WorldWideScience

Sample records for complete nucleotide sequence

  1. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  2. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-02-01

    Feb 1, 2010 ... In this study, the complete mitochondrial genome (mitogenome) of E. autonoe was .... skew” was calculated for the PCGs between two strands and the ..... codon stem and 7 bp in the anticodon loop, but also con- tained a ...

  3. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  4. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  5. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  6. Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

    Science.gov (United States)

    The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

  7. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  8. Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

    Science.gov (United States)

    Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

    2010-12-01

    Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

  9. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  10. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  11. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  12. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  13. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  14. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  15. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  16. Complete nucleotide sequences and virion particle association of two satellite RNAs of panicum mosaic virus.

    Science.gov (United States)

    Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth

    2017-08-15

    Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  18. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  19. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  20. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  1. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  2. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  3. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  4. Complete nucleotide sequence and genome analysis of bacteriophage BFK20 — A lytic phage of the industrial producer Brevibacterium flavum

    Czech Academy of Sciences Publication Activity Database

    Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.

    2006-01-01

    Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006

  5. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

  6. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  7. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  8. Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species.

    Science.gov (United States)

    Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H

    2002-01-01

    Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions

  9. Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

    Science.gov (United States)

    Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

    2000-05-01

    We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

  10. COMPLETE NUCLEOTIDE SEQUENCE OF SPHEROIDIN GENES OF CALLIPTAMUS ITALICUS ENTOMOPOXVIRUS(CIEPV) AND GOMPHOCERUS SIBIRICUS ENTOMOPOXVIRUS(GSEPV)

    Institute of Scientific and Technical Information of China (English)

    Yong-danLi; Li-yingWang; Xi-wuGao; Chao-yangZhao; Zhao-fengTian

    2004-01-01

    The spheroidin genes of Calliptamus italicus entomopoxvirus (CiEPV) and Gomphocerus sibiricus entomopoxvirus (GsEPV) were obtained by PCR,and the fragments were cloned, sequenced and analyzed. The CiEPV and GsEPV spheroidin genes respectively harbored ORFs of 2 922 bps and 2 967 bps that were capable of coding polypeptides of 109.2 and 111.1 kDa. Computer analysis indicated that CiEPV and GsEPV spheroidins shared less than 20% amino acid identities with lepidopteran AmEPV and coleopteran AcEPV spheroidins, but more than 80% amino acid identities with orthopteran OaEPV, MsEPV and AaEPV spheroidins. The CiEPV and GsEPV spheroidins respectively contained 19 and 21 cysteine residues that were particularly abundant at the C-termini, as is the case with those of the other orthopteran EPV spheroidins. The numbers and locations of the cysteine residues of the spheroidins were most similar to those of the spheroidins of EPVs that are virulent on the same insect orders. The promoter regions of the two spheroidin genes were highly conserved (99%) among the orthopteran EPVs and also contained the typical very A+T rich and TAAATG signal mediating transcription of poxvirus late genes. We also sequenced an incomplete ORF downstream of the pheroidin gene of CiEPV and GsEPV. The ORF was in the opposite direction to the spheroidin gene and was homologous to MSV072 putative protein of MsEPV.

  11. The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

    2008-09-01

    A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

  12. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    Science.gov (United States)

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  13. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  14. Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates: insertional events of transposons and insertion sequences.

    Directory of Open Access Journals (Sweden)

    Annemieke Smet

    Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of

  15. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  16. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  17. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

    Science.gov (United States)

    Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2008-04-30

    The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

  18. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  19. Complete nucleotide sequence of Sida golden mosaic Florida virus and phylogenetic relationships with other begomoviruses infecting malvaceous weeds in the Caribbean.

    Science.gov (United States)

    Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús

    2010-09-01

    The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.

  20. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  1. Analysis of complete nucleotide sequences of Angolan hepatitis B virus isolates reveals the existence of a separate lineage within genotype E.

    Directory of Open Access Journals (Sweden)

    Barbara V Lago

    Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.

  2. Characterization of the Complete Nucleotide Sequences of IncA/C2 Plasmids Carrying In809-Like Integrons from Enterobacteriaceae Isolates of Wildlife Origin.

    Science.gov (United States)

    Papagiannitsis, Costas C; Kutilova, Iva; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika

    2017-09-01

    A total of 18 Enterobacteriaceae (17 from gulls and 1 from a clinical sample) collected from Australia, carrying IncA/C plasmids with the IMP-encoding In809-like integrons, were studied. Seven plasmids, being representatives of different origins, plasmid sizes, replicon combinations, and resistance genes, were completely sequenced. Plasmid pEc158, identified in a clinical Escherichia coli ST752 isolate, showed extensive similarity to type 2 IncA/C 2 plasmids. pEc158 carried none of the bla CMY-2 -like region or ARI-B and ARI-A regions, while it contained a hybrid transposon structure. The six remaining plasmids, which were of wildlife origin, were highly similar to each other and probably were fusion derivatives of type 1 and type 2 A/C 2 plasmids. The latter plasmids contained an ARI-B region and hybrid transposon structures. In all plasmids, hybrid transposon structures containing In809-like integrons were inserted 3,434 bp downstream of the rhs2 start codon. In all cases, the one outermost 38-bp inverted repeat (IR) of the transposon was associated with the Tn 1696 tnp module, while the other outermost 38-bp IR of the transposon was associated with either a Tn 6317 -like module or a Tn 21 mer module. However, the internal structure of the transposon and the resistance genes were different in each plasmid. These findings indicated that, for the specific periods of time and settings, different IncA/C 2 plasmid types carrying In809-like elements circulated among isolates of wildlife and clinical origins. Additionally, they provided the basis for speculations regarding the reshuffling of IncA/C 2 plasmids with In809-like integrons and confirmed the rapid evolution of IncA/C 2 plasmid lineages. Copyright © 2017 American Society for Microbiology.

  3. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    NARCIS (Netherlands)

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.; Elsas, van J.D.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily

  4. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    OpenAIRE

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van, L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily extensible. We present a genome annotation system for prokaryote genomes, which is well tested and readily adaptable to different tasks. The modular system was developed using an object-oriented approac...

  5. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  6. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  7. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  8. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  9. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  10. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...

  11. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  12. Complete genome sequence of pronghorn virus, a pestivirus

    Science.gov (United States)

    The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....

  13. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  14. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  15. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  16. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  17. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  18. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  20. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  1. Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Nigg, Jared C; Nouri, Shahideh; Falk, Bryce W

    2016-07-28

    Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera. Copyright © 2016 Nigg et al.

  2. Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Nigg, Jared C.; Nouri, Shahideh; Falk, Bryce W.

    2016-01-01

    Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri. Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera.

  3. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  4. [Complete genome sequencing and sequence analysis of BCG Tice].

    Science.gov (United States)

    Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli

    2012-10-04

    The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.

  5. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  6. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  7. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  8. Complete Genome Sequences of 44 Arthrobacter Phages.

    Science.gov (United States)

    Klyczek, Karen K; Jacobs-Sera, Deborah; Adair, Tamarah L; Adams, Sandra D; Ball, Sarah L; Benjamin, Robert C; Bonilla, J Alfred; Breitenberger, Caroline A; Daniels, Charles J; Gaffney, Bobby L; Harrison, Melinda; Hughes, Lee E; King, Rodney A; Krukonis, Gregory P; Lopez, A Javier; Monsen-Collar, Kirsten; Pizzorno, Marie C; Rinehart, Claire A; Staples, Amanda K; Stowe, Emily L; Garlena, Rebecca A; Russell, Daniel A; Cresawn, Steven G; Pope, Welkin H; Hatfull, Graham F

    2018-02-01

    We report here the complete genome sequences of 44 phages infecting Arthrobacter sp. strain ATCC 21022. These phages have double-stranded DNA genomes with sizes ranging from 15,680 to 70,707 bp and G+C contents from 45.1% to 68.5%. All three tail types (belonging to the families Siphoviridae , Myoviridae , and Podoviridae ) are represented. Copyright © 2018 Klyczek et al.

  9. First Complete Genome Sequence of Suakwa aphid-borne yellows virus from East Timor

    Science.gov (United States)

    Maina, Solomon; Edwards, Owain R.; de Almeida, Luis; Ximenes, Abel

    2016-01-01

    We present here the first complete genomic RNA sequence of the polerovirus Suakwa aphid-borne yellows virus (SABYV), from East Timor. The isolate sequenced came from a virus-infected pumpkin plant. The East Timorese genome had a nucleotide identity of 86.5% with the only other SABYV genome available, which is from Taiwan. PMID:27469955

  10. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  11. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    3Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People's Republic of China ... of these rearrangements involve tRNA genes, ND5 gene and ... ncbi.nlm.nih.gov/projects/Sequin/download/seq_win_download.

  12. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    mt) genome of the round-tongued floating frog, Occidozyga martensii was determined. Although, the base composition and codon usage of O. martensii conformed to the typical vertebrate patterns, this mt genome contained 23 tRNAs (a ...

  13. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    ... genes (PCGs) consistently supported a close relationship between Bombycoidea and Geometroidea among six available lepidopteran superfamilies (Tortricoidea, Pyraloidea, Papilionoidea, Bombycoidea, Geometroidea and Noctuoidea). Among the true butterflies (Pieridae, Nymphalidae, Lycaenidae and Papilionidae), ...

  14. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  15. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  16. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  17. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  18. The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

    Science.gov (United States)

    Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

    2016-07-01

    The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

  19. The complete sequence of human chromosome 5

    Energy Technology Data Exchange (ETDEWEB)

    Schmutz, Jeremy; Martin, Joel; Terry, Astrid; Couronne, Olivier; Grimwood, Jane; Lowry, State; Gordon, Laurie A.; Scott, Duncan; Xie, Gary; Huang, Wayne; Hellsten, Uffe; Tran-Gyamfi, Mary; She, Xinwei; Prabhakar, Shyam; Aerts, Andrea; Altherr, Michael; Bajorek, Eva; Black, Stacey; Branscomb, Elbert; Caoile, Chenier; Challacombe, Jean F.; Chan, Yee Man; Denys, Mirian; Detter, Chris; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstenin, David; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Israni, Sanjay; Jett, Jamie; Kadner, Kristen; Kimbal, Heather; Kobayashi, Arthur; Lopez, Frederick; Lou, Yunian; Martinez, Diego; Medina, Catherine; Morgan, Jenna; Nandkeshwar, Richard; Noonan, James P.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Priest, James; Ramirez, Lucia; Rash, Sam; Retterer, James; Rodriguez, Alex; Rogers, Stephanie; Salamov, Asaf; Salazar, Angelica; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wheeler, Jeremy; Wu, Kevin; Yang, Joan; Dickson, Mark; Cheng, Jan-Fang; Eichler, Evan E.; Olsen, Anne; Pennacchio, Len A.; Rokhsar, Daniel S.; Richardson, Paul; Lucas, Susan M.; Myers, Richard M.; Rubin, Edward M.

    2004-04-15

    Chromosome 5 is one of the largest human chromosomes yet has one of the lowest gene densities. This is partially explained by numerous gene-poor regions that display a remarkable degree of noncoding and syntenic conservation with non-mammalian vertebrates, suggesting they are functionally constrained. In total, we compiled 177.7 million base pairs of highly accurate finished sequence containing 923 manually curated protein-encoding genes including the protocadherin and interleukin gene families and the first complete versions of each of the large chromosome 5 specific internal duplications. These duplications are very recent evolutionary events and play a likely mechanistic role, since deletions of these regions are the cause of debilitating disorders including spinal muscular atrophy (SMA).

  20. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I

    1988-01-11

    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  1. The complete genome sequence of the Atlantic salmon paramyxovirus (ASPV)

    International Nuclear Information System (INIS)

    Nylund, Stian; Karlsen, Marius; Nylund, Are

    2008-01-01

    The complete RNA genome of the Atlantic salmon paramyxovirus (ASPV), isolated from Atlantic salmon suffering from proliferative gill inflammation (PGI), has been determined. The genome is 16,965 nucleotides in length and consists of six nonoverlapping genes in the order 3'- N - P/C/V - M - F - HN - L -5', coding for the nucleocapsid, phospho-, matrix, fusion, hemagglutinin-neuraminidase and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and trinucleotide intergenic regions similar to those of other Paramyxoviridae. The ASPV P-gene expression strategy is like that of the respiro- and morbilliviruses, which express the phosphoprotein from the primary transcript, and edit a portion of the mRNA to encode the accessory proteins V and W. It also encodes the C-protein by ribosomal choice of translation initiation. Pairwise comparisons of amino acid identities, and phylogenetic analysis of deduced ASPV protein sequences with homologous sequences from other Paramyxoviridae, show that ASPV has an affinity for the genus Respirovirus, but may represent a new genus within the subfamily Paramyxovirinae

  2. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  3. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  4. Complete Genome Sequence of the Halophilic Methylotrophic Methanogen Archaeon Methanohalophilus portucalensis Strain FDF-1T

    KAUST Repository

    L’Haridon, Stéphane

    2018-01-17

    We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.

  5. Complete genome sequence of a divergent strain of lettuce chlorosis virus from Periwinkle in China

    Science.gov (United States)

    A novel strain of Lettuce chlorosis virus (LCV) was identified from periwinkle in China (PW) with foliar interveinal chlorosis and plant dwarfing. Complete nucleotide (nt) sequences of genomic RNA1 and RNA2 of the virus are 8,602 nt and 8,456 nt, respectively. The genomic organization of LCV-PW rese...

  6. Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas

    OpenAIRE

    Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; Ludergnani, Nicholas; McMullen, Allison

    2017-01-01

    ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends.

  7. Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas

    Science.gov (United States)

    Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; McMullen, Allison; Mirza, Sohail A.; Thrift, Noah; Vaughan, Donald P.; Worley, Grace; Ejikemeuwa, Amara; Zaw, May; Albritton, Claude F.; Bertrand, Sarah C.; Chaudhry, Shanzay S.; Cheema, Vzair A.; Do, Camilla; Do, Michael L.; Duong, Huyen M.; El-Desoky, Dalia H.; Green, Kelsey M.; Lee, Rhea N.; Thornton, Lauren A.; Vu, James M.; Zahra, Mah Noor; Stoner, Ty H.; Garlena, Rebecca A.; Jacobs-Sera, Deborah; Russell, Daniel A.

    2017-01-01

    ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends. PMID:29122864

  8. Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus

    Science.gov (United States)

    The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3’-terminal poly (A) tail, containing a single open reading frame (ORF) encoding a large polyprotein. The virus shares 52.1-69.7%...

  9. Complete Genome Sequence of the Halophilic Methylotrophic Methanogen Archaeon Methanohalophilus portucalensis Strain FDF-1T

    KAUST Repository

    L’ Haridon, Sté phane; Corre, Erwan; Guan, Yue; Vinu, Manikandan; La Cono, Violetta; Yakimov, Michail; Stingl, Ulrich; Toffin, Laurent; Jebbar, Mohamed

    2018-01-01

    We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.

  10. Complete genome sequence of a recent panzootic virulent Newcastle disease virus from Pakistan

    Science.gov (United States)

    Complete genome sequence of a new strain of Newcastle disease virus (NDV) (chicken/Pak/Lahore-611/2013) is reported. The strain was isolated from a vaccinated chicken flock in Pakistan in 2013 and has panzootic features. The genome is 15192 nucleotides in length and is classified as sub-genotype V...

  11. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  12. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul

    2008-05-01

    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

  13. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  14. The nucleotide sequence of a Polish isolate of Tomato torrado virus.

    Science.gov (United States)

    Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

    2008-12-01

    A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

  15. ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

    Science.gov (United States)

    Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

    2012-09-08

    The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  16. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  17. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Science.gov (United States)

    2012-01-01

    Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

  18. Complete Genome Sequence of Ikoma Lyssavirus

    OpenAIRE

    Marston, Denise A.; Ellis, Richard J.; Horton, Daniel L.; Kuzmin, Ivan V.; Wise, Emma L.; McElhinney, Lorraine M.; Banyard, Ashley C.; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E.; Fooks, Anthony R.

    2012-01-01

    Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isol...

  19. Complete genome sequence of a novel hypovirus infecting Phomopsis longicolla

    Czech Academy of Sciences Publication Activity Database

    Koloniuk, Igor; El-Habbak, M.H.; Petrzik, Karel; Ghabrial, S.A.

    2014-01-01

    Roč. 159, č. 7 (2014), s. 1861-1863 ISSN 0304-8608 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 Institutional support: RVO:60077344 Keywords : Fungus * Phomopsis longicolla * Nucleotide sequence Subject RIV: EE - Microbiology, Virology Impact factor: 2.390, year: 2014

  20. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  1. Complete genome sequence of Ikoma lyssavirus.

    Science.gov (United States)

    Marston, Denise A; Ellis, Richard J; Horton, Daniel L; Kuzmin, Ivan V; Wise, Emma L; McElhinney, Lorraine M; Banyard, Ashley C; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E; Fooks, Anthony R

    2012-09-01

    Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isolated from an African civet in Tanzania displaying clinical signs of rabies. Genetically, this virus is the most divergent within the genus Lyssavirus. Characterization of the genome will help to improve our understanding of lyssavirus diversity and enable investigation into vaccine-induced immunity and protection.

  2. Complete Genome Sequence of Staphylococcus epidermidis 1457.

    Science.gov (United States)

    Galac, Madeline R; Stam, Jason; Maybank, Rosslyn; Hinkle, Mary; Mack, Dietrich; Rohde, Holger; Roth, Amanda L; Fey, Paul D

    2017-06-01

    Staphylococcus epidermidis 1457 is a frequently utilized strain that is amenable to genetic manipulation and has been widely used for biofilm-related research. We report here the whole-genome sequence of this strain, which encodes 2,277 protein-coding genes and 81 RNAs within its 2.4-Mb genome and plasmid. Copyright © 2017 Galac et al.

  3. Nature and distribution of feline sarcoma virus nucleotide sequences.

    Science.gov (United States)

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  4. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  5. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  6. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  7. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  8. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  9. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  10. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  11. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  12. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  13. Complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R

    1986-01-24

    The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.

  14. [Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

    Science.gov (United States)

    Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

    2008-05-01

    One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

  15. Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

    Science.gov (United States)

    Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

    2008-01-01

    The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

  16. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    Science.gov (United States)

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  17. Complete Genome Sequence of the Gamma-Aminobutyric Acid-Producing Strain Streptococcus thermophilus APC151.

    Science.gov (United States)

    Linares, Daniel M; Arboleya, Silvia; Ross, R Paul; Stanton, Catherine

    2017-04-27

    Here is presented the whole-genome sequence of Streptococcus thermophilus APC151, isolated from a marine fish. This bacterium produces gamma-aminobutyric acid (GABA) in high yields and is biotechnologically suitable to produce naturally GABA-enriched biofunctional yogurt. Its complete genome comprises 2,097 genes and 1,839,134 nucleotides, with an average G+C content of 39.1%. Copyright © 2017 Linares et al.

  18. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  19. Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

    Science.gov (United States)

    Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

    2012-10-01

    The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

  20. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  1. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  2. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  3. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  4. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  5. Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

    NARCIS (Netherlands)

    Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

    2005-01-01

    The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

  6. Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

    DEFF Research Database (Denmark)

    Defoor, Els Marie Celine; Martinussen, Jan

    A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

  7. Complete genome sequences of six strains of the genus methylobacterium

    Energy Technology Data Exchange (ETDEWEB)

    Marx, Christopher J [Harvard University; Bringel, Francoise O. [University of Strasbourg; Christoserdova, Ludmila [University of Washington, Seattle; Moulin, Lionel [UMR, France; Farhan Ul Haque, Muhammad [CNRS, Strasbourg, France; Fleischman, Darrell E. [Wright State University, Dayton, OH; Gruffaz, Christelle [CNRS, Strasbourg, France; Jourand, Philippe [UMR, France; Knief, Claudia [ETH Zurich, Switzerland; Lee, Ming-Chun [Harvard University; Muller, Emilie E. L. [CNRS, Strasbourg, France; Nadalig, Thierry [CNRS, Strasbourg, France; Peyraud, Remi [ETH Zurich, Switzerland; Roselli, Sandro [CNRS, Strasbourg, France; Russ, Lina [ETH Zurich, Switzerland; Aguero, Fernan [Universidad Nacional de General San Martin; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lajus, Aurelie [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Land, Miriam L [ORNL; Medigue, Claudine [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Stolyar, Sergey [University of Washington; Vorholt, Julia A. [ETH Zurich, Switzerland; Vuilleumier, Stephane [University of Strasbourg

    2012-01-01

    The complete and assembled genome sequences were determined for six strains of the alphaproteobacterial genus Methylobacterium, chosen for their key adaptations to different plant-associated niches and environmental constraints.

  8. Complete Genome Sequences of Six Strains of the Genus Methylobacterium

    Energy Technology Data Exchange (ETDEWEB)

    Marx, Christopher J [Harvard University; Bringel, Francoise O. [University of Strasbourg; Christoserdova, Ludmila [University of Washington, Seattle; Moulin, Lionel [UMR, France; UI Hague, Muhammad Farhan [University of Strasbourg; Fleischman, Darrell E. [Wright State University, Dayton, OH; Gruffaz, Christelle [CNRS, Strasbourg, France; Jourand, Philippe [UMR, France; Knief, Claudia [ETH Zurich, Switzerland; Lee, Ming-Chun [Harvard University; Muller, Emilie E. L. [CNRS, Strasbourg, France; Nadalig, Thierry [CNRS, Strasbourg, France; Peyraud, Remi [ETH Zurich, Switzerland; Roselli, Sandro [CNRS, Strasbourg, France; Russ, Lina [ETH Zurich, Switzerland; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Ivanov, Pavel S. [University of Wyoming, Laramie; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lajus, Aurelie [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Land, Miriam L [ORNL; Medigue, Claudine [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Stolyar, Sergey [University of Washington; Vorholt, Julia A. [ETH Zurich, Switzerland; Vuilleumier, Stephane [University of Strasbourg

    2012-01-01

    The complete and assembled genome sequences were determined for six strains of the alphaproteobacterial genus Methylobacterium, chosen for their key adaptations to different plant-associated niches and environmental constraints.

  9. The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.

    OpenAIRE

    Haggarty, N W; Dunbar, B; Fothergill, L A

    1983-01-01

    The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important...

  10. Complete genome sequences of six measles virus strains

    NARCIS (Netherlands)

    Phan, M.V.T. (My V.T.); C.M.E. Schapendonk (Claudia); B.B. Oude Munnink (Bas B.); M.P.G. Koopmans D.V.M. (Marion); R.L. de Swart (Rik); Cotten, M. (Matthew)

    2018-01-01

    textabstractGenetic characterization of wild-type measles virus (MV) strains is a critical component of measles surveillance and molecular epidemiology. We have obtained complete genome sequences of six MV strains belonging to different genotypes, using random-primed next generation sequencing.

  11. Complete Genome Sequence of the Human Gut Symbiont Roseburia hominis

    DEFF Research Database (Denmark)

    Travis, Anthony J.; Kelly, Denise; Flint, Harry J

    2015-01-01

    We report here the complete genome sequence of the human gut symbiont Roseburia hominis A2-183(T) (= DSM 16839(T) = NCIMB 14029(T)), isolated from human feces. The genome is represented by a 3,592,125-bp chromosome with 3,405 coding sequences. A number of potential functions contributing to host...

  12. Complete genome sequence of a novel pestivirus from sheep.

    Science.gov (United States)

    Becher, Paul; Schmeiser, Stefanie; Oguzoglu, Tuba Cigdem; Postel, Alexander

    2012-10-01

    We report here the complete genome sequence of pestivirus strain Aydin/04-TR, which is the prototype of a group of similar viruses currently present in sheep and goats in Turkey. Sequence data from this virus showed that it clusters separately from the established and previously proposed tentative pestivirus species.

  13. Complete Genome Sequence of a Novel Pestivirus from Sheep

    OpenAIRE

    Becher, Paul; Schmeiser, Stefanie; Oguzoglu, Tuba Cigdem; Postel, Alexander

    2012-01-01

    We report here the complete genome sequence of pestivirus strain Aydin/04-TR, which is the prototype of a group of similar viruses currently present in sheep and goats in Turkey. Sequence data from this virus showed that it clusters separately from the established and previously proposed tentative pestivirus species.

  14. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  15. From Sequence to Morphology - Long-Range Correlations in Complete Sequenced Genomes

    NARCIS (Netherlands)

    T.A. Knoch (Tobias)

    2004-01-01

    textabstractThe largely unresolved sequential organization, i.e. the relations within DNA sequences, and its connection to the three-dimensional organization of genomes was investigated by correlation analyses of completely sequenced chromosomes from Viroids, Archaea, Bacteria, Arabidopsis

  16. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  17. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  18. A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius).

    LENUS (Irish Health Repository)

    Edwards, Ceiridwen J

    2010-01-01

    BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius) has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs) from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+\\/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer). In total, 289.9 megabases (22.48%) of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously identified

  19. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  20. Molecular Characterization of Five Potyviruses Infecting Korean Sweet Potatoes Based on Analyses of Complete Genome Sequences

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2015-12-01

    Full Text Available Sweet potatoes (Ipomea batatas L. are grown extensively, in tropical and temperate regions, and are important food crops worldwide. In Korea, potyviruses, including Sweet potato feathery mottle virus (SPFMV, Sweet potato virus C (SPVC, Sweet potato virus G (SPVG, Sweet potato virus 2 (SPV2, and Sweet potato latent virus (SPLV, have been detected in sweet potato fields at a high (~95% incidence. In the present work, complete genome sequences of 18 isolates, representing the five potyviruses mentioned above, were compared with previously reported genome sequences. The complete genomes consisted of 10,081 to 10,830 nucleotides, excluding the poly-A tails. Their genomic organizations were typical of the Potyvirus genus, including one target open reading frame coding for a putative polyprotein. Based on phylogenetic analyses and sequence comparisons, the Korean SPFMV isolates belonged to the strains RC and O with >98% nucleotide sequence identity. Korean SPVC isolates had 99% identity to the Japanese isolate SPVC-Bungo and 70% identity to the SPFMV isolates. The Korean SPVG isolates showed 99% identity to the three previously reported SPVG isolates. Korean SPV2 isolates had 97% identity to the SPV2 GWB-2 isolate from the USA. Korean SPLV isolates had a relatively low (88% nucleotide sequence identity with the Taiwanese SPLV-TW isolates, and they were phylogenetically distantly related to SPFMV isolates. Recombination analysis revealed that possible recombination events occurred in the P1, HC-Pro and NIa-NIb regions of SPFMV and SPLV isolates and these regions were identified as hotspots for recombination in the sweet potato potyviruses.

  1. Complete Genome Sequences of Four Avian Paramyxoviruses of Serotype 10 Isolated from Rockhopper Penguins on the Falkland Islands

    OpenAIRE

    Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.; Afonso, Claudio L.

    2017-01-01

    ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related.

  2. Complete Genome Sequences of Four Avian Paramyxoviruses of Serotype 10 Isolated from Rockhopper Penguins on the Falkland Islands

    Science.gov (United States)

    Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.

    2017-01-01

    ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related. PMID:28572332

  3. First Complete Genome Sequence of Papaya ringspot virus-W Isolated from a Gourd in the United States.

    Science.gov (United States)

    Ali, Akhtar

    2017-01-12

    In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.

  4. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  5. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  6. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  7. Complete Genome Sequence of Bifidobacterium bifidum S17▿

    Science.gov (United States)

    Zhurina, Daria; Zomer, Aldert; Gleinser, Marita; Brancaccio, Vincenco Francesco; Auchter, Marc; Waidmann, Mark S.; Westermann, Christina; van Sinderen, Douwe; Riedel, Christian U.

    2011-01-01

    Here, we report on the first completely annotated genome sequence of a Bifidobacterium bifidum strain. B. bifidum S17, isolated from feces of a breast-fed infant, was shown to strongly adhere to intestinal epithelial cells and has potent anti-inflammatory activity in vitro and in vivo. The genome sequence will provide new insights into the biology of this potential probiotic organism and allow for the characterization of the molecular mechanisms underlying its beneficial properties. PMID:21037011

  8. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    Science.gov (United States)

    Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

    2009-01-01

    Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

  9. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    Directory of Open Access Journals (Sweden)

    Carmen Yea

    2009-06-01

    Full Text Available Although the human parainfluenza virus 4 (HPIV4 has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada. The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97% with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized.

  10. The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.

    Science.gov (United States)

    Haggarty, N W; Dunbar, B; Fothergill, L A

    1983-01-01

    The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important for the activity of the glycolytic mutase are conserved in the erythrocyte diphosphoglycerate mutase. PMID:6313356

  11. Complete genome sequence of Gordonia bronchialis type strain (3410T)

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Jando, Marlen [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Chen, Feng [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Chain, Patrick S. G. [Lawrence Livermore National Laboratory (LLNL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J C [U.S. Department of Energy, Joint Genome Institute; Brettin, Thomas S [ORNL; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute

    2010-01-01

    Gordonia bronchialis Tsukamura 1971 is the type species of the genus. G. bronchialis is a human-pathogenic organism that has been isolated from a large variety of human tissues. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of the family Gordoniaceae. The 5,290,012 bp long genome with its 4,944 protein-coding and 55 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  12. Complete genome sequence of Acidimicrobium ferrooxidans type strain (ICPT)

    Energy Technology Data Exchange (ETDEWEB)

    Clum, Alicia; Nolan, Matt; Lang, Elke; Glavina Del Rio, Tijana; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Goker, Markus; Spring, Stefan; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chain, Patrick; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Lapidus, Alla

    2009-05-20

    Acidimicrobium ferrooxidans (Clark and Norris 1996) is the sole and type species of the genus, which until recently was the only genus within the actinobacterial family Acidimicrobiaceae and in the order Acidomicrobiales. Rapid oxidation of iron pyrite during autotrophic growth in the absence of an enhanced CO2 concentration is characteristic for A. ferrooxidans. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the order Acidomicrobiales, and the 2,158,157 bp long single replicon genome with its 2038 protein coding and 54 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  13. Complete Genome Sequence of Escherichia coli Strain WG5

    DEFF Research Database (Denmark)

    Imamovic, Lejla; Misiakou, Maria-Anna; van der Helm, Eric

    2018-01-01

    Escherichia coli strain WG5 is a widely used host for phage detection, including somatic coliphages employed as standard ISO method 10705-1 (2000). Here, we present the complete genome sequence of a commercial E. coli WG5 strain.......Escherichia coli strain WG5 is a widely used host for phage detection, including somatic coliphages employed as standard ISO method 10705-1 (2000). Here, we present the complete genome sequence of a commercial E. coli WG5 strain....

  14. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  15. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  16. Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

    Science.gov (United States)

    Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

    2004-01-01

    The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

  17. Complete genome sequence of a novel Plum pox virus strain W isolate determined by 454 pyrosequencing.

    Science.gov (United States)

    Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei

    2013-10-01

    The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.

  18. Complete sequence of Fig fleck-associated virus, a novel member of the family Tymoviridae.

    Science.gov (United States)

    Elbeaino, Toufic; Digiaro, Michele; Martelli, Giovanni P

    2011-11-01

    The complete nucleotide sequence and the genome organization were determined of a novel virus, tentatively named Fig fleck-associated virus (FFkaV). The viral genome is a positive-sense, single-stranded RNA 7046 nucleotides in size excluding the 3'-terminal poly(A) tract, and comprising two open reading frames. ORF1 encodes a polypeptide of 2161 amino acids (p240), which contains the signatures of replication-associated proteins and the coat protein cistron (p24) at its 3' end. ORF2 codes for a 461 amino acid protein (p50) identified as a putative movement proteins (MP). In phylogenetic trees constructed with sequences of the putative polymerase and CP proteins FFkaV consistently groups with members of the genus Maculavirus, family Tymoviridae. However, the genome organization diverges from that of the two completely sequenced maculaviruses, Grapevine fleck virus (GFkV) and Bombix mori Macula-like virus (BmMLV), as it exhibits a structure resembling that of Maize rayado fino virus (MRFV), the type species of the genus Marafivirus and of Olive latent virus 3 (OLV-3), an unclassified virus in the family Tymoviridae. FFkaV was found in field-grown figs from six Mediterranean countries with an incidence ranging from 15% to 25%. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Complete genome sequence of Menghai rhabdovirus, a novel mosquito-borne rhabdovirus from China.

    Science.gov (United States)

    Sun, Qiang; Zhao, Qiumin; An, Xiaoping; Guo, Xiaofang; Zuo, Shuqing; Zhang, Xianglilan; Pei, Guangqian; Liu, Wenli; Cheng, Shi; Wang, Yunfei; Shu, Peng; Mi, Zhiqiang; Huang, Yong; Zhang, Zhiyi; Tong, Yigang; Zhou, Hongning; Zhang, Jiusong

    2017-04-01

    Menghai rhabdovirus (MRV) was isolated from Aedes albopictus in Menghai county of Yunnan Province, China, in August 2010. Whole-genome sequencing of MRV was performed using an Ion PGM™ Sequencer. We found that MRV is a single-stranded, negative-sense RNA virus. The complete genome of MRV has 10,744 nt, with short inverted repeat termini, encoding five typical rhabdovirus proteins (N, P, M, G, and L) and an additional small hypothetical protein. Nucleotide BLAST analysis using the BLASTn method showed that the genome sequence most similar to that of MRV is that of Arboretum virus (NC_025393.1), with a Max score of 322, query coverage of 14%, and 66% identity. Genomic and phylogenetic analyses both demonstrated that MRV should be considered a member of a novel species of the family Rhabdoviridae.

