WorldWideScience

Sample records for competent plants characterization

  1. Plant morphology and allometric relationships in competing and non-competing plants of Tagetes patula L.

    Directory of Open Access Journals (Sweden)

    Ingeborga Jarzyna

    2014-01-01

    Full Text Available Allometric relationships (defined as correlation coefficients between plant mass - stem diameter, plant mass - stem height and stem diameter - stem height in plants of Tagetes patula L. (Brassicaceae var. "Tangerine" were analyzed. Competing and non-competing plants were compared in a glasshouse experiment. Competing plants were grown in broad range of densities, from 200 to 6000 individuals • m-2. For non-competing plants no allometric relationships were observed, while for competing plants they were strong, irrespective of density treatment used. Gradual changes of plant morphology (plant mass, stem diameter, stem height and height/mass ratio with the increase of competition intensity were also analyzed.The present study clearly showed, that the intraspecific competition influenced allometric relationships between height, mass and stem diameter of Tagetes patula.

  2. Plant Phenotype Characterization System

    Energy Technology Data Exchange (ETDEWEB)

    Daniel W McDonald; Ronald B Michaels

    2005-09-09

    This report is the final scientific report for the DOE Inventions and Innovations Project: Plant Phenotype Characterization System, DE-FG36-04GO14334. The period of performance was September 30, 2004 through July 15, 2005. The project objective is to demonstrate the viability of a new scientific instrument concept for the study of plant root systems. The root systems of plants are thought to be important in plant yield and thus important to DOE goals in renewable energy sources. The scientific study and understanding of plant root systems is hampered by the difficulty in observing root activity and the inadequacy of existing root study instrumentation options. We have demonstrated a high throughput, non-invasive, high resolution technique for visualizing plant root systems in-situ. Our approach is based upon low-energy x-ray radiography and the use of containers and substrates (artificial soil) which are virtually transparent to x-rays. The system allows us to germinate and grow plant specimens in our containers and substrates and to generate x-ray images of the developing root system over time. The same plant can be imaged at different times in its development. The system can be used for root studies in plant physiology, plant morphology, plant breeding, plant functional genomics and plant genotype screening.

  3. Construction and characterization of a plant transformation-competent BIBAC library of the black Sigatoka-resistant banana Musa acuminata cv. Tuu Gia (AA).

    Science.gov (United States)

    Ortiz-Vázquez, E; Kaemmer, D; Zhang, H-B; Muth, J; Rodríguez-Mendiola, M; Arias-Castro, C; James, Andrew

    2005-02-01

    A plant transformation-competent binary bacterial artificial chromosome (BIBAC) library was constructed from Musa acuminata cv. Tuu Gia (AA), a black Sigatoka-resistant diploid banana. After digestion of high-molecular-weight banana DNA by HindIII, several methods of DNA size selection were tested, followed by ligation, using a vector/insert molar ratio of 4:1. The library consists of 30,700 clones stored in 80 384-well microtiter plates. The mean insert size was estimated to be 100 kb, and the frequency of inserts with internal NotI sites was 61%. The majority of insert sizes fell into the range of 100+/-20 kb, making them suitable for Agrobacterium-mediated transformation. Only 1% and 0.9% of the clones contain chloroplast and mitochondrial DNA, respectively. This is the first BIBAC library for banana, estimated to represent five times its haploid genome (600 Mbp). It was demonstrated by hybridization that the library contains typical members of resistance gene and defense gene families that can be used for transformation of disease susceptible banana cultivars for banana genetic improvement.

  4. Measures geared to maintain the competence of operating personnel at Grohnde nuclear power plant

    International Nuclear Information System (INIS)

    Bohr, H.

    1986-01-01

    Organizational structure of the German power plant 'Gemeinschaftskernkraftwerk Grohnde GmbH'. The plant characteristics of the tasks and duties and definition of competence. Measures to maintain competence. The experience by the realization of training programs to maintain competence. (orig.)

  5. Verifying competence of operations personnel in nuclear power plants

    International Nuclear Information System (INIS)

    Farber, G.H.

    1986-01-01

    To ensure that only competent people are authorized to fill positions in a nuclear power plant, both the initial competence of personnel and the continuous maintenance of competence have to be verified. Two main methods are normally used for verifying competence, namely evaluation of a person's performance over a period of time, and evaluation of his knowledge and skills at a particular time by means of an examination. Both methods have limitations, and in practice they are often used together to give different and to some extent complementary evaluations of a person's competence. Verification of competence itself is a problem area, because objective judging of human competence is extremely difficult. Formal verification methods, such as tests and examinations, are particularly or exclusively applied for the direct operating personnel in the control room (very rarely for management personnel). Out of the many elements contributing to a person's competence, the knowledge which is needed and the intellectual skills are the main subjects of the formal verification methods. Therefore the presentation will concentrate on the proof of the technical qualification of operators by means of examinations. The examination process in the Federal Republic of Germany for the proof of knowledge and skills will serve as an example to describe and analyze the important aspects. From that recommendations are derived regarding standardization of the procedure as well as validation. (orig./GL)

  6. Selection, competency development and assessment of nuclear power plant managers

    International Nuclear Information System (INIS)

    1998-06-01

    This publication provides information on proven methods and good practices with respect to the selection, development and assessment of nuclear power plant (NPP) managers. The report is organized into four sections, a glossary, two appendices, and several annexes. The Introduction (Section 1) provides the framework for the report. Section 2 describes how appropriate management competencies can be used for the selection, development and assessment of NPP managers, including: -Selection which includes recruitment, promotion and succession management. -Management development programmes including formal training, job rotation, on the job training, mentoring, and outside assignments. -Assessment of individual performance. Section 3 describes a systematic process for identifying the competencies needed by NPP managers. This section culminates in a set of suggested core competencies for NPP managers which are further expanded in Appendix A. The annexes included provide specific examples of competency-based management selection, development, and assessment programmes in several Member States. -Annex A is one method to organize and display competencies. -Annex B is an example of using competencies for selection of first line managers. -Annex C is an example of using management competencies for succession management. -Annexes -H are examples of management development programmes. -Annexes I and J are examples of management assessment programmes. A glossary of terms is provided at the end of the report to explain the use of some key terms explain the use of some key terms

  7. Competence and regulatory interactions during regeneration in plants

    Directory of Open Access Journals (Sweden)

    Ajai Joseph Pulianmackal

    2014-04-01

    Full Text Available The ability to regenerate is widely exploited by multitudes of organisms ranging from unicellular bacteria to multicellular plants for their propagation and repair. But the levels of competence for regeneration vary from species to species. While variety of living cells of a plant display regeneration ability, only a few set of cells maintain their stemness in mammals. This highly pliable nature of plant cells in-terms of regeneration can be attributed to their high developmental plasticity. De novo organ initiation can be relatively easily achieved in plants by proper hormonal regulations. Elevated levels of plant hormone auxin induces the formation of proliferating mass of pluripotent cells called callus, which predominantly express lateral root meristem markers and hence is having an identity similar to lateral root primordia. Organ formation can be induced from the callus by modulating the ratio of hormones. An alternative for de novo organogenesis is by the forced expression of plant specific transcription factors. The mechanisms by which plant cells attain competence for regeneration on hormonal treatment or forced expression remain largely elusive. Recent studies have provided some insight into how the epigenetic modifications in plants affect this competence. In this review we discuss the present understanding of regenerative biology in plants and scrutinize the future prospectives of this topic. While discussing about the regeneration in the sporophyte of angiosperms which is well studied, here we outline the regenerative biology of the gametophytic phase and discuss about various strategies of regeneration that have evolved in the domain of life so that a common consensus on the entire process of regeneration can be made.

  8. Assuring the competence of nuclear power plant contractor personnel

    International Nuclear Information System (INIS)

    2001-07-01

    This report was prepared in response to a recommendation by the IAEA International Working Group on Training and Qualification of NPP Personnel (JWG-T and Q) and supported by a number of IAEA meetings on NPP personnel training. IAEA publications on NPP training are the only international documents available to all Member States with nuclear programmes. This report complements the following IAEA publications on NPP personnel training: Technical Reports Series No. 380, Nuclear Power Plant Personnel Training and its Evaluation, A Guidebook; IAEA-TECDOC-1057, Experience in the Use of Systematic Approach to Training (SAT) for Nuclear Power Plant Personnel and IAEA-TECDOC-1063, IAEA World Survey on Nuclear Power Plant Personnel Training. This TECDOC also supplements the IAEA Safety Guide 50-SG-O1 (Rev. 1), Staffing of Nuclear Power Plants and the Recruitment Training and Authorization of Operating Personnel and Safety Standards Series No. NS-R-2, Safety of Nuclear Power Plants. Operation. Within the context of this report NPP contractors are defined as any personnel working for a nuclear power plant who are not directly employed by the nuclear power plant. Competence is the ability to perform to identified standards; it comprises skills, knowledge and attitudes and may be developed through education, experience and training. Qualification is a formal statement of achievement, resulting from an auditable assessment; if competence is assessed, the qualification becomes a formal statement of competence and may be shown on a certificate, diploma, etc. It is recognized that personnel are used to perform tasks that are of a specialised or temporary nature where it is not feasible to hire or maintain a full-time NPP employee. Accordingly, contractors may be used in a variety of situations to support NPPs. Typical situations include: supplies and services being delivered by the contractors that are subject to different quality standards based on a graded approach to assuring

  9. Plant-soil feedbacks and the coexistence of competing plants

    NARCIS (Netherlands)

    Revilla, T.A.; Veen, G.F.; Eppinga, M.B.; Weissing, F.J.

    Plant–soil feedbacks can have important implications for the interactions among plants. Understanding these effects is a major challenge since it is inherently difficult to measure and manipulate highly diverse soil communities. Mathematical models may advance this understanding by making the

  10. Assuring Competency in Nuclear Power Plants: Regulatory Policy and Practice

    International Nuclear Information System (INIS)

    Durbin, Nancy E.; Melber, Barbara

    2004-06-01

    This report provides descriptive and comparative information on competency regulation and oversight in selected countries and identifies issues concerning competency. Interviews with competency experts in five countries: Sweden, Finland, Spain, Canada, and the United Kingdom were conducted and analyzed. The report provides a summary and comparison of the regulations used in these five countries. Regulations and policies in four areas are discussed: Licensing, certification and approvals; Educational qualifications; Training; Experience. Methods and tools used by regulators in the five countries are discussed with regard to how regulators: Assure that licensees determine the competencies needed for the safe operation of nuclear facilities and fill positions with competent staff; Oversee training and examinations in the areas of operations, engineering and maintenance; Assure competence of contractors; Oversee work group performance; Assure competency of managers; Assure competency of other personnel; Assure competency when modifications and other changes occur. Competency experts identified the following as the biggest challenges in regulating competency: The continued availability of qualified personnel; Determining appropriate criteria for competency and assuring those criteria are met. Determining whether licensees have adequately identified and met training needs, especially evaluating systematic approaches to training (SAT); Overseeing contractors. The following issues related to competency are discussed in the report: The sufficiency of qualified personnel; The evaluation of personnel requirements (determining appropriate criteria for competency and assuring those criteria are met); The effects of major organizational changes, including downsizing; Assurance of competency of contractors; International competency issues; The historical and current focus on technical and hardware issues over human factors issues; Selected examples illustrate regulatory

  11. Assuring Competency in Nuclear Power Plants: Regulatory Policy and Practice

    Energy Technology Data Exchange (ETDEWEB)

    Durbin, Nancy E. [Nancy E. Durbin Consulting, Kirkland, WA (United States); Melber, Barbara [Melber Consulting, Seattle, WA (United States)

    2004-06-01

    This report provides descriptive and comparative information on competency regulation and oversight in selected countries and identifies issues concerning competency. Interviews with competency experts in five countries: Sweden, Finland, Spain, Canada, and the United Kingdom were conducted and analyzed. The report provides a summary and comparison of the regulations used in these five countries. Regulations and policies in four areas are discussed: Licensing, certification and approvals; Educational qualifications; Training; Experience. Methods and tools used by regulators in the five countries are discussed with regard to how regulators: Assure that licensees determine the competencies needed for the safe operation of nuclear facilities and fill positions with competent staff; Oversee training and examinations in the areas of operations, engineering and maintenance; Assure competence of contractors; Oversee work group performance; Assure competency of managers; Assure competency of other personnel; Assure competency when modifications and other changes occur. Competency experts identified the following as the biggest challenges in regulating competency: The continued availability of qualified personnel; Determining appropriate criteria for competency and assuring those criteria are met. Determining whether licensees have adequately identified and met training needs, especially evaluating systematic approaches to training (SAT); Overseeing contractors. The following issues related to competency are discussed in the report: The sufficiency of qualified personnel; The evaluation of personnel requirements (determining appropriate criteria for competency and assuring those criteria are met); The effects of major organizational changes, including downsizing; Assurance of competency of contractors; International competency issues; The historical and current focus on technical and hardware issues over human factors issues; Selected examples illustrate regulatory

  12. Training for the qualification and competence of nuclear power plant personnel. Working material

    International Nuclear Information System (INIS)

    1993-01-01

    This document contains summaries of the presentations prepared for the IAEA Review Meeting ''Training for the Qualification and Competence of Nuclear Power Plant Personnel''. The individual contributors have been indexed separately for the database. Refs, figs and tabs

  13. Characterizing Illusions of Competence in Introductory Chemistry Students

    Science.gov (United States)

    Pazicni, Samuel; Bauer, Christopher F.

    2014-01-01

    The Dunning-Kruger effect is a cognitive bias that plagues a particular population of students--the unskilled. This population suffers from illusory competence, as determined by inaccurate ratings of their own ability/performance. These mistakenly high self-ratings (i.e. ''illusions of competence'') are typically explained by a metacognitive…

  14. Medicinal plants: production and biochemical characterization

    International Nuclear Information System (INIS)

    Chunzhao Liu; Zobayed, S.M.A; Murch, S.J.; Saxena, P.K.

    2002-01-01

    Recent advances in the area of biotechnology offer some possibility for the development of new technologies for the conservation, characterization and mass production of medicinal plant species, (i.e. in vitro cell culture techniques for the mass production of sterile, consistent, standardized medicinal plant materials). This paper discussed the following subjects - plant tissue culture, de novo shoot organogenesis, de novo root organogenesis, somatic embryogenesis, large scale propagation in bioreactors and discovery of unique biomolecules

  15. The use of plant experience for maintaining and improving competence

    International Nuclear Information System (INIS)

    Hoffmann, E.

    1986-01-01

    The following topics to be covered in this report are: documentation of plant experience (esp. operational events), derivation of training subjects and training goals, implementation of subjects and goals into retraining, effects of plant experience on tuning and refitting of nuclear power plant simulators and other training equipment. (orig.)

  16. Pollinator Foraging Adaptation and Coexistence of Competing Plants.

    Science.gov (United States)

    Revilla, Tomás A; Křivan, Vlastimil

    2016-01-01

    We use the optimal foraging theory to study coexistence between two plant species and a generalist pollinator. We compare conditions for plant coexistence for non-adaptive vs. adaptive pollinators that adjust their foraging strategy to maximize fitness. When pollinators have fixed preferences, we show that plant coexistence typically requires both weak competition between plants for resources (e.g., space or nutrients) and pollinator preferences that are not too biased in favour of either plant. We also show how plant coexistence is promoted by indirect facilitation via the pollinator. When pollinators are adaptive foragers, pollinator's diet maximizes pollinator's fitness measured as the per capita population growth rate. Simulations show that this has two conflicting consequences for plant coexistence. On the one hand, when competition between pollinators is weak, adaptation favours pollinator specialization on the more profitable plant which increases asymmetries in plant competition and makes their coexistence less likely. On the other hand, when competition between pollinators is strong, adaptation promotes generalism, which facilitates plant coexistence. In addition, adaptive foraging allows pollinators to survive sudden loss of the preferred plant host, thus preventing further collapse of the entire community.

  17. Competing values, tensions and trade-offs in management of nuclear power plants.

    Science.gov (United States)

    Reiman, Teemu; Rollenhagen, Carl

    2012-01-01

    The specific goal of the study is to look how tensions, competing values and trade-offs manifest in the management of nuclear power plants. Second goal is to inspect how existing frameworks, such as Competing Values Framework, can be used to model the tensions. Empirical data consists of thirty interviews that were conducted as part of a NKS study on safety culture in the Nordic nuclear branch. Eight trade-offs are identified based on a grounded theory based analysis of the interview data. The competing values and potential tensions involved in the trade-offs are discussed.

  18. Characterization of bound residues in plants

    International Nuclear Information System (INIS)

    Stratton, G.D. Jr.; Wheeler, W.B.

    1986-01-01

    The characterization of unextractable (or 'bound') pesticide residues in plants can be difficult owing to the insoluble nature of the pesticide-plant complex. An unextractable residue can be defined as material derived from the applied pesticide which remains in the plant matrix after exhaustive organic solvent extraction. Experiments with a variety of pesticide classes in plants indicate that the level of unextractable residue varies with the plant species, the pesticide and the exposure time of the plant to the pesticide. Methods used in attempts to release 'bound' residues from solvent-extracted plant tissues include acid hydrolyses, enzymatic treatments and techniques of high-temperature distillation. These methods solubilize or release varying amounts of unextractable material; the amounts depend on the pesticide and on the extent to which the plant fibre is degraded. In experiments using radiolabelled dieldrin (1, 2, 3, 4, 10, 10-hexachloro-6, 7-epoxy-1, 4, 4a, 5, 6, 7, 8, 8a-octahydro-exo-1, 4-endo-5,6-dimethanonaphthalene), carbofuran (2,3-dihydro-2, 2-dimethylbenzofuran-7-yl methylcarbamate) and permethrin ([3-phenoxybenzyl(+-)-3-(2, 2-dichlorovinyl)-2, 2-dimethylcyclopropanecarboxylate]) in radishes, portions of the unextractable material solubilized by the above methods were identified as parent compound and/or closely related metabolites. The bioavailability and toxicological significance of unextractable pesticide residues need to be evaluated. (author)

  19. Development of Behavioral Indicators of Competences for Safety Culture of Nuclear Power Plants: A Preliminary Study

    International Nuclear Information System (INIS)

    Moon, Kwangsu; Kim, Sa Kil; Oh, Yeon Ju; Shin, Youmin; Lee, Yong-Hee; Jang, Tong Il

    2015-01-01

    The term of safety competency in nuclear field was presented in the OECD/NEA workshop held in 1999. A model of the safety culture competencies in nuclear power plants was developed by KAERI (Korea Atomic Energy Research Institute). In general, a competency (competence) is defined as 'cluster of employee's attribute, knowledge, skill, ability or other characteristic that contributes to successful job performance'. We also defined safety culture competency as 'cluster of various internal characteristics (e.g., knowledge, skill, ability, motive, attitude and etc.) of employee that contribute to perform job safely and shape a healthy and strong safety culture.' By this definition, the safety culture competency is the broader construct including job competency. An employee having high level of safety culture competency shows extra discretionary effort to improve safety of peer, team and organization in addition to the individual's successful and safe job accomplishment. The behavioral indicators for each of the competencies are focal points of conversations on progress and are monitored continuously by self-assessment and managers or supervisors' intervention. Deficiencies in any of these indicators can point to coaching, training or other learning opportunities that employees may be required in order to improve. The purpose of this study was to derive a model of safety competencies for improving safety culture of NPPs and develop a set of behavioral indicators of each competency. In addition, the method of measuring behavioral indicators was suggested. For the application of developed safety culture competences and behavioral indicators, the most suitable measuring method for behavioral indicators must be developed. In the case of behavioral observations, behavioral dimensions (frequency, persistence and latency), observation possibility, occurrence basis of behavior (daily job performance, situational dependent) are considered to

  20. Development of Behavioral Indicators of Competences for Safety Culture of Nuclear Power Plants: A Preliminary Study

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Kwangsu; Kim, Sa Kil; Oh, Yeon Ju; Shin, Youmin; Lee, Yong-Hee; Jang, Tong Il [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-10-15

    The term of safety competency in nuclear field was presented in the OECD/NEA workshop held in 1999. A model of the safety culture competencies in nuclear power plants was developed by KAERI (Korea Atomic Energy Research Institute). In general, a competency (competence) is defined as 'cluster of employee's attribute, knowledge, skill, ability or other characteristic that contributes to successful job performance'. We also defined safety culture competency as 'cluster of various internal characteristics (e.g., knowledge, skill, ability, motive, attitude and etc.) of employee that contribute to perform job safely and shape a healthy and strong safety culture.' By this definition, the safety culture competency is the broader construct including job competency. An employee having high level of safety culture competency shows extra discretionary effort to improve safety of peer, team and organization in addition to the individual's successful and safe job accomplishment. The behavioral indicators for each of the competencies are focal points of conversations on progress and are monitored continuously by self-assessment and managers or supervisors' intervention. Deficiencies in any of these indicators can point to coaching, training or other learning opportunities that employees may be required in order to improve. The purpose of this study was to derive a model of safety competencies for improving safety culture of NPPs and develop a set of behavioral indicators of each competency. In addition, the method of measuring behavioral indicators was suggested. For the application of developed safety culture competences and behavioral indicators, the most suitable measuring method for behavioral indicators must be developed. In the case of behavioral observations, behavioral dimensions (frequency, persistence and latency), observation possibility, occurrence basis of behavior (daily job performance, situational dependent) are considered to

  1. Administrative competence of regions in connection with the establishment of power plants

    International Nuclear Information System (INIS)

    Poidomani, C.

    1980-03-01

    This paper which is divided into two parts, analyses the concept of competence underlying the regulations concerning the transfer of certain state duties to the regions. The author considers that this concept does not seem adaptable to the various functions the regions are required to discharge in the energy field. A description follows of the technical and administrative authority given to the regions in the licensing process for power-producing plants. The second part of the paper deals with recent regulations concerning energy conservation and development of alternative energy sources, in the context of regional competence. (NEA) [fr

  2. What Characterizes the Algebraic Competence of Norwegian Upper Secondary School Students? Evidence from TIMSS Advanced

    Science.gov (United States)

    Pedersen, Ida Friestad

    2015-01-01

    Algebra is the fundamental language of mathematics, and a profound understanding of school algebra is an important prerequisite for further studies in mathematical sciences. The aim of this study is to characterize the algebraic competence of the Norwegian upper secondary school students participating in Trends in International Mathematics and…

  3. Dynamics of three types of annual plants competing for water and light

    Science.gov (United States)

    Pȩkalski, Andrzej; Szwabiński, Janusz

    2013-02-01

    We present and discuss a Monte Carlo model describing the dynamics of three types of annual plants which have different tolerances to shade and drought. External conditions (water and light) fluctuate around some values which are our control parameters and which decide how many resources the system receives. The plants compete with their nearest neighbours for the resources, however not in the same way. We show that for certain ranges of the control parameters a coexistence of the three species is observed. We discuss how the characteristics of the the plants - their number, germination, biomass or the number of nearest neighbours, depend on the two control parameters characterising external conditions. We show that elimination is done at the level of adult plants, not seedlings. We find also cooperative behaviour of plants in difficult conditions, as observed in field studies and we propose an explanation for this fact. Apart from plants tolerating shade but requiring more water and those tolerating drought but needing more light, which are common in nature, we introduce a third species with intermediary demands. We investigate under what conditions this new species could dominate and whether the total number of plants, regardless of their type, is larger with or without the intermediate plant. We show that in our model, like in nature, systems with two kinds of plants with opposite characteristics are, in general, as effective as a system with an additional third type of plants. We show that two contradictory hypotheses made by biologists, concerning the demands of plants in drought and shade, could be both true, however in different regimes.

  4. How To Produce and Characterize Transgenic Plants.

    Science.gov (United States)

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  5. Competence of nuclear power plant operations personnel: the regulatory assessment process

    International Nuclear Information System (INIS)

    Ishack, G.A.

    1994-01-01

    Assessment of the competence of nuclear power plant operations personnel constitutes an essential element in the overall regulatory process of ensuring that the use of nuclear energy does not pose undue risk to health, safety, security and the environment. This paper presents a review of the activities of the Operator Certification Division of the Canadian Atomic Energy Control Board, reports on its experience with simulator-based examinations and with training programme evaluation techniques and outlines and Division's future plans. 3 refs., 1 fig

  6. Characterization of haemoglobin from Actinorhizal plants – An in ...

    Indian Academy of Sciences (India)

    2013-10-01

    Oct 1, 2013 ... in oxygen transport and respiration in animals. They are found ubiquitously in eukaryotes and in many bacteria (Dordas et al. 2003). Plant Hbs, structurally similar to animal Hbs and myo- globins, were first characterized from the root nodules of legu- minous plants (Kubo 1939). Initially, plant Hb proteins ...

  7. Tree root systems competing for soil moisture in a 3D soil-plant model

    Science.gov (United States)

    Manoli, Gabriele; Bonetti, Sara; Domec, Jean-Christophe; Putti, Mario; Katul, Gabriel; Marani, Marco

    2014-04-01

    Competition for water among multiple tree rooting systems is investigated using a soil-plant model that accounts for soil moisture dynamics and root water uptake (RWU), whole plant transpiration, and leaf-level photosynthesis. The model is based on a numerical solution to the 3D Richards equation modified to account for a 3D RWU, trunk xylem, and stomatal conductances. The stomatal conductance is determined by combining a conventional biochemical demand formulation for photosynthesis with an optimization hypothesis that selects stomatal aperture so as to maximize carbon gain for a given water loss. Model results compare well with measurements of soil moisture throughout the rooting zone, of total sap flow in the trunk xylem, as well as of leaf water potential collected in a Loblolly pine forest. The model is then used to diagnose plant responses to water stress in the presence of competing rooting systems. Unsurprisingly, the overlap between rooting zones is shown to enhance soil drying. However, the 3D spatial model yielded transpiration-bulk root-zone soil moisture relations that do not deviate appreciably from their proto-typical form commonly assumed in lumped eco-hydrological models. The increased overlap among rooting systems primarily alters the timing at which the point of incipient soil moisture stress is reached by the entire soil-plant system.

  8. Characterization of Cellulose Synthesis in Plant Cells

    Science.gov (United States)

    Maleki, Samaneh Sadat; Mohammadi, Kourosh; Ji, Kong-shu

    2016-01-01

    Cellulose is the most significant structural component of plant cell wall. Cellulose, polysaccharide containing repeated unbranched β (1-4) D-glucose units, is synthesized at the plasma membrane by the cellulose synthase complex (CSC) from bacteria to plants. The CSC is involved in biosynthesis of cellulose microfibrils containing 18 cellulose synthase (CesA) proteins. Macrofibrils can be formed with side by side arrangement of microfibrils. In addition, beside CesA, various proteins like the KORRIGAN, sucrose synthase, cytoskeletal components, and COBRA-like proteins have been involved in cellulose biosynthesis. Understanding the mechanisms of cellulose biosynthesis is of great importance not only for improving wood production in economically important forest trees to mankind but also for plant development. This review article covers the current knowledge about the cellulose biosynthesis-related gene family. PMID:27314060

  9. Characterization of Cellulose Synthesis in Plant Cells

    Directory of Open Access Journals (Sweden)

    Samaneh Sadat Maleki

    2016-01-01

    Full Text Available Cellulose is the most significant structural component of plant cell wall. Cellulose, polysaccharide containing repeated unbranched β (1-4 D-glucose units, is synthesized at the plasma membrane by the cellulose synthase complex (CSC from bacteria to plants. The CSC is involved in biosynthesis of cellulose microfibrils containing 18 cellulose synthase (CesA proteins. Macrofibrils can be formed with side by side arrangement of microfibrils. In addition, beside CesA, various proteins like the KORRIGAN, sucrose synthase, cytoskeletal components, and COBRA-like proteins have been involved in cellulose biosynthesis. Understanding the mechanisms of cellulose biosynthesis is of great importance not only for improving wood production in economically important forest trees to mankind but also for plant development. This review article covers the current knowledge about the cellulose biosynthesis-related gene family.

  10. Wildflower Plantings Do Not Compete With Neighboring Almond Orchards for Pollinator Visits.

    Science.gov (United States)

    Lundin, Ola; Ward, Kimiora L; Artz, Derek R; Boyle, Natalie K; Pitts-Singer, Theresa L; Williams, Neal M

    2017-06-01

    The engineering of flowering agricultural field borders has emerged as a research and policy priority to mitigate threats to pollinators. Studies have, however, rarely addressed the potential that flowering field borders might compete with neighboring crops for pollinator visits if they both are in bloom at the same time, despite this being a concern expressed by growers. We evaluated how wildflower plantings added to orchard borders in a large (512 ha) commercial almond orchard affected honey bee and wild bee visitation to orchard borders and the crop. The study was conducted over two consecutive seasons using three large (0.48 ha) wildflower plantings paired with control orchard borders in a highly simplified agricultural landscape in California. Honey bee (Apis mellifera L.) and wild bee visitation to wildflower plots were at least an order of magnitude higher than to control plots, but increased honey bee visitation to wildflower plots did not lead to any detectable shifts in honey bee visitation to almond flowers in the neighboring orchard. Wild bees were rarely observed visiting almond flowers irrespective of border treatment, indicating a limited short-term potential for augmenting crop pollination using wild bees in highly simplified agricultural landscapes. Although further studies are warranted on bee visitation and crop yield from spatially independent orchards, this study indicates that growers can support bees with alternative forage in almond orchards without risking competition between the wildflower plantings and the crop. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Immunological characterization of plant ornithine transcarbamylases

    Science.gov (United States)

    Slocum, R. D.; Williamson, C. L.; Poggenburg, C. A.; Lynes, M. A.

    1990-01-01

    Pea (Pisum sativum L.) ornithine transcarbamylase (OTC) antisera were used to investigate the immunological relatedness of several plant and animal OTC enzymes. The antisera immunoprecipitated OTC activity in all monocot and dicot species tested, and sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis of immunoprecipitated protein revealed monomeric proteins ranging from 35,200 to 36,800 daltons in size. Pea OTC antisera did not recognize mammalian OTC protein. OTC activity and protein levels detected on sodium dodecyl sulfate polyacrylamide gel electrophoresis immunoblots from homogenates of green leaf, etiolated epicotyl and cotyledon, and root tissues of pea were poorly correlated. This might result from differences in amounts of enzymatically active OTC protein in the homogenates. Alternatively, the antisera may fail to recognize different isozyme forms of OTC, which have been reported for some plant species. A putative cytosolic precursor OTC (pOTC) polypeptide exhibiting and Mr = 39,500 to 40,000 daltons was immunoprecipitated from in vitro translation mixtures of total pea leaf poly(A)+ RNA. The size of the pOTC polypeptide, as compared with mature OTC monomer (36,000 daltons), suggests that a 4 kilodalton N-terminal leader sequence, like that responsible for mitochondrial targeting of the mammalian enzyme, may be involved in organellar import of the plant enzyme.

