Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Complete nucleotide sequences of avian metapneumovirus subtype B genome.
Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro
2010-12-01
Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.
Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1
Energy Technology Data Exchange (ETDEWEB)
Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G
1988-03-25
Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G
2011-04-01
A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
The nucleotide sequences of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...
Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P
2010-09-01
The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.
Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid
2012-07-01
Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang
2009-01-01
The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
DEFF Research Database (Denmark)
Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili
2013-01-01
In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel
2016-06-01
Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.
Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea
Directory of Open Access Journals (Sweden)
Ji-Sun Park
2015-01-01
Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Complete genome sequence of pronghorn virus, a pestivirus
The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....
Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P
2005-05-01
The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.
Directory of Open Access Journals (Sweden)
Martin Beránek
2012-01-01
Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2014-11-01
In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.
Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping
2010-12-01
Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.
Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R
2012-10-01
To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.
Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.
Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin
2008-01-01
The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.
The International Nucleotide Sequence Database Collaboration.
Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu
2011-01-01
Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri
Nigg, Jared C.; Nouri, Shahideh; Falk, Bryce W.
2016-01-01
Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri. Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera.
Complete Genome Sequence of a Putative Densovirus of the Asian Citrus Psyllid, Diaphorina citri.
Nigg, Jared C; Nouri, Shahideh; Falk, Bryce W
2016-07-28
Here, we report the complete genome sequence of a putative densovirus of the Asian citrus psyllid, Diaphorina citri Diaphorina citri densovirus (DcDNV) was originally identified through metagenomics, and here, we obtained the complete nucleotide sequence using PCR-based approaches. Phylogenetic analysis places DcDNV between viruses of the Ambidensovirus and Iteradensovirus genera. Copyright © 2016 Nigg et al.
Directory of Open Access Journals (Sweden)
Bingjun eDang
2016-02-01
Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.
A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.
Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.
1996-01-01
A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having
First Complete Genome Sequence of Suakwa aphid-borne yellows virus from East Timor
Maina, Solomon; Edwards, Owain R.; de Almeida, Luis; Ximenes, Abel
2016-01-01
We present here the first complete genomic RNA sequence of the polerovirus Suakwa aphid-borne yellows virus (SABYV), from East Timor. The isolate sequenced came from a virus-infected pumpkin plant. The East Timorese genome had a nucleotide identity of 86.5% with the only other SABYV genome available, which is from Taiwan. PMID:27469955
Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas
Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; Ludergnani, Nicholas; McMullen, Allison
2017-01-01
ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends.
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.
Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun
2016-07-01
The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.
Complete Genome Sequences of Mycobacteriophages Clautastrophe, Kingsolomon, Krypton555, and Nicholas
Chung, Hui-Min; D’Elia, Tom; Ross, Joseph F.; Alvarado, Samuel M.; Brantley, Molly-Catherine; Bricker, Lydia P.; Butler, Courtney R.; Crist, Carson; Dane, Julia M.; Farran, Brett W.; Hobbs, Sierra; Lapak, Michelle; Lovell, Conner; McMullen, Allison; Mirza, Sohail A.; Thrift, Noah; Vaughan, Donald P.; Worley, Grace; Ejikemeuwa, Amara; Zaw, May; Albritton, Claude F.; Bertrand, Sarah C.; Chaudhry, Shanzay S.; Cheema, Vzair A.; Do, Camilla; Do, Michael L.; Duong, Huyen M.; El-Desoky, Dalia H.; Green, Kelsey M.; Lee, Rhea N.; Thornton, Lauren A.; Vu, James M.; Zahra, Mah Noor; Stoner, Ty H.; Garlena, Rebecca A.; Jacobs-Sera, Deborah; Russell, Daniel A.
2017-01-01
ABSTRACT We report here the complete genome sequences of four subcluster L3 mycobacteriophages newly isolated from soil samples, using Mycobacterium smegmatis mc2155 as the host. Comparative genomic analyses with four previously described subcluster L3 phages reveal strong nucleotide similarity and gene conservation, with several large insertions/deletions near their right genome ends. PMID:29122864
Sequencing genes in silico using single nucleotide polymorphisms
Directory of Open Access Journals (Sweden)
Zhang Xinyi
2012-01-01
Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate
Completed sequence and corrected annotation of the genome of maize Iranian mosaic virus.
Ghorbani, Abozar; Izadpanah, Keramatollah; Dietzgen, Ralf G
2018-03-01
Maize Iranian mosaic virus (MIMV) is a negative-sense single-stranded RNA virus that is classified in the genus Nucleorhabdovirus, family Rhabdoviridae. The MIMV genome contains six open reading frames (ORFs) that encode in 3΄ to 5΄ order the nucleocapsid protein (N), phosphoprotein (P), putative movement protein (P3), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). In this study, we determined the first complete genome sequence of MIMV using Illumina RNA-Seq and 3'/5' RACE. MIMV genome ('Fars' isolate) is 12,426 nucleotides in length. Unexpectedly, the predicted N gene ORF of this isolate and of four other Iranian isolates is 143 nucleotides shorter than that of the MIMV coding-complete reference isolate 'Shiraz 1' (Genbank NC_011542), possibly due to a minor error in the previous sequence. Genetic variability among the N, P, P3 and G ORFs of Iranian MIMV isolates was limited, but highest in the G gene ORF. Phylogenetic analysis of complete nucleorhabdovirus genomes demonstrated a close evolutionary relationship between MIMV, maize mosaic virus and taro vein chlorosis virus.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.
Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L
1989-04-01
The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.
Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.
Directory of Open Access Journals (Sweden)
Kouki Yonezawa
Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.
Directory of Open Access Journals (Sweden)
Peter Norberg
Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.
Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl
2014-07-04
Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was
Complete genome sequence of a recent panzootic virulent Newcastle disease virus from Pakistan
Complete genome sequence of a new strain of Newcastle disease virus (NDV) (chicken/Pak/Lahore-611/2013) is reported. The strain was isolated from a vaccinated chicken flock in Pakistan in 2013 and has panzootic features. The genome is 15192 nucleotides in length and is classified as sub-genotype V...
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-04-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...
Energy Technology Data Exchange (ETDEWEB)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.
1987-02-01
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.
Complete Genome Sequence of the Soybean Symbiont Bradyrhizobium japonicum Strain USDA6T
Directory of Open Access Journals (Sweden)
Nobukazu Uchiike
2011-10-01
Full Text Available The complete nucleotide sequence of the genome of the soybean symbiont Bradyrhizobium japonicum strain USDA6T was determined. The genome of USDA6T is a single circular chromosome of 9,207,384 bp. The genome size is similar to that of the genome of another soybean symbiont, B. japonicum USDA110 (9,105,828 bp. Comparison of the whole-genome sequences of USDA6T and USDA110 showed colinearity of major regions in the two genomes, although a large inversion exists between them. A significantly high level of sequence conservation was detected in three regions on each genome. The gene constitution and nucleotide sequence features in these three regions indicate that they may have been derived from a symbiosis island. An ancestral, large symbiosis island, approximately 860 kb in total size, appears to have been split into these three regions by unknown large-scale genome rearrangements. The two integration events responsible for this appear to have taken place independently, but through comparable mechanisms, in both genomes.
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat
2013-07-01
Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.
1987-01-01
Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative
Directory of Open Access Journals (Sweden)
Hae-Ryun Kwak
2015-12-01
Full Text Available Sweet potatoes (Ipomea batatas L. are grown extensively, in tropical and temperate regions, and are important food crops worldwide. In Korea, potyviruses, including Sweet potato feathery mottle virus (SPFMV, Sweet potato virus C (SPVC, Sweet potato virus G (SPVG, Sweet potato virus 2 (SPV2, and Sweet potato latent virus (SPLV, have been detected in sweet potato fields at a high (~95% incidence. In the present work, complete genome sequences of 18 isolates, representing the five potyviruses mentioned above, were compared with previously reported genome sequences. The complete genomes consisted of 10,081 to 10,830 nucleotides, excluding the poly-A tails. Their genomic organizations were typical of the Potyvirus genus, including one target open reading frame coding for a putative polyprotein. Based on phylogenetic analyses and sequence comparisons, the Korean SPFMV isolates belonged to the strains RC and O with >98% nucleotide sequence identity. Korean SPVC isolates had 99% identity to the Japanese isolate SPVC-Bungo and 70% identity to the SPFMV isolates. The Korean SPVG isolates showed 99% identity to the three previously reported SPVG isolates. Korean SPV2 isolates had 97% identity to the SPV2 GWB-2 isolate from the USA. Korean SPLV isolates had a relatively low (88% nucleotide sequence identity with the Taiwanese SPLV-TW isolates, and they were phylogenetically distantly related to SPFMV isolates. Recombination analysis revealed that possible recombination events occurred in the P1, HC-Pro and NIa-NIb regions of SPFMV and SPLV isolates and these regions were identified as hotspots for recombination in the sweet potato potyviruses.
Agindotan, Bright O; Gray, Michael E; Hammond, Rosemarie W; Bradley, Carl A
2012-09-01
The complete genome sequence of a virus recently detected in switchgrass (Panicum virgatum) was determined and found to be closely related to that of maize rayado fino virus (MRFV), genus Marafivirus, family Tymoviridae. The genomic RNA is 6408 nucleotides long. It contains three predicted open reading frames (ORFs 1-3), encoding proteins of 227 kDa, 43.9 kDa, and 31.5 kDa, compared to two ORFs (1 and 2) for MRFV. The complete genome shares 76 % sequence identity with MRFV. The nucleotide sequence of ORF2 of this virus and the amino acid sequence of its encoded protein are 49 % and 77 % identical, respectively, to those of MRFV. The virus-encoded polyprotein and capsid protein aa sequences are 83 % and 74-80 % identical, respectively, to those of MRFV. Although closely related to MRFV, the amino acid sequence of its capsid protein (CP) forms a clade that is separate from that of MRFV. Based on the International Committee on Taxonomy of Viruses (ICTV) sequence-related criteria for delineation of species within the genus Marafivirus, the virus qualifies as a member of a new species, and the name Switchgrass mosaic virus (SwMV) is proposed.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
International Nuclear Information System (INIS)
Lo, A.; Yang, H.L.
1990-01-01
This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described
cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs
Energy Technology Data Exchange (ETDEWEB)
Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K
1983-01-01
Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.
The nucleotide sequence of a Polish isolate of Tomato torrado virus.
Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk
2008-12-01
A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.
Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei
2013-10-01
The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.
The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.
Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F
1992-12-01
The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
Energy Technology Data Exchange (ETDEWEB)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Complete sequence of Fig fleck-associated virus, a novel member of the family Tymoviridae.
Elbeaino, Toufic; Digiaro, Michele; Martelli, Giovanni P
2011-11-01
The complete nucleotide sequence and the genome organization were determined of a novel virus, tentatively named Fig fleck-associated virus (FFkaV). The viral genome is a positive-sense, single-stranded RNA 7046 nucleotides in size excluding the 3'-terminal poly(A) tract, and comprising two open reading frames. ORF1 encodes a polypeptide of 2161 amino acids (p240), which contains the signatures of replication-associated proteins and the coat protein cistron (p24) at its 3' end. ORF2 codes for a 461 amino acid protein (p50) identified as a putative movement proteins (MP). In phylogenetic trees constructed with sequences of the putative polymerase and CP proteins FFkaV consistently groups with members of the genus Maculavirus, family Tymoviridae. However, the genome organization diverges from that of the two completely sequenced maculaviruses, Grapevine fleck virus (GFkV) and Bombix mori Macula-like virus (BmMLV), as it exhibits a structure resembling that of Maize rayado fino virus (MRFV), the type species of the genus Marafivirus and of Olive latent virus 3 (OLV-3), an unclassified virus in the family Tymoviridae. FFkaV was found in field-grown figs from six Mediterranean countries with an incidence ranging from 15% to 25%. Copyright © 2011 Elsevier B.V. All rights reserved.
Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus
The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3’-terminal poly (A) tail, containing a single open reading frame (ORF) encoding a large polyprotein. The virus shares 52.1-69.7%...
Complete Genomic Sequence of Border Disease Virus, a Pestivirus from Sheep
Becher, Paul; Orlich, Michaela; Thiel, Heinz-Jürgen
1998-01-01
The genus Pestivirus of the family Flaviviridae comprises three established species, namely, bovine viral diarrhea virus (BVDV), classical swine fever virus (CSFV), and border disease virus from sheep (BDV). In this study, we report the first complete nucleotide sequence of BDV, that of strain X818. The genome is 12,333 nucleotides long and contains one long open reading frame encoding 3,895 amino acids. The 5′ noncoding region (NCR) of BDV X818 consists of 372 nucleotides and is thus similar in length to the 5′ NCR reported for other pestiviruses. The 3′ NCR of X818 is 273 nucleotides long and thereby at least 32 nucleotides longer than the 3′ NCR of pestiviruses analyzed thus far. Within the 3′ NCR of BDV X818, the sequence motif TATTTATTTA was identified at four locations. The same repeat was found at two or three locations within the 3′ NCR of different CSFV isolates but was absent in the 3′ NCR of BVDV. Analysis of five additional BDV strains showed that the 3′ NCR sequences are highly conserved within this species. Comparison of the deduced amino acid sequence of X818 with the ones of other pestiviruses allowed the prediction of polyprotein cleavage sites which were conserved with regard to the structural proteins. It has been reported for two BVDV strains that cleavage at the nonstructural (NS) protein sites 3/4A, 4A/4B, 4B/5A, and 5A/5B is mediated by the NS3 serine protease and for each site a conserved leucine was found at the P1 position followed by either serine or alanine at P1′ (N. Tautz, K. Elbers, D. Stoll, G. Meyers, and H.-J. Thiel, J. Virol. 71:5415–5422, 1997; J. Xu, E. Mendez, P. R. Caron, C. Lin, M. A. Murcko, M. S. Collett, and C. M. Rice, J. Virol. 71:5312–5322). Interestingly, P1′ of the predicted NS5A/5B cleavage site of BDV is represented by an asparagine residue. Transient expression studies demonstrated that this unusual NS5A/5B processing site is efficiently cleaved by the NS3 serine protease of BDV. PMID
Complete genome sequence of a divergent strain of lettuce chlorosis virus from Periwinkle in China
A novel strain of Lettuce chlorosis virus (LCV) was identified from periwinkle in China (PW) with foliar interveinal chlorosis and plant dwarfing. Complete nucleotide (nt) sequences of genomic RNA1 and RNA2 of the virus are 8,602 nt and 8,456 nt, respectively. The genomic organization of LCV-PW rese...
Energy Technology Data Exchange (ETDEWEB)
Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R
1986-01-24
The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.
Directory of Open Access Journals (Sweden)
Meiler Arno
2012-09-01
Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
[Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].
Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong
2008-05-01
One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.
Complete Genome Sequence of Zucchini Yellow Mosaic Virus Strain Kurdistan, Iran.
Maghamnia, Hamid Reza; Hajizadeh, Mohammad; Azizi, Abdolbaset
2018-03-01
The complete genome sequence of Zucchini yellow mosaic virus strain Kurdistan (ZYMV-Kurdistan) infecting squash from Iran was determined from 13 overlapping fragments. Excluding the poly (A) tail, ZYMV-Kurdistan genome consisted of 9593 nucleotides (nt), with 138 and 211 nt at the 5' and 3' non-translated regions, respectively. It contained two open-reading frames (ORFs), the large ORF encoding a polyprotein of 3080 amino acids (aa) and the small overlapping ORF encoding a P3N-PIPO protein of 74 aa. This isolate had six unique aa differences compared to other ZYMV isolates and shared 79.6-98.8% identities with other ZYMV genome sequences at the nt level and 90.1-99% identities at the aa level. A phylogenetic tree of ZYMV complete genomic sequences showed that Iranian and Central European isolates are closely related and form a phylogenetically homogenous group. All values in the ratio of substitution rates at non-synonymous and synonymous sites ( d N / d S ) were below 1, suggestive of strong negative selection forces during ZYMV protein history. This is the first report of complete genome sequence information of the most prevalent virus in the west of Iran. This study helps our understanding of the genetic diversity of ZYMV isolates infecting cucurbit plants in Iran, virus evolution and epidemiology and can assist in designing better diagnostic tools.
Complete genome sequence of a proposed new tymovirus, tomato blistering mosaic virus.
Nicolini, Cícero; Inoue-Nagata, Alice Kazuko; Nagata, Tatsuya
2015-02-01
In a previous work, a distinct tymovirus infecting tomato plants in Brazil was reported and tentatively named tomato blistering mosaic virus (ToBMV). In this study, the complete genome sequence of ToBMV was determined and shown to have a size of 6277 nucleotides and three ORFs: ORF 1 encodes the replication-complex polyprotein, ORF 2 the movement protein, and ORF 3 the coat protein. The cleavage sites of the replication-complex polyprotein (GS/LP and VAG/QSP) of ToBMV were predicted by alignment analysis of amino acid sequences of other tymoviruses. In the phylogenetic tree, ToBMV clustered with the tymoviruses that infect solanaceous hosts.
International Nuclear Information System (INIS)
Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.
2006-01-01
Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)
Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg
2008-09-01
A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.
Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme
2013-07-01
The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.
Complete nucleotide sequence and organization of the mitogenome ...
African Journals Online (AJOL)
STORAGESEVER
2010-02-01
Feb 1, 2010 ... In this study, the complete mitochondrial genome (mitogenome) of E. autonoe was .... skew” was calculated for the PCGs between two strands and the ..... codon stem and 7 bp in the anticodon loop, but also con- tained a ...
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-10-11
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.
Linares, Daniel M; Arboleya, Silvia; Ross, R Paul; Stanton, Catherine
2017-04-27
Here is presented the whole-genome sequence of Streptococcus thermophilus APC151, isolated from a marine fish. This bacterium produces gamma-aminobutyric acid (GABA) in high yields and is biotechnologically suitable to produce naturally GABA-enriched biofunctional yogurt. Its complete genome comprises 2,097 genes and 1,839,134 nucleotides, with an average G+C content of 39.1%. Copyright © 2017 Linares et al.
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11
International Nuclear Information System (INIS)
Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre
2003-01-01
The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome
L’Haridon, Stéphane
2018-01-17
We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.
L’ Haridon, Sté phane; Corre, Erwan; Guan, Yue; Vinu, Manikandan; La Cono, Violetta; Yakimov, Michail; Stingl, Ulrich; Toffin, Laurent; Jebbar, Mohamed
2018-01-01
We report here the complete genome sequence (2.08 Mb) of Methanohalophilus portucalensis strain FDF-1T, a halophilic methylotrophic methanogen isolated from the sediment of a saltern in Figeria da Foz, Portugal. The average nucleotide identity and DNA-DNA hybridization analyses show that Methanohalophilus mahii, M. halophilus, and M. portucalensis are three different species within the Methanosarcinaceae family.
Ali, Akhtar
2017-01-12
In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.
Equid herpesvirus 8: Complete genome sequence and association with abortion in mares
Garvey, Marie; Suárez, Nicolás M.; Kerr, Karen; Hector, Ralph; Moloney-Quinn, Laura; Arkins, Sean; Davison, Andrew J.
2018-01-01
Equid herpesvirus 8 (EHV-8), formerly known as asinine herpesvirus 3, is an alphaherpesvirus that is closely related to equid herpesviruses 1 and 9 (EHV-1 and EHV-9). The pathogenesis of EHV-8 is relatively little studied and to date has only been associated with respiratory disease in donkeys in Australia and horses in China. A single EHV-8 genome sequence has been generated for strain Wh in China, but is apparently incomplete and contains frameshifts in two genes. In this study, the complete genome sequences of four EHV-8 strains isolated in Ireland between 2003 and 2015 were determined by Illumina sequencing. Two of these strains were isolated from cases of abortion in horses, and were misdiagnosed initially as EHV-1, and two were isolated from donkeys, one with neurological disease. The four genome sequences are very similar to each other, exhibiting greater than 98.4% nucleotide identity, and their phylogenetic clustering together demonstrated that genomic diversity is not dependent on the host. Comparative genomic analysis revealed 24 of the 76 predicted protein sequences are completely conserved among the Irish EHV-8 strains. Evolutionary comparisons indicate that EHV-8 is phylogenetically closer to EHV-9 than it is to EHV-1. In summary, the first complete genome sequences of EHV-8 isolates from two host species over a twelve year period are reported. The current study suggests that EHV-8 can cause abortion in horses. The potential threat of EHV-8 to the horse industry and the possibility that donkeys may act as reservoirs of infection warrant further investigation. PMID:29414990
Umene, Kenichi; Shiraishi, Atsushi
2013-06-01
"Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.
Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H
2008-01-01
During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.
The complete genome sequence of the Atlantic salmon paramyxovirus (ASPV)
International Nuclear Information System (INIS)
Nylund, Stian; Karlsen, Marius; Nylund, Are
2008-01-01
The complete RNA genome of the Atlantic salmon paramyxovirus (ASPV), isolated from Atlantic salmon suffering from proliferative gill inflammation (PGI), has been determined. The genome is 16,965 nucleotides in length and consists of six nonoverlapping genes in the order 3'- N - P/C/V - M - F - HN - L -5', coding for the nucleocapsid, phospho-, matrix, fusion, hemagglutinin-neuraminidase and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and trinucleotide intergenic regions similar to those of other Paramyxoviridae. The ASPV P-gene expression strategy is like that of the respiro- and morbilliviruses, which express the phosphoprotein from the primary transcript, and edit a portion of the mRNA to encode the accessory proteins V and W. It also encodes the C-protein by ribosomal choice of translation initiation. Pairwise comparisons of amino acid identities, and phylogenetic analysis of deduced ASPV protein sequences with homologous sequences from other Paramyxoviridae, show that ASPV has an affinity for the genus Respirovirus, but may represent a new genus within the subfamily Paramyxovirinae
Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.
2005-01-01
The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that
Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)
International Nuclear Information System (INIS)
Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.
1994-01-01
The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs
Complete genome sequence of Menghai rhabdovirus, a novel mosquito-borne rhabdovirus from China.
Sun, Qiang; Zhao, Qiumin; An, Xiaoping; Guo, Xiaofang; Zuo, Shuqing; Zhang, Xianglilan; Pei, Guangqian; Liu, Wenli; Cheng, Shi; Wang, Yunfei; Shu, Peng; Mi, Zhiqiang; Huang, Yong; Zhang, Zhiyi; Tong, Yigang; Zhou, Hongning; Zhang, Jiusong
2017-04-01
Menghai rhabdovirus (MRV) was isolated from Aedes albopictus in Menghai county of Yunnan Province, China, in August 2010. Whole-genome sequencing of MRV was performed using an Ion PGM™ Sequencer. We found that MRV is a single-stranded, negative-sense RNA virus. The complete genome of MRV has 10,744 nt, with short inverted repeat termini, encoding five typical rhabdovirus proteins (N, P, M, G, and L) and an additional small hypothetical protein. Nucleotide BLAST analysis using the BLASTn method showed that the genome sequence most similar to that of MRV is that of Arboretum virus (NC_025393.1), with a Max score of 322, query coverage of 14%, and 66% identity. Genomic and phylogenetic analyses both demonstrated that MRV should be considered a member of a novel species of the family Rhabdoviridae.
Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses
Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.
2004-01-01
The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.
DEFF Research Database (Denmark)
Defoor, Els Marie Celine; Martinussen, Jan
A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...
Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen
2013-01-01
The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).
Directory of Open Access Journals (Sweden)
Elizabeth N. Krueger
2013-07-01
Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.
A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius.
Directory of Open Access Journals (Sweden)
Ceiridwen J Edwards
Full Text Available BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer. In total, 289.9 megabases (22.48% of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously
A complete mitochondrial genome sequence from a mesolithic wild aurochs (Bos primigenius).
LENUS (Irish Health Repository)
Edwards, Ceiridwen J
2010-01-01
BACKGROUND: The derivation of domestic cattle from the extinct wild aurochs (Bos primigenius) has been well-documented by archaeological and genetic studies. Genetic studies point towards the Neolithic Near East as the centre of origin for Bos taurus, with some lines of evidence suggesting possible, albeit rare, genetic contributions from locally domesticated wild aurochsen across Eurasia. Inferences from these investigations have been based largely on the analysis of partial mitochondrial DNA sequences generated from modern animals, with limited sequence data from ancient aurochsen samples. Recent developments in DNA sequencing technologies, however, are affording new opportunities for the examination of genetic material retrieved from extinct species, providing new insight into their evolutionary history. Here we present DNA sequence analysis of the first complete mitochondrial genome (16,338 base pairs) from an archaeologically-verified and exceptionally-well preserved aurochs bone sample. METHODOLOGY: DNA extracts were generated from an aurochs humerus bone sample recovered from a cave site located in Derbyshire, England and radiocarbon-dated to 6,738+\\/-68 calibrated years before present. These extracts were prepared for both Sanger and next generation DNA sequencing technologies (Illumina Genome Analyzer). In total, 289.9 megabases (22.48%) of the post-filtered DNA sequences generated using the Illumina Genome Analyzer from this sample mapped with confidence to the bovine genome. A consensus B. primigenius mitochondrial genome sequence was constructed and was analysed alongside all available complete bovine mitochondrial genome sequences. CONCLUSIONS: For all nucleotide positions where both Sanger and Illumina Genome Analyzer sequencing methods gave high-confidence calls, no discrepancies were observed. Sequence analysis reveals evidence of heteroplasmy in this sample and places this mitochondrial genome sequence securely within a previously identified
Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.; Afonso, Claudio L.
2017-01-01
ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related.
Complete cDNA sequence coding for human docking protein
Energy Technology Data Exchange (ETDEWEB)
Hortsch, M; Labeit, S; Meyer, D I
1988-01-11
Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.
Goraichuk, Iryna V.; Dimitrov, Kiril M.; Sharma, Poonam; Miller, Patti J.; Swayne, David E.; Suarez, David L.
2017-01-01
ABSTRACT The first complete genome sequences of four avian paramyxovirus serotype 10 (APMV-10) isolates are described here. The viruses were isolated from rockhopper penguins on the Falkland Islands, sampled in 2007. All four genomes are 15,456 nucleotides in length, and phylogenetic analyses show them to be closely related. PMID:28572332
Directory of Open Access Journals (Sweden)
Shui-Lian He
Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Nouri, Shahideh; Salem, Nid?; Falk, Bryce W.
2016-01-01
We present here the complete nucleotide sequence and genome organization of a novel putative RNA virus identified in field populations of the Asian citrus psyllid, Diaphorina citri, through sequencing of the transcriptome followed by reverse transcription-PCR (RT-PCR). We tentatively named this virus Diaphorina citri-associated C virus (DcACV). DcACV is an unclassified positive-sense RNA virus.
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Complete sequence of RNA1 of grapevine Anatolian ringspot virus.
Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic
2012-10-01
The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.
Nouri, Shahideh; Salem, Nidà; Falk, Bryce W
2016-07-21
We present here the complete nucleotide sequence and genome organization of a novel putative RNA virus identified in field populations of the Asian citrus psyllid, Diaphorina citri, through sequencing of the transcriptome followed by reverse transcription-PCR (RT-PCR). We tentatively named this virus Diaphorina citri-associated C virus (DcACV). DcACV is an unclassified positive-sense RNA virus. Copyright © 2016 Nouri et al.
Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing
2009-08-01
Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers
Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito
2017-12-01
The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Cheng-Chong Chou
2004-11-01
Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.
The complete sequence of the mitochondrial genome of the African Penguin (Spheniscus demersus).
Labuschagne, Christiaan; Kotzé, Antoinette; Grobler, J Paul; Dalton, Desiré L
2014-01-15
The complete mitochondrial genome of the African Penguin (Spheniscus demersus) was sequenced. The molecule was sequenced via next generation sequencing and primer walking. The size of the genome is 17,346 bp in length. Comparison with the mitochondrial DNA of two other penguin genomes that have so far been reported was conducted namely; Little blue penguin (Eudyptula minor) and the Rockhopper penguin (Eudyptes chrysocome). This analysis made it possible to identify common penguin mitochondrial DNA characteristics. The S. demersus mtDNA genome is very similar, both in composition and length to both the E. chrysocome and E. minor genomes. The gene content of the African penguin mitochondrial genome is typical of vertebrates and all three penguin species have the standard gene order originally identified in the chicken. The control region for S. demersus is located between tRNA-Glu and tRNA-Phe and all three species of penguins contain two sets of similar repeats with varying copy numbers towards the 3' end of the control region, accounting for the size variance. This is the first report of the complete nucleotide sequence for the mitochondrial genome of the African penguin, S. demersus. These results can be subsequently used to provide information for penguin phylogenetic studies and insights into the evolution of genomes. © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Yu-Hoon Kim
2014-01-01
Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.
Directory of Open Access Journals (Sweden)
Tautz Diethard
2002-03-01
Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.
Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban
2010-11-01
Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.
Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Madura, K.; Prakash, S.
1986-01-01
The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
Czech Academy of Sciences Publication Activity Database
Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.
2006-01-01
Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006
Matsumura, Emilyn E.; Nerva, Luca; Nigg, Jared C.; Falk, Bryce W.; Nouri, Shahideh
2016-01-01
A novel flavi-like virus tentatively named Diaphorina citri flavi-like virus (DcFLV) was identified in field populations of Diaphorina citri through small RNA and transcriptome sequencing followed by reverse transcription (RT)-PCR. We report here the complete nucleotide sequence and genome organization of DcFLV, the largest flavi-like virus identified to date.
Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal A; Gröne, Andrea; Kik, Marja J L
2017-01-01
Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the
Saucedo, Bernardo; Hughes, Joseph; Beurden, van Steven J.; Suárez, Nicolás M.; Haenen, Olga L.M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kika, Marja J.L.
2017-01-01
Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the
Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing
2010-01-01
Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses
Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik
2016-12-01
Here, we present the 3,795,952 bp complete genome sequence of the biofilm-forming Curtobacterium sp. strain BH-2-1-1, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017580.
A first report and complete genome sequence of alfalfa enamovirus from Sudan
A full genome sequence of a viral pathogen, provisionally named alfalfa enamovirus 2 (AEV-2), was reconstructed from short reads obtained by Illumina RNA sequencing of alfalfa sample originating from Sudan. Ambiguous nucleotides in the resultant consensus assembly and identity of the predicted virus...
The first complete chloroplast genome sequence of a lycophyte,Huperzia lucidula (Lycopodiaceae)
Energy Technology Data Exchange (ETDEWEB)
Wolf, Paul G.; Karol, Kenneth G.; Mandoli, Dina F.; Kuehl,Jennifer V.; Arumuganathan, K.; Ellis, Mark W.; Mishler, Brent D.; Kelch,Dean G.; Olmstead, Richard G.; Boore, Jeffrey L.
2005-02-01
We used a unique combination of techniques to sequence the first complete chloroplast genome of a lycophyte, Huperzia lucidula. This plant belongs to a significant clade hypothesized to represent the sister group to all other vascular plants. We used fluorescence-activated cell sorting (FACS) to isolate the organelles, rolling circle amplification (RCA) to amplify the genome, and shotgun sequencing to 8x depth coverage to obtain the complete chloroplast genome sequence. The genome is 154,373bp, containing inverted repeats of 15,314 bp each, a large single-copy region of 104,088 bp, and a small single-copy region of 19,671 bp. Gene order is more similar to those of mosses, liverworts, and hornworts than to gene order for other vascular plants. For example, the Huperziachloroplast genome possesses the bryophyte gene order for a previously characterized 30 kb inversion, thus supporting the hypothesis that lycophytes are sister to all other extant vascular plants. The lycophytechloroplast genome data also enable a better reconstruction of the basaltracheophyte genome, which is useful for inferring relationships among bryophyte lineages. Several unique characters are observed in Huperzia, such as movement of the gene ndhF from the small single copy region into the inverted repeat. We present several analyses of evolutionary relationships among land plants by using nucleotide data, amino acid sequences, and by comparing gene arrangements from chloroplast genomes. The results, while still tentative pending the large number of chloroplast genomes from other key lineages that are soon to be sequenced, are intriguing in themselves, and contribute to a growing comparative database of genomic and morphological data across the green plants.
Energy Technology Data Exchange (ETDEWEB)
von Nickisch-Rosenegk, Markus; Brown, Wesley M.; Boore, Jeffrey L.
2001-01-01
Using ''long-PCR'' we have amplified in overlapping fragments the complete mitochondrial genome of the tapeworm Hymenolepis diminuta (Platyhelminthes: Cestoda) and determined its 13,900 nucleotide sequence. The gene content is the same as that typically found for animal mitochondrial DNA (mtDNA) except that atp8 appears to be lacking, a condition found previously for several other animals. Despite the small size of this mtDNA, there are two large non-coding regions, one of which contains 13 repeats of a 31 nucleotide sequence and a potential stem-loop structure of 25 base pairs with an 11-member loop. Large potential secondary structures are identified also for the non-coding regions of two other cestode mtDNAs. Comparison of the mitochondrial gene arrangement of H. diminuta with those previously published supports a phylogenetic position of flatworms as members of the Eutrochozoa, rather than being basal to either a clade of protostomes or a clade of coelomates.
First complete genome sequence of canine bocavirus 2 in mainland China
Directory of Open Access Journals (Sweden)
S.-L. Zhai
2017-07-01
Full Text Available We obtained the first full-length genome sequence of canine bocavirus 2 (CBoV2 from the faeces of a healthy dog in Guangzhou city, Guangdong province, mainland China. The genome of GZHD15 consisted of 5059 nucleotides. Sequence analysis suggested that GZHD15 was close to a previously circulated Hong Kong isolate.