  20. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  1. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

    Directory of Open Access Journals (Sweden)

    Sukdeb Nandi

    2010-03-01

    Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

  2. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

    Science.gov (United States)

    Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

  3. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  4. Complete Genome Sequence of the Soybean Symbiont Bradyrhizobium japonicum Strain USDA6T

    Directory of Open Access Journals (Sweden)

    Nobukazu Uchiike

    2011-10-01

    Full Text Available The complete nucleotide sequence of the genome of the soybean symbiont Bradyrhizobium japonicum strain USDA6T was determined. The genome of USDA6T is a single circular chromosome of 9,207,384 bp. The genome size is similar to that of the genome of another soybean symbiont, B. japonicum USDA110 (9,105,828 bp. Comparison of the whole-genome sequences of USDA6T and USDA110 showed colinearity of major regions in the two genomes, although a large inversion exists between them. A significantly high level of sequence conservation was detected in three regions on each genome. The gene constitution and nucleotide sequence features in these three regions indicate that they may have been derived from a symbiosis island. An ancestral, large symbiosis island, approximately 860 kb in total size, appears to have been split into these three regions by unknown large-scale genome rearrangements. The two integration events responsible for this appear to have taken place independently, but through comparable mechanisms, in both genomes.

  5. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus

    OpenAIRE

    Spence, Robert J.; Noune, Christopher; Hauxwell, Caroline

    2016-01-01

    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length.

  6. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus.

    Science.gov (United States)

    Spence, Robert J; Noune, Christopher; Hauxwell, Caroline

    2016-06-30

    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length. Copyright © 2016 Spence et al.

  7. The complete mitochondrial genome sequence of Diaphorina citri (Hemiptera: Psyllidae)

    Science.gov (United States)

    The first complete mitochondrial genome (mitogenome) sequence of Asian citrus psyllid, Diaphorina citri (Hemiptera: Psyllidae), from Guangzhou, China is presented. The circular mitogenome is 14,996 bp in length with an A+T content of 74.5%, and contains 13 protein-coding genes (PCGs), 22 tRNA genes ...

  8. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Science.gov (United States)

    2010-07-01

    ... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

  9. Completed sequence and corrected annotation of the genome of maize Iranian mosaic virus.

    Science.gov (United States)

    Ghorbani, Abozar; Izadpanah, Keramatollah; Dietzgen, Ralf G

    2018-03-01

    Maize Iranian mosaic virus (MIMV) is a negative-sense single-stranded RNA virus that is classified in the genus Nucleorhabdovirus, family Rhabdoviridae. The MIMV genome contains six open reading frames (ORFs) that encode in 3΄ to 5΄ order the nucleocapsid protein (N), phosphoprotein (P), putative movement protein (P3), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). In this study, we determined the first complete genome sequence of MIMV using Illumina RNA-Seq and 3'/5' RACE. MIMV genome ('Fars' isolate) is 12,426 nucleotides in length. Unexpectedly, the predicted N gene ORF of this isolate and of four other Iranian isolates is 143 nucleotides shorter than that of the MIMV coding-complete reference isolate 'Shiraz 1' (Genbank NC_011542), possibly due to a minor error in the previous sequence. Genetic variability among the N, P, P3 and G ORFs of Iranian MIMV isolates was limited, but highest in the G gene ORF. Phylogenetic analysis of complete nucleorhabdovirus genomes demonstrated a close evolutionary relationship between MIMV, maize mosaic virus and taro vein chlorosis virus.

  10. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  11. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  12. Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

    Science.gov (United States)

    Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

    2013-07-01

    Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  14. Complete Genomic Sequence of Border Disease Virus, a Pestivirus from Sheep

    Science.gov (United States)

    Becher, Paul; Orlich, Michaela; Thiel, Heinz-Jürgen

    1998-01-01

    The genus Pestivirus of the family Flaviviridae comprises three established species, namely, bovine viral diarrhea virus (BVDV), classical swine fever virus (CSFV), and border disease virus from sheep (BDV). In this study, we report the first complete nucleotide sequence of BDV, that of strain X818. The genome is 12,333 nucleotides long and contains one long open reading frame encoding 3,895 amino acids. The 5′ noncoding region (NCR) of BDV X818 consists of 372 nucleotides and is thus similar in length to the 5′ NCR reported for other pestiviruses. The 3′ NCR of X818 is 273 nucleotides long and thereby at least 32 nucleotides longer than the 3′ NCR of pestiviruses analyzed thus far. Within the 3′ NCR of BDV X818, the sequence motif TATTTATTTA was identified at four locations. The same repeat was found at two or three locations within the 3′ NCR of different CSFV isolates but was absent in the 3′ NCR of BVDV. Analysis of five additional BDV strains showed that the 3′ NCR sequences are highly conserved within this species. Comparison of the deduced amino acid sequence of X818 with the ones of other pestiviruses allowed the prediction of polyprotein cleavage sites which were conserved with regard to the structural proteins. It has been reported for two BVDV strains that cleavage at the nonstructural (NS) protein sites 3/4A, 4A/4B, 4B/5A, and 5A/5B is mediated by the NS3 serine protease and for each site a conserved leucine was found at the P1 position followed by either serine or alanine at P1′ (N. Tautz, K. Elbers, D. Stoll, G. Meyers, and H.-J. Thiel, J. Virol. 71:5415–5422, 1997; J. Xu, E. Mendez, P. R. Caron, C. Lin, M. A. Murcko, M. S. Collett, and C. M. Rice, J. Virol. 71:5312–5322). Interestingly, P1′ of the predicted NS5A/5B cleavage site of BDV is represented by an asparagine residue. Transient expression studies demonstrated that this unusual NS5A/5B processing site is efficiently cleaved by the NS3 serine protease of BDV. PMID

  15. Complete genome sequence of the European sheatfish virus.

    Science.gov (United States)

    Mavian, Carla; López-Bueno, Alberto; Fernández Somalo, María Pilar; Alcamí, Antonio; Alejo, Alí

    2012-06-01

    Viral diseases are an increasing threat to the thriving aquaculture industry worldwide. An emerging group of fish pathogens is formed by several ranaviruses, which have been isolated at different locations from freshwater and seawater fish species since 1985. We report the complete genome sequence of European sheatfish ranavirus (ESV), the first ranavirus isolated in Europe, which causes high mortality rates in infected sheatfish (Silurus glanis) and in other species. Analysis of the genome sequence shows that ESV belongs to the amphibian-like ranaviruses and is closely related to the epizootic hematopoietic necrosis virus (EHNV), a disease agent geographically confined to the Australian continent and notifiable to the World Organization for Animal Health.

  16. The Complete Chloroplast Genome Sequences of Six Rehmannia Species

    Directory of Open Access Journals (Sweden)

    Shuyun Zeng

    2017-03-01

    Full Text Available Rehmannia is a non-parasitic genus in Orobanchaceae including six species mainly distributed in central and north China. Its phylogenetic position and infrageneric relationships remain uncertain due to potential hybridization and polyploidization. In this study, we sequenced and compared the complete chloroplast genomes of six Rehmannia species using Illumina sequencing technology to elucidate the interspecific variations. Rehmannia plastomes exhibited typical quadripartite and circular structures with good synteny of gene order. The complete genomes ranged from 153,622 bp to 154,055 bp in length, including 133 genes encoding 88 proteins, 37 tRNAs, and 8 rRNAs. Three genes (rpoA, rpoC2, accD have potentially experienced positive selection. Plastome size variation of Rehmannia was mainly ascribed to the expansion and contraction of the border regions between the inverted repeat (IR region and the single-copy (SC regions. Despite of the conserved structure in Rehmannia plastomes, sequence variations provide useful phylogenetic information. Phylogenetic trees of 23 Lamiales species reconstructed with the complete plastomes suggested that Rehmannia was monophyletic and sister to the clade of Lindenbergia and the parasitic taxa in Orobanchaceae. The interspecific relationships within Rehmannia were completely different with the previous studies. In future, population phylogenomic works based on plastomes are urgently needed to clarify the evolutionary history of Rehmannia.

  17. Complete Genome Sequence of Zucchini Yellow Mosaic Virus Strain Kurdistan, Iran.

    Science.gov (United States)

    Maghamnia, Hamid Reza; Hajizadeh, Mohammad; Azizi, Abdolbaset

    2018-03-01

    The complete genome sequence of Zucchini yellow mosaic virus strain Kurdistan (ZYMV-Kurdistan) infecting squash from Iran was determined from 13 overlapping fragments. Excluding the poly (A) tail, ZYMV-Kurdistan genome consisted of 9593 nucleotides (nt), with 138 and 211 nt at the 5' and 3' non-translated regions, respectively. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small overlapping ORF encoding a P3N-PIPO protein of 74 aa. This isolate had six unique aa differences compared to other ZYMV isolates and shared 79.6-98.8% identities with other ZYMV genome sequences at the nt level and 90.1-99% identities at the aa level. A phylogenetic tree of ZYMV complete genomic sequences showed that Iranian and Central European isolates are closely related and form a phylogenetically homogenous group. All values in the ratio of substitution rates at non-synonymous and synonymous sites ( d N / d S ) were below 1, suggestive of strong negative selection forces during ZYMV protein history. This is the first report of complete genome sequence information of the most prevalent virus in the west of Iran. This study helps our understanding of the genetic diversity of ZYMV isolates infecting cucurbit plants in Iran, virus evolution and epidemiology and can assist in designing better diagnostic tools.

  18. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  19. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    Science.gov (United States)

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  20. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  1. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  2. Getting complete genomes from complex samples using nanopore sequencing

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Albertsen, Mads

    Background Short read DNA sequencing and metagenomic binning workflows have made it possible to extract bacterial genome bins from environmental microbial samples containing hundreds to thousands of different species. However, these genome bins often do not represent complete genomes......, as they are mostly fragmented, incomplete and often contaminated with foreign DNA. The value of these `draft genomes` have limited, lasting value to the scientific community, as gene synteny is broken and there is some uncertainty of what is missing1. The genetic material most often missed is important multi......-copy and/or conserved marker genes such as the 16S rRNA gene, as sequence micro-heterogeneity prevents assembly of these genes in the de novo assembly. However, long read sequencing technologies are emerging promising an end to fragmented genome assemblies2. Experimental design We extracted DNA from a full...

  3. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  4. Complete genome sequence of Nakamurella multipartita type strain (Y-104).

    Science.gov (United States)

    Tice, Hope; Mayilraj, Shanmugam; Sims, David; Lapidus, Alla; Nolan, Matt; Lucas, Susan; Glavina Del Rio, Tijana; Copeland, Alex; Cheng, Jan-Fang; Meincke, Linda; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavromatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Detter, John C; Brettin, Thomas; Rohde, Manfred; Göker, Markus; Bristow, Jim; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Chen, Feng

    2010-03-30

    Nakamurella multipartita (Yoshimi et al. 1996) Tao et al. 2004 is the type species of the monospecific genus Nakamurella in the actinobacterial suborder Frankineae. The nonmotile, coccus-shaped strain was isolated from activated sludge acclimated with sugar-containing synthetic wastewater, and is capable of accumulating large amounts of polysaccharides in its cells. Here we describe the features of the organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of a member of the family Nakamurellaceae. The 6,060,298 bp long single replicon genome with its 5415 protein-coding and 56 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  5. Using nanopore sequencing to get complete genomes from complex samples

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Nielsen, Per Halkjær

    The advantages of “next generation sequencing” has come at the cost of genome finishing. The dominant sequencing technology provides short reads of 150-300 bp, which has made genome assembly very difficult as the reads do not span important repeat regions. Genomes have thus been added...... to the databases as fragmented assemblies and not as finished contigs that resemble the chromosomes in which the DNA is organised within the cells. This is especially troublesome for genomes derived from complex metagenome sequencing. Databases with incomplete genomes can lead to false conclusions about...... the absence of genes and functional predictions of the organisms. Furthermore, it is common that repetitive elements and marker genes such as the 16S rRNA gene are missing completely from these genome bins. Using nanopore long reads, we demonstrate that it is possible to span these regions and make complete...

  6. Getting complete genomes from complex samples using nanopore sequencing

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Albertsen, Mads

    Short read sequencing and metagenomic binning workflows have made it possible to extract bacterial genome bins from environmental microbial samples containing hundreds to thousands of different species. However, these genome bins often do not represent complete genomes, as they are mostly...... fragmented, incomplete and often contaminated with foreign DNA and with no robust strategies to validate the quality. The value of these `draft genomes` have limited, lasting value to the scientific community, as gene synteny is broken and the uncertainty of what is missing. The genetic material most often...... missed is important multi-copy and/or conserved marker genes such as the 16S rRNA gene, as sequence micro-heterogeneity prevents assembly of these genes in the de novo assembly. We demonstrate that using nanopore long reads it is now possible to overcome these issues and make complete genomes from...

  7. Complete genome sequence of Marivirga tractuosa type strain (H-43).

    Science.gov (United States)

    Pagani, Ioanna; Chertkov, Olga; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Nolan, Matt; Saunders, Elizabeth; Pitluck, Sam; Held, Brittany; Goodwin, Lynne; Liolios, Konstantinos; Ovchinikova, Galina; Ivanova, Natalia; Mavromatis, Konstantinos; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Jeffries, Cynthia D; Detter, John C; Han, Cliff; Tapia, Roxanne; Ngatchou-Djao, Olivier D; Rohde, Manfred; Göker, Markus; Spring, Stefan; Sikorski, Johannes; Woyke, Tanja; Bristow, Jim; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C

    2011-04-29

    Marivirga tractuosa (Lewin 1969) Nedashkovskaya et al. 2010 is the type species of the genus Marivirga, which belongs to the family Flammeovirgaceae. Members of this genus are of interest because of their gliding motility. The species is of interest because representative strains show resistance to several antibiotics, including gentamicin, kanamycin, neomycin, polymixin and streptomycin. This is the first complete genome sequence of a member of the family Flammeovirgaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,511,574 bp long chromosome and the 4,916 bp plasmid with their 3,808 protein-coding and 49 RNA genes are a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  8. The complete chloroplast genome sequence of Dendrobium officinale.

    Science.gov (United States)

    Yang, Pei; Zhou, Hong; Qian, Jun; Xu, Haibin; Shao, Qingsong; Li, Yonghua; Yao, Hui

    2016-01-01

    The complete chloroplast sequence of Dendrobium officinale, an endangered and economically important traditional Chinese medicine, was reported and characterized. The genome size is 152,018 bp, with 37.5% GC content. A pair of inverted repeats (IRs) of 26,284 bp are separated by a large single-copy region (LSC, 84,944 bp) and a small single-copy region (SSC, 14,506 bp). The complete cp DNA contains 83 protein-coding genes, 39 tRNA genes and 8 rRNA genes. Fourteen genes contained one or two introns.

  9. Complete genome sequence of Marivirga tractuosa type strain (H-43).

    OpenAIRE

    Pagani, Ioanna; Chertkov, Olga; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Nolan, Matt; Saunders, Elizabeth; Pitluck, Sam; Held, Brittany; Goodwin, Lynne; Liolios, Konstantinos; Ovchinikova, Galina

    2011-01-01

    Marivirga tractuosa (Lewin 1969) Nedashkovskaya et al. 2010 is the type species of the genus Marivirga, which belongs to the family Flammeovirgaceae. Members of this genus are of interest because of their gliding motility. The species is of interest because representative strains show resistance to several antibiotics, including gentamicin, kanamycin, neomycin, polymixin and streptomycin. This is the first complete genome sequence of a member of the family Flammeovirgaceae. Here we describe t...

  10. The complete chloroplast genome sequence of Abies nephrolepis (Pinaceae: Abietoideae

    Directory of Open Access Journals (Sweden)

    Dong-Keun Yi

    2016-06-01

    Full Text Available The plant chloroplast (cp genome has maintained a relatively conserved structure and gene content throughout evolution. Cp genome sequences have been used widely for resolving evolutionary and phylogenetic issues at various taxonomic levels of plants. Here, we report the complete cp genome of Abies nephrolepis. The A. nephrolepis cp genome is 121,336 base pairs (bp in length including a pair of short inverted repeat regions (IRa and IRb of 139 bp each separated by a small single copy (SSC region of 54,323 bp (SSC and a large single copy region of 66,735 bp (LSC. It contains 114 genes, 68 of which are protein coding genes, 35 tRNA and four rRNA genes, six open reading frames, and one pseudogene. Seventeen repeat units and 64 simple sequence repeats (SSR have been detected in A. nephrolepis cp genome. Large IR sequences locate in 42-kb inversion points (1186 bp. The A. nephrolepis cp genome is identical to Abies koreana’s which is closely related to taxa. Pairwise comparison between two cp genomes revealed 140 polymorphic sites in each. Complete cp genome sequence of A. nephrolepis has a significant potential to provide information on the evolutionary pattern of Abietoideae and valuable data for development of DNA markers for easy identification and classification.

  11. Complete genome sequence of a proposed new tymovirus, tomato blistering mosaic virus.

    Science.gov (United States)

    Nicolini, Cícero; Inoue-Nagata, Alice Kazuko; Nagata, Tatsuya

    2015-02-01

    In a previous work, a distinct tymovirus infecting tomato plants in Brazil was reported and tentatively named tomato blistering mosaic virus (ToBMV). In this study, the complete genome sequence of ToBMV was determined and shown to have a size of 6277 nucleotides and three ORFs: ORF 1 encodes the replication-complex polyprotein, ORF 2 the movement protein, and ORF 3 the coat protein. The cleavage sites of the replication-complex polyprotein (GS/LP and VAG/QSP) of ToBMV were predicted by alignment analysis of amino acid sequences of other tymoviruses. In the phylogenetic tree, ToBMV clustered with the tymoviruses that infect solanaceous hosts.

  12. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  13. Complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from lettuce (Lactuca sativa) originating from a conventional field in Norway.

    Science.gov (United States)

    Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik

    2016-12-01

    Here, we present the 3,795,952 bp complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017580.

  14. Complete Genome Sequence of the Largest Known Flavi-Like Virus, Diaphorina citri flavi-like virus, a Novel Virus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Matsumura, Emilyn E.; Nerva, Luca; Nigg, Jared C.; Falk, Bryce W.; Nouri, Shahideh

    2016-01-01

    A novel flavi-like virus tentatively named Diaphorina citri flavi-like virus (DcFLV) was identified in field populations of Diaphorina citri through small RNA and transcriptome sequencing followed by reverse transcription (RT)-PCR. We report here the complete nucleotide sequence and genome organization of DcFLV, the largest flavi-like virus identified to date.

  15. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

  16. A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius.

    Directory of Open Access Journals (Sweden)

    Ceiridwen J Edwards

    Full Text Available BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer. In total, 289.9 megabases (22.48% of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously

  17. Complete genome sequence of Actinosynnema mirum type strain (101T)

    Energy Technology Data Exchange (ETDEWEB)

    Land, Miriam; Lapidus, Alla; Mayilraj, Shanmugam; Chen, Feng; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Chertkov, Olga; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Rohde, Manfred; Goker, Markus; Pati, Amrita; Ivanova, Natalia; Mavrommatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia; Brettin, Thomas; Detter, John C.; Han, Cliff; Chain, Patrick; Tindall, Brian; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter

    2009-05-20

    Actinosynnema mirum Hasegawa et al. 1978 is the type species of the genus, and is of phylogenetic interest because of its central phylogenetic location in the Actino-synnemataceae, a rapidly growing family within the actinobacterial suborder Pseudo-nocardineae. A. mirum is characterized by its motile spores borne on synnemata and as a producer of nocardicin antibiotics. It is capable of growing aerobically and under a moderate CO2 atmosphere. The strain is a Gram-positive, aerial and substrate mycelium producing bacterium, originally isolated from a grass blade collected from the Raritan River, New Jersey. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of a member of the family Actinosynnemataceae, and only the second sequence from the actinobacterial suborder Pseudonocardineae. The 8,248,144 bp long single replicon genome with its 7100 protein-coding and 77 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  18. The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).

    Science.gov (United States)

    Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan

    2015-01-01

    In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis.

  19. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  20. The complete sequence of the mitochondrial genome of the African Penguin (Spheniscus demersus).

    Science.gov (United States)

    Labuschagne, Christiaan; Kotzé, Antoinette; Grobler, J Paul; Dalton, Desiré L

    2014-01-15

    The complete mitochondrial genome of the African Penguin (Spheniscus demersus) was sequenced. The molecule was sequenced via next generation sequencing and primer walking. The size of the genome is 17,346 bp in length. Comparison with the mitochondrial DNA of two other penguin genomes that have so far been reported was conducted namely; Little blue penguin (Eudyptula minor) and the Rockhopper penguin (Eudyptes chrysocome). This analysis made it possible to identify common penguin mitochondrial DNA characteristics. The S. demersus mtDNA genome is very similar, both in composition and length to both the E. chrysocome and E. minor genomes. The gene content of the African penguin mitochondrial genome is typical of vertebrates and all three penguin species have the standard gene order originally identified in the chicken. The control region for S. demersus is located between tRNA-Glu and tRNA-Phe and all three species of penguins contain two sets of similar repeats with varying copy numbers towards the 3' end of the control region, accounting for the size variance. This is the first report of the complete nucleotide sequence for the mitochondrial genome of the African penguin, S. demersus. These results can be subsequently used to provide information for penguin phylogenetic studies and insights into the evolution of genomes. © 2013 Elsevier B.V. All rights reserved.

  1. Equid herpesvirus 8: Complete genome sequence and association with abortion in mares

    Science.gov (United States)

    Garvey, Marie; Suárez, Nicolás M.; Kerr, Karen; Hector, Ralph; Moloney-Quinn, Laura; Arkins, Sean; Davison, Andrew J.

    2018-01-01

    Equid herpesvirus 8 (EHV-8), formerly known as asinine herpesvirus 3, is an alphaherpesvirus that is closely related to equid herpesviruses 1 and 9 (EHV-1 and EHV-9). The pathogenesis of EHV-8 is relatively little studied and to date has only been associated with respiratory disease in donkeys in Australia and horses in China. A single EHV-8 genome sequence has been generated for strain Wh in China, but is apparently incomplete and contains frameshifts in two genes. In this study, the complete genome sequences of four EHV-8 strains isolated in Ireland between 2003 and 2015 were determined by Illumina sequencing. Two of these strains were isolated from cases of abortion in horses, and were misdiagnosed initially as EHV-1, and two were isolated from donkeys, one with neurological disease. The four genome sequences are very similar to each other, exhibiting greater than 98.4% nucleotide identity, and their phylogenetic clustering together demonstrated that genomic diversity is not dependent on the host. Comparative genomic analysis revealed 24 of the 76 predicted protein sequences are completely conserved among the Irish EHV-8 strains. Evolutionary comparisons indicate that EHV-8 is phylogenetically closer to EHV-9 than it is to EHV-1. In summary, the first complete genome sequences of EHV-8 isolates from two host species over a twelve year period are reported. The current study suggests that EHV-8 can cause abortion in horses. The potential threat of EHV-8 to the horse industry and the possibility that donkeys may act as reservoirs of infection warrant further investigation. PMID:29414990

  2. Complete genome sequence of the myxobacterium Sorangium cellulosum

    DEFF Research Database (Denmark)

    Schneiker, S; Perlova, O; Kaiser, O

    2007-01-01

    The genus Sorangium synthesizes approximately half of the secondary metabolites isolated from myxobacteria, including the anti-cancer metabolite epothilone. We report the complete genome sequence of the model Sorangium strain S. cellulosum Soce56, which produces several natural products and has...... morphological and physiological properties typical of the genus. The circular genome, comprising 13,033,779 base pairs, is the largest bacterial genome sequenced to date. No global synteny with the genome of Myxococcus xanthus is apparent, revealing an unanticipated level of divergence between...... these myxobacteria. A large percentage of the genome is devoted to regulation, particularly post-translational phosphorylation, which probably supports the strain's complex, social lifestyle. This regulatory network includes the highest number of eukaryotic protein kinase-like kinases discovered in any organism...

  3. Complete genome sequence of Oceanithermus profundus type strain (506T)

    Energy Technology Data Exchange (ETDEWEB)

    Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Zhang, Xiaojing [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Hauser, Loren John [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Ruhl, Alina [U.S. Department of Energy, Joint Genome Institute; Mwirichia, Romano [University of Munster, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Wirth, Reinhard [Universitat Regensburg, Regensburg, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL

    2011-01-01

    Oceanithermus profundus Miroshnichenko et al. 2003 is the type species of the genus Oceanithermus, which belongs to the family Thermaceae. The genus currently comprises two species whose members are thermophilic and are able to reduce sulfur compounds and nitrite. The organism is adapted to the salinity of sea water, is able to utilize a broad range of carbohydrates, some proteinaceous substrates, organic acids and alcohols. This is the first completed genome sequence of a member of the genus Oceanithermus and the fourth sequence from the family Thermaceae. The 2,439,291 bp long genome with its 2,391 protein-coding and 54 RNA genes consists of one chromosome and a 135,351 bp long plasmid, and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  4. Complete genome sequence of Truepera radiovictrix type strain (RQ-24).

    Science.gov (United States)

    Ivanova, Natalia; Rohde, Christine; Munk, Christine; Nolan, Matt; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Deshpande, Shweta; Cheng, Jan-Fang; Tapia, Roxane; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Brambilla, Evelyne; Rohde, Manfred; Göker, Markus; Tindall, Brian J; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lapidus, Alla

    2011-02-22

    Truepera radiovictrix Albuquerque et al. 2005 is the type species of the genus Truepera within the phylum "Deinococcus/Thermus". T. radiovictrix is of special interest not only because of its isolated phylogenetic location in the order Deinococcales, but also because of its ability to grow under multiple extreme conditions in alkaline, moderately saline, and high temperature habitats. Of particular interest is the fact that, T. radiovictrix is also remarkably resistant to ionizing radiation, a feature it shares with members of the genus Deinococcus. This is the first completed genome sequence of a member of the family Trueperaceae and the fourth type strain genome sequence from a member of the order Deinococcales. The 3,260,398 bp long genome with its 2,994 protein-coding and 52 RNA genes consists of one circular chromosome and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  5. The complete chloroplast genome sequence of Euonymus japonicus (Celastraceae).

    Science.gov (United States)

    Choi, Kyoung Su; Park, SeonJoo

    2016-09-01

    The complete chloroplast (cp) genome sequence of the Euonymus japonicus, the first sequenced of the genus Euonymus, was reported in this study. The total length was 157 637 bp, containing a pair of 26 678 bp inverted repeat region (IR), which were separated by small single copy (SSC) region and large single copy (LSC) region of 18 340 bp and 85 941 bp, respectively. This genome contains 107 unique genes, including 74 coding genes, four rRNA genes, and 29 tRNA genes. Seventeen genes contain intron of E. japonicus, of which three genes (clpP, ycf3, and rps12) include two introns. The maximum likelihood (ML) phylogenetic analysis revealed that E. japonicus was closely related to Manihot and Populus.

  6. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  7. The complete chloroplast genome sequence of Hibiscus syriacus.

    Science.gov (United States)

    Kwon, Hae-Yun; Kim, Joon-Hyeok; Kim, Sea-Hyun; Park, Ji-Min; Lee, Hyoshin

    2016-09-01

    The complete chloroplast genome sequence of Hibiscus syriacus L. is presented in this study. The genome is composed of 161 019 bp in length, with a typical circular structure containing a pair of inverted repeats of 25 745 bp of length separated by a large single-copy region and a small single-copy region of 89 698 bp and 19 831 bp of length, respectively. The overall GC content is 36.8%. One hundred and fourteen genes were annotated, including 81 protein-coding genes, 4 ribosomal RNA genes and 29 transfer RNA genes.

  8. The complete chloroplast genome sequence of Curcuma flaviflora (Curcuma).

    Science.gov (United States)

    Zhang, Yan; Deng, Jiabin; Li, Yangyi; Gao, Gang; Ding, Chunbang; Zhang, Li; Zhou, Yonghong; Yang, Ruiwu

    2016-09-01

    The complete chloroplast (cp) genome of Curcuma flaviflora, a medicinal plant in Southeast Asia, was sequenced. The genome size was 160 478 bp in length, with 36.3% GC content. A pair of inverted repeats (IRs) of 26 946 bp were separated by a large single copy (LSC) of 88 008 bp and a small single copy (SSC) of 18 578 bp, respectively. The cp genome contained 132 annotated genes, including 79 protein coding genes, 30 tRNA genes, and four rRNA genes. And 19 of these genes were duplicated in inverted repeat regions.

  9. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  10. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  11. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    Science.gov (United States)

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  12. MACSIMS : multiple alignment of complete sequences information management system

    Directory of Open Access Journals (Sweden)

    Plewniak Frédéric

    2006-06-01

    Full Text Available Abstract Background In the post-genomic era, systems-level studies are being performed that seek to explain complex biological systems by integrating diverse resources from fields such as genomics, proteomics or transcriptomics. New information management systems are now needed for the collection, validation and analysis of the vast amount of heterogeneous data available. Multiple alignments of complete sequences provide an ideal environment for the integration of this information in the context of the protein family. Results MACSIMS is a multiple alignment-based information management program that combines the advantages of both knowledge-based and ab initio sequence analysis methods. Structural and functional information is retrieved automatically from the public databases. In the multiple alignment, homologous regions are identified and the retrieved data is evaluated and propagated from known to unknown sequences with these reliable regions. In a large-scale evaluation, the specificity of the propagated sequence features is estimated to be >99%, i.e. very few false positive predictions are made. MACSIMS is then used to characterise mutations in a test set of 100 proteins that are known to be involved in human genetic diseases. The number of sequence features associated with these proteins was increased by 60%, compared to the features available in the public databases. An XML format output file allows automatic parsing of the MACSIM results, while a graphical display using the JalView program allows manual analysis. Conclusion MACSIMS is a new information management system that incorporates detailed analyses of protein families at the structural, functional and evolutionary levels. MACSIMS thus provides a unique environment that facilitates knowledge extraction and the presentation of the most pertinent information to the biologist. A web server and the source code are available at http://bips.u-strasbg.fr/MACSIMS/.

  13. Complete genome sequence of switchgrass mosaic virus, a member of a proposed new species in the genus Marafivirus.

    Science.gov (United States)

    Agindotan, Bright O; Gray, Michael E; Hammond, Rosemarie W; Bradley, Carl A

    2012-09-01

    The complete genome sequence of a virus recently detected in switchgrass (Panicum virgatum) was determined and found to be closely related to that of maize rayado fino virus (MRFV), genus Marafivirus, family Tymoviridae. The genomic RNA is 6408 nucleotides long. It contains three predicted open reading frames (ORFs 1-3), encoding proteins of 227 kDa, 43.9 kDa, and 31.5 kDa, compared to two ORFs (1 and 2) for MRFV. The complete genome shares 76 % sequence identity with MRFV. The nucleotide sequence of ORF2 of this virus and the amino acid sequence of its encoded protein are 49 % and 77 % identical, respectively, to those of MRFV. The virus-encoded polyprotein and capsid protein aa sequences are 83 % and 74-80 % identical, respectively, to those of MRFV. Although closely related to MRFV, the amino acid sequence of its capsid protein (CP) forms a clade that is separate from that of MRFV. Based on the International Committee on Taxonomy of Viruses (ICTV) sequence-related criteria for delineation of species within the genus Marafivirus, the virus qualifies as a member of a new species, and the name Switchgrass mosaic virus (SwMV) is proposed.

  14. Complete genome sequence of Desulfomicrobium baculatum type strain (XT)

    Energy Technology Data Exchange (ETDEWEB)

    Copeland, Alex; Spring, Stefan; Goker, Markus; Schneider, Susanne; Lapidus, Alla; Glavina Del Rio, Tijana; Tice, Hope; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Nolan, Matt; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C; Meincke, Linda; Sims, David; Brettin, Thomas; Detter, John C; Han, Cliff; Chain, Patrick; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C; Lucas, Susan

    2009-05-20

    Desulfomicrobium baculatum is the type species of the genus Desulfomicrobium, which is the type genus of the family Desulfomicrobiaceae. It is of phylogenetic interest because of the isolated location of the family Desulfomicrobiaceae within the order Desulfovibrionales. D. baculatum strain XT is a Gram-negative, motile, sulfate-reducing bacterium isolated from water-saturated manganese carbonate ore. It is strictly anaerobic and does not require NaCl for growth, although NaCl concentrations up to 6percent (w/v) are tolerated. The metabolism is respiratory or fermentative. In the presence of sulfate, pyruvate and lactate are incompletely oxidized to acetate and CO2. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of a member of the deltaproteobacterial family Desulfomicrobiaceae, and this 3,942,657 bp long single replicon genome with its 3494 protein-coding and 72 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  15. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  16. Complete Plastid Genome Sequencing of Four Tilia Species (Malvaceae: A Comparative Analysis and Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Jie Cai

    Full Text Available Tilia is an ecologically and economically important genus in the family Malvaceae. However, there is no complete plastid genome of Tilia sequenced to date, and the taxonomy of Tilia is difficult owing to frequent hybridization and polyploidization. A well-supported interspecific relationships of this genus is not available due to limited informative sites from the commonly used molecular markers. We report here the complete plastid genome sequences of four Tilia species determined by the Illumina technology. The Tilia plastid genome is 162,653 bp to 162,796 bp in length, encoding 113 unique genes and a total number of 130 genes. The gene order and organization of the Tilia plastid genome exhibits the general structure of angiosperms and is very similar to other published plastid genomes of Malvaceae. As other long-lived tree genera, the sequence divergence among the four Tilia plastid genomes is very low. And we analyzed the nucleotide substitution patterns and the evolution of insertions and deletions in the Tilia plastid genomes. Finally, we build a phylogeny of the four sampled Tilia species with high supports using plastid phylogenomics, suggesting that it is an efficient way to resolve the phylogenetic relationships of this genus.