  12. Morphoagronomic Characterization of Tomato Plants and Fruit: A Multivariate Approach

    Directory of Open Access Journals (Sweden)

    Aniela Pilar Campos de Melo

    2015-01-01

    Full Text Available Consumers in the fresh fruit market choose fruits mainly following criteria related to the external appearance. However, the introduction of new material for planting depends on the productive capacity of the plant as well as on the formation of fruit that meets consumer desires. Given the above, the objective of this study was to morphoagronomically characterize tomato genotypes using multivariate statistics. The genotype seedlings (Ellus, Black Mauri, Green Zebra, Green Tomato, Pomodoro Marmande, Pomodoro Fiorentino, Pitanga, and Black Krim were transplanted 30 days after sowing. The morphoagronomic characterization of the genotypes was carried out by evaluating plants and fruits. The data were analyzed using descriptive analysis, namely, position and variability measurements. In addition, a multivariate cluster analysis and a principal component analysis were carried out for plant and fruit attributes. The cluster and principal component analyses were efficient in characterizing plants and/or fruits of different tomato genotypes. Such efficiency enhances result interpretation and proposed inferences, with applied relevance for the producers. The genotype Ellus has a combination of morphoagronomic plant and fruit traits superior to other genotypes. Such superior traits enable a high productivity.

  13. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along with ...

  14. Identification and primary characterization of a plant antimicrobial ...

    African Journals Online (AJOL)

    Then an agar-overlay method using fully separated proteins on sodium dodecyl sulphate-polyacryliamide gel electrophoresis (SDS-PAGE) gels was used for initial determination and primary characterization of active putative defensins in the plant seeds. Clear and remarkable zones of inhibition in a region corresponding to ...

  15. Pressurized water reactor nuclear power plant. Environmental characterization information report

    International Nuclear Information System (INIS)

    1981-01-01

    The typical plant chosen for characterization is a 10000-MWe nameplate rating with wet-natural-draft cooling towers and modern radwaste control and processing equipment. The process, plant operating parameters, resources needed, and the environmental residuals and products associated with the power plant are presented. Annual resource usage and pollutant discharges are shown in English and metric units, assuming an annual plant capacity factor of 70%. In addition to annual quantities, the summary table gives quantities in terms of 10 12 Btu (about 293 million kWh) of electrical energy produced for comparison among energy processes. Supporting information and calculation procedures for the data are given. Thirteen environmental points of interest are discussed individually. Cost information, typical radioactive releases, and use of cooling ponds as an alternative cooling method are discussed in appendixes. A glossary and list of acronyms and abbreviations are provided

  16. Characterization of ultrafine and fine particles from CHP Plants

    Energy Technology Data Exchange (ETDEWEB)

    2009-08-15

    Samples of particles collected at CHP plants in the project 'Survey of emissions from CHP Plants' have been analysed in this project to give information on the morphology and chemical composition of individual particle size classes. The objective of this project was to characterize ultrafine and fine particles emitted to the atmosphere from Danish CHP plants. Nine CHP plants were selected in the Emission Survey Project as being representative for the different types of CHP plants operating in Denmark: 1) Three Waste-to Energy (WTE) plants. 2) Three biomass fired (BM) plants (two straw fired, one wood/saw dust fired). 3) Two gas fired (GF) plants (one natural gas, one landfill gas fired). 4) One gasoil (GO) fired plant. At the WTE and BM plants, various types of emission control systems implemented. The results from these plants represent the composition and size distribution of combustion particles that are emitted from the plants emission control systems. The measured emissions of particles from the waste-to-energy plants WTE1-3 are generally very low. The number and mass concentrations of ultrafine particles (PM{sub 0.1}) were particularly low in the flue gas from WTE2 and WTE3, where bag filters are used for the reduction of particle emissions. The EDX analysis of particles from the WTE plants indicates that the PM{sub 0.1} that penetrates the ECS at WTE can contain high fractions of metals such as Fe, Mn and Cu. The SEM analysis of particles from WTE1-3 showed that the particles were generally porous and irregular in shape. The concentrations of particles in the flue gas from the biomass plants were generally higher than found for the WTE plants. The time series results showed that periodical, high concentration peaks of PM emissions occur from BM1 and BM2. The chemical composition of the particles emitted from the three biomass plants is generally dominated by C, O and S, and to some extend also Fe and Si. A high amount of Cu was found in selected

  17. Chemical Characterization of Cotton Plant Parts for Multiple Uses

    Directory of Open Access Journals (Sweden)

    Zhongqi He

    2017-01-01

    Full Text Available Cotton ( L. is an important crop in the southern and southeastern parts of the United States, but cotton plant biomass residues are underutilized because the high-value lint receives the most attention. In this study, whole cotton plants were collected at midseason and just before harvest and were chemically characterized to explore multiple uses. The plant samples were separated into six (midseason or eight (pre-defoliation for harvest biomass fractions. We determined the macro- and trace elements, protein, fiber, and lignin contents in the biomass materials. Growth stages affected the relative contents of some, but not all, of the measured parameters. Correlation coefficient analysis of the measured data revealed that some of the parameters were well related to each other, whereas some were quite independent. The information reported in this work will be helpful in exploring and optimizing management practices and processing strategies for best utilization of these types of cotton crop biomass materials as renewable natural resources.

  18. Effects of a Research-Infused Botanical Curriculum on Undergraduates’ Content Knowledge, STEM Competencies, and Attitudes toward Plant Sciences

    Science.gov (United States)

    Clarke, H. David; Horton, Jonathan L.

    2014-01-01

    In response to the American Association for the Advancement of Science's Vision and Change in Undergraduate Biology Education initiative, we infused authentic, plant-based research into majors’ courses at a public liberal arts university. Faculty members designed a financially sustainable pedagogical approach, utilizing vertically integrated curricular modules based on undergraduate researchers’ field and laboratory projects. Our goals were to 1) teach botanical concepts, from cells to ecosystems; 2) strengthen competencies in statistical analysis and scientific writing; 3) pique plant science interest; and 4) allow all undergraduates to contribute to genuine research. Our series of inquiry-centered exercises mitigated potential faculty barriers to adopting research-rich curricula, facilitating teaching/research balance by gathering publishable scholarly data during laboratory class periods. Student competencies were assessed with pre- and postcourse quizzes and rubric-graded papers, and attitudes were evaluated with pre- and postcourse surveys. Our revised curriculum increased students’ knowledge and awareness of plant science topics, improved scientific writing, enhanced statistical knowledge, and boosted interest in conducting research. More than 300 classroom students have participated in our program, and data generated from these modules’ assessment allowed faculty and students to present 28 contributed talks or posters and publish three papers in 4 yr. Future steps include analyzing the effects of repeated module exposure on student learning and creating a regional consortium to increase our project's pedagogical impact. PMID:25185223

  19. Effect of controlling herbaceous and woody competing vegetation on wood quality of planted loblolly pine

    Science.gov (United States)

    Alexander Clark; Richard F. Daniels; James H. Miller

    2006-01-01

    Southern pine plantations are increasingly established using herbicides to control herbaceous and/or woody competing vegetation to enhance growth, but little is known about the effect on wood quality. A study was established at 13 southern locations in 1984 to examine the effects of complete control of woody, herbaceous, and woody plus herbaceous competition for the...

  20. Model parameterization to simulate and compare the PAR absorption potential of two competing plant species.

    Science.gov (United States)

    Bendix, Jörg; Silva, Brenner; Roos, Kristin; Göttlicher, Dietrich Otto; Rollenbeck, Rütger; Nauss, Thomas; Beck, Erwin

    2010-05-01

    Mountain pastures dominated by the pasture grass Setaria sphacelata in the Andes of southern Ecuador are heavily infested by southern bracken (Pteridium arachnoideum), a major problem for pasture management. Field observations suggest that bracken might outcompete the grass due to its competitive strength with regard to the absorption of photosynthetically active radiation (PAR). To understand the PAR absorption potential of both species, the aims of the current paper are to (1) parameterize a radiation scheme of a two-big-leaf model by deriving structural (LAI, leaf angle parameter) and optical (leaf albedo, transmittance) plant traits for average individuals from field surveys, (2) to initialize the properly parameterized radiation scheme with realistic global irradiation conditions of the Rio San Francisco Valley in the Andes of southern Ecuador, and (3) to compare the PAR absorption capabilities of both species under typical local weather conditions. Field data show that bracken reveals a slightly higher average leaf area index (LAI) and more horizontally oriented leaves in comparison to Setaria. Spectrometer measurements reveal that bracken and Setaria are characterized by a similar average leaf absorptance. Simulations with the average diurnal course of incoming solar radiation (1998-2005) and the mean leaf-sun geometry reveal that PAR absorption is fairly equal for both species. However, the comparison of typical clear and overcast days show that two parameters, (1) the relation of incoming diffuse and direct irradiance, and (2) the leaf-sun geometry play a major role for PAR absorption in the two-big-leaf approach: Under cloudy sky conditions (mainly diffuse irradiance), PAR absorption is slightly higher for Setaria while under clear sky conditions (mainly direct irradiance), the average bracken individual is characterized by a higher PAR absorption potential. (approximately 74 MJ m(-2) year(-1)). The latter situation which occurs if the maximum daily

  1. Modified AFLP technique for rapid genetic characterization in plants.

    Science.gov (United States)

    Ranamukhaarachchi, D G; Kane, M E; Guy, C L; Li, Q B

    2000-10-01

    The standard amplified fragment-length polymorphism (AFLP) technique was modified to develop a convenient and reliable technique for rapid genetic characterization of plants. Modifications included (i) using one restriction enzyme, one adapter molecule and primer, (ii) incorporating formamide to generate more intense and uniform bands and (iii) using agarose gel electrophoresis. Sea oats (Uniola paniculata L.), pickerel-weed (Pontederia cordata L.), Bermudagrass (Cynodon dactylon L.) and Penstemon heterophyllus Lindl. were used to determine the ability to generate adequate resolution power with both self- and cross-pollinated plant species including cultivars, ecotypes and individuals within populations. Reproducibility of bands was higher in all the AFLP experiments compared to random amplified polymorphic DNA (RAPD). Formamide with or without bovine serum albumin improved band intensities compared to dimethyl sulfoxide and the standard reaction mixture with no organic solvents. Comparison between RAPD and modified AFLP using sea-oats population samples proved that modified AFLP exhibits (i) a low number of faint bands with increased specificity of amplified bands, (ii) a significantly higher number of polymorphic loci per primer, (iii) less primer screening time, (iv) easy scoring associated with fewer faint bands and (v) greatly enhanced reproducibility. The technique described here can be applied with a high degree of accuracy for plant genetic characterization.

  2. Characterizing radionuclides in the B Plant HEPA filters

    International Nuclear Information System (INIS)

    Roege, P.E.

    1998-01-01

    B Plant was built during World War II to separate plutonium for nuclear weapons from reactor fuel. Later, the plant was re-equipped and used to separate radioactive fission products from the Hanford Site's nuclear processing waste tanks. The facility is now being deactivated: eliminating, stabilizing, and documenting existing hazards to allow safe surveillance and maintenance pending a final disposition which is yet to be determined. The processing areas of the plant, including process cells and exhaust air system, are heavily contaminated with radioactive cesium and strontium from the tank waste separation process. However, detailed characterization is difficult because many of these areas are inaccessible because of physical barriers and high radiological dose rates. The five existing canyon high efficiency particulate air (HEPA) filters were thought to contain a significant fraction of the inventory, but estimates were highly uncertain. This paper describes the process used to inspect and characterize the radionuclide content in one of these filters. The investigation required a collaborative effort among field and technical personnel. Sophisticated computer modeling and detector technologies were employed in conjunction with sound radiological control and field work practices. The outcome of the effort was a considerable reduction in the filter inventory estimate, accompanied by a greatly improved level of confidence in the data. The information derived from this project will provide a sound basis for future decisions regarding filter disposition

  3. Characterization of some plant extracts by GC-MS

    International Nuclear Information System (INIS)

    Iordache, A.; Culea, M.; Gherman, C.; Cozar, O.

    2009-01-01

    Different types of herbs often used in pharmaceutical, cosmetic and food industry were extracted and then analyzed by gas chromatography and gas chromatography-mass spectrometry. The method validation parameters showed good linearity, precision and recovery for a standard mixture. Herbs from different zones of Romania were studied: melissa (Melissa officinalis), nettle (Urtica dioica, Lamium album), camomile (Matricaria chamomilla). The study was applied for fingerprint chromatograms to characterize the flavors extracted from herb plants of different sources. The identity and quantity of the measured active compounds was correlated with the expected therapeutic effects. The active principles content was determined for the same herb, and different amounts of the active principles were determined for plants of different origin.

  4. Characterization of some plant extracts by GC-MS

    Energy Technology Data Exchange (ETDEWEB)

    Iordache, A. [' Babes-Bolyai' University, Str. M. Kogalniceanu, Nr. 1, Cluj-Napoca 400084 (Romania)], E-mail: andres_iro2002@yahoo.com; Culea, M.; Gherman, C.; Cozar, O. [' Babes-Bolyai' University, Str. M. Kogalniceanu, Nr. 1, Cluj-Napoca 400084 (Romania)

    2009-01-15

    Different types of herbs often used in pharmaceutical, cosmetic and food industry were extracted and then analyzed by gas chromatography and gas chromatography-mass spectrometry. The method validation parameters showed good linearity, precision and recovery for a standard mixture. Herbs from different zones of Romania were studied: melissa (Melissa officinalis), nettle (Urtica dioica, Lamium album), camomile (Matricaria chamomilla). The study was applied for fingerprint chromatograms to characterize the flavors extracted from herb plants of different sources. The identity and quantity of the measured active compounds was correlated with the expected therapeutic effects. The active principles content was determined for the same herb, and different amounts of the active principles were determined for plants of different origin.

  5. Tree root systems competing for soil moisture in a 3D soil–plant model

    Science.gov (United States)

    Gabriele Manoli; Sara Bonetti; Jean-Christophe Domec; Mario Putti; Gabriel Katul; Marco Marani

    2014-01-01

    Competition for water among multiple tree rooting systems is investigated using a soil–plant model that accounts for soil moisture dynamics and root water uptake (RWU), whole plant transpiration, and leaflevel photosynthesis. The model is based on a numerical solution to the 3D Richards equation modified to account for a 3D RWU, trunk xylem, and stomatal conductances....

  6. Functional characterization of the competence protein DprA/Smf in Escherichia coli

    NARCIS (Netherlands)

    Smeets, Leonard C.; Becker, Stephen C.; Barcak, Gerard J.; Vandenbroucke-Grauls, Christina M. J. E.; Bitter, Wilbert; Goosen, Nora

    2006-01-01

    In several bacterial species that show natural transformation, dprA has been described as a competence gene. The DprA protein has been suggested to be involved in the protection of incoming DNA. However, members of the dprA gene family (also called smf) can be detected in virtually all bacterial

  7. Phytochemical evaluation and molecular characterization of some important medicinal plants

    Directory of Open Access Journals (Sweden)

    Varahalarao Vadlapudi

    2012-05-01

    Full Text Available Objective: Phytochemical evaluation and molecular characterization of plants is an important task in medicinal botany and drug discovery. In the current study, Ocimum species, Pimenta officinalis and Piper betel were considered as medicinal plants by evaluation of phytochemical composition like phenol content, Flavonoid content, antioxidant content and other activities like antibacterial, antifungal, lethal dosage (LD 50 of the plant extracts. Among the selected plants P. officinalis shown higher medicinal properties and is selected for molecular characterization. Methods: Antimicrobial activity by agar well diffusion method and also estimated Total phenols, flavonoids content, Total Antioxidants, Cytotoxic assay on Artemia salina for determining lethal dosage (LD50, matK gene was sequenced by using ABI Prism 3700. Leaf extract of P. officinalis plant is further selected for GC-chromatographic analysis to know its chemical composition. DNA was isolated by different protocols, optimized, and is used for the PCR amplification of trnL-gene which is a universal marker among plants in molecular taxonomy. The trnL-gene is amplified by using PCR. The product obtained from PCR is purified and the sample is used for sequencing so that it can be used for comparative studies. Results: P.offcinalis has shown good antimicrobial activity against all organisms . A. flavus is resistant against O. sanctum (B. Phenolic content (26.5 毺 g/g is found to be rich in P. betel where as flavonoid and Antioxidant content are significant in P. betel. The chromatogram revealed the presence of high concentration of Eugenol in the leaf sample. On submitting to BLASTN, the genetic sequence has found similarity with Pimenta dioica plastid partial matK gene and Ugni molinae trnK gene. MatK did not shown any interactions with trnK or trnL genes. MatK has shown interactions with various genes like ycf5, pclpp, psbh, atph, NDVI, rpoc1, ndha, ndhd, psai. Conclusions: we can

  8. Characterization recommendations for waste sites at the Savannah River Plant

    International Nuclear Information System (INIS)

    Carlton, W.H.; Gordon, D.E.; Johnson, W.F.; Kaback, D.S.; Looney, B.B.; Nichols, R.L.; Shedrow, C.B.

    1987-11-01

    One hundred and sixty six disposal facilities that received or may have received waste materials resulting from operations at the Savannah River Plant (SRP) have been identified. These waste range from innocuous solid and liquid materials (e.g., wood piles) to process effluents that contain hazardous and/or radioactive constituents. The waste sites have been grouped into 45 categories according the the type of waste materials they received. Waste sites are located with SRP coordinates, a local Department of Energy (DOE) grid system whose grid north is 36 degrees 22 minutes west of true north. DOE policy is to close all waste sites at SRP in a manner consistent with protecting human health and environment and complying with applicable environmental regulations (DOE 1984). A uniform, explicit characterization program for SRP waste sites will provide a sound technical basis for developing closure plans. Several elements are summarized in the following individual sections including (1) a review of the history, geohydrology, and available characterization data for each waste site and (2) recommendations for additional characterization necessary to prepare a reasonable closure plan. Many waste sites have been fully characterized, while others have not been investigated at all. The approach used in this report is to evaluate available groundwater quality and site history data. For example, groundwater data are compared to review criteria to help determine what additional information is required. The review criteria are based on regulatory and DOE guidelines for acceptable concentrations of constituents in groundwater and soil

  9. Characterization recommendations for waste sites at the Savannah River Plant

    Energy Technology Data Exchange (ETDEWEB)

    Carlton, W.H.; Gordon, D.E.; Johnson, W.F.; Kaback, D.S.; Looney, B.B.; Nichols, R.L.; Shedrow, C.B.

    1987-11-01

    One hundred and sixty six disposal facilities that received or may have received waste materials resulting from operations at the Savannah River Plant (SRP) have been identified. These waste range from innocuous solid and liquid materials (e.g., wood piles) to process effluents that contain hazardous and/or radioactive constituents. The waste sites have been grouped into 45 categories according the the type of waste materials they received. Waste sites are located with SRP coordinates, a local Department of Energy (DOE) grid system whose grid north is 36 degrees 22 minutes west of true north. DOE policy is to close all waste sites at SRP in a manner consistent with protecting human health and environment and complying with applicable environmental regulations (DOE 1984). A uniform, explicit characterization program for SRP waste sites will provide a sound technical basis for developing closure plans. Several elements are summarized in the following individual sections including (1) a review of the history, geohydrology, and available characterization data for each waste site and (2) recommendations for additional characterization necessary to prepare a reasonable closure plan. Many waste sites have been fully characterized, while others have not been investigated at all. The approach used in this report is to evaluate available groundwater quality and site history data. For example, groundwater data are compared to review criteria to help determine what additional information is required. The review criteria are based on regulatory and DOE guidelines for acceptable concentrations of constituents in groundwater and soil.

  10. Effects of a research-infused botanical curriculum on undergraduates' content knowledge, STEM competencies, and attitudes toward plant sciences.

    Science.gov (United States)

    Ward, Jennifer Rhode; Clarke, H David; Horton, Jonathan L

    2014-01-01

    In response to the American Association for the Advancement of Science's Vision and Change in Undergraduate Biology Education initiative, we infused authentic, plant-based research into majors' courses at a public liberal arts university. Faculty members designed a financially sustainable pedagogical approach, utilizing vertically integrated curricular modules based on undergraduate researchers' field and laboratory projects. Our goals were to 1) teach botanical concepts, from cells to ecosystems; 2) strengthen competencies in statistical analysis and scientific writing; 3) pique plant science interest; and 4) allow all undergraduates to contribute to genuine research. Our series of inquiry-centered exercises mitigated potential faculty barriers to adopting research-rich curricula, facilitating teaching/research balance by gathering publishable scholarly data during laboratory class periods. Student competencies were assessed with pre- and postcourse quizzes and rubric-graded papers, and attitudes were evaluated with pre- and postcourse surveys. Our revised curriculum increased students' knowledge and awareness of plant science topics, improved scientific writing, enhanced statistical knowledge, and boosted interest in conducting research. More than 300 classroom students have participated in our program, and data generated from these modules' assessment allowed faculty and students to present 28 contributed talks or posters and publish three papers in 4 yr. Future steps include analyzing the effects of repeated module exposure on student learning and creating a regional consortium to increase our project's pedagogical impact. © 2014 J. R. Ward et al. CBE—Life Sciences Education © 2014 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http

  11. Seismic site characterization for nuclear structures and power plants

    International Nuclear Information System (INIS)

    Boominathan, A.

    2004-01-01

    Seismic site characterization is carried out for the construction of nuclear structures and power plants in earthquake-prone areas to establish the occurrence of severe seismic hazards such as tectonic rupture, surface faulting, large scale liquefaction, sliding and seismic settlement which may alter the overall stability of the site. Seismic characterization is required to finalize the design earthquake parameters including choosing input seismic data. As a part of the investigation, measurements of relevant dynamic parameters both in laboratory and in situ have been made for carrying out dynamic soil structure interaction analysis, for determination of dynamic deformation, seismic settlement and dynamic response spectrum of the site, and for calculating dynamic earth pressure acting on retaining structures. We discuss here the seismic investigation components and methods, measurement of P- and S- wave velocities in the field and estimation of important dynamic parameters such as maximum shear modulus, modulus reduction curve, damping ratio, seismic site classification, predominant site period, liquefaction analysis through case studies for nuclear structures at Kalpakkam and Kudankulam and power plant structures at New Delhi and Konaseema. (author)

  12. Competence is Competence

    DEFF Research Database (Denmark)

    Bramming, Pia

    2004-01-01

    The article will address competence, its' diffusion, application, and the consequence of this application within the field of Human Resource Management (HRM). The concept competence-in-practice will be presented and in conclusion the article will consider implications and possibilities...... of competence-in-practice as an alternative approach to Competence Development within Human Resource Management....

  13. Synthesis and characterization of nanoparticles capped with medicinal plant extracts

    Science.gov (United States)

    Rekulapally, Sujith R.

    In this study, synthesis, characterization and biological application of series nanometal (silver, Ag) and nanometal oxide (titania, TiO2) were carried out. These nanomaterials were prepared using wet-chemistry method and then coated using natural plant extract. Three medicinal plants, namely Zingiber officinale (Ginger), Allium sativum (Garlic) and Capsicum annuum (Chili) were chosen as grafting agent to decrease the side-effects and increase the efficiency of NPs towards living organism. Extraction conditions were controlled under 60-100 °C for 8 hrs. Ag and TiO2 NPs were fabricated using colloidal chemistry and variables were controlled at ambient condition. The band gap of TiO2 NPs used as disinfectant was also modified through coating the medicinal plant extracts. The medicinal plant extracts and coated NPs were measured using spectroscopic methods. Ultraviolet-visible spectra indicated the Ag NPs were formed. The peak at 410 nm resulted from the electrons transferred from their ground to the excited state. The broadened full width at half maximum (FWHM) suggested the ultrafine particles were obtained. The lipid soluble compounds, phenols, tri-terpenoids, flavanoids, capsaicinoids, flavonoids, carotenoids, steroids steroidal glycosides, and vitamins were determined from the high performance liquid chromatographical analyses. X-ray powder diffraction indicated that the face-centered cubic Ag (PDF: 00-004-0783, a = 4.0862A, a = 90°) and anatase TiO2 (PDF: 01-08-1285, a = 3.7845, c = 9.5143A, a = 90°) were obtained using colloidal chemistry. Bactericidal activity indicated that these core-shelled TiO 2 were effective (MBC=0.6 ppm, within 30 mins) at inactivating Gram-positive and Gram-negative bacteria. It is proposed that the medicinal extracts enhanced the potency of NPs against bacteria. From our previous study, the Ag NPs were highly effective at inactivating both bacteria.

  14. Analytical characterization of contaminated soils from former manufactured gas plants

    International Nuclear Information System (INIS)

    Haeseler, F.; Blanchet, D.; Vandecasteele, J.P.; Druelle, V.; Werner, P.; Technische Univ., Dresden,

    1999-01-01

    Detailed analytical characterization of the organic matter (OM) of aged polluted soils from five former manufactured gas plants (MGP) and of two coal tars was completed. It was aimed at obtaining information relevant to the physicochemical state of the polycyclic aromatic hydrocarbon (PAH) pollutants and to their in-situ evolution in time. Overall characterization of total OM (essentially polluting OM) was carried out directly on soil samples with or without prior extraction with solvent. It involved a technique of pyrolysis/oxidation coupled to flame ionization/thermal conductivity detection. Extracts in solvent were fractionated by liquid chromatography into saturated hydrocarbons, PAH, and resins, the first two fractions being further characterized by gas chromatography and mass spectrometry. The compositions of OM of soils were found to be very similar. A total of 28% of organic carbon, including all PAH, was extractable by solvent. The compositions of coal tars were qualitatively similar to those of OM of MGP soils but with a higher proportion (48%) of total extractable OM and of PAH, in particular lower PAH. Contamination of MGP soils appeared essentially as coal tar having undergone natural attenuation. The constant association of PAH with heavy OM in MGP soils is important with respect to the mobility and bioaccessibility of these pollutants

  15. Socioeconomic baseline characterization for the Savannah River Plant area

    Energy Technology Data Exchange (ETDEWEB)

    1981-09-01

    This report presents the social and economic characteristics of the environs of the Savannah River Plant (SRP). The characterization is keyed to those areas of the social and economic environment that could be impacted by the construction and operation of major facilities at SRP. The data consists of past trends and existing characteristics of the area's land use; its demographic, social, and economic profile; regional government; community services; housing, transportation; and historical, scenic, and archeological resources. Published documents, reports, and brochures were the primary sources of all the data presented in this document. When current published data was unavailable, representatives of federal, state, and local agencies were contacted by telephone. Conversations were followed by letters of verification, which were reviewed and verified by the agency representative.

  16. CHARACTERIZATION OF CADMIUM UPTAKE BY ROOTS OF DURUM WHEAT PLANTS

    Directory of Open Access Journals (Sweden)

    Lyubka Koleva

    2009-03-01

    Full Text Available Root Cd uptake of durum wheat plants (cv. Beloslava was characterized in hydroponics conditions. The uptake experiments have been performed in Cd concentration range of 0 – 2 μM adjusted by both stable Cd and radiolabeled (109Cd tracer. Cd removal from the solution over duration of 1 hour reached 50%. The part of loosely adsorbed Cd ions on root surface accounted for about 20%. Over 30% of absorbed Cd at 0.5 μM Cd treatment was retained in root cell walls. The apparent root Cd accumulation showed concentration-dependant tendency with the highest accumulation value of 7.45 nmol Cd g FW-1.

  17. Identification, characterization, and palynology of high-valued medicinal plants.

    Science.gov (United States)

    Fazal, Hina; Ahmad, Nisar; Haider Abbasi, Bilal

    2013-01-01

    High-valued medicinal plants Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina, and Vetiveria zizanioides were identified with the help of taxonomical markers and investigated for characterization and palynological studies. These parameters are used to analyze their quality, safety, and standardization for their safe use. Botanical description and crude drug description is intended for their quality assurance at the time of collection, commerce stages, manufacturing, and production. For this purpose the detailed morphology was studied and compared with the Flora of Pakistan and other available literatures. Here we reported the pollen grain morphology of Origanum vulgare, Paeonia emodi, Psoralea corylifolia, and Rauwolfia serpentina for the first time. Similarly the crude drug study of Gymnema sylvestre (leaf), Origanum vulgare (aerial parts), Paeonia emodi (tubers), and Peganum harmala (seeds) was also carried out for the first time.

  18. Socioeconomic baseline characterization for the Savannah River Plant area

    International Nuclear Information System (INIS)

    1981-09-01

    This report presents the social and economic characteristics of the environs of the Savannah River Plant (SRP). The characterization is keyed to those areas of the social and economic environment that could be impacted by the construction and operation of major facilities at SRP. The data consists of past trends and existing characteristics of the area's land use; its demographic, social, and economic profile; regional government; community services; housing, transportation; and historical, scenic, and archeological resources. Published documents, reports, and brochures were the primary sources of all the data presented in this document. When current published data was unavailable, representatives of federal, state, and local agencies were contacted by telephone. Conversations were followed by letters of verification, which were reviewed and verified by the agency representative

  19. Host plant use by competing acacia-ants: mutualists monopolize while parasites share hosts.

    Science.gov (United States)

    Kautz, Stefanie; Ballhorn, Daniel J; Kroiss, Johannes; Pauls, Steffen U; Moreau, Corrie S; Eilmus, Sascha; Strohm, Erhard; Heil, Martin

    2012-01-01

    Protective ant-plant mutualisms that are exploited by non-defending parasitic ants represent prominent model systems for ecology and evolutionary biology. The mutualist Pseudomyrmex ferrugineus is an obligate plant-ant and fully depends on acacias for nesting space and food. The parasite Pseudomyrmex gracilis facultatively nests on acacias and uses host-derived food rewards but also external food sources. Integrative analyses of genetic microsatellite data, cuticular hydrocarbons and behavioral assays showed that an individual acacia might be inhabited by the workers of several P. gracilis queens, whereas one P. ferrugineus colony monopolizes one or more host trees. Despite these differences in social organization, neither of the species exhibited aggressive behavior among conspecific workers sharing a tree regardless of their relatedness. This lack of aggression corresponds to the high similarity of cuticular hydrocarbon profiles among ants living on the same tree. Host sharing by unrelated colonies, or the presence of several queens in a single colony are discussed as strategies by which parasite colonies could achieve the observed social organization. We argue that in ecological terms, the non-aggressive behavior of non-sibling P. gracilis workers--regardless of the route to achieve this social structure--enables this species to efficiently occupy and exploit a host plant. By contrast, single large and long-lived colonies of the mutualist P. ferrugineus monopolize individual host plants and defend them aggressively against invaders from other trees. Our findings highlight the necessity for using several methods in combination to fully understand how differing life history strategies affect social organization in ants.

  20. Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Lee, Mi-Kyung; Zhang, Yang; Zhang, Meiping; Goebel, Mark; Kim, Hee Jin; Triplett, Barbara A; Stelly, David M; Zhang, Hong-Bin

    2013-03-28

    Cotton, one of the world's leading crops, is important to the world's textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G

  1. Spent fuel characterization program in Jose Cabrera nuclear power plant

    International Nuclear Information System (INIS)

    Lloret, M.; Canencia, R.; Blanco, J.; POMAR, C.