Directory of Open Access Journals (Sweden)
Mandoli Dina F
2010-10-01
Full Text Available Abstract Background Despite considerable progress in our understanding of land plant phylogeny, several nodes in the green tree of life remain poorly resolved. Furthermore, the bulk of currently available data come from only a subset of major land plant clades. Here we examine early land plant evolution using complete plastome sequences including two previously unexamined and phylogenetically critical lineages. To better understand the evolution of land plants and their plastomes, we examined aligned nucleotide sequences, indels, gene and nucleotide composition, inversions, and gene order at the boundaries of the inverted repeats. Results We present the plastome sequences of Equisetum arvense, a horsetail, and of Isoetes flaccida, a heterosporous lycophyte. Phylogenetic analysis of aligned nucleotides from 49 plastome genes from 43 taxa supported monophyly for the following clades: embryophytes (land plants, lycophytes, monilophytes (leptosporangiate ferns + Angiopteris evecta + Psilotum nudum + Equisetum arvense, and seed plants. Resolution among the four monilophyte lineages remained moderate, although nucleotide analyses suggested that P. nudum and E. arvense form a clade sister to A. evecta + leptosporangiate ferns. Results from phylogenetic analyses of nucleotides were consistent with the distribution of plastome gene rearrangements and with analysis of sequence gaps resulting from insertions and deletions (indels. We found one new indel and an inversion of a block of genes that unites the monilophytes. Conclusions Monophyly of monilophytes has been disputed on the basis of morphological and fossil evidence. In the context of a broad sampling of land plant data we find several new pieces of evidence for monilophyte monophyly. Results from this study demonstrate resolution among the four monilophytes lineages, albeit with moderate support; we posit a clade consisting of Equisetaceae and Psilotaceae that is sister to the "true ferns
Directory of Open Access Journals (Sweden)
Boulund Fredrik
2012-12-01
Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.
Complete sequencing of five araliaceae chloroplast genomes and the phylogenetic implications.
Directory of Open Access Journals (Sweden)
Rong Li
Full Text Available BACKGROUND: The ginseng family (Araliaceae includes a number of economically important plant species. Previously phylogenetic studies circumscribed three major clades within the core ginseng plant family, yet the internal relationships of each major group have been poorly resolved perhaps due to rapid radiation of these lineages. Recent studies have shown that phyogenomics based on chloroplast genomes provides a viable way to resolve complex relationships. METHODOLOGY/PRINCIPAL FINDINGS: We report the complete nucleotide sequences of five Araliaceae chloroplast genomes using next-generation sequencing technology. The five chloroplast genomes are 156,333-156,459 bp in length including a pair of inverted repeats (25,551-26,108 bp separated by the large single-copy (86,028-86,566 bp and small single-copy (18,021-19,117 bp regions. Each chloroplast genome contains the same 114 unique genes consisting of 30 transfer RNA genes, four ribosomal RNA genes, and 80 protein coding genes. Gene size, content, and order, AT content, and IR/SC boundary structure are similar among all Araliaceae chloroplast genomes. A total of 140 repeats were identified in the five chloroplast genomes with palindromic repeat as the most common type. Phylogenomic analyses using parsimony, likelihood, and Bayesian inference based on the complete chloroplast genomes strongly supported the monophyly of the Asian Palmate group and the Aralia-Panax group. Furthermore, the relationships among the sampled taxa within the Asian Palmate group were well resolved. Twenty-six DNA markers with the percentage of variable sites higher than 5% were identified, which may be useful for phylogenetic studies of Araliaceae. CONCLUSION: The chloroplast genomes of Araliaceae are highly conserved in all aspects of genome features. The large-scale phylogenomic data based on the complete chloroplast DNA sequences is shown to be effective for the phylogenetic reconstruction of Araliaceae.
[Complete genome sequencing and sequence analysis of BCG Tice].
Wang, Zhiming; Pan, Yuanlong; Wu, Jun; Zhu, Baoli
2012-10-04
The objective of this study is to obtain the complete genome sequence of Bacillus Calmette-Guerin Tice (BCG Tice), in order to provide more information about the molecular biology of BCG Tice and design more reasonable vaccines to prevent tuberculosis. We assembled the data from high-throughput sequencing with SOAPdenovo software, with many contigs and scaffolds obtained. There are many sequence gaps and physical gaps remained as a result of regional low coverage and low quality. We designed primers at the end of contigs and performed PCR amplification in order to link these contigs and scaffolds. With various enzymes to perform PCR amplification, adjustment of PCR reaction conditions, and combined with clone construction to sequence, all the gaps were finished. We obtained the complete genome sequence of BCG Tice and submitted it to GenBank of National Center for Biotechnology Information (NCBI). The genome of BCG Tice is 4334064 base pairs in length, with GC content 65.65%. The problems and strategies during the finishing step of BCG Tice sequencing are illuminated here, with the hope of affording some experience to those who are involved in the finishing step of genome sequencing. The microarray data were verified by our results.
Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.
Dunn, Joshua G; Weissman, Jonathan S
2016-11-22
Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily
Matsumura, Emilyn E; Nerva, Luca; Nigg, Jared C; Falk, Bryce W; Nouri, Shahideh
2016-09-08
A novel flavi-like virus tentatively named Diaphorina citri flavi-like virus (DcFLV) was identified in field populations of Diaphorina citri through small RNA and transcriptome sequencing followed by reverse transcription (RT)-PCR. We report here the complete nucleotide sequence and genome organization of DcFLV, the largest flavi-like virus identified to date. Copyright © 2016 Matsumura et al.
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Complete genome sequence of a novel hypovirus infecting Phomopsis longicolla
Czech Academy of Sciences Publication Activity Database
Koloniuk, Igor; El-Habbak, M.H.; Petrzik, Karel; Ghabrial, S.A.
2014-01-01
Roč. 159, č. 7 (2014), s. 1861-1863 ISSN 0304-8608 R&D Projects: GA MŠk(CZ) EE2.3.30.0032 Institutional support: RVO:60077344 Keywords : Fungus * Phomopsis longicolla * Nucleotide sequence Subject RIV: EE - Microbiology, Virology Impact factor: 2.390, year: 2014
Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.
2016-01-01
Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II. PMID:27469959
Wajid, Abdul; Rehmani, Shafqat F.; Wasim, Muhammad; Basharat, Asma; Bibi, Tasra; Arif, Saima; Dimitrov, Kiril M.; Afonso, Claudio L.
2016-01-01
Here, we report the complete genome sequence of a virulent Newcastle disease virus (vNDV) strain, duck/Pakistan/Lahore/AW-123/2015, isolated from apparently healthy laying ducks (Anas platyrhynchos domesticus) from the province of Punjab, Pakistan. The virus has a genome length of 15,192 nucleotides and is classified as member of subgenotype VIIi, class II.
Directory of Open Access Journals (Sweden)
Michal Strouhal
2017-09-01
Full Text Available Treponema pallidum subsp. pertenue (TPE is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier and one TPE strain (Fribourg-Blanc isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet.Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively. Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation.The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.
Nucleotide sequence of the human N-myc gene
International Nuclear Information System (INIS)
Stanton, L.W.; Schwab, M.; Bishop, J.M.
1986-01-01
Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions
Hatono, Saki; Nishimura, Kaori; Murakami, Yoko; Tsujimura, Mai; Yamagishi, Hiroshi
2017-09-01
The complete sequence of the mitochondrial genome was determined for two cultivars of Brassica rapa . After determining the sequence of a Chinese cabbage variety, 'Oushou hakusai', the sequence of a mizuna variety, 'Chusei shiroguki sensuji kyomizuna', was mapped against the sequence of Chinese cabbage. The precise sequences where the two varieties demonstrated variation were ascertained by direct sequencing. It was found that the mitochondrial genomes of the two varieties are identical over 219,775 bp, with a single nucleotide polymorphism (SNP) between the genomes. Because B. rapa is the maternal species of an amphidiploid crop species, Brassica juncea , the distribution of the SNP was observed both in B. rapa and B. juncea . While the mizuna type SNP was restricted mainly to cultivars of mizuna (japonica group) in B. rapa , the mizuna type was widely distributed in B. juncea . The finding that the two Brassica species have these SNP types in common suggests that the nucleotide substitution occurred in wild B. rapa before both mitotypes were domesticated. It was further inferred that the interspecific hybridization between B. rapa and B. nigra took place twice and resulted in the two mitotypes of cultivated B. juncea .
Nucleotide sequence alignment of hdcA from Gram-positive bacteria.
Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A
2016-03-01
The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
2010-07-01
... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...
Yao, Xiaohong; Tang, Ping; Li, Zuozhou; Li, Dawei; Liu, Yifei; Huang, Hongwen
2015-01-01
Actinidia chinensis is an important economic plant belonging to the basal lineage of the asterids. Availability of a complete Actinidia chloroplast genome sequence is crucial to understanding phylogenetic relationships among major lineages of angiosperms and facilitates kiwifruit genetic improvement. We report here the complete nucleotide sequences of the chloroplast genomes for Actinidia chinensis and A. chinensis var deliciosa obtained through de novo assembly of Illumina paired-end reads produced by total DNA sequencing. The total genome size ranges from 155,446 to 157,557 bp, with an inverted repeat (IR) of 24,013 to 24,391 bp, a large single copy region (LSC) of 87,984 to 88,337 bp and a small single copy region (SSC) of 20,332 to 20,336 bp. The genome encodes 113 different genes, including 79 unique protein-coding genes, 30 tRNA genes and 4 ribosomal RNA genes, with 16 duplicated in the inverted repeats, and a tRNA gene (trnfM-CAU) duplicated once in the LSC region. Comparisons of IR boundaries among four asterid species showed that IR/LSC borders were extended into the 5' portion of the psbA gene and IR contraction occurred in Actinidia. The clap gene has been lost from the chloroplast genome in Actinidia, and may have been transferred to the nucleus during chloroplast evolution. Twenty-seven polymorphic simple sequence repeat (SSR) loci were identified in the Actinidia chloroplast genome. Maximum parsimony analyses of a 72-gene, 16 taxa angiosperm dataset strongly support the placement of Actinidiaceae in Ericales within the basal asterids.
Base Sequence Context Effects on Nucleotide Excision Repair
Directory of Open Access Journals (Sweden)
Yuqin Cai
2010-01-01
Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.
Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal; Gröne, Andrea; Kik, Marja J L
2017-08-31
Frog virus 3 was isolated from a strawberry poison frog ( Oophaga pumilio ) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op /2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the reference Frog virus 3 isolate. Copyright © 2017 Saucedo et al.
Wen, Chiu-Ming
2017-08-01
An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.
Ruhlman, Tracey; Lee, Seung-Bum; Jansen, Robert K; Hostetler, Jessica B; Tallon, Luke J; Town, Christopher D; Daniell, Henry
2006-08-31
Carrot (Daucus carota) is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats > or = 30 bp with a sequence identity > or = 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP) and maximum likelihood (ML) were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap) for the sister relationship of Daucus with Panax in the euasterid II clade. These
Directory of Open Access Journals (Sweden)
Ruhlman Tracey
2006-08-01
Full Text Available Abstract Background Carrot (Daucus carota is a major food crop in the US and worldwide. Its capacity for storage and its lifecycle as a biennial make it an attractive species for the introduction of foreign genes, especially for oral delivery of vaccines and other therapeutic proteins. Until recently efforts to express recombinant proteins in carrot have had limited success in terms of protein accumulation in the edible tap roots. Plastid genetic engineering offers the potential to overcome this limitation, as demonstrated by the accumulation of BADH in chromoplasts of carrot taproots to confer exceedingly high levels of salt resistance. The complete plastid genome of carrot provides essential information required for genetic engineering. Additionally, the sequence data add to the rapidly growing database of plastid genomes for assessing phylogenetic relationships among angiosperms. Results The complete carrot plastid genome is 155,911 bp in length, with 115 unique genes and 21 duplicated genes within the IR. There are four ribosomal RNAs, 30 distinct tRNA genes and 18 intron-containing genes. Repeat analysis reveals 12 direct and 2 inverted repeats ≥ 30 bp with a sequence identity ≥ 90%. Phylogenetic analysis of nucleotide sequences for 61 protein-coding genes using both maximum parsimony (MP and maximum likelihood (ML were performed for 29 angiosperms. Phylogenies from both methods provide strong support for the monophyly of several major angiosperm clades, including monocots, eudicots, rosids, asterids, eurosids II, euasterids I, and euasterids II. Conclusion The carrot plastid genome contains a number of dispersed direct and inverted repeats scattered throughout coding and non-coding regions. This is the first sequenced plastid genome of the family Apiaceae and only the second published genome sequence of the species-rich euasterid II clade. Both MP and ML trees provide very strong support (100% bootstrap for the sister relationship of
Detection of a divergent variant of grapevine virus F by next-generation sequencing.
Molenaar, Nicholas; Burger, Johan T; Maree, Hans J
2015-08-01
The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.
Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y
1998-07-01
An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.
Directory of Open Access Journals (Sweden)
Jie Cai
Full Text Available Tilia is an ecologically and economically important genus in the family Malvaceae. However, there is no complete plastid genome of Tilia sequenced to date, and the taxonomy of Tilia is difficult owing to frequent hybridization and polyploidization. A well-supported interspecific relationships of this genus is not available due to limited informative sites from the commonly used molecular markers. We report here the complete plastid genome sequences of four Tilia species determined by the Illumina technology. The Tilia plastid genome is 162,653 bp to 162,796 bp in length, encoding 113 unique genes and a total number of 130 genes. The gene order and organization of the Tilia plastid genome exhibits the general structure of angiosperms and is very similar to other published plastid genomes of Malvaceae. As other long-lived tree genera, the sequence divergence among the four Tilia plastid genomes is very low. And we analyzed the nucleotide substitution patterns and the evolution of insertions and deletions in the Tilia plastid genomes. Finally, we build a phylogeny of the four sampled Tilia species with high supports using plastid phylogenomics, suggesting that it is an efficient way to resolve the phylogenetic relationships of this genus.
Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo
2008-04-30
The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.
Zhang, Xiao-Yan; Xiang, Hai-Ying; Zhou, Cui-Ji; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2014-08-01
For brassica yellows virus (BrYV), proposed to be a member of a new polerovirus species, two clearly distinct genotypes (BrYV-A and BrYV-B) have been described. In this study, the complete nucleotide sequences of two BrYV isolates from radish and Chinese cabbage were determined. Sequence analysis suggested that these isolates represent a new genotype, referred to here as BrYV-C. The full-length sequences of the two BrYV-C isolates shared 93.4-94.8 % identity with BrYV-A and BrYV-B. Further phylogenetic analysis showed that the BrYV-C isolates formed a subgroup that was distinct from the BrYV-A and BrYV-B isolates based on all of the proteins except P5.
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
Dees, Merete Wiken; Brurberg, May Bente; Lysøe, Erik
2017-03-01
The genus Microbacterium contains bacteria that are ubiquitously distributed in various environments and includes plant-associated bacteria that are able to colonize tissue of agricultural crop plants. Here, we report the 3,508,491 bp complete genome sequence of Microbacterium sp. strain BH-3-3-3, isolated from conventionally grown lettuce ( Lactuca sativa ) from a field in Vestfold, Norway. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession CP017674.
Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum
Directory of Open Access Journals (Sweden)
White Frank F
2011-07-01
Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.
International Nuclear Information System (INIS)
Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.
1987-01-01
Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2
Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A
1997-05-01
The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.
Sailaja, B; Anjum, Najreen; Patil, Yogesh K; Agarwal, Surekha; Malathi, P; Krishnaveni, D; Balachandran, S M; Viraktamath, B C; Mangrauthia, Satendra K
2013-12-01
In this study, complete genome of a south Indian isolate of Rice tungro spherical virus (RTSV) from Andhra Pradesh (AP) was sequenced, and the predicted amino acid sequence was analysed. The RTSV RNA genome consists of 12,171 nt without the poly(A) tail, encoding a putative typical polyprotein of 3,470 amino acids. Furthermore, cleavage sites and sequence motifs of the polyprotein were predicted. Multiple alignment with other RTSV isolates showed a nucleotide sequence identity of 95% to east Indian isolates and 90% to Philippines isolates. A phylogenetic tree based on complete genome sequence showed that Indian isolates clustered together, while Vt6 and PhilA isolates of Philippines formed two separate clusters. Twelve recombination events were detected in RNA genome of RTSV using the Recombination Detection Program version 3. Recombination analysis suggested significant role of 5' end and central region of genome in virus evolution. Further, AP and Odisha isolates appeared as important RTSV isolates involved in diversification of this virus in India through recombination phenomenon. The new addition of complete genome of first south Indian isolate provided an opportunity to establish the molecular evolution of RTSV through recombination analysis and phylogenetic relationship.
The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.
Directory of Open Access Journals (Sweden)
Fang Lü
Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.
From Sequence to Morphology - Long-Range Correlations in Complete Sequenced Genomes
T.A. Knoch (Tobias)
2004-01-01
textabstractThe largely unresolved sequential organization, i.e. the relations within DNA sequences, and its connection to the three-dimensional organization of genomes was investigated by correlation analyses of completely sequenced chromosomes from Viroids, Archaea, Bacteria, Arabidopsis
Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1
Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef
The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for
Macey, J Robert; Papenfuss, Theodore J; Kuehl, Jennifer V; Fourcade, H Mathew; Boore, Jeffrey L
2004-10-01
Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in Bipes biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with the block cob, trnT, trnP, as they are in birds.
Energy Technology Data Exchange (ETDEWEB)
Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.
2004-05-19
Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.
International Nuclear Information System (INIS)
Deen, K.C.; Sweet, R.W.
1986-01-01
Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1987-01-01
The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes
Sánchez-Navarro, J A; Pallás, V
1997-01-01
The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.
Directory of Open Access Journals (Sweden)
Zhu Yuan-Mao
2011-12-01
Full Text Available Abstract Background Bovine adenovirus type 3 (BAV-3 belongs to the Mastadenovirus genus of the family Adenoviridae and is involved in respiratory and enteric infections of calves. The isolation of BAV-3 has not been reported prior to this study in China. In 2009, there were many cases in cattle showing similar clinical signs to BAV-3 infection and a virus strain, showing cytopathic effect in Madin-Darby bovine kidney cells, was isolated from a bovine nasal swab collected from feedlot cattle in Heilongjiang Province, China. The isolate was confirmed as a bovine adenovirus type 3 by PCR and immunofluorescence assay, and named as HLJ0955. So far only the complete genome sequence of prototype of BAV-3 WBR-1 strain has been reported. In order to further characterize the Chinese isolate HLJ0955, the complete genome sequence of HLJ0955 was determined. Results The size of the genome of the Chinese isolate HLJ0955 is 34,132 nucleotides in length with a G+C content of 53.6%. The coding sequences for gene regions of HLJ0955 isolate were similar to the prototype of BAV-3 WBR-1 strain, with 80.0-98.6% nucleotide and 87.5-98.8% amino acid identities. The genome of HLJ0955 strain contains 16 regions and four deletions in inverted terminal repeats, E1B region and E4 region, respectively. The complete genome and DNA binding protein gene based phylogenetic analysis with other adenoviruses were performed and the results showed that HLJ0955 isolate belonged to BAV-3 and clustered within the Mastadenovirus genus of the family Adenoviridae. Conclusions This is the first study to report the isolation and molecular characterization of BAV-3 from cattle in China. The phylogenetic analysis performed in this study supported the use of the DNA binding protein gene of adenovirus as an appropriate subgenomic target for the classification of different genuses of the family Adenoviridae on the molecular basis. Meanwhile, a large-scale pathogen and serological epidemiological
Complete Chloroplast Genome Sequences and Comparative Analysis of Chenopodium quinoa and C. album.
Hong, Su-Young; Cheon, Kyeong-Sik; Yoo, Ki-Oug; Lee, Hyun-Oh; Cho, Kwang-Soo; Suh, Jong-Taek; Kim, Su-Jeong; Nam, Jeong-Hwan; Sohn, Hwang-Bae; Kim, Yul-Ho
2017-01-01
The Chenopodium genus comprises ~150 species, including Chenopodium quinoa and Chenopodium album , two important crops with high nutritional value. To elucidate the phylogenetic relationship between the two species, the complete chloroplast (cp) genomes of these species were obtained by next generation sequencing. We performed comparative analysis of the sequences and, using InDel markers, inferred phylogeny and genetic diversity of the Chenopodium genus. The cp genome is 152,099 bp ( C. quinoa ) and 152,167 bp ( C. album ) long. In total, 119 genes (78 protein-coding, 37 tRNA, and 4 rRNA) were identified. We found 14 ( C. quinoa ) and 15 ( C. album ) tandem repeats (TRs); 14 TRs were present in both species and C. album and C. quinoa each had one species-specific TR. The trnI-GAU intron sequences contained one ( C. quinoa ) or two ( C. album ) copies of TRs (66 bp); the InDel marker was designed based on the copy number variation in TRs. Using the InDel markers, we detected this variation in the TR copy number in four species, Chenopodium hybridum, Chenopodium pumilio, Chenopodium ficifolium , and Chenopodium koraiense , but not in Chenopodium glaucum . A comparison of coding and non-coding regions between C. quinoa and C. album revealed divergent sites. Nucleotide diversity >0.025 was found in 17 regions-14 were located in the large single copy region (LSC), one in the inverted repeats, and two in the small single copy region (SSC). A phylogenetic analysis based on 59 protein-coding genes from 25 taxa resolved Chenopodioideae monophyletic and sister to Betoideae. The complete plastid genome sequences and molecular markers based on divergence hotspot regions in the two Chenopodium taxa will help to resolve the phylogenetic relationships of Chenopodium .
Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.
Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng
2017-07-01
The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.
Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor
International Nuclear Information System (INIS)
Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.
1987-01-01
Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2
The Complete Sequence of a Human Parainfluenzavirus 4 Genome
Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond
2009-01-01
Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536
The Complete Sequence of a Human Parainfluenzavirus 4 Genome
Directory of Open Access Journals (Sweden)
Carmen Yea
2009-06-01
Full Text Available Although the human parainfluenza virus 4 (HPIV4 has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada. The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97% with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized.
Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji
2015-04-01
Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Directory of Open Access Journals (Sweden)
Francesca Bertolini
Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
Steenbergh, P.H.; Sussenbach, J.S.
The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the
Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.
Liljeström, P L; Liljeström, P
1987-01-01
Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
2010-07-01
... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Palindromic nucleotide analysis in human T cell receptor rearrangements.
Directory of Open Access Journals (Sweden)
Santosh K Srivastava
Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2012-07-01
We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.
Kuznedelov, K D; Timoshkin, O A
1995-01-01
Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun
2016-03-01
The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.
Complete genome sequences of six measles virus strains
Phan, M.V.T. (My V.T.); C.M.E. Schapendonk (Claudia); B.B. Oude Munnink (Bas B.); M.P.G. Koopmans D.V.M. (Marion); R.L. de Swart (Rik); Cotten, M. (Matthew)
2018-01-01
textabstractGenetic characterization of wild-type measles virus (MV) strains is a critical component of measles surveillance and molecular epidemiology. We have obtained complete genome sequences of six MV strains belonging to different genotypes, using random-primed next generation sequencing.
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
RANDNA: a random DNA sequence generator.
Piva, Francesco; Principato, Giovanni
2006-01-01
Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.
Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús
2010-09-01
The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.
Directory of Open Access Journals (Sweden)
Yuki Furuse
2015-11-01
Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.
Directory of Open Access Journals (Sweden)
Annemieke Smet
Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of
Complete genome sequence of the first human parechovirus type 3 isolated in Taiwan
Directory of Open Access Journals (Sweden)
Jenn-Tzong Chang
2017-11-01
Full Text Available The first human parechovirus 3 (HPeV3 VGHKS-2007 in Taiwan was identified from a clinical specimen from a male infant. The entire genome of the HPeV3 isolate was sequenced and compared to known HPeV3 sequences. Genome alignment data showed that HPeV3 VGHKS-2007 shares the highest nucleotide identity, 99%, with the Japanese strain of HPeV3 1361K-162589-Yamagata-2008. All HPeV3 isolates possess at least 97% amino acid identity. The analysis of the genome sequence of HPeV3 VGHKS-2007 will facilitate future investigations of the epidemiology and pathogenicity of HPeV3 infection.
Zhao, Kaixi; Margaria, Paolo; Rosa, Cristina
2018-05-10
Impatiens necrotic spot orthotospovirus (INSV) can impact economically important ornamental plants and vegetables worldwide. Characterization studies on INSV are limited. For most INSV isolates, there are no complete genome sequences available. This lack of genomic information has a negative impact on the understanding of the INSV genetic diversity and evolution. Here we report the first complete nucleotide sequence of a US INSV isolate. INSV-UP01 was isolated from an impatiens in Pennsylvania, US. RT-PCR was used to clone its full-length genome and Vector NTI to assemble overlapping sequences. Phylogenetic trees were constructed by using MEGA7 software to show the phylogenetic relationships with other available INSV sequences worldwide. This US isolate has genome and biological features classical of INSV species and clusters in the Western Hemisphere clade, but its origin appears to be recent. Furthermore, INSV-UP01 might have been involved in a recombination event with an Italian isolate belonging to the Asian clade. Our analyses support that INSV isolates infect a broad plant-host range they group by geographic origin and not by host, and are subjected to frequent recombination events. These results justify the need to generate and analyze complete genome sequences of orthotospoviruses in general and INSV in particular.
Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah
Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.
Wang, Xumin; Deng, Xin; Zhang, Xiaowei; Hu, Songnian; Yu, Jun
2012-01-01
The complete nucleotide sequences of the chloroplast (cp) and mitochondrial (mt) genomes of resurrection plant Boea hygrometrica (Bh, Gesneriaceae) have been determined with the lengths of 153,493 bp and 510,519 bp, respectively. The smaller chloroplast genome contains more genes (147) with a 72% coding sequence, and the larger mitochondrial genome have less genes (65) with a coding faction of 12%. Similar to other seed plants, the Bh cp genome has a typical quadripartite organization with a conserved gene in each region. The Bh mt genome has three recombinant sequence repeats of 222 bp, 843 bp, and 1474 bp in length, which divide the genome into a single master circle (MC) and four isomeric molecules. Compared to other angiosperms, one remarkable feature of the Bh mt genome is the frequent transfer of genetic material from the cp genome during recent Bh evolution. We also analyzed organellar genome evolution in general regarding genome features as well as compositional dynamics of sequence and gene structure/organization, providing clues for the understanding of the evolution of organellar genomes in plants. The cp-derived sequences including tRNAs found in angiosperm mt genomes support the conclusion that frequent gene transfer events may have begun early in the land plant lineage. PMID:22291979
Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes
Energy Technology Data Exchange (ETDEWEB)
McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.
2005-08-26
Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.
Rey, Michael W; Ramaiya, Preethi; Nelson, Beth A; Brody-Karpin, Shari D; Zaretsky, Elizabeth J; Tang, Maria; de Leon, Alfredo Lopez; Xiang, Henry; Gusti, Veronica; Clausen, Ib Groth; Olsen, Peter B; Rasmussen, Michael D; Andersen, Jens T; Jørgensen, Per L; Larsen, Thomas S; Sorokin, Alexei; Bolotin, Alexander; Lapidus, Alla; Galleron, Nathalie; Ehrlich, S Dusko; Berka, Randy M
2004-01-01
Background Bacillus licheniformis is a Gram-positive, spore-forming soil bacterium that is used in the biotechnology industry to manufacture enzymes, antibiotics, biochemicals and consumer products. This species is closely related to the well studied model organism Bacillus subtilis, and produces an assortment of extracellular enzymes that may contribute to nutrient cycling in nature. Results We determined the complete nucleotide sequence of the B. licheniformis ATCC 14580 genome which comprises a circular chromosome of 4,222,336 base-pairs (bp) containing 4,208 predicted protein-coding genes with an average size of 873 bp, seven rRNA operons, and 72 tRNA genes. The B. licheniformis chromosome contains large regions that are colinear with the genomes of B. subtilis and Bacillus halodurans, and approximately 80% of the predicted B. licheniformis coding sequences have B. subtilis orthologs. Conclusions Despite the unmistakable organizational similarities between the B. licheniformis and B. subtilis genomes, there are notable differences in the numbers and locations of prophages, transposable elements and a number of extracellular enzymes and secondary metabolic pathway operons that distinguish these species. Differences include a region of more than 80 kilobases (kb) that comprises a cluster of polyketide synthase genes and a second operon of 38 kb encoding plipastatin synthase enzymes that are absent in the B. licheniformis genome. The availability of a completed genome sequence for B. licheniformis should facilitate the design and construction of improved industrial strains and allow for comparative genomics and evolutionary studies within this group of Bacillaceae. PMID:15461803
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M
2002-12-01
There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.
Directory of Open Access Journals (Sweden)
Barbara V Lago
Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.
A complete analysis of HA and NA genes of influenza A viruses.
LENUS (Irish Health Repository)
Shi, Weifeng
2010-12-01
More and more nucleotide sequences of type A influenza virus are available in public databases. Although these sequences have been the focus of many molecular epidemiological and phylogenetic analyses, most studies only deal with a few representative sequences. In this paper, we present a complete analysis of all Haemagglutinin (HA) and Neuraminidase (NA) gene sequences available to allow large scale analyses of the evolution and epidemiology of type A influenza.
Directory of Open Access Journals (Sweden)
Sukdeb Nandi
2010-03-01
Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India
Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.
Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth
2017-08-15
Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.
Complete Genome Sequence of Escherichia coli Strain WG5
DEFF Research Database (Denmark)
Imamovic, Lejla; Misiakou, Maria-Anna; van der Helm, Eric
2018-01-01
Escherichia coli strain WG5 is a widely used host for phage detection, including somatic coliphages employed as standard ISO method 10705-1 (2000). Here, we present the complete genome sequence of a commercial E. coli WG5 strain.......Escherichia coli strain WG5 is a widely used host for phage detection, including somatic coliphages employed as standard ISO method 10705-1 (2000). Here, we present the complete genome sequence of a commercial E. coli WG5 strain....
Directory of Open Access Journals (Sweden)
Andréia B. Poletto
2008-01-01
Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing
Complete sequence and diversity of a maize-associated Polerovirus in East Africa.
Massawe, Deogracious P; Stewart, Lucy R; Kamatenesi, Jovia; Asiimwe, Theodore; Redinbaugh, Margaret G
2018-06-01
Since 2011-2012, Maize lethal necrosis (MLN) has emerged in East Africa, causing massive yield loss and propelling research to identify viruses and virus populations present in maize. As expected, next generation sequencing (NGS) has revealed diverse and abundant viruses from the family Potyviridae, primarily sugarcane mosaic virus (SCMV), and maize chlorotic mottle virus (MCMV) (Tombusviridae), which are known to cause MLN by synergistic co-infection. In addition to these expected viruses, we identified a virus in the genus Polerovirus (family Luteoviridae) in 104/172 samples selected for MLN or other potential virus symptoms from Kenya, Uganda, Rwanda, and Tanzania. This polerovirus (MF974579) nucleotide sequence is 97% identical to maize-associated viruses recently reported in China, termed 'maize yellow mosaic virus' (MaYMV) and maize yellow dwarf virus (MaYMV; KU291101, KU291107, MYDV-RMV2; KT992824); and 99% identical to MaYMV (KY684356) infecting sugarcane and itch grass in Nigeria; 83% identical to a barley-associated polerovirus recently identified in Korea (BVG; KT962089); and 79% identical to the U.S. maize-infecting polerovirus maize yellow dwarf virus (MYDV-RMV; KT992824). Nucleotide sequences from ORF0 of 20 individual East African isolates collected from Kenya, Uganda, Rwanda, and Tanzania shared 98% or higher identity, and were detected in 104/172 (60.5%) of samples collected for virus-like symptoms, indicating extensive prevalence but limited diversity of this virus in East Africa. We refer to this virus as "MYDV-like polerovirus" until symptoms of the virus in maize are known.
Czech Academy of Sciences Publication Activity Database
Demina, T. V.; Tkachev, S. E.; Kozlova, I. V.; Doroshchenko, E. K.; Lisak, O. V.; Suntsova, O. V.; Verkhozina, M. M.; Dzhioev, Y. P.; Paramonov, A. I.; Tikunov, A. Y.; Tikunova, N. V.; Zlobin, V. I.; Růžek, Daniel
2017-01-01
Roč. 8, č. 4 (2017), s. 547-553 ISSN 1877-959X Institutional support: RVO:60077344 Keywords : TBEV * complete genome * European subtype * Western Siberia * Eastern Siberia * nucleotide * Amino acid sequence Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology OBOR OECD: Infectious Diseases Impact factor: 3.230, year: 2016
Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.
Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick
2017-08-01
A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.
Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon
2015-02-01
There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.
Directory of Open Access Journals (Sweden)
Erena A. Edae
2013-07-01
Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.