  17. Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

    Science.gov (United States)

    Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

    2017-08-01

    A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

  18. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    Science.gov (United States)

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  19. Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

    Science.gov (United States)

    Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

    2001-01-01

    Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

  20. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  1. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  2. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  3. Complete chloroplast DNA sequence from a Korean endemic genus, Megaleranthis saniculifolia, and its evolutionary implications.

    Science.gov (United States)

    Kim, Young-Kyu; Park, Chong-wook; Kim, Ki-Joong

    2009-03-31

    The chloroplast DNA sequences of Megaleranthis saniculifolia, an endemic and monotypic endangered plant species, were completed in this study (GenBank FJ597983). The genome is 159,924 bp in length. It harbors a pair of IR regions consisting of 26,608 bp each. The lengths of the LSC and SSC regions are 88,326 bp and 18,382 bp, respectively. The structural organizations, gene and intron contents, gene orders, AT contents, codon usages, and transcription units of the Megaleranthis chloroplast genome are similar to those of typical land plant cp DNAs. However, the detailed features of Megaleranthis chloroplast genomes are substantially different from that of Ranunculus, which belongs to the same family, the Ranunculaceae. First, the Megaleranthis cp DNA was 4,797 bp longer than that of Ranunculus due to an expanded IR region into the SSC region and duplicated sequence elements in several spacer regions of the Megaleranthis cp genome. Second, the chloroplast genomes of Megaleranthis and Ranunculus evidence 5.6% sequence divergence in the coding regions, 8.9% sequence divergence in the intron regions, and 18.7% sequence divergence in the intergenic spacer regions, respectively. In both the coding and noncoding regions, average nucleotide substitution rates differed markedly, depending on the genome position. Our data strongly implicate the positional effects of the evolutionary modes of chloroplast genes. The genes evidencing higher levels of base substitutions also have higher incidences of indel mutations and low Ka/Ks ratios. A total of 54 simple sequence repeat loci were identified from the Megaleranthis cp genome. The existence of rich cp SSR loci in the Megaleranthis cp genome provides a rare opportunity to study the population genetic structures of this endangered species. Our phylogenetic trees based on the two independent markers, the nuclear ITS and chloroplast matK sequences, strongly support the inclusion of the Megaleranthis to the Trollius. Therefore, our

  4. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  5. The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.

    Science.gov (United States)

    Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo

    2016-05-01

    The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.

  6. Complete genome sequence of 'Thermobaculum terrenum' type strain (YNP1).

    Science.gov (United States)

    Kiss, Hajnalka; Cleland, David; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Nolan, Matt; Tice, Hope; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Ivanova, Natalia; Mavromatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Lu, Megan; Brettin, Thomas; Detter, John C; Göker, Markus; Tindall, Brian J; Beck, Brian; McDermott, Timothy R; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Cheng, Jan-Fang

    2010-10-27

    'Thermobaculum terrenum' Botero et al. 2004 is the sole species within the proposed genus 'Thermobaculum'. Strain YNP1(T) is the only cultivated member of an acid tolerant, extremely thermophilic species belonging to a phylogenetically isolated environmental clone group within the phylum Chloroflexi. At present, the name 'Thermobaculum terrenum' is not yet validly published as it contravenes Rule 30 (3a) of the Bacteriological Code. The bacterium was isolated from a slightly acidic extreme thermal soil in Yellowstone National Park, Wyoming (USA). Depending on its final taxonomic allocation, this is likely to be the third completed genome sequence of a member of the class Thermomicrobia and the seventh type strain genome from the phylum Chloroflexi. The 3,101,581 bp long genome with its 2,872 protein-coding and 58 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  7. The complete chloroplast genome sequence of Dendrobium nobile.

    Science.gov (United States)

    Yan, Wenjin; Niu, Zhitao; Zhu, Shuying; Ye, Meirong; Ding, Xiaoyu

    2016-11-01

    The complete chloroplast (cp) genome sequence of Dendrobium nobile, an endangered and traditional Chinese medicine with important economic value, is presented in this article. The total genome size is 150,793 bp, containing a large single copy (LSC) region (84,939 bp) and a small single copy region (SSC) (13,310 bp) which were separated by two inverted repeat (IRs) regions (26,272 bp). The overall GC contents of the plastid genome were 38.8%. In total, 130 unique genes were annotated and they were consisted of 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. Fourteen genes contained one or two introns.

  8. Complete genome sequence of Halanaerobium praevalens type strain (GSLT)

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Chertkov, Olga [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kannan, K. Palani [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute

    2011-01-01

    Halanaerobium praevalens Zeikus et al. 1984 is the type species of the genus Halanaero- bium, which in turn is the type genus of the family Halanaerobiaceae. The species is of inter- est because it is able to reduce a variety of nitro-substituted aromatic compounds at a high rate, and because of its ability to degrade organic pollutants. The strain is also of interest be- cause it functions as a hydrolytic bacterium, fermenting complex organic matter and produc- ing intermediary metabolites for other trophic groups such as sulfate-reducing and methano- genic bacteria. It is further reported as being involved in carbon removal in the Great Salt Lake, its source of isolation. This is the first completed genome sequence of a representative of the genus Halanaerobium and the second genome sequence from a type strain of the fami- ly Halanaerobiaceae. The 2,309,262 bp long genome with its 2,110 protein-coding and 70 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  9. The first complete chloroplast genome sequence of a lycophyte,Huperzia lucidula (Lycopodiaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Wolf, Paul G.; Karol, Kenneth G.; Mandoli, Dina F.; Kuehl,Jennifer V.; Arumuganathan, K.; Ellis, Mark W.; Mishler, Brent D.; Kelch,Dean G.; Olmstead, Richard G.; Boore, Jeffrey L.

    2005-02-01

    We used a unique combination of techniques to sequence the first complete chloroplast genome of a lycophyte, Huperzia lucidula. This plant belongs to a significant clade hypothesized to represent the sister group to all other vascular plants. We used fluorescence-activated cell sorting (FACS) to isolate the organelles, rolling circle amplification (RCA) to amplify the genome, and shotgun sequencing to 8x depth coverage to obtain the complete chloroplast genome sequence. The genome is 154,373bp, containing inverted repeats of 15,314 bp each, a large single-copy region of 104,088 bp, and a small single-copy region of 19,671 bp. Gene order is more similar to those of mosses, liverworts, and hornworts than to gene order for other vascular plants. For example, the Huperziachloroplast genome possesses the bryophyte gene order for a previously characterized 30 kb inversion, thus supporting the hypothesis that lycophytes are sister to all other extant vascular plants. The lycophytechloroplast genome data also enable a better reconstruction of the basaltracheophyte genome, which is useful for inferring relationships among bryophyte lineages. Several unique characters are observed in Huperzia, such as movement of the gene ndhF from the small single copy region into the inverted repeat. We present several analyses of evolutionary relationships among land plants by using nucleotide data, amino acid sequences, and by comparing gene arrangements from chloroplast genomes. The results, while still tentative pending the large number of chloroplast genomes from other key lineages that are soon to be sequenced, are intriguing in themselves, and contribute to a growing comparative database of genomic and morphological data across the green plants.

  10. Complete plastid genome sequence of Daucus carota: implications for biotechnology and phylogeny of angiosperms.

    Science.gov (United States)

    Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry

    2006-08-31

    Carrot (Daucus carota) is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats > or = 30 bp with a sequence identity > or = 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP) and maximum likelihood (ML) were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap) for the sister relationship of Daucus with Panax in the euasterid II clade. These

  11. Complete plastid genome sequence of Daucus carota: Implications for biotechnology and phylogeny of angiosperms

    Directory of Open Access Journals (Sweden)

    Ruhlman Tracey

    2006-08-01

    Full Text Available Abstract Background Carrot (Daucus carota is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. Results The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats ≥ 30 bp with a sequence identity ≥ 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP and maximum likelihood (ML were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. Conclusion The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap for the sister relationship of

  12. Two complete chloroplast genome sequences of Cannabis sativa varieties.

    Science.gov (United States)

    Oh, Hyehyun; Seo, Boyoung; Lee, Seunghwan; Ahn, Dong-Ha; Jo, Euna; Park, Jin-Kyoung; Min, Gi-Sik

    2016-07-01

    In this study, we determined the complete chloroplast (cp) genomes from two varieties of Cannabis sativa. The genome sizes were 153,848 bp (the Korean non-drug variety, Cheungsam) and 153,854 bp (the African variety, Yoruba Nigeria). The genome structures were identical with 131 individual genes [86 protein-coding genes (PCGs), eight rRNA, and 37 tRNA genes]. Further, except for the presence of an intron in the rps3 genes of two C. sativa varieties, the cp genomes of C. sativa had conservative features similar to that of all known species in the order Rosales. To verify the position of C. sativa within the order Rosales, we conducted phylogenetic analysis by using concatenated sequences of all PCGs from 17 complete cp genomes. The resulting tree strongly supported monophyly of Rosales. Further, the family Cannabaceae, represented by C. sativa, showed close relationship with the family Moraceae. The phylogenetic relationship outlined in our study is well congruent with those previously shown for the order Rosales.

  13. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  14. First complete genome sequence of canine bocavirus 2 in mainland China

    Directory of Open Access Journals (Sweden)

    S.-L. Zhai

    2017-07-01

    Full Text Available We obtained the first full-length genome sequence of canine bocavirus 2 (CBoV2 from the faeces of a healthy dog in Guangzhou city, Guangdong province, mainland China. The genome of GZHD15 consisted of 5059 nucleotides. Sequence analysis suggested that GZHD15 was close to a previously circulated Hong Kong isolate.

  15. A first report and complete genome sequence of alfalfa enamovirus from Sudan

    Science.gov (United States)

    A full genome sequence of a viral pathogen, provisionally named alfalfa enamovirus 2 (AEV-2), was reconstructed from short reads obtained by Illumina RNA sequencing of alfalfa sample originating from Sudan. Ambiguous nucleotides in the resultant consensus assembly and identity of the predicted virus...

  16. Murine mammary tumor virus pol-related sequences in human DNA: characterization and sequence comparison with the complete murine mammary tumor virus pol gene

    International Nuclear Information System (INIS)

    Deen, K.C.; Sweet, R.W.

    1986-01-01

    Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively

  17. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  18. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  19. The First Complete Chloroplast Genome Sequences in Actinidiaceae: Genome Structure and Comparative Analysis.

    Science.gov (United States)

    Yao, Xiaohong; Tang, Ping; Li, Zuozhou; Li, Dawei; Liu, Yifei; Huang, Hongwen

    2015-01-01

    Actinidia chinensis is an important economic plant belonging to the basal lineage of the asterids. Availability of a complete Actinidia chloroplast genome sequence is crucial to understanding phylogenetic relationships among major lineages of angiosperms and facilitates kiwifruit genetic improvement. We report here the complete nucleotide sequences of the chloroplast genomes for Actinidia chinensis and A. chinensis var deliciosa obtained through de novo assembly of Illumina paired-end reads produced by total DNA sequencing. The total genome size ranges from 155,446 to 157,557 bp, with an inverted repeat (IR) of 24,013 to 24,391 bp, a large single copy region (LSC) of 87,984 to 88,337 bp and a small single copy region (SSC) of 20,332 to 20,336 bp. The genome encodes 113 different genes, including 79 unique protein-coding genes, 30 tRNA genes and 4 ribosomal RNA genes, with 16 duplicated in the inverted repeats, and a tRNA gene (trnfM-CAU) duplicated once in the LSC region. Comparisons of IR boundaries among four asterid species showed that IR/LSC borders were extended into the 5' portion of the psbA gene and IR contraction occurred in Actinidia. The clap gene has been lost from the chloroplast genome in Actinidia, and may have been transferred to the nucleus during chloroplast evolution. Twenty-seven polymorphic simple sequence repeat (SSR) loci were identified in the Actinidia chloroplast genome. Maximum parsimony analyses of a 72-gene, 16 taxa angiosperm dataset strongly support the placement of Actinidiaceae in Ericales within the basal asterids.

  20. Complete Chloroplast Genome Sequences and Comparative Analysis of Chenopodium quinoa and C. album.

    Science.gov (United States)

    Hong, Su-Young; Cheon, Kyeong-Sik; Yoo, Ki-Oug; Lee, Hyun-Oh; Cho, Kwang-Soo; Suh, Jong-Taek; Kim, Su-Jeong; Nam, Jeong-Hwan; Sohn, Hwang-Bae; Kim, Yul-Ho

    2017-01-01

    The Chenopodium genus comprises ~150 species, including Chenopodium quinoa and Chenopodium album , two important crops with high nutritional value. To elucidate the phylogenetic relationship between the two species, the complete chloroplast (cp) genomes of these species were obtained by next generation sequencing. We performed comparative analysis of the sequences and, using InDel markers, inferred phylogeny and genetic diversity of the Chenopodium genus. The cp genome is 152,099 bp ( C. quinoa ) and 152,167 bp ( C. album ) long. In total, 119 genes (78 protein-coding, 37 tRNA, and 4 rRNA) were identified. We found 14 ( C. quinoa ) and 15 ( C. album ) tandem repeats (TRs); 14 TRs were present in both species and C. album and C. quinoa each had one species-specific TR. The trnI-GAU intron sequences contained one ( C. quinoa ) or two ( C. album ) copies of TRs (66 bp); the InDel marker was designed based on the copy number variation in TRs. Using the InDel markers, we detected this variation in the TR copy number in four species, Chenopodium hybridum, Chenopodium pumilio, Chenopodium ficifolium , and Chenopodium koraiense , but not in Chenopodium glaucum . A comparison of coding and non-coding regions between C. quinoa and C. album revealed divergent sites. Nucleotide diversity >0.025 was found in 17 regions-14 were located in the large single copy region (LSC), one in the inverted repeats, and two in the small single copy region (SSC). A phylogenetic analysis based on 59 protein-coding genes from 25 taxa resolved Chenopodioideae monophyletic and sister to Betoideae. The complete plastid genome sequences and molecular markers based on divergence hotspot regions in the two Chenopodium taxa will help to resolve the phylogenetic relationships of Chenopodium .

  1. Complete sequencing of five araliaceae chloroplast genomes and the phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Rong Li

    Full Text Available BACKGROUND: The ginseng family (Araliaceae includes a number of economically important plant species. Previously phylogenetic studies circumscribed three major clades within the core ginseng plant family, yet the internal relationships of each major group have been poorly resolved perhaps due to rapid radiation of these lineages. Recent studies have shown that phyogenomics based on chloroplast genomes provides a viable way to resolve complex relationships. METHODOLOGY/PRINCIPAL FINDINGS: We report the complete nucleotide sequences of five Araliaceae chloroplast genomes using next-generation sequencing technology. The five chloroplast genomes are 156,333-156,459 bp in length including a pair of inverted repeats (25,551-26,108 bp separated by the large single-copy (86,028-86,566 bp and small single-copy (18,021-19,117 bp regions. Each chloroplast genome contains the same 114 unique genes consisting of 30 transfer RNA genes, four ribosomal RNA genes, and 80 protein coding genes. Gene size, content, and order, AT content, and IR/SC boundary structure are similar among all Araliaceae chloroplast genomes. A total of 140 repeats were identified in the five chloroplast genomes with palindromic repeat as the most common type. Phylogenomic analyses using parsimony, likelihood, and Bayesian inference based on the complete chloroplast genomes strongly supported the monophyly of the Asian Palmate group and the Aralia-Panax group. Furthermore, the relationships among the sampled taxa within the Asian Palmate group were well resolved. Twenty-six DNA markers with the percentage of variable sites higher than 5% were identified, which may be useful for phylogenetic studies of Araliaceae. CONCLUSION: The chloroplast genomes of Araliaceae are highly conserved in all aspects of genome features. The large-scale phylogenomic data based on the complete chloroplast DNA sequences is shown to be effective for the phylogenetic reconstruction of Araliaceae.

  2. Isolation, identification, and complete genome sequence of a bovine adenovirus type 3 from cattle in China

    Directory of Open Access Journals (Sweden)

    Zhu Yuan-Mao

    2011-12-01

    Full Text Available Abstract Background Bovine adenovirus type 3 (BAV-3 belongs to the Mastadenovirus genus of the family Adenoviridae and is involved in respiratory and enteric infections of calves. The isolation of BAV-3 has not been reported prior to this study in China. In 2009, there were many cases in cattle showing similar clinical signs to BAV-3 infection and a virus strain, showing cytopathic effect in Madin-Darby bovine kidney cells, was isolated from a bovine nasal swab collected from feedlot cattle in Heilongjiang Province, China. The isolate was confirmed as a bovine adenovirus type 3 by PCR and immunofluorescence assay, and named as HLJ0955. So far only the complete genome sequence of prototype of BAV-3 WBR-1 strain has been reported. In order to further characterize the Chinese isolate HLJ0955, the complete genome sequence of HLJ0955 was determined. Results The size of the genome of the Chinese isolate HLJ0955 is 34,132 nucleotides in length with a G+C content of 53.6%. The coding sequences for gene regions of HLJ0955 isolate were similar to the prototype of BAV-3 WBR-1 strain, with 80.0-98.6% nucleotide and 87.5-98.8% amino acid identities. The genome of HLJ0955 strain contains 16 regions and four deletions in inverted terminal repeats, E1B region and E4 region, respectively. The complete genome and DNA binding protein gene based phylogenetic analysis with other adenoviruses were performed and the results showed that HLJ0955 isolate belonged to BAV-3 and clustered within the Mastadenovirus genus of the family Adenoviridae. Conclusions This is the first study to report the isolation and molecular characterization of BAV-3 from cattle in China. The phylogenetic analysis performed in this study supported the use of the DNA binding protein gene of adenovirus as an appropriate subgenomic target for the classification of different genuses of the family Adenoviridae on the molecular basis. Meanwhile, a large-scale pathogen and serological epidemiological

  3. The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

    Science.gov (United States)

    Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

    2005-12-20

    Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

  4. Complete Genome Sequence of a Virulent Newcastle Disease Virus Strain Isolated from a Clinically Healthy Duck (Anas platyrhynchos domesticus) in Pakistan

    Science.gov (United States)

    Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.

    2016-01-01

    Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II. PMID:27469959

  5. Complete Genome Sequence of a Virulent Newcastle Disease Virus Strain Isolated from a Clinically Healthy Duck (Anas platyrhynchos domesticus) in Pakistan

    OpenAIRE

    Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.; Afonso, Claudio L.

    2016-01-01

    Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II.

  6. Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal A; Gröne, Andrea; Kik, Marja J L

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  7. Complete genome sequence of frog virus 3, isolated from a strawberry poison frog (Oophaga pumilio) imported from nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; Beurden, van Steven J.; Suárez, Nicolás M.; Haenen, Olga L.M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kika, Marja J.L.

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  8. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  9. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

    Science.gov (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2012-07-01

    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  10. The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

    2010-11-01

    Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

  11. MIPS: a database for protein sequences and complete genomes.

    Science.gov (United States)

    Mewes, H W; Hani, J; Pfeiffer, F; Frishman, D

    1998-01-01

    The MIPS group [Munich Information Center for Protein Sequences of the German National Center for Environment and Health (GSF)] at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, is involved in a number of data collection activities, including a comprehensive database of the yeast genome, a database reflecting the progress in sequencing the Arabidopsis thaliana genome, the systematic analysis of other small genomes and the collection of protein sequence data within the framework of the PIR-International Protein Sequence Database (described elsewhere in this volume). Through its WWW server (http://www.mips.biochem.mpg.de ) MIPS provides access to a variety of generic databases, including a database of protein families as well as automatically generated data by the systematic application of sequence analysis algorithms. The yeast genome sequence and its related information was also compiled on CD-ROM to provide dynamic interactive access to the 16 chromosomes of the first eukaryotic genome unraveled. PMID:9399795

  12. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  13. Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus species

    Science.gov (United States)

    Rey, Michael W; Ramaiya, Preethi; Nelson, Beth A; Brody-Karpin, Shari D; Zaretsky, Elizabeth J; Tang, Maria; de Leon, Alfredo Lopez; Xiang, Henry; Gusti, Veronica; Clausen, Ib Groth; Olsen, Peter B; Rasmussen, Michael D; Andersen, Jens T; Jørgensen, Per L; Larsen, Thomas S; Sorokin, Alexei; Bolotin, Alexander; Lapidus, Alla; Galleron, Nathalie; Ehrlich, S Dusko; Berka, Randy M

    2004-01-01

    Background Bacillus licheniformis is a Gram-positive, spore-forming soil bacterium that is used in the biotechnology industry to manufacture enzymes, antibiotics, biochemicals and consumer products. This species is closely related to the well studied model organism Bacillus subtilis, and produces an assortment of extracellular enzymes that may contribute to nutrient cycling in nature. Results We determined the complete nucleotide sequence of the B. licheniformis ATCC 14580 genome which comprises a circular chromosome of 4,222,336 base-pairs (bp) containing 4,208 predicted protein-coding genes with an average size of 873 bp, seven rRNA operons, and 72 tRNA genes. The B. licheniformis chromosome contains large regions that are colinear with the genomes of B. subtilis and Bacillus halodurans, and approximately 80% of the predicted B. licheniformis coding sequences have B. subtilis orthologs. Conclusions Despite the unmistakable organizational similarities between the B. licheniformis and B. subtilis genomes, there are notable differences in the numbers and locations of prophages, transposable elements and a number of extracellular enzymes and secondary metabolic pathway operons that distinguish these species. Differences include a region of more than 80 kilobases (kb) that comprises a cluster of polyketide synthase genes and a second operon of 38 kb encoding plipastatin synthase enzymes that are absent in the B. licheniformis genome. The availability of a completed genome sequence for B. licheniformis should facilitate the design and construction of improved industrial strains and allow for comparative genomics and evolutionary studies within this group of Bacillaceae. PMID:15461803

  14. First report of a complete genome sequence for a begomovirus infecting Jatropha gossypifolia in the Americas.

    Science.gov (United States)

    Simmonds-Gordon, R N; Collins-Fairclough, A M; Stewart, C S; Roye, M E

    2014-10-01

    Jatropha gossypifolia is a weed that is commonly found with yellow mosaic symptoms growing along the roadside and in close proximity to cultivated crops in many farming communities in Jamaica. For the first time, the complete genome sequence of a new begomovirus, designated jatropha mosaic virus-[Jamaica:Spanish Town:2004] (JMV-[JM:ST:04]), was determined from field-infected J. gossypifolia in the western hemisphere. DNA-A nucleotide sequence comparisons showed closest identity (84 %) to two tobacco-infecting viruses from Cuba, tobacco mottle leaf curl virus-[Cuba:Sancti Spiritus:03] (TbMoLCV-[CU:SS:03]) and tobacco leaf curl Cuba virus-[Cuba:Taguasco:2005] (TbLCuCUV-[CU:Tag:05]), and two weed-infecting viruses from Cuba and Jamaica, Rhynchosia rugose golden mosaic virus-[Cuba:Camaguey:171:2009] (RhRGMV- [CU:Cam:171:09]) and Wissadula golden mosaic St. Thomas virus-[Jamaica:Albion:2005] (WGMSTV-[JM:Alb:05]). Phylogenetic analysis revealed that JMV-[JM:ST:04] is most closely related to tobacco and tomato viruses from Cuba and WGMSTV-[JM:Alb:05], a common malvaceous-weed-infecting virus from eastern Jamaica, and that it is distinct from begomoviruses infecting Jatropha species in India and Nigeria.

  15. Complete genome sequence of the biofilm-forming Microbacterium sp. strain BH-3-3-3, isolated from conventional field-grown lettuce (Lactuca sativa) in Norway.

    Science.gov (United States)

    Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik

    2017-03-01

    The genus Microbacterium contains bacteria that are ubiquitously distributed in various environments and includes plant-associated bacteria that are able to colonize tissue of agricultural crop plants. Here, we report the 3,508,491 bp complete genome sequence of Microbacterium sp. strain BH-3-3-3, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017674.

  16. Complete Genome Sequence of Diaphorina citri-associated C virus, a Novel Putative RNA Virus of the Asian Citrus Psyllid, Diaphorina citri

    OpenAIRE

    Nouri, Shahideh; Salem, Nid?; Falk, Bryce W.

    2016-01-01

    We present here the complete nucleotide sequence and genome organization of a novel putative RNA virus identified in field populations of the Asian citrus psyllid, Diaphorina citri, through sequencing of the transcriptome followed by reverse transcription-PCR (RT-PCR). We tentatively named this virus Diaphorina citri-associated C virus (DcACV). DcACV is an unclassified positive-sense RNA virus.

  17. Complete Genome Sequence of Diaphorina citri-associated C virus, a Novel Putative RNA Virus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Nouri, Shahideh; Salem, Nidà; Falk, Bryce W

    2016-07-21

    We present here the complete nucleotide sequence and genome organization of a novel putative RNA virus identified in field populations of the Asian citrus psyllid, Diaphorina citri, through sequencing of the transcriptome followed by reverse transcription-PCR (RT-PCR). We tentatively named this virus Diaphorina citri-associated C virus (DcACV). DcACV is an unclassified positive-sense RNA virus. Copyright © 2016 Nouri et al.

  18. Complete Genome Sequence of the Largest Known Flavi-Like Virus, Diaphorina citri flavi-like virus, a Novel Virus of the Asian Citrus Psyllid, Diaphorina citri.

    Science.gov (United States)

    Matsumura, Emilyn E; Nerva, Luca; Nigg, Jared C; Falk, Bryce W; Nouri, Shahideh

    2016-09-08

    A novel flavi-like virus tentatively named Diaphorina citri flavi-like virus (DcFLV) was identified in field populations of Diaphorina citri through small RNA and transcriptome sequencing followed by reverse transcription (RT)-PCR. We report here the complete nucleotide sequence and genome organization of DcFLV, the largest flavi-like virus identified to date. Copyright © 2016 Matsumura et al.

  19. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  20. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  1. Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Yu-Hoon Kim

    2014-01-01

    Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

  2. Complete Genome Sequence of Mycobacterium phlei Type Strain RIVM601174

    KAUST Repository

    Abdallah, A. M.; Rashid, M.; Adroub, S. A.; Arnoux, M.; Ali, Shahjahan; van Soolingen, D.; Bitter, W.; Pain, Arnab

    2012-01-01

    Mycobacterium phlei is a rapidly growing nontuberculous Mycobacterium species that is typically nonpathogenic, with few reported cases of human disease. Here we report the whole genome sequence of M. phlei type strain RIVM601174.

  3. Complete Genome Sequence of Mycobacterium phlei Type Strain RIVM601174

    KAUST Repository

    Abdallah, A. M.

    2012-05-24

    Mycobacterium phlei is a rapidly growing nontuberculous Mycobacterium species that is typically nonpathogenic, with few reported cases of human disease. Here we report the whole genome sequence of M. phlei type strain RIVM601174.

  4. Complete genome sequence of Arcanobacterium haemolyticum type strain (11018T)

    Energy Technology Data Exchange (ETDEWEB)

    Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Teshima, Hazuki [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Pukall, Rudiger [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2010-01-01

    Vulcanisaeta distributa Itoh et al. 2002 belongs to the family Thermoproteaceae in the phylum Crenarchaeota. The genus Vulcanisaeta is characterized by a global distribution in hot and acidic springs. This is the first genome sequence from a member of the genus Vulcanisaeta and seventh genome sequence in the family Thermoproteaceae. The 2,374,137 bp long genome with its 2,544 protein-coding and 49 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  5. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  6. Complete genome sequence analysis identifies a new genotype of brassica yellows virus that infects cabbage and radish in China.

    Science.gov (United States)

    Zhang, Xiao-Yan; Xiang, Hai-Ying; Zhou, Cui-Ji; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2014-08-01

    For brassica yellows virus (BrYV), proposed to be a member of a new polerovirus species, two clearly distinct genotypes (BrYV-A and BrYV-B) have been described. In this study, the complete nucleotide sequences of two BrYV isolates from radish and Chinese cabbage were determined. Sequence analysis suggested that these isolates represent a new genotype, referred to here as BrYV-C. The full-length sequences of the two BrYV-C isolates shared 93.4-94.8 % identity with BrYV-A and BrYV-B. Further phylogenetic analysis showed that the BrYV-C isolates formed a subgroup that was distinct from the BrYV-A and BrYV-B isolates based on all of the proteins except P5.

  7. The Complete Sequence of the Mitochondrial Genome of the Chamberednautilus (Mollusca: Cephalopoda)

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.

    2005-12-01

    Background: Mitochondria contain small genomes that arephysically separate from those of nuclei. Their comparison serves as amodel system for understanding the processes of genome evolution.Although complete mitochondrial genome sequences have been reported formore than 600 animals, the taxonomic sampling is highly biased towardvertebrates and arthropods, leaving much of the diversity yetuncharacterized. Results: The mitochondrial genome of a cephalopodmollusk, the Chambered Nautilus, is 16,258 nts in length and 59.5 percentA+T, both values that are typical of animal mitochondrial genomes. Itcontains the 37 genes that are typical for animal mtDNAs, with 15 on oneDNA strand and 22 on the other. The arrangement of these genes can bederived from that of the distantly related Katharina tunicata (Mollusca:Polyplacophora) by a switch in position of two large blocks of genes andtranspositions of four tRNA genes. There is strong skew in thedistribution of nucleotides between the two strands. There are an unusualnumber of non-coding regions and their function, if any, is not known;however, several of these demark abrupt shifts in nucleotide skew,suggesting that they may play roles in transcription and/or replication.One of the non-coding regions contains multiple repeats of a tRNA-likesequence. Some of the tRNA genes appear to overlap on the same strand,but this could be resolved if the polycistron were cleaved at thebeginning of the downstream gene, followed by polyadenylation of theproduct of the upstream gene to form a fully paired structure.Conclusions: Nautilus sp. mtDNA contains an expected gene content thathas experienced few rearrangements since the evolutionary split betweencephalopods and polyplacophorans. It contains an unusual number ofnon-coding regions, especially considering that these otherwise often aregenerated by the same processes that produce gene rearrangements. Thisappears to be yet another case where polyadenylation of mitochondrialtRNAs restores

  8. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences.

    Science.gov (United States)

    Macey, J Robert; Papenfuss, Theodore J; Kuehl, Jennifer V; Fourcade, H Mathew; Boore, Jeffrey L

    2004-10-01

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in Bipes biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with the block cob, trnT, trnP, as they are in birds.

  9. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.

    2004-05-19

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.

  10. Complete Genome Sequence of Mulberry Vein Banding Associated Virus, a New Tospovirus Infecting Mulberry.

    Directory of Open Access Journals (Sweden)

    Jiaorong Meng

    Full Text Available Mulberry vein banding associated virus (MVBaV that infects mulberry plants with typical vein banding symptoms had been identified as a tentative species of the genus Tospovirus based on the homology of N gene sequence to those of tospoviruses. In this study, the complete sequence of the tripartite RNA genome of MVBaV was determined and analyzed. The L RNA has 8905 nucleotides (nt and encodes the putative RNA-dependent RNA polymerase (RdRp of 2877 aa amino acids (aa in the viral complementary (vc strand. The RdRp of MVBaV shares the highest aa sequence identity (85.9% with that of Watermelon silver mottle virus (WSMoV, and contains conserved motifs shared with those of the species of the genus Tospovirus. The M RNA contains 4731 nt and codes in ambisense arrangement for the NSm protein of 309 aa in the sense strand and the Gn/Gc glycoprotein precursor (GP of 1,124 aa in the vc strand. The NSm and GP of MVBaV share the highest aa sequence identities with those of Capsicum chlorosis virus (CaCV and Groundnut bud necrosis virus (GBNV (83.2% and 84.3%, respectively. The S RNA is 3294 nt in length and contains two open reading frames (ORFs in an ambisense coding strategy, encoding a 439-aa non-structural protein (NSs and the 277-aa nucleocapsid protein (N, respectively. The NSs and N also share the highest aa sequence identity (71.1% and 74.4%, respectively with those of CaCV. Phylogenetic analysis of the RdRp, NSm, GP, NSs, and N proteins showed that MVBaV is most closely related to CaCV and GBNV and that these proteins cluster with those of the WSMoV serogroup, and that MVBaV seems to be a species bridging the two subgroups within the WSMoV serogroup of tospoviruses in evolutionary aspect, suggesting that MVBaV represents a distinct tospovirus. Analysis of S RNA sequence uncovered the highly conserved 5'-/3'-ends and the coding regions, and the variable region of IGR with divergent patterns among MVBaV isolates.