    2010-01-01

    Jose Cabrera Nuclear Power Plant (NPP) is a 14x14 PWR reactor built in 1964 in Spain (160 MWe). The commercial operation started in 1969 and finished in 2006. During year 2009, 377 fuel assemblies from cycles 11 to 29 have been stored in 12 containers HI-STORM 100, and positioned in an Interim Spent Fuel Storage Installation built near the NPP. The spent fuel characterization and classification is a critical and complex activity that could impact all the storage process. As every container has a number of positions for damaged fuel, the loading plans and the quantity of containers depends on the total fuels classified as damaged. The classification of the spent fuel in Jose Cabrera has been performed on the basis of the Interim Staff Guidance ISG-1 from USNRC, 'Damaged Fuel'. As the storage system should assure thermal limitations, criticality control, retrievability, confinement and shielding for radioactive protection, the criteria analyzed for every spent fuel have been the existence/non existence of fuel leaks; damage that could affect the criticality analysis (as missing fuel pins) and any situation that could affect the future retrievability, as defects on the top nozzle. The first classification was performed based upon existing core records. If there were no indication of operating leakers during the concerned cycles and the structural integrity was adequate, the fuel was classified as intact or undamaged. When operating records indicated a fuel leaker, an additional inspection by ultrasonic testing of all the fuel in the concerned cycle was performed to determine the fuel leakers. If the examination results indicated that the fuel has cladding cracks, it was classified as damaged fuel without considering if it was a gross breach or a hairline crack. Additionally, it was confirmed that the water chemistry specifications for spent fuel pool has been fulfilled. Finally, a visual inspection before dry cask storage was performed and foreign particles were

  2. Central Heating Plant site characterization report, Marine Corps Combat Development Command, Quantico, Virginia

    Energy Technology Data Exchange (ETDEWEB)

    1990-08-01

    This report presents the methodology and results of a characterization of the operation and maintenance (O M) environment at the US Marine Corps (USMC) Quantico, Virginia, Central Heating Plant (CHP). This characterization is part of a program intended to provide the O M staff with a computerized artificial intelligence (AI) decision support system that will assist the plant staff in more efficient operation of their plant. 3 refs., 12 figs.

  3. Characterization of Foliage Mutants for Plant Variety Registration

    International Nuclear Information System (INIS)

    Affrida Abu Hassan; Shuhaimi Shamsuddin; Zaiton Ahmad

    2011-01-01

    Breeding for new plant varieties requires a substantial investment in terms of skill, labour, material resources and financing. Thus, registration of new plant variety is important to ensure return of revenue and protection of the breeder's right. Before a new variety is registered, it has to comply certain requirements under Plant Variety Protection Act. One of the most important requirements is, the new species/variety must be morphologically distinguishable from existing plant varieties. This paper discusses detailed leaf characteristics of 4 foliage mutants produced by Malaysian Nuclear Agency as part of the requirement for new variety registration. (author)

  4. Characterization of haemoglobin from Actinorhizal plants – An in ...

    Indian Academy of Sciences (India)

    2013-10-01

    Oct 1, 2013 ... Plant haemoglobins (Hbs), found in both symbiotic and non-symbiotic plants, are heme proteins and members of the globin superfamily. Hb genes of actinorhizal Fagales mostly belong to the non-symbiotic type of haemoglobin; however, along with the non-symbiotic Hb, Casuarina sp. posses a symbiotic ...

  5. Retention of phosphorous ions on natural and engineered waste pumice: Characterization, equilibrium, competing ions, regeneration, kinetic, equilibrium and thermodynamic study

    Energy Technology Data Exchange (ETDEWEB)

    Karimaian, Kamal Aldin [Department of Environmental Health Engineering, Faculty of Health, Kurdistan University of Medical Sciences, Sannandaj (Iran, Islamic Republic of); Amrane, Abdeltif [Ecole Nationale Supérieure de Chimie de Rennes, Université Rennes 1, CNRS, UMR 6226, Avenue du Général Leclerc, CS 50837, 35708 Rennes Cedex 7 (France); Kazemian, Hossein [Department of Chemical and Biochemical Engineering, Western University, London, ON, Canada N6A 5B9 (Canada); Panahi, Reza [Department of Biotechnology, Faculty of Chemical Engineering, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Zarrabi, Mansur, E-mail: mansor62@gmail.com [Department of Environmental Health Engineering, Faculty of Health, Alborz University of Medical Sciences, Karaj (Iran, Islamic Republic of)

    2013-11-01

    Natural and Mg{sup 2+} modified pumice were used for the removal of phosphorous. The adsorbents were characterized using XRF, XRD, SEM and FTIR instrumental techniques. In the optimal conditions, namely at equilibrium time (30 min), for a phosphorus concentration of 15 mg/L and pH 6, 69 and 97% phosphorus removals were achieved using 10 g/L of natural and modified pumice adsorbents, respectively. Maximum adsorption capacities were 11.88 and 17.71 mg/g by natural and modified pumice, respectively. Pseudo-second order kinetic model was the most relevant to describe the kinetic of phosphorus adsorption. External mass transfer coefficient decreased for increasing phosphorous concentration and film diffusion was found to be the rate-controlling step. Only a very low dissolution of the adsorbent was observed, leading to a low increase in conductivity and turbidity. Removal efficiency decreased for increasing ionic strength. It also decreased in the presence of competing ions; however modified pumice remained effective, since 67% of phosphorus was removed, versus only 17% for the natural pumice. The efficiency of the modified pumice was confirmed during the regeneration tests, since 96% regeneration yield was obtained after 510 min experiment, while only 22% was observed for the raw pumice.

  6. Induction and characterization of a replication competent cervid endogenous gammaretrovirus (CrERV) from mule deer cells.

    Science.gov (United States)

    Fábryová, Helena; Hron, Tomáš; Kabíčková, Hana; Poss, Mary; Elleder, Daniel

    2015-11-01

    Endogenous retroviruses (ERVs) were acquired during evolution of their host organisms after infection and mendelian inheritance in the germline by their exogenous counterparts. The ERVs can spread in the host genome and in some cases they affect the host phenotype. The cervid endogenous gammaretrovirus (CrERV) is one of only a few well-defined examples of evolutionarily recent invasion of mammalian genome by retroviruses. Thousands of insertionally polymorphic CrERV integration sites have been detected in wild ranging mule deer (Odocoileus hemionus) host populations. Here, we describe for the first time induction of replication competent CrERV by cocultivation of deer and human cells. We characterize the physical properties and tropism of the induced virus. The genomic sequence of the induced virus is phylogenetically related to the evolutionarily young endogenous CrERVs described so far. We also describe the level of replication block of CrERV on deer cells and its capacity to establish superinfection interference. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Molecular characterization and functional analysis of plant WRKY ...

    African Journals Online (AJOL)

    . Furthermore, the group-I WRKY genes may represent the ancestral form and the WRKY genes not only limited in the plant kingdom. Keywords: WRKY, structure characteristic, biotic and abiotic stress, senescence, development, evolution ...

  8. Visual Characterization of VX Droplets on Plant Foliage

    Science.gov (United States)

    2016-07-01

    protocol with intact living plants was needed to maintain plant physiological responses and obtain results applicable to CWA-contaminated battlefields...indigenous vegetation . The organophosphorus (OP) CWA, VX [O-ethyl-S-(2-diisopropylaminoethyl) methyl phosphonothioate] is, by any route of exposure to...visual signs and symptoms, fate, and persistence of VX that has been disseminated on indigenous vegetation is important for the estimation of risk to

  9. Functional, genetic and chemical characterization of biosurfactants produced by plant growth-promoting Pseudomonas putida 267

    NARCIS (Netherlands)

    Kruijt, M.; Tran, H.; Raaijmakers, J.M.

    2009-01-01

    Aims: Plant growth-promoting Pseudomonas putida strain 267, originally isolated from the rhizosphere of black pepper, produces biosurfactants that cause lysis of zoospores of the oomycete pathogen Phytophthora capsici. The biosurfactants were characterized, the biosynthesis gene(s) partially

  10. Symbiotic competence in Lotus japonicus is affected by plant nitrogen status: transcriptomic identification of genes affected by a new signalling pathway.

    Science.gov (United States)

    Omrane, Selim; Ferrarini, Alberto; D'Apuzzo, Enrica; Rogato, Alessandra; Delledonne, Massimo; Chiurazzi, Maurizio

    2009-01-01

    In leguminous plants, symbiotic nitrogen (N) fixation performances and N environmental conditions are linked because nodule initiation, development and functioning are greatly influenced by the amount of available N sources. We demonstrate here that N supply also controls, beforehand, the competence of leguminous plants to perform the nodulation program. Lotus japonicus plants preincubated for 10 d in high-N conditions, and then transferred to low N before the Mesorhizobium loti inoculation, had reduced nodulation. This phenotype was maintained for at least 6 d and a complete reacquisition of the symbiotic competence was observed only after 9 d. The time-course analysis of the change of the symbiotic phenotype was analysed by transcriptomics. The differentially expressed genes identified are mostly involved in metabolic pathways. However, the transcriptional response also includes genes belonging to other functional categories such as signalling, stress response and transcriptional regulation. Some of these genes show a molecular identity and a regulation profile, that suggest a role as possible molecular links between the N-dependent plant response and the nodule organogenesis program.

  11. Characterization of Minnesota lunar simulant for plant growth

    Science.gov (United States)

    Oglesby, James P.; Lindsay, Willard L.; Sadeh, Willy Z.

    1993-01-01

    Processing of lunar regolith into a plant growth medium is crucial in the development of a regenerative life support system for a lunar base. Plants, which are the core of such a system, produce food and oxygen for humans and, at the same time, consume carbon dioxide. Because of the scarcity of lunar regolith, simulants must be used to infer its properties and to develop procedures for weathering and chemical analyses. The Minnesota Lunar Simulant (MLS) has been identified to date as the best available simulant for lunar regolith. Results of the dissolution studies reveal that appropriately fertilized MLS can be a suitable medium for plant growth. The techniques used in conducting these studies can be extended to investigate the suitability of actual lunar regolith as a plant growth medium. Dissolution experiments were conducted using the MLS to determine its nutritional and toxicity characteristics for plant growth and to develop weathering and chemical analysis techniques. Two weathering regimes, one with water and one with dilute organic acids simulating the root rhizosphere microenvironment, were investigated. Elemental concentrations were measured using inductively-coupled-plasma (ICP) emission spectrometry and ion chromatography (IC). The geochemical speciation model, MINTEQA2, was used to determine the major solution species and the minerals controlling them. Acidification was found to be a useful method for increasing cation concentrations to meaningful levels. Initial results indicate that MLS weathers to give neutral to slightly basic solutions which contain acceptable amounts of the essential elements required for plant nutrition (i.e., potassium, calcium, magnesium, sulfur, zinc, sodium, silicon, manganese, copper, chlorine, boron, molybdenum, and cobalt). Elements that need to be supplemented include carbon, nitrogen, and perhaps phosphorus and iron. Trace metals in solution were present at nontoxic levels.

  12. Mass spectrometry for characterizing plant cell wall polysaccharides

    Directory of Open Access Journals (Sweden)

    Stefan eBauer

    2012-03-01

    Full Text Available Mass spectrometry is a selective and powerful technique to obtain identification and structural information on compounds present in complex mixtures. Since it requires only small sample amount it is an excellent tool for researchers interested in detecting changes in composition of complex carbohydrates of plants. This mini-review gives an overview of common mass spectrometry techniques applied to the analysis of plant cell wall carbohydrates. It presents examples in which mass spectrometry has been used to elucidate the structure of oligosaccharides derived from hemicelluloses and pectins and illustrates how information on sequence, linkages, branching and modifications are obtained from characteristic fragmentation patterns.

  13. Characterization of pure plant oil and biodiesel from Jatropha curcas ...

    African Journals Online (AJOL)

    The problems associated with long term availability of conventional hydrocarbon fuels for automotive engines, and the continuous emission of combustion ... study investigates the characteristics of pure plant oils (PPO) of Jatropha curcas and Thevetia nerifolia ; biodiesel produced from them at different methanol/ oil ratio.

  14. Understanding the Biological Roles of Pectins in Plants through Physiological and Functional Characterizations of Plant and Fungal Mutants

    DEFF Research Database (Denmark)

    Stranne, Maria

    polysaccharides and consist of backbones rich in galacturonic acids, which are decorated with a range of functional groups including acetyl esters and arabinan sidechains. Although much effort has been made to uncover biological functions of pectins in plants and remarkable progresses have taken place, many...... aspects remain elusive. Studies described in this thesis aimed at gaining new insights into the biological roles of pectin acetylation and arabinosylation in the model plant Arabidopsis thaliana. The thesis consists of four chapters: physiological characterization of cell wall mutants affected in cell......-degrading enzyme secreted by B. cinerea during infection of plants (Chapter 5). The results described resulted in valuable new knowledge regarding the role of pectin acetylation and arabinosylation in the model plant Arabidopsis thaliana documented in three published research papers, one manuscript and one...

  15. Characterization and developmental patterns of telomerase expression in plants

    Science.gov (United States)

    Fitzgerald, Matthew S.; McKnight, Thomas D.; Shippen, Dorothy E.

    1996-01-01

    Telomerase activity is developmentally regulated in mammals. Here we examine telomerase activity in plants, whose development differs in fundamental ways from that of animals. Using a modified version of the telomere repeat amplification protocol (TRAP) assay, we detected an activity in extracts from carrots, cauliflower, soybean, Arabidopsis, and rice with all the characteristics expected for a telomerase synthesizing the plant telomere repeat sequence TTTAGGG. The activity was dependent on RNA and protein components, required dGTP, dATP, and dTTP, but not dCTP, and generated products with a seven nucleotide periodicity. Telomerase activity was abundant in cauliflower meristematic tissue and undifferentiated cells from Arabidopsis, soybean, and carrot suspension cultures, but was low or not detectable in a sampling of differentiated tissues from mature plants. Telomerase from cauliflower meristematic tissues exhibited relaxed DNA sequence requirements, which might reflect the capacity to form telomeres on broken chromosomes in vivo. The dramatic differences in telomerase expression and their correlation with cellular proliferation capacity mirror changes in human telomerase levels during differentiation and immortalization. Hence, telomerase activation appears to be a conserved mechanism involved in conferring long-term proliferation capacity. PMID:8962067

  16. Extraction and characterization of anthocyanin colorants from plant sources

    Directory of Open Access Journals (Sweden)

    S. Dyankova

    2016-03-01

    Full Text Available Abstract. Natural pigments (and especially those of anthocyanins are a valuable source of bioactive compounds and may be used in the production of new functional food ingredients. Furthermore, their applications in the treatment and prevention of chronic disorders are becoming more and more widespread. In the last few years consumers have focused their attention on the natural biologically active compounds as functional food ingredients, and therefore, it may be assumed that natural colorants are an alternative source of synthetic additives. The aim of the study was to determine the quantitative content of monomeric anthocyanin pigments in extracts obtained from eight plants. The total content of monomeric anthocyanin pigments was measured by a pH-differential method. The TLC analysis of the pigment extracts from the different plants showed intensive rose, red and violet stripes corresponding to the anthocyanin content. The extracts from chicory and lavender petals were unstable and their color decreased in intensity in 1 month. The analysis of the experimental data shows that the yield of pigment substances depends on a few factors: the type of plant, the preliminary treatment of the plant and the solvent that is used. The largest quantity of extracted substances in the studied plants were isolated from chokeberry (2 195.9 cyd eq mg/l, followed by blackberry (1 466.2 and one variety of the grapes (1 199.3 . In the case of chokeberry, the pigment content included a large number of anthocyanins and the combination of these components was the reason for the deep red/violet color of the extract. Fresh or frozen materials are the most suitable for extraction of anthocyanin pigments. On the whole, fruit pulp yielded a larger quantity of pigments than juice. Anthocyanins are water-soluble compounds and for that reason their isolation requires water and other polar solvents. Better stabilization of color is obtained by a slight acidification of the

  17. Rhizosphere Competence and Biocontrol Effect ofPseudomonassp. RU47 Independent from Plant Species and Soil Type at the Field Scale.

    Science.gov (United States)

    Schreiter, Susanne; Babin, Doreen; Smalla, Kornelia; Grosch, Rita

    2018-01-01

    Biocontrol inoculants often show inconsistency in their efficacy at field scale and the reason for this remains often unclear. A high rhizosphere competence of inoculant strains is assumed to be a key factor for successful biocontrol effects as the biocontrol strain has to compete with the indigenous microbial community in the rhizosphere. It is known that many factors, among them plant species and soil type shape the rhizosphere microbial community composition. However, microbial community composition in the rhizosphere can also be influenced by the presence of a pathogen. We hypothesized that plant species, soil type, and a pathogen affect the rhizosphere competence of a biocontrol strain and its biocontrol effect against a soil-borne pathogen. To test the hypothesis, we used an experimental plot system with three soil types (diluvial sand, alluvial loam, loess loam) kept under similar agricultural management at the same field site for 12 years. We investigate the rhizosphere competence of Pseudomonas sp. RU47 in two plant species (potato and lettuce) and its biocontrol effect against Rhizoctonia diseases. The colonization density of a rifampicin resistant mutant of RU47 in the rhizosphere of both crops was evaluated by plate counts. Bacterial community compositions were analyzed by denaturing gradient gel electrophoresis (DGGE) of 16S rRNA gene fragments amplified from total community DNA. The inoculant RU47 was able to colonize the rhizosphere of both model crops in a sufficient density and to reduce disease severity of black scurf on potato and bottom rot on lettuce in all three soils. DGGE indicated that RU47 affected the bacterial community composition stronger in the rhizosphere of lettuce than in the potato rhizosphere. In contrast, the effect of the pathogen Rhizoctonia solani on the bacterial community was much stronger in the rhizosphere of potato than in the lettuce rhizosphere. A significant effect of RU47 on the Pseudomonas -specific gac

  18. Rhizosphere Competence and Biocontrol Effect of Pseudomonas sp. RU47 Independent from Plant Species and Soil Type at the Field Scale

    Directory of Open Access Journals (Sweden)

    Susanne Schreiter

    2018-02-01

    Full Text Available Biocontrol inoculants often show inconsistency in their efficacy at field scale and the reason for this remains often unclear. A high rhizosphere competence of inoculant strains is assumed to be a key factor for successful biocontrol effects as the biocontrol strain has to compete with the indigenous microbial community in the rhizosphere. It is known that many factors, among them plant species and soil type shape the rhizosphere microbial community composition. However, microbial community composition in the rhizosphere can also be influenced by the presence of a pathogen. We hypothesized that plant species, soil type, and a pathogen affect the rhizosphere competence of a biocontrol strain and its biocontrol effect against a soil-borne pathogen. To test the hypothesis, we used an experimental plot system with three soil types (diluvial sand, alluvial loam, loess loam kept under similar agricultural management at the same field site for 12 years. We investigate the rhizosphere competence of Pseudomonas sp. RU47 in two plant species (potato and lettuce and its biocontrol effect against Rhizoctonia diseases. The colonization density of a rifampicin resistant mutant of RU47 in the rhizosphere of both crops was evaluated by plate counts. Bacterial community compositions were analyzed by denaturing gradient gel electrophoresis (DGGE of 16S rRNA gene fragments amplified from total community DNA. The inoculant RU47 was able to colonize the rhizosphere of both model crops in a sufficient density and to reduce disease severity of black scurf on potato and bottom rot on lettuce in all three soils. DGGE indicated that RU47 affected the bacterial community composition stronger in the rhizosphere of lettuce than in the potato rhizosphere. In contrast, the effect of the pathogen Rhizoctonia solani on the bacterial community was much stronger in the rhizosphere of potato than in the lettuce rhizosphere. A significant effect of RU47 on the Pseudomonas

  19. Characterization of a Maize Wip1 Promoter in Transgenic Plants

    Directory of Open Access Journals (Sweden)

    Shengxue Zhang

    2013-12-01

    Full Text Available The Maize Wip1 gene encodes a wound-induced Bowman-Birk inhibitor (BBI protein which is a type of serine protease inhibitor, and its expression is induced by wounding or infection, conferring resistance against pathogens and pests. In this study, the maize Wip1 promoter was isolated and its function was analyzed. Different truncated Wip1 promoters were fused upstream of the GUS reporter gene and transformed into Arabidopsis, tobacco and rice plants. We found that (1 several truncated maize Wip1 promoters led to strong GUS activities in both transgenic Arabidopsis and tobacco leaves, whereas low GUS activity was detected in transgenic rice leaves; (2 the Wip1 promoter was not wound-induced in transgenic tobacco leaves, but was induced by wounding in transgenic rice leaves; (3 the truncated Wip1 promoter had different activity in different organs of transgenic tobacco plants; (4 the transgenic plant leaves containing different truncated Wip1 promoters had low GUS transcripts, even though high GUS protein level and GUS activities were observed; (5 there was one transcription start site of Wip1 gene in maize and two transcription start sites of GUS in Wip1::GUS transgenic lines; (6 the adjacent 35S promoter which is present in the transformation vectors enhanced the activity of the truncated Wip1 promoters in transgenic tobacco leaves, but did not influence the disability of truncated Wip1231 promoter to respond to wounding signals. We speculate that an ACAAAA hexamer, several CAA trimers and several elements similar to ACAATTAC octamer in the 5'-untranslated region might contribute to the strong GUS activity in Wip1231 transgenic lines, meanwhile, compared to the 5'-untranslated region from Wip1231 transgenic lines, the additional upstream open reading frames (uORFs in the 5'-untranslated region from Wip1737 transgenic lines might contribute to the lower level of GUS transcript and GUS activity.

  20. Biochemical and Physiological Characterization of Nonsymbiotic Plant Hemoglobins

    OpenAIRE

    Leiva, Nélida

    2014-01-01

    Hemoglobins (Hb) are usually associated with blood in humans. However, these proteins are widely distributed among living organisms. In plants the most known group are the leghemoglobins. Still, other Hbs that not participate in symbiosis are also found. They are known as nonsymbiotic Hbs (nsHbs). NsHbs are divided into class-1 and class-2. In this thesis three nsHbs from sugar beet (BvHb1-1, BvHb1-2, and BvHb2) and one class-1 nsHb from poplar (PttHb1) have been studied. Additionally, the po...

  1. Effects of logging debris treatments on five-year development of competing vegetation and planted Douglas-fir

    Science.gov (United States)

    Timothy B. Harrington; Stephen H. Schoenholtz

    2010-01-01

    Although considerable research has focused on the influences of logging debris treatments on soil and forest regeneration responses, few studies have identified whether debris effects are mediated by associated changes in competing vegetation abundance. At sites near Matlock, Washington, and Molalla, Oregon, studies were initiated after timber harvest to quantify the...

  2. Immunological approaches to plant cell wall and biomass characterization: Glycome Profiling.

    Science.gov (United States)

    Pattathil, Sivakumar; Avci, Utku; Miller, Jeffrey S; Hahn, Michael G

    2012-01-01

    The native complexity of plant cell walls makes research on them challenging. Hence, it is advantageous to have a diversity of tools that can be used to analyze and characterize plant cell walls. In this chapter, we describe one of two immunological approaches that can be employed for screening of plant cell wall/biomass materials from diverse plants and tissues. This approach, Glycome Profiling, lends itself well to moderate to high-throughput screening of plant cell wall/biomass samples. Glycome Profiling is being further optimized to reduce the amount of sample required for the analysis, and to improve the sensitivity and throughput of the assay. We are optimistic that Glycome Profiling will prove to be a broadly applicable experimental approach that will find increasing application to a wide variety of studies on plant cell wall/biomass samples.

  3. Characterization of Plant Growth under Single-Wavelength Laser Light Using the Model Plant Arabidopsis Thaliana

    KAUST Repository

    Ooi, Amanda

    2016-12-01

    Indoor horticulture offers a promising solution for sustainable food production and is becoming increasingly widespread. However, it incurs high energy and cost due to the use of artificial lighting such as high-pressure sodium lamps, fluorescent light or increasingly, the light-emitting diodes (LEDs). The energy efficiency and light quality of currently available lighting is suboptimal, therefore less than ideal for sustainable and cost-effective large-scale plant production. Here, we demonstrate the use of high-powered single-wavelength lasers for indoor horticulture. Lasers are highly energy-efficient and can be remotely guided to the site of plant growth, thus reducing on-site heat accumulation. Besides, laser beams can be tailored to match the absorption profiles of different plants. We have developed a prototype laser growth chamber and demonstrate that laser-grown plants can complete a full growth cycle from seed to seed with phenotypes resembling those of plants grown under LEDs. Importantly, the plants have lower expression of proteins diagnostic for light and radiation stress. The phenotypical, biochemical and proteomic data show that the singlewavelength laser light is suitable for plant growth and therefore, potentially able to unlock the advantages of this next generation lighting technology for highly energy-efficient horticulture. Furthermore, stomatal movement partly determines the plant productivity and stress management. Abscisic acid (ABA) induces stomatal closure by promoting net K+-efflux from guard cells through outwardrectifying K+ (K+ out) channels to regulate plant water homeostasis. Here, we show that the Arabidopsis thaliana guard cell outward-rectifying K+ (ATGORK) channel is a direct target for ABA in the regulation of stomatal aperture and hence gas exchange and transpiration. Addition of (±)-ABA, but not the biologically inactive (−)-isomer, increases K+ out channel activity in Vicia faba guard cell protoplast. A similar ABA

  4. Diversity and characterization of bioactive compounds of endophytic bacteria from medicinal plants

    OpenAIRE

    Akinsanya, Mushafau Adewale

    2017-01-01

    Endophytes are believed to produce a number of beneficial bioactive compounds of pharmacological importance. The aims of this study are to evaluate the diversity and characterize the bioactive compounds of bacterial endophytes from selected local medicinal plants. Eighty-seven species of endophytic bacteria were isolated from surface sterilized tissues of six local medicinal plants of which 29 were isolated from Aloe vera, 15 from Mentha spicata, eight from Ocimum basilicum, 16 from Cymbopogo...

  5. Characterization and viscosity parameters of seed oils from wild plants.

    Science.gov (United States)

    Eromosele, C O; Paschal, N H

    2003-01-01

    The physico-chemical properties of Spondias mombin seed oil and the viscosity-temperature profiles of six seed oils from other plants which grow in the wild: Balanites aegytiaca, Lophira lanceolata, Sterculia setigera, Khaya senegalensis, Ximenia americana and Sclereocarya birrea, were investigated. The oil content of S. mombin seed was significant at 31.5% (w/w). The oil appeared stable as deduced from its low peroxide and acid values of 6.0 mEq kg(-1) and 1.68 mg KOH, respectively. The X. americana oil was denser than the other ones, with a value of 0.9625 g cm(-3) at 30 degrees C. The kinematic viscosities of the oils and their temperature dependence in the range 30-70 degrees C suggested a potential industrial application of the oils as lubricating base stock. Specifically, the kinematic viscosities of the oils were in the range 59.8-938.2 cst at 30 degrees C with X. americana having the highest value. At 70 degrees C, the reduction in viscosities of the oils was marked: reduction by over 70% of their values at 30 degrees C for S. setigera, K. senegalensis, X. americana and S. birrea oils.

  6. Plant VAP27 proteins: domain characterization, intracellular localization and role in plant development.

    Science.gov (United States)

    Wang, Pengwei; Richardson, Christine; Hawkins, Timothy J; Sparkes, Imogen; Hawes, Chris; Hussey, Patrick J

    2016-06-01

    The endoplasmic reticulum (ER) is connected to the plasma membrane (PM) through the plant-specific NETWORKED protein, NET3C, and phylogenetically conserved vesicle-associated membrane protein-associated proteins (VAPs). Ten VAP homologues (VAP27-1 to 27-10) can be identified in the Arabidopsis genome and can be divided into three clades. Representative members from each clade were tagged with fluorescent protein and expressed in Nicotiana benthamiana. Proteins from clades I and III localized to the ER as well as to ER/PM contact sites (EPCSs), whereas proteins from clade II were found only at the PM. Some of the VAP27-labelled EPCSs localized to plasmodesmata, and we show that the mobility of VAP27 at EPCSs is influenced by the cell wall. EPCSs closely associate with the cytoskeleton, but their structure is unaffected when the cytoskeleton is removed. VAP27-labelled EPCSs are found in most cell types in Arabidopsis, with the exception of cells in early trichome development. Arabidopsis plants expressing VAP27-GFP fusions exhibit pleiotropic phenotypes, including defects in root hair morphogenesis. A similar effect is also observed in plants expressing VAP27 RNAi. Taken together, these data indicate that VAP27 proteins used at EPCSs are essential for normal ER-cytoskeleton interaction and for plant development. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  7. Biochemical characterization of selected plant species from Brazilian Savannas

    Directory of Open Access Journals (Sweden)

    Samantha Salomão Caramori

    2004-06-01

    Full Text Available The aim of this work was to analyze and quantify the presence of antinutritional compounds such as lectins and trypsin-like inhibitors, polyphenols and tannins, and enzymatic activity of peroxidases and proteases in the seeds of Annona crassiflora Mart. (araticum, Hymenaea courbaril L. var. courbaril (jatobá, Plathymenia reticulata Benth. (vinhático, Zanthoxylum rhoifolium Lam. (maminha de porca, Apeiba tibourbou Aubl. (pau jangada, Salacia crassiflora Mart G. Don. (bacupari, and Sclerolobium paniculatum Vog. (carvoeiro. The results suggested that these plants could be used as new source of food.O Cerrado é constituído por inúmeras espécies vegetais com potencial econômico, as quais são utilizadas para os mais variados fins, como medicinal e nutricional. O objetivo deste trabalho foi analisar e quantificar a presença de atividade enzimática de peroxidases e proteases e fatores antinutricionais, como lectinas e inibidores de proteases, além de polifenóis e taninos em algumas espécies nativas do Cerrado. O material vegetal utilizado foram sementes de Annona crassiflora Mart. (araticum, Hymenaea courbaril L. var. courbaril (jatobá, Plathymenia reticulata Benth. (vinhático, Zanthoxylum rhoifolium Lam. (maminha de porca, Apeiba tibourbou Aubl. (pau jangada, Salacia crassiflora (Mart. G. Don. (bacupari e Sclerolobium paniculatum Vog. (carvoeiro, coletadas na cidade de Goiânia e municípios de Jataí e Caldas Novas, estado de Goiás. O uso potencial destas plantas e suas enzimas na indústria de alimentos, poderia resultar em aplicações ao aparecimento de novos produtos a partir das matérias-primas tradicionais, além do uso de novas fontes de alimentos.

  8. Advances in methods for identification and characterization of plant transporter function

    DEFF Research Database (Denmark)

    Larsen, Bo; Xu, Deyang; Halkier, Barbara Ann

    2017-01-01

    Transport proteins are crucial for cellular function at all levels. Numerous importers and exporters facilitate transport of a diverse array of metabolites and ions intra- and intercellularly. Identification of transporter function is essential for understanding biological processes at both......-based approaches. In this review, we highlight examples that illustrate how new technology and tools have advanced identification and characterization of plant transporter functions....