Directory of Open Access Journals (Sweden)
Salem Mohamed
2009-11-01
Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In
Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E
2009-11-25
To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the
Simmonds-Gordon, R N; Collins-Fairclough, A M; Stewart, C S; Roye, M E
2014-10-01
Jatropha gossypifolia is a weed that is commonly found with yellow mosaic symptoms growing along the roadside and in close proximity to cultivated crops in many farming communities in Jamaica. For the first time, the complete genome sequence of a new begomovirus, designated jatropha mosaic virus-[Jamaica:Spanish Town:2004] (JMV-[JM:ST:04]), was determined from field-infected J. gossypifolia in the western hemisphere. DNA-A nucleotide sequence comparisons showed closest identity (84 %) to two tobacco-infecting viruses from Cuba, tobacco mottle leaf curl virus-[Cuba:Sancti Spiritus:03] (TbMoLCV-[CU:SS:03]) and tobacco leaf curl Cuba virus-[Cuba:Taguasco:2005] (TbLCuCUV-[CU:Tag:05]), and two weed-infecting viruses from Cuba and Jamaica, Rhynchosia rugose golden mosaic virus-[Cuba:Camaguey:171:2009] (RhRGMV- [CU:Cam:171:09]) and Wissadula golden mosaic St. Thomas virus-[Jamaica:Albion:2005] (WGMSTV-[JM:Alb:05]). Phylogenetic analysis revealed that JMV-[JM:ST:04] is most closely related to tobacco and tomato viruses from Cuba and WGMSTV-[JM:Alb:05], a common malvaceous-weed-infecting virus from eastern Jamaica, and that it is distinct from begomoviruses infecting Jatropha species in India and Nigeria.
Complete genome sequence of Parvibaculum lavamentivorans type strain (DS-1(T)).
Schleheck, David; Weiss, Michael; Pitluck, Sam; Bruce, David; Land, Miriam L; Han, Shunsheng; Saunders, Elizabeth; Tapia, Roxanne; Detter, Chris; Brettin, Thomas; Han, James; Woyke, Tanja; Goodwin, Lynne; Pennacchio, Len; Nolan, Matt; Cook, Alasdair M; Kjelleberg, Staffan; Thomas, Torsten
2011-12-31
Parvibaculum lavamentivorans DS-1(T) is the type species of the novel genus Parvibaculum in the novel family Rhodobiaceae (formerly Phyllobacteriaceae) of the order Rhizobiales of Alphaproteobacteria. Strain DS-1(T) is a non-pigmented, aerobic, heterotrophic bacterium and represents the first tier member of environmentally important bacterial communities that catalyze the complete degradation of synthetic laundry surfactants. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 3,914,745 bp long genome with its predicted 3,654 protein coding genes is the first completed genome sequence of the genus Parvibaculum, and the first genome sequence of a representative of the family Rhodobiaceae.
Vera-Cabrera, Lucio; Ortiz-Lopez, Rocio; Elizondo-Gonzalez, Ramiro; Ocampo-Candiani, Jorge
2013-01-01
Nocardia brasiliensis is an important etiologic agent of mycetoma. These bacteria live as a saprobe in soil or organic material and enter the tissue via minor trauma. Mycetoma is characterized by tumefaction and the production of fistula and abscesses, with no spontaneous cure. By using mass sequencing, we determined the complete genomic nucleotide sequence of the bacteria. According to our data, the genome is a circular chromosome 9,436,348-bp long with 68% G+C content that encodes 8,414 proteins. We observed orthologs for virulence factors, a higher number of genes involved in lipid biosynthesis and catabolism, and gene clusters for the synthesis of bioactive compounds, such as antibiotics, terpenes, and polyketides. An in silico analysis of the sequence supports the conclusion that the bacteria acquired diverse genes by horizontal transfer from other soil bacteria, even from eukaryotic organisms. The genome composition reflects the evolution of bacteria via the acquisition of a large amount of DNA, which allows it to survive in new ecological niches, including humans.
Directory of Open Access Journals (Sweden)
Lucio Vera-Cabrera
Full Text Available Nocardia brasiliensis is an important etiologic agent of mycetoma. These bacteria live as a saprobe in soil or organic material and enter the tissue via minor trauma. Mycetoma is characterized by tumefaction and the production of fistula and abscesses, with no spontaneous cure. By using mass sequencing, we determined the complete genomic nucleotide sequence of the bacteria. According to our data, the genome is a circular chromosome 9,436,348-bp long with 68% G+C content that encodes 8,414 proteins. We observed orthologs for virulence factors, a higher number of genes involved in lipid biosynthesis and catabolism, and gene clusters for the synthesis of bioactive compounds, such as antibiotics, terpenes, and polyketides. An in silico analysis of the sequence supports the conclusion that the bacteria acquired diverse genes by horizontal transfer from other soil bacteria, even from eukaryotic organisms. The genome composition reflects the evolution of bacteria via the acquisition of a large amount of DNA, which allows it to survive in new ecological niches, including humans.
Complete genome sequence of a novel pestivirus from sheep.
Becher, Paul; Schmeiser, Stefanie; Oguzoglu, Tuba Cigdem; Postel, Alexander
2012-10-01
We report here the complete genome sequence of pestivirus strain Aydin/04-TR, which is the prototype of a group of similar viruses currently present in sheep and goats in Turkey. Sequence data from this virus showed that it clusters separately from the established and previously proposed tentative pestivirus species.
Complete Genome Sequence of a Novel Pestivirus from Sheep
Becher, Paul; Schmeiser, Stefanie; Oguzoglu, Tuba Cigdem; Postel, Alexander
2012-01-01
We report here the complete genome sequence of pestivirus strain Aydin/04-TR, which is the prototype of a group of similar viruses currently present in sheep and goats in Turkey. Sequence data from this virus showed that it clusters separately from the established and previously proposed tentative pestivirus species.
DEFF Research Database (Denmark)
Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.
2013-01-01
Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...
The Complete Sequence of the Mitochondrial Genome of the Chamberednautilus (Mollusca: Cephalopoda)
Energy Technology Data Exchange (ETDEWEB)
Boore, Jeffrey L.
2005-12-01
Background: Mitochondria contain small genomes that arephysically separate from those of nuclei. Their comparison serves as amodel system for understanding the processes of genome evolution.Although complete mitochondrial genome sequences have been reported formore than 600 animals, the taxonomic sampling is highly biased towardvertebrates and arthropods, leaving much of the diversity yetuncharacterized. Results: The mitochondrial genome of a cephalopodmollusk, the Chambered Nautilus, is 16,258 nts in length and 59.5 percentA+T, both values that are typical of animal mitochondrial genomes. Itcontains the 37 genes that are typical for animal mtDNAs, with 15 on oneDNA strand and 22 on the other. The arrangement of these genes can bederived from that of the distantly related Katharina tunicata (Mollusca:Polyplacophora) by a switch in position of two large blocks of genes andtranspositions of four tRNA genes. There is strong skew in thedistribution of nucleotides between the two strands. There are an unusualnumber of non-coding regions and their function, if any, is not known;however, several of these demark abrupt shifts in nucleotide skew,suggesting that they may play roles in transcription and/or replication.One of the non-coding regions contains multiple repeats of a tRNA-likesequence. Some of the tRNA genes appear to overlap on the same strand,but this could be resolved if the polycistron were cleaved at thebeginning of the downstream gene, followed by polyadenylation of theproduct of the upstream gene to form a fully paired structure.Conclusions: Nautilus sp. mtDNA contains an expected gene content thathas experienced few rearrangements since the evolutionary split betweencephalopods and polyplacophorans. It contains an unusual number ofnon-coding regions, especially considering that these otherwise often aregenerated by the same processes that produce gene rearrangements. Thisappears to be yet another case where polyadenylation of mitochondrialtRNAs restores
Fu, Peng-Cheng; Zhang, Yan-Zhao; Geng, Hui-Min; Chen, Shi-Long
2016-01-01
The chloroplast (cp) genome is useful in plant systematics, genetic diversity analysis, molecular identification and divergence dating. The genus Gentiana contains 362 species, but there are only two valuable complete cp genomes. The purpose of this study is to report the characterization of complete cp genome of G. lawrencei var. farreri , which is endemic to the Qinghai-Tibetan Plateau (QTP). Using high throughput sequencing technology, we got the complete nucleotide sequence of the G. lawrencei var. farreri cp genome. The comparison analysis including genome difference and gene divergence was performed with its congeneric species G. straminea . The simple sequence repeats (SSRs) and phylogenetics were studied as well. The cp genome of G. lawrencei var. farreri is a circular molecule of 138,750 bp, containing a pair of 24,653 bp inverted repeats which are separated by small and large single-copy regions of 11,365 and 78,082 bp, respectively. The cp genome contains 130 known genes, including 85 protein coding genes (PCGs), eight ribosomal RNA genes and 37 tRNA genes. Comparative analyses indicated that G. lawrencei var. farreri is 10,241 bp shorter than its congeneric species G. straminea. Four large gaps were detected that are responsible for 85% of the total sequence loss. Further detailed analyses revealed that 10 PCGs were included in the four gaps that encode nine NADH dehydrogenase subunits. The cp gene content, order and orientation are similar to those of its congeneric species, but with some variation among the PCGs. Three genes, ndhB , ndhF and clpP , have high nonsynonymous to synonymous values. There are 34 SSRs in the G. lawrencei var. farreri cp genome, of which 25 are mononucleotide repeats: no dinucleotide repeats were detected. Comparison with the G. straminea cp genome indicated that five SSRs have length polymorphisms and 23 SSRs are species-specific. The phylogenetic analysis of 48 PCGs from 12 Gentianales taxa cp genomes clearly identified
Directory of Open Access Journals (Sweden)
Aviv Dombrovsky
Full Text Available We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV. PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV (both poleroviruses. The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs, which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93% and to ORF5 of CABYV (87%. Both PYLCV and Pepper vein yellowing virus (PeVYV contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP, may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2 were identified between nucleotides 4,962 and 5,061 (ORF 5 and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3 with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s between poleroviruses co-infecting a common host(s, resulting in the emergence of PYLCV, a novel pathogen with a wider host range.
Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel
2013-01-01
We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range.
Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio
2005-12-20
Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.
Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella
Li, Hongshan; Dai, Huaguo; Wei, Hui
2005-01-01
A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627
Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.
2013-01-01
Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619
Cheng, Hui; Li, Jinfeng; Zhang, Hong; Cai, Binhua; Gao, Zhihong; Qiao, Yushan; Mi, Lin
2017-01-01
Compared with other members of the family Rosaceae, the chloroplast genomes of Fragaria species exhibit low variation, and this situation has limited phylogenetic analyses; thus, complete chloroplast genome sequencing of Fragaria species is needed. In this study, we sequenced the complete chloroplast genome of F . × ananassa 'Benihoppe' using the Illumina HiSeq 2500-PE150 platform and then performed a combination of de novo assembly and reference-guided mapping of contigs to generate complete chloroplast genome sequences. The chloroplast genome exhibits a typical quadripartite structure with a pair of inverted repeats (IRs, 25,936 bp) separated by large (LSC, 85,531 bp) and small (SSC, 18,146 bp) single-copy (SC) regions. The length of the F . × ananassa 'Benihoppe' chloroplast genome is 155,549 bp, representing the smallest Fragaria chloroplast genome observed to date. The genome encodes 112 unique genes, comprising 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Comparative analysis of the overall nucleotide sequence identity among ten complete chloroplast genomes confirmed that for both coding and non-coding regions in Rosaceae, SC regions exhibit higher sequence variation than IRs. The Ka/Ks ratio of most genes was less than 1, suggesting that most genes are under purifying selection. Moreover, the mVISTA results also showed a high degree of conservation in genome structure, gene order and gene content in Fragaria , particularly among three octoploid strawberries which were F . × ananassa 'Benihoppe', F . chiloensis (GP33) and F . virginiana (O477). However, when the sequences of the coding and non-coding regions of F . × ananassa 'Benihoppe' were compared in detail with those of F . chiloensis (GP33) and F . virginiana (O477), a number of SNPs and InDels were revealed by MEGA 7. Six non-coding regions ( trnK - matK , trnS - trnG , atpF - atpH , trnC - petN , trnT - psbD and trnP - psaJ ) with a percentage of variable sites greater than
Directory of Open Access Journals (Sweden)
Hui Cheng
2017-10-01
Full Text Available Compared with other members of the family Rosaceae, the chloroplast genomes of Fragaria species exhibit low variation, and this situation has limited phylogenetic analyses; thus, complete chloroplast genome sequencing of Fragaria species is needed. In this study, we sequenced the complete chloroplast genome of F. × ananassa ‘Benihoppe’ using the Illumina HiSeq 2500-PE150 platform and then performed a combination of de novo assembly and reference-guided mapping of contigs to generate complete chloroplast genome sequences. The chloroplast genome exhibits a typical quadripartite structure with a pair of inverted repeats (IRs, 25,936 bp separated by large (LSC, 85,531 bp and small (SSC, 18,146 bp single-copy (SC regions. The length of the F. × ananassa ‘Benihoppe’ chloroplast genome is 155,549 bp, representing the smallest Fragaria chloroplast genome observed to date. The genome encodes 112 unique genes, comprising 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Comparative analysis of the overall nucleotide sequence identity among ten complete chloroplast genomes confirmed that for both coding and non-coding regions in Rosaceae, SC regions exhibit higher sequence variation than IRs. The Ka/Ks ratio of most genes was less than 1, suggesting that most genes are under purifying selection. Moreover, the mVISTA results also showed a high degree of conservation in genome structure, gene order and gene content in Fragaria, particularly among three octoploid strawberries which were F. × ananassa ‘Benihoppe’, F. chiloensis (GP33 and F. virginiana (O477. However, when the sequences of the coding and non-coding regions of F. × ananassa ‘Benihoppe’ were compared in detail with those of F. chiloensis (GP33 and F. virginiana (O477, a number of SNPs and InDels were revealed by MEGA 7. Six non-coding regions (trnK-matK, trnS-trnG, atpF-atpH, trnC-petN, trnT-psbD and trnP-psaJ with a percentage of variable sites greater than 1
Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei
2017-07-01
DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.
The Complete Chloroplast Genome Sequences of Six Rehmannia Species
Directory of Open Access Journals (Sweden)
Shuyun Zeng
2017-03-01
Full Text Available Rehmannia is a non-parasitic genus in Orobanchaceae including six species mainly distributed in central and north China. Its phylogenetic position and infrageneric relationships remain uncertain due to potential hybridization and polyploidization. In this study, we sequenced and compared the complete chloroplast genomes of six Rehmannia species using Illumina sequencing technology to elucidate the interspecific variations. Rehmannia plastomes exhibited typical quadripartite and circular structures with good synteny of gene order. The complete genomes ranged from 153,622 bp to 154,055 bp in length, including 133 genes encoding 88 proteins, 37 tRNAs, and 8 rRNAs. Three genes (rpoA, rpoC2, accD have potentially experienced positive selection. Plastome size variation of Rehmannia was mainly ascribed to the expansion and contraction of the border regions between the inverted repeat (IR region and the single-copy (SC regions. Despite of the conserved structure in Rehmannia plastomes, sequence variations provide useful phylogenetic information. Phylogenetic trees of 23 Lamiales species reconstructed with the complete plastomes suggested that Rehmannia was monophyletic and sister to the clade of Lindenbergia and the parasitic taxa in Orobanchaceae. The interspecific relationships within Rehmannia were completely different with the previous studies. In future, population phylogenomic works based on plastomes are urgently needed to clarify the evolutionary history of Rehmannia.
International Nuclear Information System (INIS)
Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.
1998-01-01
To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)
Kim, Young-Kyu; Park, Chong-wook; Kim, Ki-Joong
2009-03-31
The chloroplast DNA sequences of Megaleranthis saniculifolia, an endemic and monotypic endangered plant species, were completed in this study (GenBank FJ597983). The genome is 159,924 bp in length. It harbors a pair of IR regions consisting of 26,608 bp each. The lengths of the LSC and SSC regions are 88,326 bp and 18,382 bp, respectively. The structural organizations, gene and intron contents, gene orders, AT contents, codon usages, and transcription units of the Megaleranthis chloroplast genome are similar to those of typical land plant cp DNAs. However, the detailed features of Megaleranthis chloroplast genomes are substantially different from that of Ranunculus, which belongs to the same family, the Ranunculaceae. First, the Megaleranthis cp DNA was 4,797 bp longer than that of Ranunculus due to an expanded IR region into the SSC region and duplicated sequence elements in several spacer regions of the Megaleranthis cp genome. Second, the chloroplast genomes of Megaleranthis and Ranunculus evidence 5.6% sequence divergence in the coding regions, 8.9% sequence divergence in the intron regions, and 18.7% sequence divergence in the intergenic spacer regions, respectively. In both the coding and noncoding regions, average nucleotide substitution rates differed markedly, depending on the genome position. Our data strongly implicate the positional effects of the evolutionary modes of chloroplast genes. The genes evidencing higher levels of base substitutions also have higher incidences of indel mutations and low Ka/Ks ratios. A total of 54 simple sequence repeat loci were identified from the Megaleranthis cp genome. The existence of rich cp SSR loci in the Megaleranthis cp genome provides a rare opportunity to study the population genetic structures of this endangered species. Our phylogenetic trees based on the two independent markers, the nuclear ITS and chloroplast matK sequences, strongly support the inclusion of the Megaleranthis to the Trollius. Therefore, our
Complete genome sequence of Acidimicrobium ferrooxidans type strain (ICPT)
Energy Technology Data Exchange (ETDEWEB)
Clum, Alicia; Nolan, Matt; Lang, Elke; Glavina Del Rio, Tijana; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Goker, Markus; Spring, Stefan; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chain, Patrick; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Lapidus, Alla
2009-05-20
Acidimicrobium ferrooxidans (Clark and Norris 1996) is the sole and type species of the genus, which until recently was the only genus within the actinobacterial family Acidimicrobiaceae and in the order Acidomicrobiales. Rapid oxidation of iron pyrite during autotrophic growth in the absence of an enhanced CO2 concentration is characteristic for A. ferrooxidans. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the order Acidomicrobiales, and the 2,158,157 bp long single replicon genome with its 2038 protein coding and 54 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Main: Nucleotide Analysis [KOME
Lifescience Database Archive (English)
Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...
Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.
2003-01-01
A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171
Complete genome sequence of Gordonia bronchialis type strain (3410T)
Energy Technology Data Exchange (ETDEWEB)
Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Jando, Marlen [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Chen, Feng [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Chain, Patrick S. G. [Lawrence Livermore National Laboratory (LLNL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J C [U.S. Department of Energy, Joint Genome Institute; Brettin, Thomas S [ORNL; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute
2010-01-01
Gordonia bronchialis Tsukamura 1971 is the type species of the genus. G. bronchialis is a human-pathogenic organism that has been isolated from a large variety of human tissues. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of the family Gordoniaceae. The 5,290,012 bp long genome with its 4,944 protein-coding and 55 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition
Štambuk, Nikola
The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.
Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi
2016-01-01
Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for
Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.
Wolf, P
1997-10-01
Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.
International Nuclear Information System (INIS)
Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.
1985-01-01
The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy
Li, Weiwen; Dai, Xiaojie; Xu, Qianghua; Wu, Feng; Gao, Chunxia; Zhang, Yanbo
2016-05-01
The complete mitochondrial DNA sequence of Carcharhinus longimanus was determined and analyzed. The complete mtDNA genome sequence of C. longimanus was 16,706 bp in length. It contained 22 tRNA genes, 2 rRNA genes, 13 protein-coding genes and 2 non-conding regions: control region (D-loop) and origin of light-strand replication (OL). The complete mitogenome sequence information of C. longimanus can provide a useful data for further studies on molecular systematics, stock evaluation, taxonomic status and conservation genetics.
The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.
Haggarty, N W; Dunbar, B; Fothergill, L A
1983-01-01
The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important...
Complete Genome Sequences of 44 Arthrobacter Phages.
Klyczek, Karen K; Jacobs-Sera, Deborah; Adair, Tamarah L; Adams, Sandra D; Ball, Sarah L; Benjamin, Robert C; Bonilla, J Alfred; Breitenberger, Caroline A; Daniels, Charles J; Gaffney, Bobby L; Harrison, Melinda; Hughes, Lee E; King, Rodney A; Krukonis, Gregory P; Lopez, A Javier; Monsen-Collar, Kirsten; Pizzorno, Marie C; Rinehart, Claire A; Staples, Amanda K; Stowe, Emily L; Garlena, Rebecca A; Russell, Daniel A; Cresawn, Steven G; Pope, Welkin H; Hatfull, Graham F
2018-02-01
We report here the complete genome sequences of 44 phages infecting Arthrobacter sp. strain ATCC 21022. These phages have double-stranded DNA genomes with sizes ranging from 15,680 to 70,707 bp and G+C contents from 45.1% to 68.5%. All three tail types (belonging to the families Siphoviridae , Myoviridae , and Podoviridae ) are represented. Copyright © 2018 Klyczek et al.
I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)
1993-01-01
textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the
Directory of Open Access Journals (Sweden)
Jiaorong Meng
Full Text Available Mulberry vein banding associated virus (MVBaV that infects mulberry plants with typical vein banding symptoms had been identified as a tentative species of the genus Tospovirus based on the homology of N gene sequence to those of tospoviruses. In this study, the complete sequence of the tripartite RNA genome of MVBaV was determined and analyzed. The L RNA has 8905 nucleotides (nt and encodes the putative RNA-dependent RNA polymerase (RdRp of 2877 aa amino acids (aa in the viral complementary (vc strand. The RdRp of MVBaV shares the highest aa sequence identity (85.9% with that of Watermelon silver mottle virus (WSMoV, and contains conserved motifs shared with those of the species of the genus Tospovirus. The M RNA contains 4731 nt and codes in ambisense arrangement for the NSm protein of 309 aa in the sense strand and the Gn/Gc glycoprotein precursor (GP of 1,124 aa in the vc strand. The NSm and GP of MVBaV share the highest aa sequence identities with those of Capsicum chlorosis virus (CaCV and Groundnut bud necrosis virus (GBNV (83.2% and 84.3%, respectively. The S RNA is 3294 nt in length and contains two open reading frames (ORFs in an ambisense coding strategy, encoding a 439-aa non-structural protein (NSs and the 277-aa nucleocapsid protein (N, respectively. The NSs and N also share the highest aa sequence identity (71.1% and 74.4%, respectively with those of CaCV. Phylogenetic analysis of the RdRp, NSm, GP, NSs, and N proteins showed that MVBaV is most closely related to CaCV and GBNV and that these proteins cluster with those of the WSMoV serogroup, and that MVBaV seems to be a species bridging the two subgroups within the WSMoV serogroup of tospoviruses in evolutionary aspect, suggesting that MVBaV represents a distinct tospovirus. Analysis of S RNA sequence uncovered the highly conserved 5'-/3'-ends and the coding regions, and the variable region of IGR with divergent patterns among MVBaV isolates.
Complete Genome Sequence of the Human Gut Symbiont Roseburia hominis
DEFF Research Database (Denmark)
Travis, Anthony J.; Kelly, Denise; Flint, Harry J
2015-01-01
We report here the complete genome sequence of the human gut symbiont Roseburia hominis A2-183(T) (= DSM 16839(T) = NCIMB 14029(T)), isolated from human feces. The genome is represented by a 3,592,125-bp chromosome with 3,405 coding sequences. A number of potential functions contributing to host...
Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.
Le Gall, O; Candresse, T; Dunez, J
1988-02-01
Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.
DEFF Research Database (Denmark)
Wang, Xuzhen; Wang, Jun; He, Shunping
2007-01-01
The complete mitochondrial genome sequence of the Chinese hook snout carp, Opsariichthys bidens, was newly determined using the long and accurate polymerase chain reaction method. The 16,611-nucleotide mitogenome contains 13 protein-coding genes, two rRNA genes (12S, 16S), 22 tRNA genes, and a no......The complete mitochondrial genome sequence of the Chinese hook snout carp, Opsariichthys bidens, was newly determined using the long and accurate polymerase chain reaction method. The 16,611-nucleotide mitogenome contains 13 protein-coding genes, two rRNA genes (12S, 16S), 22 tRNA genes...
Complete nucleotide sequence and gene rearrangement of the ...
Indian Academy of Sciences (India)
3Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People's Republic of China ... of these rearrangements involve tRNA genes, ND5 gene and ... ncbi.nlm.nih.gov/projects/Sequin/download/seq_win_download.
Complete nucleotide sequence and gene rearrangement of the ...
Indian Academy of Sciences (India)
mt) genome of the round-tongued floating frog, Occidozyga martensii was determined. Although, the base composition and codon usage of O. martensii conformed to the typical vertebrate patterns, this mt genome contained 23 tRNAs (a ...
Complete nucleotide sequence and organization of the mitogenome ...
African Journals Online (AJOL)
... genes (PCGs) consistently supported a close relationship between Bombycoidea and Geometroidea among six available lepidopteran superfamilies (Tortricoidea, Pyraloidea, Papilionoidea, Bombycoidea, Geometroidea and Noctuoidea). Among the true butterflies (Pieridae, Nymphalidae, Lycaenidae and Papilionidae), ...
Directory of Open Access Journals (Sweden)
Jacqueline Morris
2017-12-01
Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation
Energy Technology Data Exchange (ETDEWEB)
Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))
1988-07-25
The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
Meganathan, P R; Pagan, Heidi J T; McCulloch, Eve S; Stevens, Richard D; Ray, David A
2012-01-15
Order Chiroptera is a unique group of mammals whose members have attained self-powered flight as their main mode of locomotion. Much speculation persists regarding bat evolution; however, lack of sufficient molecular data hampers evolutionary and conservation studies. Of ~1200 species, complete mitochondrial genome sequences are available for only eleven. Additional sequences should be generated if we are to resolve many questions concerning these fascinating mammals. Herein, we describe the complete mitochondrial genomes of three bats: Corynorhinus rafinesquii, Lasiurus borealis and Artibeus lituratus. We also compare the currently available mitochondrial genomes and analyze codon usage in Chiroptera. C. rafinesquii, L. borealis and A. lituratus mitochondrial genomes are 16438 bp, 17048 bp and 16709 bp, respectively. Genome organization and gene arrangements are similar to other bats. Phylogenetic analyses using complete mitochondrial genome sequences support previously established phylogenetic relationships and suggest utility in future studies focusing on the evolutionary aspects of these species. Comprehensive analyses of available bat mitochondrial genomes reveal distinct nucleotide patterns and synonymous codon preferences corresponding to different chiropteran families. These patterns suggest that mutational and selection forces are acting to different extents within Chiroptera and shape their mitochondrial genomes. Copyright © 2011 Elsevier B.V. All rights reserved.
The complete chloroplast genome sequence of Dendrobium officinale.
Yang, Pei; Zhou, Hong; Qian, Jun; Xu, Haibin; Shao, Qingsong; Li, Yonghua; Yao, Hui
2016-01-01
The complete chloroplast sequence of Dendrobium officinale, an endangered and economically important traditional Chinese medicine, was reported and characterized. The genome size is 152,018 bp, with 37.5% GC content. A pair of inverted repeats (IRs) of 26,284 bp are separated by a large single-copy region (LSC, 84,944 bp) and a small single-copy region (SSC, 14,506 bp). The complete cp DNA contains 83 protein-coding genes, 39 tRNA genes and 8 rRNA genes. Fourteen genes contained one or two introns.
Complete Genome Sequence of Bifidobacterium bifidum S17▿
Zhurina, Daria; Zomer, Aldert; Gleinser, Marita; Brancaccio, Vincenco Francesco; Auchter, Marc; Waidmann, Mark S.; Westermann, Christina; van Sinderen, Douwe; Riedel, Christian U.
2011-01-01
Here, we report on the first completely annotated genome sequence of a Bifidobacterium bifidum strain. B. bifidum S17, isolated from feces of a breast-fed infant, was shown to strongly adhere to intestinal epithelial cells and has potent anti-inflammatory activity in vitro and in vivo. The genome sequence will provide new insights into the biology of this potential probiotic organism and allow for the characterization of the molecular mechanisms underlying its beneficial properties. PMID:21037011
Complete genome sequence of Nakamurella multipartita type strain (Y-104).
Tice, Hope; Mayilraj, Shanmugam; Sims, David; Lapidus, Alla; Nolan, Matt; Lucas, Susan; Glavina Del Rio, Tijana; Copeland, Alex; Cheng, Jan-Fang; Meincke, Linda; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavromatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Detter, John C; Brettin, Thomas; Rohde, Manfred; Göker, Markus; Bristow, Jim; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Chen, Feng
2010-03-30
Nakamurella multipartita (Yoshimi et al. 1996) Tao et al. 2004 is the type species of the monospecific genus Nakamurella in the actinobacterial suborder Frankineae. The nonmotile, coccus-shaped strain was isolated from activated sludge acclimated with sugar-containing synthetic wastewater, and is capable of accumulating large amounts of polysaccharides in its cells. Here we describe the features of the organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of a member of the family Nakamurellaceae. The 6,060,298 bp long single replicon genome with its 5415 protein-coding and 56 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
International Nuclear Information System (INIS)
Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.
1988-01-01
Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Dubey, Bhawna; Meganathan, P R; Haque, Ikramul
2012-07-01
This paper reports the complete mitochondrial genome sequence of an endangered Indian snake, Python molurus molurus (Indian Rock Python). A typical snake mitochondrial (mt) genome of 17258 bp length comprising of 37 genes including the 13 protein coding genes, 22 tRNA genes, and 2 ribosomal RNA genes along with duplicate control regions is described herein. The P. molurus molurus mt. genome is relatively similar to other snake mt. genomes with respect to gene arrangement, composition, tRNA structures and skews of AT/GC bases. The nucleotide composition of the genome shows that there are more A-C % than T-G% on the positive strand as revealed by positive AT and CG skews. Comparison of individual protein coding genes, with other snake genomes suggests that ATP8 and NADH3 genes have high divergence rates. Codon usage analysis reveals a preference of NNC codons over NNG codons in the mt. genome of P. molurus. Also, the synonymous and non-synonymous substitution rates (ka/ks) suggest that most of the protein coding genes are under purifying selection pressure. The phylogenetic analyses involving the concatenated 13 protein coding genes of P. molurus molurus conformed to the previously established snake phylogeny.
Getting complete genomes from complex samples using nanopore sequencing
DEFF Research Database (Denmark)
Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Albertsen, Mads
Short read sequencing and metagenomic binning workflows have made it possible to extract bacterial genome bins from environmental microbial samples containing hundreds to thousands of different species. However, these genome bins often do not represent complete genomes, as they are mostly...... fragmented, incomplete and often contaminated with foreign DNA and with no robust strategies to validate the quality. The value of these `draft genomes` have limited, lasting value to the scientific community, as gene synteny is broken and the uncertainty of what is missing. The genetic material most often...... missed is important multi-copy and/or conserved marker genes such as the 16S rRNA gene, as sequence micro-heterogeneity prevents assembly of these genes in the de novo assembly. We demonstrate that using nanopore long reads it is now possible to overcome these issues and make complete genomes from...
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Complete genome sequence of Actinosynnema mirum type strain (101T)
Energy Technology Data Exchange (ETDEWEB)
Land, Miriam; Lapidus, Alla; Mayilraj, Shanmugam; Chen, Feng; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Chertkov, Olga; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Rohde, Manfred; Goker, Markus; Pati, Amrita; Ivanova, Natalia; Mavrommatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia; Brettin, Thomas; Detter, John C.; Han, Cliff; Chain, Patrick; Tindall, Brian; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter
2009-05-20
Actinosynnema mirum Hasegawa et al. 1978 is the type species of the genus, and is of phylogenetic interest because of its central phylogenetic location in the Actino-synnemataceae, a rapidly growing family within the actinobacterial suborder Pseudo-nocardineae. A. mirum is characterized by its motile spores borne on synnemata and as a producer of nocardicin antibiotics. It is capable of growing aerobically and under a moderate CO2 atmosphere. The strain is a Gram-positive, aerial and substrate mycelium producing bacterium, originally isolated from a grass blade collected from the Raritan River, New Jersey. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of a member of the family Actinosynnemataceae, and only the second sequence from the actinobacterial suborder Pseudonocardineae. The 8,248,144 bp long single replicon genome with its 7100 protein-coding and 77 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase.
Haggarty, N W; Dunbar, B; Fothergill, L A
1983-01-01
The complete amino acid sequence of human erythrocyte diphosphoglycerate mutase, comprising 239 residues, was determined. The sequence was deduced from the four cyanogen bromide fragments, and from the peptides derived from these fragments after digestion with a number of proteolytic enzymes. Comparison of this sequence with that of the yeast glycolytic enzyme, phosphoglycerate mutase, shows that these enzymes are 47% identical. Most, but not all, of the residues implicated as being important for the activity of the glycolytic mutase are conserved in the erythrocyte diphosphoglycerate mutase. PMID:6313356
Complete genome sequence of Marivirga tractuosa type strain (H-43).
Pagani, Ioanna; Chertkov, Olga; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Nolan, Matt; Saunders, Elizabeth; Pitluck, Sam; Held, Brittany; Goodwin, Lynne; Liolios, Konstantinos; Ovchinikova, Galina; Ivanova, Natalia; Mavromatis, Konstantinos; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Jeffries, Cynthia D; Detter, John C; Han, Cliff; Tapia, Roxanne; Ngatchou-Djao, Olivier D; Rohde, Manfred; Göker, Markus; Spring, Stefan; Sikorski, Johannes; Woyke, Tanja; Bristow, Jim; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C
2011-04-29
Marivirga tractuosa (Lewin 1969) Nedashkovskaya et al. 2010 is the type species of the genus Marivirga, which belongs to the family Flammeovirgaceae. Members of this genus are of interest because of their gliding motility. The species is of interest because representative strains show resistance to several antibiotics, including gentamicin, kanamycin, neomycin, polymixin and streptomycin. This is the first complete genome sequence of a member of the family Flammeovirgaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,511,574 bp long chromosome and the 4,916 bp plasmid with their 3,808 protein-coding and 49 RNA genes are a part of the Genomic Encyclopedia of Bacteria and Archaea project.