  11. Complete genome sequence of Serratia plymuthica strain AS12

    Energy Technology Data Exchange (ETDEWEB)

    Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Finlay, Roger D. [Uppsala University, Uppsala, Sweden; Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Han, James [U.S. Department of Energy, Joint Genome Institute; Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Hogberg, Nils [Uppsala University, Uppsala, Sweden

    2012-01-01

    A plant associated member of the family Enterobacteriaceae, Serratia plymuthica strain AS12 was isolated from rapeseed roots. It is of scientific interest due to its plant growth promoting and plant pathogen inhibiting ability. The genome of S. plymuthica AS12 comprises a 5,443,009 bp long circular chromosome, which consists of 4,952 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome was sequenced within the 2010 DOE-JGI Community Sequencing Program (CSP2010) as part of the project entitled 'Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens'.

  12. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  13. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  14. Complete Genome Sequence of Pediococcus pentosaceus Strain SL4

    DEFF Research Database (Denmark)

    Dantoft, Shruti Harnal; Bielak, Eliza Maria; Seo, Jae-Gu

    2013-01-01

    Pediococcus pentosaceus SL4 was isolated from a Korean fermented vegetable product, kimchi. We report here the whole-genome sequence (WGS) of P. pentosaceus SL4. The genome consists of a 1.79-Mb circular chromosome (G+C content of 37.3%) and seven distinct plasmids ranging in size from 4 kb to 50...

  15. Complete Chromosome Sequence of Carnobacterium maltaromaticum LMA 28

    DEFF Research Database (Denmark)

    Cailliez-Grimal, Catherine; Chaillou, Stéphane; Anba-Mondoloni, Jamila

    2013-01-01

    Within the lactic acid bacterium genus Carnobacterium, Carnobacterium maltaromaticum is one of the most frequently isolated species from natural environments and food. It potentially plays a major role in food product biopreservation. We report here on the 3.649-Mb chromosome sequence of C...

  16. Complete Genome Sequence of Beijerinckia indica subsp. indica▿

    Science.gov (United States)

    Tamas, Ivica; Dedysh, Svetlana N.; Liesack, Werner; Stott, Matthew B.; Alam, Maqsudul; Murrell, J. Colin; Dunfield, Peter F.

    2010-01-01

    Beijerinckia indica subsp. indica is an aerobic, acidophilic, exopolysaccharide-producing, N2-fixing soil bacterium. It is a generalist chemoorganotroph that is phylogenetically closely related to facultative and obligate methanotrophs of the genera Methylocella and Methylocapsa. Here we report the full genome sequence of this bacterium. PMID:20601475

  17. Complete genome sequence of Beijerinckia indica subsp. indica.

    Science.gov (United States)

    Tamas, Ivica; Dedysh, Svetlana N; Liesack, Werner; Stott, Matthew B; Alam, Maqsudul; Murrell, J Colin; Dunfield, Peter F

    2010-09-01

    Beijerinckia indica subsp. indica is an aerobic, acidophilic, exopolysaccharide-producing, N(2)-fixing soil bacterium. It is a generalist chemoorganotroph that is phylogenetically closely related to facultative and obligate methanotrophs of the genera Methylocella and Methylocapsa. Here we report the full genome sequence of this bacterium.

  18. Complete Genome Sequence of Mycobacterium vaccae Type Strain ATCC 25954

    KAUST Repository

    Ho, Y. S.; Adroub, S. A.; Abadi, Maram; Al Alwan, B.; Alkhateeb, R.; Gao, G.; Ragab, A.; Ali, Shahjahan; van Soolingen, D.; Bitter, W.; Pain, Arnab; Abdallah, A. M.

    2012-01-01

    Mycobacterium vaccae is a rapidly growing, nontuberculous Mycobacterium species that is generally not considered a human pathogen and is of major pharmaceutical interest as an immunotherapeutic agent. We report here the annotated genome sequence of the M. vaccae type strain, ATCC 25954.

  19. Complete Genome Sequence of Mycobacterium vaccae Type Strain ATCC 25954

    KAUST Repository

    Ho, Y. S.

    2012-10-26

    Mycobacterium vaccae is a rapidly growing, nontuberculous Mycobacterium species that is generally not considered a human pathogen and is of major pharmaceutical interest as an immunotherapeutic agent. We report here the annotated genome sequence of the M. vaccae type strain, ATCC 25954.

  20. [Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

    Science.gov (United States)

    Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

    2009-08-01

    Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers

  1. [Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

    Science.gov (United States)

    Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

    2010-01-01

    Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses

  2. Complete Genome Sequence of Pseudomonas aeruginosa Phage AAT-1.

    Science.gov (United States)

    Andrade-Domínguez, Andrés; Kolter, Roberto

    2016-08-25

    Aspects of the interaction between phages and animals are of interest and importance for medical applications. Here, we report the genome sequence of the lytic Pseudomonas phage AAT-1, isolated from mammalian serum. AAT-1 is a double-stranded DNA phage, with a genome of 57,599 bp, containing 76 predicted open reading frames. Copyright © 2016 Andrade-Domínguez and Kolter.

  3. Complete Genome Sequence of Mycobacterium xenopi Type Strain RIVM700367

    KAUST Repository

    Abdallah, A. M.; Rashid, M.; Adroub, S. A.; Elabdalaoui, H.; Ali, Shahjahan; van Soolingen, D.; Bitter, W.; Pain, Arnab

    2012-01-01

    Mycobacterium xenopi is a slow-growing, thermophilic, water-related Mycobacterium species. Like other nontuberculous mycobacteria, M. xenopi more commonly infects humans with altered immune function, such as chronic obstructive pulmonary disease patients. It is considered clinically relevant in a significant proportion of the patients from whom it is isolated. We report here the whole genome sequence of M. xenopi type strain RIVM700367.

  4. Complete Genome Sequence of Mycobacterium xenopi Type Strain RIVM700367

    KAUST Repository

    Abdallah, A. M.

    2012-05-24

    Mycobacterium xenopi is a slow-growing, thermophilic, water-related Mycobacterium species. Like other nontuberculous mycobacteria, M. xenopi more commonly infects humans with altered immune function, such as chronic obstructive pulmonary disease patients. It is considered clinically relevant in a significant proportion of the patients from whom it is isolated. We report here the whole genome sequence of M. xenopi type strain RIVM700367.

  5. Complete chloroplast genome sequence of Elodea canadensis and comparative analyses with other monocot plastid genomes.

    Science.gov (United States)

    Huotari, Tea; Korpelainen, Helena

    2012-10-15

    Elodea canadensis is an aquatic angiosperm native to North America. It has attracted great attention due to its invasive nature when transported to new areas in its non-native range. We have determined the complete nucleotide sequence of the chloroplast (cp) genome of Elodea. Taxonomically Elodea is a basal monocot, and only few monocot cp genomes representing early lineages of monocots have been sequenced so far. The genome is a circular double-stranded DNA molecule 156,700 bp in length, and has a typical structure with large (LSC 86,194 bp) and small (SSC 17,810 bp) single-copy regions separated by a pair of inverted repeats (IRs 26,348 bp each). The Elodea cp genome contains 113 unique genes and 16 duplicated genes in the IR regions. A comparative analysis showed that the gene order and organization of the Elodea cp genome is almost identical to that of Amborella trichopoda, a basal angiosperm. The structure of IRs in Elodea is unique among monocot species with the whole cp genome sequenced. In Elodea and another monocot Lemna minor the borders between IRs and LSC are located upstream of rps 19 gene and downstream of trnH-GUG gene, while in most monocots, IR has extended to include both trnH and rps 19 genes. A phylogenetic analysis conducted using Bayesian method, based on the DNA sequences of 81 chloroplast genes from 17 monocot taxa provided support for the placement of Elodea together with Lemna as a basal monocot and the next diverging lineage of monocots after Acorales. In comparison with other monocots, the Elodea cp genome has gone through only few rearrangements or gene losses. IR of Elodea has a unique structure among the monocot species studied so far as its structure is similar to that of a basal angiosperm Amborella. This result together with phylogenetic analyses supports the placement of Elodea as a basal monocot to the next diverging lineage of monocots after Acorales. So far, only few cp genomes representing early lineages of monocots have been

  6. Complete mitochondrial genome sequence from an endangered Indian snake, Python molurus molurus (Serpentes, Pythonidae).

    Science.gov (United States)

    Dubey, Bhawna; Meganathan, P R; Haque, Ikramul

    2012-07-01

    This paper reports the complete mitochondrial genome sequence of an endangered Indian snake, Python molurus molurus (Indian Rock Python). A typical snake mitochondrial (mt) genome of 17258 bp length comprising of 37 genes including the 13 protein coding genes, 22 tRNA genes, and 2 ribosomal RNA genes along with duplicate control regions is described herein. The P. molurus molurus mt. genome is relatively similar to other snake mt. genomes with respect to gene arrangement, composition, tRNA structures and skews of AT/GC bases. The nucleotide composition of the genome shows that there are more A-C % than T-G% on the positive strand as revealed by positive AT and CG skews. Comparison of individual protein coding genes, with other snake genomes suggests that ATP8 and NADH3 genes have high divergence rates. Codon usage analysis reveals a preference of NNC codons over NNG codons in the mt. genome of P. molurus. Also, the synonymous and non-synonymous substitution rates (ka/ks) suggest that most of the protein coding genes are under purifying selection pressure. The phylogenetic analyses involving the concatenated 13 protein coding genes of P. molurus molurus conformed to the previously established snake phylogeny.

  7. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  8. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  9. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  10. Complete genome sequences of two strains of Treponema pallidum subsp. pertenue from Ghana, Africa: Identical genome sequences in samples isolated more than 7 years apart.

    Directory of Open Access Journals (Sweden)

    Michal Strouhal

    2017-09-01

    Full Text Available Treponema pallidum subsp. pertenue (TPE is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier and one TPE strain (Fribourg-Blanc isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet.Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively. Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation.The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.

  11. Complete Genome Sequence of Plesiomonas shigelloides Type Strain NCTC10360

    Science.gov (United States)

    Fazal, Mohammed-Abbas; Burnett, Edward; Deheer-Graham, Ana; Oliver, Karen; Holroyd, Nancy; Russell, Julie E.

    2016-01-01

    Plesiomonas shigelloides is a Gram-negative rod within the Enterobacteriaceae family. It is a gastrointestinal pathogen of increasing notoriety, often associated with diarrheal disease. P. shigelloides is waterborne, and infection is often linked to the consumption of seafood. Here, we describe the first complete genome for P. shigelloides type strain NCTC10360. PMID:27660796

  12. Complete Genome Sequence of Enterotoxigenic Escherichia coli Siphophage Seurat.

    Science.gov (United States)

    Doan, Dung P; Lessor, Lauren E; Hernandez, Adriana C; Kuty Everett, Gabriel F

    2015-02-26

    Enterotoxigenic Escherichia coli (ETEC) is one of the leading causes of diarrhea in developing countries. Bacteriophage therapy has the potential to aid in the prevention and treatment of ETEC-related illness. To that end, we present here the complete genome of ETEC siphophage Seurat and describe its major features. Copyright © 2015 Doan et al.

  13. Complete genome sequence of Rhodospirillum rubrum type strain (S1).

    Science.gov (United States)

    Munk, A Christine; Copeland, Alex; Lucas, Susan; Lapidus, Alla; Del Rio, Tijana Glavina; Barry, Kerrie; Detter, John C; Hammon, Nancy; Israni, Sanjay; Pitluck, Sam; Brettin, Thomas; Bruce, David; Han, Cliff; Tapia, Roxanne; Gilna, Paul; Schmutz, Jeremy; Larimer, Frank; Land, Miriam; Kyrpides, Nikos C; Mavromatis, Konstantinos; Richardson, Paul; Rohde, Manfred; Göker, Markus; Klenk, Hans-Peter; Zhang, Yaoping; Roberts, Gary P; Reslewic, Susan; Schwartz, David C

    2011-07-01

    Rhodospirillum rubrum (Esmarch 1887) Molisch 1907 is the type species of the genus Rhodospirillum, which is the type genus of the family Rhodospirillaceae in the class Alphaproteobacteria. The species is of special interest because it is an anoxygenic phototroph that produces extracellular elemental sulfur (instead of oxygen) while harvesting light. It contains one of the most simple photosynthetic systems currently known, lacking light harvesting complex 2. Strain S1(T) can grow on carbon monoxide as sole energy source. With currently over 1,750 PubMed entries, R. rubrum is one of the most intensively studied microbial species, in particular for physiological and genetic studies. Next to R. centenum strain SW, the genome sequence of strain S1(T) is only the second genome of a member of the genus Rhodospirillum to be published, but the first type strain genome from the genus. The 4,352,825 bp long chromosome and 53,732 bp plasmid with a total of 3,850 protein-coding and 83 RNA genes were sequenced as part of the DOE Joint Genome Institute Program DOEM 2002.

  14. Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

    Science.gov (United States)

    Sasaya, T; Ishikawa, K; Koganezawa, H

    2001-06-01

    A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

  15. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  16. Complete Genome Sequence of Vibrio campbellii LMB 29 Isolated from Red Drum with Four Native Megaplasmids

    Directory of Open Access Journals (Sweden)

    Jinxin Liu

    2017-10-01

    Full Text Available Vibrio spp. are the most common pathogens for animals reared in aquaculture. Vibrio campbellii, which is often involved in shrimp, fish and mollusks diseases, is widely distributed in the marine environment worldwide, but our knowledge about its pathogenesis and antimicrobial resistance is very limited. The existence of this knowledge gap is at least partially because that V. campbellii was originally classified as Vibrio harveyi, and the detailed information of its comparative genome analysis to other Vibrio spp. is currently lacking. In this study, the complete genome of a V. campbellii predominant strain, LMB29, was determined by MiSeq in conjunction with PacBio SMRT sequencing. This genome consists of two circular DNA chromosomes and four megaplasmids. Comparative genome analysis indicates that LMB29 shares a 96.66% similarity (average nucleotide identity with the V. campbellii ATCC strain BAA-1116 based on a 75% AF (average fraction calculations, and its functional profile is very similar to V. campbellii E1 and V. campbellii CAIM115. Both type III secretion system (T3SS and type VI secretion system (T6SS, along with the tlh gene which encodes a thermolabile hemolysin, are present in LMB29 which may contribute to the bacterial pathogenesis. The virulence of this strain was experimental confirmed by performing a LDH assay on a fish cell infection model, and cell death was observed as early as within 3 h post infection. Thirty-seven antimicrobial resistance genes (>45% identity were predicted in LMB29 which includes a novel rifampicin ADP ribosyltransferase, arr-9, in plasmid pLMB157. The gene arr-9 was predicted on a genomic island with horizontal transferable potentials which may facilitate the rifampicin resistance dissemination. Future researches are needed to explore the pathogenesis of V. campbellii LMB29, but the availability of this genome sequence will certainly aid as a basis for further analysis.

  17. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  18. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  19. The phylogeny of Mediterranean tortoises and their close relativesbased on complete mitochondrial genome sequences from museumspecimens

    Energy Technology Data Exchange (ETDEWEB)

    Parham, James F.; Macey, J. Robert; Papenfuss, Theodore J.; Feldman, Chris R.; Turkozan, Oguz; Polymeni, Rosa; Boore, Jeffrey

    2005-04-29

    As part of an ongoing project to generate a mitochondrial database for terrestrial tortoises based on museum specimens, the complete mitochondrial genome sequences of 10 species and a {approx}14 kb sequence from an eleventh species are reported. The sampling of the present study emphasizes Mediterranean tortoises (genus Testudo and their close relatives). Our new sequences are aligned, along with those of two testudinoid turtles from GenBank, Chrysemys picta and Mauremys reevesii, yielding an alignment of 14,858 positions, of which 3,238 are parsimony informative. We develop a phylogenetic taxonomy for Testudo and related species based on well-supported, diagnosable clades. Several well-supported nodes are recovered, including the monophyly of a restricted Testudo, T. kleinmanni + T. marginata (the Chersus clade), and the placement of the enigmatic African pancake tortoise (Malacochersustornieri) within the predominantly Palearctic greater Testudo group (Testudona tax. nov.). Despite the large amount of sequence reported, there is low statistical support for some nodes within Testudona and Sowe do not propose names for those groups. A preliminary and conservative estimation of divergence times implies a late Miocene diversification for the testudonan clade (6-12 million years ago), matching their first appearance in the fossil record. The multi-continental distribution of testudonan turtles can be explained by the establishment of permanent connections between Europe, Africa, and Asia at this time. The arrival of testudonan turtles to Africa occurred after one or more initial tortoise invasions gave rise to the diverse (>25 species) 'Geochelone complex.'Two unusual genomic features are reported for the mtDNA of one tortoise, M. tornieri: (1) nad4 has a shift of reading frame that we suggest is resolved by translational frameshifting of the mRNA on the ribosome during protein synthesis and (2) there are two copies of the control region and trnF, with the

  20. Complete genome sequencing and evolutionary analysis of Indian isolates of Dengue virus type 2

    Energy Technology Data Exchange (ETDEWEB)

    Dash, Paban Kumar, E-mail: pabandash@rediffmail.com; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Parida, Manmohan; Rao, P.V.Lakshmana

    2013-07-05

    Highlights: •Complete genome of Indian DENV-2 was deciphered for the first time in this study. •The recent Indian DENV-2 revealed presence of many unique amino acid residues. •Genotype shift (American to Cosmopolitan) characterizes evolution of DENV-2 in India. •Circulation of a unique clade of DENV-2 in South Asia was identified. -- Abstract: Dengue is the most important arboviral infection of global public health significance. It is now endemic in most parts of the South East Asia including India. Though Dengue virus type 2 (DENV-2) is predominantly associated with major outbreaks in India, complete genome information of Indian DENV-2 is not available. In this study, the full-length genome of five DENV-2 isolates (four from 2001 to 2011 and one from 1960), from different parts of India was determined. The complete genome of the Indian DENV-2 was found to be 10,670 bases long with an open reading frame coding for 3391 amino acids. The recent Indian DENV-2 (2001–2011) revealed a nucleotide sequence identity of around 90% and 97% with an older Indian DENV-2 (1960) and closely related Sri Lankan and Chinese DENV-2 respectively. Presence of unique amino acid residues and non-conservative substitutions in critical amino acid residues of major structural and non-structural proteins was observed in recent Indian DENV-2. Selection pressure analysis revealed positive selection in few amino acid sites of the genes encoding for structural and non-structural proteins. The molecular phylogenetic analysis based on comparison of both complete coding region and envelope protein gene with globally diverse DENV-2 viruses classified the recent Indian isolates into a unique South Asian clade within Cosmopolitan genotype. A shift of genotype from American to Cosmopolitan in 1970s characterized the evolution of DENV-2 in India. Present study is the first report on complete genome characterization of emerging DENV-2 isolates from India and highlights the circulation of a

  1. Complete genome sequencing and evolutionary analysis of Indian isolates of Dengue virus type 2

    International Nuclear Information System (INIS)

    Dash, Paban Kumar; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Parida, Manmohan; Rao, P.V.Lakshmana

    2013-01-01

    Highlights: •Complete genome of Indian DENV-2 was deciphered for the first time in this study. •The recent Indian DENV-2 revealed presence of many unique amino acid residues. •Genotype shift (American to Cosmopolitan) characterizes evolution of DENV-2 in India. •Circulation of a unique clade of DENV-2 in South Asia was identified. -- Abstract: Dengue is the most important arboviral infection of global public health significance. It is now endemic in most parts of the South East Asia including India. Though Dengue virus type 2 (DENV-2) is predominantly associated with major outbreaks in India, complete genome information of Indian DENV-2 is not available. In this study, the full-length genome of five DENV-2 isolates (four from 2001 to 2011 and one from 1960), from different parts of India was determined. The complete genome of the Indian DENV-2 was found to be 10,670 bases long with an open reading frame coding for 3391 amino acids. The recent Indian DENV-2 (2001–2011) revealed a nucleotide sequence identity of around 90% and 97% with an older Indian DENV-2 (1960) and closely related Sri Lankan and Chinese DENV-2 respectively. Presence of unique amino acid residues and non-conservative substitutions in critical amino acid residues of major structural and non-structural proteins was observed in recent Indian DENV-2. Selection pressure analysis revealed positive selection in few amino acid sites of the genes encoding for structural and non-structural proteins. The molecular phylogenetic analysis based on comparison of both complete coding region and envelope protein gene with globally diverse DENV-2 viruses classified the recent Indian isolates into a unique South Asian clade within Cosmopolitan genotype. A shift of genotype from American to Cosmopolitan in 1970s characterized the evolution of DENV-2 in India. Present study is the first report on complete genome characterization of emerging DENV-2 isolates from India and highlights the circulation of a

  2. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  3. Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

    Science.gov (United States)

    Wen, Chiu-Ming

    2017-08-01

    An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

  4. Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1988-02-01

    Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

  5. The Complete Chloroplast and Mitochondrial Genome Sequences of Boea hygrometrica: Insights into the Evolution of Plant Organellar Genomes

    Science.gov (United States)

    Wang, Xumin; Deng, Xin; Zhang, Xiaowei; Hu, Songnian; Yu, Jun

    2012-01-01

    The complete nucleotide sequences of the chloroplast (cp) and mitochondrial (mt) genomes of resurrection plant Boea hygrometrica (Bh, Gesneriaceae) have been determined with the lengths of 153,493 bp and 510,519 bp, respectively. The smaller chloroplast genome contains more genes (147) with a 72% coding sequence, and the larger mitochondrial genome have less genes (65) with a coding faction of 12%. Similar to other seed plants, the Bh cp genome has a typical quadripartite organization with a conserved gene in each region. The Bh mt genome has three recombinant sequence repeats of 222 bp, 843 bp, and 1474 bp in length, which divide the genome into a single master circle (MC) and four isomeric molecules. Compared to other angiosperms, one remarkable feature of the Bh mt genome is the frequent transfer of genetic material from the cp genome during recent Bh evolution. We also analyzed organellar genome evolution in general regarding genome features as well as compositional dynamics of sequence and gene structure/organization, providing clues for the understanding of the evolution of organellar genomes in plants. The cp-derived sequences including tRNAs found in angiosperm mt genomes support the conclusion that frequent gene transfer events may have begun early in the land plant lineage. PMID:22291979

  6. Complete Sequence of the mitochondrial genome of the tapeworm Hymenolepis diminuta: Gene arrangements indicate that platyhelminths are eutrochozoans

    Energy Technology Data Exchange (ETDEWEB)

    von Nickisch-Rosenegk, Markus; Brown, Wesley M.; Boore, Jeffrey L.

    2001-01-01

    Using ''long-PCR'' we have amplified in overlapping fragments the complete mitochondrial genome of the tapeworm Hymenolepis diminuta (Platyhelminthes: Cestoda) and determined its 13,900 nucleotide sequence. The gene content is the same as that typically found for animal mitochondrial DNA (mtDNA) except that atp8 appears to be lacking, a condition found previously for several other animals. Despite the small size of this mtDNA, there are two large non-coding regions, one of which contains 13 repeats of a 31 nucleotide sequence and a potential stem-loop structure of 25 base pairs with an 11-member loop. Large potential secondary structures are identified also for the non-coding regions of two other cestode mtDNAs. Comparison of the mitochondrial gene arrangement of H. diminuta with those previously published supports a phylogenetic position of flatworms as members of the Eutrochozoa, rather than being basal to either a clade of protostomes or a clade of coelomates.

  7. Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands.

    Science.gov (United States)

    Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal; Gröne, Andrea; Kik, Marja J L

    2017-08-31

    Frog virus 3 was isolated from a strawberry poison frog ( Oophaga pumilio ) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op /2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the reference Frog virus 3 isolate. Copyright © 2017 Saucedo et al.

  8. Complete genome sequence of a tomato infecting tomato mottle mosaic virus in New York

    Science.gov (United States)

    Complete genome sequence of an emerging isolate of tomato mottle mosaic virus (ToMMV) infecting experimental nicotianan benthamiana plants in up-state New York was obtained using small RNA deep sequencing. ToMMV_NY-13 shared 99% sequence identity to ToMMV isolates from Mexico and Florida. Broader d...

  9. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M

    2018-01-01

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  10. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian

    2018-04-10

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  11. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  12. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  13. Mason: a JavaScript web site widget for visualizing and comparing annotated features in nucleotide or protein sequences.

    Science.gov (United States)

    Jaschob, Daniel; Davis, Trisha N; Riffle, Michael

    2015-03-07

    Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.

  14. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Haag KL

    1998-01-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  15. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  16. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  17. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  18. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  19. Complete genome sequence of the first human parechovirus type 3 isolated in Taiwan

    Directory of Open Access Journals (Sweden)

    Jenn-Tzong Chang

    2017-11-01

    Full Text Available The first human parechovirus 3 (HPeV3 VGHKS-2007 in Taiwan was identified from a clinical specimen from a male infant. The entire genome of the HPeV3 isolate was sequenced and compared to known HPeV3 sequences. Genome alignment data showed that HPeV3 VGHKS-2007 shares the highest nucleotide identity, 99%, with the Japanese strain of HPeV3 1361K-162589-Yamagata-2008. All HPeV3 isolates possess at least 97% amino acid identity. The analysis of the genome sequence of HPeV3 VGHKS-2007 will facilitate future investigations of the epidemiology and pathogenicity of HPeV3 infection.

  20. Complete plastome sequences of Equisetum arvense and Isoetes flaccida: implications for phylogeny and plastid genome evolution of early land plant lineages

    Directory of Open Access Journals (Sweden)

    Mandoli Dina F

    2010-10-01

    Full Text Available Abstract Background Despite considerable progress in our understanding of land plant phylogeny, several nodes in the green tree of life remain poorly resolved. Furthermore, the bulk of currently available data come from only a subset of major land plant clades. Here we examine early land plant evolution using complete plastome sequences including two previously unexamined and phylogenetically critical lineages. To better understand the evolution of land plants and their plastomes, we examined aligned nucleotide sequences, indels, gene and nucleotide composition, inversions, and gene order at the boundaries of the inverted repeats. Results We present the plastome sequences of Equisetum arvense, a horsetail, and of Isoetes flaccida, a heterosporous lycophyte. Phylogenetic analysis of aligned nucleotides from 49 plastome genes from 43 taxa supported monophyly for the following clades: embryophytes (land plants, lycophytes, monilophytes (leptosporangiate ferns + Angiopteris evecta + Psilotum nudum + Equisetum arvense, and seed plants. Resolution among the four monilophyte lineages remained moderate, although nucleotide analyses suggested that P. nudum and E. arvense form a clade sister to A. evecta + leptosporangiate ferns. Results from phylogenetic analyses of nucleotides were consistent with the distribution of plastome gene rearrangements and with analysis of sequence gaps resulting from insertions and deletions (indels. We found one new indel and an inversion of a block of genes that unites the monilophytes. Conclusions Monophyly of monilophytes has been disputed on the basis of morphological and fossil evidence. In the context of a broad sampling of land plant data we find several new pieces of evidence for monilophyte monophyly. Results from this study demonstrate resolution among the four monilophytes lineages, albeit with moderate support; we posit a clade consisting of Equisetaceae and Psilotaceae that is sister to the "true ferns

  1. High coverage of the complete mitochondrial genome of the rare Gray's beaked whale (Mesoplodon grayi) using Illumina next generation sequencing.

    Science.gov (United States)

    Thompson, Kirsten F; Patel, Selina; Williams, Liam; Tsai, Peter; Constantine, Rochelle; Baker, C Scott; Millar, Craig D

    2016-01-01

    Using an Illumina platform, we shot-gun sequenced the complete mitochondrial genome of Gray's beaked whale (Mesoplodon grayi) to an average coverage of 152X. We performed a de novo assembly using SOAPdenovo2 and determined the total mitogenome length to be 16,347 bp. The nucleotide composition was asymmetric (33.3% A, 24.6% C, 12.6% G, 29.5% T) with an overall GC content of 37.2%. The gene organization was similar to that of other cetaceans with 13 protein-coding genes, 2 rRNAs (12S and 16S), 22 predicted tRNAs and 1 control region or D-loop. We found no evidence of heteroplasmy or nuclear copies of mitochondrial DNA in this individual. Beaked whales within the genus Mesoplodon are rarely seen at sea and their basic biology is poorly understood. These data will contribute to resolving the phylogeography and population ecology of this speciose group.

  2. Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

    Science.gov (United States)

    Han, S S; Karasev, A V; Ieki, H; Iwanami, T

    2002-11-01

    Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

  3. The complete mitochondrial genome sequence of Oceanic whitetip shark, Carcharhinus longimanus (Carcharhiniformes: Carcharhinidae).

    Science.gov (United States)

    Li, Weiwen; Dai, Xiaojie; Xu, Qianghua; Wu, Feng; Gao, Chunxia; Zhang, Yanbo

    2016-05-01

    The complete mitochondrial DNA sequence of Carcharhinus longimanus was determined and analyzed. The complete mtDNA genome sequence of C. longimanus was 16,706 bp in length. It contained 22 tRNA genes, 2 rRNA genes, 13 protein-coding genes and 2 non-conding regions: control region (D-loop) and origin of light-strand replication (OL). The complete mitogenome sequence information of C. longimanus can provide a useful data for further studies on molecular systematics, stock evaluation, taxonomic status and conservation genetics.

  4. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  5. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  6. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-01-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  7. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  8. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  9. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  10. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  11. Complete genome sequence of Leptospira alstonii serovar room 22, strain GWTS#1

    Science.gov (United States)

    We report the complete genome sequence of Leptospira alstonii serovar room 22 strain GWTS#1. This is the first isolate of L. alstonii to be cultured from a mammal, in Western Europe, and represents a new serovar of pathogenic leptospires....

  12. First Complete Genome Sequence of a Watermelon Mosaic Virus Isolated from Watermelon in the United States

    OpenAIRE

    Rajbanshi, Naveen; Ali, Akhtar

    2016-01-01

    Watermelon mosaic virus was first reported in 1965 from the Rio Grande Valley, TX. We report here the first complete genome sequence of a watermelon mosaic virus isolate from watermelon collected from the Rio Grande Valley of Texas.

  13. Complete genome sequence of Campylobacter jejuni strain 12567 a livestock-associated clade representative

    Science.gov (United States)

    We report the complete genome sequence of the Campylobacter jejuni strain 12567, a member of a C. jejuni livestock-associated clade that expresses glycoconjugates linked to improved gastrointestinal tract persistence....

  14. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  15. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  16. Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus

    International Nuclear Information System (INIS)

    Upton, C.; McFadden, G.

    1986-01-01

    The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively

  17. Complete Genome Sequence of the Probiotic Strain Lactobacillus salivarius LPM01.

    Science.gov (United States)

    Chenoll, Empar; Codoñer, Francisco M; Martinez-Blanch, Juan F; Acevedo-Piérart, Marcelo; Ormeño, M Loreto; Ramón, Daniel; Genovés, Salvador

    2016-11-23

    Lactobacillus salivarius LPM01 (DSM 22150) is a probiotic strain able to improve health status in immunocompromised people. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insights into its functional activity and safety assessment. Copyright © 2016 Chenoll et al.

  18. Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk.

    Science.gov (United States)

    Jiménez, Esther; Villar-Tajadura, M Antonia; Marín, María; Fontecha, Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M

    2012-07-01

    Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties.

  19. Complete Genome Sequence of EtG, the First Phage Sequenced from Erwinia tracheiphila.

    Science.gov (United States)

    Andrade-Domínguez, Andrés; Kolter, Roberto; Shapiro, Lori R

    2018-02-22

    Erwinia tracheiphila is the causal agent of bacterial wilt of cucurbits. Here, we report the genome sequence of the temperate phage EtG, which was isolated from an E. tracheiphila -infected cucumber plant. Phage EtG has a linear 30,413-bp double-stranded DNA genome with cohesive ends and 45 predicted open reading frames. Copyright © 2018 Andrade-Domínguez et al.

  20. Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

    Science.gov (United States)

    Guo, D; Maiss, E; Adam, G; Casper, R

    1995-05-01

    The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

  1. Complete genome sequence analysis of Nocardia brasiliensis HUJEG-1 reveals a saprobic lifestyle and the genes needed for human pathogenesis.

    Science.gov (United States)

    Vera-Cabrera, Lucio; Ortiz-Lopez, Rocio; Elizondo-Gonzalez, Ramiro; Ocampo-Candiani, Jorge

    2013-01-01

    Nocardia brasiliensis is an important etiologic agent of mycetoma. These bacteria live as a saprobe in soil or organic material and enter the tissue via minor trauma. Mycetoma is characterized by tumefaction and the production of fistula and abscesses, with no spontaneous cure. By using mass sequencing, we determined the complete genomic nucleotide sequence of the bacteria. According to our data, the genome is a circular chromosome 9,436,348-bp long with 68% G+C content that encodes 8,414 proteins. We observed orthologs for virulence factors, a higher number of genes involved in lipid biosynthesis and catabolism, and gene clusters for the synthesis of bioactive compounds, such as antibiotics, terpenes, and polyketides. An in silico analysis of the sequence supports the conclusion that the bacteria acquired diverse genes by horizontal transfer from other soil bacteria, even from eukaryotic organisms. The genome composition reflects the evolution of bacteria via the acquisition of a large amount of DNA, which allows it to survive in new ecological niches, including humans.