  9. Characterization and genetics of multiple soybean aphid biotype resistance in five soybean plant introductions

    Science.gov (United States)

    Soybean aphid (Aphis glycines Matsumura) is the most important soybean [Glycine max (L.) Merr.] insect pest in the USA. The objectives of this study were to characterize the resistance expressed in the five plant introductions (PIs) to four soybean aphid biotypes, determine the mode of resistance in...

  10. Expression and characterization of plant aspartic protease nepenthesin-1 from Nepenthes gracilis

    Czech Academy of Sciences Publication Activity Database

    Kádek, Alan; Tretyachenko, V.; Mrázek, Hynek; Ivanova, Ljubina; Halada, Petr; Rey, M.; Schriemer, D. C.; Man, Petr

    2014-01-01

    Roč. 95, MAR 2014 (2014), s. 121-128 ISSN 1046-5928 R&D Projects: GA ČR GAP206/12/0503; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Plant aspartic protease * Nepenthesin * Protease characterization Subject RIV: CE - Biochemistry Impact factor: 1.695, year: 2014

  11. CHARACTERIZATION OF MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT, VOLUME II. APPENDICES F-J

    Science.gov (United States)

    The report gives results of a characterization of mercury (Hg) emissions at a chlor-alkali plant. Up to 160 short tons (146 Mg) of Hg is consumed by the chlor-alkali industry each year. Very little quantitative information is currently available however, on the actual Hg losses f...

  12. Characterization of Carambola (Averrhoa carambola L. Plant Collection of Cibinong Plant Germplasm Garden Based on Phenotypic and Genetic Characters

    Directory of Open Access Journals (Sweden)

    Dody Priadi

    2016-04-01

    Full Text Available Indonesia as a rich biodiversity country has many superior fruit plant germplasms such as sweet star fruit or carambola (Averrhoa carambola L.. Some varieties of carambola which collected at the Germplasm Garden of Research Center for Biotechnology-LIPI have been used for parent trees of fruit plant production. Therefore, they have to be characterized both phenotypically and genetically. The objective of the study was to analyze the relationship between eight varieties of carambola i.e. Malaysia, Penang, Rawasari, Bangkok, Sembiring, Dewabaru, Demak and Dewimurni at the germplasm garden based on phenotypic and genetic characters. Phenotypic characters were observed directly in the field, whereas genetic characters were observed with RAPD markers using 10 primers. Phylogenetic analysis was done using NT-SYS software showed that there were three clusters of carambola varieties. Meanwhile, Malaysia and Penang varieties have closed relationships (96% compared with the other varieties. The result of the study would be dedicated to updating and completing the existing fruit plant collection database of Plants Germplasm Garden. 

  13. Screening and partial immunochemical characterization of sulfite oxidase from plant source.

    Science.gov (United States)

    Ahmad, Ausaf; Sarfraz, Ahmad

    2010-01-01

    Sulfite oxidase [SO; EC 1.8.3.1] catalyses the physiologically vital oxidation of sulfite to sulfate, the terminal reaction in degradation of sulfur containing amino acids, cysteine and methionine. Sulfite oxidase from vertebrate sources is among the best studied molybdenum enzymes. Existence of SO in plants has been established recently by identification of a cDNA from Arabidopsis thaliana encoding a functional SO. The present study was undertaken to identify herbaceous and woody plants (viz., Azardirachta indica L., Cassia fistula L., Saraca indica L., Spinacea oleracea L., and Syzyzium cumini L.), a relatively less explored source, having significant SO activity and to characterize some of its immuno-biochemical properties. The Syzyzium cumini was chosen to characterize SO as it showed maximum enzyme activity in the crude extract as compared to other plants. Absorption spectra of SO revealed two peaks at 235 and 277 nm, but no distinct peak in the visible region could be observed. Crude extract of all the plants were taken into considerations for immuno-biochemical studies. Despite of significant protein structure-functional similarities between plant and animal SO, no cross-reactivity could be established between the two sources of SO. These data suggested that plants SO, however, differed with regards to their immunobiochemical properties.

  14. Mathematical Competences

    DEFF Research Database (Denmark)

    Westphael, Henning; Mogensen, Arne

    2013-01-01

    In this article we present the notion of Mathematical competences as a tool to describe the mathematically gifted students.......In this article we present the notion of Mathematical competences as a tool to describe the mathematically gifted students....

  15. Teacher competencies

    OpenAIRE

    Svatošová, Kateřina

    2012-01-01

    This diploma thesis deals with adult teacher competencies. It describes current situation in adult education and it focuses on measuring quality level of teacher competencies. There is given the main overview of adult education specifics. These are the prerequisites for defining adult teacher competencies. There is given specific adult teacher competencies and related roles which are generally based on teacher's activities during educational courses. Next part describes present conception of ...

  16. AAOHN Competencies.

    Science.gov (United States)

    2015-11-01

    The AAOHN Competency document is one of the core documents that define occupational health nursing practice. This article provides a description of the process used to update the competencies, as well as a description of the new competencies. © 2015 The Author(s).

  17. ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES

    Directory of Open Access Journals (Sweden)

    Dominika Ďurechová

    2013-02-01

    Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.

  18. Linking the response of bacterial populations to plant development through analysis of rhizosphere-competence traits of soil bacteria

    Science.gov (United States)

    Cho, H. J.; Karaoz, U.; Zhalnina, K.; Firestone, M. K.; Brodie, E.

    2016-12-01

    A growing plant root exudes changing combinations of compounds including root litter and other detritus throughout its developmental stages, providing a major source of organic C for rhizosphere bacteria. Clear patterns of microbial succession have been observed in the rhizosphere of a number of plants. These patterns of microbial succession are likely key to the processing of soil organic carbon and nutrient recycling. What is less well understood are the microbial traits, or combinations of traits, selected for during plant development. Are these traits or trait-combinations conserved, and is phylogeny a useful integrator of traits? Understanding the mechanisms underlying ecological succession would enable improved prediction of future rhizosphere states and consequences for C and nutrient cycles. In this study, we resolve the responses of rhizosphere bacteria at strain-level during plant (Avena fatua) developmental stages using both isolation and metagenomic approaches. Metagenome reads from bulk and rhizosphere soils were mapped to the genomes of thirty nine bacterial isolates numerically abundant ( 0.5% in relative abundance) and phylogenetically representative of these soils, and also to ninety six metagenome-derived genome bins. Analysis of temporal coverage patterns demonstrate that bacteria can be classified as positive and negative rhizosphere responders, with traits associated with root exudate utilization being important. Significant strain level diversity was observed and variance in the temporal coverage patterns further distinguished closely related strains of the same genera. For example, while a number of strains from the Bradyrhizobia, Mesorhizobia and Mycobacteria all increased in coverage with root growth, suggesting that recently acquired traits are selected for. Candidate traits distinguishing closely related strains included those related to xylose and other plant cell-wall derived sugar utilization, motility and aromatic organic acid

  19. Application of RAPD for molecular characterization of plant species of medicinal value from an arid environment.

    Science.gov (United States)

    Arif, I A; Bakir, M A; Khan, H A; Al Farhan, A H; Al Homaidan, A A; Bahkali, A H; Al Sadoon, M; Shobrak, M

    2010-11-09

    The use of highly discriminatory methods for the identification and characterization of genotypes is essential for plant protection and appropriate use. We utilized the RAPD method for the genetic fingerprinting of 11 plant species of desert origin (seven with known medicinal value). Andrachne telephioides, Zilla spinosa, Caylusea hexagyna, Achillea fragrantissima, Lycium shawii, Moricandia sinaica, Rumex vesicarius, Bassia eriophora, Zygophyllum propinquum subsp migahidii, Withania somnifera, and Sonchus oleraceus were collected from various areas of Saudi Arabia. The five primers used were able to amplify the DNA from all the plant species. The amplified products of the RAPD profiles ranged from 307 to 1772 bp. A total of 164 bands were observed for 11 plant species, using five primers. The number of well-defined and major bands for a single plant species for a single primer ranged from 1 to 10. The highest pair-wise similarities (0.32) were observed between A. fragrantissima and L. shawii, when five primers were combined. The lowest similarities (0) were observed between A. telephioides and Z. spinosa; Z. spinosa and B. eriophora; B. eriophora and Z. propinquum. In conclusion, the RAPD method successfully discriminates among all the plant species, therefore providing an easy and rapid tool for identification, conservation and sustainable use of these plants.

  20. Distribution and Molecular Characterization of Campylobacter Species at Different Processing Stages in Two Poultry Processing Plants.

    Science.gov (United States)

    Lee, Soo-Kyoung; Park, Hyun-Jung; Lee, Jin-Hee; Lim, Jong-Soo; Seo, Kun-Ho; Heo, Eun-Jeong; Kim, Young-Jo; Wee, Sung-Hwan; Moon, Jin-San

    2017-03-01

    The present study analyzed the prevalence and molecular characterization of Campylobacter at different processing steps in poultry slaughterhouses to determine where contamination mainly occurs. A total of 1,040 samples were collected at four different stages (preprocessing cloacal swabs, postevisceration, postwashing, and postchilling) in two processing plants. Campylobacter was detected in 5.8% (15 of 260) of the cloacal swabs and in 13.3% (104 of 780) of the processing samples. In both plants, the sampling points with the greatest contamination rates were after evisceration (20.5% and 15.4% for plants A and B, respectively) and significantly decreased after chilling (p Campylobacter contamination was achieved through the sequential processing procedures in both plants. Campylobacter loads (>10 3 colony-forming units [CFUs]/mL) also decreased from 41.7% at evisceration to 20.0% in final carcasses. The genetic relationships of isolates were analyzed by the automated repetitive sequence-based polymerase chain reaction (rep-PCR) system, and the rep-PCR banding pattern was found to be unrelated to the processing plants, species, sampling point, or sampling day. As the gap in the intervention efficacy remains between plant A and B despite several consistencies, a national program for monitoring critical processing stages in poultry processing plants is recommended for the successful exportation of Korean-processed white mini broiler meat.

  1. Nutritional compound analysis and morphological characterization of spider plant (Cleome gynandra) - an African indigenous leafy vegetable.

    Science.gov (United States)

    Omondi, Emmanuel O; Engels, Christof; Nambafu, Godfrey; Schreiner, Monika; Neugart, Susanne; Abukutsa-Onyango, Mary; Winkelmann, Traud

    2017-10-01

    Spider plant is among the important indigenous African leafy vegetables having the potential to contribute to food and nutritional security in sub-Saharan Africa. The main objective of this study was to quantify the mineral concentration, to identify and quantify glucosinolates and flavonoids in spider plant and further to characterize spider plant entries using important morphological traits. Thirty spider plant entries from different African countries, comprising of farmers' cultivars, gene bank accessions and advanced lines were grown in a field experiment and harvested for leaves, stems, flowers and siliques at different developmental stages. Five plant types based on the stem and petiole colorations were identified. Significant genotypic differences were shown for all the morphological traits except for 100 seed weight and silique weight. High mineral concentrations in the leaf tissue were observed especially for potassium, calcium, magnesium, phosphorus, iron, manganese and zinc. The aliphatic 3-hydroxypropyl glucosinolate was the main glucosinolate detected in all tissues with the highest concentrations in the reproductive organs. Glycosides of quercetin, kaempferol and isorhamnetin were the main flavonoids. Isorhamnetin glycosides were detected in trace amounts in both, leaves and inflorescences, while quercetin and kaempferol glycosides were the dominant flavonoids in the leaves and inflorescences, respectively. This knowledge of beneficial nutrient contents is an incentive for promoting spider plant consumption for improved human health while the morphological diversity analysis will be important for the further development of the spider plant germplasm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Effects of a Research-Infused Botanical Curriculum on Undergraduates' Content Knowledge, STEM Competencies, and Attitudes toward Plant Sciences

    Science.gov (United States)

    Ward, Jennifer Rhode; Clarke, H. David; Horton, Jonathan L.

    2014-01-01

    In response to the American Association for the Advancement of Science's Vision and Change in Undergraduate Biology Education initiative, we infused authentic, plant-based research into majors' courses at a public liberal arts university. Faculty members designed a financially sustainable pedagogical approach, utilizing vertically integrated…

  3. Introducing close-range photogrammetry for characterizing forest understory plant diversity and surface fuel structure at fine scales

    Science.gov (United States)

    Benjamin C. Bright; E. Louise Loudermilk; Scott M. Pokswinski; Andrew T. Hudak; Joseph J. O' Brien

    2016-01-01

    Methods characterizing fine-scale fuels and plant diversity can advance understanding of plant-fire interactions across scales and help in efforts to monitor important ecosystems such as longleaf pine (Pinus palustris Mill.) forests of the southeastern United States. Here, we evaluate the utility of close-range photogrammetry for measuring fuels and plant...

  4. Anthocyanin Characterization of Pilot Plant Water Extracts of Delonix regia Flowers

    Directory of Open Access Journals (Sweden)

    Emile M. Gaydou

    2008-06-01

    Full Text Available Following the development of new applications of pilot plant scale extraction and formulation processes for natural active bioproducts obtained from various underutilized tropical plants and herbs, we have manufactured water-extracts from Delonix regia flowers, grown in Ivory Coast. These extracts, which contain polyphenols, are traditionally home made and used as healthy bioproducts. They are reddish-coloured due to the presence of anthocyanins. The three major anthocyanins in these extracts have been characterized. The molecular structures were confirmed by LC-SM analysis. Amongst them, two are described for the first time in Delonix regia.

  5. Waste Isolation Pilot Plant transuranic wastes experimental characterization program: executive summary

    International Nuclear Information System (INIS)

    Molecke, M.A.

    1978-11-01

    A general overview of the Waste Isolation Pilot Plant transuranic wastes experimental characterization program is presented. Objectives and outstanding concerns of this program are discussed. Characteristics of transuranic wastes are also described. Concerns for the terminal isolation of such wastes in a deep bedded salt facility are divided into two phases, those during the short-term operational phase of the facility, and those potentially occurring in the long-term, after decommissioning of the repository. An inclusive summary covering individual studies, their importance to the Waste Isolation Pilot Plant, investigators, general milestones, and comments are presented

  6. Guidebook on training to establish and maintain the qualification and competence of nuclear power plant operations personnel

    International Nuclear Information System (INIS)

    1994-03-01

    Since the IAEA published its Guidebook on the Qualification of Nuclear Power Plant Operations Personnel in 1984 (Technical Reports Series 242) there have been important developments in the approach to training adopted by many operating organizations in different countries. It is now accepted that developing training programmes based solely on experience is inappropriate for the nuclear power industry, and that a systematic approach to training is necessary. It has been recognized that inadequate knowledge and skills may lead to human errors, and it is therefore necessary to review and improve the development and implementation of initial and continuing training programmes. The present Guidebook proposes an approach which is comprehensive and systematic in its methodology and also cost effective in its implementation. This Guidebook is mainly intended for management and training staff of nuclear power plant operating organizations. Relevant examples of current training practices are presented in the Appendices, which constitute an integral part of the Guidebook. Ref, figs and tabs

  7. Guidebook on training to establish and maintain the qualification and competence of nuclear power plant operations personnel

    International Nuclear Information System (INIS)

    1989-11-01

    Since the IAEA published its Guidebook on the Qualification of Nuclear Power Plant Operations Personnel in 1984 (Technical Reports Series 242) there have been important developments in the approach to training adopted by many operating organizations in different countries. It is now accepted that developing training programmes based solely on experience is inappropriate for the nuclear power industry, and that a systematic approach to training is necessary. It has been recognized that inadequate knowledge and skills may lead to human errors, and it is therefore necessary to review and improve the development and implementation of initial and continuing training programmes. The present Guidebook proposes an approach which is comprehensive and systematic in its methodology and also cost effective in its implementation. This Guidebook is mainly intended for management and training staff of nuclear power plant operating organizations. Relevant examples of current training practices are presented in the Appendices, which constitute an integral part of the Guidebook. Refs, figs and tabs

  8. A strategy for characterization of persistent heteroduplex DNA in higher plants.

    Science.gov (United States)

    Dong, Chun-Bo; Mao, Jian-Feng; Suo, Yu-Jing; Shi, Le; Wang, Jun; Zhang, Ping-Dong; Kang, Xiang-Yang

    2014-10-01

    Heteroduplex DNA (hDNA) generated during homologous recombination (HR) is an important component that shapes genetic diversity in sexually reproducing organisms. However, studies of this process in higher plants are limited. This is because hDNAs are difficult to capture in higher plants as their reproductive developmental model only produces normal gametes and does not preserve the mitotic products of the post-meiotic segregation (PMS) process which is crucial for studying hDNAs. In this study, using the model system for tree and woody perennial plant biology (Populus), we propose a strategy for characterizing hDNAs in higher plants. We captured hDNAs by constructing triploid hybrids originating from a cross between unreduced 2n eggs (containing hDNA information as a result of inhibition chromosome segregation at the PMS stage) with normal male gametes. These triploid hybrids allowed us to detect the frequency and location of persistent hDNAs resulting from HR at the molecular level. We found that the frequency of persistent hDNAs, which ranged from 5.3 to 76.6%, was related to locations of the simple sequence repeat markers at the chromosomes, such as the locus-centromere distance, the surrounding DNA sequence and epigenetic information, and the richness of protein-coding transcripts at these loci. In summary, this study provides a method for characterizing persistent hDNAs in higher plants. When high-throughput sequencing techniques can be incorporated, genome-wide persistent hDNA assays for higher plants can be easily carried out using the strategy presented in this study. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  9. On the phase characterization of the residues of the plant Comandante Pedro Soto Alba

    International Nuclear Information System (INIS)

    Diaz Ruano, A.; Fernandez Miranda, J.

    1980-04-01

    It has been studied of the phases present in the solid industrial residues of the plant Comandante Pedro Soto Alba (Moas's tails). It is done a preliminary qualitative characterization by X ray diffraction. It is done a characterization by differential and gravimetric thermal analysis and a quantitative valuation of SO 3 and H 2 O present in the samples. A complex of S and Al is detected. The results of SO 3 are compared with those obtained by the gravimetric method to verify those of Al, an elemental analysis by neutron activation was solicitated. A formula for the complex of S and Al is proposed. (author)

  10. Isolation and characterization of soil Streptomyces species as potential biological control agents against fungal plant pathogens.

    Science.gov (United States)

    Evangelista-Martínez, Zahaed

    2014-05-01

    The use of antagonist microorganisms against fungal plant pathogens is an attractive and ecologically alternative to the use of chemical pesticides. Streptomyces are beneficial soil bacteria and potential candidates for biocontrol agents. This study reports the isolation, characterization and antagonist activity of soil streptomycetes from the Los Petenes Biosphere Reserve, a Natural protected area in Campeche, Mexico. The results showed morphological, physiological and biochemical characterization of six actinomycetes and their inhibitory activity against Curvularia sp., Aspergillus niger, Helminthosporium sp. and Fusarium sp. One isolate, identified as Streptomyces sp. CACIS-1.16CA showed the potential to inhibit additional pathogens as Alternaria sp., Phytophthora capsici, Colletotrichum sp. and Rhizoctonia sp. with percentages ranging from 47 to 90 %. This study identified a streptomycete strain with a broad antagonist activity that could be used for biocontrol of plant pathogenic fungi.

  11. Characterization of an antennal carboxylesterase from the pest moth Spodoptera littoralis degrading a host plant odorant.

    Directory of Open Access Journals (Sweden)

    Nicolas Durand

    2010-11-01

    Full Text Available Carboxyl/cholinesterases (CCEs are highly diversified in insects. These enzymes have a broad range of proposed functions, in neuro/developmental processes, dietary detoxification, insecticide resistance or hormone/pheromone degradation. As few functional data are available on purified or recombinant CCEs, the physiological role of most of these enzymes is unknown. Concerning their role in olfaction, only two CCEs able to metabolize sex pheromones have been functionally characterized in insects. These enzymes are only expressed in the male antennae, and secreted into the lumen of the pheromone-sensitive sensilla. CCEs able to hydrolyze other odorants than sex pheromones, such as plant volatiles, have not been identified.In Spodoptera littoralis, a major crop pest, a diversity of antennal CCEs has been previously identified. We have employed here a combination of molecular biology, biochemistry and electrophysiology approaches to functionally characterize an intracellular CCE, SlCXE10, whose predominant expression in the olfactory sensilla suggested a role in olfaction. A recombinant protein was produced using the baculovirus system and we tested its catabolic properties towards a plant volatile and the sex pheromone components.We showed that SlCXE10 could efficiently hydrolyze a green leaf volatile and to a lesser extent the sex pheromone components. The transcript level in male antennae was also strongly induced by exposure to this plant odorant. In antennae, SlCXE10 expression was associated with sensilla responding to the sex pheromones and to plant odours. These results suggest that a CCE-based intracellular metabolism of odorants could occur in insect antennae, in addition to the extracellular metabolism occurring within the sensillar lumen. This is the first functional characterization of an Odorant-Degrading Enzyme active towards a host plant volatile.

  12. Competence articulation:

    DEFF Research Database (Denmark)

    Larsen, Simon Bo; Bardram, Jakob

    2008-01-01

    Many studies and concepts within CSCW deal with the temporal, spatial, social, and computational aspects of supporting collaborative work. In this paper we want to pay attention to another central aspect to the achievement of collaborative work, namely the competence of the people involved....... In particular, we want to look at the dynamic quality of competences, and investigate how competence is mutually developed in coordinated work. We have termed this process competence articulation, a concept which tries to emphasize competence as well as social development of competence as part of cooperation....... The concept has emerged out of a longitudinal participatory design process investigating telemedical treatment of diabetic foot ulcers using video phones. We analyze the transitions occurring with the introduction of synchronous telemedical consultations and detail how the online video facilitates...

  13. Characterization of Bottom Ash from Czech Waste-to-Energy Plants.

    OpenAIRE

    Krausová, Aneta

    2016-01-01

    Our study summarizes the composition of bottom ash from two WtE plants in the Czech Republic. Bottom ash with particle size over 2 mm was characterized by combination of manual and mechanical analyses (e.g. magnetic separation, sieving, grinding, etc.). Bottom ash with particle size under 2 mm was analysed using scanning electron microscopy, to find its composition and to determine the form of comprised metals.

  14. Characterization of past and present solid waste streams from the plutonium finishing plant

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, D.R.; Mayancsik, B.A. [Westinghouse Hanford Co., Richland, WA (United States); Pottmeyer, J.A.; Vejvoda, E.J.; Reddick, J.A.; Sheldon, K.M.; Weyns, M.I. [Los Alamos Technical Associates, Kennewick, WA (United States)

    1993-02-01

    During the next two decades the transuranic (TRU) wastes now stored in the burial trenches and storage facilities at the Hanford Site are to be retrieved, processed at the Waste Receiving and Processing (WRAP) Facility, and shipped to the Waste Isolation Pilot Plant (WIPP) near Carlsbad, New Mexico for final disposal. Over 50% of the TRU waste to be retrieved for shipment to the WIPP has been generated at the Plutonium Finishing Plant (PFP), also known as the Plutonium Processing and Storage Facility and Z Plant. The purpose of this report is to characterize the radioactive solid wastes generated by the PFP since its construction in 1947 using process knowledge, existing records, and history-obtained from interviews. The PFP is currently operated by Westinghouse Hanford Company (WHC) for the US Department of Energy (DOE).

  15. Diffusivity-Based Characterization of Plant Growth Media for Earth and Space

    DEFF Research Database (Denmark)

    Chamindu, Deepagoda; Møldrup, Per; Jones, Scot B.

    Most of the plant requirements for optimal growth (air, water, and nutrient supply, and mechanical support) are closely linked with the basic physical properties of the growth media. Oxygen and nutrients supply to plant roots occur predominantly by diffusion, and gas and solute diffusivity...... are the key parameters controlling the diffusive movement of oxygen and nutrients in the root zone. As one among several essential aspects of optimal porous media design for plant growth, this study presents a diffusion-based characterization of four aggregated growth media. To account for the observed large...... percolation threshold for gas diffusivity in the selected media, we presented an Inactive Pore and Density Corrected (IPDC) model which could describe well the measured gas diffusivity in both inter- and inter-aggregate pore regions. A strong relation (r2 = 0.98) between percolation threshold for gas...

  16. Characterization of livestock wastewater at various stages of wastewater treatment plant

    International Nuclear Information System (INIS)

    Ting Teo Ming; Kim, Tak Hyun; Lee, Myun Joo

    2007-01-01

    A characterization study has been conducted at Gongju Livestock Wastewater Treatment Plant, Gongju, South Korea. It is owned and operated by the government with treatment capacity of 250 tons per day. Livestock wastewater was collected from individual farmer and treated at the treatment plant. The centralized livestock wastewater treatment plant has various treatment processes namely pre-treatment, anaerobic digestion, nitrification, de-nitrification , chemical treatment, sand filtration and ozonization. The livestock wastewater was characterized by high COD, SS, T-N and T-P with concentration of 20600 mg/l, 6933 mg/l, 2820 mg/l and 700 mg/ l, respectively. After the wastewater has undergone various treatment processes it was discharged to waterways with concentration of COD, SS, T-N and T-P at 105 mg/l, 73 mg/l, 2.1 mg/l and 9 mg/l, respectively. This is part of the study to investigate the potential of irradiation to be applied at the centralized livestock wastewater treatment plant. Although livestock wastewater can be potentially applied to crop as source of nutrients it also affect the water quality due to runoff and leaching. When the wastewater applied at the rates in excess of crop uptake rates, the excess wastewater could potentially enter surface and groundwater and polluted them. (author)

  17. Twenty years of experience in spent fuel shipment from German nuclear power plants - a view of the competent authority

    International Nuclear Information System (INIS)

    Fasten, Ch.; Mueller, U.; Alter, U.

    1994-01-01

    A survey of the transport of spent fuel in and from Germany during the last 20 years is presented. The spent fuel is now transported from the German nuclear power facilities to the reprocessing plants in France and the United Kingdom. In the past, there were also shipments to the former reprocessing plant WAK Karlsruhe (Germany), to the long-term storage facility CLAB (Sweden) and also from the former German Democratic Republic to the USSR. The transport of the spent fuel is carried out in specially built flasks requiring an extensive quality assurance programme. Due to the heavy weight of these packages, the shipments are mostly carried out by rail, but also by road and sea. An overview is given of the following matters: (i) quantities of spent fuel transport, (ii) organisation of transport (iii) licensing matters, and (iv) reported incidents. In addition, an analysis is included of the radiation exposure for normal conditions of transport, especially of the transport workers. Difficulties and hindrances during transport are also reported. (author)

  18. Characterization of Plant Peroxidases and Their Potential for Degradation of Dyes: a Review.

    Science.gov (United States)

    Kalsoom, Umme; Bhatti, Haq Nawaz; Asgher, Muhammad

    2015-07-01

    Peroxidases are ubiquitously found in all vascular plants and are promising biocatalysts for oxidization of wide range of aromatic substrates including various industrial dyes. Peroxidases can catalyze degradation of chemical structure of aromatic dyes either by precipitation or by opening the aromatic ring structure. Both soluble and immobilized peroxidases have been successfully used in batches as well as in continuous processes for the treatment of aromatic dyes present in industrial effluents. Plant peroxidases are stable catalysts that retain their activities over a broad range of pH and temperatures. The performance of an enzyme for degradation process depends upon the structure of dyes and the operational parameters like concentration of enzyme, H2O2 and dye, incubation time, pH, and temperature. Recalcitrant dyes can also be mineralized by plant peroxidases in the presence of redox mediators. Thus, plant peroxidases are easily available, inexpensive, and ecofriendly biocatalysts for the treatment of wastewaters containing a wide spectrum of textile and non-textile synthetic dyes. This article reviews the recent developments in isolation and characterization of plant peroxidases and their applications for bioremediation of synthetic dyes.

  19. Competence Building

    DEFF Research Database (Denmark)

    Borrás, Susana; Edquist, Charles

    on the one hand, and the real world of innovation policy-making on the other, typically not speaking to each other. With this purpose in mind, this paper discusses the role of competences and competence-building in the innovation process from a perspective of innovation systems; it examines how governments...

  20. Outsourcing competence

    NARCIS (Netherlands)

    Bergstra, J.; Delen, G.; van Vlijmen, B.

    2011-01-01

    The topic of this paper, competences needed for outsourcing, is organized by first providing a generic competence scheme, which is subsequently instantiated to the area of sourcing and outsourcing. Sourcing and outsourcing are positioned as different areas of activity, neither one of which is

  1. Timespacing competence

    DEFF Research Database (Denmark)

    Laursen, Helle Pia; Mogensen, Naja Dahlstrup

    2016-01-01

    Drawing on Kramsch’s (2009) conceptualization of the multilingual subject and the symbolic self, in this paper, we explore how multilingual children re-signify three intertwined myths about the bilingual student, linguistic diversity and language competence, when, in the researcher......-generated activity My linguistic world 2014, they are invited to map and talk about their lived experiences as multiple language users seen in the light of place and movement. By demythifying themselves and their linguistic worlds, the children also raise important questions about the notion of linguistic competence....... By perceiving competences from a subjective child perspective, we learn how children do what we call timespacing competence. On that basis, we suggest paying attention to how children themselves timespace competence by focusing (more consistently) on the subjective, social, spatial and temporal dimensions...

  2. Competence Building

    DEFF Research Database (Denmark)

    Borrás, Susana; Edquist, Charles

    The main question that guides this paper is how governments are focusing (and must focus) on competence building (education and training) when designing and implementing innovation policies. With this approach, the paper aims at filling the gap between the existing literature on competences...... on the one hand, and the real world of innovation policy-making on the other, typically not speaking to each other. With this purpose in mind, this paper discusses the role of competences and competence-building in the innovation process from a perspective of innovation systems; it examines how governments...... and public agencies in different countries and different times have actually approached the issue of building, maintaining and using competences in their innovation systems; it examines what are the critical and most important issues at stake from the point of view of innovation policy, looking particularly...

  3. Nuclear safety and human competence

    International Nuclear Information System (INIS)

    Stefanescu, Petre

    2001-01-01

    Competence represents a very well defined ensemble of knowledge and skills, behavior modalities, standard procedures and judgement types that can be used in a given situation, without a priori learning. It is obvious that a person competence should fulfill the needs of the company he works for. For a Nuclear Power Plant operator competence is a constitutive part of his individuality. Competence includes: 1. Knowledge that can be classified in three main items: - procedural and declarative knowledge; - practical knowledge and skills; - fundamental knowledge. 2. 'Non cognitive' knowledge components, such as 'social information', team collective competence, safety education, risks perception and management. The last item presents a special interest for nuclear safety. On the other hand, competence level defines the quality of procedures applied in different operational situations. Competence - procedures relations are presented. Competence fundament results from operator activity analysis. The analyst has to take into consideration several phases of activity in which competence is highlighted like: - genesis, during formation; - transformation, during adaptation to a technical modification; - transfer, from expert to probationer. Competence is subject to a continuous transformation process due to technical and organizational evolutions and 'operator ageing'. Cognitive ageing of operators or the technical ageing of competence often appear to be superimposed. Technical progress acceleration increases the ageing effects of competence. Knowledge - skills dynamic relations are discussed. The changing of organizational form determines appearance of new competence gained from others domains or defined by multidisciplinary studies. Ergonomics can help the changing of organizational form through analysis of operators evolution activity which will generate new competence. Ergonomics can contribute to identify means of raising competence starting from learning process

  4. Physiological and biochemical characterization of Azospirillum brasilense strains commonly used as plant growth-promoting rhizobacteria.