Lee, Jong-Seung; Cho, Won Kyong; Kim, Mi-Kyeong; Kwak, Hae-Ryun; Choi, Hong-Soo; Kim, Kook-Hyung
2011-04-01
Tomato spotted wilt virus (TSWV) infects numerous host plants and has three genome segments, called L, M and S. Here, we report the complete genome sequences of three Korean TSWV isolates (TSWV-1 to -3) infecting tomato and pepper plants. Although the nucleotide sequence of TSWV-1 genome isolated from tomato is very different from those of TSWV-2 and TSWV-3 isolated from pepper, the deduced amino acid sequences of the five TSWV genes are highly conserved among all three TSWV isolates. In phylogenetic analysis, deduced RdRp protein sequences of TSWV-2 and TSWV-3 were clustered together with two previously reported isolates from Japan and Korea, while TSWV-1 grouped together with a Hawaiian isolate. A phylogenetic tree based on N protein sequences, however, revealed four distinct groups of TSWV isolates, and all three Korean isolates belonged to group II, together with many other isolates, mostly from Europe and Asia. Interestingly, most American isolates grouped together as group I. Together, these results suggested that these newly identified TSWV isolates might have originated from an Asian ancestor and undergone divergence upon infecting different host plants.
Complete genome sequence of Francisella tularensis subspecies holarctica FTNF002-00.
Directory of Open Access Journals (Sweden)
Ravi D Barabote
Full Text Available Francisella tularensis subspecies holarctica FTNF002-00 strain was originally obtained from the first known clinical case of bacteremic F. tularensis pneumonia in Southern Europe isolated from an immunocompetent individual. The FTNF002-00 complete genome contains the RD(23 deletion and represents a type strain for a clonal population from the first epidemic tularemia outbreak in Spain between 1997-1998. Here, we present the complete sequence analysis of the FTNF002-00 genome. The complete genome sequence of FTNF002-00 revealed several large as well as small genomic differences with respect to two other published complete genome sequences of F. tularensis subsp. holarctica strains, LVS and OSU18. The FTNF002-00 genome shares >99.9% sequence similarity with LVS and OSU18, and is also approximately 5 MB smaller by comparison. The overall organization of the FTNF002-00 genome is remarkably identical to those of LVS and OSU18, except for a single 3.9 kb inversion in FTNF002-00. Twelve regions of difference ranging from 0.1-1.5 kb and forty-two small insertions and deletions were identified in a comparative analysis of FTNF002-00, LVS, and OSU18 genomes. Two small deletions appear to inactivate two genes in FTNF002-00 causing them to become pseudogenes; the intact genes encode a protein of unknown function and a drug:H(+ antiporter. In addition, we identified ninety-nine proteins in FTNF002-00 containing amino acid mutations compared to LVS and OSU18. Several non-conserved amino acid replacements were identified, one of which occurs in the virulence-associated intracellular growth locus subunit D protein. Many of these changes in FTNF002-00 are likely the consequence of direct selection that increases the fitness of this subsp. holarctica clone within its endemic population. Our complete genome sequence analyses lay the foundation for experimental testing of these possibilities.
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Complete genome sequencing and evolutionary analysis of Indian isolates of Dengue virus type 2
Energy Technology Data Exchange (ETDEWEB)
Dash, Paban Kumar, E-mail: pabandash@rediffmail.com; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Parida, Manmohan; Rao, P.V.Lakshmana
2013-07-05
Highlights: •Complete genome of Indian DENV-2 was deciphered for the first time in this study. •The recent Indian DENV-2 revealed presence of many unique amino acid residues. •Genotype shift (American to Cosmopolitan) characterizes evolution of DENV-2 in India. •Circulation of a unique clade of DENV-2 in South Asia was identified. -- Abstract: Dengue is the most important arboviral infection of global public health significance. It is now endemic in most parts of the South East Asia including India. Though Dengue virus type 2 (DENV-2) is predominantly associated with major outbreaks in India, complete genome information of Indian DENV-2 is not available. In this study, the full-length genome of five DENV-2 isolates (four from 2001 to 2011 and one from 1960), from different parts of India was determined. The complete genome of the Indian DENV-2 was found to be 10,670 bases long with an open reading frame coding for 3391 amino acids. The recent Indian DENV-2 (2001–2011) revealed a nucleotide sequence identity of around 90% and 97% with an older Indian DENV-2 (1960) and closely related Sri Lankan and Chinese DENV-2 respectively. Presence of unique amino acid residues and non-conservative substitutions in critical amino acid residues of major structural and non-structural proteins was observed in recent Indian DENV-2. Selection pressure analysis revealed positive selection in few amino acid sites of the genes encoding for structural and non-structural proteins. The molecular phylogenetic analysis based on comparison of both complete coding region and envelope protein gene with globally diverse DENV-2 viruses classified the recent Indian isolates into a unique South Asian clade within Cosmopolitan genotype. A shift of genotype from American to Cosmopolitan in 1970s characterized the evolution of DENV-2 in India. Present study is the first report on complete genome characterization of emerging DENV-2 isolates from India and highlights the circulation of a
Complete genome sequencing and evolutionary analysis of Indian isolates of Dengue virus type 2
International Nuclear Information System (INIS)
Dash, Paban Kumar; Sharma, Shashi; Soni, Manisha; Agarwal, Ankita; Parida, Manmohan; Rao, P.V.Lakshmana
2013-01-01
Highlights: •Complete genome of Indian DENV-2 was deciphered for the first time in this study. •The recent Indian DENV-2 revealed presence of many unique amino acid residues. •Genotype shift (American to Cosmopolitan) characterizes evolution of DENV-2 in India. •Circulation of a unique clade of DENV-2 in South Asia was identified. -- Abstract: Dengue is the most important arboviral infection of global public health significance. It is now endemic in most parts of the South East Asia including India. Though Dengue virus type 2 (DENV-2) is predominantly associated with major outbreaks in India, complete genome information of Indian DENV-2 is not available. In this study, the full-length genome of five DENV-2 isolates (four from 2001 to 2011 and one from 1960), from different parts of India was determined. The complete genome of the Indian DENV-2 was found to be 10,670 bases long with an open reading frame coding for 3391 amino acids. The recent Indian DENV-2 (2001–2011) revealed a nucleotide sequence identity of around 90% and 97% with an older Indian DENV-2 (1960) and closely related Sri Lankan and Chinese DENV-2 respectively. Presence of unique amino acid residues and non-conservative substitutions in critical amino acid residues of major structural and non-structural proteins was observed in recent Indian DENV-2. Selection pressure analysis revealed positive selection in few amino acid sites of the genes encoding for structural and non-structural proteins. The molecular phylogenetic analysis based on comparison of both complete coding region and envelope protein gene with globally diverse DENV-2 viruses classified the recent Indian isolates into a unique South Asian clade within Cosmopolitan genotype. A shift of genotype from American to Cosmopolitan in 1970s characterized the evolution of DENV-2 in India. Present study is the first report on complete genome characterization of emerging DENV-2 isolates from India and highlights the circulation of a
Zhang, Dong-Yan; Feng, Yan; Zhong, Shu-Ling; Lu, Yi-Yu; Zhuang, Fang-Cheng; Xu, Chang-Ping
2012-03-01
To compare the differences in the complete genome sequence between mumps epidemic strain and mumps vaccine strain S79 isolated in Zhejiang province. A total of 4 mumps epidemic strains, which were separated from Zhejiang province during 2005 to 2010, named as ZJ05-1, ZJ06-3, ZJ08-1 and ZJ10-1 were selected in the study. The complete genome sequences were amplified using RT-PCR. The genetic differences between vaccine strain S79 and other genotype strains were compared; while the genetic-distance was calculated and the evolution was analyzed. The biggest difference between the 4 epidemic strains and the vaccine strain S79 was found on the membrane associated protein gene; whose average nucleotide differential number was 42.5 +/- 3.0 and the average variant ratio was 13.6%; while the mean amino acid differential number was 12.8 +/- 1.5 and the average variant ratio was 22.4%. The smallest difference among the 4 epidemic strains and the vaccine strain was found in stromatin genes, whose average nucleotide differential number was 73.8 +/- 2.5 and the average variant ratio was 5.9%; while the mean amino acid differential number was 3.0 +/- 0.8 and the average variant ratio was 0.8%. The dn/ds value of the stromatin genes of the 4 epidemic strains reached the highest, as 0.6526; but without any positive pressure (dn/ds 0.05). There were mutations happened on the known antigen epitope, as 8th amino acid of membrane associated protein genes and on the 336th and 356th amino acid of hemagglutinin/neuraminidase proteins. Compared with the vaccine strain, the glycosylation sites of ZJ05-1, ZJ06-3, ZJ08-1 and ZJ10-1 increased 1, 1, 2 and 2 respectively. The complete amino acid sequence of all strains showed that there were 17 characteristic sites found on the genotype-F mumps strain. Within the complete genome, the genetic-distance between epidemic strains and vaccine strains in Zhejiang province (0.071) was significantly larger than the genetic-distance between strains in
Short sequence motifs, overrepresented in mammalian conservednon-coding sequences
Energy Technology Data Exchange (ETDEWEB)
Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna
2007-02-21
Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by
Energy Technology Data Exchange (ETDEWEB)
Boore, Jeffrey L.; Medina, Monica; Rosenberg, Lewis A.
2004-01-31
We have determined the complete sequence of the mitochondrial genome of the scaphopod mollusk Graptacme eborea (Conrad, 1846) (14,492 nts) and completed the sequence of the mitochondrial genome of the bivalve mollusk Mytilus edulis Linnaeus, 1758 (16,740 nts). (The name Graptacme eborea is a revision of the species formerly known as Dentalium eboreum.) G. eborea mtDNA contains the 37 genes that are typically found and has the genes divided about evenly between the two strands, but M. edulis contains an extra trnM and is missing atp8, and has all genes on the same strand. Each has a highly rearranged gene order relative to each other and to all other studied mtDNAs. G. eborea mtDNA has almost no strand skew, but the coding strand of M. edulis mtDNA is very rich in G and T. This is reflected in differential codon usage patterns and even in amino acid compositions. G. eborea mtDNA has fewer non-coding nucleotides than any other mtDNA studied to date, with the largest non-coding region being only 24 nt long. Phylogenetic analysis using 2,420 aligned amino acid positions of concatenated proteins weakly supports an association of the scaphopod with gastropods to the exclusion of Bivalvia, Cephalopoda, and Polyplacophora, but is generally unable to convincingly resolve the relationships among major groups of the Lophotrochozoa, in contrast to the good resolution seen for several other major metazoan groups.
Complete genome sequences of six strains of the genus methylobacterium
Energy Technology Data Exchange (ETDEWEB)
Marx, Christopher J [Harvard University; Bringel, Francoise O. [University of Strasbourg; Christoserdova, Ludmila [University of Washington, Seattle; Moulin, Lionel [UMR, France; Farhan Ul Haque, Muhammad [CNRS, Strasbourg, France; Fleischman, Darrell E. [Wright State University, Dayton, OH; Gruffaz, Christelle [CNRS, Strasbourg, France; Jourand, Philippe [UMR, France; Knief, Claudia [ETH Zurich, Switzerland; Lee, Ming-Chun [Harvard University; Muller, Emilie E. L. [CNRS, Strasbourg, France; Nadalig, Thierry [CNRS, Strasbourg, France; Peyraud, Remi [ETH Zurich, Switzerland; Roselli, Sandro [CNRS, Strasbourg, France; Russ, Lina [ETH Zurich, Switzerland; Aguero, Fernan [Universidad Nacional de General San Martin; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lajus, Aurelie [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Land, Miriam L [ORNL; Medigue, Claudine [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Stolyar, Sergey [University of Washington; Vorholt, Julia A. [ETH Zurich, Switzerland; Vuilleumier, Stephane [University of Strasbourg
2012-01-01
The complete and assembled genome sequences were determined for six strains of the alphaproteobacterial genus Methylobacterium, chosen for their key adaptations to different plant-associated niches and environmental constraints.
Complete Genome Sequences of Six Strains of the Genus Methylobacterium
Energy Technology Data Exchange (ETDEWEB)
Marx, Christopher J [Harvard University; Bringel, Francoise O. [University of Strasbourg; Christoserdova, Ludmila [University of Washington, Seattle; Moulin, Lionel [UMR, France; UI Hague, Muhammad Farhan [University of Strasbourg; Fleischman, Darrell E. [Wright State University, Dayton, OH; Gruffaz, Christelle [CNRS, Strasbourg, France; Jourand, Philippe [UMR, France; Knief, Claudia [ETH Zurich, Switzerland; Lee, Ming-Chun [Harvard University; Muller, Emilie E. L. [CNRS, Strasbourg, France; Nadalig, Thierry [CNRS, Strasbourg, France; Peyraud, Remi [ETH Zurich, Switzerland; Roselli, Sandro [CNRS, Strasbourg, France; Russ, Lina [ETH Zurich, Switzerland; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Ivanov, Pavel S. [University of Wyoming, Laramie; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Lajus, Aurelie [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Land, Miriam L [ORNL; Medigue, Claudine [Genoscope/Centre National de la Recherche Scientifique-Unite Mixte de Recherche; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Stolyar, Sergey [University of Washington; Vorholt, Julia A. [ETH Zurich, Switzerland; Vuilleumier, Stephane [University of Strasbourg
2012-01-01
The complete and assembled genome sequences were determined for six strains of the alphaproteobacterial genus Methylobacterium, chosen for their key adaptations to different plant-associated niches and environmental constraints.
Complete genome sequence of the European sheatfish virus.
Mavian, Carla; López-Bueno, Alberto; Fernández Somalo, María Pilar; Alcamí, Antonio; Alejo, Alí
2012-06-01
Viral diseases are an increasing threat to the thriving aquaculture industry worldwide. An emerging group of fish pathogens is formed by several ranaviruses, which have been isolated at different locations from freshwater and seawater fish species since 1985. We report the complete genome sequence of European sheatfish ranavirus (ESV), the first ranavirus isolated in Europe, which causes high mortality rates in infected sheatfish (Silurus glanis) and in other species. Analysis of the genome sequence shows that ESV belongs to the amphibian-like ranaviruses and is closely related to the epizootic hematopoietic necrosis virus (EHNV), a disease agent geographically confined to the Australian continent and notifiable to the World Organization for Animal Health.
Directory of Open Access Journals (Sweden)
Jonas Binladen
2007-02-01
Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2016-05-11
Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures
Dong, Min; Graham, Mitchell; Yadav, Nehul
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416
JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.
Directory of Open Access Journals (Sweden)
Jieming Shi
Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.
Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Barta, John R
2014-07-17
Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotically replicating mitochondrial genome may be more suited for species level molecular work; however, only limited sequence data are available for Eimeria spp. infecting turkeys. The purpose of this study was to sequence and annotate the complete mitochondrial genomes from 5 Eimeria species that commonly infect the domestic turkey (Meleagris gallopavo). Six single-oocyst derived cultures of five Eimeria species infecting turkeys were PCR-amplified and sequenced completely prior to detailed annotation. Resulting sequences were aligned and used in phylogenetic analyses (BI, ML, and MP) that included complete mitochondrial genomes from 16 Eimeria species or concatenated CDS sequences from each genome. Complete mitochondrial genome sequences were obtained for Eimeria adenoeides Guelph, 6211 bp; Eimeria dispersa Briston, 6238 bp; Eimeria meleagridis USAR97-01, 6212 bp; Eimeria meleagrimitis USMN08-01, 6165 bp; Eimeria gallopavonis Weybridge, 6215 bp; and Eimeria gallopavonis USKS06-01, 6215 bp). The order, orientation and CDS lengths of the three protein coding genes (COI, COIII and CytB) as well as rDNA fragments encoding ribosomal large and small subunit rRNA were conserved among all sequences. Pairwise sequence identities between species ranged from 88.1% to 98.2%; sequence variability was concentrated within CDS or between rDNA fragments (where indels were common). No phylogenetic reconstruction supported monophyly of Eimeria species infecting turkeys; Eimeria dispersa may have arisen
Complete genome sequence of Desulfomicrobium baculatum type strain (XT)
Energy Technology Data Exchange (ETDEWEB)
Copeland, Alex; Spring, Stefan; Goker, Markus; Schneider, Susanne; Lapidus, Alla; Glavina Del Rio, Tijana; Tice, Hope; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Nolan, Matt; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C; Meincke, Linda; Sims, David; Brettin, Thomas; Detter, John C; Han, Cliff; Chain, Patrick; Bristow, James; Eisen, Jonathan; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C; Lucas, Susan
2009-05-20
Desulfomicrobium baculatum is the type species of the genus Desulfomicrobium, which is the type genus of the family Desulfomicrobiaceae. It is of phylogenetic interest because of the isolated location of the family Desulfomicrobiaceae within the order Desulfovibrionales. D. baculatum strain XT is a Gram-negative, motile, sulfate-reducing bacterium isolated from water-saturated manganese carbonate ore. It is strictly anaerobic and does not require NaCl for growth, although NaCl concentrations up to 6percent (w/v) are tolerated. The metabolism is respiratory or fermentative. In the presence of sulfate, pyruvate and lactate are incompletely oxidized to acetate and CO2. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of a member of the deltaproteobacterial family Desulfomicrobiaceae, and this 3,942,657 bp long single replicon genome with its 3494 protein-coding and 72 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.
2014-01-01
Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang
2016-09-01
Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.
Complete Genome Sequence of the Probiotic Strain Lactobacillus salivarius LPM01.
Chenoll, Empar; Codoñer, Francisco M; Martinez-Blanch, Juan F; Acevedo-Piérart, Marcelo; Ormeño, M Loreto; Ramón, Daniel; Genovés, Salvador
2016-11-23
Lactobacillus salivarius LPM01 (DSM 22150) is a probiotic strain able to improve health status in immunocompromised people. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insights into its functional activity and safety assessment. Copyright © 2016 Chenoll et al.
Yamada, Hiroko; Takahashi, Kazuaki; Lim, Olline; Svay, Somana; Chuon, Channarena; Hok, Sirany; Do, Son Huy; Fujimoto, Mayumi; Akita, Tomoyuki; Goto, Noboru; Katayama, Keiko; Arai, Masahiro; Tanaka, Junko
2015-01-01
Hepatitis E virus (HEV) is a growing public health problem in many countries. In this study, we investigated HEV seroprevalence among the general population in the Siem Reap province, Cambodia, and performed HEV genetic analysis with the aim to develop an HEV prevention strategy. This seroepidemiological cross-sectional study conducted from 2010 to 2014 included 868 participants from four different locations in Siem Reap province, Cambodia. They answered questionnaires and provided blood samples for the analysis of hepatitis virus infections. Among the participants (360 men and 508 women; age range, 7-90 years), the prevalence of anti-HEV IgG was 18.4% (95% confidence interval: 15.9-21.0); HEV RNA was detected in two participants (0.23%) and was classified as genotype 3 and 4. Full-length genome of the genotype 4 isolate, CVS-Sie10, was sequenced; it contained 7,222 nucleotides and three ORFs and demonstrated high sequence identity with the swine China isolates swGX40 (95.57%), SS19 (94.37%), and swDQ (91.94%). Multivariate logistic regression analysis revealed that men, elderly people, and house workers were risk groups significantly associated with the positivity for anti-HEV IgG. This is the first report on the detection of HEV genotype 4 in humans in Cambodia and on the complete genome sequence of HEV genotype 4 from this country. Our study demonstrates that new HEV infection cases occur frequently among the general population in Cambodia, and effective preventive measures are required.
Directory of Open Access Journals (Sweden)
Hiroko Yamada
Full Text Available Hepatitis E virus (HEV is a growing public health problem in many countries. In this study, we investigated HEV seroprevalence among the general population in the Siem Reap province, Cambodia, and performed HEV genetic analysis with the aim to develop an HEV prevention strategy. This seroepidemiological cross-sectional study conducted from 2010 to 2014 included 868 participants from four different locations in Siem Reap province, Cambodia. They answered questionnaires and provided blood samples for the analysis of hepatitis virus infections. Among the participants (360 men and 508 women; age range, 7-90 years, the prevalence of anti-HEV IgG was 18.4% (95% confidence interval: 15.9-21.0; HEV RNA was detected in two participants (0.23% and was classified as genotype 3 and 4. Full-length genome of the genotype 4 isolate, CVS-Sie10, was sequenced; it contained 7,222 nucleotides and three ORFs and demonstrated high sequence identity with the swine China isolates swGX40 (95.57%, SS19 (94.37%, and swDQ (91.94%. Multivariate logistic regression analysis revealed that men, elderly people, and house workers were risk groups significantly associated with the positivity for anti-HEV IgG. This is the first report on the detection of HEV genotype 4 in humans in Cambodia and on the complete genome sequence of HEV genotype 4 from this country. Our study demonstrates that new HEV infection cases occur frequently among the general population in Cambodia, and effective preventive measures are required.
Complete genome sequence of the myxobacterium Sorangium cellulosum
DEFF Research Database (Denmark)
Schneiker, S; Perlova, O; Kaiser, O
2007-01-01
The genus Sorangium synthesizes approximately half of the secondary metabolites isolated from myxobacteria, including the anti-cancer metabolite epothilone. We report the complete genome sequence of the model Sorangium strain S. cellulosum Soce56, which produces several natural products and has...... morphological and physiological properties typical of the genus. The circular genome, comprising 13,033,779 base pairs, is the largest bacterial genome sequenced to date. No global synteny with the genome of Myxococcus xanthus is apparent, revealing an unanticipated level of divergence between...... these myxobacteria. A large percentage of the genome is devoted to regulation, particularly post-translational phosphorylation, which probably supports the strain's complex, social lifestyle. This regulatory network includes the highest number of eukaryotic protein kinase-like kinases discovered in any organism...
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
Jang-Liaw, Nian-Hong; Chang, Chia-Hao; Tsai, Chi-Li
2013-06-01
We sequenced the complete mitochondrial genome of two spotted barbs native to Taiwan: Puntius semifasciolatus and Puntius snyderi. The complete mitochondrial genomes are 16,594 and 16,578 bp in size, respectively. Both of them contain 37 genes coding for 13 proteins, 2 rRNAs, 22 tRNAs, and 1 control region. They share the same gene arrangement pattern that was identical with most vertebrates. Nucleotide sequence divergence (K2P distance) between the two whole mitochondrial genomes was 7.63%. These two spotted barbs show very close relationship based on the comparison of the characters of their mitochondrial genomes.
2012-01-01
Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR) are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas. PMID:23256920
Directory of Open Access Journals (Sweden)
Liu Chang
2012-12-01
Full Text Available Abstract Background The complete sequences of chloroplast genomes provide wealthy information regarding the evolutionary history of species. With the advance of next-generation sequencing technology, the number of completely sequenced chloroplast genomes is expected to increase exponentially, powerful computational tools annotating the genome sequences are in urgent need. Results We have developed a web server CPGAVAS. The server accepts a complete chloroplast genome sequence as input. First, it predicts protein-coding and rRNA genes based on the identification and mapping of the most similar, full-length protein, cDNA and rRNA sequences by integrating results from Blastx, Blastn, protein2genome and est2genome programs. Second, tRNA genes and inverted repeats (IR are identified using tRNAscan, ARAGORN and vmatch respectively. Third, it calculates the summary statistics for the annotated genome. Fourth, it generates a circular map ready for publication. Fifth, it can create a Sequin file for GenBank submission. Last, it allows the extractions of protein and mRNA sequences for given list of genes and species. The annotation results in GFF3 format can be edited using any compatible annotation editing tools. The edited annotations can then be uploaded to CPGAVAS for update and re-analyses repeatedly. Using known chloroplast genome sequences as test set, we show that CPGAVAS performs comparably to another application DOGMA, while having several superior functionalities. Conclusions CPGAVAS allows the semi-automatic and complete annotation of a chloroplast genome sequence, and the visualization, editing and analysis of the annotation results. It will become an indispensible tool for researchers studying chloroplast genomes. The software is freely accessible from http://www.herbalgenomics.org/cpgavas.
Complete genome sequence of Sanguibacter keddieii type strain (ST-74T)
Energy Technology Data Exchange (ETDEWEB)
Ivanova, Natalia; Sikorski, Johannes; Sims, David; Brettin, Thomas; Detter, John C.; Han, Cliff; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Pati, Amrita; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; D' haeseleer, Patrik; Chain, Patrick; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Goker, Markus; Pukall, Rudiger; Klenk, Hans-Peter; Kyrpides, Nikos
2009-05-20
Sanguibacter keddieii is the type species of the genus Sanguibacter, the only described genus within the family of Sanguibacteraceae. Phylogenetically, this family is located in the neighbourhood of the genus Oerskovia and the family Cellulomonadaceae within the actinobacterial suborder Micrococcineae. The strain described in this report was isolated from blood of apparently healthy cows. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the family Sanguibacteraceae, and the 4,253,413 bp long single replicon genome with its 3735 protein-coding and 70 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Huotari, Tea; Korpelainen, Helena
2012-10-15
Elodea canadensis is an aquatic angiosperm native to North America. It has attracted great attention due to its invasive nature when transported to new areas in its non-native range. We have determined the complete nucleotide sequence of the chloroplast (cp) genome of Elodea. Taxonomically Elodea is a basal monocot, and only few monocot cp genomes representing early lineages of monocots have been sequenced so far. The genome is a circular double-stranded DNA molecule 156,700 bp in length, and has a typical structure with large (LSC 86,194 bp) and small (SSC 17,810 bp) single-copy regions separated by a pair of inverted repeats (IRs 26,348 bp each). The Elodea cp genome contains 113 unique genes and 16 duplicated genes in the IR regions. A comparative analysis showed that the gene order and organization of the Elodea cp genome is almost identical to that of Amborella trichopoda, a basal angiosperm. The structure of IRs in Elodea is unique among monocot species with the whole cp genome sequenced. In Elodea and another monocot Lemna minor the borders between IRs and LSC are located upstream of rps 19 gene and downstream of trnH-GUG gene, while in most monocots, IR has extended to include both trnH and rps 19 genes. A phylogenetic analysis conducted using Bayesian method, based on the DNA sequences of 81 chloroplast genes from 17 monocot taxa provided support for the placement of Elodea together with Lemna as a basal monocot and the next diverging lineage of monocots after Acorales. In comparison with other monocots, the Elodea cp genome has gone through only few rearrangements or gene losses. IR of Elodea has a unique structure among the monocot species studied so far as its structure is similar to that of a basal angiosperm Amborella. This result together with phylogenetic analyses supports the placement of Elodea as a basal monocot to the next diverging lineage of monocots after Acorales. So far, only few cp genomes representing early lineages of monocots have been
First Complete Genome Sequence of Pepper vein yellows virus from Australia
Maina, Solomon; Edwards, Owain R.
2016-01-01
We present here the first complete genomic RNA sequence of the polerovirus Pepper vein yellows virus (PeVYV) obtained from a pepper plant in Australia. We compare it with complete PeVYV genomes from Japan and China. The Australian genome was more closely related to the Japanese than the Chinese genome. PMID:27231375
The complete chloroplast genome sequence of Abies nephrolepis (Pinaceae: Abietoideae
Directory of Open Access Journals (Sweden)
Dong-Keun Yi
2016-06-01
Full Text Available The plant chloroplast (cp genome has maintained a relatively conserved structure and gene content throughout evolution. Cp genome sequences have been used widely for resolving evolutionary and phylogenetic issues at various taxonomic levels of plants. Here, we report the complete cp genome of Abies nephrolepis. The A. nephrolepis cp genome is 121,336 base pairs (bp in length including a pair of short inverted repeat regions (IRa and IRb of 139 bp each separated by a small single copy (SSC region of 54,323 bp (SSC and a large single copy region of 66,735 bp (LSC. It contains 114 genes, 68 of which are protein coding genes, 35 tRNA and four rRNA genes, six open reading frames, and one pseudogene. Seventeen repeat units and 64 simple sequence repeats (SSR have been detected in A. nephrolepis cp genome. Large IR sequences locate in 42-kb inversion points (1186 bp. The A. nephrolepis cp genome is identical to Abies koreana’s which is closely related to taxa. Pairwise comparison between two cp genomes revealed 140 polymorphic sites in each. Complete cp genome sequence of A. nephrolepis has a significant potential to provide information on the evolutionary pattern of Abietoideae and valuable data for development of DNA markers for easy identification and classification.
Mukhopadhyaya, R; Sadaie, M R
1993-02-01
Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
Getting complete genomes from complex samples using nanopore sequencing
DEFF Research Database (Denmark)
Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Albertsen, Mads
Background Short read DNA sequencing and metagenomic binning workflows have made it possible to extract bacterial genome bins from environmental microbial samples containing hundreds to thousands of different species. However, these genome bins often do not represent complete genomes......, as they are mostly fragmented, incomplete and often contaminated with foreign DNA. The value of these `draft genomes` have limited, lasting value to the scientific community, as gene synteny is broken and there is some uncertainty of what is missing1. The genetic material most often missed is important multi......-copy and/or conserved marker genes such as the 16S rRNA gene, as sequence micro-heterogeneity prevents assembly of these genes in the de novo assembly. However, long read sequencing technologies are emerging promising an end to fragmented genome assemblies2. Experimental design We extracted DNA from a full...
Genome Sequence of Novel Human Parechovirus Type 17
B?ttcher, Sindy; Obermeier, Patrick E.; Diedrich, Sabine; Kabor?, Yolande; D?Alfonso, Rossella; Pfister, Herbert; Kaiser, Rolf; Di Cristanziano, Veronica
2017-01-01
ABSTRACT Human parechoviruses (HPeV) circulate worldwide, causing a broad variety of symptoms, preferentially in early childhood. We report here the nearly complete genome sequence of a novel HPeV type, consisting of 7,062 nucleotides and encoding 2,179?amino acids. M36/CI/2014 was taxonomically classified as HPeV-17 by the picornavirus study group.
Mitochondrial DNA analysis reveals a low nucleotide diversity of ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Complete genome sequence of Hydrogenobacter thermophilus type strain (TK-6T)
Energy Technology Data Exchange (ETDEWEB)
Zeytun, Ahmet [Los Alamos National Laboratory (LANL); Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Han, James [Joint Genome Institute; Tice, Hope [Joint Genome Institute, Walnut Creek, California; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [Joint Genome Institute, Walnut Creek, California; Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Ngatchou, Olivier Duplex [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [Joint Genome Institute, Walnut Creek, California; Ubler, Susanne [Universitat Regensburg, Regensburg, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Wirth, Reinhard [Universitat Regensburg, Regensburg, Germany; Woyke, Tanja [Joint Genome Institute, Walnut Creek, California; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kyrpides, Nikos C [Joint Genome Institute, Walnut Creek, California
2011-01-01
Hydrogenobacter thermophilus Kawasumi et al. 1984 is the type species of the genus Hydrogenobacter. H. thermophilus was the first obligate autotrophic organism reported among aerobic hydrogen-oxidizing bacteria. Strain TK-6T is of interest because of the unusually efficient hydrogen-oxidizing ability of this strain, which results in a faster generation time compared to other autotrophs. It is also able to grow anaerobically using nitrate as an electron acceptor when molecular hydrogen is used as the energy source, and able to aerobically fix CO2 via the reductive tricarboxylic acid cycle. This is the fifth completed genome sequence in the family Aquificaceae, and the second genome sequence determined from a strain derived from the original isolate. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 1,742,932 bp long genome with its 1,899 protein-coding and 49 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).
Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan
2015-01-01
In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis.
Complete genome sequence of Cryptobacterium curtum type strain (12-3T)
Energy Technology Data Exchange (ETDEWEB)
Mavromatis, Konstantinos; Pukall, Rudiger; Rohde, Christine; Sims, David; Brettin, Thomas; Kuske, Cheryl; Detter, John C.; Han, Cliff; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ovchinnikova, Galina; Pati, Amrita; Ivanova, Natalia; Chen, Amy; Palaniappan, Krishna; Chain, Patrick; D' haeseleer, Patrik; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Rohde, Manfred; Klenk, Hans-Peter; Kyrpides, Nikos C.
2009-05-20
Cryptobacterium curtum Nakazawa et al. 1999 is the type species of the genus, and is of phylogenetic interest because of its very distant and isolated position within the family Coriobacteriaceae. C. curtum is an asaccharolytic, opportunistic pathogen with a typical occurrence in the oral cavity, involved in dental and oral infections like periodontitis, inflammations and abscesses. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the actinobacterial family Coriobacteriaceae, and this 1,617,804 bp long single replicon genome with its 1364 protein-coding and 58 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Single Nucleotide Polymorphism
DEFF Research Database (Denmark)
Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg
2014-01-01
Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....