  2. Complete genome sequence analysis of Nocardia brasiliensis HUJEG-1 reveals a saprobic lifestyle and the genes needed for human pathogenesis.

    Directory of Open Access Journals (Sweden)

    Lucio Vera-Cabrera

    Full Text Available Nocardia brasiliensis is an important etiologic agent of mycetoma. These bacteria live as a saprobe in soil or organic material and enter the tissue via minor trauma. Mycetoma is characterized by tumefaction and the production of fistula and abscesses, with no spontaneous cure. By using mass sequencing, we determined the complete genomic nucleotide sequence of the bacteria. According to our data, the genome is a circular chromosome 9,436,348-bp long with 68% G+C content that encodes 8,414 proteins. We observed orthologs for virulence factors, a higher number of genes involved in lipid biosynthesis and catabolism, and gene clusters for the synthesis of bioactive compounds, such as antibiotics, terpenes, and polyketides. An in silico analysis of the sequence supports the conclusion that the bacteria acquired diverse genes by horizontal transfer from other soil bacteria, even from eukaryotic organisms. The genome composition reflects the evolution of bacteria via the acquisition of a large amount of DNA, which allows it to survive in new ecological niches, including humans.

  3. The complete chloroplast genome sequence of Gentiana lawrencei var. farreri (Gentianaceae) and comparative analysis with its congeneric species.

    Science.gov (United States)

    Fu, Peng-Cheng; Zhang, Yan-Zhao; Geng, Hui-Min; Chen, Shi-Long

    2016-01-01

    The chloroplast (cp) genome is useful in plant systematics, genetic diversity analysis, molecular identification and divergence dating. The genus Gentiana contains 362 species, but there are only two valuable complete cp genomes. The purpose of this study is to report the characterization of complete cp genome of G. lawrencei var. farreri , which is endemic to the Qinghai-Tibetan Plateau (QTP). Using high throughput sequencing technology, we got the complete nucleotide sequence of the G. lawrencei var. farreri cp genome. The comparison analysis including genome difference and gene divergence was performed with its congeneric species G. straminea . The simple sequence repeats (SSRs) and phylogenetics were studied as well. The cp genome of G. lawrencei var. farreri is a circular molecule of 138,750 bp, containing a pair of 24,653 bp inverted repeats which are separated by small and large single-copy regions of 11,365 and 78,082 bp, respectively. The cp genome contains 130 known genes, including 85 protein coding genes (PCGs), eight ribosomal RNA genes and 37 tRNA genes. Comparative analyses indicated that G. lawrencei var. farreri is 10,241 bp shorter than its congeneric species G. straminea. Four large gaps were detected that are responsible for 85% of the total sequence loss. Further detailed analyses revealed that 10 PCGs were included in the four gaps that encode nine NADH dehydrogenase subunits. The cp gene content, order and orientation are similar to those of its congeneric species, but with some variation among the PCGs. Three genes, ndhB , ndhF and clpP , have high nonsynonymous to synonymous values. There are 34 SSRs in the G. lawrencei var. farreri cp genome, of which 25 are mononucleotide repeats: no dinucleotide repeats were detected. Comparison with the G. straminea cp genome indicated that five SSRs have length polymorphisms and 23 SSRs are species-specific. The phylogenetic analysis of 48 PCGs from 12 Gentianales taxa cp genomes clearly identified

  4. Complete sequences of the highly rearranged molluscan mitochondrial genomes of the scaphopod graptacme eborea and the bivalve mytilus edulis

    Energy Technology Data Exchange (ETDEWEB)

    Boore, Jeffrey L.; Medina, Monica; Rosenberg, Lewis A.

    2004-01-31

    We have determined the complete sequence of the mitochondrial genome of the scaphopod mollusk Graptacme eborea (Conrad, 1846) (14,492 nts) and completed the sequence of the mitochondrial genome of the bivalve mollusk Mytilus edulis Linnaeus, 1758 (16,740 nts). (The name Graptacme eborea is a revision of the species formerly known as Dentalium eboreum.) G. eborea mtDNA contains the 37 genes that are typically found and has the genes divided about evenly between the two strands, but M. edulis contains an extra trnM and is missing atp8, and has all genes on the same strand. Each has a highly rearranged gene order relative to each other and to all other studied mtDNAs. G. eborea mtDNA has almost no strand skew, but the coding strand of M. edulis mtDNA is very rich in G and T. This is reflected in differential codon usage patterns and even in amino acid compositions. G. eborea mtDNA has fewer non-coding nucleotides than any other mtDNA studied to date, with the largest non-coding region being only 24 nt long. Phylogenetic analysis using 2,420 aligned amino acid positions of concatenated proteins weakly supports an association of the scaphopod with gastropods to the exclusion of Bivalvia, Cephalopoda, and Polyplacophora, but is generally unable to convincingly resolve the relationships among major groups of the Lophotrochozoa, in contrast to the good resolution seen for several other major metazoan groups.

  5. The R package otu2ot for implementing the entropy decomposition of nucleotide variation in sequence data

    Directory of Open Access Journals (Sweden)

    Alban eRamette

    2014-11-01

    Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.

  6. Complete mitochondrial genome sequences of Brassica rapa (Chinese cabbage and mizuna), and intraspecific differentiation of cytoplasm in B. rapa and Brassica juncea.

    Science.gov (United States)

    Hatono, Saki; Nishimura, Kaori; Murakami, Yoko; Tsujimura, Mai; Yamagishi, Hiroshi

    2017-09-01

    The complete sequence of the mitochondrial genome was determined for two cultivars of Brassica rapa . After determining the sequence of a Chinese cabbage variety, 'Oushou hakusai', the sequence of a mizuna variety, 'Chusei shiroguki sensuji kyomizuna', was mapped against the sequence of Chinese cabbage. The precise sequences where the two varieties demonstrated variation were ascertained by direct sequencing. It was found that the mitochondrial genomes of the two varieties are identical over 219,775 bp, with a single nucleotide polymorphism (SNP) between the genomes. Because B. rapa is the maternal species of an amphidiploid crop species, Brassica juncea , the distribution of the SNP was observed both in B. rapa and B. juncea . While the mizuna type SNP was restricted mainly to cultivars of mizuna (japonica group) in B. rapa , the mizuna type was widely distributed in B. juncea . The finding that the two Brassica species have these SNP types in common suggests that the nucleotide substitution occurred in wild B. rapa before both mitotypes were domesticated. It was further inferred that the interspecific hybridization between B. rapa and B. nigra took place twice and resulted in the two mitotypes of cultivated B. juncea .

  7. A new HCV genotype 6 subtype designated 6v was confirmed with three complete genome sequences.

    Science.gov (United States)

    Wang, Yizhong; Xia, Xueshan; Li, Chunhua; Maneekarn, Niwat; Xia, Wenjie; Zhao, Wenhua; Feng, Yue; Kung, Hsiang Fu; Fu, Yongshui; Lu, Ling

    2009-03-01

    Although hepatitis C virus (HCV) genotype 6 is classified into 21 subtypes, 6a-6u, new variants continue to be identified. To characterize the full-length genomes of three novel HCV genotype 6 variants: KMN02, KM046 and KM181. From sera of patients with HCV infection, the entire HCV genome was amplified by RT-PCR followed by direct DNA sequencing and phylogenetic analysis. The sera contained HCV genomes of 9461, 9429, and 9461nt in length, and each harboured a single ORF of 9051nt. The genomes showed 95.3-98.1% nucleotide similarity to each other and 72.2-75.4% similarity to 23 genotype 6 reference sequences, which represent subtypes 6a-6u and unassigned variants km41 and gz52557. Phylogenetic analyses demonstrated that they were genotype 6, but were subtypically distinct. Based on the current criteria of HCV classification, they were designed to represent a new subtype, 6v. Analysis of E1 and NS5B region partial sequences revealed two additional related variants, CMBD-14 and CMBD-86 that had been previously reported in northern Thailand and sequences dropped into Genbank. Three novel HCV genotype 6 variants were entirely sequenced and designated subtype 6v.

  8. Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

    Energy Technology Data Exchange (ETDEWEB)

    McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

    2005-08-26

    Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

  9. Complete Genome Sequence of Genotype VI Newcastle Disease Viruses Isolated from Pigeons in Pakistan

    OpenAIRE

    Wajid, Abdul; Rehmani, Shafqat Fatima; Sharma, Poonam; Goraichuk, Iryna V.; Dimitrov, Kiril M.; Afonso, Claudio L.

    2016-01-01

    Two complete genome sequences of Newcastle disease virus (NDV) are described here. Virulent isolates pigeon/Pakistan/Lahore/21A/2015 and pigeon/Pakistan/Lahore/25A/2015 were obtained from racing pigeons sampled in the Pakistani province of Punjab during 2015. Phylogenetic analysis of the fusion protein genes and complete genomes classified the isolates as members of NDV class II, genotype VI.

  10. First Complete Genome Sequence of Pepper vein yellows virus from Australia

    Science.gov (United States)

    Maina, Solomon; Edwards, Owain R.

    2016-01-01

    We present here the first complete genomic RNA sequence of the polerovirus Pepper vein yellows virus (PeVYV) obtained from a pepper plant in Australia. We compare it with complete PeVYV genomes from Japan and China. The Australian genome was more closely related to the Japanese than the Chinese genome. PMID:27231375

  11. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    Science.gov (United States)

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  13. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  14. Comparative analysis of complete genome sequences of European subtype tick-borne encephalitis virus strains isolated from Ixodes persulcatus ticks, long-tailed ground squirrel (Spermophilus undulatus), and human blood in the Asian part of Russia

    Czech Academy of Sciences Publication Activity Database

    Demina, T. V.; Tkachev, S. E.; Kozlova, I. V.; Doroshchenko, E. K.; Lisak, O. V.; Suntsova, O. V.; Verkhozina, M. M.; Dzhioev, Y. P.; Paramonov, A. I.; Tikunov, A. Y.; Tikunova, N. V.; Zlobin, V. I.; Růžek, Daniel

    2017-01-01

    Roč. 8, č. 4 (2017), s. 547-553 ISSN 1877-959X Institutional support: RVO:60077344 Keywords : TBEV * complete genome * European subtype * Western Siberia * Eastern Siberia * nucleotide * Amino acid sequence Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology OBOR OECD: Infectious Diseases Impact factor: 3.230, year: 2016

  15. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  16. Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys.

    Science.gov (United States)

    Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Barta, John R

    2014-07-17

    Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotically replicating mitochondrial genome may be more suited for species level molecular work; however, only limited sequence data are available for Eimeria spp. infecting turkeys. The purpose of this study was to sequence and annotate the complete mitochondrial genomes from 5 Eimeria species that commonly infect the domestic turkey (Meleagris gallopavo). Six single-oocyst derived cultures of five Eimeria species infecting turkeys were PCR-amplified and sequenced completely prior to detailed annotation. Resulting sequences were aligned and used in phylogenetic analyses (BI, ML, and MP) that included complete mitochondrial genomes from 16 Eimeria species or concatenated CDS sequences from each genome. Complete mitochondrial genome sequences were obtained for Eimeria adenoeides Guelph, 6211 bp; Eimeria dispersa Briston, 6238 bp; Eimeria meleagridis USAR97-01, 6212 bp; Eimeria meleagrimitis USMN08-01, 6165 bp; Eimeria gallopavonis Weybridge, 6215 bp; and Eimeria gallopavonis USKS06-01, 6215 bp). The order, orientation and CDS lengths of the three protein coding genes (COI, COIII and CytB) as well as rDNA fragments encoding ribosomal large and small subunit rRNA were conserved among all sequences. Pairwise sequence identities between species ranged from 88.1% to 98.2%; sequence variability was concentrated within CDS or between rDNA fragments (where indels were common). No phylogenetic reconstruction supported monophyly of Eimeria species infecting turkeys; Eimeria dispersa may have arisen

  17. Analysis of the complete genome sequence of Nocardia seriolae UTF1, the causative agent of fish nocardiosis: The first reference genome sequence of the fish pathogenic Nocardia species.

    Science.gov (United States)

    Yasuike, Motoshige; Nishiki, Issei; Iwasaki, Yuki; Nakamura, Yoji; Fujiwara, Atushi; Shimahara, Yoshiko; Kamaishi, Takashi; Yoshida, Terutoyo; Nagai, Satoshi; Kobayashi, Takanori; Katoh, Masaya

    2017-01-01

    Nocardiosis caused by Nocardia seriolae is one of the major threats in the aquaculture of Seriola species (yellowtail; S. quinqueradiata, amberjack; S. dumerili and kingfish; S. lalandi) in Japan. Here, we report the complete nucleotide genome sequence of N. seriolae UTF1, isolated from a cultured yellowtail. The genome is a circular chromosome of 8,121,733 bp with a G+C content of 68.1% that encodes 7,697 predicted proteins. In the N. seriolae UTF1 predicted genes, we found orthologs of virulence factors of pathogenic mycobacteria and human clinical Nocardia isolates involved in host cell invasion, modulation of phagocyte function and survival inside the macrophages. The virulence factor candidates provide an essential basis for understanding their pathogenic mechanisms at the molecular level by the fish nocardiosis research community in future studies. We also found many potential antibiotic resistance genes on the N. seriolae UTF1 chromosome. Comparative analysis with the four existing complete genomes, N. farcinica IFM 10152, N. brasiliensis HUJEG-1 and N. cyriacigeorgica GUH-2 and N. nova SH22a, revealed that 2,745 orthologous genes were present in all five Nocardia genomes (core genes) and 1,982 genes were unique to N. seriolae UTF1. In particular, the N. seriolae UTF1 genome contains a greater number of mobile elements and genes of unknown function that comprise the differences in structure and gene content from the other Nocardia genomes. In addition, a lot of the N. seriolae UTF1-specific genes were assigned to the ABC transport system. Because of limited resources in ocean environments, these N. seriolae UTF1 specific ABC transporters might facilitate adaptation strategies essential for marine environment survival. Thus, the availability of the complete N. seriolae UTF1 genome sequence will provide a valuable resource for comparative genomic studies of N. seriolae isolates, as well as provide new insights into the ecological and functional diversity of

  18. Complete sequence and diversity of a maize-associated Polerovirus in East Africa.

    Science.gov (United States)

    Massawe, Deogracious P; Stewart, Lucy R; Kamatenesi, Jovia; Asiimwe, Theodore; Redinbaugh, Margaret G

    2018-06-01

    Since 2011-2012, Maize lethal necrosis (MLN) has emerged in East Africa, causing massive yield loss and propelling research to identify viruses and virus populations present in maize. As expected, next generation sequencing (NGS) has revealed diverse and abundant viruses from the family Potyviridae, primarily sugarcane mosaic virus (SCMV), and maize chlorotic mottle virus (MCMV) (Tombusviridae), which are known to cause MLN by synergistic co-infection. In addition to these expected viruses, we identified a virus in the genus Polerovirus (family Luteoviridae) in 104/172 samples selected for MLN or other potential virus symptoms from Kenya, Uganda, Rwanda, and Tanzania. This polerovirus (MF974579) nucleotide sequence is 97% identical to maize-associated viruses recently reported in China, termed 'maize yellow mosaic virus' (MaYMV) and maize yellow dwarf virus (MaYMV; KU291101, KU291107, MYDV-RMV2; KT992824); and 99% identical to MaYMV (KY684356) infecting sugarcane and itch grass in Nigeria; 83% identical to a barley-associated polerovirus recently identified in Korea (BVG; KT962089); and 79% identical to the U.S. maize-infecting polerovirus maize yellow dwarf virus (MYDV-RMV; KT992824). Nucleotide sequences from ORF0 of 20 individual East African isolates collected from Kenya, Uganda, Rwanda, and Tanzania shared 98% or higher identity, and were detected in 104/172 (60.5%) of samples collected for virus-like symptoms, indicating extensive prevalence but limited diversity of this virus in East Africa. We refer to this virus as "MYDV-like polerovirus" until symptoms of the virus in maize are known.

  19. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  20. Complete genome sequence of a Chinese isolate of pepper vein yellows virus and evolutionary analysis based on the CP, MP and RdRp coding regions.

    Science.gov (United States)

    Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun

    2016-03-01

    The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.

  1. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  2. Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

    Science.gov (United States)

    Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

    2011-05-25

    Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

  3. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Directory of Open Access Journals (Sweden)

    Kei-ichi Morita

    Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  4. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Science.gov (United States)

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  5. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  6. Complete genome sequence of Parvibaculum lavamentivorans type strain (DS-1(T)).

    Science.gov (United States)

    Schleheck, David; Weiss, Michael; Pitluck, Sam; Bruce, David; Land, Miriam L; Han, Shunsheng; Saunders, Elizabeth; Tapia, Roxanne; Detter, Chris; Brettin, Thomas; Han, James; Woyke, Tanja; Goodwin, Lynne; Pennacchio, Len; Nolan, Matt; Cook, Alasdair M; Kjelleberg, Staffan; Thomas, Torsten

    2011-12-31

    Parvibaculum lavamentivorans DS-1(T) is the type species of the novel genus Parvibaculum in the novel family Rhodobiaceae (formerly Phyllobacteriaceae) of the order Rhizobiales of Alphaproteobacteria. Strain DS-1(T) is a non-pigmented, aerobic, heterotrophic bacterium and represents the first tier member of environmentally important bacterial communities that catalyze the complete degradation of synthetic laundry surfactants. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,914,745 bp long genome with its predicted 3,654 protein coding genes is the first completed genome sequence of the genus Parvibaculum, and the first genome sequence of a representative of the family Rhodobiaceae.

  7. The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).

    Science.gov (United States)

    Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai

    2016-01-01

    In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.

  8. Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk

    OpenAIRE

    Jiménez, Esther; Villar-Tajadura, M. Antonia; Marín, María; Fontecha, F. Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M.

    2012-01-01

    Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties. © 2012, American Society for Microbiology.

  9. High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

  10. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    Science.gov (United States)

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  11. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

    Science.gov (United States)

    Pietrowski, D; Förster, M

    2000-01-01

    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  12. Complete amino acid sequence of bovine colostrum low-Mr cysteine proteinase inhibitor.

    Science.gov (United States)

    Hirado, M; Tsunasawa, S; Sakiyama, F; Niinobe, M; Fujii, S

    1985-07-01

    The complete amino acid sequence of bovine colostrum cysteine proteinase inhibitor was determined by sequencing native inhibitor and peptides obtained by cyanogen bromide degradation, Achromobacter lysylendopeptidase digestion and partial acid hydrolysis of reduced and S-carboxymethylated protein. Achromobacter peptidase digestion was successfully used to isolate two disulfide-containing peptides. The inhibitor consists of 112 amino acids with an Mr of 12787. Two disulfide bonds were established between Cys 66 and Cys 77 and between Cys 90 and Cys 110. A high degree of homology in the sequence was found between the colostrum inhibitor and human gamma-trace, human salivary acidic protein and chicken egg-white cystatin.

  13. Complete genome sequence of Sanguibacter keddieii type strain (ST-74T)

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, Natalia; Sikorski, Johannes; Sims, David; Brettin, Thomas; Detter, John C.; Han, Cliff; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Pati, Amrita; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; D' haeseleer, Patrik; Chain, Patrick; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Goker, Markus; Pukall, Rudiger; Klenk, Hans-Peter; Kyrpides, Nikos

    2009-05-20

    Sanguibacter keddieii is the type species of the genus Sanguibacter, the only described genus within the family of Sanguibacteraceae. Phylogenetically, this family is located in the neighbourhood of the genus Oerskovia and the family Cellulomonadaceae within the actinobacterial suborder Micrococcineae. The strain described in this report was isolated from blood of apparently healthy cows. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the family Sanguibacteraceae, and the 4,253,413 bp long single replicon genome with its 3735 protein-coding and 70 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  14. Complete genome sequence of Calditerrivibrio nitroreducens type strain (Yu37-1T)

    Energy Technology Data Exchange (ETDEWEB)

    Pitluck, Sam [Joint Genome Institute, Walnut Creek, California; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Zeytun, Ahmet [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Hammon, Nancy [Joint Genome Institute, Walnut Creek, California; Deshpande, Shweta [Joint Genome Institute, Walnut Creek, California; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Pagani, Ioanna [Joint Genome Institute, Walnut Creek, California; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Detter, J. Chris [Joint Genome Institute, Walnut Creek, California; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Ngatchou, Olivier Duplex [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [Joint Genome Institute, Walnut Creek, California; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [Joint Genome Institute, Walnut Creek, California; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL

    2011-01-01

    Calditerrivibrio nitroreducens Iino et al. 2008 is the type species of the genus Calditerrivibrio. The species is of interest because of its important role in the nitrate cycle as nitrate reducer and for its isolated phylogenetic position in the Tree of Life. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the third complete genome sequence of a member of the family Deferribacteraceae. The 2,216,552 bp long genome with its 2,128 protein-coding and 50 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  15. Complete Genome Sequence of an Avian Metapneumovirus Subtype A Strain Isolated from Chicken (Gallus gallus) in Brazil

    OpenAIRE

    Rizotto, La?s S.; Scagion, Guilherme P.; Cardoso, Tereza C.; Sim?o, Raphael M.; Caserta, Leonardo C.; Benassi, Julia C.; Keid, Lara B.; Oliveira, Tr?cia M. F. de S.; Soares, Rodrigo M.; Arns, Clarice W.; Van Borm, Steven; Ferreira, Helena L.

    2017-01-01

    ABSTRACT We report here the complete genome sequence of an avian metapneumovirus (aMPV) isolated from a tracheal tissue sample of a commercial layer flock. The complete genome sequence of aMPV-A/chicken/Brazil-SP/669/2003 was obtained using MiSeq (Illumina, Inc.) sequencing. Phylogenetic analysis of the complete genome classified the isolate as avian metapneumovirus subtype A.

  16. First complete genome sequence of parainfluenza virus 5 isolated from lesser panda.

    Science.gov (United States)

    Zhai, Jun-Qiong; Zhai, Shao-Lun; Lin, Tao; Liu, Jian-Kui; Wang, He-Xing; Li, Bing; Zhang, He; Zou, Shu-Zhan; Zhou, Xia; Wu, Meng-Fan; Chen, Wu; Luo, Man-Lin

    2017-05-01

    Parainfluenza virus 5 (PIV5) is widespread in mammals and humans. Up to now, there is little information about PIV5 infection in lesser pandas. In this study, a PIV5 variant (named ZJQ-221) was isolated from a lesser panda with respiratory disease in Guangzhou zoo in Guangdong province, southern China. The full-length genome of ZJQ-221 was found to be 15,246 nucleotides and consisted of seven non-overlapping genes encoding eight proteins (i.e., NP, V, P, M, F, SH, HN and L). Sequence alignment and genetic analysis revealed that ZJQ-221 shared a close relationship with a PIV5 strain of canine-origin (1168-1) from South Korea. The findings of this study confirm the presence of PIV5 in lesser panda and indicate this mammal as a possible natural reservoir. Furthermore they highlight the urgent need to strengthen viral surveillance and control of PIV5 in zoo animals.

  17. Complete chloroplast genome sequence of a major allogamous forage species, perennial ryegrass (Lolium perenne L.).

    Science.gov (United States)

    Diekmann, Kerstin; Hodkinson, Trevor R; Wolfe, Kenneth H; van den Bekerom, Rob; Dix, Philip J; Barth, Susanne

    2009-06-01

    Lolium perenne L. (perennial ryegrass) is globally one of the most important forage and grassland crops. We sequenced the chloroplast (cp) genome of Lolium perenne cultivar Cashel. The L. perenne cp genome is 135 282 bp with a typical quadripartite structure. It contains genes for 76 unique proteins, 30 tRNAs and four rRNAs. As in other grasses, the genes accD, ycf1 and ycf2 are absent. The genome is of average size within its subfamily Pooideae and of medium size within the Poaceae. Genome size differences are mainly due to length variations in non-coding regions. However, considerable length differences of 1-27 codons in comparison of L. perenne to other Poaceae and 1-68 codons among all Poaceae were also detected. Within the cp genome of this outcrossing cultivar, 10 insertion/deletion polymorphisms and 40 single nucleotide polymorphisms were detected. Two of the polymorphisms involve tiny inversions within hairpin structures. By comparing the genome sequence with RT-PCR products of transcripts for 33 genes, 31 mRNA editing sites were identified, five of them unique to Lolium. The cp genome sequence of L. perenne is available under Accession number AM777385 at the European Molecular Biology Laboratory, National Center for Biotechnology Information and DNA DataBank of Japan.

  18. Striking structural dynamism and nucleotide sequence variation of the transposon Galileo in the genome of Drosophila mojavensis.

    Science.gov (United States)

    Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo

    2013-02-04

    Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.

  19. Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs.

    Science.gov (United States)

    Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A

    1997-05-01

    The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.

  20. Complete Genome Sequence of Genotype VI Newcastle Disease Viruses Isolated from Pigeons in Pakistan

    Science.gov (United States)

    Wajid, Abdul; Rehmani, Shafqat Fatima; Sharma, Poonam; Goraichuk, Iryna V.; Dimitrov, Kiril M.

    2016-01-01

    Two complete genome sequences of Newcastle disease virus (NDV) are described here. Virulent isolates pigeon/Pakistan/Lahore/21A/2015 and pigeon/Pakistan/Lahore/25A/2015 were obtained from racing pigeons sampled in the Pakistani province of Punjab during 2015. Phylogenetic analysis of the fusion protein genes and complete genomes classified the isolates as members of NDV class II, genotype VI. PMID:27540069

  1. Complete chloroplast genome sequence of a major economic species, Ziziphus jujuba (Rhamnaceae).

    Science.gov (United States)

    Ma, Qiuyue; Li, Shuxian; Bi, Changwei; Hao, Zhaodong; Sun, Congrui; Ye, Ning

    2017-02-01

    Ziziphus jujuba is an important woody plant with high economic and medicinal value. Here, we analyzed and characterized the complete chloroplast (cp) genome of Z. jujuba, the first member of the Rhamnaceae family for which the chloroplast genome sequence has been reported. We also built a web browser for navigating the cp genome of Z. jujuba ( http://bio.njfu.edu.cn/gb2/gbrowse/Ziziphus_jujuba_cp/ ). Sequence analysis showed that this cp genome is 161,466 bp long and has a typical quadripartite structure of large (LSC, 89,120 bp) and small (SSC, 19,348 bp) single-copy regions separated by a pair of inverted repeats (IRs, 26,499 bp). The sequence contained 112 unique genes, including 78 protein-coding genes, 30 transfer RNAs, and four ribosomal RNAs. The genome structure, gene order, GC content, and codon usage are similar to other typical angiosperm cp genomes. A total of 38 tandem repeats, two forward repeats, and three palindromic repeats were detected in the Z. jujuba cp genome. Simple sequence repeat (SSR) analysis revealed that most SSRs were AT-rich. The homopolymer regions in the cp genome of Z. jujuba were verified and manually corrected by Sanger sequencing. One-third of mononucleotide repeats were found to be erroneously sequenced by the 454 pyrosequencing, which resulted in sequences of 1-4 bases shorter than that by the Sanger sequencing. Analyzing the cp genome of Z. jujuba revealed that the IR contraction and expansion events resulted in ycf1 and rps19 pseudogenes. A phylogenetic analysis based on 64 protein-coding genes showed that Z. jujuba was closely related to members of the Elaeagnaceae family, which will be helpful for phylogenetic studies of other Rosales species. The complete cp genome sequence of Z. jujuba will facilitate population, phylogenetic, and cp genetic engineering studies of this economic plant.

  2. [Complete genome sequencing of polymalic acid-producing strain Aureobasidium pullulans CCTCC M2012223].

    Science.gov (United States)

    Wang, Yongkang; Song, Xiaodan; Li, Xiaorong; Yang, Sang-tian; Zou, Xiang

    2017-01-04

    To explore the genome sequence of Aureobasidium pullulans CCTCC M2012223, analyze the key genes related to the biosynthesis of important metabolites, and provide genetic background for metabolic engineering. Complete genome of A. pullulans CCTCC M2012223 was sequenced by Illumina HiSeq high throughput sequencing platform. Then, fragment assembly, gene prediction, functional annotation, and GO/COG cluster were analyzed in comparison with those of other five A. pullulans varieties. The complete genome sequence of A. pullulans CCTCC M2012223 was 30756831 bp with an average GC content of 47.49%, and 9452 genes were successfully predicted. Genome-wide analysis showed that A. pullulans CCTCC M2012223 had the biggest genome assembly size. Protein sequences involved in the pullulan and polymalic acid pathway were highly conservative in all of six A. pullulans varieties. Although both A. pullulans CCTCC M2012223 and A. pullulans var. melanogenum have a close affinity, some point mutation and inserts were occurred in protein sequences involved in melanin biosynthesis. Genome information of A. pullulans CCTCC M2012223 was annotated and genes involved in melanin, pullulan and polymalic acid pathway were compared, which would provide a theoretical basis for genetic modification of metabolic pathway in A. pullulans.

  3. Complete Genome Sequence of Biocontroller Bacillus velezensis Strain JTYP2, Isolated from Leaves of Echeveria laui.

    Science.gov (United States)

    Wang, Beibei; Liu, Hu; Ma, Hailin; Wang, Chengqiang; Liu, Kai; Li, Yuhuan; Hou, Qihui; Ge, Ruofei; Zhang, Tongrui; Liu, Fangchun; Ma, Jinjin; Wang, Yun; Wang, Haide; Xu, Baochao; Yao, Gan; Xu, Wenfeng; Fan, Lingchao; Ding, Yanqin; Du, Binghai

    2017-06-15

    Bacillus velezensis JTYP2 was isolated from the leaves of Echeveria laui in Qingzhou, China, and may control some of the fungal pathogens of the plant. Here, we present the complete genome sequence of B. velezensis JTYP2. Several gene clusters related to its biosynthesis of antimicrobial compounds were predicted. Copyright © 2017 Wang et al.

  4. Complete Genome Sequence of Bacillus velezensis L-1, Which Has Antagonistic Activity against Pear Diseases

    OpenAIRE

    Sun, Pingping; Cui, Jianchao; Jia, Xiaohui; Wang, Wenhui

    2017-01-01

    ABSTRACT Bacillus velezensis L-1 is an effective biocontrol agent against pear diseases. Here, we report the complete genome sequence of B. velezensis L-1 in which clusters related to the biosynthesis of secondary metabolites were predicted. This genome provides insights into the possible biocontrol mechanisms and furthers application of this specific bacterium.

  5. Complete Genome Sequence of Bacillus velezensis L-1, Which Has Antagonistic Activity against Pear Diseases.

    Science.gov (United States)

    Sun, Pingping; Cui, Jianchao; Jia, Xiaohui; Wang, Wenhui

    2017-11-30

    Bacillus velezensis L-1 is an effective biocontrol agent against pear diseases. Here, we report the complete genome sequence of B. velezensis L-1 in which clusters related to the biosynthesis of secondary metabolites were predicted. This genome provides insights into the possible biocontrol mechanisms and furthers application of this specific bacterium. Copyright © 2017 Sun et al.

  6. Complete Genome Sequences of Two Escherichia coli O145:H28 Outbreak Strains of Food Origin

    OpenAIRE

    Cooper, Kerry K.; Mandrell, Robert E.; Louie, Jacqueline W.; Korlach, Jonas; Clark, Tyson A.; Parker, Craig T.; Huynh, Steven; Chain, Patrick S. G.; Ahmed, Sanaa; Carter, Michelle Qiu

    2014-01-01

    Escherichia coli O145:H28 strain RM12581 was isolated from bagged romaine lettuce during a 2010 U.S. lettuce-associated outbreak. E. coli O145:H28 strain RM12761 was isolated from ice cream during a 2007 ice cream-associated outbreak in Belgium. Here we report the complete genome sequences and annotation of both strains.

  7. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  8. Rickettsia asembonensis Characterization by Multilocus Sequence Typing of Complete Genes, Peru.

    Science.gov (United States)

    Loyola, Steev; Flores-Mendoza, Carmen; Torre, Armando; Kocher, Claudine; Melendrez, Melanie; Luce-Fedrow, Alison; Maina, Alice N; Richards, Allen L; Leguia, Mariana

    2018-05-01

    While studying rickettsial infections in Peru, we detected Rickettsia asembonensis in fleas from domestic animals. We characterized 5 complete genomic regions (17kDa, gltA, ompA, ompB, and sca4) and conducted multilocus sequence typing and phylogenetic analyses. The molecular isolate from Peru is distinct from the original R. asembonensis strain from Kenya.

  9. Complete Genome Sequence of the Novel Bacteriophage pSco-10 Infecting Staphylococcus cohnii.

    Science.gov (United States)

    Jun, Jin Woo; Giri, Sib Sankar; Kim, Hyoun Joong; Chi, Cheng; Yun, Saekil; Kim, Sang Guen; Kim, Sang Wha; Kang, Jeong Woo; Park, Se Chang

    2017-11-22

    Herein, we report the complete genome sequence of the Staphylococcus Myoviridae phage pSco-10 infecting Staphylococcus cohnii The phage pSco-10 was isolated from duck feces collected from four farms in South Korea. The current report provides valuable information for genomic study of phages. Copyright © 2017 Jun et al.