    Science.gov (United States)

    Di Salvo, Luciana P; Silva, Esdras; Teixeira, Kátia R S; Cote, Rosalba Esquivel; Pereyra, M Alejandra; García de Salamone, Inés E

    2014-12-01

    Azospirillum is a plant growth-promoting rhizobacteria (PGPR) genus vastly studied and utilized as agriculture inoculants. Isolation of new strains under different environmental conditions allows the access to the genetic diversity and improves the success of inoculation procedures. Historically, the isolation of this genus has been performed by the use of some traditional culture media. In this work we characterized the physiology and biochemistry of five different A. brasilense strains, commonly used as cereal inoculants. The aim of this work is to contribute to pose into revision some concepts concerning the most used protocols to isolate and characterize this bacterium. We characterized their growth in different traditional and non-traditional culture media, evaluated some PGPR mechanisms and characterized their profiles of fatty acid methyl esters and carbon-source utilization. This work shows, for the first time, differences in both profiles, and ACC deaminase activity of A. brasilense strains. Also, we show unexpected results obtained in some of the evaluated culture media. Results obtained here and an exhaustive knowledge revision revealed that it is not appropriate to conclude about bacterial species without analyzing several strains. Also, it is necessary to continue developing studies and laboratory techniques to improve the isolation and characterization protocols. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. The Rocky Flats Plant Waste Stream and Residue Identification and Characterization Program (WSRIC): Progress and achievements

    International Nuclear Information System (INIS)

    Ideker, V.L.

    1994-01-01

    The Waste Stream and Residue Identification and Characterization (WSRIC) Program, as described in the WSRIC Program Description delineates the process knowledge used to identify and characterize currently-generated waste from approximately 5404 waste streams originating from 576 processes in 288 buildings at Rocky Flats Plant (RFP). Annual updates to the WSRIC documents are required by the Federal Facilities Compliance Agreement between the US Department of Energy, the Colorado Department of Health and the Environmental Protection Agency. Accurate determination and characterization of waste is a crucial component in RFP's waste management strategy to assure compliance with Resource Conservation and Recovery Act (RCRA) storage and treatment requirements, as well as disposal acceptance criteria. The WSRIC Program was rebaselined in September 1992, and serves as the linchpin for documenting process knowledge in RFP's RCRA operating record. Enhancements to the WSRIC include strengthening the waste characterization rationale, expanding WSRIC training for waste generators, and incorporating analytical information into the WSRIC building books. These enhancements will improve credibility with the regulators and increase waste generators' understanding of the basis for credible waste characterizations

  6. Characterization of plant-derived carbon and phosphorus in lakes by sequential fractionation and NMR spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Shasha [College of Water Sciences, Beijing Normal University, Beijing 100875 (China); State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Zhu, Yuanrong, E-mail: zhuyuanrong07@mails.ucas.ac.cn [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Wu, Fengchang, E-mail: wufengchang@vip.skleg.cn [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Meng, Wei [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); He, Zhongqi [USDA-ARS Southern Regional Research Center, 1100 Robert E Lee Blvd, New Orleans, LA 70124 (United States); Giesy, John P. [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Department of Biomedical and Veterinary Biosciences and Toxicology Centre, University of Saskatchewan, Saskatoon, Saskatchewan (Canada)

    2016-10-01

    Although debris from aquatic macrophytes is one of the most important endogenous sources of organic matter (OM) and nutrients in lakes, its biogeochemical cycling and contribution to internal load of nutrients in eutrophic lakes are still poorly understood. In this study, sequential fractionation by H{sub 2}O, 0.1 M NaOH and 1.0 M HCl, combined with {sup 13}C and {sup 31}P NMR spectroscopy, was developed and used to characterize organic carbon (C) and phosphorus (P) in six aquatic plants collected from Tai Lake (Ch: Taihu), China. Organic matter, determined by total organic carbon (TOC), was unequally distributed in H{sub 2}O (21.2%), NaOH (29.9%), HCl (3.5%) and residual (45.3%) fractions. For P in debris of aquatic plants, 53.3% was extracted by H{sub 2}O, 31.9% by NaOH, and 11% by HCl, with 3.8% in residual fractions. Predominant OM components extracted by H{sub 2}O and NaOH were carbohydrates, proteins and aliphatic acids. Inorganic P (P{sub i}) was the primary form of P in H{sub 2}O fractions, whereas organic P (P{sub o}) was the primary form of P in NaOH fractions. The subsequent HCl fractions extracted fewer species of C and P. Some non-extractable carbohydrates, aromatics and metal phytate compounds remained in residual fractions. Based on sequential extraction and NMR analysis, it was proposed that those forms of C (54.7% of TOC) and P (96.2% of TP) in H{sub 2}O, NaOH and HCl fractions are potentially released to overlying water as labile components, while those in residues are stable and likely preserved in sediments of lakes. These results will be helpful in understanding internal loading of nutrients from debris of aquatic macrophytes and their recycling in lakes. - Highlights: • Sequential fractionation combined with NMR analysis was applied on aquatic plants. • Labile and stable C and P forms in aquatic plants were characterized. • 54.7% of OM and 96.2% of P in aquatic plants are potentially available. • 45.3% of OM and 3.8% of P in aquatic

  7. Molecular Characterization and Analysis of Antimicrobial Activity of Endophytic Fungi From Medicinal Plants in Saudi Arabia.

    Science.gov (United States)

    Gashgari, Rukaia; Gherbawy, Youssuf; Ameen, Fuad; Alsharari, Salam

    2016-01-01

    Endophytic fungi, which have been reported in numerous plant species, are important components of the forest community and contribute significantly to the diversity of natural ecosystems. The current study aimed to evaluate and characterize, at the molecular level, the diversity and antimicrobial activities of endophytic fungi from medicinal plants in Saudi Arabia. Fungi growing on plant segments were isolated and identified based on morphological and molecular characteristics. The isolates were grouped into 35 distinct operational taxonomic units, based on the sequence of the internal transcribed spacer regions in the rRNA gene. The colonization frequency and the dominant fungi percentage of these endophytic fungi were calculated. A dual culture technique was adopted to investigate the antifungal activity of these endophytes. Tamarix nilotica showed the highest endophytic diversity with a relative frequency of 27.27%, followed by Cressa cretica with a relative frequency of 19.27%. The most frequently isolated species was Penicillium chrysogenum with an overall colonization rate of 98.57%. Seven out of 35 endophytic fungi exhibited strong antifungal activity to all plant fungal pathogens tested. P. chrysogenum, Fusarium oxysporum, and F. nygamai exhibited the highest inhibition against the human pathogenic bacteria Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and Klebsiella pneumoniae. Aspergillus sydowii, P. chrysogenum, and Eupenicillium crustaceum showed strong antimicrobial activity against Enterococcus faecalis. The antimicrobial activity of these endophytic microorganisms could be exploited in biotechnology, medicine, and agriculture.

  8. NOM characterization and removal at six Southern African water treatment plants

    Directory of Open Access Journals (Sweden)

    J. Haarhoff

    2010-04-01

    Full Text Available Organic pollution is a major concern during drinking water treatment. Major challenges attributed to organic pollution include the proliferation of pathogenic micro-organisms, prevalence of toxic and physiologically disruptive organic micro-pollutants, and quality deterioration in water distribution systems. A major component of organic pollution is natural organic matter (NOM. The operational mechanisms of most unit processes are well understood. However, their interaction with NOM is still the subject of scientific research. This paper takes the form of a meta-study to capture some of the experiences with NOM monitoring and analysis at a number of Southern African Water Treatment Plants. It is written from the perspective of practical process selection, to try and coax some pointers from the available data for the design of more detailed pilot work. NOM was tracked at six water treatment plants using dissolved organic carbon (DOC measurements. Fractionation of the DOC based on biodegradability and molecular weight distribution was done at a water treatment plant in Namibia. A third fractionation technique using ion exchange resins was used to assess the impact of ozonation on DOC. DOC measurements alone did not give much insight into NOM evolution through the treatment train. The more detailed characterization techniques showed that different unit processes preferentially remove different NOM fractions. Therefore these techniques provide better information for process design and optimisation than the DOC measurement which is routinely done during full scale operation at these water treatment plants.

  9. Neutron field characterization at the independent spent fuel storage installation of the Trillo nuclear power plant.

    Science.gov (United States)

    Campo, Xandra; Méndez, Roberto; Embid, Miguel; Ortego, Alberto; Novo, Manuel; Sanz, Javier

    2018-05-01

    Neutron fields inside and outside the independent spent fuel storage installation of Trillo Nuclear Power Plant are characterized exhaustively in terms of neutron spectra and ambient dose equivalent, measured by Bonner sphere system and LB6411 monitor. Measurements are consistent with storage casks and building shield characteristics, and also with casks distribution inside the building. Outer values at least five times lower than dose limit for free access area are found. Measurements with LB6411 and spectrometer are consistent with each other. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Quality Assurance Program Plan for the Waste Isolation Pilot Plant Experimental-Waste Characterization Program

    International Nuclear Information System (INIS)

    1991-01-01

    This Quality Assurance Program Plan (QAPP) identifies the quality of data necessary to meet the specific objectives associated with the Department of Energy (DOE) Waste Isolation Pilot Plant (WIPP) Experimental-Waste Characterization Program (the Program). This experimental-waste characterization program is only one part of the WIPP Test Phase, both in the short- and long-term, to quantify and evaluate the characteristics and behavior of transuranic (TRU) wastes in the repository environment. Other parts include the bin-scale and alcove tests, drum-scale tests, and laboratory experiments. In simplified terms, the purpose of the Program is to provide chemical, physical, and radiochemical data describing the characteristics of the wastes that will be emplaced in the WIPP, while the remaining WIPP Test Phase is directed at examining the behavior of these wastes in the repository environment. 50 refs., 35 figs., 33 tabs

  11. Characterization and Photoprotector Activity of Endophytic Fungal Pigments from Coatal Plant Sarang Semut (Hydnophytum formicarum

    Directory of Open Access Journals (Sweden)

    Mada Triandala Sabero

    2016-04-01

    Full Text Available Isolate endophytic fungal RS3 from smooth ant plants (Hydnophytum formicarum produced black pigment. The aims of this research were to obtain the pigment, to characterize and to determine the photoprotector activity. This research was consisted into several steps, there were determined the best precipitating agent, characterization using instrument and solubility analysis, and analysis of Sun Protection Factor (SPF. Results showed the pigment was precipitated using acid solvent with pH ≤ 2,5. Functional groups of pigment pellet were hydroxy, aromatic ring, phenol and amine. According to characteristic, black pigment produced by fungal RS3 proposed as melanin. The photoprotector analysis showed SPF the value was 11.33.

  12. Characterization of subjective uncertainty in the 1996 performance assessment for the Waste Isolation Pilot Plant

    Energy Technology Data Exchange (ETDEWEB)

    HELTON,JON CRAIG; MARTELL,MARY-ALENA; TIERNEY,MARTIN S.

    2000-05-18

    The 1996 performance assessment (PA) for the Waste Isolation Pilot Plant (WIPP) maintains a separation between stochastic (i.e., aleatory) and subjective (i.e., epistemic) uncertainty, with stochastic uncertainty arising from the possible disruptions that could occur at the WIPP over the 10,000 yr regulatory period specified by the US Environmental Protection Agency (40 CFR 191,40 CFR 194) and subjective uncertainty arising from an inability to uniquely characterize many of the inputs required in the 1996 WIPP PA. The characterization of subjective uncertainty is discussed, including assignment of distributions, uncertain variables selected for inclusion in analysis, correlation control, sample size, statistical confidence on mean complementary cumulative distribution functions, generation of Latin hypercube samples, sensitivity analysis techniques, and scenarios involving stochastic and subjective uncertainty.

  13. Characterization of subjective uncertainty in the 1996 performance assessment for the Waste Isolation Pilot Plant

    International Nuclear Information System (INIS)

    HELTON, JON CRAIG; MARTELL, MARY-ALENA; TIERNEY, MARTIN S.

    2000-01-01

    The 1996 performance assessment (PA) for the Waste Isolation Pilot Plant (WIPP) maintains a separation between stochastic (i.e., aleatory) and subjective (i.e., epistemic) uncertainty, with stochastic uncertainty arising from the possible disruptions that could occur at the WIPP over the 10,000 yr regulatory period specified by the US Environmental Protection Agency (40 CFR 191,40 CFR 194) and subjective uncertainty arising from an inability to uniquely characterize many of the inputs required in the 1996 WIPP PA. The characterization of subjective uncertainty is discussed, including assignment of distributions, uncertain variables selected for inclusion in analysis, correlation control, sample size, statistical confidence on mean complementary cumulative distribution functions, generation of Latin hypercube samples, sensitivity analysis techniques, and scenarios involving stochastic and subjective uncertainty

  14. Detection, isolation, and preliminary characterization of bacteria contaminating plant tissue cultures

    Directory of Open Access Journals (Sweden)

    Monika Kałużna

    2014-01-01

    Full Text Available In order to limit the contamination problem in plant tissue cultures experiments on selection of media suitable for detection and isolation of bacteria contaminating plant tissue explants, and preliminary characterization of isolates were made. In the first experiment aiming at detection of bacteria in plant explants four strains representing genera most often occurring at our survey of plant tissue cultures, and earlier isolated and identified (Bacillus, Methylobacterium, Pseudomonas and Xanthomonas were streaked on five bacteriological media (NA, King B, K, R2A and 523 and on the medium used for plant culture initiation – ½ MS with milk albumin (IM. All strains grew on all media but on K and IM at the slowest rate and on 523 medium at the fastest. The IM medium proved to be useful for immediate bacteria detection at the initial stage of culture. In the second experiment, aiming at characterization of isolates on the basis of colony growth and morphology 14 strains (Agrobacterium, Bacillus, Curtobacterium, Flavobacterium, Lactobacillus, Methylobacterium – 2 strains Mycobacterium, Paenibacillus, Plantibacterium, Pseudomonas, Stenotrophomonas, Xanthomonas, and species Serratia marcescens were streaked on five microbiological media: KB, NBY, YDC, YNA and YPGA. All strains grew on all those media but at different rates. The only exception was the strain of Lactobacillus spp., which did not grow on King B medium. This medium allowed the detection of such characteristic traits as fluorescence (Pseudomonas and secretion of inclusions (Stenotrophomonas. The third experiment was focussed on assessment of the sensitivity of detection of specific bacteria in pure cultures and in plant tis- sue cultures using standard PCR and BIO-PCR techniques with genus specific primers and 2 methods of DNA isolation. Results showed that the use of Genomic Mini kit enabled an increase of the sensitivity by 100 times as compared to extraction of DNA by boiling

  15. Genome-wide identification and characterization of tRNA-derived RNA fragments in land plants.

    Science.gov (United States)

    Alves, Cristiane S; Vicentini, Renato; Duarte, Gustavo T; Pinoti, Vitor F; Vincentz, Michel; Nogueira, Fabio T S

    2017-01-01

    The manuscript by Alves et al. entitled "Genome-wide identification and characterization of tRNA-derived RNA fragments in land plants" describes the identification and characterization of tRNAderived sRNA fragments in plants. By combining bioinformatic analysis and genetic and molecular approaches, we show that tRF biogenesis does not rely on canonical microRNA/siRNA processing machinery (i.e., independent of DICER-LIKE proteins). Moreover, we provide evidences that the Arabidopsis S-like Ribonuclease 1 (RNS1) might be involved in the biogenesis of tRFs. Detailed analyses showed that plant tRFs are sorted into different types of ARGONAUTE proteins and that they have potential target candidate genes. Our work advances the understanding of the tRF biology in plants by providing evidences that plant and animal tRFs shared common features and raising the hypothesis that an interplay between tRFs and other sRNAs might be important to fine-tune gene expression and protein biosynthesis in plant cells. Small RNA (sRNA) fragments derived from tRNAs (3'-loop, 5'-loop, anti-codon loop), named tRFs, have been reported in several organisms, including humans and plants. Although they may interfere with gene expression, their biogenesis and biological functions in plants remain poorly understood. Here, we capitalized on small RNA sequencing data from distinct species such as Arabidopsis thaliana, Oryza sativa, and Physcomitrella patens to examine the diversity of plant tRFs and provide insight into their properties. In silico analyzes of 19 to 25-nt tRFs derived from 5' (tRF-5s) and 3'CCA (tRF-3s) tRNA loops in these three evolutionary distant species showed that they are conserved and their abundance did not correlate with the number of genomic copies of the parental tRNAs. Moreover, tRF-5 is the most abundant variant in all three species. In silico and in vivo expression analyses unraveled differential accumulation of tRFs in Arabidopsis tissues/organs, suggesting that they are

  16. Cloning and functional characterization of MusaVND1 using transgenic banana plants.

    Science.gov (United States)

    Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

    2015-06-01

    Vascular related NAC (NAM, ATAF and CUC) domain-containing genes regulate secondary wall deposition and differentiation of xylem vessel elements. MusaVND1 is an ortholog of Arabidopsis VND1 and contains the highly conserved NAC domain. The expression of MusaVND1 is highest in developing corm and during lignification conditions, the increase in expression of MusaVND1 coincides with the expression of PAL, COMT and C4H genes. MusaVND1 encodes a nuclear localized protein as MusaVND1-GFP fusion protein gets localized to nucleus. Transient overexpression of MusaVND1 converts banana embryogenic cells to xylem vessel elements, with a final differentiation frequency of 33.54% at the end of tenth day. Transgenic banana plants overexpressing MusaVND1 showed stunted growth and were characterized by PCR and Southern blot analysis. Transgenic banana plants showed transdifferentiation of various types of cells into xylem vessel elements and ectopic deposition of lignin in cells of various plant organs such as leaf and corm. Tracheary element formation was seen in the cortical region of transgenic corm as well as in epidermal cells of leaves. Biochemical analysis indicates significantly higher levels of lignin and cellulose content in transgenic banana lines than control plants. MusaVND1 overexpressing transgenic banana plants showed elevated expression levels of genes involved in lignin and cellulose biosynthesis pathway. Further expression of different MYB transcription factors positively regulating secondary wall deposition was also up regulated in MusaVND1 transgenic lines.

  17. Ames expedited site characterization demonstration at the former manufactured gas plant site, Marshalltown, Iowa

    Energy Technology Data Exchange (ETDEWEB)

    Bevolo, A.J.; Kjartanson, B.H.; Wonder, J.D.

    1996-03-01

    The goal of the Ames Expedited Site Characterization (ESC) project is to evaluate and promote both innovative technologies (IT) and state-of-the-practice technologies (SOPT) for site characterization and monitoring. In April and May 1994, the ESC project conducted site characterization, technology comparison, and stakeholder demonstration activities at a former manufactured gas plant (FMGP) owned by Iowa Electric Services (IES) Utilities, Inc., in Marshalltown, Iowa. Three areas of technology were fielded at the Marshalltown FMGP site: geophysical, analytical and data integration. The geophysical technologies are designed to assess the subsurface geological conditions so that the location, fate and transport of the target contaminants may be assessed and forecasted. The analytical technologies/methods are designed to detect and quantify the target contaminants. The data integration technology area consists of hardware and software systems designed to integrate all the site information compiled and collected into a conceptual site model on a daily basis at the site; this conceptual model then becomes the decision-support tool. Simultaneous fielding of different methods within each of the three areas of technology provided data for direct comparison of the technologies fielded, both SOPT and IT. This document reports the results of the site characterization, technology comparison, and ESC demonstration activities associated with the Marshalltown FMGP site. 124 figs., 27 tabs.

  18. Radiological and chemical characterization report for the planned Quarry Construction Staging Area and Water Treatment Plant: Revision 1

    International Nuclear Information System (INIS)

    1989-03-01

    The Quarry Construction Staging Area and Water Treatment Plant (QCSA) will be used in the support of the bulk waste removal of the Weldon Spring Quarry. Radiological and chemical characterization was performed on a 12 acre site where the QCSA will be constructed. The characterization revealed approximately .5 acres of radiologically contaminated land. No chemical contamination was found. 8 refs., 5 figs., 7 tabs

  19. Spatially resolved investigation of competing nanocluster emission in quantum-disks-in-nanowires structure characterized by nanoscale cathodoluminescence

    KAUST Repository

    Prabaswara, Aditya

    2017-06-30

    We report on the study and characterization of nanoclusters-related recombination centers within quantum-disks-in-nanowires heterostructure by utilizing microphotoluminescence (mu-PL) and cathodoluminescence scanning transmission electron microscopy (CL-STEM). mu-PL measurement shows that the nanoclusters-related recombination center exhibits different temperature-dependent characteristics compared with the surrounding InGaN quantum-disksrelated recombination center. CL-STEM measurements reveal that these recombination centers mainly arise from irregularities within the quantum disks, with a strong, spatially localized emission when measured at low temperature. The spectra obtained from both CL-STEM and mu-PL correlate well with each other. Our work sheds light on the optical and structural properties of simultaneously coexisting recombination centers within nanowires heterostructures. (C) The Authors. Published by SPIE under a Creative Commons Attribution 3.0 Unported License. Distribution or reproduction of this work in whole or in part requires full attribution of the original publication, including its DOI.

  20. Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil.

    Science.gov (United States)

    Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F

    2014-03-03

    This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Expression and characterization of plant aspartic protease nepenthesin-1 from Nepenthes gracilis.

    Science.gov (United States)

    Kadek, Alan; Tretyachenko, Vyacheslav; Mrazek, Hynek; Ivanova, Ljubina; Halada, Petr; Rey, Martial; Schriemer, David C; Man, Petr

    2014-03-01

    Carnivorous plants of the genus Nepenthes produce their own aspartic proteases, nepenthesins, to digest prey trapped in their pitchers. Nepenthesins differ significantly in sequence from other aspartic proteases in the animal or even plant kingdoms. This difference, which also brings more cysteine residues into the structure of these proteases, can be a cause of uniquely high temperature and pH stabilities of nepenthesins. Their detailed structure characterization, however, has not previously been possible due to low amounts of protease present in the pitcher fluid and also due to limited accessibility of Nepenthes plants. In the present study we describe a convenient way for obtaining high amounts of nepenthesin-1 from Nepenthes gracilis using heterologous production in Escherichia coli. The protein can be easily refolded in vitro and its characteristics are very close to those described for a natural enzyme isolated from the pitcher fluid. Similarly to the natural enzyme, recombinant nepenthesin-1 is sensitive to denaturing and reducing agents. It also has maximal activity around pH 2.5, shows unusual stability at high pH and its activity is not irreversibly inhibited even after prolonged incubation in the basic pH range. On the other hand, temperature stability of the recombinant enzyme is lower in comparison with the natural enzyme, which can be attributed to missing N-glycosylation in the recombinant protein. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Plant growth promoting characterization of indigenous Azotobacteria isolated from soils in Iran.

    Science.gov (United States)

    Farajzadeh, Davoud; Yakhchali, Bagher; Aliasgharzad, Naser; Sokhandan-Bashir, Nemat; Farajzadeh, Malak

    2012-04-01

    It has been well known that the bacteria of the genus Azotobacter, in addition to the beneficial N(2)-fixing activity, are able to improve plant growth by a number of direct and indirect mechanisms. To identify this potential in indigenous azotobacteria, the efficiency of 17 isolates of Azotobacter from the rhizosphere of wheat and barley plants cultivated in salt- and/or drought-affected soils in Iran were evaluated for their ability to dissolve inorganic and organic phosphates, siderophore secretion, indole acetic acid (IAA) production; and protease, chitinase, and ACC deaminase (ACCD) activities. First, they were biochemically characterized and one isolate (strain) was identified by 16S rDNA sequencing. Eight isolates were designated as Azotobacter vinelandii and the remaining isolates were identified as A. chroococcum. All isolates hydrolyzed the organic and inorganic phosphate compounds and effectively produced IAA. Fifteen isolates produced siderophore, but only one isolate showed protease activity which is being reported for the first time in relation to Azotobacter. None of the 17 isolates was capable of producing ACCD or chitinase. However, polymerase chain reaction amplification of the ACCD coding genes, by the use of the gene-specific primers, indicated that not all contain the ACCD gene. The standard screening methods with slight modifications, especially in the case of ACCD assay, were applied. The results showed that the use of specific screening methods, modified according to bacterial nutritional requirements, are the efficient methods for precise evaluation of the plant growth promoting rhizobacteria activity.

  3. Structural characterization of lignin from leaf sheaths of "dwarf cavendish" banana plant.

    Science.gov (United States)

    Oliveira, Lúcia; Evtuguin, Dmitry V; Cordeiro, Nereida; Silvestre, Armando J D; Silva, Artur M S; Torres, Isabel C

    2006-04-05

    Dioxane lignin (DL) isolated from leaf sheaths of banana plant (Musa acuminata Colla var. cavendish) and in situ lignin were submitted to a comprehensive structural characterization employing spectroscopic (UV, FTIR, solid state 13C CP-MAS NMR, liquid state 13C and 1H NMR) and chemical degradation techniques (permanganate and nitrobenzene oxidation). Results obtained showed that banana plant leaf sheath lignin is of HGS type with a molar proportion of p-hydroxyphenyl (H)/guaiacyl (G)/syringyl (S) units of 12:25:63. Most of the H units in DL are terminal phenolic coumarates linked to other lignin substructures by benzyl and Cgamma-ester bonds in contrast to ferulates that are mainly ether linked to bulk lignin. It is proposed that banana plant leaf sheath lignin is chemically bonded to suberin-like components of cell tissues by ester linkages via essentially hydroxycinnamic acid residues. beta-O-4 structures (0.31/C6), the most abundant in DL, comprise mainly S units, whereas a significant proportion of G units is bonded by beta-5, 5-5', and 4-O-5' linkages contributing to ca. 80% of condensed structures in DL.

  4. Characterization of phenolic compounds, carotenoids, vitamins and antioxidant activities of selected Malaysian wild edible plants.

    Science.gov (United States)

    Wong, Jin Yi; Matanjun, Patricia; Ooi, Yasmin Beng Houi; Chia, Kah Fei

    2013-08-01

    This study was carried out to characterize phenolic compounds, carotenoids, vitamins and the antioxidant activity of selected wild edible plants. Plant extracts were purified, and phenolic compounds comprising 11 phenolic acids (hydroxybenzoic acid and hydrocinnamic acid) and 33 flavonoids (including catechin, glycosides and aglycones) were analysed using High Performance Liquid Chromatography - Diode Array Detector (HPLC-DAD). Furthermore, the contents of ascorbic acid and tocopherol ((α and γ tocopherol) and carotenoids (lutein and β-carotene) were also determined. The major phenolics identified consisted of glycosides of flavones (apigenin and luteolin) and flavonols (kaempferol and quercetin). Among the phenolic acids identified after hydrolysis, coumaric acid was the predominant phenolic acid in all the extracts of wild plants. Ascorbic acid [53.8 mg/100 g fresh weight (FW)] and β-carotene (656.5 mg/100 g FW) showed the highest content in the leaf of Heckeria umbellatum. In conclusion, the leaves of H. umbellatum, Aniseia martinicensis and Gonostegia hirta have excellent potential in the future to emerge as functional ingredients.

  5. Biological assessment for rare and endangered plant species: Related to CERCLA characterization activities

    International Nuclear Information System (INIS)

    Sackschewsky, M.R.

    1992-04-01

    Environmental characterization in support of hazardous, radioactive, and mixed waste cleanup (in accordance with the Comprehensive Environmental Response, Compensation, and Liability Act of 1980) can involve a large number of both nonintrusive and intrusive activities. Many of these activities could have a detrimental impact on listed plant species. These impacts can be minimized by following simple conservation policies while conducting the various field activities. For instance, frequent off-road vehicular traffic and have a severe impact on native habitats and, therefore, should be kept to a minimum. Personnel performing the field activities should be trained to preserve, respect, and minimize their impact on native habitat while performing work in the field. In addition, areas where sampling is planned should be surveyed for the presence of listed plant species before the initiation of the field activities. Extremely distributed areas could be exempted from this requirement provided adequate habitat assessments have been performed by qualified personnel. Twelve special status plant species are known to survive on or very near the Hanford Site. None of these species currently are listed as Federal Threatened or Endangered Species. However, four local species currently are candidates for federal protection. These species are the Northern Wormwood (Artemisia campestris ssp. borealis var. wormskioldii), Persistantsepal Yellowcress (Rorippa columbiae), Hoover's Desert Parsley (Lomatium tuberosum), and Columbia Milkvetch (Astragalus columbianus)

  6. Characterization of fly ash from a power plant and surroundings by micro-Raman spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Guedes, A.; Valentim, B. [Centro de Geologia da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Prieto, A.C.; Sanz, A. [Departamento de Fisica de la Materia Condensada, Cristalografia y Mineralogia. Universidad de Valladolid, Valladolid (Spain); Flores, D.; Noronha, F. [Centro de Geologia da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Departamento de Geologia da Faculdade de Ciencias, Rua do Campo Alegre 687, 4169-007 Porto (Portugal)

    2008-02-01

    Fly ash samples were collected from a Portuguese power plant that burns low-sulphur coals from South Africa, U.S.A., Colombia, and Australia. The fly ashes were collected from the hoppers of the economizers, air heaters, electrostatic precipitators, and from the stack. The power plant air monitoring system was also sampled. The fly ash characterization was conducted by micro-Raman spectroscopy (MRS). The micro-Raman spectroscopic analysis permitted an efficient identification and characterization of different inorganic and organic materials present in fly ash: quartz, hematite, magnetite, calcite, glass, aluminium and calcium oxides, and different types of organic constituents. The study of the structural evolution of the unburned carbon/char material during their path through the power plant, though the use of Raman spectra and Raman parameters reveal that despite the high temperatures they reached, these materials are still structurally disordered. However, a structural evolution occurs in the char from the economizer up to the electrostatic precipitators where the char is structurally more disordered. The different features of the Raman spectra observed for carbon particles collected from the stack, together with the high range of variation of the Raman parameters, confirm the existence of different carbon particles in the stack, i.e., char and others (probably soot). The filters from the surroundings contain a variety of carbon particles with Raman parameters different from the ones obtained in the fly ash hoppers and stack. These are diesel particles as indicated by the values of W{sub D1}, FWHM{sub D1}, FWHM{sub G}, W{sub G} and ID1/IG obtained. (author)

  7. Competency Education and Evaluation: Issues and Dilemmas

    Science.gov (United States)

    Short, Ronald R.

    1977-01-01

    Competency education in the applied behavioral sciences can be enhanced by synethesizing the values of humanistic psychology with the measurement, evaluation, and accountability that characterize behavioral psychology. (Author)

  8. Nuclear energy can compete, industry watchers say

    International Nuclear Information System (INIS)

    Cash, C.J.