Wang, Xiaodan; Ma, Dehong; Huang, Xinwei; Li, Lihua; Li, Duo; Zhao, Yujiao; Qiu, Lijuan; Pan, Yue; Chen, Junying; Xi, Juemin; Shan, Xiyun; Sun, Qiangming
2017-06-15
In the past few decades, dengue has spread rapidly and is an emerging disease in China. An unexpected dengue outbreak occurred in Xishuangbanna, Yunnan, China, resulting in 1331 patients in 2013. In order to obtain the complete genome information and perform mutation and evolutionary analysis of causative agent related to this largest outbreak of dengue fever. The viruses were isolated by cell culture and evaluated by genome sequence analysis. Phylogenetic trees were then constructed by Neighbor-Joining methods (MEGA6.0), followed by analysis of nucleotide mutation and amino acid substitution. The analysis of the diversity of secondary structure for E and NS1 protein were also performed. Then selection pressures acting on the coding sequences were estimated by PAML software. The complete genome sequences of two isolated strains (YNSW1, YNSW2) were 10,710 and 10,702 nucleotides in length, respectively. Phylogenetic analysis revealed both strain were classified as genotype II of DENV-3. The results indicated that both isolated strains of Xishuangbanna in 2013 and Laos 2013 stains (KF816161.1, KF816158.1, LC147061.1, LC147059.1, KF816162.1) were most similar to Bangladesh (AY496873.2) in 2002. After comparing with the DENV-3SS (H87) 62 amino acid substitutions were identified in translated regions, and 38 amino acid substitutions were identified in translated regions compared with DENV-3 genotype II stains Bangladesh (AY496873.2). 27(YNSW1) or 28(YNSW2) single nucleotide changes were observed in structural protein sequences with 7(YNSW1) or 8(YNSW2) non-synonymous mutations compared with AY496873.2. Of them, 4 non-synonymous mutations were identified in E protein sequences with (2 in the β-sheet, 2 in the coil). Meanwhile, 117(YNSW1) or 115 (YNSW2) single nucleotide changes were observed in non-structural protein sequences with 31(YNSW1) or 30 (YNSW2) non-synonymous mutations. Particularly, 14 single nucleotide changes were observed in NS1 sequences with 4/14 non
Directory of Open Access Journals (Sweden)
Collins Peter L
2008-10-01
Full Text Available Abstract Background Avian paramyxoviruses (APMVs are frequently isolated from domestic and wild birds throughout the world. All APMVs, except avian metapneumovirus, are classified in the genus Avulavirus of the family Paramyxoviridae. At present, the APMVs of genus Avulavirus are divided into nine serological types (APMV 1–9. Newcastle disease virus represents APMV-1 and is the most characterized among all APMV types. Very little is known about the molecular characteristics and pathogenicity of APMV 2–9. Results As a first step towards understanding the molecular genetics and pathogenicity of APMV-4, we have sequenced the complete genome of APMV-4 strain duck/Hong Kong/D3/75 and determined its pathogenicity in embryonated chicken eggs. The genome of APMV-4 is 15,054 nucleotides (nt in length, which is consistent with the "rule of six". The genome contains six non-overlapping genes in the order 3'-N-P/V-M-F-HN-L-5'. The genes are flanked on either side by highly conserved transcription start and stop signals and have intergenic sequences varying in length from 9 to 42 nt. The genome contains a 55 nt leader region at 3' end. The 5' trailer region is 17 nt, which is the shortest in the family Paramyxoviridae. Analysis of mRNAs transcribed from the P gene showed that 35% of the transcripts were edited by insertion of one non-templated G residue at an editing site leading to production of V mRNAs. No message was detected that contained insertion of two non-templated G residues, indicating that the W mRNAs are inefficiently produced in APMV-4 infected cells. The cleavage site of the F protein (DIPQR↓F does not conform to the preferred cleavage site of the ubiquitous intracellular protease furin. However, exogenous proteases were not required for the growth of APMV-4 in cell culture, indicating that the cleavage does not depend on a furin site. Conclusion Phylogenic analysis of the nucleotide sequences of viruses of all five genera of the family
Institute of Scientific and Technical Information of China (English)
Yong-danLi; Li-yingWang; Xi-wuGao; Chao-yangZhao; Zhao-fengTian
2004-01-01
The spheroidin genes of Calliptamus italicus entomopoxvirus (CiEPV) and Gomphocerus sibiricus entomopoxvirus (GsEPV) were obtained by PCR,and the fragments were cloned, sequenced and analyzed. The CiEPV and GsEPV spheroidin genes respectively harbored ORFs of 2 922 bps and 2 967 bps that were capable of coding polypeptides of 109.2 and 111.1 kDa. Computer analysis indicated that CiEPV and GsEPV spheroidins shared less than 20% amino acid identities with lepidopteran AmEPV and coleopteran AcEPV spheroidins, but more than 80% amino acid identities with orthopteran OaEPV, MsEPV and AaEPV spheroidins. The CiEPV and GsEPV spheroidins respectively contained 19 and 21 cysteine residues that were particularly abundant at the C-termini, as is the case with those of the other orthopteran EPV spheroidins. The numbers and locations of the cysteine residues of the spheroidins were most similar to those of the spheroidins of EPVs that are virulent on the same insect orders. The promoter regions of the two spheroidin genes were highly conserved (99%) among the orthopteran EPVs and also contained the typical very A+T rich and TAAATG signal mediating transcription of poxvirus late genes. We also sequenced an incomplete ORF downstream of the pheroidin gene of CiEPV and GsEPV. The ORF was in the opposite direction to the spheroidin gene and was homologous to MSV072 putative protein of MsEPV.
Alam, Md Tauqeer; Petit, Robert A; Read, Timothy D; Dove, Alistair D M
2014-04-10
The whale shark (Rhincodon typus) is the largest extant species of fish, belonging to the order Orectolobiformes. It is listed as a "vulnerable" species on the International Union for Conservation of Nature (IUCN)'s Red List of Threatened Species, which makes it an important species for conservation efforts. We report here the first complete sequence of the mitochondrial genome (mitogenome) of the whale shark obtained by next-generation sequencing methods. The assembled mitogenome is a 16,875 bp circle, comprising of 13 protein-coding genes, two rRNA genes, 22 tRNA genes and a control region. We also performed comparative analysis of the whale shark mitogenome to the available mitogenome sequences of 17 other shark species, four from the order Orectolobiformes, five from Lamniformes and eight from Carcharhiniformes. The nucleotide composition, number and arrangement of the genes in whale shark mitogenome are the same as found in the mitogenomes of the other members of the order Orectolobiformes and its closest orders Lamniformes and Carcharhiniformes, although the whale shark mitogenome had a slightly longer control region. The availability of mitogenome sequence of whale shark will aid studies of molecular systematics, biogeography, genetic differentiation, and conservation genetics in this species. Copyright © 2014 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2015-10-05
This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.
Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai
2013-08-01
To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.
US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...
Using nanopore sequencing to get complete genomes from complex samples
DEFF Research Database (Denmark)
Kirkegaard, Rasmus Hansen; Karst, Søren Michael; Nielsen, Per Halkjær
The advantages of “next generation sequencing” has come at the cost of genome finishing. The dominant sequencing technology provides short reads of 150-300 bp, which has made genome assembly very difficult as the reads do not span important repeat regions. Genomes have thus been added...... to the databases as fragmented assemblies and not as finished contigs that resemble the chromosomes in which the DNA is organised within the cells. This is especially troublesome for genomes derived from complex metagenome sequencing. Databases with incomplete genomes can lead to false conclusions about...... the absence of genes and functional predictions of the organisms. Furthermore, it is common that repetitive elements and marker genes such as the 16S rRNA gene are missing completely from these genome bins. Using nanopore long reads, we demonstrate that it is possible to span these regions and make complete...
Complete genome sequence of Calditerrivibrio nitroreducens type strain (Yu37-1T)
Energy Technology Data Exchange (ETDEWEB)
Pitluck, Sam [Joint Genome Institute, Walnut Creek, California; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Zeytun, Ahmet [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Hammon, Nancy [Joint Genome Institute, Walnut Creek, California; Deshpande, Shweta [Joint Genome Institute, Walnut Creek, California; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Pagani, Ioanna [Joint Genome Institute, Walnut Creek, California; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Detter, J. Chris [Joint Genome Institute, Walnut Creek, California; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Ngatchou, Olivier Duplex [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [Joint Genome Institute, Walnut Creek, California; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [Joint Genome Institute, Walnut Creek, California; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL
2011-01-01
Calditerrivibrio nitroreducens Iino et al. 2008 is the type species of the genus Calditerrivibrio. The species is of interest because of its important role in the nitrate cycle as nitrate reducer and for its isolated phylogenetic position in the Tree of Life. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the third complete genome sequence of a member of the family Deferribacteraceae. The 2,216,552 bp long genome with its 2,128 protein-coding and 50 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L
2001-01-01
Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.
Energy Technology Data Exchange (ETDEWEB)
Parham, James F.; Macey, J. Robert; Papenfuss, Theodore J.; Feldman, Chris R.; Turkozan, Oguz; Polymeni, Rosa; Boore, Jeffrey
2005-04-29
As part of an ongoing project to generate a mitochondrial database for terrestrial tortoises based on museum specimens, the complete mitochondrial genome sequences of 10 species and a {approx}14 kb sequence from an eleventh species are reported. The sampling of the present study emphasizes Mediterranean tortoises (genus Testudo and their close relatives). Our new sequences are aligned, along with those of two testudinoid turtles from GenBank, Chrysemys picta and Mauremys reevesii, yielding an alignment of 14,858 positions, of which 3,238 are parsimony informative. We develop a phylogenetic taxonomy for Testudo and related species based on well-supported, diagnosable clades. Several well-supported nodes are recovered, including the monophyly of a restricted Testudo, T. kleinmanni + T. marginata (the Chersus clade), and the placement of the enigmatic African pancake tortoise (Malacochersustornieri) within the predominantly Palearctic greater Testudo group (Testudona tax. nov.). Despite the large amount of sequence reported, there is low statistical support for some nodes within Testudona and Sowe do not propose names for those groups. A preliminary and conservative estimation of divergence times implies a late Miocene diversification for the testudonan clade (6-12 million years ago), matching their first appearance in the fossil record. The multi-continental distribution of testudonan turtles can be explained by the establishment of permanent connections between Europe, Africa, and Asia at this time. The arrival of testudonan turtles to Africa occurred after one or more initial tortoise invasions gave rise to the diverse (>25 species) 'Geochelone complex.'Two unusual genomic features are reported for the mtDNA of one tortoise, M. tornieri: (1) nad4 has a shift of reading frame that we suggest is resolved by translational frameshifting of the mRNA on the ribosome during protein synthesis and (2) there are two copies of the control region and trnF, with the
Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.
Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent
2016-03-22
Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.
Complete genome sequence of Isosphaera pallida type strain (IS1BT)
Energy Technology Data Exchange (ETDEWEB)
Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Cleland, David M [ORNL; Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Hammon, Nancy [Joint Genome Institute, Walnut Creek, California; Deshpande, Shweta [Joint Genome Institute, Walnut Creek, California; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [Joint Genome Institute, Walnut Creek, California; Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Pagani, Ioanna [Joint Genome Institute, Walnut Creek, California; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Detter, J. Chris [Joint Genome Institute, Walnut Creek, California; Beck, Brian [ATCC - American Type Culture Collection; Woyke, Tanja [Joint Genome Institute, Walnut Creek, California; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [Joint Genome Institute, Walnut Creek, California; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany
2011-01-01
Isosphaera pallida (ex Woronichin 1927) Giovannoni et al. 1995 is the type species of the genus Isosphaera. The species is of interest because it was the first heterotrophic bacterium known to be phototactic, and it occupies an isolated phylogenetic position within the Planctomycetaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of a member of the genus Isosphaera and the third of a member of the family Planctomycetaceae. The 5,472,964 bp long chromosome and the 56,340 bp long plasmid with a total of 3,763 protein-coding and 60 RNA genes are part of the Genomic Encyclopedia of Bacteria and Archaea project.
Complete genome sequence of Marivirga tractuosa type strain (H-43T)
Pagani, Ioanna; Chertkov, Olga; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Nolan, Matt; Saunders, Elizabeth; Pitluck, Sam; Held, Brittany; Goodwin, Lynne; Liolios, Konstantinos; Ovchinikova, Galina; Ivanova, Natalia; Mavromatis, Konstantinos; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Jeffries, Cynthia D.; Detter, John C.; Han, Cliff; Tapia, Roxanne; Ngatchou-Djao, Olivier D.; Rohde, Manfred; Göker, Markus; Spring, Stefan; Sikorski, Johannes; Woyke, Tanja; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C.
2011-01-01
Marivirga tractuosa (Lewin 1969) Nedashkovskaya et al. 2010 is the type species of the genus Marivirga, which belongs to the family Flammeovirgaceae. Members of this genus are of interest because of their gliding motility. The species is of interest because representative strains show resistance to several antibiotics, including gentamicin, kanamycin, neomycin, polymixin and streptomycin. This is the first complete genome sequence of a member of the family Flammeovirgaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,511,574 bp long chromosome and the 4,916 bp plasmid with their 3,808 protein-coding and 49 RNA genes are a part of the Genomic Encyclopedia of Bacteria and Archaea project. PMID:21677852
Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution
Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira
2012-01-01
Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569
Complete genome sequence of Leptotrichia buccalis type strain (C-1013-bT)
Energy Technology Data Exchange (ETDEWEB)
Ivanova, Natalia; Gronow, Sabine; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice, Hope; Cheng, Jan-Fang; Saunders, Liz; Bruce, David; Goodwin, Lynne; Brettin, Thomas; Detter, John C.; Han, Cliff; Pitluck, Sam; Mikhailova, Natalia; Pati, Amrita; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chain, Patrick; Rohde, Christine; Goker, Markus; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter
2009-05-20
Leptotrichia buccalis (Robin 1853) Trevisan 1879 is the type species of the genus, and is of phylogenetic interest because of its isolated location in the sparsely populated and neither taxonomically nor genomically adequately accessed family 'Leptotrichiaceae' within the phylum 'Fusobacteria'. Species of Leptotrichia are large fusiform non-motile, non-sporulating rods, which often populate the human oral flora. L. buccalis is anaerobic to aerotolerant, and saccharolytic. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of the order 'Fusobacteriales' and no more than the second sequence from the phylum 'Fusobacteria'. The 2,465,610 bp long single replicon genome with its 2306 protein-coding and 61 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H
2004-04-01
Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.
Yamagishi, Hiroshi; Tanaka, Yoshiyuki; Terachi, Toru
2014-11-01
Crop species of Brassica (Brassicaceae) consist of three monogenomic species and three amphidiploid species resulting from interspecific hybridizations among them. Until now, mitochondrial genome sequences were available for only five of these species. We sequenced the mitochondrial genome of the sixth species, Brassica nigra (nuclear genome constitution BB), and compared it with those of Brassica oleracea (CC) and Brassica carinata (BBCC). The genome was assembled into a 232 145 bp circular sequence that is slightly larger than that of B. oleracea (219 952 bp). The genome of B. nigra contained 33 protein-coding genes, 3 rRNA genes, and 17 tRNA genes. The cox2-2 gene present in B. oleracea was absent in B. nigra. Although the nucleotide sequences of 52 genes were identical between B. nigra and B. carinata, the second exon of rps3 showed differences including an insertion/deletion (indel) and nucleotide substitutions. A PCR test to detect the indel revealed intraspecific variation in rps3, and in one line of B. nigra it amplified a DNA fragment of the size expected for B. carinata. In addition, the B. carinata lines tested here produced DNA fragments of the size expected for B. nigra. The results indicate that at least two mitotypes of B. nigra were present in the maternal parents of B. carinata.
Rizotto, La?s S.; Scagion, Guilherme P.; Cardoso, Tereza C.; Sim?o, Raphael M.; Caserta, Leonardo C.; Benassi, Julia C.; Keid, Lara B.; Oliveira, Tr?cia M. F. de S.; Soares, Rodrigo M.; Arns, Clarice W.; Van Borm, Steven; Ferreira, Helena L.
2017-01-01
ABSTRACT We report here the complete genome sequence of an avian metapneumovirus (aMPV) isolated from a tracheal tissue sample of a commercial layer flock. The complete genome sequence of aMPV-A/chicken/Brazil-SP/669/2003 was obtained using MiSeq (Illumina, Inc.) sequencing. Phylogenetic analysis of the complete genome classified the isolate as avian metapneumovirus subtype A.
Analysis and comparison of fragrant gene sequence in some rice cultivars
Directory of Open Access Journals (Sweden)
Karami Noushafarin
2016-01-01
Full Text Available It is known that the fragrant trait in rice (Oryza sativa L. is largely controlled by fgr gene on chromosome 8 and it has been specified that the existence of an 8 bp deletion and three single nucleotide polymorphism (SNP in exon 7 is effective on this trait. In this study, sequence alignment analysis of fgr exon7 on chromosome 8 for 11 different fragrant and non-fragrant cultivars revealed that 5 aromatic rice cultivars carried 3 SNPs and 8 bp deletion in exon7 which terminates prematurely at a TAA stop codon. However, 5 of the non-aromatics showed a sequence identical to the published Nipponbare, being non-fragrant Japonica variety sequence. An exception among them was Bejar, which had 8 bp deletion and 3SNPs but it was non-aromatic. Sequencing can determine nucleotide alignment of a gene and give beneficial information about gene function. In silico prediction showed proteins sequences alignment of fgr gene for Khazar and Domsiah genotypes were different. Betaine aldehyde dehydrogenase complete enzyme belongs to Khazar non-fragrant genotype that has complete length and 503 amino acids while non-functional BADH2 enzyme for Domsiah fragrant genotype has 251 amino acids that result in accumulate 2-acetyl-1-pyrroline (2AP and produces aroma in fragrant genotypes.
Zhang, Yanzhen; Ma, Ji; Yang, Bingxian; Li, Ruyi; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Zhang, Lin
2014-05-01
Taxus chinensis var. mairei (Taxaceae) is a domestic variety of yew species in local China. This plant is one of the sources for paclitaxel, which is a promising antineoplastic chemotherapy drugs during the last decade. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of T. chinensis var. mairei. The T. chinensis var. mairei cp genome is 129,513 bp in length, with 113 single copy genes and two duplicated genes (trnI-CAU, trnQ-UUG). Among the 113 single copy genes, 9 are intron-containing. Compared to other land plant cp genomes, the T. chinensis var. mairei cp genome has lost one of the large inverted repeats (IRs) found in angiosperms, fern, liverwort, and gymnosperm such as Cycas revoluta and Ginkgo biloba L. Compared to related species, the gene order of T. chinensis var. mairei has a large inversion of ~110kb including 91 genes (from rps18 to accD) with gene contents unarranged. Repeat analysis identified 48 direct and 2 inverted repeats 30 bp long or longer with a sequence identity greater than 90%. Repeated short segments were found in genes rps18, rps19 and clpP. Analysis also revealed 22 simple sequence repeat (SSR) loci and almost all are composed of A or T. Copyright © 2014 Elsevier B.V. All rights reserved.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.
Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L
1990-07-01
The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.
Viral Genome DataBase: storing and analyzing genes and proteins from complete viral genomes.
Hiscock, D; Upton, C
2000-05-01
The Viral Genome DataBase (VGDB) contains detailed information of the genes and predicted protein sequences from 15 completely sequenced genomes of large (&100 kb) viruses (2847 genes). The data that is stored includes DNA sequence, protein sequence, GenBank and user-entered notes, molecular weight (MW), isoelectric point (pI), amino acid content, A + T%, nucleotide frequency, dinucleotide frequency and codon use. The VGDB is a mySQL database with a user-friendly JAVA GUI. Results of queries can be easily sorted by any of the individual parameters. The software and additional figures and information are available at http://athena.bioc.uvic.ca/genomes/index.html .
Applications of High Throughput Nucleotide Sequencing
DEFF Research Database (Denmark)
Waage, Johannes Eichler
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Rizotto, Laís S; Scagion, Guilherme P; Cardoso, Tereza C; Simão, Raphael M; Caserta, Leonardo C; Benassi, Julia C; Keid, Lara B; Oliveira, Trícia M F de S; Soares, Rodrigo M; Arns, Clarice W; Van Borm, Steven; Ferreira, Helena L
2017-07-20
We report here the complete genome sequence of an avian metapneumovirus (aMPV) isolated from a tracheal tissue sample of a commercial layer flock. The complete genome sequence of aMPV-A/chicken/Brazil-SP/669/2003 was obtained using MiSeq (Illumina, Inc.) sequencing. Phylogenetic analysis of the complete genome classified the isolate as avian metapneumovirus subtype A. Copyright © 2017 Rizotto et al.
Directory of Open Access Journals (Sweden)
Meng He
2007-07-01
Full Text Available Abstract Background The family Camelidae that evolved in North America during the Eocene survived with two distinct tribes, Camelini and Lamini. To investigate the evolutionary relationship between them and to further understand the evolutionary history of this family, we determined the complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus, the only wild survivor of the Old World camel. Results The mitochondrial genome sequence (16,680 bp from C. bactrianus ferus contains 13 protein-coding, two rRNA, and 22 tRNA genes as well as a typical control region; this basic structure is shared by all metazoan mitochondrial genomes. Its protein-coding region exhibits codon usage common to all mammals and possesses the three cryptic stop codons shared by all vertebrates. C. bactrianus ferus together with the rest of mammalian species do not share a triplet nucleotide insertion (GCC that encodes a proline residue found only in the nd1 gene of the New World camelid Lama pacos. This lineage-specific insertion in the L. pacos mtDNA occurred after the split between the Old and New World camelids suggests that it may have functional implication since a proline insertion in a protein backbone usually alters protein conformation significantly, and nd1 gene has not been seen as polymorphic as the rest of ND family genes among camelids. Our phylogenetic study based on complete mitochondrial genomes excluding the control region suggested that the divergence of the two tribes may occur in the early Miocene; it is much earlier than what was deduced from the fossil record (11 million years. An evolutionary history reconstructed for the family Camelidae based on cytb sequences suggested that the split of bactrian camel and dromedary may have occurred in North America before the tribe Camelini migrated from North America to Asia. Conclusion Molecular clock analysis of complete mitochondrial genomes from C. bactrianus ferus and L
Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H
2002-01-01
Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions
Complete genome sequence of Mahella australiensis type strain (50-1 BONT)
Energy Technology Data Exchange (ETDEWEB)
Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Teshima, Hazuki [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Ngatchou, Olivier Duplex [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Pukall, Rudiger [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Abt, Birte [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute
2011-01-01
Mahella australiensis Bonilla Salinas et al. 2004 is the type species of the genus Mahella, which belongs to the family Thermoanaerobacteraceae. The species is of interest because it differs from other known anaerobic spore-forming bacteria in its G+C content, and in certain phenotypic traits, such as carbon source utilization and relationship to temperature. Moreo- ver, it has been discussed that this species might be an indigenous member of petroleum and oil reservoirs. This is the first completed genome sequence of a member of the genus Mahella and the ninth completed type strain genome sequence from the family Thermoanaerobacte- raceae. The 3,135,972 bp long genome with its 2,974 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
The complete mitochondrial genome sequence of Diaphorina citri (Hemiptera: Psyllidae)
The first complete mitochondrial genome (mitogenome) sequence of Asian citrus psyllid, Diaphorina citri (Hemiptera: Psyllidae), from Guangzhou, China is presented. The circular mitogenome is 14,996 bp in length with an A+T content of 74.5%, and contains 13 protein-coding genes (PCGs), 22 tRNA genes ...
DivStat: a user-friendly tool for single nucleotide polymorphism analysis of genomic diversity.
Directory of Open Access Journals (Sweden)
Inês Soares
Full Text Available Recent developments have led to an enormous increase of publicly available large genomic data, including complete genomes. The 1000 Genomes Project was a major contributor, releasing the results of sequencing a large number of individual genomes, and allowing for a myriad of large scale studies on human genetic variation. However, the tools currently available are insufficient when the goal concerns some analyses of data sets encompassing more than hundreds of base pairs and when considering haplotype sequences of single nucleotide polymorphisms (SNPs. Here, we present a new and potent tool to deal with large data sets allowing the computation of a variety of summary statistics of population genetic data, increasing the speed of data analysis.
DEFF Research Database (Denmark)
Liu, Siyang; Huang, Shujia; Rao, Junhua
2015-01-01
present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...
Complete genome sequence of a tomato infecting tomato mottle mosaic virus in New York
Complete genome sequence of an emerging isolate of tomato mottle mosaic virus (ToMMV) infecting experimental nicotianan benthamiana plants in up-state New York was obtained using small RNA deep sequencing. ToMMV_NY-13 shared 99% sequence identity to ToMMV isolates from Mexico and Florida. Broader d...
The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).
Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai
2016-01-01
In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.
Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado
Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.; Navas-Castillo, Jesús
2012-01-01
A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV).
Thompson, Kirsten F; Patel, Selina; Williams, Liam; Tsai, Peter; Constantine, Rochelle; Baker, C Scott; Millar, Craig D
2016-01-01
Using an Illumina platform, we shot-gun sequenced the complete mitochondrial genome of Gray's beaked whale (Mesoplodon grayi) to an average coverage of 152X. We performed a de novo assembly using SOAPdenovo2 and determined the total mitogenome length to be 16,347 bp. The nucleotide composition was asymmetric (33.3% A, 24.6% C, 12.6% G, 29.5% T) with an overall GC content of 37.2%. The gene organization was similar to that of other cetaceans with 13 protein-coding genes, 2 rRNAs (12S and 16S), 22 predicted tRNAs and 1 control region or D-loop. We found no evidence of heteroplasmy or nuclear copies of mitochondrial DNA in this individual. Beaked whales within the genus Mesoplodon are rarely seen at sea and their basic biology is poorly understood. These data will contribute to resolving the phylogeography and population ecology of this speciose group.
The complete chloroplast genome sequence of Dodonaea viscosa: comparative and phylogenetic analyses.
Saina, Josphat K; Gichira, Andrew W; Li, Zhi-Zhong; Hu, Guang-Wan; Wang, Qing-Feng; Liao, Kuo
2018-02-01
The plant chloroplast (cp) genome is a highly conserved structure which is beneficial for evolution and systematic research. Currently, numerous complete cp genome sequences have been reported due to high throughput sequencing technology. However, there is no complete chloroplast genome of genus Dodonaea that has been reported before. To better understand the molecular basis of Dodonaea viscosa chloroplast, we used Illumina sequencing technology to sequence its complete genome. The whole length of the cp genome is 159,375 base pairs (bp), with a pair of inverted repeats (IRs) of 27,099 bp separated by a large single copy (LSC) 87,204 bp, and small single copy (SSC) 17,972 bp. The annotation analysis revealed a total of 115 unique genes of which 81 were protein coding, 30 tRNA, and four ribosomal RNA genes. Comparative genome analysis with other closely related Sapindaceae members showed conserved gene order in the inverted and single copy regions. Phylogenetic analysis clustered D. viscosa with other species of Sapindaceae with strong bootstrap support. Finally, a total of 249 SSRs were detected. Moreover, a comparison of the synonymous (Ks) and nonsynonymous (Ka) substitution rates in D. viscosa showed very low values. The availability of cp genome reported here provides a valuable genetic resource for comprehensive further studies in genetic variation, taxonomy and phylogenetic evolution of Sapindaceae family. In addition, SSR markers detected will be used in further phylogeographic and population structure studies of the species in this genus.
Complete genome sequence of currant latent virus (genus Cheravirus, family Secoviridae)
Czech Academy of Sciences Publication Activity Database
Petrzik, Karel; Koloniuk, Igor; Přibylová, Jaroslava; Špak, Josef
2016-01-01
Roč. 161, č. 2 (2016), s. 491-493 ISSN 0304-8608 Institutional support: RVO:60077344 Keywords : Stranded-RNA * complete genome sequence * Currant latent virus Subject RIV: EE - Microbiology, Virology Impact factor: 2.058, year: 2016
Complete chloroplast genome sequence of a major economic species, Ziziphus jujuba (Rhamnaceae).
Ma, Qiuyue; Li, Shuxian; Bi, Changwei; Hao, Zhaodong; Sun, Congrui; Ye, Ning
2017-02-01
Ziziphus jujuba is an important woody plant with high economic and medicinal value. Here, we analyzed and characterized the complete chloroplast (cp) genome of Z. jujuba, the first member of the Rhamnaceae family for which the chloroplast genome sequence has been reported. We also built a web browser for navigating the cp genome of Z. jujuba ( http://bio.njfu.edu.cn/gb2/gbrowse/Ziziphus_jujuba_cp/ ). Sequence analysis showed that this cp genome is 161,466 bp long and has a typical quadripartite structure of large (LSC, 89,120 bp) and small (SSC, 19,348 bp) single-copy regions separated by a pair of inverted repeats (IRs, 26,499 bp). The sequence contained 112 unique genes, including 78 protein-coding genes, 30 transfer RNAs, and four ribosomal RNAs. The genome structure, gene order, GC content, and codon usage are similar to other typical angiosperm cp genomes. A total of 38 tandem repeats, two forward repeats, and three palindromic repeats were detected in the Z. jujuba cp genome. Simple sequence repeat (SSR) analysis revealed that most SSRs were AT-rich. The homopolymer regions in the cp genome of Z. jujuba were verified and manually corrected by Sanger sequencing. One-third of mononucleotide repeats were found to be erroneously sequenced by the 454 pyrosequencing, which resulted in sequences of 1-4 bases shorter than that by the Sanger sequencing. Analyzing the cp genome of Z. jujuba revealed that the IR contraction and expansion events resulted in ycf1 and rps19 pseudogenes. A phylogenetic analysis based on 64 protein-coding genes showed that Z. jujuba was closely related to members of the Elaeagnaceae family, which will be helpful for phylogenetic studies of other Rosales species. The complete cp genome sequence of Z. jujuba will facilitate population, phylogenetic, and cp genetic engineering studies of this economic plant.
Next generation sequencing and comparative analyses of Xenopus mitogenomes
Directory of Open Access Journals (Sweden)
Lloyd Rhiannon E
2012-09-01
Full Text Available Abstract Background Mitochondrial genomes comprise a small but critical component of the total DNA in eukaryotic organisms. They encode several key proteins for the cell’s major energy producing apparatus, the mitochondrial respiratory chain. Additonally, their nucleotide and amino acid sequences are of great utility as markers for systematics, molecular ecology and forensics. Their characterization through nucleotide sequencing is a fundamental starting point in mitogenomics. Methods to amplify complete mitochondrial genomes rapidly and efficiently from microgram quantities of tissue of single individuals are, however, not always available. Here we validate two approaches, which combine long-PCR with Roche 454 pyrosequencing technology, to obtain two complete mitochondrial genomes from individual amphibian species. Results We obtained two new xenopus frogs (Xenopus borealis and X. victorianus complete mitochondrial genome sequences by means of long-PCR followed by 454 of individual genomes (approach 1 or of multiple pooled genomes (approach 2, the mean depth of coverage per nucleotide was 9823 and 186, respectively. We also characterised and compared the new mitogenomes against their sister taxa; X. laevis and Silurana tropicalis, two of the most intensely studied amphibians. Our results demonstrate how our approaches can be used to obtain complete amphibian mitogenomes with depths of coverage that far surpass traditional primer-walking strategies, at either the same cost or less. Our results also demonstrate: that the size, gene content and order are the same among xenopus mitogenomes and that S. tropicalis form a separate clade to the other xenopus, among which X. laevis and X. victorianus were most closely related. Nucleotide and amino acid diversity was found to vary across the xenopus mitogenomes, with the greatest diversity observed in the Complex 1 gene nad4l and the least diversity observed in Complex 4 genes (cox1-3. All protein
Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus
Spence, Robert J.; Noune, Christopher; Hauxwell, Caroline
2016-01-01
Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length.
FASH: A web application for nucleotides sequence search
Directory of Open Access Journals (Sweden)
Chew Paul
2008-05-01
Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T
1993-12-22
The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.
Complete mitochondrial genome of the spadenose shark (Scoliodon macrorhynchos).
Chen, Xiao; Peng, Xin; Zhang, Peng; Yang, Shenyun; Liu, Min
2014-04-01
We firstly presented the complete mitogenome of the spadenose shark Scoliodon macrorhynchos (Carcharhinidae, Carcharhiniformes). The mitogenome is 16,693 bp long and contains 13 protein-coding genes, two rRNAs, 22 tRNAs and one control region, a typical vertebrate arrangement. The codon usage bias was different between the H-strand and L-strand encoded protein genes. All tRNA genes have the typical cloverleaf secondary structure excepting tRNA-Ser2, in which the dihydrouridine (DHU) arm is replaced by a simple loop with 12 unpaired nucleotides. A termination associated sequence and three conserved sequence blocks (CSB I-III) were identified in the control region, which were considered associating with the replication and transcription of mitogenome.
Complete Genome Sequence of a Double-Stranded RNA Virus from Avocado
Villanueva, Francisco; Sabanadzovic, Sead; Valverde, Rodrigo A.
2012-01-01
A number of avocado (Persea americana) cultivars are known to contain high-molecular-weight double-stranded RNA (dsRNA) molecules for which a viral nature has been suggested, although sequence data are not available. Here we report the cloning and complete sequencing of a 13.5-kbp dsRNA virus isolated from avocado and show that it corresponds to the genome of a new species of the genus Endornavirus (family Endornaviridae), tentatively named Persea americana endornavirus (PaEV). PMID:22205720
Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.
da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes
2016-05-01
Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.