  10. Complete Genome Sequence of the Novel Bacteriophage pSco-10 Infecting Staphylococcus cohnii

    OpenAIRE

    Jun, Jin Woo; Giri, Sib Sankar; Kim, Hyoun Joong; Chi, Cheng; Yun, Saekil; Kim, Sang Guen; Kim, Sang Wha; Kang, Jeong Woo; Park, Se Chang

    2017-01-01

    ABSTRACT Herein, we report the complete genome sequence of the Staphylococcus Myoviridae phage pSco-10 infecting Staphylococcus cohnii. The phage pSco-10 was isolated from duck feces collected from four farms in South Korea. The current report provides valuable information for genomic study of phages.

  11. Identification and Complete Genome Sequence Analysis of a Genotype XIV Newcastle Disease Virus from Nigeria

    OpenAIRE

    Shittu, Ismaila; Sharma, Poonam; Volkening, Jeremy D.; Solomon, Ponman; Sulaiman, Lanre K.; Joannis, Tony M.; Williams-Coplin, Dawn; Miller, Patti J.; Dimitrov, Kiril M.; Afonso, Claudio L.

    2016-01-01

    The first complete genome sequence of a strain of Newcastle disease virus (NDV) from genotype XIV is reported here. Strain duck/Nigeria/NG-695/KG.LOM.11-16/2009 was isolated from an apparently healthy domestic duck from a live bird market in Kogi State, Nigeria, in 2009. This strain is classified as a member of subgenotype XIVb of class II.

  12. Complete genome sequence of the bioleaching bacterium Leptospirillum sp. group II strain CF-1.

    Science.gov (United States)

    Ferrer, Alonso; Bunk, Boyke; Spröer, Cathrin; Biedendieck, Rebekka; Valdés, Natalia; Jahn, Martina; Jahn, Dieter; Orellana, Omar; Levicán, Gloria

    2016-03-20

    We describe the complete genome sequence of Leptospirillum sp. group II strain CF-1, an acidophilic bioleaching bacterium isolated from an acid mine drainage (AMD). This work provides data to gain insights about adaptive response of Leptospirillum spp. to the extreme conditions of bioleaching environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Complete genome sequence of currant latent virus (genus Cheravirus, family Secoviridae)

    Czech Academy of Sciences Publication Activity Database

    Petrzik, Karel; Koloniuk, Igor; Přibylová, Jaroslava; Špak, Josef

    2016-01-01

    Roč. 161, č. 2 (2016), s. 491-493 ISSN 0304-8608 Institutional support: RVO:60077344 Keywords : Stranded-RNA * complete genome sequence * Currant latent virus Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016

  14. Complete Genome Sequence of the Anaerobic Halophilic Alkalithermophile Natranaerobius thermophilus JW/NM-WN-LFT

    Energy Technology Data Exchange (ETDEWEB)

    Mesbah, Noha [University of Georgia, Athens, GA; Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Han, James [U.S. Department of Energy, Joint Genome Institute; Larimer, Frank W [ORNL; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Wiegel, Juergen [University of Georgia, Athens, GA

    2011-01-01

    The genome of the anaerobic halophilic alkalithermophile Natranaerobius thermophiles consists of one chromosome and two plasmids.The present study is the first to report the completely sequenced genome of polyextremophile and the harboring genes harboring genes associated with roles in regulation of intracellular osmotic pressure, pH homeostasis, and thermophilic stability.

  15. Complete Genome Sequence of the Fruiting Myxobacterium Melittangium boletus DSM 14713.

    Science.gov (United States)

    Treuner-Lange, Anke; Bruckskotten, Marc; Rupp, Oliver; Goesmann, Alexander; Søgaard-Andersen, Lotte

    2017-11-09

    The formation of spore-filled fruiting bodies in response to starvation represents a hallmark of many members of the order Myxococcales Here, we present the complete 9.9-Mb genome of the fruiting type strain Melittangium boletus DSM 14713, the first member of this genus to have its genome sequenced. Copyright © 2017 Treuner-Lange et al.

  16. Complete coding sequence of Zika virus from Martinique outbreak in 2015

    Directory of Open Access Journals (Sweden)

    G. Piorkowski

    2016-05-01

    Full Text Available Zika virus is an Aedes-borne Flavivirus causing fever, arthralgia, myalgia rash, associated with Guillain–Barré syndrome and suspected to induce microcephaly in the fetus. We report here the complete coding sequence of the first characterized Caribbean Zika virus strain, isolated from a patient from Martinique in December, 2015.

  17. Complete Genome Sequence of an Atypical Dengue Virus Serotype 2 Lineage Isolated in Brazil

    Science.gov (United States)

    Salvador, Felipe Scassi; Amorim, Jaime Henrique; Alves, Rubens Prince Santos; Pereira, Sara A.; Ferreira, Luis Carlos Souza

    2015-01-01

    Here, we report the complete polyprotein sequence of a dengue virus 2 strain isolated in Brazil. This virus belongs to the American genotype and has the ability to cause neurovirulence in immunocompetent adult mice. The data presented here may help understand the genetic determinants responsible for neurovirulence. PMID:26184939

  18. Complete Genome Sequence of the Pigmented Streptococcus thermophilus Strain JIM8232

    Science.gov (United States)

    Delorme, Christine; Bartholini, Claire; Luraschi, Mélanie; Pons, Nicolas; Loux, Valentin; Almeida, Mathieu; Guédon, Eric; Gibrat, Jean-François; Renault, Pierre

    2011-01-01

    Streptococcus thermophilus is a dairy species commonly used in the manufacture of cheese and yogurt. Here, we report the complete sequence of S. thermophilus strain JIM8232, isolated from milk and which produces a yellow pigment, an atypical trait for this bacterium. PMID:21914889

  19. Complete DNA sequence of the linear mitochondrial genome of the pathogenic yeast Candida parapsilosis

    DEFF Research Database (Denmark)

    Nosek, J.; Novotna, M.; Hlavatovicova, Z.

    2004-01-01

    The complete sequence of the mitochondrial DNA of the opportunistic yeast pathogen Candida parapsilosis was determined. The mitochondrial genome is represented by linear DNA molecules terminating with tandem repeats of a 738-bp unit. The number of repeats varies, thus generating a population...

  20. Complete Genome Sequence of Methylobacterium populi P-1M, Isolated from Pink-Pigmented Household Biofilm

    OpenAIRE

    Morohoshi, Tomohiro; Ikeda, Tsukasa

    2016-01-01

    Methylobacterium populi P-1M is isolated from the pink-pigmented household biofilm. Here, we present the complete genome sequence of P-1M, consisting of one chromosome of 5,705,640?bp and five plasmids of 64,864?bp, 59,879?bp, 42,569?bp, 41,417?bp, and 29,506?bp.

  1. Complete Whole-Genome Sequence of Salmonella enterica subsp. enterica Serovar Java NCTC5706.

    Science.gov (United States)

    Fazal, Mohammed-Abbas; Alexander, Sarah; Burnett, Edward; Deheer-Graham, Ana; Oliver, Karen; Holroyd, Nancy; Parkhill, Julian; Russell, Julie E

    2016-11-03

    Salmonellae are a significant cause of morbidity and mortality globally. Here, we report the first complete genome sequence for Salmonella enterica subsp. enterica serovar Java strain NCTC5706. This strain is of historical significance, having been isolated in the pre-antibiotic era and was deposited into the National Collection of Type Cultures in 1939. © Crown copyright 2016.

  2. Complete Genome Sequences of Getah Virus Strains Isolated from Horses in 2016 in Japan.

    Science.gov (United States)

    Nemoto, Manabu; Bannai, Hiroshi; Ochi, Akihiro; Niwa, Hidekazu; Murakami, Satoshi; Tsujimura, Koji; Yamanaka, Takashi; Kokado, Hiroshi; Kondo, Takashi

    2017-08-03

    Getah virus is mosquito-borne and causes disease in horses and pigs. We sequenced and analyzed the complete genomes of three strains isolated from horses in Ibaraki Prefecture, eastern Japan, in 2016. They were almost identical to the genomes of strains recently isolated from horses, pigs, and mosquitoes in Japan. Copyright © 2017 Nemoto et al.

  3. Complete Genome Sequence of the Quality Control Strain Staphylococcus aureus subsp. aureus ATCC 25923.

    Science.gov (United States)

    Treangen, Todd J; Maybank, Rosslyn A; Enke, Sana; Friss, Mary Beth; Diviak, Lynn F; Karaolis, David K R; Koren, Sergey; Ondov, Brian; Phillippy, Adam M; Bergman, Nicholas H; Rosovitz, M J

    2014-11-06

    Staphylococcus aureus subsp. aureus ATCC 25923 is commonly used as a control strain for susceptibility testing to antibiotics and as a quality control strain for commercial products. We present the completed genome sequence for the strain, consisting of the chromosome and a 27.5-kb plasmid. Copyright © 2014 Treangen et al.

  4. Complete genome sequences of Escherichia coli strains 1303 and ECC-1470 isolated from bovine mastitis

    NARCIS (Netherlands)

    Leimbach, Andreas; Poehlein, Anja; Witten, Anika; Scheutz, Flemming; Schukken, Ynte|info:eu-repo/dai/nl/075051907; Daniel, Rolf; Dobrindt, Ulrich

    2016-01-01

    Escherichia coli is the leading causative agent of acute bovine mastitis. Here, we report the complete genome sequence of E. coli O70:H32 strain 1303, isolated from an acute case of bovine mastitis, and E. coli Ont:Hnt strain ECC-1470, isolated from a persistent infection.

  5. Complete genome sequence of thermophilic Bacillus smithii type strain DSM 4216T

    DEFF Research Database (Denmark)

    Bosma, Elleke Fenna; Koehorst, Jasper J.; van Hijum, Sacha A. F. T.

    2016-01-01

    determined the complete genomic sequence of the B. smithii type strain DSM 4216T, which consists of a 3,368,778 bp chromosome (GenBank accession number CP012024.1) and a 12,514 bp plasmid (GenBank accession number CP012025.1), together encoding 3880 genes. Genome annotation via RAST was complemented...

  6. Complete Genome Sequence of the Yogurt Isolate Lactobacillus delbrueckii subsp. bulgaricus ACA-DC 87.

    Science.gov (United States)

    Alexandraki, Voula; Kazou, Maria; Pot, Bruno; Tsakalidou, Effie; Papadimitriou, Konstantinos

    2017-08-24

    Lactobacillus delbrueckii subsp. bulgaricus is widely used in the production of yogurt and cheese. In this study, we present the complete genome sequence of L. delbrueckii subsp. bulgaricus ACA-DC 87 isolated from traditional Greek yogurt. Whole-genome analysis may reveal desirable technological traits of the strain for dairy fermentations. Copyright © 2017 Alexandraki et al.

  7. Complete Genome Sequence of Porcine Parvovirus N Strain Isolated from Guangxi, China

    OpenAIRE

    Su, Qian-Lian; Li, Bin; Zhao, Wu; Liang, Jia-Xing; He, Ying; Qin, Yi-Bin; Lu, Bing-Xia

    2015-01-01

    We report here the complete genomic sequence of the porcine parvovirus (PPV) N strain, isolated in 1989 from the viscera of a stillborn fetus farrowed by a gilt in Guangxi, southern China. Phylogenetic analyses suggest that the PPV-N strain is closely related to attenuated PPV NADL-2 strains. The PPV-N strain has good immunogenicity, genetic stability, and safety.

  8. Complete genome sequence of an attenuated Sparfloxacin-resistant Streptococcus agalactiae strain 138spar

    Science.gov (United States)

    The complete genome of a sparfloxacin-resistant Streptococcus agalactiae vaccine strain 138spar is 1,838,126 bp in size. The genome has 1892 coding sequences and 82 RNAs. The annotation of the genome is added by the NCBI Prokaryotic Genome Annotation Pipeline. The publishing of this genome will allo...

  9. Characterization of the first complete genome sequence of an Impatiens necrotic spot orthotospovirus isolate from the United States and worldwide phylogenetic analyses of INSV isolates.

    Science.gov (United States)

    Zhao, Kaixi; Margaria, Paolo; Rosa, Cristina

    2018-05-10

    Impatiens necrotic spot orthotospovirus (INSV) can impact economically important ornamental plants and vegetables worldwide. Characterization studies on INSV are limited. For most INSV isolates, there are no complete genome sequences available. This lack of genomic information has a negative impact on the understanding of the INSV genetic diversity and evolution. Here we report the first complete nucleotide sequence of a US INSV isolate. INSV-UP01 was isolated from an impatiens in Pennsylvania, US. RT-PCR was used to clone its full-length genome and Vector NTI to assemble overlapping sequences. Phylogenetic trees were constructed by using MEGA7 software to show the phylogenetic relationships with other available INSV sequences worldwide. This US isolate has genome and biological features classical of INSV species and clusters in the Western Hemisphere clade, but its origin appears to be recent. Furthermore, INSV-UP01 might have been involved in a recombination event with an Italian isolate belonging to the Asian clade. Our analyses support that INSV isolates infect a broad plant-host range they group by geographic origin and not by host, and are subjected to frequent recombination events. These results justify the need to generate and analyze complete genome sequences of orthotospoviruses in general and INSV in particular.

  10. The complete genome sequence of a south Indian isolate of Rice tungro spherical virus reveals evidence of genetic recombination between distinct isolates.

    Science.gov (United States)

    Sailaja, B; Anjum, Najreen; Patil, Yogesh K; Agarwal, Surekha; Malathi, P; Krishnaveni, D; Balachandran, S M; Viraktamath, B C; Mangrauthia, Satendra K

    2013-12-01

    In this study, complete genome of a south Indian isolate of Rice tungro spherical virus (RTSV) from Andhra Pradesh (AP) was sequenced, and the predicted amino acid sequence was analysed. The RTSV RNA genome consists of 12,171 nt without the poly(A) tail, encoding a putative typical polyprotein of 3,470 amino acids. Furthermore, cleavage sites and sequence motifs of the polyprotein were predicted. Multiple alignment with other RTSV isolates showed a nucleotide sequence identity of 95% to east Indian isolates and 90% to Philippines isolates. A phylogenetic tree based on complete genome sequence showed that Indian isolates clustered together, while Vt6 and PhilA isolates of Philippines formed two separate clusters. Twelve recombination events were detected in RNA genome of RTSV using the Recombination Detection Program version 3. Recombination analysis suggested significant role of 5' end and central region of genome in virus evolution. Further, AP and Odisha isolates appeared as important RTSV isolates involved in diversification of this virus in India through recombination phenomenon. The new addition of complete genome of first south Indian isolate provided an opportunity to establish the molecular evolution of RTSV through recombination analysis and phylogenetic relationship.

  11. Isolation and complete genome sequencing of Mimivirus bombay, a Giant Virus in sewage of Mumbai, India

    Directory of Open Access Journals (Sweden)

    Anirvan Chatterjee

    2016-09-01

    Full Text Available We report the isolation and complete genome sequencing of a new Mimiviridae family member, infecting Acanthamoeba castellanii, from sewage in Mumbai, India. The isolated virus has a particle size of about 435 nm and a 1,182,200-bp genome. A phylogeny based on the DNA polymerase sequence placed the isolate as a new member of the Mimiviridae family lineage A and was named as Mimivirus bombay. Extensive presence of Mimiviridae family members in different environmental niches, with remarkably similar genome size and genetic makeup, point towards an evolutionary advantage that needs to be further investigated. The complete genome sequence of Mimivirus bombay was deposited at GenBank/EMBL/DDBJ under the accession number KU761889.

  12. Next generation sequencing yields the complete mitochondrial genome of the largescale mullet, Liza macrolepis (Teleostei: Mugilidae).

    Science.gov (United States)

    Shen, Kang-Ning; Tsai, Shiou-Yi; Chen, Ching-Hung; Hsiao, Chung-Der; Durand, Jean-Dominique

    2016-11-01

    In this study, the complete mitogenome sequence of largescale mullet (Teleostei: Mugilidae) has been sequenced by the next-generation sequencing method. The assembled mitogenome, consisting of 16,832 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 transfer RNAs, two ribosomal RNAs genes, and a non-coding control region of D-loop. D-loop which has a length of 1094 bp is located between tRNA-Pro and tRNA-Phe. The overall base composition of largescale mullet is 27.8% for A, 30.1% for C, 16.2% for G, and 25.9% for T. The complete mitogenome may provide essential and important DNA molecular data for further phylogenetic and evolutionary analysis for Mugilidae.

  13. Next generation sequencing yields the complete mitochondrial genome of the Hornlip mullet Plicomugil labiosus (Teleostei: Mugilidae).

    Science.gov (United States)

    Shen, Kang-Ning; Chen, Ching-Hung; Hsiao, Chung-Der

    2016-05-01

    In this study, the complete mitogenome sequence of hornlip mullet Plicomugil labiosus (Teleostei: Mugilidae) has been sequenced by next-generation sequencing method. The assembled mitogenome, consisting of 16,829 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes and a non-coding control region of D-loop. D-loop contains 1057 bp length is located between tRNA-Pro and tRNA-Phe. The overall base composition of P. labiosus is 28.0% for A, 29.3% for C, 15.5% for G and 27.2% for T. The complete mitogenome may provide essential and important DNA molecular data for further population, phylogenetic and evolutionary analysis for Mugilidae.

  14. Complete genome sequence of Leptotrichia buccalis type strain (C-1013-bT)

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, Natalia; Gronow, Sabine; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice, Hope; Cheng, Jan-Fang; Saunders, Liz; Bruce, David; Goodwin, Lynne; Brettin, Thomas; Detter, John C.; Han, Cliff; Pitluck, Sam; Mikhailova, Natalia; Pati, Amrita; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chain, Patrick; Rohde, Christine; Goker, Markus; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter

    2009-05-20

    Leptotrichia buccalis (Robin 1853) Trevisan 1879 is the type species of the genus, and is of phylogenetic interest because of its isolated location in the sparsely populated and neither taxonomically nor genomically adequately accessed family 'Leptotrichiaceae' within the phylum 'Fusobacteria'. Species of Leptotrichia are large fusiform non-motile, non-sporulating rods, which often populate the human oral flora. L. buccalis is anaerobic to aerotolerant, and saccharolytic. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of the order 'Fusobacteriales' and no more than the second sequence from the phylum 'Fusobacteria'. The 2,465,610 bp long single replicon genome with its 2306 protein-coding and 61 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  15. Hepatitis E Virus in Cambodia: Prevalence among the General Population and Complete Genome Sequence of Genotype 4.

    Science.gov (United States)

    Yamada, Hiroko; Takahashi, Kazuaki; Lim, Olline; Svay, Somana; Chuon, Channarena; Hok, Sirany; Do, Son Huy; Fujimoto, Mayumi; Akita, Tomoyuki; Goto, Noboru; Katayama, Keiko; Arai, Masahiro; Tanaka, Junko

    2015-01-01

    Hepatitis E virus (HEV) is a growing public health problem in many countries. In this study, we investigated HEV seroprevalence among the general population in the Siem Reap province, Cambodia, and performed HEV genetic analysis with the aim to develop an HEV prevention strategy. This seroepidemiological cross-sectional study conducted from 2010 to 2014 included 868 participants from four different locations in Siem Reap province, Cambodia. They answered questionnaires and provided blood samples for the analysis of hepatitis virus infections. Among the participants (360 men and 508 women; age range, 7-90 years), the prevalence of anti-HEV IgG was 18.4% (95% confidence interval: 15.9-21.0); HEV RNA was detected in two participants (0.23%) and was classified as genotype 3 and 4. Full-length genome of the genotype 4 isolate, CVS-Sie10, was sequenced; it contained 7,222 nucleotides and three ORFs and demonstrated high sequence identity with the swine China isolates swGX40 (95.57%), SS19 (94.37%), and swDQ (91.94%). Multivariate logistic regression analysis revealed that men, elderly people, and house workers were risk groups significantly associated with the positivity for anti-HEV IgG. This is the first report on the detection of HEV genotype 4 in humans in Cambodia and on the complete genome sequence of HEV genotype 4 from this country. Our study demonstrates that new HEV infection cases occur frequently among the general population in Cambodia, and effective preventive measures are required.

  16. Hepatitis E Virus in Cambodia: Prevalence among the General Population and Complete Genome Sequence of Genotype 4.

    Directory of Open Access Journals (Sweden)

    Hiroko Yamada

    Full Text Available Hepatitis E virus (HEV is a growing public health problem in many countries. In this study, we investigated HEV seroprevalence among the general population in the Siem Reap province, Cambodia, and performed HEV genetic analysis with the aim to develop an HEV prevention strategy. This seroepidemiological cross-sectional study conducted from 2010 to 2014 included 868 participants from four different locations in Siem Reap province, Cambodia. They answered questionnaires and provided blood samples for the analysis of hepatitis virus infections. Among the participants (360 men and 508 women; age range, 7-90 years, the prevalence of anti-HEV IgG was 18.4% (95% confidence interval: 15.9-21.0; HEV RNA was detected in two participants (0.23% and was classified as genotype 3 and 4. Full-length genome of the genotype 4 isolate, CVS-Sie10, was sequenced; it contained 7,222 nucleotides and three ORFs and demonstrated high sequence identity with the swine China isolates swGX40 (95.57%, SS19 (94.37%, and swDQ (91.94%. Multivariate logistic regression analysis revealed that men, elderly people, and house workers were risk groups significantly associated with the positivity for anti-HEV IgG. This is the first report on the detection of HEV genotype 4 in humans in Cambodia and on the complete genome sequence of HEV genotype 4 from this country. Our study demonstrates that new HEV infection cases occur frequently among the general population in Cambodia, and effective preventive measures are required.

  17. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  18. Comparative analysis of complete chloroplast genome sequence and inversion variation in Lasthenia burkei (Madieae, Asteraceae).

    Science.gov (United States)

    Walker, Joseph F; Zanis, Michael J; Emery, Nancy C

    2014-04-01

    Complete chloroplast genome studies can help resolve relationships among large, complex plant lineages such as Asteraceae. We present the first whole plastome from the Madieae tribe and compare its sequence variation to other chloroplast genomes in Asteraceae. We used high throughput sequencing to obtain the Lasthenia burkei chloroplast genome. We compared sequence structure and rates of molecular evolution in the small single copy (SSC), large single copy (LSC), and inverted repeat (IR) regions to those for eight Asteraceae accessions and one Solanaceae accession. The chloroplast sequence of L. burkei is 150 746 bp and contains 81 unique protein coding genes and 4 coding ribosomal RNA sequences. We identified three major inversions in the L. burkei chloroplast, all of which have been found in other Asteraceae lineages, and a previously unreported inversion in Lactuca sativa. Regions flanking inversions contained tRNA sequences, but did not have particularly high G + C content. Substitution rates varied among the SSC, LSC, and IR regions, and rates of evolution within each region varied among species. Some observed differences in rates of molecular evolution may be explained by the relative proportion of coding to noncoding sequence within regions. Rates of molecular evolution vary substantially within and among chloroplast genomes, and major inversion events may be promoted by the presence of tRNAs. Collectively, these results provide insight into different mechanisms that may promote intramolecular recombination and the inversion of large genomic regions in the plastome.

  19. The complete genomic sequence of pepper yellow leaf curl virus (PYLCV and its implications for our understanding of evolution dynamics in the genus polerovirus.

    Directory of Open Access Journals (Sweden)

    Aviv Dombrovsky

    Full Text Available We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV. PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV (both poleroviruses. The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs, which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93% and to ORF5 of CABYV (87%. Both PYLCV and Pepper vein yellowing virus (PeVYV contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP, may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2 were identified between nucleotides 4,962 and 5,061 (ORF 5 and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3 with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s between poleroviruses co-infecting a common host(s, resulting in the emergence of PYLCV, a novel pathogen with a wider host range.

  20. The complete genomic sequence of pepper yellow leaf curl virus (PYLCV) and its implications for our understanding of evolution dynamics in the genus polerovirus.

    Science.gov (United States)

    Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel

    2013-01-01

    We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range.

  1. The complete chloroplast genome sequence of Dodonaea viscosa: comparative and phylogenetic analyses.

    Science.gov (United States)

    Saina, Josphat K; Gichira, Andrew W; Li, Zhi-Zhong; Hu, Guang-Wan; Wang, Qing-Feng; Liao, Kuo

    2018-02-01

    The plant chloroplast (cp) genome is a highly conserved structure which is beneficial for evolution and systematic research. Currently, numerous complete cp genome sequences have been reported due to high throughput sequencing technology. However, there is no complete chloroplast genome of genus Dodonaea that has been reported before. To better understand the molecular basis of Dodonaea viscosa chloroplast, we used Illumina sequencing technology to sequence its complete genome. The whole length of the cp genome is 159,375 base pairs (bp), with a pair of inverted repeats (IRs) of 27,099 bp separated by a large single copy (LSC) 87,204 bp, and small single copy (SSC) 17,972 bp. The annotation analysis revealed a total of 115 unique genes of which 81 were protein coding, 30 tRNA, and four ribosomal RNA genes. Comparative genome analysis with other closely related Sapindaceae members showed conserved gene order in the inverted and single copy regions. Phylogenetic analysis clustered D. viscosa with other species of Sapindaceae with strong bootstrap support. Finally, a total of 249 SSRs were detected. Moreover, a comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates in D. viscosa showed very low values. The availability of cp genome reported here provides a valuable genetic resource for comprehensive further studies in genetic variation, taxonomy and phylogenetic evolution of Sapindaceae family. In addition, SSR markers detected will be used in further phylogeographic and population structure studies of the species in this genus.

  2. Complete motif analysis of sequence requirements for translation initiation at non-AUG start codons.

    Science.gov (United States)

    Diaz de Arce, Alexander J; Noderer, William L; Wang, Clifford L

    2018-01-25

    The initiation of mRNA translation from start codons other than AUG was previously believed to be rare and of relatively low impact. More recently, evidence has suggested that as much as half of all translation initiation utilizes non-AUG start codons, codons that deviate from AUG by a single base. Furthermore, non-AUG start codons have been shown to be involved in regulation of expression and disease etiology. Yet the ability to gauge expression based on the sequence of a translation initiation site (start codon and its flanking bases) has been limited. Here we have performed a comprehensive analysis of translation initiation sites that utilize non-AUG start codons. By combining genetic-reporter, cell-sorting, and high-throughput sequencing technologies, we have analyzed the expression associated with all possible variants of the -4 to +4 positions of non-AUG translation initiation site motifs. This complete motif analysis revealed that 1) with the right sequence context, certain non-AUG start codons can generate expression comparable to that of AUG start codons, 2) sequence context affects each non-AUG start codon differently, and 3) initiation at non-AUG start codons is highly sensitive to changes in the flanking sequences. Complete motif analysis has the potential to be a key tool for experimental and diagnostic genomics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Genomic treasure troves: complete genome sequencing of herbarium and insect museum specimens.

    Science.gov (United States)

    Staats, Martijn; Erkens, Roy H J; van de Vossenberg, Bart; Wieringa, Jan J; Kraaijeveld, Ken; Stielow, Benjamin; Geml, József; Richardson, James E; Bakker, Freek T

    2013-01-01

    Unlocking the vast genomic diversity stored in natural history collections would create unprecedented opportunities for genome-scale evolutionary, phylogenetic, domestication and population genomic studies. Many researchers have been discouraged from using historical specimens in molecular studies because of both generally limited success of DNA extraction and the challenges associated with PCR-amplifying highly degraded DNA. In today's next-generation sequencing (NGS) world, opportunities and prospects for historical DNA have changed dramatically, as most NGS methods are actually designed for taking short fragmented DNA molecules as templates. Here we show that using a standard multiplex and paired-end Illumina sequencing approach, genome-scale sequence data can be generated reliably from dry-preserved plant, fungal and insect specimens collected up to 115 years ago, and with minimal destructive sampling. Using a reference-based assembly approach, we were able to produce the entire nuclear genome of a 43-year-old Arabidopsis thaliana (Brassicaceae) herbarium specimen with high and uniform sequence coverage. Nuclear genome sequences of three fungal specimens of 22-82 years of age (Agaricus bisporus, Laccaria bicolor, Pleurotus ostreatus) were generated with 81.4-97.9% exome coverage. Complete organellar genome sequences were assembled for all specimens. Using de novo assembly we retrieved between 16.2-71.0% of coding sequence regions, and hence remain somewhat cautious about prospects for de novo genome assembly from historical specimens. Non-target sequence contaminations were observed in 2 of our insect museum specimens. We anticipate that future museum genomics projects will perhaps not generate entire genome sequences in all cases (our specimens contained relatively small and low-complexity genomes), but at least generating vital comparative genomic data for testing (phylo)genetic, demographic and genetic hypotheses, that become increasingly more horizontal

  4. The complete mitochondrial genome sequence of the Tibetan red fox (Vulpes vulpes montana).

    Science.gov (United States)

    Zhang, Jin; Zhang, Honghai; Zhao, Chao; Chen, Lei; Sha, Weilai; Liu, Guangshuai

    2015-01-01

    In this study, the complete mitochondrial genome of the Tibetan red fox (Vulpes Vulpes montana) was sequenced for the first time using blood samples obtained from a wild female red fox captured from Lhasa in Tibet, China. Qinghai--Tibet Plateau is the highest plateau in the world with an average elevation above 3500 m. Sequence analysis showed it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region (CR). The variable tandem repeats in CR is the main reason of the length variability of mitochondrial genome among canide animals.

  5. Complete mitochondrial genome sequence of the common bean anthracnose pathogen Colletotrichum lindemuthianum.

    Science.gov (United States)

    Gutiérrez, Pablo; Alzate, Juan; Yepes, Mauricio Salazar; Marín, Mauricio

    2016-01-01

    Colletotrichum lindemuthianum is the causal agent of anthracnose in common bean (Phaseolus vulgaris), one of the most limiting factors for this crop in South and Central America. In this work, the mitochondrial sequence of a Colombian isolate of C. lindemuthianum obtained from a common bean plant (var. Cargamanto) with anthracnose symptoms is presented. The mtDNA codes for 13 proteins of the respiratory chain, 1 ribosomal protein, 2 homing endonucleases, 2 ribosomal RNAs and 28 tRNAs. This is the first report of a complete mtDNA genome sequence from C. lindemuthianum.

  6. The First Complete Mitochondrial Genome Sequences for Stomatopod Crustaceans: Implications for Phylogeny

    Energy Technology Data Exchange (ETDEWEB)

    Swinstrom, Kirsten; Caldwell, Roy; Fourcade, H. Matthew; Boore, Jeffrey L.

    2005-09-07

    We report the first complete mitochondrial genome sequences of stomatopods and compare their features to each other and to those of other crustaceans. Phylogenetic analyses of the concatenated mitochondrial protein-coding sequences were used to explore relationships within the Stomatopoda, within the malacostracan crustaceans, and among crustaceans and insects. Although these analyses support the monophyly of both Malacostraca and, within it, Stomatopoda, it also confirms the view of a paraphyletic Crustacea, with Malacostraca being more closely related to insects than to the branchiopod crustaceans.

  7. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    OpenAIRE

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.; Navas-Castillo, Jesús

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV).

  8. Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado

    Science.gov (United States)

    Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.

    2012-01-01

    A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720

  9. Complete genome sequence of the plant-associated Serratia plymuthica strain AS13

    Energy Technology Data Exchange (ETDEWEB)

    Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Finlay, Roger D. [Uppsala University, Uppsala, Sweden; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Held, Brittany [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J C [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Hauser, Loren John [ORNL; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Hogberg, Nils [Uppsala University, Uppsala, Sweden

    2012-01-01

    Serratia plymuthica AS13 is a plant-associated Gammaproteobacteria, isolated from rapeseed roots. It is of special interest because of its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The complete genome of S. plymuthica AS13 consists of a 5,442,549 bp circular chromosome. The chromosome contains 4,951 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome was sequenced as part of the project enti- tled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens within the 2010 DOE-JGI Community Sequencing Program (CSP2010).

  10. Complete Genome Sequence of Sporisorium scitamineum and Biotrophic Interaction Transcriptome with Sugarcane.

    Directory of Open Access Journals (Sweden)

    Lucas M Taniguti

    Full Text Available Sporisorium scitamineum is a biotrophic fungus responsible for the sugarcane smut, a worldwide spread disease. This study provides the complete sequence of individual chromosomes of S. scitamineum from telomere to telomere achieved by a combination of PacBio long reads and Illumina short reads sequence data, as well as a draft sequence of a second fungal strain. Comparative analysis to previous available sequences of another strain detected few polymorphisms among the three genomes. The novel complete sequence described herein allowed us to identify and annotate extended subtelomeric regions, repetitive elements and the mitochondrial DNA sequence. The genome comprises 19,979,571 bases, 6,677 genes encoding proteins, 111 tRNAs and 3 assembled copies of rDNA, out of our estimated number of copies as 130. Chromosomal reorganizations were detected when comparing to sequences of S. reilianum, the closest smut relative, potentially influenced by repeats of transposable elements. Repetitive elements may have also directed the linkage of the two mating-type loci. The fungal transcriptome profiling from in vitro and from interaction with sugarcane at two time points (early infection and whip emergence revealed that 13.5% of the genes were differentially expressed in planta and particular to each developmental stage. Among them are plant cell wall degrading enzymes, proteases, lipases, chitin modification and lignin degradation enzymes, sugar transporters and transcriptional factors. The fungus also modulates transcription of genes related to surviving against reactive oxygen species and other toxic metabolites produced by the plant. Previously described effectors in smut/plant interactions were detected but some new candidates are proposed. Ten genomic islands harboring some of the candidate genes unique to S. scitamineum were expressed only in planta. RNAseq data was also used to reassure gene predictions.