    1995-01-01

    Nuclear power plants with outstanding operating records and cost-conscious management can continue to compete with other forms of generation as the electricity business becomes more competitive. Natural gas-fired units will set the pricing standard with which nuclear power plants must compete

  9. Characterization of plant sulfiredoxin and role of sulphinic form of 2-Cys peroxiredoxin

    Science.gov (United States)

    Iglesias-Baena, Iván; Barranco-Medina, Sergio; Lázaro-Payo, Alfonso; López-Jaramillo, Francisco Javier; Sevilla, Francisca; Lázaro, Juan-José

    2010-01-01

    The antioxidant function of 2-Cys peroxiredoxin (Prx) involves the oxidation of its conserved peroxidatic cysteine to sulphenic acid that is recycled by a reductor agent. In conditions of oxidative stress, the peroxidatic cysteine can be overoxidized to sulphinic acid inactivating the Prx. An enzyme recently discovered, named sulfiredoxin (Srx), reduces the sulphinic 2-Cys Prx (Prx-SO2H). To explore the physiological functions of Srx in plants we have cloned, expressed and purified to homogeneity a Srx from Arabidopsis thaliana (AtSrx), as well as five variants by site-directed mutagenesis on amino acids involved in its activity. The activity of sulfiredoxin, determined by a new method, is dependent on the concentration of the sulphinic form of Prx and the conserved Srx is capable of regenerating the functionality of both pea and Arabidopsis Prx-SO2H. Molecular modelling of AtSrx and the facts that the R28Q variant shows a partial inactivation, that the activity of the E76A variant is equivalent to that of the native enzyme and that the double mutation R28Q/E76A abolishes the enzymatic activity suggests that the pair His100-Glu76 may be involved in the activation of C72 in the absence of R28. The knock-out mutant plants without Srx or 2-Cys Prx exhibited phenotypical differences under growth conditions of 16 h light, probably due to the signalling role of the sulphinic form of Prx. These mutants showed more susceptibility to oxidative stress than wild-type plants. This work presents the first systematic biochemical characterization of the Srx/Prx system from plants and contributes to a better understanding of its physiological function. PMID:20176891

  10. Characterization of the ability to form biofilms by plant-associated Pseudomonas species.

    Science.gov (United States)

    Ueda, Akihiro; Saneoka, Hirofumi

    2015-04-01

    Successful colonization is the initial step for plant-bacteria interactions; therefore, the development of strategies to improve adherence to plant surfaces is critically important for environmental bacteria. Biofilm formation is thought to be one such strategy for bacteria to establish stable colonization on inert and living surfaces. Although biofilms play potential roles in enabling persistent bacterial colonization, little attention has been paid to biofilms formed by plant-associated bacteria. In this study, we characterized the biofilm-forming ability of 6 species of bacteria from the family Pseudomonadaceae: Pseudomonas protegens, Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas stutzeri, Pseudomonas mendocina, and Pseudomonas syringae. These strains exhibit different degrees of biofilm formation depending on incubation time and nutrient availability. Distinct preferences for growth media were observed, as biofilms were formed by P. protegens with rich nutrients and by P. fluorescens and P. putida with poor nutrients. Likewise, P. stutzeri did not form biofilms with rich nutrients but did form biofilms under nutrient-poor conditions. These observations indicate that particular components in media may influence biofilm formation. P. putida, one of the strains with high biofilm-forming ability, showed the highest ability for initial attachment, which may be mediated by the hydrophobicity of its cell surface. P. mendocina also has high ability for initial attachment, and this strain produces cell surface-attached extracellular polysaccharides that promote cell aggregation. Thus, each strain possesses different properties that facilitate biofilm formation. Shedding light on bacterial strategies for colonization via biofilm formation would enable a better understanding of plant-bacteria interactions.

  11. Identification of Diverse Mycoviruses through Metatranscriptomics Characterization of the Viromes of Five Major Fungal Plant Pathogens

    Science.gov (United States)

    Nelson, Berlin D.; Ajayi-Oyetunde, Olutoyosi; Bradley, Carl A.; Hughes, Teresa J.; Hartman, Glen L.; Eastburn, Darin M.

    2016-01-01

    ABSTRACT Mycoviruses can have a marked effect on natural fungal communities and influence plant health and productivity. However, a comprehensive picture of mycoviral diversity is still lacking. To characterize the viromes of five widely dispersed plant-pathogenic fungi, Colletotrichum truncatum, Macrophomina phaseolina, Diaporthe longicolla, Rhizoctonia solani, and Sclerotinia sclerotiorum, a high-throughput sequencing-based metatranscriptomic approach was used to detect viral sequences. Total RNA and double-stranded RNA (dsRNA) from mycelia and RNA from samples enriched for virus particles were sequenced. Sequence data were assembled de novo, and contigs with predicted amino acid sequence similarities to viruses in the nonredundant protein database were selected. The analysis identified 72 partial or complete genome segments representing 66 previously undescribed mycoviruses. Using primers specific for each viral contig, at least one fungal isolate was identified that contained each virus. The novel mycoviruses showed affinity with 15 distinct lineages: Barnaviridae, Benyviridae, Chrysoviridae, Endornaviridae, Fusariviridae, Hypoviridae, Mononegavirales, Narnaviridae, Ophioviridae, Ourmiavirus, Partitiviridae, Tombusviridae, Totiviridae, Tymoviridae, and Virgaviridae. More than half of the viral sequences were predicted to be members of the Mitovirus genus in the family Narnaviridae, which replicate within mitochondria. Five viral sequences showed strong affinity with three families (Benyviridae, Ophioviridae, and Virgaviridae) that previously contained no mycovirus species. The genomic information provides insight into the diversity and taxonomy of mycoviruses and coevolution of mycoviruses and their fungal hosts. IMPORTANCE Plant-pathogenic fungi reduce crop yields, which affects food security worldwide. Plant host resistance is considered a sustainable disease management option but may often be incomplete or lacking for some crops to certain fungal pathogens

  12. Competence Map of Regulatory Body: Personal and Interpersonal Effectiveness Competencies

    International Nuclear Information System (INIS)

    Volkov, E.

    2016-01-01

    Full text: The paper presents implementation stages and outcomes of the project “Nuclear Facility Competences” fulfilled in JSC “Rosenergoatom” and outcomes of the project “Knowledge Management, Training and Staff Retention” fulfilled for Romania regulatory authority. The goal of the project was a development of competence profiles for nuclear power plant and corporate inspectorate key job positions. The paper is focused on personal and interpersonal effectiveness competencies for inspectorate job positions which are a part of well-known 4-Quadrant Competence Model. Each competence is described by one or two behavior scales. One can consider those competencies like common ones for organizations implementing inspection activity and could be used in human resource management processes like personnel selection, job assessment, career planning, training, mentoring. (author

  13. A competence approach to adult continuing education for identify and classifying living organisms

    Directory of Open Access Journals (Sweden)

    Julio César Rifa Téllez

    2015-09-01

    Full Text Available A competence approach to the systematic identification and classification of vegetal organisms is described in connection with the training of Biology professors for integrating citizens’ attitude to plants, with strictly professional methods. Several theoretical methods were used to construct a general framework together with the application of surveys to experts. The findings include three units of competence together with its components, essential knowledge and performance indicators; patterns of achievement were set in three levels: 1 empirical distinction of the phytodiversity; 2 characterization in the context of wise range use and 3 systematization of systematic botany contents involved in leading the educational process characterized by protagonist strategic actions in management.

  14. Quality Assurance Program Plan for the Waste Isolation Pilot Plant Experimental-Waste Characterization Program

    International Nuclear Information System (INIS)

    1991-01-01

    This Quality Assurance Program Plan (QAPP) identifies the quality of data necessary to meet the specific objectives associated with the Department of Energy (DOE) Waste Isolation Pilot Plant (WIPP) Experimental-Waste Characterization Program (the Program). DOE plans to conduct experiments in the WIPP during a Test Phase of approximately 5 years. These experiments will be conducted to reduce the uncertainties associated with the prediction of several processes (e.g., gas generation) that may influence repository performance. The results of the experiments will be used to assess the ability of the WIPP to meet regulatory requirements for the long-term protection of human health and the environment from the disposal of TRU wastes. 37 refs., 25 figs., 18 tabs

  15. Molecular cloning and characterization of drimenol synthase from valerian plant (Valeriana officinalis).

    Science.gov (United States)

    Kwon, Moonhyuk; Cochrane, Stephen A; Vederas, John C; Ro, Dae-Kyun

    2014-12-20

    Drimenol, a sesquiterpene alcohol, and its derivatives display diverse bio-activities in nature. However, a drimenol synthase gene has yet to be identified. We identified a new sesquiterpene synthase cDNA (VoTPS3) in valerian plant (Valeriana officinalis). Purification and NMR analyses of the VoTPS3-produced terpene, and characterization of the VoTPS3 enzyme confirmed that VoTPS3 synthesizes (-)-drimenol. In feeding assays, possible reaction intermediates, farnesol and drimenyl diphosphate, could not be converted to drimenol, suggesting that the intermediate remains tightly bound to VoTPS3 during catalysis. A mechanistic consideration of (-)-drimenol synthesis suggests that drimenol synthase is likely to use a protonation-initiated cyclization, which is rare for sesquiterpene synthases. VoTPS3 can be used to produce (-)-drimenol, from which useful drimane-type terpenes can be synthesized. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  16. Integral Parameters for Characterizing Water, Energy, and Aeration Properties of Soilless Plant Growth Media

    DEFF Research Database (Denmark)

    Deepagoda Thuduwe Kankanamge Kelum, Chamindu; Lopez, Jose Choc Chen; Møldrup, Per

    2013-01-01

    systems are regaining increased worldwide attention. The optimal control of water availability and aeration is an essential prerequisite to successfully operate plant growth systems with soilless substrates such as aggregated foamed glass, perlite, rockwool, coconut coir, or mixtures thereof. While......Over the last decade there has been a significant shift in global agricultural practice. Because the rapid increase of human population poses unprecedented challenges to production of an adequate and economically feasible food supply for undernourished populations, soilless greenhouse production...... was expanded to dual-porosity substrates and an analog integral oxygen diffusivity parameter was introduced to simultaneously characterize aeration properties of four common soilless greenhouse growth media. Integral parameters were derived for greenhouse crops in general, as well as for tomatoes. The integral...

  17. Characterization and constructive utilization of sludge produced in clari-flocculation unit of water treatment plant

    Science.gov (United States)

    Ahmad, Tarique; Ahmad, Kafeel; Alam, Mehtab

    2018-03-01

    All water treatment plants produce waste/residue amid the treatment of raw water. This study selectively investigates the clariflocculator sludge for its physicochemical characteristics and potential reuse options. Sieve analysis, XRF, SEM, XRD, FTIR, and TG-DTA instrumental techniques have been used to characterize the sludge sample. Results show that clariflocculator sludge contains about 78% fine sand having grain size range 150-75 μm. SiO2, Al2O3, Fe2O3 and CaO constitute the maximum percentage of chemical compounds present in the sludge and quartz is the main crystalline phase of the sludge. Recycling and reuse of this sludge, especially, as fine sand in preparing mortar, concrete mix and other civil engineering products would pave the way for constructive utilization with safe and sustainable sludge management strategies.

  18. Characterization of syngas produced from MSW gasification at commercial-scale ENERGOS Plants.

    Science.gov (United States)

    del Alamo, G; Hart, A; Grimshaw, A; Lundstrøm, P

    2012-10-01

    Characterization of the syngas produced in the gasification process has been performed at commercial-scale Energy-from-Waste plants under various conditions of lambda value and syngas temperature. The lambda value from the gasification process is here defined as the ratio of the gasification air to the total stoichiometric air for complete combustion of the fuel input. Evaluation of the syngas calorific value has been performed by three different methods, i.e., estimation of the syngas calorific value from continuous in-line process measurements by mass and energy conservation equations, measurement of the syngas composition based on gas chromatography and calculation of the Gross Calorific Value from the measured composition, and direct continuous measurement of the calorific value using based on gas calorimeter. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Mineralogical, Microstructural and Thermal Characterization of Coal Fly Ash Produced from Kazakhstani Power Plants

    Science.gov (United States)

    Tauanov, Z.; Abylgazina, L.; Spitas, C.; Itskos, G.; Inglezakis, V.

    2017-09-01

    Coal fly ash (CFA) is a waste by-product of coal combustion. Kazakhstan has vast coal deposits and is major consumer of coal and hence produces huge amounts of CFA annually. The government aims to recycle and effectively utilize this waste by-product. Thus, a detailed study of the physical and chemical properties of material is required as the data available in literature is either outdated or not applicable for recently produced CFA samples. The full mineralogical, microstructural and thermal characterization of three types of coal fly ash (CFA) produced in two large Kazakhstani power plants is reported in this work. The properties of CFAs were compared between samples as well as with published values.

  20. Risk Informed Safety Margin Characterization for Effective Long Term Nuclear Power Plant Safety Management

    International Nuclear Information System (INIS)

    Hess, Stephen M.

    2012-01-01

    A critical element to achieve safe long term NPP operation will be the development and application of a robust method to perform safety margin evaluations in a manner that is technically accurate and economically efficient. We present an approach that meets these objectives by describing the successful pilot application of the Risk-Informed Safety Margin Characterization (RISMC) approach. This effort demonstrated that the RISMC framework can be used to identify important contributors to plant safety margins and the outcomes can be used to develop strategies to enhance NPP safety. The research also demonstrated that this approach can be applied using a reasonable level of resources and within a timeframe that supports effective NPP decision-making.

  1. Isolation and Characterization of Bacteriophages Infecting Nocardioforms in Wastewater Treatment Plant

    Directory of Open Access Journals (Sweden)

    Krishna Khairnar

    2014-01-01

    Full Text Available Activated sludge plants (ASP are associated with the stable foaming problem worldwide. Apart from the physical and chemical treatment methods, biological treatment method has been least explored and may prove to be a novel and ecofriendly approach to tackle the problem of stable foam formation. In ASP Nocardia species are commonly found and are one of the major causes for forming sticky and stable foam. This study describes the isolation and characterization of three Nocardia bacteriophages NOC1, NOC2, and NOC3 for the control of Nocardia species. The bacteriophages isolated in this study have shown promising results in controlling foam producing bacterial growth under laboratory conditions, suggesting that it may prove useful in the field as an alternative biocontrol agent to reduce the foaming problem. To the best of our knowledge to date no work has been published from India related to biological approach for the control of foaming.

  2. Characterization and comparative analysis of promoters from three plant pararetroviruses associated with Dahlia (Dahlia variabilis).

    Science.gov (United States)

    Almeyda, C V; Raikhy, G; Pappu, H R

    2015-08-01

    Two distinct caulimoviruses, Dahlia mosaic virus (DMV) and Dahlia common mosaic virus (DCMV), and an endogenous plant pararetroviral sequence (DvEPRS, formerly known as DMV-D10) were reported from dahlia (Dahlia spp). Promoter elements from these dahlia-associated pararetroviruses were identified and characterized. The TATA box, the CAAT box, the transcription start site, the polyadenylation signal, and regulation factors, characteristic of caulimovirus promoters, were present in each of these promoter regions. Each of the promoter regions was separately cloned into a binary vector containing β-glucuronidase (GUS) reporter gene and delivered into Agrobacterium tumefaciens by electroporation followed by agroinfiltration into Nicotiana benthamiana. The activity of the 35S promoter homologs was determined by transient expression of the GUS gene both in qualitative and quantitative assays. The length of the promoter regions in DMV, DCMV, and DvEPRS corresponded to 438, 439, and 259 bp, respectively. Quantitative GUS assays showed that the promoters from DMV and DCMV resulted in higher levels of gene expression compared to that of DvEPRS in N. benthamiana leaf tissue. Significant differences were observed among the three promoters (p < 0.001). Qualitative GUS assays were consistent with quantitative GUS results. This study provides important information on new promoters for prospect applications as novel promoters for their potential use in foreign gene expression in plants.

  3. Characterization of nuclear decontamination solutions at the Idaho Chemical Processing Plant from 1982-1990

    Energy Technology Data Exchange (ETDEWEB)

    Zohner, S.K.

    1996-03-01

    This report represents possibly the single largest collection of operational decontamination data from a nuclear reprocessing facility at the Idaho National Engineering Laboratory and perhaps anywhere in the world. The uniqueness of this data is due to the Idaho Chemical Processing Plant`s (ICPP`s) ability to process different types of highly enriched nuclear fuel. The report covers an 8-year period, during which six campaigns were conducted to dissolve nuclear fuel clad in stainless steel, aluminum, graphite, and zirconium. Each fuel type had a separate head-end process with unique dissolution chemistry, but shared the same extraction process equipment. This report presents data about decontamination activities of the ICPP`s First Cycle extraction vessels, columns, piping, and aluminum dissolution vessels. Operating data from 1982 through 1990 has been collected, analyzed, and characterized. Chemicals used in the decontamination processes are documented along with quantities used. The chemical solutions are analyzed to compare effectiveness. Radioisotopic analysis is recorded, showing and quantifying what nuclides were removed by the various solutions. The original data is also provided to make it possible for researchers to address questions and test other hypotheses not discussed in this report.

  4. CHARACTERIZATION OF SOIL TRICHODERMA ISOLATES FOR POTENTIAL BIOCONTROL OF PLANT PATHOGENS

    Directory of Open Access Journals (Sweden)

    S. Matei

    2011-12-01

    Full Text Available Various fungal strains belonging to genus Trichoderma act as biological control agents for soil born plant pathogens. Two new strains of Trichoderma harzianum (T.h. and Trichoderma viride (T.v. were isolated from forest soils in Ilfov county and their morphological aspects, enzymatic and antagonistic activity were examined. Current chemical fungicides had constantly, in time, less influence on pathogens due to their diversity, adaptability and increasing resistance.The paper present the morphological characterization of two strains of Trichoderma isolated from forest soils. Growth rate was higher in strain T.v.SP456 (0,675mm/h than in strain T.h.P8 (0,505mm/h when fungi were grown on Czapek culture medium.Morphological description is completed with photographs of colonies in Petri plates and microscopical aspects of fungal structures belonging to Trichoderma strains SP456 and P8.Comparative aspects concerning the level of main enzymes released by T.h. isolate P8 and T.v.SP456 in liquid culture media showed differences as a function of genetic structure of each fungal isolate. The optimum culture media for inducing peroxidase, polyphenol-oxidase, β-1,3-glucanase activity in T.v.SP456 isolate was Czapek and PDA for phenil-alanin-ammonium-oxidase and chitinase. T.v.SP456 was more efficient than T.h.P8 concerning enzymes activity.The interaction between Trichoderma fungal strains SP456 and P8 and strawberry plant pathogen strains, three belonging to Botrytis cinerea (S1, P1, P2 and one to Phytophtora spp. were examined, also. Both Trichoderma strains act as mycoparasites for plant pathogens. The inhibition percent of radial growth was higher for T.v.SP456 when compared with T.h.P8 for almost all pathogenic isolates.

  5. Probabilistic environmental risk characterization of pharmaceuticals in sewage treatment plant discharges.

    Science.gov (United States)

    Christensen, Anne Munch; Markussen, Bo; Baun, Anders; Halling-Sørensen, Bent

    2009-10-01

    The occurrence of pharmaceuticals in different water bodies and the findings of effects on aquatic organisms in ecotoxicity tests have raised concerns about environmental risks of pharmaceuticals in receiving waters. Due to the fact that the amount of ecotoxicological studies has increased significantly during the last decade, probabilistic approaches for risk characterization of these compounds may be feasible. This approach was evaluated by applying it to 22 human-used pharmaceuticals covering both pharmaceuticals with a high volume and high ecotoxicity, using ecotoxicological effect data from laboratory studies and comparing these to monitoring data on the effluents from sewage treatment plants in Europe and pharmaceutical sales quantities. We found that for 19 of the 22 selected pharmaceuticals the existing data were sufficient for probabilistic risk characterizations. The subsequently modeled ratios between monitored concentrations and low-effect concentrations were mostly above a factor of 100. Compared to the current paradigm for EU environmental risk assessment where a safety factor of 10 or 100 might have been used it seems that for the modeled compounds there's a low environmental risk. However, similarly calculated ratios for five pharmaceuticals (propranolol, ibuprofen, furosemide, ofloxacin, and ciprofloxacin) were below 100, while ibuprofen and ciprofloxacin are considered to be of high concern due to lack of ecotoxicity studies. This paper shows that by applying probabilistic approaches, existing data can be used to execute a comprehensive study on probability of impacts, thereby contributing to a more comprehensive environmental risk assessment of pharmaceuticals.

  6. Characterizing the Influence of Plant Growth on Carbon Association with Fresh Soil Minerals

    Science.gov (United States)

    Neurath, R.; Jacoby, I. X.; Whitman, T.; Nico, P. S.; Pett-Ridge, J.; Weber, P. K.; Lipton, A.; Firestone, M. K.

    2016-12-01

    The zone of root influence (rhizosphere) is a dynamic soil environment with active carbon release, highly active and phylogentically distinct microbial communities, and unique edaphic properties (i.e. redox, pH). We hypothesize that mineral-SOM associations in the rhizosphere differ from those in bulk soil, possibly altering the persistance and fluxes of this carbon. We investigated how SOM first associates with soil minerals during growth of Avena barbata, a Mediterranean annual grass. We grew A. barbata with 99 atom% 13CO2 and tracked 13C-labeled photosynthate into soil where three minerals types were incubated: quartz, kaolinite, and ferrihydrite. Our work suggests these different mineral types recruit different amounts of mineral-associated carbon and microbial community composition (16S and ITS with Illumina MiSeq). Here, we have focused on the micron scale to characterize the composition and source of mineral-associated SOM. Using scanning transmission X-ray microscopy (STXM), we defined major classes of C compounds, and overlaid those data with characterization of Fe mineral speciation. In the same regions of interest, we used correlated nano-scale secondary ion mass-spectrometry (NanoSIMS) analyses to assess the isotopic enrichment of these C compounds. Based on the degree of 13C-labeling in each feature, we can determine whether the initial source of the OM was plant-derived, bulk soil, or mixed. For a more bulk-scale perspective, we also conducted sequential extractions of SOM associated with Fe and Al phases to look at the bonding chemistry of these compounds. We found that minerals in the rhizosphere had unique SOM compositions, notably, rhizosphere-incubated minerals were more enriched in aromatic compounds. The source of these aromatics is likely from the bulk soil and not from the plants, suggesting re-mobilization of SOM during plant growth. Our work also shows the importance of considering the microbial communities that associate with soil minerals

  7. Characterizing effects of hydropower plants on sub-daily flow regimes

    Science.gov (United States)

    Bejarano, María Dolores; Sordo-Ward, Álvaro; Alonso, Carlos; Nilsson, Christer

    2017-07-01

    A characterization of short-term changes in river flow is essential for understanding the ecological effects of hydropower plants, which operate by turning the turbines on or off to generate electricity following variations in the market demand (i.e., hydropeaking). The goal of our study was to develop an approach for characterizing the effects of hydropower plant operations on within-day flow regimes across multiple dams and rivers. For this aim we first defined ecologically meaningful metrics that provide a full representation of the flow regime at short time scales from free-flowing rivers and rivers exposed to hydropeaking. We then defined metrics that enable quantification of the deviation of the altered short-term flow regime variables from those of the unaltered state. The approach was successfully tested in two rivers in northern Sweden, one free-flowing and another regulated by cascades of hydropower plants, which were additionally classified based on their impact on short-term flows in sites of similar management. The largest differences between study sites corresponded to metrics describing sub-daily flow magnitudes such as amplitude (i.e., difference between the highest and the lowest hourly flows) and rates (i.e., rise and fall rates of hourly flows). They were closely followed by frequency-related metrics accounting for the numbers of within-day hourly flow patterns (i.e., rises, falls and periods of stability of hourly flows). In comparison, between-site differences for the duration-related metrics were smallest. In general, hydropeaking resulted in higher within-day flow amplitudes and rates and more but shorter periods of a similar hourly flow patterns per day. The impacted flow feature and the characteristics of the impact (i.e., intensity and whether the impact increases or decreases whatever is being described by the metric) varied with season. Our approach is useful for catchment management planning, defining environmental flow targets

  8. Intercultural competence

    OpenAIRE

    Barrett, MD

    2011-01-01

    Intercultural competence is the set of attitudes, skills, knowledge and behaviours which are required for appropriate and effective interaction and communication with people who are perceived to be from a different cultural background from oneself. The term ‘appropriate’ means that the interactions do not violate the cultural rules and norms which are valued by one’s interlocutors, while the term ‘effective’ means that one is able to achieve one’s objectives in the interactions. Intercultural...

  9. Characterization and quantification of uncertainty in solid oxide fuel cell hybrid power plants

    Science.gov (United States)

    Subramanyan, Karthik; Diwekar, Urmila M.

    Distributed power generation is one of the most powerful applications of fuel cell technology. Several types of configurations have been hypothesized and tested for these kinds of applications at the conceptual level, but hybrid power plants are one of the most efficient. These are designs that combine the fuel cell cycle with other thermodynamic cycles to provide higher efficiency. The power plant in focus is the high pressure (HP)-low pressure (LP) solid oxide fuel cells (SOFC)/steam turbine (ST)/gas turbine (GT) configuration which is a part of the vision-21 program, which is a new approach, the U.S. Department of Energy's (DOE's) Office of Fossil Energy has begun, for developing 21st century energy plants that would have virtually no environmental impact. The overall goal is to effectively eliminate—at competitive costs—environmental concerns associated with the use of fossil fuels, for producing electricity and transportation fuels. In this design, coal is gasified in an entrained bed gasifier and the syn-gas produced is cleaned in a transport bed desulfurizer and passed over to cascaded SOFC modules (at two pressure levels). This module is integrated with a reheat GT cycle. The heat of the exhaust from the GT cycle is used to convert water to steam, which is eventually used in a steam bottoming cycle. Since this hybrid technology is new and futuristic, the system level models used for predicting the fuel cells' performance and for other modules like the desulfurizer have significant uncertainties in them. Also, the performance curves of the SOFC would differ depending on the materials used for the anode, cathode and electrolyte. The accurate characterization and quantification of these uncertainties is crucial for the validity of the model predictions and hence is the main focus of this paper. This work performs a two-level uncertainty analysis of the fuel cell module: uncertainty associated with (1) model and (2) material used for anode, cathode and

  10. Quality characterization of celery (Apium graveolens L.) by plant zones and two harvest dates.

    Science.gov (United States)

    Guerra, Natalia; Carrozzi, Liliana; Goñi, María Gabriela; Roura, Sara; Yommi, Alejandra

    2010-08-01

    The aim of this study was to characterize the quality of celery petioles (Apium graveolens L. cv Golden Clause) from the external, middle, and internal zones of each plant. Harvest dates were 93 (HD1) and 124 (HD2) days after transplantation. Total weight (TW), total length (TL), total leaves number (LN), and petiole length of leaves (PL) for the 3 zones were measured. Physicochemical (color, b* and h; texture; total soluble solids, TSS; titratable acidity, TA; water content, WC), nutraceutical (ascorbic acid, AA; total quinones, TQ; browning potential, BP), and sensorial analysis (flavor, fibrosity, crunchiness) were done at harvest on petioles of each zone. No differences between harvesting dates were found in TW, TL, LN, and PL. Middle leaves had the highest PL. Harvest dates were not different in b*, h, TA, AA, and WC. Texture, TSS, BP, and TQ resulted higher in petioles of HD2 than in HD1. Similar TSS and TA were found in leaves of different plant zones. The yellow color of both external and internal zones was significantly higher than in the middle zone. The texture and BP was similar between the external and middle zones but the WC was lower in the external zone. Similarly, the AA content as well as the TQ was also lower than in the middle zone. Harvest delay improved the nutraceutical value in terms of BP and TQ, even though it also resulted in pithiness and fibrosity of the leaves. This study therefore suggests that the petioles of the middle zone when harvested at HD1 are the most suitable for consumption. Practical Application: Celery is a vegetable reduced in calories, has a high nutritional value and its fresh petioles are mainly consumed in salads. The texture and flavor are the most important attributes that define consumers' acceptability. As nutritional value, texture, and flavor may change with plant age and different zones of the plant, harvest date plays an important role on quality. Results indicate that harvest delay improved the nutraceutical

  11. Novel hypovirulence-associated RNA mycovirus in the plant pathogenic fungus botrytis cinerea: molecular and biological characterization

    Science.gov (United States)

    Botrytis cinerea is a pathogenic fungus causing gray mold disease on numerous economically important crops and ornamental plants. This study was conducted to characterize the biological and molecular features of a novel RNA mycovirus, Botrytis cinerea RNA virus 1 (BcRV1), in the hypovirulent strain ...

  12. Radioactive characterization of the terrestrial ecosystem in the area of location of the Juragua Nuclear Power Plant

    International Nuclear Information System (INIS)

    Sibello Hernandez, R.Y.; Alonso Hernandez, C.M.; Diaz Asencio, M.; Cartas Aguila, H. A.

    1999-01-01

    In this work the results are exposed obtained by the Laboratory of Environmental Surveillance in the radioactive characterization of the existent terrestrial ecosystem in the area of location of the Juragua Nuclear Power Plants in Cienfuegos, Cuba, starting from 1986 and up to 1993

  13. CHARACTERIZATION OF MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT, VOLUME I. REPORT AND APPENDICES A-E

    Science.gov (United States)

    The report gives results of a characterization of mercury (Hg) emissions at a chlor-alkali plant. Up to 160 short tons (146 Mg) of Hg is consumed by the chlor-alkali industry each year. Very little quantitative information is currently available however, on the actual Hg losses f...

  14. Isolation, structural characterization and bioactivities of naturally occurring polysaccharide-polyphenolic conjugates from medicinal plants-A reivew.

    Science.gov (United States)

    Liu, Jun; Bai, Ruyu; Liu, Yunpeng; Zhang, Xin; Kan, Juan; Jin, Changhai

    2018-02-01

    In recent years, several medicinal plants have been demonstrated as valuable resources of naturally occurring polysaccharide-polyphenolic conjugates. For the first time, this article introduces recent advances of polysaccharide-polyphenolic conjugates isolated from different medicinal plants. The isolation, purification, structural characterization and biological activities of polysaccharide-polyphenolic conjugates are introduced in details. In general, polysaccharide-polyphenolic conjugates can be isolated by hot water or alkaline extraction followed by purification through anion exchange chromatography or gel filtration chromatography. The structures of conjugates are usually characterized by chemical composition analysis, UV-vis, Fourier-transform infrared and nuclear magnetic resonance spectroscopy. Moreover, polysaccharide-polyphenolic conjugates exhibit several biological activities including anticoagulant, antioxidant, radioprotective, anti-platelet, antitussive and bronchodilatory effects. Therefore, polysaccharide-polyphenolic conjugates isolated from medicinal plants are certain to have a bright prospect in the field of food and pharmaceutics. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Functional, genetic and chemical characterization of biosurfactants produced by plant growth-promoting Pseudomonas putida 267.