Energy Technology Data Exchange (ETDEWEB)
Bejerman, Nicolás, E-mail: n.bejerman@uq.edu.au [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia); Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Dietzgen, Ralf G. [Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia)
2015-09-15
Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses.
International Nuclear Information System (INIS)
Bejerman, Nicolás; Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio; Dietzgen, Ralf G.
2015-01-01
Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses
The complete sequence of human chromosome 5
Energy Technology Data Exchange (ETDEWEB)
Schmutz, Jeremy; Martin, Joel; Terry, Astrid; Couronne, Olivier; Grimwood, Jane; Lowry, State; Gordon, Laurie A.; Scott, Duncan; Xie, Gary; Huang, Wayne; Hellsten, Uffe; Tran-Gyamfi, Mary; She, Xinwei; Prabhakar, Shyam; Aerts, Andrea; Altherr, Michael; Bajorek, Eva; Black, Stacey; Branscomb, Elbert; Caoile, Chenier; Challacombe, Jean F.; Chan, Yee Man; Denys, Mirian; Detter, Chris; Escobar, Julio; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstenin, David; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Israni, Sanjay; Jett, Jamie; Kadner, Kristen; Kimbal, Heather; Kobayashi, Arthur; Lopez, Frederick; Lou, Yunian; Martinez, Diego; Medina, Catherine; Morgan, Jenna; Nandkeshwar, Richard; Noonan, James P.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Priest, James; Ramirez, Lucia; Rash, Sam; Retterer, James; Rodriguez, Alex; Rogers, Stephanie; Salamov, Asaf; Salazar, Angelica; Thayer, Nina; Tice, Hope; Tsai, Ming; Ustaszewska, Anna; Vo, Nu; Wheeler, Jeremy; Wu, Kevin; Yang, Joan; Dickson, Mark; Cheng, Jan-Fang; Eichler, Evan E.; Olsen, Anne; Pennacchio, Len A.; Rokhsar, Daniel S.; Richardson, Paul; Lucas, Susan M.; Myers, Richard M.; Rubin, Edward M.
2004-04-15
Chromosome 5 is one of the largest human chromosomes yet has one of the lowest gene densities. This is partially explained by numerous gene-poor regions that display a remarkable degree of noncoding and syntenic conservation with non-mammalian vertebrates, suggesting they are functionally constrained. In total, we compiled 177.7 million base pairs of highly accurate finished sequence containing 923 manually curated protein-encoding genes including the protocadherin and interleukin gene families and the first complete versions of each of the large chromosome 5 specific internal duplications. These duplications are very recent evolutionary events and play a likely mechanistic role, since deletions of these regions are the cause of debilitating disorders including spinal muscular atrophy (SMA).
Complete genome sequence of Beutenbergia cavernae type strain (HKI 0122T)
Energy Technology Data Exchange (ETDEWEB)
Land, Miriam; Pukall, Rudiger; Abt, Birte; Goker, Markus; Rohde, Manfred; Glavina Del Rio, Tijana; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Nolan, Matt; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Saunders, Elizabeth; Brettin, Thomas; Detter, John C.; Han, Cliff; Chain, Patrick; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Lapidus, Alla
2009-05-20
Beutenbergia cavernae (Groth et al. 1999) is the type species of the genus and is of phylogenetic interest because of its isolated location in the actinobacterial suborder Micrococcineae. B. cavernae HKI 0122T is a Gram-positive, non-motile, non-spore-forming bacterium isolated from a cave in Guangxi (China). B. cavernae grows best under aerobic conditions and shows a rod-coccus growth cycle. Its cell wall peptidoglycan contains the diagnostic L-lysine - L-glutamate interpeptide bridge. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first completed genome sequence from the poorly populated micrococcineal family Beutenbergiaceae, and this 4,669,183 bp long single replicon genome with its 4225 protein-coding and 53 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Complete genome sequence of Haliangium ochraceum type strain (SMP-2T)
Energy Technology Data Exchange (ETDEWEB)
Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Daum, Chris [U.S. Department of Energy, Joint Genome Institute; Lang, Elke [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Abt, Birte [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kopitz, marcus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Chen, Feng [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Brettin, Thomas S [ORNL; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany
2010-01-01
Haliangium ochraceum Fudou et al. 2002 is the type species of the genus Haliangium in the myxococcal family Haliangiaceae . Members of the genus Haliangium are the first halophilic myxobacterial taxa described. The cells of the species follow a multicellular lifestyle in highly organized biofilms, called swarms, they decompose bacterial and yeast cells as most myxobacteria do. The fruiting bodies contain particularly small coccoid myxospores. H. ochraceum encodes the first actin homologue identified in a bacterial genome. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the myxococcal suborder Nannocystineae, and the 9,446,314 bp long single replicon genome with its 6,898 protein-coding and 53 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Wang, Yongkang; Song, Xiaodan; Li, Xiaorong; Yang, Sang-tian; Zou, Xiang
2017-01-04
To explore the genome sequence of Aureobasidium pullulans CCTCC M2012223, analyze the key genes related to the biosynthesis of important metabolites, and provide genetic background for metabolic engineering. Complete genome of A. pullulans CCTCC M2012223 was sequenced by Illumina HiSeq high throughput sequencing platform. Then, fragment assembly, gene prediction, functional annotation, and GO/COG cluster were analyzed in comparison with those of other five A. pullulans varieties. The complete genome sequence of A. pullulans CCTCC M2012223 was 30756831 bp with an average GC content of 47.49%, and 9452 genes were successfully predicted. Genome-wide analysis showed that A. pullulans CCTCC M2012223 had the biggest genome assembly size. Protein sequences involved in the pullulan and polymalic acid pathway were highly conservative in all of six A. pullulans varieties. Although both A. pullulans CCTCC M2012223 and A. pullulans var. melanogenum have a close affinity, some point mutation and inserts were occurred in protein sequences involved in melanin biosynthesis. Genome information of A. pullulans CCTCC M2012223 was annotated and genes involved in melanin, pullulan and polymalic acid pathway were compared, which would provide a theoretical basis for genetic modification of metabolic pathway in A. pullulans.
The complete chloroplast genome sequence of Euonymus japonicus (Celastraceae).
Choi, Kyoung Su; Park, SeonJoo
2016-09-01
The complete chloroplast (cp) genome sequence of the Euonymus japonicus, the first sequenced of the genus Euonymus, was reported in this study. The total length was 157 637 bp, containing a pair of 26 678 bp inverted repeat region (IR), which were separated by small single copy (SSC) region and large single copy (LSC) region of 18 340 bp and 85 941 bp, respectively. This genome contains 107 unique genes, including 74 coding genes, four rRNA genes, and 29 tRNA genes. Seventeen genes contain intron of E. japonicus, of which three genes (clpP, ycf3, and rps12) include two introns. The maximum likelihood (ML) phylogenetic analysis revealed that E. japonicus was closely related to Manihot and Populus.
The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences
Directory of Open Access Journals (Sweden)
Ivan V. Stepanyan
2017-01-01
Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.
Classifying Coding DNA with Nucleotide Statistics
Directory of Open Access Journals (Sweden)
Nicolas Carels
2009-10-01
Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.
Yasuike, Motoshige; Nishiki, Issei; Iwasaki, Yuki; Nakamura, Yoji; Fujiwara, Atushi; Shimahara, Yoshiko; Kamaishi, Takashi; Yoshida, Terutoyo; Nagai, Satoshi; Kobayashi, Takanori; Katoh, Masaya
2017-01-01
Nocardiosis caused by Nocardia seriolae is one of the major threats in the aquaculture of Seriola species (yellowtail; S. quinqueradiata, amberjack; S. dumerili and kingfish; S. lalandi) in Japan. Here, we report the complete nucleotide genome sequence of N. seriolae UTF1, isolated from a cultured yellowtail. The genome is a circular chromosome of 8,121,733 bp with a G+C content of 68.1% that encodes 7,697 predicted proteins. In the N. seriolae UTF1 predicted genes, we found orthologs of virulence factors of pathogenic mycobacteria and human clinical Nocardia isolates involved in host cell invasion, modulation of phagocyte function and survival inside the macrophages. The virulence factor candidates provide an essential basis for understanding their pathogenic mechanisms at the molecular level by the fish nocardiosis research community in future studies. We also found many potential antibiotic resistance genes on the N. seriolae UTF1 chromosome. Comparative analysis with the four existing complete genomes, N. farcinica IFM 10152, N. brasiliensis HUJEG-1 and N. cyriacigeorgica GUH-2 and N. nova SH22a, revealed that 2,745 orthologous genes were present in all five Nocardia genomes (core genes) and 1,982 genes were unique to N. seriolae UTF1. In particular, the N. seriolae UTF1 genome contains a greater number of mobile elements and genes of unknown function that comprise the differences in structure and gene content from the other Nocardia genomes. In addition, a lot of the N. seriolae UTF1-specific genes were assigned to the ABC transport system. Because of limited resources in ocean environments, these N. seriolae UTF1 specific ABC transporters might facilitate adaptation strategies essential for marine environment survival. Thus, the availability of the complete N. seriolae UTF1 genome sequence will provide a valuable resource for comparative genomic studies of N. seriolae isolates, as well as provide new insights into the ecological and functional diversity of
Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong
2008-08-01
In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.
Zhang, Chenhua; Zheng, Hongying; Yan, Dankan; Han, Kelei; Song, Xijiao; Liu, Yong; Zhang, Dongfang; Chen, Jianping; Yan, Fei
2017-08-01
Cowpea and broad bean plants showing severe stunting and leaf rolling symptoms were observed in Hefei city, Anhui province, China, in 2014. Symptomatic plants from both species were shown to be infected with milk vetch dwarf virus (MDV) by PCR. The complete genomes of MDV isolates from cowpea and broad bean were sequenced. Each of them had eight genomic DNAs that differed between the two isolates by 10.7% in their overall nucleotide sequences. In addition, the MDV genomes from cowpea and broad bean were associated with two and three alphasatellite DNAs, respectively. This is the first report of MDV on cowpea in China and the first complete genome sequences of Chinese MDV isolates.
A new HCV genotype 6 subtype designated 6v was confirmed with three complete genome sequences.
Wang, Yizhong; Xia, Xueshan; Li, Chunhua; Maneekarn, Niwat; Xia, Wenjie; Zhao, Wenhua; Feng, Yue; Kung, Hsiang Fu; Fu, Yongshui; Lu, Ling
2009-03-01
Although hepatitis C virus (HCV) genotype 6 is classified into 21 subtypes, 6a-6u, new variants continue to be identified. To characterize the full-length genomes of three novel HCV genotype 6 variants: KMN02, KM046 and KM181. From sera of patients with HCV infection, the entire HCV genome was amplified by RT-PCR followed by direct DNA sequencing and phylogenetic analysis. The sera contained HCV genomes of 9461, 9429, and 9461nt in length, and each harboured a single ORF of 9051nt. The genomes showed 95.3-98.1% nucleotide similarity to each other and 72.2-75.4% similarity to 23 genotype 6 reference sequences, which represent subtypes 6a-6u and unassigned variants km41 and gz52557. Phylogenetic analyses demonstrated that they were genotype 6, but were subtypically distinct. Based on the current criteria of HCV classification, they were designed to represent a new subtype, 6v. Analysis of E1 and NS5B region partial sequences revealed two additional related variants, CMBD-14 and CMBD-86 that had been previously reported in northern Thailand and sequences dropped into Genbank. Three novel HCV genotype 6 variants were entirely sequenced and designated subtype 6v.
Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus.
Spence, Robert J; Noune, Christopher; Hauxwell, Caroline
2016-06-30
Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length. Copyright © 2016 Spence et al.
Complete genome sequence of Desulfohalobium retbaense type strain (HR100T)
Energy Technology Data Exchange (ETDEWEB)
Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Chen, Feng [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Munk, Christine [U.S. Department of Energy, Joint Genome Institute; Kiss, Hajnalka [Los Alamos National Laboratory (LANL); Chain, Patrick S. G. [Lawrence Livermore National Laboratory (LLNL); Han, Cliff [Los Alamos National Laboratory (LANL); Brettin, Thomas S [ORNL; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Schuler, Esther [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany
2010-01-01
Desulfohalobium retbaense (Ollivier et al. 1991) is the type species of the polyphyletic genus Desulfohalobium, which comprises, at the time of writing, two species and represents the family Desulfohalobiaceae within the Deltaproteobacteria. D. retbaense is a moderately halophilic sulfate-reducing bacterium, which can utilize H2 and a limited range of organic substrates, which are incompletely oxidized to acetate and CO2, for growth. The type strain HR100T was isolated from sediments of the hypersaline Retba Lake in Senegal. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first completed genome sequence of a member of the family Desulfohalobiaceae. The 2,909,567 bp genome (one chromosome and a 45,263 bp plasmid) with its 2,552 protein-coding and 57 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
DEFF Research Database (Denmark)
Leonardsen, L; DeClue, J E; Lybaek, H
1996-01-01
The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....
One bacterial cell, one complete genome.
Directory of Open Access Journals (Sweden)
Tanja Woyke
2010-04-01
Full Text Available While the bulk of the finished microbial genomes sequenced to date are derived from cultured bacterial and archaeal representatives, the vast majority of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes from these environmental species. Single cell genomics is a novel culture-independent approach, which enables access to the genetic material of an individual cell. No single cell genome has to our knowledge been closed and finished to date. Here we report the completed genome from an uncultured single cell of Candidatus Sulcia muelleri DMIN. Digital PCR on single symbiont cells isolated from the bacteriome of the green sharpshooter Draeculacephala minerva bacteriome allowed us to assess that this bacteria is polyploid with genome copies ranging from approximately 200-900 per cell, making it a most suitable target for single cell finishing efforts. For single cell shotgun sequencing, an individual Sulcia cell was isolated and whole genome amplified by multiple displacement amplification (MDA. Sanger-based finishing methods allowed us to close the genome. To verify the correctness of our single cell genome and exclude MDA-derived artifacts, we independently shotgun sequenced and assembled the Sulcia genome from pooled bacteriomes using a metagenomic approach, yielding a nearly identical genome. Four variations we detected appear to be genuine biological differences between the two samples. Comparison of the single cell genome with bacteriome metagenomic sequence data detected two single nucleotide polymorphisms (SNPs, indicating extremely low genetic diversity within a Sulcia population. This study demonstrates the power of single cell genomics to generate a complete, high quality, non-composite reference genome within an environmental sample, which can be used for population genetic analyzes.
One Bacterial Cell, One Complete Genome
Energy Technology Data Exchange (ETDEWEB)
Woyke, Tanja; Tighe, Damon; Mavrommatis, Konstantinos; Clum, Alicia; Copeland, Alex; Schackwitz, Wendy; Lapidus, Alla; Wu, Dongying; McCutcheon, John P.; McDonald, Bradon R.; Moran, Nancy A.; Bristow, James; Cheng, Jan-Fang
2010-04-26
While the bulk of the finished microbial genomes sequenced to date are derived from cultured bacterial and archaeal representatives, the vast majority of microorganisms elude current culturing attempts, severely limiting the ability to recover complete or even partial genomes from these environmental species. Single cell genomics is a novel culture-independent approach, which enables access to the genetic material of an individual cell. No single cell genome has to our knowledge been closed and finished to date. Here we report the completed genome from an uncultured single cell of Candidatus Sulcia muelleri DMIN. Digital PCR on single symbiont cells isolated from the bacteriome of the green sharpshooter Draeculacephala minerva bacteriome allowed us to assess that this bacteria is polyploid with genome copies ranging from approximately 200?900 per cell, making it a most suitable target for single cell finishing efforts. For single cell shotgun sequencing, an individual Sulcia cell was isolated and whole genome amplified by multiple displacement amplification (MDA). Sanger-based finishing methods allowed us to close the genome. To verify the correctness of our single cell genome and exclude MDA-derived artifacts, we independently shotgun sequenced and assembled the Sulcia genome from pooled bacteriomes using a metagenomic approach, yielding a nearly identical genome. Four variations we detected appear to be genuine biological differences between the two samples. Comparison of the single cell genome with bacteriome metagenomic sequence data detected two single nucleotide polymorphisms (SNPs), indicating extremely low genetic diversity within a Sulcia population. This study demonstrates the power of single cell genomics to generate a complete, high quality, non-composite reference genome within an environmental sample, which can be used for population genetic analyzes.
The complete chloroplast genome sequence of Hibiscus syriacus.
Kwon, Hae-Yun; Kim, Joon-Hyeok; Kim, Sea-Hyun; Park, Ji-Min; Lee, Hyoshin
2016-09-01
The complete chloroplast genome sequence of Hibiscus syriacus L. is presented in this study. The genome is composed of 161 019 bp in length, with a typical circular structure containing a pair of inverted repeats of 25 745 bp of length separated by a large single-copy region and a small single-copy region of 89 698 bp and 19 831 bp of length, respectively. The overall GC content is 36.8%. One hundred and fourteen genes were annotated, including 81 protein-coding genes, 4 ribosomal RNA genes and 29 transfer RNA genes.
Jaschob, Daniel; Davis, Trisha N; Riffle, Michael
2015-03-07
Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.
Complete Genome Sequence of the Pigmented Streptococcus thermophilus Strain JIM8232
Delorme, Christine; Bartholini, Claire; Luraschi, Mélanie; Pons, Nicolas; Loux, Valentin; Almeida, Mathieu; Guédon, Eric; Gibrat, Jean-François; Renault, Pierre
2011-01-01
Streptococcus thermophilus is a dairy species commonly used in the manufacture of cheese and yogurt. Here, we report the complete sequence of S. thermophilus strain JIM8232, isolated from milk and which produces a yellow pigment, an atypical trait for this bacterium. PMID:21914889
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Directory of Open Access Journals (Sweden)
Li Xuehui
2012-10-01
Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs
Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro
2018-03-01
Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.
Directory of Open Access Journals (Sweden)
Lucas M Taniguti
Full Text Available Sporisorium scitamineum is a biotrophic fungus responsible for the sugarcane smut, a worldwide spread disease. This study provides the complete sequence of individual chromosomes of S. scitamineum from telomere to telomere achieved by a combination of PacBio long reads and Illumina short reads sequence data, as well as a draft sequence of a second fungal strain. Comparative analysis to previous available sequences of another strain detected few polymorphisms among the three genomes. The novel complete sequence described herein allowed us to identify and annotate extended subtelomeric regions, repetitive elements and the mitochondrial DNA sequence. The genome comprises 19,979,571 bases, 6,677 genes encoding proteins, 111 tRNAs and 3 assembled copies of rDNA, out of our estimated number of copies as 130. Chromosomal reorganizations were detected when comparing to sequences of S. reilianum, the closest smut relative, potentially influenced by repeats of transposable elements. Repetitive elements may have also directed the linkage of the two mating-type loci. The fungal transcriptome profiling from in vitro and from interaction with sugarcane at two time points (early infection and whip emergence revealed that 13.5% of the genes were differentially expressed in planta and particular to each developmental stage. Among them are plant cell wall degrading enzymes, proteases, lipases, chitin modification and lignin degradation enzymes, sugar transporters and transcriptional factors. The fungus also modulates transcription of genes related to surviving against reactive oxygen species and other toxic metabolites produced by the plant. Previously described effectors in smut/plant interactions were detected but some new candidates are proposed. Ten genomic islands harboring some of the candidate genes unique to S. scitamineum were expressed only in planta. RNAseq data was also used to reassure gene predictions.
Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn
2016-01-01
Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.
DEFF Research Database (Denmark)
Dolejska, Monika; Villa, Laura; Minoia, Marco
2014-01-01
OBJECTIVES: To determine the structure of two multidrug-resistant IncHI1 plasmids carrying blaCTX-M-1 in Escherichia coli isolates disseminated in an equine clinic in the Czech Republic. METHODS: A complete nucleotide sequencing of 239 kb IncHI1 (pEQ1) and 287 kb IncHI1/X1 (pEQ2) plasmids was per...... highlight the structure and evolution of IncHI1 from equine E. coli. A plasmid-mediated sugar metabolic element could play a key role in strain fitness, contributing to the successful dissemination and maintenance of these plasmids in the intestinal microflora of horses....
Complete genome sequence of Denitrovibrio acetiphilus type strain (N2460T)
Energy Technology Data Exchange (ETDEWEB)
Kiss, Hajnalka; Lang, Elke; Lapidus, Alla; Copeland, Alex; Nolan, Matt; Glavina Del Rio, Tijana; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Pati, Amrita; Ivanova, Natalia; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D.; Detter, John C.; Brettin, Thomas; Spring, Stefan; Rohde, Manfred; Goker, Markus; Woyke, Tanja; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter
2010-06-25
Denitrovibrio acetiphilus Myhr and Torsvik 2000 is the type species of the genus Denitrovibrio in the bacterial family Deferribacteraceae. It is of phylogenetic interest because there are only six genera described in the family Deferribacteraceae. D. acetiphilus was isolated as a representative of a population reducing nitrate to ammonia in a laboratory column simulating the conditions in off-shore oil recovery fields. When nitrate was added to this column undesirable hydrogen sulfide production was stopped because the sulfate reducing populations were superseded by these nitrate reducing bacteria. Here we describe the features of this marine, mesophilic, obligately anaerobic organism respiring by nitrate reduction, together with the complete genome sequence, and annotation. This is the second complete genome sequence of the order Deferribacterales and the class Deferribacteres, which is the sole class in the phylum Deferribacteres. The 3,222,077 bp genome with its 3,034 protein-coding and 51 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Complete genome sequence of Saccharomonospora viridis type strain (P101T)
Energy Technology Data Exchange (ETDEWEB)
Pati, Amrita; Sikorski, Johannes; Nolan, Matt; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Lucas, Susan; Chen, Feng; Tice, Hope; Pitluck, Sam; Cheng, Jan-Fang; Chertkov, Olga; Brettin, Thomas; Han, Cliff; Detter, John C.; Kuske, Cheryl; Bruce, David; Goodwin, Lynne; Chain, Patrick; D' haeseleer, Patrik; Chen, Amy; Palaniappan, Krishna; Ivanova, Natalia; Mavromatis, Konstantinos; Mikhailova, Natalia; Rohde, Manfred; Tindall, Brian J.; Goker, Markus; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides1, Nikos C.; Klenk, Hans-Peter
2009-05-20
Saccharomonospora viridis (Schuurmans et al. 1956) Nonomurea and Ohara 1971 is the type species of the genus Saccharomonospora which belongs to the family Pseudonocardiaceae. S. viridis is of interest because it is a Gram-negative organism classified amongst the usually Gram-positive actinomycetes. Members of the species are frequently found in hot compost and hay, and its spores can cause farmer?s lung disease, bagassosis, and humidifier fever. Strains of the species S. viridis have been found to metabolize the xenobiotic pentachlorophenol (PCP). The strain described in this study has been isolated from peat-bog in Ireland. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the family Pseudonocardiaceae, and the 4,308,349 bp long single replicon genome with its 3906 protein-coding and 64 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Complete genome sequence of Dyadobacter fermentans type strain (NS114T)
Energy Technology Data Exchange (ETDEWEB)
Lang, Elke; Lapidus, Alla; Chertkov, Olga; Brettin, Thomas; Detter, John C.; Han, Cliff; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ovchinnikova, Galina; Pati, Amrita; Ivanova, Natalia; Mavromatis, Konstantinos; Chen, Amy; Chain, Patrick; Bristow, Jim; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Goker, Markus; Rohde, Manfred; Kyrpides, Nikos C; Klenk, Hans-Peter
2009-05-20
Dyadobacter fermentans (Chelius MK and Triplett EW, 2000) is the type species of the genus Dyadobacter. It is of phylogenetic interest because of its location in the Cytophagaceae, a very diverse family within the order 'Sphingobacteriales'. D. fermentans has a mainly respiratory metabolism, stains Gram-negative, is non-motile and oxidase and catalase positive. It is characterized by the production of cell filaments in ageing cultures, a flexirubin-like pigment and its ability to ferment glucose, which is almost unique in the aerobically living members of this taxonomically difficult family. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of the 'sphingobacterial' genus Dyadobacter, and this 6,967,790 bp long single replicon genome with its 5804 protein-coding and 50 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Complete genome sequence of Catenulispora acidiphila type strain (ID 139908T)
Energy Technology Data Exchange (ETDEWEB)
Copeland, Alex; Lapidus, Alla; Rio, Tijana GlavinaDel; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Mikhailova, Natalia; Pati, Amrita; Ivanova, Natalia; Mavromatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; Chain, Patrick; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Chertkov, Olga; Brettin, Thomas; Detter, John C.; Han, Cliff; Ali, Zahid; Tindall, Brian J.; Goker, Markus; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter
2009-05-20
Catenulispora acidiphila Busti et al. 2006 is the type species of the genus Catenulispora, and is of interest because of the rather isolated phylogenetic location of the genomically little studied suborder Catenulisporineae within the order Actinomycetales. C. acidiphilia is known for its acidophilic, aerobic lifestyle, but can also grow scantly under anaerobic conditions. Under regular conditions C. acidiphilia grows in long filaments of relatively short aerial hyphae with marked septation. It is a free living, non motile, Gram-positive bacterium isolated from a forest soil sample taken from a wooded area in Gerenzano, Italy. Here we describe the features of this organism, together with the complete genome sequence and annotation. This is the first complete genome sequence of the actinobacterial family Catenulisporaceae, and the 10,467,782 bp long single replicon genome with its 9056 protein-coding and 69 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
Complete genome sequence of Kytococcus sedentarius type strain (strain 541T)
Energy Technology Data Exchange (ETDEWEB)
Sims, David; Brettin, Thomas; Detter, John C.; Han, Cliff; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ovchinnikova, Galina; Pati, Amrita; Ivanova, Natalia; Mavrommatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; D' haeseleer, Patrick; Chain, Patrick; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Schneider, Susanne; Goker, Markus; Pukall, Rudiger; Kyrpides, Nikos C.; Klenk, Hans-Peter
2009-05-20
Kytococcus sedentarius (ZoBell and Upham 1944) Stackebrandt et al. 1995 is the type strain of the species, and is of phylogenetic interest because of its location in the Dermacoccaceae, a poorly studied family within the actinobacterial suborder Micrococcineae. K. sedentarius is known for the production of oligoketide antibiotics as well as for its role as an opportunistic pathogen causing valve endocarditis, hemorrhagic pneumonia, and pitted keratolysis. It is strictly aerobic and can only grow when several amino acids are provided in the medium. The strain described in this report is a free-living, nonmotile, Gram-positive bacterium, originally isolated from a marine environment. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the family Dermacoccaceae and the 2,785,024 bp long single replicon genome with its 2639 protein-coding and 64 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Directory of Open Access Journals (Sweden)
Wang Ting
2011-04-01
Full Text Available Abstract Backgroud Foot-and-mouth disease virus (FMDV serotype Asia1 generally infects cattle and sheep, while its infection of pigs is rarely reported. In 2005-2007, FMD outbreaks caused by Asia1 type occurred in many regions of China, as well as some parts of East Asia countries. During the outbreaks, there was not any report that pigs were found to be clinically infected. Results In this study, a strain of FMDV that isolated from pigs was identified as serotype Asia1, and designated as "Asia1/WHN/CHA/06". To investigate the genomic feature of the strain, complete genome of Asia1/WHN/CHA/06 was sequenced and compared with sequences of other FMDVs by phylogenetic and recombination analysis. The complete genome of Asia1/WHN/CHA/06 was 8161 nucleotides (nt in length, and was closer to JS/CHA/05 than to all other strains. Potential recombination events associated with Asia1/WHN/CHA/06 were found between JS/CHA/05 and HNK/CHA/05 strains with partial 3B and 3C fragments. Conclusion This is the first report of the isolation and identification of a strain of FMDV type Asia1 from naturally infected pigs. The Asia1/WHN/CHA/06 strain may evolve from the recombination of JS/CHA/05 and HNK/CHA/05 strains.
Brand, R C; Klootwijk, J; Planta, R J; Maden, B E
1978-01-01
The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.
Directory of Open Access Journals (Sweden)
Arehart Eric
2009-03-01
Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in
Complete amino acid sequence of bovine colostrum low-Mr cysteine proteinase inhibitor.
Hirado, M; Tsunasawa, S; Sakiyama, F; Niinobe, M; Fujii, S
1985-07-01
The complete amino acid sequence of bovine colostrum cysteine proteinase inhibitor was determined by sequencing native inhibitor and peptides obtained by cyanogen bromide degradation, Achromobacter lysylendopeptidase digestion and partial acid hydrolysis of reduced and S-carboxymethylated protein. Achromobacter peptidase digestion was successfully used to isolate two disulfide-containing peptides. The inhibitor consists of 112 amino acids with an Mr of 12787. Two disulfide bonds were established between Cys 66 and Cys 77 and between Cys 90 and Cys 110. A high degree of homology in the sequence was found between the colostrum inhibitor and human gamma-trace, human salivary acidic protein and chicken egg-white cystatin.
OrthoANI: An improved algorithm and software for calculating average nucleotide identity.
Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik
2016-02-01
Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.
The complete chloroplast genome sequence of Dendrobium nobile.
Yan, Wenjin; Niu, Zhitao; Zhu, Shuying; Ye, Meirong; Ding, Xiaoyu
2016-11-01
The complete chloroplast (cp) genome sequence of Dendrobium nobile, an endangered and traditional Chinese medicine with important economic value, is presented in this article. The total genome size is 150,793 bp, containing a large single copy (LSC) region (84,939 bp) and a small single copy region (SSC) (13,310 bp) which were separated by two inverted repeat (IRs) regions (26,272 bp). The overall GC contents of the plastid genome were 38.8%. In total, 130 unique genes were annotated and they were consisted of 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. Fourteen genes contained one or two introns.
Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi
2016-12-01
The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
Energy Technology Data Exchange (ETDEWEB)
Kuiken, Carla [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Brian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Christian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Alabama, Tuscaloosa, AL (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2010-12-31
This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is still increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.
Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J
1989-12-21
The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)
Supplementary Material for: The arabidopsis cyclic nucleotide interactome
Donaldson, Lara; Meier, Stuart; Gehring, Christoph A
2016-01-01
Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
Complete genome sequence of Brachybacterium faecium type strain (Schefferle 6-10T)
Energy Technology Data Exchange (ETDEWEB)
Lapidus, Alla; Pukall, Rudiger; LaButti, Kurt; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Chen, Feng; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Rohde, Manfred; Goker, Markus; Pati, Amrita; Ivanova, Natalia; Mavrommatis, Konstantinos; Chen, Amy; Palaniappan, Krishna; D' haeseleer, Patrik; Chain, Patrick; Bristow, Jim; Eisen, Johnathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter
2009-05-20
Brachybacterium faecium Collins et al. 1988 is the type species of the genus, and is of phylogenetic interest because of its location in the Dermabacteraceae, a rather isolated family within the actinobacterial suborder Micrococcineae. B. faecium is known for its rod-coccus growth cycle and the ability to degrade uric acid. It grows aerobically or weakly anaerobically. The strain described in this report is a free-living, nonmotile, Gram-positive bacterium, originally isolated from poultry deep litter. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the actinobacterial family Dermabacteraceae, and the 3,614,992 bp long single replicon genome with its 3129 protein-coding and 69 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Comparative Genetic Analyses of Human Rhinovirus C (HRV-C) Complete Genome from Malaysia
Khaw, Yam Sim; Chan, Yoke Fun; Jafar, Faizatul Lela; Othman, Norlijah; Chee, Hui Yee
2016-01-01
Human rhinovirus-C (HRV-C) has been implicated in more severe illnesses than HRV-A and HRV-B, however, the limited number of HRV-C complete genomes (complete 5′ and 3′ non-coding region and open reading frame sequences) has hindered the in-depth genetic study of this virus. This study aimed to sequence seven complete HRV-C genomes from Malaysia and compare their genetic characteristics with the 18 published HRV-Cs. Seven Malaysian HRV-C complete genomes were obtained with newly redesigned primers. The seven genomes were classified as HRV-C6, C12, C22, C23, C26, C42, and pat16 based on the VP4/VP2 and VP1 pairwise distance threshold classification. Five of the seven Malaysian isolates, namely, 3430-MY-10/C22, 8713-MY-10/C23, 8097-MY-11/C26, 1570-MY-10/C42, and 7383-MY-10/pat16 are the first newly sequenced complete HRV-C genomes. All seven Malaysian isolates genomes displayed nucleotide similarity of 63–81% among themselves and 63–96% with other HRV-Cs. Malaysian HRV-Cs had similar putative immunogenic sites, putative receptor utilization and potential antiviral sites as other HRV-Cs. The genomic features of Malaysian isolates were similar to those of other HRV-Cs. Negative selections were frequently detected in HRV-Cs complete coding sequences indicating that these sequences were under functional constraint. The present study showed that HRV-Cs from Malaysia have diverse genetic sequences but share conserved genomic features with other HRV-Cs. This genetic information could provide further aid in the understanding of HRV-C infection. PMID:27199901
Complete coding sequence of Zika virus from Martinique outbreak in 2015
Directory of Open Access Journals (Sweden)
G. Piorkowski
2016-05-01
Full Text Available Zika virus is an Aedes-borne Flavivirus causing fever, arthralgia, myalgia rash, associated with Guillain–Barré syndrome and suspected to induce microcephaly in the fetus. We report here the complete coding sequence of the first characterized Caribbean Zika virus strain, isolated from a patient from Martinique in December, 2015.