  11. A complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus: an evolutionary history of camelidae

    Directory of Open Access Journals (Sweden)

    Meng He

    2007-07-01

    Full Text Available Abstract Background The family Camelidae that evolved in North America during the Eocene survived with two distinct tribes, Camelini and Lamini. To investigate the evolutionary relationship between them and to further understand the evolutionary history of this family, we determined the complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus, the only wild survivor of the Old World camel. Results The mitochondrial genome sequence (16,680 bp from C. bactrianus ferus contains 13 protein-coding, two rRNA, and 22 tRNA genes as well as a typical control region; this basic structure is shared by all metazoan mitochondrial genomes. Its protein-coding region exhibits codon usage common to all mammals and possesses the three cryptic stop codons shared by all vertebrates. C. bactrianus ferus together with the rest of mammalian species do not share a triplet nucleotide insertion (GCC that encodes a proline residue found only in the nd1 gene of the New World camelid Lama pacos. This lineage-specific insertion in the L. pacos mtDNA occurred after the split between the Old and New World camelids suggests that it may have functional implication since a proline insertion in a protein backbone usually alters protein conformation significantly, and nd1 gene has not been seen as polymorphic as the rest of ND family genes among camelids. Our phylogenetic study based on complete mitochondrial genomes excluding the control region suggested that the divergence of the two tribes may occur in the early Miocene; it is much earlier than what was deduced from the fossil record (11 million years. An evolutionary history reconstructed for the family Camelidae based on cytb sequences suggested that the split of bactrian camel and dromedary may have occurred in North America before the tribe Camelini migrated from North America to Asia. Conclusion Molecular clock analysis of complete mitochondrial genomes from C. bactrianus ferus and L

  12. The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

    International Nuclear Information System (INIS)

    Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

    1985-01-01

    The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

  13. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  14. Analysis of five complete genome sequences for members of the class Peribacteria in the recently recognized Peregrinibacteria bacterial phylum

    Directory of Open Access Journals (Sweden)

    Karthik Anantharaman

    2016-01-01

    Full Text Available Five closely related populations of bacteria from the Candidate Phylum (CP Peregrinibacteria, part of the bacterial Candidate Phyla Radiation (CPR, were sampled from filtered groundwater obtained from an aquifer adjacent to the Colorado River near the town of Rifle, CO, USA. Here, we present the first complete genome sequences for organisms from this phylum. These bacteria have small genomes and, unlike most organisms from other lineages in the CPR, have the capacity for nucleotide synthesis. They invest significantly in biosynthesis of cell wall and cell envelope components, including peptidoglycan, isoprenoids via the mevalonate pathway, and a variety of amino sugars including perosamine and rhamnose. The genomes encode an intriguing set of large extracellular proteins, some of which are very cysteine-rich and may function in attachment, possibly to other cells. Strain variation in these proteins is an important source of genotypic variety. Overall, the cell envelope features, combined with the lack of biosynthesis capacities for many required cofactors, fatty acids, and most amino acids point to a symbiotic lifestyle. Phylogenetic analyses indicate that these bacteria likely represent a new class within the Peregrinibacteria phylum, although they ultimately may be recognized as members of a separate phylum. We propose the provisional taxonomic assignment as ‘Candidatus Peribacter riflensis’, Genus Peribacter, Family Peribacteraceae, Order Peribacterales, Class Peribacteria in the phylum Peregrinibacteria.

  15. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  16. Complete genome sequence of Beutenbergia cavernae type strain (HKI 0122T)

    Energy Technology Data Exchange (ETDEWEB)

    Land, Miriam; Pukall, Rudiger; Abt, Birte; Goker, Markus; Rohde, Manfred; Glavina Del Rio, Tijana; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Nolan, Matt; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Saunders, Elizabeth; Brettin, Thomas; Detter, John C.; Han, Cliff; Chain, Patrick; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Lapidus, Alla

    2009-05-20

    Beutenbergia cavernae (Groth et al. 1999) is the type species of the genus and is of phylogenetic interest because of its isolated location in the actinobacterial suborder Micrococcineae. B. cavernae HKI 0122T is a Gram-positive, non-motile, non-spore-forming bacterium isolated from a cave in Guangxi (China). B. cavernae grows best under aerobic conditions and shows a rod-coccus growth cycle. Its cell wall peptidoglycan contains the diagnostic L-lysine - L-glutamate interpeptide bridge. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first completed genome sequence from the poorly populated micrococcineal family Beutenbergiaceae, and this 4,669,183 bp long single replicon genome with its 4225 protein-coding and 53 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  17. Complete genome sequence of Cryptobacterium curtum type strain (12-3T)

    Energy Technology Data Exchange (ETDEWEB)

    Mavromatis, Konstantinos; Pukall, Rudiger; Rohde, Christine; Sims, David; Brettin, Thomas; Kuske, Cheryl; Detter, John C.; Han, Cliff; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ovchinnikova, Galina; Pati, Amrita; Ivanova, Natalia; Chen, Amy; Palaniappan, Krishna; Chain, Patrick; D' haeseleer, Patrik; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Rohde, Manfred; Klenk, Hans-Peter; Kyrpides, Nikos C.

    2009-05-20

    Cryptobacterium curtum Nakazawa et al. 1999 is the type species of the genus, and is of phylogenetic interest because of its very distant and isolated position within the family Coriobacteriaceae. C. curtum is an asaccharolytic, opportunistic pathogen with a typical occurrence in the oral cavity, involved in dental and oral infections like periodontitis, inflammations and abscesses. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the actinobacterial family Coriobacteriaceae, and this 1,617,804 bp long single replicon genome with its 1364 protein-coding and 58 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  18. Complete genome sequence of Pedobacter heparinus type strain (HIM 762-3T)

    Energy Technology Data Exchange (ETDEWEB)

    Han, Cliff; Spring, Stefan; Lapidus, Alla; Glavina Del Rio, Tijana; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Nolan, Matt; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Saunders, Elizabeth; Chertkov, Olga; Brettin, Thomas; Goker, Markus; Rohde, Manfred; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Detter, John C.

    2009-05-20

    Pedobacter heparinus (Payza and Korn 1956) Steyn et al. 1998 comb. nov. is the type species of the rapidly growing genus Pedobacter within the family Sphingobacteriaceae of the phylum 'Bacteroidetes'. P. heparinus is of interest, because it was the first isolated strain shown to grow with heparin as sole carbon and nitrogen source and because it produces several enzymes involved in the degradation of mucopolysaccharides. All available data about this species are based on a sole strain that was isolated from dry soil. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first report on a complete genome sequence of a member of the genus Pedobacter, and the 5,167,383 bp long single replicon genome with its 4287 protein-coding and 54 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  19. Complete genome sequence of Saccharomonospora viridis type strain (P101T)

    Energy Technology Data Exchange (ETDEWEB)

    Pati, Amrita; Sikorski, Johannes; Nolan, Matt; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Lucas, Susan; Chen, Feng; Tice, Hope; Pitluck, Sam; Cheng, Jan-Fang; Chertkov, Olga; Brettin, Thomas; Han, Cliff; Detter, John C.; Kuske, Cheryl; Bruce, David; Goodwin, Lynne; Chain, Patrick; D' haeseleer, Patrik; Chen, Amy; Palaniappan, Krishna; Ivanova, Natalia; Mavromatis, Konstantinos; Mikhailova, Natalia; Rohde, Manfred; Tindall, Brian J.; Goker, Markus; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides1, Nikos C.; Klenk, Hans-Peter

    2009-05-20

    Saccharomonospora viridis (Schuurmans et al. 1956) Nonomurea and Ohara 1971 is the type species of the genus Saccharomonospora which belongs to the family Pseudonocardiaceae. S. viridis is of interest because it is a Gram-negative organism classified amongst the usually Gram-positive actinomycetes. Members of the species are frequently found in hot compost and hay, and its spores can cause farmer?s lung disease, bagassosis, and humidifier fever. Strains of the species S. viridis have been found to metabolize the xenobiotic pentachlorophenol (PCP). The strain described in this study has been isolated from peat-bog in Ireland. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the family Pseudonocardiaceae, and the 4,308,349 bp long single replicon genome with its 3906 protein-coding and 64 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  20. Complete genome sequence of Dyadobacter fermentans type strain (NS114T)

    Energy Technology Data Exchange (ETDEWEB)

    Lang, Elke; Lapidus, Alla; Chertkov, Olga; Brettin, Thomas; Detter, John C.; Han, Cliff; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ovchinnikova, Galina; Pati, Amrita; Ivanova, Natalia; Mavromatis, Konstantinos; Chen, Amy; Chain, Patrick; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Goker, Markus; Rohde, Manfred; Kyrpides, Nikos C; Klenk, Hans-Peter

    2009-05-20

    Dyadobacter fermentans (Chelius MK and Triplett EW, 2000) is the type species of the genus Dyadobacter. It is of phylogenetic interest because of its location in the Cytophagaceae, a very diverse family within the order 'Sphingobacteriales'. D. fermentans has a mainly respiratory metabolism, stains Gram-negative, is non-motile and oxidase and catalase positive. It is characterized by the production of cell filaments in ageing cultures, a flexirubin-like pigment and its ability to ferment glucose, which is almost unique in the aerobically living members of this taxonomically difficult family. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the 'sphingobacterial' genus Dyadobacter, and this 6,967,790 bp long single replicon genome with its 5804 protein-coding and 50 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  1. Complete genome sequence of Catenulispora acidiphila type strain (ID 139908T)

    Energy Technology Data Exchange (ETDEWEB)

    Copeland, Alex; Lapidus, Alla; Rio, Tijana GlavinaDel; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Mikhailova, Natalia; Pati, Amrita; Ivanova, Natalia; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Chain, Patrick; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chertkov, Olga; Brettin, Thomas; Detter, John C.; Han, Cliff; Ali, Zahid; Tindall, Brian J.; Goker, Markus; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter

    2009-05-20

    Catenulispora acidiphila Busti et al. 2006 is the type species of the genus Catenulispora, and is of interest because of the rather isolated phylogenetic location of the genomically little studied suborder Catenulisporineae within the order Actinomycetales. C. acidiphilia is known for its acidophilic, aerobic lifestyle, but can also grow scantly under anaerobic conditions. Under regular conditions C. acidiphilia grows in long filaments of relatively short aerial hyphae with marked septation. It is a free living, non motile, Gram-positive bacterium isolated from a forest soil sample taken from a wooded area in Gerenzano, Italy. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of the actinobacterial family Catenulisporaceae, and the 10,467,782 bp long single replicon genome with its 9056 protein-coding and 69 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  2. Complete genome sequence of Brachybacterium faecium type strain (Schefferle 6-10T)

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla; Pukall, Rudiger; LaButti, Kurt; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Rohde, Manfred; Goker, Markus; Pati, Amrita; Ivanova, Natalia; Mavrommatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; D' haeseleer, Patrik; Chain, Patrick; Bristow, Jim; Eisen, Johnathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter

    2009-05-20

    Brachybacterium faecium Collins et al. 1988 is the type species of the genus, and is of phylogenetic interest because of its location in the Dermabacteraceae, a rather isolated family within the actinobacterial suborder Micrococcineae. B. faecium is known for its rod-coccus growth cycle and the ability to degrade uric acid. It grows aerobically or weakly anaerobically. The strain described in this report is a free-living, nonmotile, Gram-positive bacterium, originally isolated from poultry deep litter. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the actinobacterial family Dermabacteraceae, and the 3,614,992 bp long single replicon genome with its 3129 protein-coding and 69 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  3. Complete genome sequence of Desulfohalobium retbaense type strain (HR100T)

    Energy Technology Data Exchange (ETDEWEB)

    Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Chen, Feng [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Munk, Christine [U.S. Department of Energy, Joint Genome Institute; Kiss, Hajnalka [Los Alamos National Laboratory (LANL); Chain, Patrick S. G. [Lawrence Livermore National Laboratory (LLNL); Han, Cliff [Los Alamos National Laboratory (LANL); Brettin, Thomas S [ORNL; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Schuler, Esther [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2010-01-01

    Desulfohalobium retbaense (Ollivier et al. 1991) is the type species of the polyphyletic genus Desulfohalobium, which comprises, at the time of writing, two species and represents the family Desulfohalobiaceae within the Deltaproteobacteria. D. retbaense is a moderately halophilic sulfate-reducing bacterium, which can utilize H2 and a limited range of organic substrates, which are incompletely oxidized to acetate and CO2, for growth. The type strain HR100T was isolated from sediments of the hypersaline Retba Lake in Senegal. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of a member of the family Desulfohalobiaceae. The 2,909,567 bp genome (one chromosome and a 45,263 bp plasmid) with its 2,552 protein-coding and 57 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  4. Complete genome sequence of Haliangium ochraceum type strain (SMP-2T)

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Daum, Chris [U.S. Department of Energy, Joint Genome Institute; Lang, Elke [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Abt, Birte [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kopitz, marcus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Chen, Feng [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Brettin, Thomas S [ORNL; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2010-01-01

    Haliangium ochraceum Fudou et al. 2002 is the type species of the genus Haliangium in the myxococcal family Haliangiaceae . Members of the genus Haliangium are the first halophilic myxobacterial taxa described. The cells of the species follow a multicellular lifestyle in highly organized biofilms, called swarms, they decompose bacterial and yeast cells as most myxobacteria do. The fruiting bodies contain particularly small coccoid myxospores. H. ochraceum encodes the first actin homologue identified in a bacterial genome. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the myxococcal suborder Nannocystineae, and the 9,446,314 bp long single replicon genome with its 6,898 protein-coding and 53 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.

  5. Complete genome sequence of Isosphaera pallida type strain (IS1BT)

    Energy Technology Data Exchange (ETDEWEB)

    Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Cleland, David M [ORNL; Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Hammon, Nancy [Joint Genome Institute, Walnut Creek, California; Deshpande, Shweta [Joint Genome Institute, Walnut Creek, California; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [Joint Genome Institute, Walnut Creek, California; Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Pagani, Ioanna [Joint Genome Institute, Walnut Creek, California; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Detter, J. Chris [Joint Genome Institute, Walnut Creek, California; Beck, Brian [ATCC - American Type Culture Collection; Woyke, Tanja [Joint Genome Institute, Walnut Creek, California; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [Joint Genome Institute, Walnut Creek, California; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2011-01-01

    Isosphaera pallida (ex Woronichin 1927) Giovannoni et al. 1995 is the type species of the genus Isosphaera. The species is of interest because it was the first heterotrophic bacterium known to be phototactic, and it occupies an isolated phylogenetic position within the Planctomycetaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of a member of the genus Isosphaera and the third of a member of the family Planctomycetaceae. The 5,472,964 bp long chromosome and the 56,340 bp long plasmid with a total of 3,763 protein-coding and 60 RNA genes are part of the Genomic Encyclopedia of Bacteria and Archaea project.

  6. Complete genome sequence of Mahella australiensis type strain (50-1 BONT)

    Energy Technology Data Exchange (ETDEWEB)

    Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Teshima, Hazuki [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Ngatchou, Olivier Duplex [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Pukall, Rudiger [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Abt, Birte [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute

    2011-01-01

    Mahella australiensis Bonilla Salinas et al. 2004 is the type species of the genus Mahella, which belongs to the family Thermoanaerobacteraceae. The species is of interest because it differs from other known anaerobic spore-forming bacteria in its G+C content, and in certain phenotypic traits, such as carbon source utilization and relationship to temperature. Moreo- ver, it has been discussed that this species might be an indigenous member of petroleum and oil reservoirs. This is the first completed genome sequence of a member of the genus Mahella and the ninth completed type strain genome sequence from the family Thermoanaerobacte- raceae. The 3,135,972 bp long genome with its 2,974 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  7. Complete mitochondrial genome sequence of the hedgehog seahorse Hippocampus spinosissimus Weber, 1933 (Gasterosteiformes:Syngnathidae).

    Science.gov (United States)

    Liu, Shuaishuai; Zhang, Yanhong; Wang, Changming; Lin, Qiang

    2016-07-01

    The complete mitochondrial genome sequence of the hedgehog seahorse Hippocampus spinosissimus was first determined in this article. The total length of H. spinosissimus mitogenome is 16 527 bp and consists of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region. The gene order and composition of H. spinosissimus were similar to those of most other vertebrates. The overall base composition of H. spinosissimus is 32.1% A, 30.3% T, 14.9% G and 22.7% C, with a slight A + T-rich feature (62.4%). Phylogenetic analyses based on complete mitochondrial genome sequence showed that H. spinosissimus has a close genetic relationship to H. ingens and H. kuda.

  8. Complete genome sequence of Coraliomargarita akajimensis type strain (04OKA010-24T)

    Energy Technology Data Exchange (ETDEWEB)

    Mavromatis, Konstantinos; Abt, Birte; Brambilla, Evelyne; Lapidus, Alla; Copeland, Alex; Desphande, Shweta; Nolan, Matt; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Han, Cliff; Detter, John C.; Woyke, Tanja; Goodwin, Lynne; Pitluck, Sam; Held, Brittany; Brettin, Thomas; Tapia, Roxanne; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Liolios, Konstantinos; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D.; Rohde, Manfred; G& #246; ker, Markus; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C.

    2010-06-25

    Coraliomargarita akajimensis Yoon et al. 2007 the type species of the genus Coraliomargarita. C. akajimensis is an obligately aerobic, Gram-negative, non-spore-forming, non-motile, spherical bacterium which was isolated from seawater surrounding the hard coral Galaxea fascicularis. C. akajimensis organism is of special interest because of its phylogenetic position in a genomically purely studied area in the bacterial diversity. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the family Puniceicoccaceae. The 3,750,771 bp long genome with its 3,137 protein-coding and 55 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  9. Complete genome sequence of Marivirga tractuosa type strain (H-43T)

    Science.gov (United States)

    Pagani, Ioanna; Chertkov, Olga; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Nolan, Matt; Saunders, Elizabeth; Pitluck, Sam; Held, Brittany; Goodwin, Lynne; Liolios, Konstantinos; Ovchinikova, Galina; Ivanova, Natalia; Mavromatis, Konstantinos; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Jeffries, Cynthia D.; Detter, John C.; Han, Cliff; Tapia, Roxanne; Ngatchou-Djao, Olivier D.; Rohde, Manfred; Göker, Markus; Spring, Stefan; Sikorski, Johannes; Woyke, Tanja; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C.

    2011-01-01

    Marivirga tractuosa (Lewin 1969) Nedashkovskaya et al. 2010 is the type species of the genus Marivirga, which belongs to the family Flammeovirgaceae. Members of this genus are of interest because of their gliding motility. The species is of interest because representative strains show resistance to several antibiotics, including gentamicin, kanamycin, neomycin, polymixin and streptomycin. This is the first complete genome sequence of a member of the family Flammeovirgaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,511,574 bp long chromosome and the 4,916 bp plasmid with their 3,808 protein-coding and 49 RNA genes are a part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:21677852

  10. Complete sequence and comparative analysis of the chloroplast genome of coconut palm (Cocos nucifera).

    Science.gov (United States)

    Huang, Ya-Yi; Matzke, Antonius J M; Matzke, Marjori

    2013-01-01

    Coconut, a member of the palm family (Arecaceae), is one of the most economically important trees used by mankind. Despite its diverse morphology, coconut is recognized taxonomically as only a single species (Cocos nucifera L.). There are two major coconut varieties, tall and dwarf, the latter of which displays traits resulting from selection by humans. We report here the complete chloroplast (cp) genome of a dwarf coconut plant, and describe the gene content and organization, inverted repeat fluctuations, repeated sequence structure, and occurrence of RNA editing. Phylogenetic relationships of monocots were inferred based on 47 chloroplast protein-coding genes. Potential nodes for events of gene duplication and pseudogenization related to inverted repeat fluctuation were mapped onto the tree using parsimony criteria. We compare our findings with those from other palm species for which complete cp genome sequences are available.

  11. Complete mitogenomic sequence of the Critically Endangered Northern River Shark Glyphis garricki (Carcharhiniformes: Carcharhinidae).

    Science.gov (United States)

    Feutry, Pierre; Grewe, Peter M; Kyne, Peter M; Chen, Xiao

    2015-01-01

    In this study we describe the first complete mitochondrial sequence for the Critically Endangered Northern River shark Glyphis garricki. The complete mitochondrial sequence is 16,702 bp in length, contains 37 genes and one control region with the typical gene order and transcriptional direction of vertebrate mitogenomes. The overall base composition is 31.5% A, 26.3% C, 12.9% G and 29.3% T. The length of 22 tRNA genes ranged from 68 (tRNA-Ser2 and tRNA-Cys) to 75 (tRNA-Leu1) bp. The control region of G. garricki was 1067 bp in length with high A+T (67.9%) and poor G (12.6%) content. The mitogenomic characters (base composition, codon usage and gene length) of G. garricki were very similar to Glyphis glyphis.

  12. Complete Genome Sequence of the Endophytic Biocontrol Strain Bacillus velezensis CC09

    OpenAIRE

    Cai, Xunchao; Kang, Xingxing; Xi, Huan; Liu, Changhong; Xue, Yarong

    2016-01-01

    Bacillus velezensis is a heterotypic synonym of B. methylotrophicus, B. amyloliquefaciens subsp. plantarum, and Bacillus oryzicola, and has been used to control plant fungal diseases. In order to fully understand the genetic basis of antimicrobial capacities, we did a complete genome sequencing of the endophytic B.?velezensis strain CC09. Genes tightly associated with biocontrol ability, including nonribosomal peptide synthetases, polyketide synthetases, iron acquisition, colonization, and vo...

  13. Complete Genome Sequence of the Endophytic Biocontrol Strain Bacillus velezensis CC09.

    Science.gov (United States)

    Cai, Xunchao; Kang, Xingxing; Xi, Huan; Liu, Changhong; Xue, Yarong

    2016-09-29

    Bacillus velezensis is a heterotypic synonym of B. methylotrophicus, B. amyloliquefaciens subsp. plantarum, and Bacillus oryzicola, and has been used to control plant fungal diseases. In order to fully understand the genetic basis of antimicrobial capacities, we did a complete genome sequencing of the endophytic B. velezensis strain CC09. Genes tightly associated with biocontrol ability, including nonribosomal peptide synthetases, polyketide synthetases, iron acquisition, colonization, and volatile organic compound synthesis were identified in the genome. Copyright © 2016 Cai et al.

  14. Complete Genome Sequence of an Avian Paramyxovirus Representative of Putative New Serotype 13

    OpenAIRE

    Goraichuk, Iryna; Sharma, Poonam; Stegniy, Borys; Muzyka, Denys; Pantin-Jackwood, Mary J.; Gerilovych, Anton; Solodiankin, Olexii; Bolotin, Vitaliy; Miller, Patti J.; Dimitrov, Kiril M.; Afonso, Claudio L.

    2016-01-01

    Here, we report the complete genome sequence of a virus of a putative new serotype of avian paramyxovirus (APMV). The virus was isolated from a white-fronted goose in Ukraine in 2011 and designated white-fronted goose/Ukraine/Askania-Nova/48-15-02/2011. The genomic characterization of the isolate suggests that it represents the novel avian paramyxovirus group APMV 13.

  15. Complete Genome Sequence of an Avian Paramyxovirus Representative of Putative New Serotype 13

    Science.gov (United States)

    Goraichuk, Iryna; Sharma, Poonam; Stegniy, Borys; Muzyka, Denys; Pantin-Jackwood, Mary J.; Gerilovych, Anton; Solodiankin, Olexii; Bolotin, Vitaliy; Miller, Patti J.; Dimitrov, Kiril M.

    2016-01-01

    Here, we report the complete genome sequence of a virus of a putative new serotype of avian paramyxovirus (APMV). The virus was isolated from a white-fronted goose in Ukraine in 2011 and designated white-fronted goose/Ukraine/Askania-Nova/48-15-02/2011. The genomic characterization of the isolate suggests that it represents the novel avian paramyxovirus group APMV 13. PMID:27469958

  16. Identification and Complete Genome Sequence Analysis of a Genotype XIV Newcastle Disease Virus from Nigeria

    Science.gov (United States)

    Shittu, Ismaila; Sharma, Poonam; Volkening, Jeremy D.; Solomon, Ponman; Sulaiman, Lanre K.; Joannis, Tony M.; Williams-Coplin, Dawn; Miller, Patti J.; Dimitrov, Kiril M.

    2016-01-01

    The first complete genome sequence of a strain of Newcastle disease virus (NDV) from genotype XIV is reported here. Strain duck/Nigeria/NG-695/KG.LOM.11-16/2009 was isolated from an apparently healthy domestic duck from a live bird market in Kogi State, Nigeria, in 2009. This strain is classified as a member of subgenotype XIVb of class II. PMID:26823576

  17. Complete genome sequence of Bacillus subtilis BSD-2, a microbial germicide isolated from cultivated cotton.

    Science.gov (United States)

    Liu, Hongwei; Yin, Shuli; An, Likang; Zhang, Genwei; Cheng, Huicai; Xi, Yanhua; Cui, Guanhui; Zhang, Feiyan; Zhang, Liping

    2016-07-20

    Bacillus subtilis BSD-2, isolated from cotton (Gossypium spp.), had strong antagonistic activity to Verticillium dahlia Kleb and Botrytis cinerea. We sequenced and annotated the BSD-2 complete genome to help us the better use of this strain, which has surfactin, bacilysin, bacillibactin, subtilosin A, Tas A and a potential class IV lanthipeptide biosynthetic pathways. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Complete Genome Sequence of a Newcastle Disease Virus Isolated from Wild Peacock (Pavo cristatus) in India.

    Science.gov (United States)

    Khulape, Sagar A; Gaikwad, Satish S; Chellappa, Madhan Mohan; Mishra, Bishnu Prasad; Dey, Sohini

    2014-06-05

    We report here the complete genome sequence of a Newcastle disease virus (NDV) isolated from a wild peacock. Phylogenetic analysis showed that it belongs to genotype II, class II of NDV strains. This study helps to understand the ecology of NDV strains circulating in a wild avian host of this geographical region during the outbreak of 2012 in northwest India. Copyright © 2014 Khulape et al.

  19. Complete mitochondrial DNA sequence of the Eastern keelback mullet Liza affinis.

    Science.gov (United States)

    Gong, Xiaoling; Zhu, Wenjia; Bao, Baolong

    2016-05-01

    Eastern keelback mullet (Liza affinis) inhabits inlet waters and estuaries of rivers. In this paper, we initially determined the complete mitochondrial genome of Liza affinis. The entire mtDNA sequence is 16,831 bp in length, including 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes and 1 putative control region. Its order and numbers of genes are similar to most bony fishes.

  20. Complete Genome Sequence of Methylobacterium populi P-1M, Isolated from Pink-Pigmented Household Biofilm.

    Science.gov (United States)

    Morohoshi, Tomohiro; Ikeda, Tsukasa

    2016-06-16

    Methylobacterium populi P-1M is isolated from the pink-pigmented household biofilm. Here, we present the complete genome sequence of P-1M, consisting of one chromosome of 5,705,640 bp and five plasmids of 64,864 bp, 59,879 bp, 42,569 bp, 41,417 bp, and 29,506 bp. Copyright © 2016 Morohoshi and Ikeda.

  1. Complete genome sequence of porcine parvovirus N strain isolated from guangxi, china.

    Science.gov (United States)

    Su, Qian-Lian; Li, Bin; Zhao, Wu; Liang, Jia-Xing; He, Ying; Qin, Yi-Bin; Lu, Bing-Xia

    2015-01-08

    We report here the complete genomic sequence of the porcine parvovirus (PPV) N strain, isolated in 1989 from the viscera of a stillborn fetus farrowed by a gilt in Guangxi, southern China. Phylogenetic analyses suggest that the PPV-N strain is closely related to attenuated PPV NADL-2 strains. The PPV-N strain has good immunogenicity, genetic stability, and safety. Copyright © 2015 Su et al.

  2. The complete genome sequence of the plant growth-promoting bacterium Pseudomonas sp. UW4.

    Directory of Open Access Journals (Sweden)

    Jin Duan

    Full Text Available The plant growth-promoting bacterium (PGPB Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated "housekeeping" genes (16S rRNA, gyrB, rpoB and rpoD of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup.

  3. The Complete Genome Sequence of the Plant Growth-Promoting Bacterium Pseudomonas sp. UW4

    Science.gov (United States)

    Duan, Jin; Jiang, Wei; Cheng, Zhenyu; Heikkila, John J.; Glick, Bernard R.

    2013-01-01

    The plant growth-promoting bacterium (PGPB) Pseudomonas sp. UW4, previously isolated from the rhizosphere of common reeds growing on the campus of the University of Waterloo, promotes plant growth in the presence of different environmental stresses, such as flooding, high concentrations of salt, cold, heavy metals, drought and phytopathogens. In this work, the genome sequence of UW4 was obtained by pyrosequencing and the gaps between the contigs were closed by directed PCR. The P. sp. UW4 genome contains a single circular chromosome that is 6,183,388 bp with a 60.05% G+C content. The bacterial genome contains 5,423 predicted protein-coding sequences that occupy 87.2% of the genome. Nineteen genomic islands (GIs) were predicted and thirty one complete putative insertion sequences were identified. Genes potentially involved in plant growth promotion such as indole-3-acetic acid (IAA) biosynthesis, trehalose production, siderophore production, acetoin synthesis, and phosphate solubilization were determined. Moreover, genes that contribute to the environmental fitness of UW4 were also observed including genes responsible for heavy metal resistance such as nickel, copper, cadmium, zinc, molybdate, cobalt, arsenate, and chromate. Whole-genome comparison with other completely sequenced Pseudomonas strains and phylogeny of four concatenated “housekeeping” genes (16S rRNA, gyrB, rpoB and rpoD) of 128 Pseudomonas strains revealed that UW4 belongs to the fluorescens group, jessenii subgroup. PMID:23516524

  4. Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the Dystrophin gene detected by direct sequencing

    Directory of Open Access Journals (Sweden)

    Corti Stefania

    2011-03-01

    Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects

  5. Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide sequences and antigenicity of recombinant proteins of VP1s and VP4s

    Directory of Open Access Journals (Sweden)

    Sun Yu

    2011-11-01

    Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.

  6. Intermittency as a universal characteristic of the complete chromosome DNA sequences of eukaryotes: From protozoa to human genomes

    Science.gov (United States)

    Rybalko, S.; Larionov, S.; Poptsova, M.; Loskutov, A.

    2011-10-01

    Large-scale dynamical properties of complete chromosome DNA sequences of eukaryotes are considered. Using the proposed deterministic models with intermittency and symbolic dynamics we describe a wide spectrum of large-scale patterns inherent in these sequences, such as segmental duplications, tandem repeats, and other complex sequence structures. It is shown that the recently discovered gene number balance on the strands is not of a random nature, and certain subsystems of a complete chromosome DNA sequence exhibit the properties of deterministic chaos.

  7. The Complete Chloroplast Genome Sequences of Five Epimedium Species: Lights into Phylogenetic and Taxonomic Analyses

    Science.gov (United States)

    Zhang, Yanjun; Du, Liuwen; Liu, Ao; Chen, Jianjun; Wu, Li; Hu, Weiming; Zhang, Wei; Kim, Kyunghee; Lee, Sang-Choon; Yang, Tae-Jin; Wang, Ying

    2016-01-01

    Epimedium L. is a phylogenetically and economically important genus in the family Berberidaceae. We here sequenced the complete chloroplast (cp) genomes of four Epimedium species using Illumina sequencing technology via a combination of de novo and reference-guided assembly, which was also the first comprehensive cp genome analysis on Epimedium combining the cp genome sequence of E. koreanum previously reported. The five Epimedium cp genomes exhibited typical quadripartite and circular structure that was rather conserved in genomic structure and the synteny of gene order. However, these cp genomes presented obvious variations at the boundaries of the four regions because of the expansion and contraction of the inverted repeat (IR) region and the single-copy (SC) boundary regions. The trnQ-UUG duplication occurred in the five Epimedium cp genomes, which was not found in the other basal eudicotyledons. The rapidly evolving cp genome regions were detected among the five cp genomes, as well as the difference of simple sequence repeats (SSR) and repeat sequence were identified. Phylogenetic relationships among the five Epimedium species based on their cp genomes showed accordance with the updated system of the genus on the whole, but reminded that the evolutionary relationships and the divisions of the genus need further investigation applying more evidences. The availability of these cp genomes provided valuable genetic information for accurately identifying species, taxonomy and phylogenetic resolution and evolution of Epimedium, and assist in exploration and utilization of Epimedium plants. PMID:27014326

  8. The complete chloroplast genome sequences of five Epimedium species: lights into phylogenetic and taxonomic analyses

    Directory of Open Access Journals (Sweden)

    Yanjun eZhang

    2016-03-01

    Full Text Available Epimedium L. is a phylogenetically and economically important genus in the family Berberidaceae. We here sequenced the complete chloroplast (cp genomes of four Epimedium species using Illumina sequencing technology via a combination of de novo and reference-guided assembly, which was also the first comprehensive cp genome analysis on Epimedium combining the cp genome sequence of E. koreanum previously reported. The five Epimedium cp genomes exhibited typical quadripartite and circular structure that was rather conserved in genomic structure and the synteny of gene order. However, these cp genomes presented obvious variations at the boundaries of the four regions because of the expansion and contraction of the inverted repeat (IR region and the single-copy (SC boundary regions. The trnQ-UUG duplication occurred in the five Epimedium cp genomes, which was not found in the other basal eudicotyledons. The rapidly evolving cp genome regions were detected among the five cp genomes, as well as the difference of simple sequence repeats (SSR and repeat sequence were identified. Phylogenetic relationships among the five Epimedium species based on their cp genomes showed accordance with the updated system of the genus on the whole, but reminded that the evolutionary relationships and the divisions of the genus need further investigation applying more evidences. The availability of these cp genomes provided valuable genetic information for accurately identifying species, taxonomy and phylogenetic resolution and evolution of Epimedium, and assist in exploration and utilization of Epimedium plants.