    Science.gov (United States)

    Kruijt, Marco; Tran, Ha; Raaijmakers, Jos M

    2009-08-01

    Plant growth-promoting Pseudomonas putida strain 267, originally isolated from the rhizosphere of black pepper, produces biosurfactants that cause lysis of zoospores of the oomycete pathogen Phytophthora capsici. The biosurfactants were characterized, the biosynthesis gene(s) partially identified, and their role in control of Phytophthora damping-off of cucumber evaluated. The biosurfactants were shown to lyse zoospores of Phy. capsici and inhibit growth of the fungal pathogens Botrytis cinerea and Rhizoctonia solani. In vitro assays further showed that the biosurfactants of strain 267 are essential in swarming motility and biofilm formation. In spite of the zoosporicidal activity, the biosurfactants did not play a significant role in control of Phytophthora damping-off of cucumber, since both wild type strain 267 and its biosurfactant-deficient mutant were equally effective, and addition of the biosurfactants did not provide control. Genetic characterization revealed that surfactant biosynthesis in strain 267 is governed by homologues of PsoA and PsoB, two nonribosomal peptide synthetases involved in production of the cyclic lipopeptides (CLPs) putisolvin I and II. The structural relatedness of the biosurfactants of strain 267 to putisolvins I and II was supported by LC-MS and MS-MS analyses. The biosurfactants produced by Ps. putida 267 were identified as putisolvin-like CLPs; they are essential in swarming motility and biofilm formation, and have zoosporicidal and antifungal activities. Strain 267 provides excellent biocontrol activity against Phytophthora damping-off of cucumber, but the lipopeptide surfactants are not involved in disease suppression. Pseudomonas putida 267 suppresses Phy. capsici damping-off of cucumber and provides a potential supplementary strategy to control this economically important oomycete pathogen. The putisolvin-like biosurfactants exhibit zoosporicidal and antifungal activities, yet they do not contribute to biocontrol of Phy

  16. The production and characterization of a new active lipase from Acremonium alcalophilum using a plant bioreactor.

    Science.gov (United States)

    Pereira, Eridan Orlando; Tsang, Adrian; McAllister, Tim A; Menassa, Rima

    2013-01-01

    Microorganisms are the most proficient decomposers in nature, using secreted enzymes in the hydrolysis of lignocellulose. As such, they present the most abundant source for discovery of new enzymes. Acremonium alcalophilum is the only known cellulolytic fungus that thrives in alkaline conditions and can be cultured readily in the laboratory. Its optimal conditions for growth are 30°C and pH 9.0-9.2. The genome sequence of Acremonium alcalophilum has revealed a large number of genes encoding biomass-degrading enzymes. Among these enzymes, lipases are interesting because of several industrial applications including biofuels, detergent, food processing and textile industries. We identified a lipA gene in the genome sequence of Acremonium alcalophilum, encoding a protein with a predicted lipase domain with weak sequence identity to characterized enzymes. Unusually, the predicted lipase displays ≈ 30% amino acid sequence identity to both feruloyl esterase and lipase of Aspergillus niger. LipA, when transiently produced in Nicotiana benthamiana, accumulated to over 9% of total soluble protein. Plant-produced recombinant LipA is active towards p-nitrophenol esters of various carbon chain lengths with peak activity on medium-chain fatty acid (C8). The enzyme is also highly active on xylose tetra-acetate and oat spelt xylan. These results suggests that LipA is a novel lipolytic enzyme that possesses both lipase and acetylxylan esterase activity. We determined that LipA is a glycoprotein with pH and temperature optima at 8.0 and 40°C, respectively. Besides being the first heterologous expression and characterization of a gene coding for a lipase from A. alcalophilum, this report shows that LipA is very versatile exhibiting both acetylxylan esterase and lipase activities potentially useful for diverse industry sectors, and that tobacco is a suitable bioreactor for producing fungal proteins.

  17. Herbal Plant Synthesis of Antibacterial Silver Nanoparticles by Solanum trilobatum and Its Characterization

    Directory of Open Access Journals (Sweden)

    M. Vanaja

    2014-01-01

    Full Text Available Green synthesis method of nanomaterials is rapidly growing in the nanotechnology field; it replaces the use of toxic chemicals and time consumption. In this present investigation we report the green synthesis of silver nanoparticles (AgNPs by using the leaf extract of medicinally valuable plant Solanum trilobatum. The influence of physical and chemical parameters on the silver nanoparticle fabrication such as incubation time, silver nitrate concentration, pH, and temperature is also studied in this present context. The green synthesized silver nanoparticles were characterized by UV-vis spectroscopy, X-ray diffraction (XRD, scanning electron microscope (SEM, energy dispersive X-ray (EDX, and transmission electron microscope (TEM. The SEM and TEM confirm the synthesis of spherical shape of nanocrystalline particles with the size range of 2–10 nm. FTIR reveals that the carboxyl and amine groups may be involved in the reduction of silver ions to silver nanoparticles. Antibacterial activity of synthesized silver nanoparticles was done by agar well diffusion method against different pathogenic bacteria. The green synthesized silver nanoparticles can be used in the field of medicine, due to their high antibacterial activity.

  18. Characterization of suspended bacteria from processing units in an advanced drinking water treatment plant of China.

    Science.gov (United States)

    Wang, Feng; Li, Weiying; Zhang, Junpeng; Qi, Wanqi; Zhou, Yanyan; Xiang, Yuan; Shi, Nuo

    2017-05-01

    For the drinking water treatment plant (DWTP), the organic pollutant removal was the primary focus, while the suspended bacterial was always neglected. In this study, the suspended bacteria from each processing unit in a DWTP employing an ozone-biological activated carbon process was mainly characterized by using heterotrophic plate counts (HPCs), a flow cytometer, and 454-pyrosequencing methods. The results showed that an adverse changing tendency of HPC and total cell counts was observed in the sand filtration tank (SFT), where the cultivability of suspended bacteria increased to 34%. However, the cultivability level of other units stayed below 3% except for ozone contact tank (OCT, 13.5%) and activated carbon filtration tank (ACFT, 34.39%). It meant that filtration processes promoted the increase in cultivability of suspended bacteria remarkably, which indicated biodegrading capability. In the unit of OCT, microbial diversity indexes declined drastically, and the dominant bacteria were affiliated to Proteobacteria phylum (99.9%) and Betaproteobacteria class (86.3%), which were also the dominant bacteria in the effluent of other units. Besides, the primary genus was Limnohabitans in the effluents of SFT (17.4%) as well as ACFT (25.6%), which was inferred to be the crucial contributors for the biodegradable function in the filtration units. Overall, this paper provided an overview of community composition of each processing units in a DWTP as well as reference for better developing microbial function for drinking water treatment in the future.

  19. Physical, chemical and mineralogical characterization of water treatment plant waste for use in soil-cement brick

    International Nuclear Information System (INIS)

    Pessin, L.R.; Destefani, A.Z.; Holanda, J.N.F.

    2011-01-01

    The water treatment plants (WTP) for human consumption generate huge amounts of waste in the form of sludge (sludge) that have been over the years mostly inadequately prepared in water resources and the environment. Moreover, traditional methods of disposal of waste water treatment plants commonly used are generally costly activities. An alternative method for disposal of this waste abundant is its incorporation in ceramic products. This work is focused on the physical-chemical and mineralogical composition of a sample of waste water treatment plants from the region of Campos dos Goytacazes-RJ to their use in the manufacture of soil-cement brick. Several characterization techniques were used including X-ray diffraction, X-ray fluorescence, scanning electron microscopy, picnometry, particle size analysis and plasticity. The experimental results indicate that the waste water treatment plants have the potential to be used in the manufacture of ecologic soil-cement bricks. (author)

  20. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    NARCIS (Netherlands)

    Jansen, J.J.; Van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.

    2009-01-01

    Background Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their

  1. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    NARCIS (Netherlands)

    Jansen, J.J.; van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.

    2009-01-01

    Background: Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their

  2. Isolation, characterization, and expression analyses of plant elicitor peptides (Pep) genes in maize

    Science.gov (United States)

    Insect-induced defenses occur in nearly all plants and are regulated by conserved signaling pathways. In plant families, peptides with analogous activity have remained elusive. Peps are conserved signals across diverse plant families regulating antiherbivore defenses and are likely to be the missing...

  3. Characterization of solid airborne particles deposited in snow in the vicinity of urban fossil fuel thermal power plant (Western Siberia).

    Science.gov (United States)

    Talovskaya, A V; Yazikov, E G; Filimonenko, E A; Lata, J-C; Kim, J; Shakhova, T S

    2017-07-20

    Recognition and detailed characterization of solid particles emitted from thermal power plants into the environment is highly important due to their potential detrimental effects on human health. Snow cover is used for the identification of anthropogenic emissions in the environment. However, little is known about types, physical and chemical properties of solid airborne particles (SAP) deposited in snow around thermal power plants. The purpose of this study is to quantify and characterize in detail the traceable SAP deposited in snow near fossil fuel thermal power plant in order to identify its emissions into the environment. Applying the scanning electron microscopy-energy dispersive spectroscopy, and X-ray diffraction, mineral and anthropogenic phase groups in SAP deposited in snow near the plant and in fly ash were observed. We identified quartz, albite and mullite as most abundant mineral phases and carbonaceous matter, slag and spherical particles as dominate anthropogenic phases. This is the first study reporting that zircon and anthropogenic sulphide-bearing, metal oxide-bearing, intermetallic compound-bearing and rare-earth element-bearing particles were detected in snow deposits near thermal power plant. The identified mineral and anthropogenic phases can be used as tracers for fossil fuel combustion emissions, especially with regard to their possible effect on human health.

  4. Characterization of the NADP-malic enzymes in the woody plant Populus trichocarpa.

    Science.gov (United States)

    Yu, Qiguo; Liu, Jinwen; Wang, Zhifeng; Nai, Jiefei; Lü, Mengyan; Zhou, Xiying; Cheng, Yuxiang

    2013-02-01

    Plant NADP-malic enzyme (NADP-ME, EC 1.1.1.40) participates in a large number of metabolic pathways, but little is known about the NADP-ME family in woody plants or trees. Here, we characterized the tree Populus trichocarpa NADP-ME (PtNADP-ME) family and the properties of the family members. Five NADP-ME genes (PtNADP-ME1-PtNADP-ME5) were found in the genome of Populus. Semi-quantitative RT-PCR analysis show that the transcription levels of PtNADP-ME1 in lignified stems and roots are clearly higher than in other tissues, and PtNADP-ME2, PtNADP-ME3, PtNADP-ME4 and PtNADP-ME5 are broadly expressed in various tissues. PtNADP-ME gene expression was found to respond to salt and osmotic stresses, and NaCl salts upregulated the transcripts of putative plastidic ones (PtNADP-ME4 and PtNADP-ME5) significantly. Further, the NADP-ME activities of Populus seedlings increased at least two-fold under NaCl, mannitol and PEG treatments. Also, the expression of PtNADP-ME2 and PtNADP-ME3 increased during the course of leaf wounding. Each recombinant PtNADP-ME proteins were expressed and purified from Escherichia coli, respectively. Coomassie brilliant blue and NADP-ME activity staining on native polyacrylamide gels showed different oligomeric states of the recombinant PtNADP-MEs in vitro. Noticeably, the cytosolic PtNADP-ME2 aggregates as octamers and hexadecamers while the plastidic PtNADP-ME4 resembles hexamers and octamers. The four PtNADP-ME proteins except for PtNADP-ME1 have high activities on native polyacrylamide gels including different forms for PtNADP-ME2 (octamers and hexadecamers) or for PtNADP-ME4 (hexamers and octamers). High concentrations of NADP substrate decreased the activities of all PtNADP-MEs slightly, while the malate had no effect on them. The kinetic parameters (V (max), K (m), K (cat), and K (cat)/K (m)) of each isoforms were summarized. Our data show the different effects of metabolites (influx into tricarboxylic acid cycle or Calvin cycle) on the

  5. Characterizing the effects of brassinosteroids on root development in monocot plant species

    DEFF Research Database (Denmark)

    de Bang, Louise

    The plant hormone brassinosteroid (BR) is known to affect a wide range of biological aspects, here among promotion of plant growth. Since the discovery of this class of plant steroids in the 1970s, BR has been a target when breeding for increased biomass production in plants. In this PhD study two......, because it is found to be very important, not only for plant establishment, but also for plant fitness and performance in different environments........ With TILLING, two mutants of selected BR-related genes were identified in a Brachypodium distachyon mutant population. However, compared to the wild type, the mutants did not produce more biomass. The work with BR effects on plant root growth stimulated an interest for roots and root development, which...

  6. Comparative genotyping of Clostridium thermocellum strains isolated from biogas plants: genetic markers and characterization of cellulolytic potential.

    Science.gov (United States)

    Koeck, Daniela E; Zverlov, Vladimir V; Liebl, Wolfgang; Schwarz, Wolfgang H

    2014-07-01

    Clostridium thermocellum is among the most prevalent of known anaerobic cellulolytic bacteria. In this study, genetic and phenotypic variations among C. thermocellum strains isolated from different biogas plants were determined and different genotyping methods were evaluated on these isolates. At least two C. thermocellum strains were isolated independently from each of nine different biogas plants via enrichment on cellulose. Various DNA-based genotyping methods such as ribotyping, RAPD (Random Amplified Polymorphic DNA) and VNTR (Variable Number of Tandem Repeats) were applied to these isolates. One novel approach - the amplification of unknown target sequences between copies of a previously discovered Random Inserted Mobile Element (RIME) - was also tested. The genotyping method with the highest discriminatory power was found to be the amplification of the sequences between the insertion elements, where isolates from each biogas plant yielded a different band pattern. Cellulolytic potentials, optimal growth conditions and substrate spectra of all isolates were characterized to help identify phenotypic variations. Irrespective of the genotyping method used, the isolates from each individual biogas plant always exhibited identical patterns. This is suggestive of a single C. thermocellum strain exhibiting dominance in each biogas plant. The genotypic groups reflect the results of the physiological characterization of the isolates like substrate diversity and cellulase activity. Conversely, strains isolated across a range of biogas plants differed in their genotyping results and physiological properties. Both strains isolated from one biogas plant had the best specific cellulose-degrading properties and might therefore achieve superior substrate utilization yields in biogas fermenters. Copyright © 2014 Elsevier GmbH. All rights reserved.

  7. Sampling and characterization of spent exchange resins of Atucha I nuclear power plant

    International Nuclear Information System (INIS)

    Varani, Jose L.; Cernadas, D.; Iglesias, Alberto M.; Raffo Calderon, Maria del C.

    2004-01-01

    The present storage facilities for spent resins in Atucha I NPP would be full within the next 5 years, accordingly some tasks are being planned to conditioning these waste and so generate enough storage capacity for the remaining life of the plant. Among this tasks is the characterization of spent resins that has several objectives: to know their chemical and radiochemical composition; the homogeneity of these parameters in the total volume of spent resins; the existence or not of compact zones; the proportion of 'crud'; the breakage degree of the micro-spheres; etc. The first step was to analyse the criterion to follow for sampling resins in the storage deposit of 40 m 3 . In order to take some samples from different points, a special device was required. It had to be introduced closed in the resin bed, opened to take the sample and then closed again to return to the surface. A device used in cereal industry for sampling silos to different depths was modified in its internal capacity for reducing operator dose and increasing the length of rod in order to reaching the bottom of the pit. The device was tested in cold mock up before to taking actual samples. Active resins samples, five in total up to now, were taken from deposit to different depths and kept in lead containers. After analysing the samples, the following average results were extracted: 1.7 x 10 5 Bq/g of Co-60, 9.7 x 10 5 Bq/g of Cs-137 and 774 Bq/g of total alpha, which corresponds to intermediate activity waste. The differences between the values of activity of the different samples are of up to 310 % for Co-60 and of up to 788 % for the Cs-137 what indicates a great inhomogeneity. The direct observation of resin grains, placed in a transparent glass burette, did not demonstrate an important proportion of broken or divided resins. (author)

  8. Characterization of bacterial community dynamics in a full-scale drinking water treatment plant.

    Science.gov (United States)

    Li, Cuiping; Ling, Fangqiong; Zhang, Minglu; Liu, Wen-Tso; Li, Yuxian; Liu, Wenjun

    2017-01-01

    Understanding the spatial and temporal dynamics of microbial communities in drinking water systems is vital to securing the microbial safety of drinking water. The objective of this study was to comprehensively characterize the dynamics of microbial biomass and bacterial communities at each step of a full-scale drinking water treatment plant in Beijing, China. Both bulk water and biofilm samples on granular activated carbon (GAC) were collected over 9months. The proportion of cultivable cells decreased during the treatment processes, and this proportion was higher in warm season than cool season, suggesting that treatment processes and water temperature probably had considerable impact on the R2A cultivability of total bacteria. 16s rRNA gene based 454 pyrosequencing analysis of the bacterial community revealed that Proteobacteria predominated in all samples. The GAC biofilm harbored a distinct population with a much higher relative abundance of Acidobacteria than water samples. Principle coordinate analysis and one-way analysis of similarity indicated that the dynamics of the microbial communities in bulk water and biofilm samples were better explained by the treatment processes rather than by sampling time, and distinctive changes of the microbial communities in water occurred after GAC filtration. Furthermore, 20 distinct OTUs contributing most to the dissimilarity among samples of different sampling locations and 6 persistent OTUs present in the entire treatment process flow were identified. Overall, our findings demonstrate the significant effects that treatment processes have on the microbial biomass and community fluctuation and provide implications for further targeted investigation on particular bacteria populations. Copyright © 2016. Published by Elsevier B.V.

  9. Characterization of a plant leaf cuticle model wax, phase behaviour of model wax–water systems

    International Nuclear Information System (INIS)

    Fagerström, Anton; Kocherbitov, Vitaly; Westbye, Peter; Bergström, Karin; Mamontova, Varvara; Engblom, Johan

    2013-01-01

    Highlights: • Four individual crystalline phases were discovered in the model wax–water system. • Eutectic melting occurred in both dry and hydrated model wax. • The total transition enthalpy is smaller for the cuticle wax than for the model wax. • Water has a large plasticizing effect on cuticle wax. • The thermotropic transitions of model wax fit in the window of extracted leaf waxes. - Abstract: We investigated the thermotropic phase behaviour of plant leaf intracuticular wax and two representatives of its main components, 1-docosanol (C 22 H 45 OH) and dotriacontane (C 32 H 66 ), in dry and hydrated state. One objective was to obtain a model wax, which can be used to estimate formulations effects on cuticle diffusivity in vitro. The two wax components were chosen based on results from Gas Chromatography coupled to Mass Spectrometry analysis of cuticular wax. The wax was extracted from Clivia Miniata Regel leaves and contained 68% primary alcohols (C 16 –C 32 ) and 16% n-alkanes (C 21 –C 33 ). Differential Scanning Calorimetry, Polarized Light Microscopy and Small- and Wide Angle X-ray Diffraction were used to characterize the cuticular extract and the phase behaviour of the C 22 H 45 OH/C 32 H 66 /H 2 O model system. Four individual crystalline phases were discovered in the model wax–water system and eutectic melting occurred in both dry and hydrated state. The thermotropic transitions of the model wax occur within the broader transition region of the extracted leaf wax

  10. Nanometrology of Biomass for Bioenergy: The Role of Atomic Force Microscopy and Spectroscopy in Plant Cell Characterization

    Directory of Open Access Journals (Sweden)

    Anne M. Charrier

    2018-03-01

    Full Text Available Ethanol production using extracted cellulose from plant cell walls (PCW is a very promising approach to biofuel production. However, efficient throughput has been hindered by the phenomenon of recalcitrance, leading to high costs for the lignocellulosic conversion. To overcome recalcitrance, it is necessary to understand the chemical and structural properties of the plant biological materials, which have evolved to generate the strong and cohesive features observed in plants. Therefore, tools and methods that allow the investigation of how the different molecular components of PCW are organized and distributed and how this impacts the mechanical properties of the plants are needed but challenging due to the molecular and morphological complexity of PCW. Atomic force microscopy (AFM, capitalizing on the interfacial nanomechanical forces, encompasses a suite of measurement modalities for nondestructive material characterization. Here, we present a review focused on the utilization of AFM for imaging and determination of physical properties of plant-based specimens. The presented review encompasses the AFM derived techniques for topography imaging (AM-AFM, mechanical properties (QFM, and surface/subsurface (MSAFM, HPFM chemical composition imaging. In particular, the motivation and utility of force microscopy of plant cell walls from the early fundamental investigations to achieve a better understanding of the cell wall architecture, to the recent studies for the sake of advancing the biofuel research are discussed. An example of delignification protocol is described and the changes in morphology, chemical composition and mechanical properties and their correlation at the nanometer scale along the process are illustrated.

  11. Molecular characterization of pathogenic Fusarium species in cucurbit plants from Kermanshah province, Iran

    OpenAIRE

    Chehri, K.; Salleh, B.; Yli-Mattila, T.; Reddy, K.R.N.; Abbasi, S.

    2011-01-01

    Fusarium is one of the important phytopathogenic genera of microfungi causing serious losses on cucurbit plants in Kermanshah province, the largest area of cucurbits plantation in Iran. Therefore, the objectives in this study were to isolate and identify disease-causing Fusarium spp. from infected cucurbit plants, to ascertain their pathogenicity, and to determine their phylogenetic relationships. A total of 100 Fusarium isolates were obtained from diseased cucurbit plants collected from fiel...

  12. Characterization of the plant growth promoting bacterium, Enterobacter cloacae MSR1, isolated from roots of non-nodulating Medicago sativa.

    Science.gov (United States)

    Khalifa, Ashraf Y Z; Alsyeeh, Abdel-Moneium; Almalki, Mohammed A; Saleh, Farag A

    2016-01-01

    The aim of the present study was to characterize the endophytic bacterial strain designated MSR1 that was isolated from inside the non-nodulating roots of Medicago sativa after surface-sterilization. MSR1 was identified as Enterobacter cloacae using both 16S rDNA gene sequence analysis and API20E biochemical identification system (Biomerieux, France). Furthermore, this bacterium was characterized using API50CH kit (Biomerieux, France) and tested for antibacterial activities against some food borne pathogens. The results showed that E. cloacae consumed certain carbohydrates such as glycerol, d-xylose, d-maltose and esculin melibiose as a sole carbon source and certain amino acids such as arginine, tryptophan ornithine as nitrogen source. Furthermore, MSR1 possessed multiple plant-growth promoting characteristics; phosphate solubility, production of phytohormones acetoin and bioactive compounds. Inoculation of Pisum sativum with MSR1 significantly improved the growth parameters (the length and dry weight) of this economically important grain legume compared to the non-treated plants. To our knowledge, this is the first report addressing E. cloacae which exist in roots of alfalfa growing in Al-Ahsaa region. The results confirmed that E. cloacae exhibited traits for plant growth promoting and could be developed as an eco-friendly biofertilizer for P. sativum and probably for other important plant species in future.

  13. Characterization and evolution of microRNA genes derived from repetitive elements and duplication events in plants.

    Directory of Open Access Journals (Sweden)

    Jie Sun

    Full Text Available MicroRNAs (miRNAs are a major class of small non-coding RNAs that act as negative regulators at the post-transcriptional level in animals and plants. In this study, all known miRNAs in four plant species (Arabidopsis thaliana, Populus trichocarpa, Oryza sativa and Sorghum bicolor have been analyzed, using a combination of computational and comparative genomic approaches, to systematically identify and characterize the miRNAs that were derived from repetitive elements and duplication events. The study provides a complete mapping, at the genome scale, of all the miRNAs found on repetitive elements in the four test plant species. Significant differences between repetitive element-related miRNAs and non-repeat-derived miRNAs were observed for many characteristics, including their location in protein-coding and intergenic regions in genomes, their conservation in plant species, sequence length of their hairpin precursors, base composition of their hairpin precursors and the minimum free energy of their hairpin structures. Further analysis showed that a considerable number of miRNA families in the four test plant species arose from either tandem duplication events, segmental duplication events or a combination of the two. However, comparative analysis suggested that the contribution made by these two duplication events differed greatly between the perennial tree species tested and the other three annual species. The expansion of miRNA families in A. thaliana, O. sativa and S. bicolor are more likely to occur as a result of tandem duplication events than from segmental duplications. In contrast, genomic segmental duplications contributed significantly more to the expansion of miRNA families in P. trichocarpa than did tandem duplication events. Taken together, this study has successfully characterized miRNAs derived from repetitive elements and duplication events at the genome scale and provides comprehensive knowledge and deeper insight into the

  14. Race-Specific Adult-Plant Resistance in Winter Wheat to Stripe Rust and Characterization of Pathogen Virulence Patterns.

    Science.gov (United States)

    Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten

    2015-08-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.

  15. Hillslope characterization: Identifying key controls on local-scale plant communities' distribution using remote sensing and subsurface data fusion.

    Science.gov (United States)

    Falco, N.; Wainwright, H. M.; Dafflon, B.; Leger, E.; Peterson, J.; Steltzer, H.; Wilmer, C.; Williams, K. H.; Hubbard, S. S.

    2017-12-01

    Mountainous watershed systems are characterized by extreme heterogeneity in hydrological and pedological properties that influence biotic activities, plant communities and their dynamics. To gain predictive understanding of how ecosystem and watershed system evolve under climate change, it is critical to capture such heterogeneity and to quantify the effect of key environmental variables such as topography, and soil properties. In this study, we exploit advanced geophysical and remote sensing techniques - coupled with machine learning - to better characterize and quantify the interactions between plant communities' distribution and subsurface properties. First, we have developed a remote sensing data fusion framework based on the random forest (RF) classification algorithm to estimate the spatial distribution of plant communities. The framework allows the integration of both plant spectral and structural information, which are derived from multispectral satellite images and airborne LiDAR data. We then use the RF method to evaluate the estimated plant community map, exploiting the subsurface properties (such as bedrock depth, soil moisture and other properties) and geomorphological parameters (such as slope, curvature) as predictors. Datasets include high-resolution geophysical data (electrical resistivity tomography) and LiDAR digital elevation maps. We demonstrate our approach on a mountain hillslope and meadow within the East River watershed in Colorado, which is considered to be a representative headwater catchment in the Upper Colorado Basin. The obtained results show the existence of co-evolution between above and below-ground processes; in particular, dominant shrub communities in wet and flat areas. We show that successful integration of remote sensing data with geophysical measurements allows identifying and quantifying the key environmental controls on plant communities' distribution, and provides insights into their potential changes in the future

  16. Development & Characterization of a Whole Plant Chamber for the Investigation of Environmental Perturbations on Biogenic VOC Emissions

    Science.gov (United States)

    Holder, J.; Riches, M.; Abeleira, A.; Farmer, D.

    2017-12-01

    Accurate prediction of both climate and air quality under a changing earth system requires a full understanding of the sources, feedbacks, and ultimate fate of all atmospherically relevant chemical species, including volatile organic compounds (VOCs). Biogenic VOCs (BVOC) from plant emissions are the main source of VOCs to the atmosphere. However, the impact of global change on BVOC emissions is poorly understood. For example, while short-term increases in temperature are typically associated with increased BVOC emissions, the impact of long-term temperature increases are less clear. Our study aims to investigate the effects of long-term, singular and combined environmental perturbations on plant BVOC emissions through the use of whole plant chambers in order to better understand the effects of global change on BVOC-climate-air quality feedbacks. To fill this knowledge gap and provide a fundamental understanding of how BVOC emissions respond to environmental perturbations, specifically elevated temperature, CO2, and drought, whole citrus trees were placed in home-built chambers and monitored for monoterpene and other BVOC emissions utilizing thermal desorption gas chromatography mass spectrometry (TD-GC-MS). Designing and building a robust whole plant chamber to study atmospherically relevant chemical species while accommodating the needs of live plants over timescales of days to weeks is not a trivial task. The environmental conditions within the chamber must be carefully controlled and monitored. The inter-plant and chamber variability must be characterized. Finally, target BVOCs need to be sampled and detected from the chamber. Thus, the chamber design, control and characterization considerations along with preliminary BVOC results will be presented and discussed.

  17. Characterization and Modeling of Atmospheric Flow Within and Above Plant Canopies

    Science.gov (United States)

    Souza Freire Grion, Livia

    The turbulent flow within and above plant canopies is responsible for the exchange of momentum, heat, gases and particles between vegetation and the atmosphere. Turbulence is also responsible for the mixing of air inside the canopy, playing an important role in chemical and biophysical processes occurring in the plants' environment. In the last fifty years, research has significantly advanced the understanding of and ability to model the flow field within and above the canopy, but important issues remain unsolved. In this work, we focus on (i) the estimation of turbulent mixing timescales within the canopy from field data; and (ii) the development of new computationally efficient modeling approaches for the coupled canopy-atmosphere flow field. The turbulent mixing timescale represents how quickly turbulence creates a well-mixed environment within the canopy. When the mixing timescale is much smaller than the timescale of other relevant processes (e.g. chemical reactions, deposition), the system can be assumed to be well-mixed and detailed modeling of turbulence is not critical to predict the system evolution. Conversely, if the mixing timescale is comparable or larger than the other timescales, turbulence becomes a controlling factor for the concentration of the variables involved; hence, turbulence needs to be taken into account when studying and modeling such processes. In this work, we used a combination of ozone concentration and high-frequency velocity data measured within and above the canopy in the Amazon rainforest to characterize turbulent mixing. The eddy diffusivity parameter (used as a proxy for mixing efficiency) was applied in a simple theoretical model of one-dimensional diffusion, providing an estimate of turbulent mixing timescales as a function of height within the canopy and time-of-day. Results showed that, during the day, the Amazon rainforest is characterized by well-mixed conditions with mixing timescales smaller than thirty minutes in the

  18. Exserohilum rostratum: characterization of a cross-kingdom pathogen of plants and humans.

    Directory of Open Access Journals (Sweden)

    Kalpana Sharma

    Full Text Available Pathogen host shifts represent a major source of new infectious diseases. There are several examples of cross-genus host jumps that have caused catastrophic epidemics in animal and plant species worldwide. Cross-kingdom jumps are rare, and are often associated with nosocomial infections. Here we provide an example of human-mediated cross-kingdom jumping of Exserohilum rostratum isolated from a patient who had received a corticosteroid injection and died of fungal meningitis in a Florida hospital in 2012. The clinical isolate of E. rostratum was compared with two plant pathogenic isolates of E. rostratum and an isolate of the closely related genus Bipolaris in terms of morphology, phylogeny, and pathogenicity on one C3 grass, Gulf annual rye grass (Lolium multiflorum, and two C4 grasses, Japanese stilt grass (Microstegium vimineum and bahia grass (Paspalum notatum. Colony growth and color, as well as conidia shape and size were the same for the clinical and plant isolates of E. rostratum, while these characteristics differed slightly for the Bipolaris sp. isolate. The plant pathogenic and clinical isolates of E. rostratum were indistinguishable based on morphology and ITS and 28S rDNA sequence analysis. The clinical isolate was as pathogenic to all grass species tested as the plant pathogenic strains that were originally isolated from plant hosts. The clinical isolate induced more severe symptoms on stilt grass than on rye grass, while this was the reverse for the plant isolates of E. rostratum. The phylogenetic similarity between the clinical and plant-associated E. rostratum isolates and the ability of the clinical isolate to infect plants suggests that a plant pathogenic strain of E. rostratum contaminated the corticosteroid injection fluid and was able to cause systemic disease in the affected patient. This is the first proof that a clinical isolate of E. rostratum is also an effective plant pathogen.