Directory of Open Access Journals (Sweden)
Marcos César Lima de Mendonça
2011-06-01
Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.
Complete genome sequence of Leptospira alstonii serovar room 22, strain GWTS#1
We report the complete genome sequence of Leptospira alstonii serovar room 22 strain GWTS#1. This is the first isolate of L. alstonii to be cultured from a mammal, in Western Europe, and represents a new serovar of pathogenic leptospires....
Directory of Open Access Journals (Sweden)
Alban eRamette
2014-11-01
Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.
Pelsy, F.; Merdinoglu, D.
2002-09-01
A chromosome-walking strategy was used to sequence and characterize retrotransposons in the grapevine genome. The reconstitution of a family of retroelements, named Tvv1, was achieved by six successive steps. These elements share a single, highly conserved open reading frame 4,153 nucleotides-long, putatively encoding the gag, pro, int, rt and rh proteins. Comparison of the Tvv1 open reading frame coding potential with those of drosophila copia and tobacco Tnt1, revealed that Tvv1 is closely related to Ty 1 copia-like retrotransposons. A highly variable untranslated leader region, upstream of the open reading frame, allowed us to differentiate Tvv1 variants, which represent a family of at least 28 copies, in varying sizes. This internal region is flanked by two long terminal repeats in direct orientation, sized between 149 and 157 bp. Among elements theoretically sized from 4,970 to 5,550 bp, we describe the full-length sequence of a reference element Tvv1-1, 5,343 nucleotides-long. The full-length sequence of Tvv1-1 compared to pea PDR1 shows a 53.3% identity. In addition, both elements contain long terminal repeats of nearly the same size in which the U5 region could be entirely absent. Therefore, we assume that Tvv1 and PDR1 could constitute a particular class of short LTRs retroelements.
MACSIMS : multiple alignment of complete sequences information management system
Directory of Open Access Journals (Sweden)
Plewniak Frédéric
2006-06-01
Full Text Available Abstract Background In the post-genomic era, systems-level studies are being performed that seek to explain complex biological systems by integrating diverse resources from fields such as genomics, proteomics or transcriptomics. New information management systems are now needed for the collection, validation and analysis of the vast amount of heterogeneous data available. Multiple alignments of complete sequences provide an ideal environment for the integration of this information in the context of the protein family. Results MACSIMS is a multiple alignment-based information management program that combines the advantages of both knowledge-based and ab initio sequence analysis methods. Structural and functional information is retrieved automatically from the public databases. In the multiple alignment, homologous regions are identified and the retrieved data is evaluated and propagated from known to unknown sequences with these reliable regions. In a large-scale evaluation, the specificity of the propagated sequence features is estimated to be >99%, i.e. very few false positive predictions are made. MACSIMS is then used to characterise mutations in a test set of 100 proteins that are known to be involved in human genetic diseases. The number of sequence features associated with these proteins was increased by 60%, compared to the features available in the public databases. An XML format output file allows automatic parsing of the MACSIM results, while a graphical display using the JalView program allows manual analysis. Conclusion MACSIMS is a new information management system that incorporates detailed analyses of protein families at the structural, functional and evolutionary levels. MACSIMS thus provides a unique environment that facilitates knowledge extraction and the presentation of the most pertinent information to the biologist. A web server and the source code are available at http://bips.u-strasbg.fr/MACSIMS/.
Vongerichten, K F; Klein, J R; Matern, H; Plapp, R
1994-10-01
Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.
Botero-Castro, Fidel; Tilak, Marie-ka; Justy, Fabienne; Catzeflis, François; Delsuc, Frédéric; Douzery, Emmanuel J P
2013-12-01
Leaf-nosed bats (Phyllostomidae) are one of the most studied groups within the order Chiroptera mainly because of their outstanding species richness and diversity in morphological and ecological traits. Rapid diversification and multiple homoplasies have made the phylogeny of the family difficult to solve using morphological characters. Molecular data have contributed to shed light on the evolutionary history of phyllostomid bats, yet several relationships remain unresolved at the intra-familial level. Complete mitochondrial genomes have proven useful to deal with this kind of situation in other groups of mammals by providing access to a large number of molecular characters. At present, there are only two mitogenomes available for phyllostomid bats hinting at the need for further exploration of the mitogenomic approach in this group. We used both standard Sanger sequencing of PCR products and next-generation sequencing (NGS) of shotgun genomic DNA to obtain new complete mitochondrial genomes from 10 species of phyllostomid bats, including representatives of major subfamilies, plus one outgroup belonging to the closely-related mormoopids. We then evaluated the contribution of mitogenomics to the resolution of the phylogeny of leaf-nosed bats and compared the results to those based on mitochondrial genes and the RAG2 and VWF nuclear makers. Our results demonstrate the advantages of the Illumina NGS approach to efficiently obtain mitogenomes of phyllostomid bats. The phylogenetic signal provided by entire mitogenomes is highly comparable to the one of a concatenation of individual mitochondrial and nuclear markers, and allows increasing both resolution and statistical support for several clades. This enhanced phylogenetic signal is the result of combining markers with heterogeneous evolutionary rates representing a large number of nucleotide sites. Our results illustrate the potential of the NGS mitogenomic approach for resolving the evolutionary history of
Energy Technology Data Exchange (ETDEWEB)
Swinstrom, Kirsten; Caldwell, Roy; Fourcade, H. Matthew; Boore, Jeffrey L.
2005-09-07
We report the first complete mitochondrial genome sequences of stomatopods and compare their features to each other and to those of other crustaceans. Phylogenetic analyses of the concatenated mitochondrial protein-coding sequences were used to explore relationships within the Stomatopoda, within the malacostracan crustaceans, and among crustaceans and insects. Although these analyses support the monophyly of both Malacostraca and, within it, Stomatopoda, it also confirms the view of a paraphyletic Crustacea, with Malacostraca being more closely related to insects than to the branchiopod crustaceans.
Complete genome sequence of Capnocytophaga ochracea type strain (VPI 2845T)
Energy Technology Data Exchange (ETDEWEB)
Mavromatis, Konstantinos; Gronow, Sabine; Saunders, Elizabeth; Land, Miriam; Lapidus, Alla; Copeland, Alex; Glavina Del Rio, Tijana; Nolan, Matt; Lucas, Susan; Chen, Feng; Tice1, Hope; Cheng, Jan-Fang; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Pati, Amrita; Ivanova, Natalia; Chen, Amy; Palaniappan, Krishna; Chain, Patrick; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Brettin, Thomas; Detter, John C.; Han, Cliff; Bristow, James; Goker, Markus; Rohde, Manfred; Eisen, Jonathan A.; Markowitz, Victor; Kyrpides, Nikos C.; Klenk, Hans-Peter; Hugenholtz, Philip
2009-05-20
Capnocytophaga ochracea (Prevot et al. 1956) Leadbetter et al. 1982 is the type species of the genus Capnocytophaga. It is of interest because of its location in the Flavobacteriaceae, a genomically yet uncharted family within the order Flavobacteriales. The species grows as fusiform to rod shaped cells which tend to form clumps and are able to move by gliding. C. ochracea is known as a capnophilic organism with the ability to grow under anaerobic as well as under aerobic conditions (oxygen concentration larger than 15percent), here only in the presence of 5percent CO2. Strain VPI 2845T, the type strain of the species, is portrayed in this report as a gliding, Gram-negative bacterium, originally isolated from a human oral cavity. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first completed genome sequence from the flavobacterial genus Capnocytophaga, and the 2,612,925 bp long single replicon genome with its 2193 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
We report the complete genome sequence of the Campylobacter jejuni strain 12567, a member of a C. jejuni livestock-associated clade that expresses glycoconjugates linked to improved gastrointestinal tract persistence....
Complete genome sequence of Oceanithermus profundus type strain (506T)
Energy Technology Data Exchange (ETDEWEB)
Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Zhang, Xiaojing [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Hauser, Loren John [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Ruhl, Alina [U.S. Department of Energy, Joint Genome Institute; Mwirichia, Romano [University of Munster, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Wirth, Reinhard [Universitat Regensburg, Regensburg, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Land, Miriam L [ORNL
2011-01-01
Oceanithermus profundus Miroshnichenko et al. 2003 is the type species of the genus Oceanithermus, which belongs to the family Thermaceae. The genus currently comprises two species whose members are thermophilic and are able to reduce sulfur compounds and nitrite. The organism is adapted to the salinity of sea water, is able to utilize a broad range of carbohydrates, some proteinaceous substrates, organic acids and alcohols. This is the first completed genome sequence of a member of the genus Oceanithermus and the fourth sequence from the family Thermaceae. The 2,439,291 bp long genome with its 2,391 protein-coding and 54 RNA genes consists of one chromosome and a 135,351 bp long plasmid, and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
First complete genome sequence of parainfluenza virus 5 isolated from lesser panda.
Zhai, Jun-Qiong; Zhai, Shao-Lun; Lin, Tao; Liu, Jian-Kui; Wang, He-Xing; Li, Bing; Zhang, He; Zou, Shu-Zhan; Zhou, Xia; Wu, Meng-Fan; Chen, Wu; Luo, Man-Lin
2017-05-01
Parainfluenza virus 5 (PIV5) is widespread in mammals and humans. Up to now, there is little information about PIV5 infection in lesser pandas. In this study, a PIV5 variant (named ZJQ-221) was isolated from a lesser panda with respiratory disease in Guangzhou zoo in Guangdong province, southern China. The full-length genome of ZJQ-221 was found to be 15,246 nucleotides and consisted of seven non-overlapping genes encoding eight proteins (i.e., NP, V, P, M, F, SH, HN and L). Sequence alignment and genetic analysis revealed that ZJQ-221 shared a close relationship with a PIV5 strain of canine-origin (1168-1) from South Korea. The findings of this study confirm the presence of PIV5 in lesser panda and indicate this mammal as a possible natural reservoir. Furthermore they highlight the urgent need to strengthen viral surveillance and control of PIV5 in zoo animals.
The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus)
Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya
2011-01-01
The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% iden...
Complete genome sequence of Coraliomargarita akajimensis type strain (04OKA010-24T)
Energy Technology Data Exchange (ETDEWEB)
Mavromatis, Konstantinos; Abt, Birte; Brambilla, Evelyne; Lapidus, Alla; Copeland, Alex; Desphande, Shweta; Nolan, Matt; Lucas, Susan; Tice, Hope; Cheng, Jan-Fang; Han, Cliff; Detter, John C.; Woyke, Tanja; Goodwin, Lynne; Pitluck, Sam; Held, Brittany; Brettin, Thomas; Tapia, Roxanne; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Liolios, Konstantinos; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D.; Rohde, Manfred; G& #246; ker, Markus; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Klenk, Hans-Peter; Kyrpides, Nikos C.
2010-06-25
Coraliomargarita akajimensis Yoon et al. 2007 the type species of the genus Coraliomargarita. C. akajimensis is an obligately aerobic, Gram-negative, non-spore-forming, non-motile, spherical bacterium which was isolated from seawater surrounding the hard coral Galaxea fascicularis. C. akajimensis organism is of special interest because of its phylogenetic position in a genomically purely studied area in the bacterial diversity. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first complete genome sequence of a member of the family Puniceicoccaceae. The 3,750,771 bp long genome with its 3,137 protein-coding and 55 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
Diekmann, Kerstin; Hodkinson, Trevor R; Wolfe, Kenneth H; van den Bekerom, Rob; Dix, Philip J; Barth, Susanne
2009-06-01
Lolium perenne L. (perennial ryegrass) is globally one of the most important forage and grassland crops. We sequenced the chloroplast (cp) genome of Lolium perenne cultivar Cashel. The L. perenne cp genome is 135 282 bp with a typical quadripartite structure. It contains genes for 76 unique proteins, 30 tRNAs and four rRNAs. As in other grasses, the genes accD, ycf1 and ycf2 are absent. The genome is of average size within its subfamily Pooideae and of medium size within the Poaceae. Genome size differences are mainly due to length variations in non-coding regions. However, considerable length differences of 1-27 codons in comparison of L. perenne to other Poaceae and 1-68 codons among all Poaceae were also detected. Within the cp genome of this outcrossing cultivar, 10 insertion/deletion polymorphisms and 40 single nucleotide polymorphisms were detected. Two of the polymorphisms involve tiny inversions within hairpin structures. By comparing the genome sequence with RT-PCR products of transcripts for 33 genes, 31 mRNA editing sites were identified, five of them unique to Lolium. The cp genome sequence of L. perenne is available under Accession number AM777385 at the European Molecular Biology Laboratory, National Center for Biotechnology Information and DNA DataBank of Japan.
Rybalko, S.; Larionov, S.; Poptsova, M.; Loskutov, A.
2011-10-01
Large-scale dynamical properties of complete chromosome DNA sequences of eukaryotes are considered. Using the proposed deterministic models with intermittency and symbolic dynamics we describe a wide spectrum of large-scale patterns inherent in these sequences, such as segmental duplications, tandem repeats, and other complex sequence structures. It is shown that the recently discovered gene number balance on the strands is not of a random nature, and certain subsystems of a complete chromosome DNA sequence exhibit the properties of deterministic chaos.
The complete chloroplast genome of Sinopodophyllum hexandrum Ying (Berberidaceae).
Meng, Lihua; Liu, Ruijuan; Chen, Jianbing; Ding, Chenxu
2017-05-01
The complete nucleotide sequence of the Sinopodophyllum hexandrum Ying chloroplast genome (cpDNA) was determined based on next-generation sequencing technologies in this study. The genome was 157 203 bp in length, containing a pair of inverted repeat (IRa and IRb) regions of 25 960 bp, which were separated by a large single-copy (LSC) region of 87 065 bp and a small single-copy (SSC) region of 18 218 bp, respectively. The cpDNA contained 148 genes, including 96 protein-coding genes, 8 ribosomal RNA genes, and 44 tRNA genes. In these genes, eight harbored a single intron, and two (ycf3 and clpP) contained a couple of introns. The cpDNA AT content of S. hexandrum cpDNA is 61.5%.
Complete genome sequence of Pedobacter heparinus type strain (HIM 762-3T)
Energy Technology Data Exchange (ETDEWEB)
Han, Cliff; Spring, Stefan; Lapidus, Alla; Glavina Del Rio, Tijana; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Lucas, Susan; Chen, Feng; Nolan, Matt; Bruce, David; Goodwin, Lynne; Pitluck, Sam; Ivanova, Natalia; Mavrommatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jefferies, Cynthia C.; Saunders, Elizabeth; Chertkov, Olga; Brettin, Thomas; Goker, Markus; Rohde, Manfred; Bristow, James; Eisen, Jonathan A.; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C.; Klenk, Hans-Peter; Detter, John C.
2009-05-20
Pedobacter heparinus (Payza and Korn 1956) Steyn et al. 1998 comb. nov. is the type species of the rapidly growing genus Pedobacter within the family Sphingobacteriaceae of the phylum 'Bacteroidetes'. P. heparinus is of interest, because it was the first isolated strain shown to grow with heparin as sole carbon and nitrogen source and because it produces several enzymes involved in the degradation of mucopolysaccharides. All available data about this species are based on a sole strain that was isolated from dry soil. Here we describe the features of this organism, together with the complete genome sequence, and annotation. This is the first report on a complete genome sequence of a member of the genus Pedobacter, and the 5,167,383 bp long single replicon genome with its 4287 protein-coding and 54 RNA genes is part of the Genomic Encyclopedia of Bacteria and Archaea project.
Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire
2012-01-01
Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604
Rickettsia asembonensis Characterization by Multilocus Sequence Typing of Complete Genes, Peru.
Loyola, Steev; Flores-Mendoza, Carmen; Torre, Armando; Kocher, Claudine; Melendrez, Melanie; Luce-Fedrow, Alison; Maina, Alice N; Richards, Allen L; Leguia, Mariana
2018-05-01
While studying rickettsial infections in Peru, we detected Rickettsia asembonensis in fleas from domestic animals. We characterized 5 complete genomic regions (17kDa, gltA, ompA, ompB, and sca4) and conducted multilocus sequence typing and phylogenetic analyses. The molecular isolate from Peru is distinct from the original R. asembonensis strain from Kenya.
Complete Genome Sequence of the Fruiting Myxobacterium Melittangium boletus DSM 14713.
Treuner-Lange, Anke; Bruckskotten, Marc; Rupp, Oliver; Goesmann, Alexander; Søgaard-Andersen, Lotte
2017-11-09
The formation of spore-filled fruiting bodies in response to starvation represents a hallmark of many members of the order Myxococcales Here, we present the complete 9.9-Mb genome of the fruiting type strain Melittangium boletus DSM 14713, the first member of this genus to have its genome sequenced. Copyright © 2017 Treuner-Lange et al.
Complete genome sequence of Marivirga tractuosa type strain (H-43).
Pagani, Ioanna; Chertkov, Olga; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Copeland, Alex; Cheng, Jan-Fang; Nolan, Matt; Saunders, Elizabeth; Pitluck, Sam; Held, Brittany; Goodwin, Lynne; Liolios, Konstantinos; Ovchinikova, Galina
2011-01-01
Marivirga tractuosa (Lewin 1969) Nedashkovskaya et al. 2010 is the type species of the genus Marivirga, which belongs to the family Flammeovirgaceae. Members of this genus are of interest because of their gliding motility. The species is of interest because representative strains show resistance to several antibiotics, including gentamicin, kanamycin, neomycin, polymixin and streptomycin. This is the first complete genome sequence of a member of the family Flammeovirgaceae. Here we describe t...
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Gutiérrez, Pablo; Alzate, Juan; Yepes, Mauricio Salazar; Marín, Mauricio
2016-01-01
Colletotrichum lindemuthianum is the causal agent of anthracnose in common bean (Phaseolus vulgaris), one of the most limiting factors for this crop in South and Central America. In this work, the mitochondrial sequence of a Colombian isolate of C. lindemuthianum obtained from a common bean plant (var. Cargamanto) with anthracnose symptoms is presented. The mtDNA codes for 13 proteins of the respiratory chain, 1 ribosomal protein, 2 homing endonucleases, 2 ribosomal RNAs and 28 tRNAs. This is the first report of a complete mtDNA genome sequence from C. lindemuthianum.
Wang, Xin-Cun; Shao, Junjie; Liu, Chang
2016-07-01
We have determined the complete nucleotide sequence of the mitochondrial genome of the medicinal fungus Ganoderma applanatum (Pers.) Pat. using the next-generation sequencing technology. The circular molecule is 119,803 bp long with a GC content of 26.66%. Gene prediction revealed genes encoding 15 conserved proteins, 25 tRNAs, the large and small ribosomal RNAs, all genes are located on the same strand except trnW-CCA. Compared with previously sequenced genomes of G. lucidum, G. meredithiae and G. sinense, the order of the protein and rRNA genes is highly conserved; however, the types of tRNA genes are slightly different. The mitochondrial genome of G. applanatum will contribute to the understanding of the phylogeny and evolution of Ganoderma and Ganodermataceae, the group containing many species with high medicinal values.
Kumar, A; Kumar, J; Khan, J A
2010-04-01
Diseased cotton plants showing typical leaf curl symptoms were collected from experimental plot of Agriculture Research Station-Sriganganagar, Rajasthan. Complete DNA-A component from samples taken from two areas were amplified through rolling circle amplification (RCA) using templiphi kit (GE Healthcare) and characterized. DNA-A of one isolate consists of 2751 nucleotides and second isolate of 2759 nucleotide. Both sequences comprised six ORF's. Genome organization of DNA-A of one isolate shows high sequence similarity with other characterized local begomovirus isolates of Rajasthan, while other isolate shows high sequence similarity with CLCuV reported from Pakistan. The maximum similarity of first isolate, CLCuV-SG01, shows highest sequence identity with Cotton leaf curl Abohar (Rajasthan) virus, and second isolate, CLCuV-SG02, shows highest sequence identity with cotton leaf curl virus from Pakistan. Both isolates showed 85% similarities with each other. The sequence data revealed probable infiltration of some strains of Cotton leaf curl virus from Pakistan to India, or co-existence of different isolates under similar geographical conditions. While CLCuV-SG01 shows highest nt sequence similarity with CLCuV Rajasthan (Abohar), nt identity of V1 ORF (encoding coat protein) of SG01 shows the highest nt identity (100%) with CLCuV Multan (Bhatinda) and Abohar virus while AC1 region also showed difference. Complete nucleotide sequence of SG01 shows only 86% similarity with CLCuV Multan virus. Similarity search revealed significant difference in AV1 and AC1 regions with respect to DNA-A suggesting an evolutionary history of recombination. Computer based analysis, recombination detection Program (RDP) supports the recombination hypothesis, indicated that recombination with other begomoviruses had taken place within V1 ORF and AC1 ORF of CLCuV-SG01 and AC1 ORF of CLCuV-SG02 and also in noncoding intergenic region (IR).
Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong
2018-04-05
Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome
Directory of Open Access Journals (Sweden)
Corti Stefania
2011-03-01
Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects
Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora
Directory of Open Access Journals (Sweden)
Maria Eguiluz
2017-11-01
Full Text Available Abstract Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC and 18,587 bp (SSC. The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes. Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization.
Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora
Eguiluz, Maria; Yuyama, Priscila Mary; Guzman, Frank; Rodrigues, Nureyev Ferreira; Margis, Rogerio
2017-01-01
Abstract Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp) genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC) and 18,587 bp (SSC). The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes). Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization. PMID:29111566
Complete sequence and comparative analysis of the chloroplast genome of Plinia trunciflora.
Eguiluz, Maria; Yuyama, Priscila Mary; Guzman, Frank; Rodrigues, Nureyev Ferreira; Margis, Rogerio
2017-01-01
Plinia trunciflora is a Brazilian native fruit tree from the Myrtaceae family, also known as jaboticaba. This species has great potential by its fruit production. Due to the high content of essential oils in their leaves and of anthocyanins in the fruits, there is also an increasing interest by the pharmaceutical industry. Nevertheless, there are few studies focusing on its molecular biology and genetic characterization. We herein report the complete chloroplast (cp) genome of P. trunciflora using high-throughput sequencing and compare it to other previously sequenced Myrtaceae genomes. The cp genome of P. trunciflora is 159,512 bp in size, comprising inverted repeats of 26,414 bp and single-copy regions of 88,097 bp (LSC) and 18,587 bp (SSC). The genome contains 111 single-copy genes (77 protein-coding, 30 tRNA and four rRNA genes). Phylogenetic analysis using 57 cp protein-coding genes demonstrated that P. trunciflora, Eugenia uniflora and Acca sellowiana form a cluster with closer relationship to Syzygium cumini than with Eucalyptus. The complete cp sequence reported here can be used in evolutionary and population genetics studies, contributing to resolve the complex taxonomy of this species and fill the gap in genetic characterization.
Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.
Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro
2015-11-01
The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Budzanivska I. G.
2014-03-01
Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.
Directory of Open Access Journals (Sweden)
Kwang-Soo Cho
Full Text Available We report the chloroplast (cp genome sequence of tartary buckwheat (Fagopyrum tataricum obtained by next-generation sequencing technology and compared this with the previously reported common buckwheat (F. esculentum ssp. ancestrale cp genome. The cp genome of F. tataricum has a total sequence length of 159,272 bp, which is 327 bp shorter than the common buckwheat cp genome. The cp gene content, order, and orientation are similar to those of common buckwheat, but with some structural variation at tandem and palindromic repeat frequencies and junction areas. A total of seven InDels (around 100 bp were found within the intergenic sequences and the ycf1 gene. Copy number variation of the 21-bp tandem repeat varied in F. tataricum (four repeats and F. esculentum (one repeat, and the InDel of the ycf1 gene was 63 bp long. Nucleotide and amino acid have highly conserved coding sequence with about 98% homology and four genes--rpoC2, ycf3, accD, and clpP--have high synonymous (Ks value. PCR based InDel markers were applied to diverse genetic resources of F. tataricum and F. esculentum, and the amplicon size was identical to that expected in silico. Therefore, these InDel markers are informative biomarkers to practically distinguish raw or processed buckwheat products derived from F. tataricum and F. esculentum.
Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk.
Jiménez, Esther; Villar-Tajadura, M Antonia; Marín, María; Fontecha, Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M
2012-07-01
Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties.
The complete chloroplast genome sequence of Curcuma flaviflora (Curcuma).
Zhang, Yan; Deng, Jiabin; Li, Yangyi; Gao, Gang; Ding, Chunbang; Zhang, Li; Zhou, Yonghong; Yang, Ruiwu
2016-09-01
The complete chloroplast (cp) genome of Curcuma flaviflora, a medicinal plant in Southeast Asia, was sequenced. The genome size was 160 478 bp in length, with 36.3% GC content. A pair of inverted repeats (IRs) of 26 946 bp were separated by a large single copy (LSC) of 88 008 bp and a small single copy (SSC) of 18 578 bp, respectively. The cp genome contained 132 annotated genes, including 79 protein coding genes, 30 tRNA genes, and four rRNA genes. And 19 of these genes were duplicated in inverted repeat regions.
Directory of Open Access Journals (Sweden)
Xiaofeng Shi
Full Text Available The particular environmental characteristics of deep water such as its immense scale and high pressure systems, presents technological problems that have prevented research to broaden our knowledge of deep-sea fish. Here, we described the mitogenome sequence of a deep-sea fish, Cetonurus globiceps. The genome is 17,137 bp in length, with a standard set of 22 transfer RNA genes (tRNAs, two ribosomal RNA genes, 13 protein-coding genes, and two typical non-coding control regions. Additionally, a 70 bp tRNA(Thr-tRNA(Pro intergenic spacer is present. The C. globiceps mitogenome exhibited strand-specific asymmetry in nucleotide composition. The AT-skew and GC-skew values in the whole genome of C. globiceps were 0 and -0.2877, respectively, revealing that the H-strand had equal amounts of A and T and that the overall nucleotide composition was C skewed. All of the tRNA genes could be folded into cloverleaf secondary structures, while the secondary structure of tRNA(Ser(AGY lacked a discernible dihydrouridine stem. By comparing this genome sequence with the recognition sites in teleost species, several conserved sequence blocks were identified in the control region. However, the GTGGG-box, the typical characteristic of conserved sequence block E (CSB-E, was absent. Notably, tandem repeats were identified in the 3' portion of the control region. No similar repetitive motifs are present in most of other gadiform species. Phylogenetic analysis based on 12 protein coding genes provided strong support that C. globiceps was the most derived in the clade. Some relationships however, are in contrast with those presented in previous studies. This study enriches our knowledge of mitogenomes of the genus Cetonurus and provides valuable information on the evolution of Macrouridae mtDNA and deep-sea fish.
Complete genome sequence of Halanaerobium praevalens type strain (GSLT)
Energy Technology Data Exchange (ETDEWEB)
Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Chertkov, Olga [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kannan, K. Palani [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute
2011-01-01
Halanaerobium praevalens Zeikus et al. 1984 is the type species of the genus Halanaero- bium, which in turn is the type genus of the family Halanaerobiaceae. The species is of inter- est because it is able to reduce a variety of nitro-substituted aromatic compounds at a high rate, and because of its ability to degrade organic pollutants. The strain is also of interest be- cause it functions as a hydrolytic bacterium, fermenting complex organic matter and produc- ing intermediary metabolites for other trophic groups such as sulfate-reducing and methano- genic bacteria. It is further reported as being involved in carbon removal in the Great Salt Lake, its source of isolation. This is the first completed genome sequence of a representative of the genus Halanaerobium and the second genome sequence from a type strain of the fami- ly Halanaerobiaceae. The 2,309,262 bp long genome with its 2,110 protein-coding and 70 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
Subramanian, Sankar; Lingala, Syamala Gowri; Swaminathan, Siva; Huynen, Leon; Lambert, David
2014-08-01
The complete mitochondrial genome of the Chinstrap penguin (Pygoscelis antarcticus) was sequenced and compared with other penguin mitogenomes. The genome is 15,972 bp in length with the number and order of protein coding genes and RNAs being very similar to that of other known penguin mitogenomes. Comparative nucleotide analysis showed the Chinstrap mitogenome shares 94% homology with the mitogenome of its sister species, Pygoscelis adelie (Adélie penguin). Divergence at nonsynonymous nucleotide positions was found to be up to 23 times less than that observed in synonymous positions of protein coding genes, suggesting high selection constraints. The complete mitogenome data will be useful for genetic and evolutionary studies of penguins.
Energy Technology Data Exchange (ETDEWEB)
Chain, Patrick S [ORNL; Hu, Ping [Lawrence Berkeley National Laboratory (LBNL); Malfatti, Stephanie [Lawrence Livermore National Laboratory (LLNL); Radnedge, Lyndsay [Lawrence Livermore National Laboratory (LLNL); Larimer, Frank W [ORNL; Vergez, Lisa [Lawrence Livermore National Laboratory (LLNL); Worsham, Patricia [U.S. Army Medical Research Institute of Infectious Diseases; Chu, May C [Centers for Disease Control and Prevention; Anderson, Gary L [Lawrence Berkeley National Laboratory (LBNL)
2006-01-01
Yersinia pestis, the causative agent of bubonic and pneumonic plagues, has undergone detailed study at the molecular level. To further investigate the genomic diversity among this group and to help characterize lineages of the plague organism that have no sequenced members, we present here the genomes of two isolates of the ''classical'' antiqua biovar, strains Antiqua and Nepal516. The genomes of Antiqua and Nepal516 are 4.7 Mb and 4.5 Mb and encode 4,138 and 3,956 open reading frames, respectively. Though both strains belong to one of the three classical biovars, they represent separate lineages defined by recent phylogenetic studies. We compare all five currently sequenced Y. pestis genomes and the corresponding features in Yersinia pseudotuberculosis. There are strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. We found 453 single nucleotide polymorphisms in protein-coding regions, which were used to assess the evolutionary relationships of these Y. pestis strains. Gene reduction analysis revealed that the gene deletion processes are under selective pressure, and many of the inactivations are probably related to the organism's interaction with its host environment. The results presented here clearly demonstrate the differences between the two biovar antiqua lineages and support the notion that grouping Y. pestis strains based strictly on the classical definition of biovars (predicated upon two biochemical assays) does not accurately reflect the phylogenetic relationships within this species. A comparison of four virulent Y. pestis strains with the human-avirulent strain 91001 provides further insight into the genetic basis of virulence to humans.
International Nuclear Information System (INIS)
Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.
1987-01-01
The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function
Complete genome sequence of Capnocytophaga ochracea type strain (VPI 2845T)
Energy Technology Data Exchange (ETDEWEB)
Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Gronow, Sabine [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Chen, Feng [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Chain, Patrick S. G. [Lawrence Livermore National Laboratory (LLNL); Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Brettin, Thomas S [ORNL; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Han, Cliff [Los Alamos National Laboratory (LANL); Bristow, James [U.S. Department of Energy, Joint Genome Institute; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute
2009-01-01
Capnocytophaga ochracea (Pr vot et al. 1956) Leadbetter et al. 1982 is the type species of the genus Capnocytophaga. It is of interest because of its location in the Flavobacteriaceae, a genomically not yet charted family within the order Flavobacteriales. The species grows as fusiform to rod shaped cells which tend to form clumps and are able to move by gliding. C. ochracea is known as a capnophilic (CO2-requiring) organism with the ability to grow under anaerobic as well as aerobic conditions (oxygen concentration larger than 15%), here only in the presence of 5% CO2. Strain VPI 2845T, the type strain of the species, is portrayed in this report as a gliding, Gram-negative bacterium, originally isolated from a human oral cavity. Here we describe the features of this organism, together with the complete genome se-quence, and annotation. This is the first completed genome sequence from the flavobacterial genus Capnocytophaga, and the 2,612,925 bp long single replicon genome with its 2193 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
Complete genome sequence of the plant-associated Serratia plymuthica strain AS13
Energy Technology Data Exchange (ETDEWEB)
Neupane, Saraswoti [Uppsala University, Uppsala, Sweden; Finlay, Roger D. [Uppsala University, Uppsala, Sweden; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Alstrom, Sadhna [Uppsala University, Uppsala, Sweden; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Han, James [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Peters, Lin [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Held, Brittany [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J C [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Hauser, Loren John [ORNL; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Hogberg, Nils [Uppsala University, Uppsala, Sweden
2012-01-01
Serratia plymuthica AS13 is a plant-associated Gammaproteobacteria, isolated from rapeseed roots. It is of special interest because of its ability to inhibit fungal pathogens of rapeseed and to promote plant growth. The complete genome of S. plymuthica AS13 consists of a 5,442,549 bp circular chromosome. The chromosome contains 4,951 protein-coding genes, 87 tRNA genes and 7 rRNA operons. This genome was sequenced as part of the project enti- tled Genomics of four rapeseed plant growth promoting bacteria with antagonistic effect on plant pathogens within the 2010 DOE-JGI Community Sequencing Program (CSP2010).
Liu, Shuaishuai; Zhang, Yanhong; Wang, Changming; Lin, Qiang
2016-07-01
The complete mitochondrial genome sequence of the hedgehog seahorse Hippocampus spinosissimus was first determined in this article. The total length of H. spinosissimus mitogenome is 16 527 bp and consists of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region. The gene order and composition of H. spinosissimus were similar to those of most other vertebrates. The overall base composition of H. spinosissimus is 32.1% A, 30.3% T, 14.9% G and 22.7% C, with a slight A + T-rich feature (62.4%). Phylogenetic analyses based on complete mitochondrial genome sequence showed that H. spinosissimus has a close genetic relationship to H. ingens and H. kuda.