  9. The complete chloroplast genome of Capsicum annuum var. glabriusculum using Illumina sequencing.

    Science.gov (United States)

    Raveendar, Sebastin; Na, Young-Wang; Lee, Jung-Ro; Shim, Donghwan; Ma, Kyung-Ho; Lee, Sok-Young; Chung, Jong-Wook

    2015-07-20

    Chloroplast (cp) genome sequences provide a valuable source for DNA barcoding. Molecular phylogenetic studies have concentrated on DNA sequencing of conserved gene loci. However, this approach is time consuming and more difficult to implement when gene organization differs among species. Here we report the complete re-sequencing of the cp genome of Capsicum pepper (Capsicum annuum var. glabriusculum) using the Illumina platform. The total length of the cp genome is 156,817 bp with a 37.7% overall GC content. A pair of inverted repeats (IRs) of 50,284 bp were separated by a small single copy (SSC; 18,948 bp) and a large single copy (LSC; 87,446 bp). The number of cp genes in C. annuum var. glabriusculum is the same as that in other Capsicum species. Variations in the lengths of LSC; SSC and IR regions were the main contributors to the size variation in the cp genome of this species. A total of 125 simple sequence repeat (SSR) and 48 insertions or deletions variants were found by sequence alignment of Capsicum cp genome. These findings provide a foundation for further investigation of cp genome evolution in Capsicum and other higher plants.

  10. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Liu, Siyang; Huang, Shujia; Rao, Junhua

    2015-01-01

    present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

  11. Complete Genome Sequence of an Avian Metapneumovirus Subtype A Strain Isolated from Chicken (Gallus gallus) in Brazil.

    Science.gov (United States)

    Rizotto, Laís S; Scagion, Guilherme P; Cardoso, Tereza C; Simão, Raphael M; Caserta, Leonardo C; Benassi, Julia C; Keid, Lara B; Oliveira, Trícia M F de S; Soares, Rodrigo M; Arns, Clarice W; Van Borm, Steven; Ferreira, Helena L

    2017-07-20

    We report here the complete genome sequence of an avian metapneumovirus (aMPV) isolated from a tracheal tissue sample of a commercial layer flock. The complete genome sequence of aMPV-A/chicken/Brazil-SP/669/2003 was obtained using MiSeq (Illumina, Inc.) sequencing. Phylogenetic analysis of the complete genome classified the isolate as avian metapneumovirus subtype A. Copyright © 2017 Rizotto et al.

  12. Complete genome sequence of Francisella tularensis subspecies holarctica FTNF002-00.

    Directory of Open Access Journals (Sweden)

    Ravi D Barabote

    Full Text Available Francisella tularensis subspecies holarctica FTNF002-00 strain was originally obtained from the first known clinical case of bacteremic F. tularensis pneumonia in Southern Europe isolated from an immunocompetent individual. The FTNF002-00 complete genome contains the RD(23 deletion and represents a type strain for a clonal population from the first epidemic tularemia outbreak in Spain between 1997-1998. Here, we present the complete sequence analysis of the FTNF002-00 genome. The complete genome sequence of FTNF002-00 revealed several large as well as small genomic differences with respect to two other published complete genome sequences of F. tularensis subsp. holarctica strains, LVS and OSU18. The FTNF002-00 genome shares >99.9% sequence similarity with LVS and OSU18, and is also approximately 5 MB smaller by comparison. The overall organization of the FTNF002-00 genome is remarkably identical to those of LVS and OSU18, except for a single 3.9 kb inversion in FTNF002-00. Twelve regions of difference ranging from 0.1-1.5 kb and forty-two small insertions and deletions were identified in a comparative analysis of FTNF002-00, LVS, and OSU18 genomes. Two small deletions appear to inactivate two genes in FTNF002-00 causing them to become pseudogenes; the intact genes encode a protein of unknown function and a drug:H(+ antiporter. In addition, we identified ninety-nine proteins in FTNF002-00 containing amino acid mutations compared to LVS and OSU18. Several non-conserved amino acid replacements were identified, one of which occurs in the virulence-associated intracellular growth locus subunit D protein. Many of these changes in FTNF002-00 are likely the consequence of direct selection that increases the fitness of this subsp. holarctica clone within its endemic population. Our complete genome sequence analyses lay the foundation for experimental testing of these possibilities.

  13. Complete genome sequencing and phylogenetic analysis of dengue type 1 virus isolated from Jeddah, Saudi Arabia.

    Science.gov (United States)

    Azhar, Esam I; Hashem, Anwar M; El-Kafrawy, Sherif A; Abol-Ela, Said; Abd-Alla, Adly M M; Sohrab, Sayed Sartaj; Farraj, Suha A; Othman, Norah A; Ben-Helaby, Huda G; Ashshi, Ahmed; Madani, Tariq A; Jamjoom, Ghazi

    2015-01-16

    Dengue viruses (DENVs) are mosquito-borne viruses which can cause disease ranging from mild fever to severe dengue infection. These viruses are endemic in several tropical and subtropical regions. Multiple outbreaks of DENV serotypes 1, 2 and 3 (DENV-1, DENV-2 and DENV-3) have been reported from the western region in Saudi Arabia since 1994. Strains from at least two genotypes of DENV-1 (Asia and America/Africa genotypes) have been circulating in western Saudi Arabia until 2006. However, all previous studies reported from Saudi Arabia were based on partial sequencing data of the envelope (E) gene without any reports of full genome sequences for any DENV serotypes circulating in Saudi Arabia. Here, we report the isolation and the first complete genome sequence of a DENV-1 strain (DENV-1-Jeddah-1-2011) isolated from a patient from Jeddah, Saudi Arabia in 2011. Whole genome sequence alignment and phylogenetic analysis showed high similarity between DENV-1-Jeddah-1-2011 strain and D1/H/IMTSSA/98/606 isolate (Asian genotype) reported from Djibouti in 1998. Further analysis of the full envelope gene revealed a close relationship between DENV-1-Jeddah-1-2011 strain and isolates reported between 2004-2006 from Jeddah as well as recent isolates from Somalia, suggesting the widespread of the Asian genotype in this region. These data suggest that strains belonging to the Asian genotype might have been introduced into Saudi Arabia long before 2004 most probably by African pilgrims and continued to circulate in western Saudi Arabia at least until 2011. Most importantly, these results indicate that pilgrims from dengue endemic regions can play an important role in the spread of new DENVs in Saudi Arabia and the rest of the world. Therefore, availability of complete genome sequences would serve as a reference for future epidemiological studies of DENV-1 viruses.

  14. The Complete Mitochondrial Genome Sequence of Bactericera cockerelli and Comparison with Three Other Psylloidea Species.

    Directory of Open Access Journals (Sweden)

    Fengnian Wu

    Full Text Available Potato psyllid (Bactericera cockerelli is an important pest of potato, tomato and pepper. Not only could a toxin secreted by nymphs results in serious phytotoxemia in some host plants, but also over the past few years B. cockerelli was shown to transmit "Candidatus Liberibacter solanacearum", the putative bacterial pathogen of potato zebra chip (ZC disease, to potato and tomato. ZC has caused devastating losses to potato production in the western U.S., Mexico, and elsewhere. New knowledge of the genetic diversity of the B. cockerelli is needed to develop improved strategies to manage pest populations. Mitochondrial genome (mitogenome sequencing provides important knowledge about insect evolution and diversity in and among populations. This report provides the first complete B. cockerelli mitogenome sequence as determined by next generation sequencing technology (Illumina MiSeq. The circular B. cockerelli mitogenome had a size of 15,220 bp with 13 protein-coding gene (PCGs, 2 ribosomal RNA genes (rRNAs, 22 transfer RNA genes (tRNAs, and a non-coding region of 975 bp. The overall gene order of the B. cockerelli mitogenome is identical to three other published Psylloidea mitogenomes: one species from the Triozidae, Paratrioza sinica; and two species from the Psyllidae, Cacopsylla coccinea and Pachypsylla venusta. This suggests all of these species share a common ancestral mitogenome. However, sequence analyses revealed differences between and among the insect families, in particular a unique region that can be folded into three stem-loop secondary structures present only within the B. cockerelli mitogenome. A phylogenetic tree based on the 13 PCGs matched an existing taxonomy scheme that was based on morphological characteristics. The available complete mitogenome sequence makes it accessible to all genes for future population diversity evaluation of B. cockerelli.

  15. Prediction of transcriptional regulatory sites in the complete genome sequence of Escherichia coli K-12.

    Science.gov (United States)

    Thieffry, D; Salgado, H; Huerta, A M; Collado-Vides, J

    1998-06-01

    As one of the best-characterized free-living organisms, Escherichia coli and its recently completed genomic sequence offer a special opportunity to exploit systematically the variety of regulatory data available in the literature in order to make a comprehensive set of regulatory predictions in the whole genome. The complete genome sequence of E.coli was analyzed for the binding of transcriptional regulators upstream of coding sequences. The biological information contained in RegulonDB (Huerta, A.M. et al., Nucleic Acids Res.,26,55-60, 1998) for 56 different transcriptional proteins was the support to implement a stringent strategy combining string search and weight matrices. We estimate that our search included representatives of 15-25% of the total number of regulatory binding proteins in E.coli. This search was performed on the set of 4288 putative regulatory regions, each 450 bp long. Within the regions with predicted sites, 89% are regulated by one protein and 81% involve only one site. These numbers are reasonably consistent with the distribution of experimental regulatory sites. Regulatory sites are found in 603 regions corresponding to 16% of operon regions and 10% of intra-operonic regions. Additional evidence gives stronger support to some of these predictions, including the position of the site, biological consistency with the function of the downstream gene, as well as genetic evidence for the regulatory interaction. The predictions described here were incorporated into the map presented in the paper describing the complete E.coli genome (Blattner,F.R. et al., Science, 277, 1453-1461, 1997). The complete set of predictions in GenBank format is available at the url: http://www. cifn.unam.mx/Computational_Biology/E.coli-predictions ecoli-reg@cifn.unam.mx, collado@cifn.unam.mx

  16. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    Science.gov (United States)

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  17. Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs

    International Nuclear Information System (INIS)

    Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.

    1987-01-01

    Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2

  18. Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora

    Directory of Open Access Journals (Sweden)

    Maria Eguiluz

    2017-11-01

    Full Text Available Abstract Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC and 18,587 bp (SSC. The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes. Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization.

  19. Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora

    Science.gov (United States)

    Eguiluz, Maria; Yuyama, Priscila Mary; Guzman, Frank; Rodrigues, Nureyev Ferreira; Margis, Rogerio

    2017-01-01

    Abstract Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp) genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC) and 18,587 bp (SSC). The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes). Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization. PMID:29111566

  20. Complete genome sequence of Hydrogenobacter thermophilus type strain (TK-6T)

    Energy Technology Data Exchange (ETDEWEB)

    Zeytun, Ahmet [Los Alamos National Laboratory (LANL); Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Han, James [Joint Genome Institute; Tice, Hope [Joint Genome Institute, Walnut Creek, California; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [Joint Genome Institute, Walnut Creek, California; Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Ngatchou, Olivier Duplex [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [Joint Genome Institute, Walnut Creek, California; Ubler, Susanne [Universitat Regensburg, Regensburg, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Wirth, Reinhard [Universitat Regensburg, Regensburg, Germany; Woyke, Tanja [Joint Genome Institute, Walnut Creek, California; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kyrpides, Nikos C [Joint Genome Institute, Walnut Creek, California

    2011-01-01

    Hydrogenobacter thermophilus Kawasumi et al. 1984 is the type species of the genus Hydrogenobacter. H. thermophilus was the first obligate autotrophic organism reported among aerobic hydrogen-oxidizing bacteria. Strain TK-6T is of interest because of the unusually efficient hydrogen-oxidizing ability of this strain, which results in a faster generation time compared to other autotrophs. It is also able to grow anaerobically using nitrate as an electron acceptor when molecular hydrogen is used as the energy source, and able to aerobically fix CO2 via the reductive tricarboxylic acid cycle. This is the fifth completed genome sequence in the family Aquificaceae, and the second genome sequence determined from a strain derived from the original isolate. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 1,742,932 bp long genome with its 1,899 protein-coding and 49 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  1. Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora.

    Science.gov (United States)

    Eguiluz, Maria; Yuyama, Priscila Mary; Guzman, Frank; Rodrigues, Nureyev Ferreira; Margis, Rogerio

    2017-01-01

    Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp) genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC) and 18,587 bp (SSC). The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes). Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization.

  2. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  3. Complete mitochondrial genome sequences of three bats species and whole genome mitochondrial analyses reveal patterns of codon bias and lend support to a basal split in Chiroptera.

    Science.gov (United States)

    Meganathan, P R; Pagan, Heidi J T; McCulloch, Eve S; Stevens, Richard D; Ray, David A

    2012-01-15

    Order Chiroptera is a unique group of mammals whose members have attained self-powered flight as their main mode of locomotion. Much speculation persists regarding bat evolution; however, lack of sufficient molecular data hampers evolutionary and conservation studies. Of ~1200 species, complete mitochondrial genome sequences are available for only eleven. Additional sequences should be generated if we are to resolve many questions concerning these fascinating mammals. Herein, we describe the complete mitochondrial genomes of three bats: Corynorhinus rafinesquii, Lasiurus borealis and Artibeus lituratus. We also compare the currently available mitochondrial genomes and analyze codon usage in Chiroptera. C. rafinesquii, L. borealis and A. lituratus mitochondrial genomes are 16438 bp, 17048 bp and 16709 bp, respectively. Genome organization and gene arrangements are similar to other bats. Phylogenetic analyses using complete mitochondrial genome sequences support previously established phylogenetic relationships and suggest utility in future studies focusing on the evolutionary aspects of these species. Comprehensive analyses of available bat mitochondrial genomes reveal distinct nucleotide patterns and synonymous codon preferences corresponding to different chiropteran families. These patterns suggest that mutational and selection forces are acting to different extents within Chiroptera and shape their mitochondrial genomes. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Complete DNA sequence of the mitochondrial genome of the treehopper Leptobelus gazella (Membracoidea: Hemiptera).

    Science.gov (United States)

    Zhao, Xing; Liang, Ai-Ping

    2016-09-01

    The first complete DNA sequence of the mitochondrial genome (mitogenome) of Leptobelus gazelle (Membracoidea: Hemiptera) is determined in this study. The circular molecule is 16,007 bp in its full length, which encodes a set of 37 genes, including 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs, and contains an A + T-rich region (CR). The gene numbers, content, and organization of L. gazelle are similar to other typical metazoan mitogenomes. Twelve of the 13 PCGs are initiated with ATR methionine or ATT isoleucine codons, except the atp8 gene that uses the ATC isoleucine as start signal. Ten of the 13 PCGs have complete termination codons, either TAA (nine genes) or TAG (cytb). The remaining 3 PCGs (cox1, cox2 and nad5) have incomplete termination codons T (AA). All of the 22 tRNAs can be folded in the form of a typical clover-leaf structure. The complete mitogenome sequence data of L. gazelle is useful for the phylogenetic and biogeographic studies of the Membracoidea and Hemiptera.

  5. Complete genome sequence of Tsukamurella paurometabola type strain (no. 33T)

    Energy Technology Data Exchange (ETDEWEB)

    Munk, Christine [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Brettin, Thomas S [ORNL; Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2011-01-01

    Tsukamurella paurometabola corrig. (Steinhaus 1941) Collins et al. 1988 is the type species of the genus Tsukamurella, which is the type genus to the family Tsukamurellaceae. The spe- cies is not only of interest because of its isolated phylogenetic location, but also because it is a human opportunistic pathogen with some strains of the species reported to cause lung in- fection, lethal meningitis, and necrotizing tenosynovitis. This is the first completed genome sequence of a member of the genus Tsukamurella and the first genome sequence of a member of the family Tsukamurellaceae. The 4,479,724 bp long genome contains a 99,806 bp long plasmid and a total of 4,335 protein-coding and 56 RNA genes, and is a part of the Ge- nomic Encyclopedia of Bacteria and Archaea project.

  6. Complete genome sequence of Truepera radiovictrix type strain (RQ-24T)

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Rohde, Christine [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Munk, Christine [Joint Genome Institute, Walnut Creek, California; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Glavina Del Rio, Tijana [Joint Genome Institute, Walnut Creek, California; Tice, Hope [Joint Genome Institute, Walnut Creek, California; Deshpande, Shweta [Joint Genome Institute, Walnut Creek, California; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [Joint Genome Institute, Walnut Creek, California; Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [Joint Genome Institute, Walnut Creek, California; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [Joint Genome Institute, Walnut Creek, California; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California

    2011-01-01

    Truepera radiovictrix Albuquerque et al. 2005 is the type species of the genus Truepera within the phylum Deinococcus/Thermus. T. radiovictrix is of special interest not only because of its isolated phylogenetic location in the order Deinococcales, but also because of its ability to grow under multiple extreme conditions in alkaline, moderately saline, and high temperature habitats. Of particular interest is the fact that, T. radiovictrix is also remarkably resistant to ionizing radiation, a feature it shares with members of the genus Deinococcus. This is the first completed genome sequence of a member of the family Trueperaceae and the fourth type strain genome sequence from a member of the order Deinococcales. The 3,260,398 bp long genome with its 2,994 protein-coding and 52 RNA genes consists of one circular chromosome and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  7. The complete genome sequence of Haloferax volcanii DS2, a model archaeon.

    Directory of Open Access Journals (Sweden)

    Amber L Hartman

    2010-03-01

    Full Text Available Haloferax volcanii is an easily culturable moderate halophile that grows on simple defined media, is readily transformable, and has a relatively stable genome. This, in combination with its biochemical and genetic tractability, has made Hfx. volcanii a key model organism, not only for the study of halophilicity, but also for archaeal biology in general.We report here the sequencing and analysis of the genome of Hfx. volcanii DS2, the type strain of this species. The genome contains a main 2.848 Mb chromosome, three smaller chromosomes pHV1, 3, 4 (85, 438, 636 kb, respectively and the pHV2 plasmid (6.4 kb.The completed genome sequence, presented here, provides an invaluable tool for further in vivo and in vitro studies of Hfx. volcanii.

  8. Complete genome sequence of Tolumonas auensis type strain (TA 4T)

    Energy Technology Data Exchange (ETDEWEB)

    Chertkov, Olga; Copeland, Alex; Lucas1, Susa; Lapidus, Alla; Berry, KerrieW.; Detter, JohnC.; Glavina Del Rio, Tijana; Hammon, Nancy; Dalin, Eileen; Tice, Hope; Pitluck, Sam; Richardson, Paul; Bruce, David; Goodwin, Lynne; Han, Cliff; Tapia, Roxanne; Saunders, Elizabeth; Schmutz, Jeremy; Brettin, Thomas; Larimer, Frank; Land, Miriam; Hauser, Loren; Spring, Stefan; Rohde, Manfred; Kyrpides, NikosC.; Ivanova, Natalia; G& #246; ker, Markus; Beller, HarryR.; Klenk, Hans-Peter; Woyke, Tanja

    2011-10-04

    Tolumonas auensis (Fischer-Romero et al. 1996) is currently the only validly named species of the genus Tolumonas in the family Aeromonadaceae. The strain is of interest because of its ability to produce toluene from phenylalanine and other phenyl precursors, as well as phenol from tyrosine. This is of interest because toluene is normally considered to be a tracer of anthropogenic pollution in lakes, but T. auensis represents a biogenic source of toluene. Other than Aeromonas hydrophila subsp. hydrophila, T. auensis strain TA 4T is the only other member in the family Aeromonadaceae with a completely sequenced type-strain genome. The 3,471,292-bp chromosome with a total of 3,288 protein-coding and 116 RNA genes was sequenced as part of the DOE Joint Genome Institute Program JBEI 2008.

  9. Complete genome sequence of Tolumonas auensis type strain (TA 4T)

    Energy Technology Data Exchange (ETDEWEB)

    Chertkov, Olga [Los Alamos National Laboratory (LANL); Copeland, A [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Berry, Alison M [California Institute of Technology, University of California, Davis; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Richardson, P M [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Schmutz, Jeremy [Stanford University; Brettin, Thomas S [ORNL; Larimer, Frank W [ORNL; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Beller, Harry R. [Lawrence Berkeley National Laboratory (LBNL); Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute

    2011-01-01

    Tolumonas auensis Fischer-Romero et al. 1996 is currently the only validly named species of the genus Tolumonas in the family Aeromonadaceae. The strain is of interest because of its ability to produce toluene from phenylalanine and other phenyl precursors, as well as phenol from tyrosine. This is of interest because toluene is normally considered to be a tracer of anthropogenic pollution in lakes, but T. auensis represents a biogenic source of toluene. Oth- er than Aeromonas hydrophila subsp. hydrophila, T. auensis strain TA 4T is the only other member in the family Aeromonadaceae with a completely sequenced type-strain genome. The 3,471,292 bp chromosome with a total of 3,288 protein-coding and 116 RNA genes was sequenced as part of the DOE Joint Genome Institute Program JBEI 2008.

  10. Complete genome sequence of Olsenella uli type strain (VPI D76D-27CT)

    Energy Technology Data Exchange (ETDEWEB)

    Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Held, Brittany [Los Alamos National Laboratory (LANL); Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Pukall, Rudiger [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany

    2010-01-01

    Olsenella uli (Olsen et al. 1991) Dewhirst et al. 2001 is the type species of the genus Olsenella, which belongs to the actinobacterial family Coriobacteriaceae. The species is of interest because it is frequently isolated from dental plaque in periodontitis patients and can cause primary endodontic infection. The species is a Gram-positive, non-motile and non-sporulating bacterium. The strain described in this study has been isolated from human gingival crevices in 1982. This is the first completed sequence of the genus Olsenella and the fifth sequence from the family Coriobacteriaceae. The 2,051,896 bp long genome with its 1,795 protein-coding and 55 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  11. Complete genome sequences of three tomato spotted wilt virus isolates from tomato and pepper plants in Korea and their phylogenetic relationship to other TSWV isolates.

    Science.gov (United States)

    Lee, Jong-Seung; Cho, Won Kyong; Kim, Mi-Kyeong; Kwak, Hae-Ryun; Choi, Hong-Soo; Kim, Kook-Hyung

    2011-04-01

    Tomato spotted wilt virus (TSWV) infects numerous host plants and has three genome segments, called L, M and S. Here, we report the complete genome sequences of three Korean TSWV isolates (TSWV-1 to -3) infecting tomato and pepper plants. Although the nucleotide sequence of TSWV-1 genome isolated from tomato is very different from those of TSWV-2 and TSWV-3 isolated from pepper, the deduced amino acid sequences of the five TSWV genes are highly conserved among all three TSWV isolates. In phylogenetic analysis, deduced RdRp protein sequences of TSWV-2 and TSWV-3 were clustered together with two previously reported isolates from Japan and Korea, while TSWV-1 grouped together with a Hawaiian isolate. A phylogenetic tree based on N protein sequences, however, revealed four distinct groups of TSWV isolates, and all three Korean isolates belonged to group II, together with many other isolates, mostly from Europe and Asia. Interestingly, most American isolates grouped together as group I. Together, these results suggested that these newly identified TSWV isolates might have originated from an Asian ancestor and undergone divergence upon infecting different host plants.

  12. Sequencing and analysis of the complete mitochondrial genome in Anopheles sinensis (Diptera: Culicidae).

    Science.gov (United States)

    Chen, Kai; Wang, Yan; Li, Xiang-Yu; Peng, Heng; Ma, Ya-Jun

    2017-10-02

    Anopheles sinensis (Diptera: Culicidae) is a primary vector of Plasmodium vivax and Brugia malayi in most regions of China. In addition, its phylogenetic relationship with the cryptic species of the Hyrcanus Group is complex and remains unresolved. Mitochondrial genome sequences are widely used as molecular markers for phylogenetic studies of mosquito species complexes, of which mitochondrial genome data of An. sinensis is not available. An. sinensis samples was collected from Shandong, China, and identified by molecular marker. Genomic DNA was extracted, followed by the Illumina sequencing. Two complete mitochondrial genomes were assembled and annotated using the mitochondrial genome of An. gambiae as reference. The mitochondrial genomes sequences of the 28 known Anopheles species were aligned and reconstructed phylogenetic tree by Maximum Likelihood (ML) method. The length of complete mitochondrial genomes of An. sinensis was 15,076 bp and 15,138 bp, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and an AT-rich control region. As in other insects, most mitochondrial genes are encoded on the J strand, except for ND5, ND4, ND4L, ND1, two rRNA and eight tRNA genes, which are encoded on the N strand. The bootstrap value was set as 1000 in ML analyses. The topologies restored phylogenetic affinity within subfamily Anophelinae. The ML tree showed four major clades, corresponding to the subgenera Cellia, Anopheles, Nyssorhynchus and Kerteszia of the genus Anopheles. The complete mitochondrial genomes of An. sinensis were obtained. The number, order and transcription direction of An. sinensis mitochondrial genes were the same as in other species of family Culicidae.

  13. Complete Chloroplast Genome Sequence of Aquilaria sinensis (Lour.) Gilg and Evolution Analysis within the Malvales Order.

    Science.gov (United States)

    Wang, Ying; Zhan, Di-Feng; Jia, Xian; Mei, Wen-Li; Dai, Hao-Fu; Chen, Xiong-Ting; Peng, Shi-Qing

    2016-01-01

    Aquilaria sinensis (Lour.) Gilg is an important medicinal woody plant producing agarwood, which is widely used in traditional Chinese medicine. High-throughput sequencing of chloroplast (cp) genomes enhanced the understanding about evolutionary relationships within plant families. In this study, we determined the complete cp genome sequences for A. sinensis. The size of the A. sinensis cp genome was 159,565 bp. This genome included a large single-copy region of 87,482 bp, a small single-copy region of 19,857 bp, and a pair of inverted repeats (IRa and IRb) of 26,113 bp each. The GC content of the genome was 37.11%. The A. sinensis cp genome encoded 113 functional genes, including 82 protein-coding genes, 27 tRNA genes, and 4 rRNA genes. Seven genes were duplicated in the protein-coding genes, whereas 11 genes were duplicated in the RNA genes. A total of 45 polymorphic simple-sequence repeat loci and 60 pairs of large repeats were identified. Most simple-sequence repeats were located in the noncoding sections of the large single-copy/small single-copy region and exhibited high A/T content. Moreover, 33 pairs of large repeat sequences were located in the protein-coding genes, whereas 27 pairs were located in the intergenic regions. Aquilaria sinensis cp genome bias ended with A/T on the basis of codon usage. The distribution of codon usage in A. sinensis cp genome was most similar to that in the Gonystylus bancanus cp genome. Comparative results of 82 protein-coding genes from 29 species of cp genomes demonstrated that A. sinensis was a sister species to G. bancanus within the Malvales order. Aquilaria sinensis cp genome presented the highest sequence similarity of >90% with the G. bancanus cp genome by using CGView Comparison Tool. This finding strongly supports the placement of A. sinensis as a sister to G. bancanus within the Malvales order. The complete A. sinensis cp genome information will be highly beneficial for further studies on this traditional medicinal

  14. Complete genome sequence of Defluviimonas alba cai42T, a microbial exopolysaccharides producer.

    Science.gov (United States)

    Zhao, Jie-Yu; Geng, Shuang; Xu, Lian; Hu, Bing; Sun, Ji-Quan; Nie, Yong; Tang, Yue-Qin; Wu, Xiao-Lei

    2016-12-10

    Defluviimonas alba cai42 T , isolated from the oil-production water in Xinjiang Oilfield in China, has a strong ability to produce exopolysaccharides (EPS). We hereby present its complete genome sequence information which consists of a circular chromosome and three plasmids. The strain characteristically contains various genes encoding for enzymes involved in EPS biosynthesis, modification, and export. According to the genomic and physiochemical data, it is predicted that the strain has the potential to be utilized in industrial production of microbial EPS. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. The complete mitochondrial genome of Porites harrisoni (Cnidaria: Scleractinia) obtained using next-generation sequencing

    KAUST Repository

    Terraneo, Tullia Isotta

    2018-02-24

    In this study, we sequenced the complete mitochondrial genome of Porites harrisoni using ezRAD and Illumina technology. Genome length consisted of 18,630 bp, with a base composition of 25.92% A, 13.28% T, 23.06% G, and 37.73% C. Consistent with other hard corals, P. harrisoni mitogenome was arranged in 13 protein-coding genes, 2 rRNA, and 2 tRNA genes. nad5 and cox1 contained embedded Group I Introns of 11,133 bp and 965 bp, respectively.

  16. Complete genome sequence of the aerobically denitrifying thermophilic bacterium Chelatococcus daeguensis TAD1

    Directory of Open Access Journals (Sweden)

    Yunlong Yang

    Full Text Available ABSTRACT Chelatococcus daeguensis TAD1 is a themophilic bacterium isolated from a biotrickling filter used to treat NOx in Ruiming Power Plant, located in Guangzhou, China, which shows an excellent aerobic denitrification activity at high temperature. The complete genome sequence of this strain was reported in the present study. Genes related to the aerobic denitrification were identified through whole genome analysis. This work will facilitate the mechanism of aerobic denitrification and provide evidence for its potential application in the nitrogen removal.

  17. Complete genome sequence of Spirochaeta smaragdinae type strain (SEBR 4228T)

    Energy Technology Data Exchange (ETDEWEB)

    Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Chertkov, Olga [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Bruce, David [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute

    2010-01-01

    Spirochaeta smaragdinae Magot et al. 1998 belongs to the family Spirochaetaceae. The species is Gram-negative, motile, obligately halophilic and strictly anaerobic bacterium, which is of interest because it is able to ferment numerous polysaccharides. S. smaragdinae is the only species of the family Spirochaetaceae known to reduce thiosulfate or element sulphur to sulfide. This is the first complete genome sequence in the family Spirochaetaceae. The 4,653,970 bp long genome with its 4,363 protein-coding and 57 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  18. Complete genome sequence of jacquemontia yellow vein virus, a novel begomovirus infecting Jacquemontia tamnifolia in Venezuela.

    Science.gov (United States)

    Fiallo-Olivé, Elvira; Chirinos, Dorys T; Geraud-Pouey, Francis; Navas-Castillo, Jesús

    2017-08-01

    Wild plants of the family Convolvulaceae are hosts for a few New World begomoviruses (genus Begomovirus, family Geminiviridae). In this work, we report the complete genome sequence of a new begomovirus infecting the wild convolvulaceous plant Jacquemontia tamnifolia in Venezuela. The cloned bipartite genome showed the organization of typical New World begomoviruses and was found to be phylogenetically related to those of begomoviruses from Venezuela and other Caribbean countries. Several recombination events have been shown to have occurred involving genome fragment exchange with related begomoviruses infecting crops such as tomato and cucurbits and wild plants, including Jacquemontia sp. We propose the name jacquemontia yellow vein virus (JacYVV) for this new begomovirus.

  19. The complete mitochondrial genome of Porites harrisoni (Cnidaria: Scleractinia) obtained using next-generation sequencing

    KAUST Repository

    Terraneo, Tullia Isotta; Arrigoni, Roberto; Benzoni, Francesca; Forsman, Zac H.; Berumen, Michael L.

    2018-01-01

    In this study, we sequenced the complete mitochondrial genome of Porites harrisoni using ezRAD and Illumina technology. Genome length consisted of 18,630 bp, with a base composition of 25.92% A, 13.28% T, 23.06% G, and 37.73% C. Consistent with other hard corals, P. harrisoni mitogenome was arranged in 13 protein-coding genes, 2 rRNA, and 2 tRNA genes. nad5 and cox1 contained embedded Group I Introns of 11,133 bp and 965 bp, respectively.

  20. Complete mitochondrial genome sequence of the Barbour's seahorse Hippocampus barbouri Jordan & Richardson, 1908 (Gasterosteiformes: Syngnathidae).

    Science.gov (United States)

    Wang, Bo; Zhang, Yanhong; Zhang, Huixian; Lin, Qiang

    2015-01-01

    The complete mitochondrial genome sequence of the Barbour's seahorse Hippocampus barbouri was first determined in this paper. The total length of H. barbouri mitogenome is 16,526 bp, which consists of 13 protein-coding genes, 22 tRNA and 2 rRNA genes and 1 control region. The features of the H. barbouri mitochondrial genome were similar to the typical vertebrates. The overall base composition of H. barbouri is 32.68% A, 29.75% T, 22.91% C and 14.66% G, with an AT content of 62.43%.