Complete genome sequence of Bifidobacterium breve CECT 7263, a strain isolated from human milk
Jiménez, Esther; Villar-Tajadura, M. Antonia; Marín, María; Fontecha, F. Javier; Requena, Teresa; Arroyo, Rebeca; Fernández, Leónides; Rodríguez, Juan M.
2012-01-01
Bifidobacterium breve is an actinobacterium frequently isolated from colonic microbiota of breastfeeding babies. Here, we report the complete and annotated genome sequence of a B. breve strain isolated from human milk, B. breve CECT 7263. The genome sequence will provide new insights into the biology of this potential probiotic organism and will allow the characterization of genes related to beneficial properties. © 2012, American Society for Microbiology.
Complete mitochondrial DNA sequence of the Eastern keelback mullet Liza affinis.
Gong, Xiaoling; Zhu, Wenjia; Bao, Baolong
2016-05-01
Eastern keelback mullet (Liza affinis) inhabits inlet waters and estuaries of rivers. In this paper, we initially determined the complete mitochondrial genome of Liza affinis. The entire mtDNA sequence is 16,831 bp in length, including 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes and 1 putative control region. Its order and numbers of genes are similar to most bony fishes.
Mitochondrial genome sequence of the Tibetan wild ass (Equus kiang).
Luo, Yongjun; Chen, Yu; Liu, Fuyu; Jiang, Chunhua; Gao, Yuqi
2011-02-01
The Tibetan wild ass, or kiang (Equus kiang) is endemic to the cold and hypoxic (4000-7000 m above sea level) climates of the montane and alpine grasslands of the Tibetan Plateau. We report here the complete nucleotide sequence of the E. kiang mitochondrial genome. Our results show that E. kiang mitochondrial DNA is 16,634 bp long, and predicted to encode all the 37 genes that are typical for vertebrates.
Complete motif analysis of sequence requirements for translation initiation at non-AUG start codons.
Diaz de Arce, Alexander J; Noderer, William L; Wang, Clifford L
2018-01-25
The initiation of mRNA translation from start codons other than AUG was previously believed to be rare and of relatively low impact. More recently, evidence has suggested that as much as half of all translation initiation utilizes non-AUG start codons, codons that deviate from AUG by a single base. Furthermore, non-AUG start codons have been shown to be involved in regulation of expression and disease etiology. Yet the ability to gauge expression based on the sequence of a translation initiation site (start codon and its flanking bases) has been limited. Here we have performed a comprehensive analysis of translation initiation sites that utilize non-AUG start codons. By combining genetic-reporter, cell-sorting, and high-throughput sequencing technologies, we have analyzed the expression associated with all possible variants of the -4 to +4 positions of non-AUG translation initiation site motifs. This complete motif analysis revealed that 1) with the right sequence context, certain non-AUG start codons can generate expression comparable to that of AUG start codons, 2) sequence context affects each non-AUG start codon differently, and 3) initiation at non-AUG start codons is highly sensitive to changes in the flanking sequences. Complete motif analysis has the potential to be a key tool for experimental and diagnostic genomics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Complete genome sequence of Truepera radiovictrix type strain (RQ-24).
Ivanova, Natalia; Rohde, Christine; Munk, Christine; Nolan, Matt; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Deshpande, Shweta; Cheng, Jan-Fang; Tapia, Roxane; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Brambilla, Evelyne; Rohde, Manfred; Göker, Markus; Tindall, Brian J; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lapidus, Alla
2011-02-22
Truepera radiovictrix Albuquerque et al. 2005 is the type species of the genus Truepera within the phylum "Deinococcus/Thermus". T. radiovictrix is of special interest not only because of its isolated phylogenetic location in the order Deinococcales, but also because of its ability to grow under multiple extreme conditions in alkaline, moderately saline, and high temperature habitats. Of particular interest is the fact that, T. radiovictrix is also remarkably resistant to ionizing radiation, a feature it shares with members of the genus Deinococcus. This is the first completed genome sequence of a member of the family Trueperaceae and the fourth type strain genome sequence from a member of the order Deinococcales. The 3,260,398 bp long genome with its 2,994 protein-coding and 52 RNA genes consists of one circular chromosome and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
The complete chloroplast genome of Capsicum annuum var. glabriusculum using Illumina sequencing.
Raveendar, Sebastin; Na, Young-Wang; Lee, Jung-Ro; Shim, Donghwan; Ma, Kyung-Ho; Lee, Sok-Young; Chung, Jong-Wook
2015-07-20
Chloroplast (cp) genome sequences provide a valuable source for DNA barcoding. Molecular phylogenetic studies have concentrated on DNA sequencing of conserved gene loci. However, this approach is time consuming and more difficult to implement when gene organization differs among species. Here we report the complete re-sequencing of the cp genome of Capsicum pepper (Capsicum annuum var. glabriusculum) using the Illumina platform. The total length of the cp genome is 156,817 bp with a 37.7% overall GC content. A pair of inverted repeats (IRs) of 50,284 bp were separated by a small single copy (SSC; 18,948 bp) and a large single copy (LSC; 87,446 bp). The number of cp genes in C. annuum var. glabriusculum is the same as that in other Capsicum species. Variations in the lengths of LSC; SSC and IR regions were the main contributors to the size variation in the cp genome of this species. A total of 125 simple sequence repeat (SSR) and 48 insertions or deletions variants were found by sequence alignment of Capsicum cp genome. These findings provide a foundation for further investigation of cp genome evolution in Capsicum and other higher plants.
Complete genome sequence of thermophilic Bacillus smithii type strain DSM 4216T
DEFF Research Database (Denmark)
Bosma, Elleke Fenna; Koehorst, Jasper J.; van Hijum, Sacha A. F. T.
2016-01-01
determined the complete genomic sequence of the B. smithii type strain DSM 4216T, which consists of a 3,368,778 bp chromosome (GenBank accession number CP012024.1) and a 12,514 bp plasmid (GenBank accession number CP012025.1), together encoding 3880 genes. Genome annotation via RAST was complemented...
Development of a single nucleotide polymorphism (SNP) marker for ...
African Journals Online (AJOL)
The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...
Behera, Bijay Kumar; Kumari, Kavita; Baisvar, Vishwamitra Singh; Rout, Ajaya Kumar; Pakrashi, Sudip; Paria, Prasenjet; Jena, J K
2017-01-01
In the present study, the complete mitochondrial genome sequence of Labeo gonius is reported using PGM sequencer (Ion Torrent). The complete mitogenome of L. gonius is obtained by the de novo sequences assembly of genomic reads using the Torrent Mapping Alignment Program (TMAP) which is 16 614 bp in length. The mitogenome of L. gonius comprised of 13 protein-coding genes, 22 tRNAs, 2 rRNA genes, and D-loop as control region along with gene order and organization, being similar to most of other fish mitogenomes of NCBI databases. The mitogenome in the present study has 99% similarity to the complete mitogenome sequence of Labeo fimbriatus, as reported earlier. The phylogenetic analysis of Cypriniformes depicted that their mitogenomes are closely related to each other. The complete mitogenome sequence of L. gonius would be helpful in understanding the population genetics, phylogenetics, and evolution of Indian Carps.
Complete Genome Sequence of Genotype VI Newcastle Disease Viruses Isolated from Pigeons in Pakistan
Wajid, Abdul; Rehmani, Shafqat Fatima; Sharma, Poonam; Goraichuk, Iryna V.; Dimitrov, Kiril M.; Afonso, Claudio L.
2016-01-01
Two complete genome sequences of Newcastle disease virus (NDV) are described here. Virulent isolates pigeon/Pakistan/Lahore/21A/2015 and pigeon/Pakistan/Lahore/25A/2015 were obtained from racing pigeons sampled in the Pakistani province of Punjab during 2015. Phylogenetic analysis of the fusion protein genes and complete genomes classified the isolates as members of NDV class II, genotype VI.
The Indianmeal moth, Plodia interpunctella (Lepidoptera: Pyralidae), is a common pest of stored goods with a worldwide distribution. The complete genome sequence for a larval pathogen of this moth, the baculovirus Plodia interpunctella granulovirus (PiGV), was determined by next-generation sequenci...
Complete mitochondrial genome and phylogeny of Pleistocene mammoth Mammuthus primigenius.
Directory of Open Access Journals (Sweden)
Evgeny I Rogaev
2006-03-01
Full Text Available Phylogenetic relationships between the extinct woolly mammoth (Mammuthus primigenius, and the Asian (Elephas maximus and African savanna (Loxodonta africana elephants remain unresolved. Here, we report the sequence of the complete mitochondrial genome (16,842 base pairs of a woolly mammoth extracted from permafrost-preserved remains from the Pleistocene epoch--the oldest mitochondrial genome sequence determined to date. We demonstrate that well-preserved mitochondrial genome fragments, as long as approximately 1,600-1700 base pairs, can be retrieved from pre-Holocene remains of an extinct species. Phylogenetic reconstruction of the Elephantinae clade suggests that M. primigenius and E. maximus are sister species that diverged soon after their common ancestor split from the L. africana lineage. Low nucleotide diversity found between independently determined mitochondrial genomic sequences of woolly mammoths separated geographically and in time suggests that north-eastern Siberia was occupied by a relatively homogeneous population of M. primigenius throughout the late Pleistocene.
Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.
Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip
2004-09-22
Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl
Directory of Open Access Journals (Sweden)
Ioanna A Armata
Full Text Available BACKGROUND: Mutations in the GCH1 gene are associated with childhood onset, dopa-responsive dystonia (DRD. Correct diagnosis of DRD is crucial, given the potential for complete recovery once treated with L-dopa. The majority of DRD associated mutations lie within the coding region of the GCH1 gene, but three additional single nucleotide sequence substitutions have been reported within the 5' untranslated (5'UTR region of the mRNA. The biologic significance of these 5'UTR GCH1 sequence substitutions has not been analyzed. METHODOLOGY/PRINCIPAL FINDINGS: Luciferase reporter assays, quantitative real time PCR and RNA decay assays, combined with bioinformatics, revealed a pathogenic 5'UTR GCH1 substitution. The +142C>T single nucleotide 5'UTR substitution that segregates with affected status in DRD patients, substantially attenuates translation without altering RNA expression levels or stability. The +142C>T substitution disrupts translation most likely by creating an upstream initiation start codon (uAUG and an upstream open reading frame (uORF. CONCLUSIONS/SIGNIFICANCE: This is the first GCH1 regulatory substitution reported to act at a post-transcriptional level, increasing the list of genetic diseases caused by abnormal translation and reaffirming the importance of investigating potential regulatory substitutions in genetic diseases.
One-Step PCR Sequencing. Final Technical Progress Report for February 15, 1997 - November 30, 2001
Energy Technology Data Exchange (ETDEWEB)
Shaw, B. R.
2004-04-16
We investigated new chemistries and alternate approaches for direct gene sequencing and detection based on the properties of boron-substituted nucleotides as chain delimiters in lieu of conventional chain terminators. Chain terminators, such as the widely used Sanger dideoxynucleotide truncators, stop DNA synthesis during replication and hence are incompatible with further PCR amplification. Chain delimiters, on the other hand, are chemically-modified, ''stealth'' nucleotides that act like normal nucleotides in DNA synthesis and PCR amplification, but can be unmasked following chain extension and exponential amplification. Specifically, chain delimiters give rise to an alternative sequencing strategy based on selective degradation of DNA chains generated by PCR amplification with modified nucleotides. The method as originally devised employed template-directed enzymatic, random incorporation of small amounts of boron-modified nucleotides (e.g., 2'-deoxynucleoside 5'-alpha-[P-borano]- triphosphates) during PCR amplification. Rather than incorporation of dideoxy chain terminators, which are less efficiently incorporated in PCR-based amplification than natural deoxynucleotides, our method is based on selective incorporation and exonuclease degradation of DNA chains generated by efficient PCR amplification of chemically-modified ''stealth'' nucleotides. The stealth nucleotides have a boranophosphate group instead of a normal phosphate, yet behave like normal nucleotides during PCR-amplification. The unique feature of our method is that the position of the stealth nucleotide, and hence DNA sequencing fragments, are revealed at the desired, appropriate moment following PCR amplification. During the current grant period, a variety of new boron-modified nucleotides were synthesized, and new chemistries and enzymatic methods and combinations thereof were explored to improve the method and study the effects of borane modified
Complete genome sequence of the aerobic CO-oxidizing thermophile Thermomicrobium roseum.
Directory of Open Access Journals (Sweden)
Dongying Wu
Full Text Available In order to enrich the phylogenetic diversity represented in the available sequenced bacterial genomes and as part of an "Assembling the Tree of Life" project, we determined the genome sequence of Thermomicrobium roseum DSM 5159. T. roseum DSM 5159 is a red-pigmented, rod-shaped, Gram-negative extreme thermophile isolated from a hot spring that possesses both an atypical cell wall composition and an unusual cell membrane that is composed entirely of long-chain 1,2-diols. Its genome is composed of two circular DNA elements, one of 2,006,217 bp (referred to as the chromosome and one of 919,596 bp (referred to as the megaplasmid. Strikingly, though few standard housekeeping genes are found on the megaplasmid, it does encode a complete system for chemotaxis including both chemosensory components and an entire flagellar apparatus. This is the first known example of a complete flagellar system being encoded on a plasmid and suggests a straightforward means for lateral transfer of flagellum-based motility. Phylogenomic analyses support the recent rRNA-based analyses that led to T. roseum being removed from the phylum Thermomicrobia and assigned to the phylum Chloroflexi. Because T. roseum is a deep-branching member of this phylum, analysis of its genome provides insights into the evolution of the Chloroflexi. In addition, even though this species is not photosynthetic, analysis of the genome provides some insight into the origins of photosynthesis in the Chloroflexi. Metabolic pathway reconstructions and experimental studies revealed new aspects of the biology of this species. For example, we present evidence that T. roseum oxidizes CO aerobically, making it the first thermophile known to do so. In addition, we propose that glycosylation of its carotenoids plays a crucial role in the adaptation of the cell membrane to this bacterium's thermophilic lifestyle. Analyses of published metagenomic sequences from two hot springs similar to the one from which
International Nuclear Information System (INIS)
Lubahn, D.B.; Simental, J.A.; Higgs, H.N.; Wilson, E.M.; French, F.S.; Brown, T.R.; Migeon, C.J.
1989-01-01
Androgens act through a receptor protein (AR) to mediate sex differentiation and development of the male phenotype. The authors have isolated the eight exons in the amino acid coding region of the AR gene from a human X chromosome library. Nucleotide sequences of the AR gene intron/exon boundaries were determined for use in designing synthetic oligonucleotide primers to bracket coding exons for amplification by the polymerase chain reaction. Genomic DNA was amplified from 46, XY phenotypic female siblings with complete androgen insensitivity syndrome. AR binding affinity for dihydrotestosterone in the affected siblings was lower than in normal males, but the binding capacity was normal. Sequence analysis of amplified exons demonstrated within the AR steroid-binding domain (exon G) a single guanine to adenine mutation, resulting in replacement of valine with methionine at amino acid residue 866. As expected, the carrier mother had both normal and mutant AR genes. Thus, a single point mutation in the steroid-binding domain of the AR gene correlated with the expression of an AR protein ineffective in stimulating male sexual development
Directory of Open Access Journals (Sweden)
Anirvan Chatterjee
2016-09-01
Full Text Available We report the isolation and complete genome sequencing of a new Mimiviridae family member, infecting Acanthamoeba castellanii, from sewage in Mumbai, India. The isolated virus has a particle size of about 435 nm and a 1,182,200-bp genome. A phylogeny based on the DNA polymerase sequence placed the isolate as a new member of the Mimiviridae family lineage A and was named as Mimivirus bombay. Extensive presence of Mimiviridae family members in different environmental niches, with remarkably similar genome size and genetic makeup, point towards an evolutionary advantage that needs to be further investigated. The complete genome sequence of Mimivirus bombay was deposited at GenBank/EMBL/DDBJ under the accession number KU761889.
Shen, Kang-Ning; Tsai, Shiou-Yi; Chen, Ching-Hung; Hsiao, Chung-Der; Durand, Jean-Dominique
2016-11-01
In this study, the complete mitogenome sequence of largescale mullet (Teleostei: Mugilidae) has been sequenced by the next-generation sequencing method. The assembled mitogenome, consisting of 16,832 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 transfer RNAs, two ribosomal RNAs genes, and a non-coding control region of D-loop. D-loop which has a length of 1094 bp is located between tRNA-Pro and tRNA-Phe. The overall base composition of largescale mullet is 27.8% for A, 30.1% for C, 16.2% for G, and 25.9% for T. The complete mitogenome may provide essential and important DNA molecular data for further phylogenetic and evolutionary analysis for Mugilidae.
Shen, Kang-Ning; Chen, Ching-Hung; Hsiao, Chung-Der
2016-05-01
In this study, the complete mitogenome sequence of hornlip mullet Plicomugil labiosus (Teleostei: Mugilidae) has been sequenced by next-generation sequencing method. The assembled mitogenome, consisting of 16,829 bp, had the typical vertebrate mitochondrial gene arrangement, including 13 protein coding genes, 22 transfer RNAs, 2 ribosomal RNAs genes and a non-coding control region of D-loop. D-loop contains 1057 bp length is located between tRNA-Pro and tRNA-Phe. The overall base composition of P. labiosus is 28.0% for A, 29.3% for C, 15.5% for G and 27.2% for T. The complete mitogenome may provide essential and important DNA molecular data for further population, phylogenetic and evolutionary analysis for Mugilidae.
Two complete chloroplast genome sequences of Cannabis sativa varieties.
Oh, Hyehyun; Seo, Boyoung; Lee, Seunghwan; Ahn, Dong-Ha; Jo, Euna; Park, Jin-Kyoung; Min, Gi-Sik
2016-07-01
In this study, we determined the complete chloroplast (cp) genomes from two varieties of Cannabis sativa. The genome sizes were 153,848 bp (the Korean non-drug variety, Cheungsam) and 153,854 bp (the African variety, Yoruba Nigeria). The genome structures were identical with 131 individual genes [86 protein-coding genes (PCGs), eight rRNA, and 37 tRNA genes]. Further, except for the presence of an intron in the rps3 genes of two C. sativa varieties, the cp genomes of C. sativa had conservative features similar to that of all known species in the order Rosales. To verify the position of C. sativa within the order Rosales, we conducted phylogenetic analysis by using concatenated sequences of all PCGs from 17 complete cp genomes. The resulting tree strongly supported monophyly of Rosales. Further, the family Cannabaceae, represented by C. sativa, showed close relationship with the family Moraceae. The phylogenetic relationship outlined in our study is well congruent with those previously shown for the order Rosales.
Complete genome sequence of Tolumonas auensis type strain (TA 4T)
Energy Technology Data Exchange (ETDEWEB)
Chertkov, Olga; Copeland, Alex; Lucas1, Susa; Lapidus, Alla; Berry, KerrieW.; Detter, JohnC.; Glavina Del Rio, Tijana; Hammon, Nancy; Dalin, Eileen; Tice, Hope; Pitluck, Sam; Richardson, Paul; Bruce, David; Goodwin, Lynne; Han, Cliff; Tapia, Roxanne; Saunders, Elizabeth; Schmutz, Jeremy; Brettin, Thomas; Larimer, Frank; Land, Miriam; Hauser, Loren; Spring, Stefan; Rohde, Manfred; Kyrpides, NikosC.; Ivanova, Natalia; G& #246; ker, Markus; Beller, HarryR.; Klenk, Hans-Peter; Woyke, Tanja
2011-10-04
Tolumonas auensis (Fischer-Romero et al. 1996) is currently the only validly named species of the genus Tolumonas in the family Aeromonadaceae. The strain is of interest because of its ability to produce toluene from phenylalanine and other phenyl precursors, as well as phenol from tyrosine. This is of interest because toluene is normally considered to be a tracer of anthropogenic pollution in lakes, but T. auensis represents a biogenic source of toluene. Other than Aeromonas hydrophila subsp. hydrophila, T. auensis strain TA 4T is the only other member in the family Aeromonadaceae with a completely sequenced type-strain genome. The 3,471,292-bp chromosome with a total of 3,288 protein-coding and 116 RNA genes was sequenced as part of the DOE Joint Genome Institute Program JBEI 2008.
Complete genome sequence of Tsukamurella paurometabola type strain (no. 33T)
Energy Technology Data Exchange (ETDEWEB)
Munk, Christine [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Brettin, Thomas S [ORNL; Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany
2011-01-01
Tsukamurella paurometabola corrig. (Steinhaus 1941) Collins et al. 1988 is the type species of the genus Tsukamurella, which is the type genus to the family Tsukamurellaceae. The spe- cies is not only of interest because of its isolated phylogenetic location, but also because it is a human opportunistic pathogen with some strains of the species reported to cause lung in- fection, lethal meningitis, and necrotizing tenosynovitis. This is the first completed genome sequence of a member of the genus Tsukamurella and the first genome sequence of a member of the family Tsukamurellaceae. The 4,479,724 bp long genome contains a 99,806 bp long plasmid and a total of 4,335 protein-coding and 56 RNA genes, and is a part of the Ge- nomic Encyclopedia of Bacteria and Archaea project.
Complete genome sequence of Tolumonas auensis type strain (TA 4T)
Energy Technology Data Exchange (ETDEWEB)
Chertkov, Olga [Los Alamos National Laboratory (LANL); Copeland, A [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Berry, Alison M [California Institute of Technology, University of California, Davis; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Richardson, P M [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Schmutz, Jeremy [Stanford University; Brettin, Thomas S [ORNL; Larimer, Frank W [ORNL; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Beller, Harry R. [Lawrence Berkeley National Laboratory (LBNL); Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute
2011-01-01
Tolumonas auensis Fischer-Romero et al. 1996 is currently the only validly named species of the genus Tolumonas in the family Aeromonadaceae. The strain is of interest because of its ability to produce toluene from phenylalanine and other phenyl precursors, as well as phenol from tyrosine. This is of interest because toluene is normally considered to be a tracer of anthropogenic pollution in lakes, but T. auensis represents a biogenic source of toluene. Oth- er than Aeromonas hydrophila subsp. hydrophila, T. auensis strain TA 4T is the only other member in the family Aeromonadaceae with a completely sequenced type-strain genome. The 3,471,292 bp chromosome with a total of 3,288 protein-coding and 116 RNA genes was sequenced as part of the DOE Joint Genome Institute Program JBEI 2008.
Expressed sequence tags (ESTs) and single nucleotide ...
African Journals Online (AJOL)
SERVER
2008-02-19
Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.
Retrieval and Representation of Nucleotide Sequence of ...
African Journals Online (AJOL)
Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...
Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J
1995-05-01
The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.
Complete Genome Sequence of Genotype VI Newcastle Disease Viruses Isolated from Pigeons in Pakistan
Wajid, Abdul; Rehmani, Shafqat Fatima; Sharma, Poonam; Goraichuk, Iryna V.; Dimitrov, Kiril M.
2016-01-01
Two complete genome sequences of Newcastle disease virus (NDV) are described here. Virulent isolates pigeon/Pakistan/Lahore/21A/2015 and pigeon/Pakistan/Lahore/25A/2015 were obtained from racing pigeons sampled in the Pakistani province of Punjab during 2015. Phylogenetic analysis of the fusion protein genes and complete genomes classified the isolates as members of NDV class II, genotype VI. PMID:27540069
Directory of Open Access Journals (Sweden)
Steven Y C Tong
Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
The genome sequence of pepper vein yellows virus (family Luteoviridae, genus Polerovirus).
Murakami, Ritsuko; Nakashima, Nobuhiko; Hinomoto, Norihide; Kawano, Shinji; Toyosato, Tetsuya
2011-05-01
The complete genome of pepper vein yellows virus (PeVYV) was sequenced using random amplification of RNA samples isolated from vector insects (Aphis gossypii) that had been given access to PeVYV-infected plants. The PeVYV genome consisted of 6244 nucleotides and had a genomic organization characteristic of members of the genus Polerovirus. PeVYV had highest amino acid sequence identities in ORF0 to ORF3 (75.9 - 91.9%) with tobacco vein distorting polerovirus, with which it was only 25.1% identical in ORF5. These sequence comparisons and previously studied biological properties indicate that PeVYV is a distinctly different virus and belongs to a new species of the genus Polerovirus.
Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun
2016-10-01
As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.
Doyle, Stephen R; Griffith, Ian S; Murphy, Nick P; Strugnell, Jan M
2015-01-01
The complete mitochondrial genome of the Eastern Rock lobster, Sagmariasus verreauxi, is reported for the first time. Using low-coverage, long read MiSeq next generation sequencing, we constructed and determined the mtDNA genome organization of the 15,470 bp sequence from two isolates from Eastern Tasmania, Australia and Northern New Zealand, and identified 46 polymorphic nucleotides between the two sequences. This genome sequence and its genetic polymorphisms will likely be useful in understanding the distribution and population connectivity of the Eastern Rock Lobster, and in the fisheries management of this commercially important species.
Directory of Open Access Journals (Sweden)
Jinxin Liu
2017-10-01
Full Text Available Vibrio spp. are the most common pathogens for animals reared in aquaculture. Vibrio campbellii, which is often involved in shrimp, fish and mollusks diseases, is widely distributed in the marine environment worldwide, but our knowledge about its pathogenesis and antimicrobial resistance is very limited. The existence of this knowledge gap is at least partially because that V. campbellii was originally classified as Vibrio harveyi, and the detailed information of its comparative genome analysis to other Vibrio spp. is currently lacking. In this study, the complete genome of a V. campbellii predominant strain, LMB29, was determined by MiSeq in conjunction with PacBio SMRT sequencing. This genome consists of two circular DNA chromosomes and four megaplasmids. Comparative genome analysis indicates that LMB29 shares a 96.66% similarity (average nucleotide identity with the V. campbellii ATCC strain BAA-1116 based on a 75% AF (average fraction calculations, and its functional profile is very similar to V. campbellii E1 and V. campbellii CAIM115. Both type III secretion system (T3SS and type VI secretion system (T6SS, along with the tlh gene which encodes a thermolabile hemolysin, are present in LMB29 which may contribute to the bacterial pathogenesis. The virulence of this strain was experimental confirmed by performing a LDH assay on a fish cell infection model, and cell death was observed as early as within 3 h post infection. Thirty-seven antimicrobial resistance genes (>45% identity were predicted in LMB29 which includes a novel rifampicin ADP ribosyltransferase, arr-9, in plasmid pLMB157. The gene arr-9 was predicted on a genomic island with horizontal transferable potentials which may facilitate the rifampicin resistance dissemination. Future researches are needed to explore the pathogenesis of V. campbellii LMB29, but the availability of this genome sequence will certainly aid as a basis for further analysis.
Feutry, Pierre; Grewe, Peter M; Kyne, Peter M; Chen, Xiao
2015-01-01
In this study we describe the first complete mitochondrial sequence for the Critically Endangered Northern River shark Glyphis garricki. The complete mitochondrial sequence is 16,702 bp in length, contains 37 genes and one control region with the typical gene order and transcriptional direction of vertebrate mitogenomes. The overall base composition is 31.5% A, 26.3% C, 12.9% G and 29.3% T. The length of 22 tRNA genes ranged from 68 (tRNA-Ser2 and tRNA-Cys) to 75 (tRNA-Leu1) bp. The control region of G. garricki was 1067 bp in length with high A+T (67.9%) and poor G (12.6%) content. The mitogenomic characters (base composition, codon usage and gene length) of G. garricki were very similar to Glyphis glyphis.
Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin
2013-10-10
Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae
International Nuclear Information System (INIS)
Hurley, L.H.; Needham-VanDevanter, D.R.
1986-01-01
DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs
Complete Genome Sequence of the Novel Bacteriophage pSco-10 Infecting Staphylococcus cohnii
Jun, Jin Woo; Giri, Sib Sankar; Kim, Hyoun Joong; Chi, Cheng; Yun, Saekil; Kim, Sang Guen; Kim, Sang Wha; Kang, Jeong Woo; Park, Se Chang
2017-01-01
ABSTRACT Herein, we report the complete genome sequence of the Staphylococcus Myoviridae phage pSco-10 infecting Staphylococcus cohnii. The phage pSco-10 was isolated from duck feces collected from four farms in South Korea. The current report provides valuable information for genomic study of phages.
Directory of Open Access Journals (Sweden)
Marize Pereira Miagostovich
2006-05-01
Full Text Available We have determined the complete nucleotide and the deduced amino acid sequences of Brazilian dengue virus type 3 (DENV-3 from a dengue case with fatal outcome, which occurred during an epidemic in the state of Rio de Janeiro, Brazil, in 2002. This constitutes the first complete genetic characterization of a Brazilian DENV-3 strain since its introduction into the country in 2001. DENV-3 was responsible for the most severe dengue epidemic in the state, based on the highest number of reported cases and on the severity of clinical manifestations and deaths reported.
Applications of High-Throughput Nucleotide Sequencing (PhD)
DEFF Research Database (Denmark)
Waage, Johannes
equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...
Complete Genome Sequence of Porcine Parvovirus N Strain Isolated from Guangxi, China
Su, Qian-Lian; Li, Bin; Zhao, Wu; Liang, Jia-Xing; He, Ying; Qin, Yi-Bin; Lu, Bing-Xia
2015-01-01
We report here the complete genomic sequence of the porcine parvovirus (PPV) N strain, isolated in 1989 from the viscera of a stillborn fetus farrowed by a gilt in Guangxi, southern China. Phylogenetic analyses suggest that the PPV-N strain is closely related to attenuated PPV NADL-2 strains. The PPV-N strain has good immunogenicity, genetic stability, and safety.
Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J
2015-01-01
Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required
Zhao, Xing; Liang, Ai-Ping
2016-09-01
The first complete DNA sequence of the mitochondrial genome (mitogenome) of Leptobelus gazelle (Membracoidea: Hemiptera) is determined in this study. The circular molecule is 16,007 bp in its full length, which encodes a set of 37 genes, including 13 proteins, 2 ribosomal RNAs, 22 transfer RNAs, and contains an A + T-rich region (CR). The gene numbers, content, and organization of L. gazelle are similar to other typical metazoan mitogenomes. Twelve of the 13 PCGs are initiated with ATR methionine or ATT isoleucine codons, except the atp8 gene that uses the ATC isoleucine as start signal. Ten of the 13 PCGs have complete termination codons, either TAA (nine genes) or TAG (cytb). The remaining 3 PCGs (cox1, cox2 and nad5) have incomplete termination codons T (AA). All of the 22 tRNAs can be folded in the form of a typical clover-leaf structure. The complete mitogenome sequence data of L. gazelle is useful for the phylogenetic and biogeographic studies of the Membracoidea and Hemiptera.
Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.
Pietrowski, D; Förster, M
2000-01-01
The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).
Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B
2000-05-01
We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.
Chen, Kai; Wang, Yan; Li, Xiang-Yu; Peng, Heng; Ma, Ya-Jun
2017-10-02
Anopheles sinensis (Diptera: Culicidae) is a primary vector of Plasmodium vivax and Brugia malayi in most regions of China. In addition, its phylogenetic relationship with the cryptic species of the Hyrcanus Group is complex and remains unresolved. Mitochondrial genome sequences are widely used as molecular markers for phylogenetic studies of mosquito species complexes, of which mitochondrial genome data of An. sinensis is not available. An. sinensis samples was collected from Shandong, China, and identified by molecular marker. Genomic DNA was extracted, followed by the Illumina sequencing. Two complete mitochondrial genomes were assembled and annotated using the mitochondrial genome of An. gambiae as reference. The mitochondrial genomes sequences of the 28 known Anopheles species were aligned and reconstructed phylogenetic tree by Maximum Likelihood (ML) method. The length of complete mitochondrial genomes of An. sinensis was 15,076 bp and 15,138 bp, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and an AT-rich control region. As in other insects, most mitochondrial genes are encoded on the J strand, except for ND5, ND4, ND4L, ND1, two rRNA and eight tRNA genes, which are encoded on the N strand. The bootstrap value was set as 1000 in ML analyses. The topologies restored phylogenetic affinity within subfamily Anophelinae. The ML tree showed four major clades, corresponding to the subgenera Cellia, Anopheles, Nyssorhynchus and Kerteszia of the genus Anopheles. The complete mitochondrial genomes of An. sinensis were obtained. The number, order and transcription direction of An. sinensis mitochondrial genes were the same as in other species of family Culicidae.
Yu, Danna; Fang, Xindong; Storey, Kenneth B; Zhang, Yongpu; Zhang, Jiayong
2016-05-01
The complete mitochondrial genomes of the yellow-bellied slider (Trachemys scripta scripta) and anoxia tolerant red-eared slider (Trachemys scripta elegans) turtles were sequenced to analyze gene arrangement. The complete mt genomes of T. s. scripta and elegans were circular molecules of 16,791 bp and 16,810 bp in length, respectively, and included an A + 1 frameshift insertion in ND3 and ND4L genes. The AT content of the overall base composition of scripta and elegans was 61.2%. Nucleotide sequence divergence of the mt-genome (p distance) between scripta and elegans was 0.4%. A detailed comparison between the mitochondrial genomes of the two subspecies is shown.