  19. AtNEA1-identification and characterization of a novel plant nuclear ...

    African Journals Online (AJOL)

    In animal and yeast cells, a cross nuclear envelope structure linker of nucleoskeleton and cytoskeleton (LINC) is formed by outer nuclear membrane SUN proteins and inner nuclear membrane KASH proteins. However, little information was acquired about plant SUN-KASH structure until they were found in plant SUN ...

  20. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  1. Characterizing pathways of invasion using Sternorryhncha on imported plant material in cargo

    Science.gov (United States)

    Timothy T. Work

    2011-01-01

    Non-indigenous Homoptera, mainly scales, aphids, and mealy bugs, intercepted on plants destined for cultivation represent an elevated risk for the establishment of invasive insects in North America. These insects [grouped as the suborder Sternorrhyncha] are often parthenogenic and are imported on viable host plants.

  2. Characterization of deposits and their influence on corrosion in waste incineration plants in Denmark

    DEFF Research Database (Denmark)

    Montgomery, Melanie; Larsen, OH

    2001-01-01

    A program has been initiated in Denmark to investigate the aggressive environment in various waste incineration plants. The results described are the preliminary results from one waste incineration plant. Deposits and corrosion products have been removed from various locations in the boiler...

  3. Establishing competence

    International Nuclear Information System (INIS)

    Ugedo, E.

    1986-01-01

    As suggested by the organizers, this lecture is based on actual practice in Spain. Description of the Spanish electricity generating system: The nuclear contribution. Codes and regulations applicable to training and qualification of nuclear power plant operating personnel. The licensing process. Description of SRO and RO training courses for initial qualification; differences between power stations in operation and under construction. The role of the academic institutions. The role of the training center. The role of the utility-owner. The training program efficiency verification: On-the-job performance feedback. Incorporating third parties experiences. Periodic requalification of the licensed personnel: Frequency, topics, schedule. Training programs for other NPP positions. (orig./GL)

  4. Characterization of Salmonella enterica isolates from turkeys in commercial processing plants for resistance to antibiotics, disinfectants, and a growth promoter.

    Science.gov (United States)

    Beier, Ross C; Anderson, Phelue N; Hume, Michael E; Poole, Toni L; Duke, Sara E; Crippen, Tawni L; Sheffield, Cynthia L; Caldwell, David J; Byrd, James A; Anderson, Robin C; Nisbet, David J

    2011-05-01

    Salmonella enterica isolates from turkeys in two commercial processing plants (1 and 2) were characterized for susceptibility to antibiotics, disinfectants, and the organoarsenical growth promoter, 4-hydroxy-3-nitrophenylarsonic acid (3-NHPAA, roxarsone), and it's metabolites, NaAsO(2) (As(III)) and Na(2)HAsO(4) • 7H(2)O (As(V)). The 130 Salmonella serovars tested demonstrated a low incidence of resistance to the antibiotics gentamicin (GEN), kanamycin (KAN), sulfamethoxazole (SMX), streptomycin (STR), and tetracycline (TET). Isolates resistant to antibiotics were most often multidrug resistant. Serovars Hadar and Typhimurium were resistant to KAN, STR, and TET and GEN, SMX, and STR, respectively. All isolated Salmonella serovars were resistant to the disinfectant chlorhexidine with minimum inhibitory concentrations (MICs; 1-8 μg/mL), and they were susceptible to triclosan and benzalkonium chloride. The didecyldimethylammonium chloride component was the most active ammonium chloride tested. No cross-resistance was observed between antibiotics and disinfectants. The MICs for 3-NHPAA (4096 μg/mL) were consistent between processing Plant 1 and Plant 2, but MICs for the 3-NHPAA metabolites (As(III) and As(V)) were higher in Plant 1 than in Plant 2. In Plant 1, 76% of the isolates had MICs >256 μg/mL for As(III) and 92% of the isolates had MICs >1024 μg/mL for As(V). In Plant 2, all of the isolates had MICs ≤256 μg/mL for As(III) and 90% of the isolates had MICs ≤1024 μg/mL for As(V). Only 4 Salmonella serovars were isolated from Plant 1, but 10 serovars were isolated from Plant 2. S. enterica serovar Derby from Plant 1 was highly resistant to As(III) and As(V) with MICs >1024 and >8192 μg/mL, respectively, suggesting previous exposure to high arsenic metabolite concentrations. These levels may have been high enough to kill other Salmonella serovars, thus possibly explaining the lack of serovar diversity observed in Plant 1. The application of

  5. Characterization of ethno-medicinal plant resources of karamar valley Swabi, Pakistan

    Directory of Open Access Journals (Sweden)

    Muhammad Khalid

    2017-04-01

    Industrial relevance: Medicinal plants are still widely used for the treatment of different ailments in the area of Swabi, therefore survey of medicinal flora should be carried out to explore and bring up-to-date the catalogue of existing natural plant resources of the area especially in agricultural country like Pakistan. Small scale government processing units of agroforestry should be implemented to reduce the overuse and motivate the cultivation of valuable medicinal plants. Majority of the people use various formulations of medicinal plants for different ailments treatment. The phytochemicals greatly varied in medicinal plants and cause a marvelous effect on human illnesses. The objective of the present study was to document the information of folk medicines, its identification, collection of samples, study of its chemical constituents and uses by the local people of District Swabi, Pakistan.

  6. Characterization of trace element emissions from coal-fired power plants

    International Nuclear Information System (INIS)

    Ondov, J.M.; Ragaini, R.C.; Biermann, A.H.

    1977-01-01

    Samples of suspended particulate material collected in-stack and in the plume at two major Western power plants were analyzed for up to 45 elements using instrumental neutron activation analysis, atomic absorption spectroscopy, and x-ray fluorescence. Enrichments of trace species are compared as a function of particle size from each of the units tested at several distances in the plume. The results of our studies are compared with other trace element studies of coal-fired power plants. Geochemical enrichments of trace elements in coal and enrichment processes occurring during combustion in power plants, and atmospheric transport are discussed. Trace element enrichments in ambient plume aerosols are predicted for an average coal plant. Comparison of the predicted enrichments with mean enrichments of aerosols in 29 cities suggests that coal-fired power plants can be significant sources of Se, As, Mo, W, U, Co, and Ga

  7. Chemical, dimensional and morphological ultrafine particle characterization from a waste-to-energy plant.

    Science.gov (United States)

    Buonanno, Giorgio; Stabile, Luca; Avino, Pasquale; Belluso, Elena

    2011-11-01

    Waste combustion processes are responsible of particles and gaseous emissions. Referring to the particle emission, in the last years specific attention was paid to ultrafine particles (UFPs, diameter less than 0.1 μm), mainly emitted by combustion processes. In fact, recent findings of toxicological and epidemiological studies indicate that fine and ultrafine particles could represent a risk for health and environment. Therefore, it is necessary to quantify particle emissions from incinerators also to perform an exposure assessment for the human populations living in their surrounding areas. To these purposes, in the present work an experimental campaign aimed to monitor UFPs was carried out at the incineration plant in San Vittore del Lazio (Italy). Particle size distributions and total concentrations were measured both at the stack and before the fabric filter inlet in order to evaluate the removal efficiency of the filter in terms of UFPs. A chemical characterization of UFPs in terms of heavy metal concentration was performed through a nuclear method, i.e., Instrumental Neutron Activation Analysis (INAA), as well as a mineralogical investigation was carried out through a Transmission Electron Microscope (TEM) equipped with an Energy Dispersive Spectrometer (EDS) in order to evaluate shape, crystalline state and mineral compound of sampled particles. Maximum values of 2.7 × 10(7) part. cm(-3) and 2.0 × 10(3) part. cm(-3) were found, respectively, for number concentration before and after the fabric filter showing a very high efficiency in particle removing by the fabric filter. With regard to heavy metal concentrations, the elements with higher boiling temperature present higher concentrations at lower diameters showing a not complete evaporation in the combustion section and the consequent condensation of semi-volatile compounds on solid nuclei. In terms of mineralogical and morphological analysis, the most abundant compounds found in samples collected before

  8. Isolation, Characterization, Screening, Formulation and Evaluation of Plant Growth Promoting Rhizobacteria

    Directory of Open Access Journals (Sweden)

    Puja Kumari

    2017-10-01

    Full Text Available Plant growth promoting rhizobacteria (PGPR are bioresources which may be viewed as a novel and potential tool for providing substantial benefits to the agriculture. Soil is the dynamic living matrix and the major source of food security providing various resources of plant growth and maintaining life processes. PGPR are originally defined as root- colonizing bacteria that cause either plant growth promotion or biological control of plant diseases. Chemical fertilizers are used for killing pathogens, increase crop yield but long term use of chemical fertilizers lead to adverse effect to the soil profile and is the reason for decrease in soil productivity, on the other hand PGPR promote plant growth directly by either facilitating resource acquisition (nitrogen, phosphorus and essential minerals or modulating plant hormone levels, or indirectly by decreasing the inhibitory effects of various pathogens on plant growth and development in the forms of biocontrol agents. PGPR is the indispensable part of rhizosphere biota that when grown in association with the host plants can stimulate the growth of the host. PGPR seemed as successful rhizobacteria in getting established in soil ecosystem due to their high adaptability in a wide variety of environments, faster growth rate and biochemical versatility to metabolize a wide range of natural and xenobiotic compounds. Isolated PGPRs from selective crop rizosphere soil were used for further growth promotion and biocontrol studies in the green house and field. Different studies have been carrying out to develop some new bioformulations and evaluate their efficacy in promoting crop seedlings growth characteristics. Field trials were performed to evaluate selective crops with formulations of several plants PGPR in a production system. The present review highlights the Plant growth promoting rhizobacteria as an alternative of chemical fertilizer for sustainable, environment friendly agriculture.

  9. Field Trial and Molecular Characterization of RNAi-Transgenic Tomato Plants That Exhibit Resistance to Tomato Yellow Leaf Curl Geminivirus.

    Science.gov (United States)

    Fuentes, Alejandro; Carlos, Natacha; Ruiz, Yoslaine; Callard, Danay; Sánchez, Yadira; Ochagavía, María Elena; Seguin, Jonathan; Malpica-López, Nachelli; Hohn, Thomas; Lecca, Maria Rita; Pérez, Rosabel; Doreste, Vivian; Rehrauer, Hubert; Farinelli, Laurent; Pujol, Merardo; Pooggin, Mikhail M

    2016-03-01

    RNA interference (RNAi) is a widely used approach to generate virus-resistant transgenic crops. However, issues of agricultural importance like the long-term durability of RNAi-mediated resistance under field conditions and the potential side effects provoked in the plant by the stable RNAi expression remain poorly investigated. Here, we performed field trials and molecular characterization studies of two homozygous transgenic tomato lines, with different selection markers, expressing an intron-hairpin RNA cognate to the Tomato yellow leaf curl virus (TYLCV) C1 gene. The tested F6 and F4 progenies of the respective kanamycin- and basta-resistant plants exhibited unchanged field resistance to TYLCV and stably expressed the transgene-derived short interfering RNA (siRNAs) to represent 6 to 8% of the total plant small RNAs. This value outnumbered the average percentage of viral siRNAs in the nontransformed plants exposed to TYLCV-infested whiteflies. As a result of the RNAi transgene expression, a common set of up- and downregulated genes was revealed in the transcriptome profile of the plants selected from either of the two transgenic events. A previously unidentified geminivirus causing no symptoms of viral disease was detected in some of the transgenic plants. The novel virus acquired V1 and V2 genes from TYLCV and C1, C2, C3, and C4 genes from a distantly related geminivirus and, thereby, it could evade the repressive sequence-specific action of transgene-derived siRNAs. Our findings shed light on the mechanisms of siRNA-directed antiviral silencing in transgenic plants and highlight the applicability limitations of this technology as it may alter the transcriptional pattern of nontarget genes.

  10. Characterization of Effective Rhizobacteria Isolated from Velvet Bean (Mucuna Pruriens) to Enhance Plant Growth

    International Nuclear Information System (INIS)

    Saleem, A. R.; Mahmood, T.; Batool, A.; Khalid, A.

    2016-01-01

    Rhizobacteria with plant growth promoting ability exist in association with plant roots and ameliorate over all plant development and yield. Numerous species of rhizobacteria have been identified with plant growth promoting ability, which can be attributed to multiple microbial characteristics. In the current study rhizobacterial isolates with best plant growth promotion traits were subjected to screening for plant growth promotion under axenic condition. The results of lab assays revealed that out of five rhizobacterial isolates three of bacterial isolate were Gram -ve and two of them were Gram +ve bacterial group. All isolates found positive for the auxin production and ACC-demainase activity. The isolate HS9 showed highest ACC activity (331 ketobutyrate nmol mg-1 biomass hr-1) and auxin production (3.85 without L-TRP). PGPR increase plant growth by reducing the ethylene release and its inhibitory effects, the role of isolates to decrease ethylene effects was affirmed via classical triple response assay on velvet bean. Furthermore, isolate were assessed for resistance test, three efficient strains (G9, HS9 and H38) exhibited antibiotic resistance for streptomycin, kanamycin and rifampicin at 100 mg L-1in TSB medium. For the purpose of co-inoculation, all three isolates showed positive relation to grow together. The results concluded that rhizobacteria selected from rain fed areas were found effective to improve plant growth with their multiple growth enhancing traits. Therefore, PGPR with various characteristics could be a better option for inoculation and co-inoculation to improve plant growth in well watered and water stressed environment. (author)

  11. Identification and characterization of OsEBS, a gene involved in enhanced plant biomass and spikelet number in rice.

    Science.gov (United States)

    Dong, Xianxin; Wang, Xiaoyan; Zhang, Liangsheng; Yang, Zhengting; Xin, Xiaoyun; Wu, Shuang; Sun, Chuanqing; Liu, Jianxiang; Yang, Jinshui; Luo, Xiaojin

    2013-12-01

    Common wild rice (Oryza rufipogon Griff.) is an important genetic reservoir for rice improvement. We investigated a quantitative trait locus (QTL), qGP5-1, which is related to plant height, leaf size and panicle architecture, using a set of introgression lines of O. rufipogon in the background of the Indica cultivar Guichao2 (Oryza sativa L.). We cloned and characterized qGP5-1 and confirmed that the newly identified gene OsEBS (enhancing biomass and spikelet number) increased plant height, leaf size and spikelet number per panicle, leading to an increase in total grain yield per plant. Our results showed that the increased size of vegetative organs in OsEBS-expressed plants was enormously caused by increasing cell number. Sequence alignment showed that OsEBS protein contains a region with high similarity to the N-terminal conserved ATPase domain of Hsp70, but it lacks the C-terminal regions of the peptide-binding domain and the C-terminal lid. More results indicated that OsEBS gene did not have typical characteristics of Hsp70 in this study. Furthermore, Arabidopsis (Arabidopsis thaliana) transformed with OsEBS showed a similar phenotype to OsEBS-transgenic rice, indicating a conserved function of OsEBS among plant species. Together, we report the cloning and characterization of OsEBS, a new QTL that controls rice biomass and spikelet number, through map-based cloning, and it may have utility in improving grain yield in rice. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  12. Carbon and Hydrogen Isotopic Composition of Plant Wax n-Alkanes: A Tool for Characterizing Soil Provenance in Forensic Science

    Science.gov (United States)

    Pedentchouk, N.; Wagner, T.; Jones, M.

    2009-04-01

    patterns result from physiological differences among the plants. The relative differences in deltaD and delta13C values of various plant types could be explained by differences in stomatal diffusive conductance to H2O vapour and CO2 gas, so that species with higher stomatal conductance would have D-enriched and 13C-depleted values. We are currently investigating the stomatal conductance of leaves and needles taken from the same plants that were sampled for deltaD and delta13C measurements. Comparison of the isotopic data from the deciduous angiosperm plants growing in Newcastle and Norwich shows that 6 species from Newcastle are more 13C-depleted (delta13C: c. -39 to -35 per mil) than 11 deciduous angiosperm species from Norwich (delta13C: c. -36 to -31 per mil). However, there is no significant difference in the deltaD values between the two locations since the Newcastle data (deltaD: c. -155 to -130 per mil) is within the range of the Norwich data (deltaD: c. -115 to -170 per mil). Our n-alkane isotope data from Newcastle indicate that deciduous angiosperm species have a very different delta13C/dD signature in comparison with that of the evergreen angiosperm species. On the other hand, gymnosperms have deltaD values similar to those of deciduous angiosperms and delta13C values similar to those of evergreen angiosperms. Further results from our compound-specific work, will reveal whether these patterns also characterize the same plant groups in Norwich and whether different weather patterns in Newcastle and Norwich lead to isotopic differences in the same species/plant types. The results of this study will provide a valuable dataset that could be used for higher plant and soil characterization by forensics experts in the UK and elsewhere.

  13. Engineering soluble insect and plant cytochromes P450 for biochemical characterization

    DEFF Research Database (Denmark)

    Jensen, Mikael Kryger

    to express them in a soluble state in E. coli, using various modifications of the primary sequence as well as optimizing the growth conditions. The modified enzyme CYP79A1 was purified and attempted structurally elucidated using crystallography. As this was not successful, within the time frame of this Ph......Because most plants are sessile organisms they have had to evolve different mechanisms to defend against herbivores. Cyanogenic glucosides (CNglcs) are ancient defence compounds found in certain plant and a few insect species, which releases cyanide upon attack. The biosynthesis of CNglcs in plants...... and insects is performed by three enzymes converting an amino acid into its corresponding CNglc. The pathways have been shown to have evolved convergently with the enzymes from plants and insects having less than 20 percent sequence identity at the amino acid level. The first enzyme in the pathway is from...

  14. Mechanical–biological treatment: Performance and potentials. An LCA of 8 MBT plants including waste characterization

    DEFF Research Database (Denmark)

    Montejo, Cristina; Tonini, Davide; Márquez, María del Carmen

    2013-01-01

    In the endeavour of avoiding presence of biodegradable waste in landfills and increasing recycling, mechanical–biological treatment (MBT) plants have seen a significant increase in number and capacity in the last two decades. The aim of these plants is separating and stabilizing the quickly...... of the MBT plants. These widely differed in type of biological treatment and recovery efficiencies. The results indicated that the performance is strongly connected with energy and materials recovery efficiency. The recommendation for upgrading and/or commissioning of future plants is to optimize materials...... recovery through increased automation of the selection and to prioritize biogas-electricity production from the organic fraction over direct composting. The optimal strategy for refuse derived fuel (RDF) management depends upon the environmental compartment to be prioritized and the type of marginal...

  15. Eleventh-year response of loblolly pine and competing vegetation to woody and herbaceous plant control on a Georgia flatwoods site

    Science.gov (United States)

    Bruce R. Zutter; James H. Miller

    1998-01-01

    Through 11 growing seasons, growth of loblolly pine (Pinus taeda L.) increased after control of herbaceous, woody, or both herbaceous and woody vegetation (total control) for the first 3 years after planting on a bedded site in the Georgia coastal flatwoods. Gains in stand volume index from controlling either herbaceous or woody vegetation alone were approximately two-...

  16. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  17. Functional characterization of a strong bi-directional constitutive plant promoter isolated from cotton leaf curl Burewala virus.

    Directory of Open Access Journals (Sweden)

    Zainul A Khan

    Full Text Available Cotton leaf curl Burewala virus (CLCuBuV, belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV were fused with β-glucuronidase (GUS and green fluorescent protein (GFP reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.

  18. Characterization of a New Tomato Spotted Wilt Virus Isolates Found in Hippeastrum hybridum (Hort. Plants in Poland

    Directory of Open Access Journals (Sweden)

    Berniak Hanna

    2016-06-01

    Full Text Available Two Tomato spotted wilt virus (TSWV isolates H1 and H2 found in Hippeastrum hybridum plants were characterized based on biological, serological, and molecular properties. Virus isolates showed differences in symptom expression – H1 isolate displayed severe necrotic spots and patterns, whereas mild mosaic symptoms were observed on H2-infected H. hybridum plants. Both TSWV isolates showed comparable reactivity with TSWV-specific antibodies and they induced similar symptoms on herbaceous indicator plants, but some differences between these isolates were detected at the nucleotide sequence level of genomic S and M ssRNAs segment fragments. The nucleotide sequences encoding nucleocapsid (N and nonstructural (NSs and NSm proteins showed 98.2%, 97.5%, and 96.5% identity, respectively. Phylogenetic analysis of N and NSs sequences conducted for tested isolates and 31 TSWV isolates included for comparison revealed that H1 and H2 isolates fell into the same cluster and they were grouped together with isolates found previously in different vegetables, ornamentals, and weeds. When NSm ORF was analyzed, the tested isolates formed a separate cluster: H1 isolate showed the highest affinity with TSWV isolates infecting chrysanthemum and pepper plants, whereas H2 isolate was most closely related to other virus isolates found in sweet pepper and tomatoes. These results indicate that both isolates were reassortants between different virus isolates, and represented two novel genetic patterns of TSWV.

  19. Plant productivity and characterization of zeoponic substrates after three successive crops of radish

    Science.gov (United States)

    Gruener, J. E.; Ming, Doug; Galindo, C., Jr.; Henderson, K. E.

    2006-01-01

    The National Aeronautics and Space Administration (NASA) has developed advanced life support (ALS) systems for long duration space missions that incorporate plants to regenerate the atmosphere (CO2 to O2), recycle water (via evapotranspiration), and produce food. NASA has also developed a zeolite-based synthetic substrate consisting of clinoptilolite and synthetic apatite to support plant growth for ALS systems (Ming et al., 1995). The substrate is called zeoponics and has been designed to slowly release all plant essential elements into "soil" solution. The substrate consists of K- and NH4-exchanged clinoptilolite and a synthetic hydroxyapatite that has Mg, S, and the plant-essential micronutrients incorporated into its structure in addition to Ca and P. Plant performance in zeoponic substrates has been improved by the addition of dolomite pH buffers, nitrifying bacteria, and other calcium-bearing minerals (Henderson et al., 2000; Gruener et al., 2003). Wheat was used as the test crop for all of these studies. The objectives of this study were to expand upon the previous studies to determine the growth and nutrient uptake of radish in zeoponic substrates and to determine the nutrient availability of the zeoponic substrate after three successive radish crops.

  20. Characterization of Listeria monocytogenes and Listeria innocua from a vegetable processing plant by RAPD and REA.

    Science.gov (United States)

    Aguado, V; Vitas, A I; García-Jalón, I

    2004-02-01

    The incidence of Listeria monocytogenes in a vegetable processing plant was investigated over a 23-month period. Frozen ready-to-eat vegetable samples, well as the plant environment, were sampled. The molecular subtyping techniques, Random Amplified Polymorphic DNA (RAPD) and Restriction Endonuclease Analyses (REA), were performed to help investigate the origin and routes of Listeria dissemination. The low and sporadic incidence of L. monocytogenes made it impossible to establish an epidemiological sequence in the processing plant, though a case of cross-contamination between tomato and ratatouille was detected. Listeria innocua subtyping, however, allowed us to determine the prevalence of several strains in vegetables, and their presence on machinery samples suggested the possibility of cross-contamination during processing. The low incidence of L. monocytogenes indicated that the risk of listeriosis transmission by vegetable consumption is low. On the other hand, the isolation of the same strain of L. innocua in several surveys pointed out the risk of colonisation on surfaces and machinery. The persistence of Listeria spp. is a cause for concern as can lead to future contamination of vegetables processed in the plant and to a possible increased risk for health. Therefore, periodic controls for the presence of Listeria spp. and a further review of the cleaning and disinfection procedures used in frozen vegetable plants are recommended.

  1. Single-Step Purification and Characterization of A Recombinant Serine Proteinase Inhibitor from Transgenic Plants.

    Science.gov (United States)

    Jha, Shweta; Agarwal, Saurabh; Sanyal, Indraneel; Amla, D V

    2016-05-01

    Expression of recombinant therapeutic proteins in transgenic plants has a tremendous impact on safe and economical production of biomolecules for biopharmaceutical industry. The major limitation in their production is downstream processing of recombinant protein to obtain higher yield and purity of the final product. In this study, a simple and rapid process has been developed for purification of therapeutic recombinant α1-proteinase inhibitor (rα1-PI) from transgenic tomato plants, which is an abundant serine protease inhibitor in human serum and chiefly inhibits the activity of neutrophil elastase in lungs. We have expressed rα1-PI with modified synthetic gene in transgenic tomato plants at a very high level (≃3.2 % of total soluble protein). The heterologous protein was extracted with (NH4)2SO4 precipitation, followed by chromatographic separation on different matrices. However, only immunoaffinity chromatography resulted into homogenous preparation of rα1-PI with 54 % recovery. The plant-purified rα1-PI showed molecular mass and structural conformation comparable to native serum α1-PI, as shown by mass spectrometry and optical spectroscopy. The results of elastase inhibition assay revealed biological activity of the purified rα1-PI protein. This work demonstrates a simple and efficient one-step purification of rα1-PI from transgenic plants, which is an essential prerequisite for further therapeutic development.

  2. Spectroscopic characterization of cell membranes and their constituents of the plant-associated soil bacterium Azospirillum brasilense

    Science.gov (United States)

    Kamnev, A. A.; Antonyuk, L. P.; Matora, L. Yu.; Serebrennikova, O. B.; Sumaroka, M. V.; Colina, M.; Renou-Gonnord, M.-F.; Ignatov, V. V.

    1999-05-01

    Structural and compositional features of bacterial membranes and some of their isolated constituents (cell surface lipopolysaccharide, phospholipids) of the plant-growth-promoting diazotrophic rhizobacterium Azospirillum brasilense (wild-type strain Sp245) were characterized using Fourier transform infrared (FTIR) spectroscopy and some other techniques. FTIR spectra of the cell membranes were shown to comprise the main vibration modes of the relevant lipopolysaccharide and protein components which are believed to be involved in associative plant-bacterium interactions, as well as of phospholipid constituents. The role and functions of metal cations in the structural organization and physicochemical properties of bacterial cell membranes are also discussed considering their accumulation in the membranes from the culture medium.

  3. Y-12 Plant remedial action Technology Logic Diagram: Volume 3, Technology evaluation data sheets: Part B, Characterization; robotics/automation

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-09-01

    The Y-12 Plant Remedial Action Technology Logic Diagram (TLD) was developed to provide a decision-support tool that relates environmental restoration (ER) problems at the Y-12 Plant to potential technologies that can remediate theses problems. The TLD identifies the research, development, demonstration, testing, and evaluation needed for sufficient development of these technologies to allow for technology transfer and application to remedial action (RA) activities. The TLD consists of three volumes. Volume 1 contains an overview of the TLD, an explanation of the program-specific responsibilities, a review of identified technologies, and the rankings of remedial technologies. Volume 2 contains the logic linkages among environmental management goals, environmental problems, and the various technologies that have the potential to solve these problems. Volume 3 contains the TLD data sheets. This report is Part B of Volume 3 and contains the Characterization and Robotics/Automation sections.

  4. Y-12 Plant remedial action Technology Logic Diagram: Volume 3, Technology evaluation data sheets: Part B, Characterization; robotics/automation

    International Nuclear Information System (INIS)

    1994-09-01

    The Y-12 Plant Remedial Action Technology Logic Diagram (TLD) was developed to provide a decision-support tool that relates environmental restoration (ER) problems at the Y-12 Plant to potential technologies that can remediate theses problems. The TLD identifies the research, development, demonstration, testing, and evaluation needed for sufficient development of these technologies to allow for technology transfer and application to remedial action (RA) activities. The TLD consists of three volumes. Volume 1 contains an overview of the TLD, an explanation of the program-specific responsibilities, a review of identified technologies, and the rankings of remedial technologies. Volume 2 contains the logic linkages among environmental management goals, environmental problems, and the various technologies that have the potential to solve these problems. Volume 3 contains the TLD data sheets. This report is Part B of Volume 3 and contains the Characterization and Robotics/Automation sections

  5. Characterization and elimination of undesirable protein residues in plant cell walls for enhancing lignin analysis by solution-state 2D gel-NMR methods

    Science.gov (United States)

    Proteins exist in every plant cell wall. Certain protein residues interfere with lignin characterization and quantification. The current solution-state 2D-NMR technique (gel-NMR) for whole plant cell wall structural profiling provides detailed information regarding cell walls and proteins. However, ...

  6. Examining Factors Predicting Students’ Digital Competence

    Directory of Open Access Journals (Sweden)

    Ove Edvard Hatlevik

    2015-02-01

    Full Text Available The purpose of this study was to examine factors predicting lower secondary school students’ digital competence and to explore differences between students when it comes to digital competence. Results from a digital competence test and survey in lower secondary school will be presented. It is important to learn more about and investigate what characterizes students’ digital competence. A sample of 852 ninth-grade Norwegian students from 38 schools participated in the study. The students answered a 26 item multiple-choice digital competence test and a self-report questionnaire about family background, motivation, and previous grades. Structural equation modeling was used to test a model of the hypothesised relationship between family background, mastery orientation, previous achievements, and digital competence. The results indicate variation in digital competence among the ninth-graders. Further, analyses showed that students’ conditions at home, i.e., language integration and cultural capital, together with mastery orientation and academic achievements predict students digital competence. This study indicates that that there is evidence of digital diversity between lower secondary students. It does not seem like the development of digital competence among the students happens automatically. Students’ family background and school performance are the most important factors. Therefore, as this study shows, it is necessary to further investigate how schools can identify students’ level of competence and to develop plans and actions for how schools can help to try to equalize differences.

  7. Characterization of soil contamination by using environmental magnetic techniques: example of the Ribatejo power plant

    Science.gov (United States)

    Braga Mendes, Ana Rita; Font, Eric; Andrade, Mariana

    2017-04-01

    Soil contamination resulting from power plant atmospheric emissions represents a major problem for soil management, water resource and agriculture. Here, we studied the contamination of soils located close to the Ribatejo power plant, near Carregado, Portugal. We used magnetic susceptibility (MS), isothermal remanent magnetization (IRM) curves and frequency-dependent magnetic susceptibility (Kfd) in order to identify the concentration and grainsize of anthropogenic magnetic particles. Separation of natural (background) and anthropogenic magnetic particles is achieved by studying several sites located close (polluted) and far (background) from the Ribatejo power plant. Vertical variations of magnetic particle content at each site provide information about the depth at which anthropogenic particles are maximum, and allow discussing the influence of downward fluid percolation within the different soil horizons.

  8. Purification, characterization and stability of barley grain peroxidase BP1, a new type of plant peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Christine B; Henriksen, Anette; Abelskov, A. Katrine

    1997-01-01

    -protoporphyrin IX, which is characteristic of plant peroxidases. BP 1 is stable from pH 3 to 11, indicating that its unusual spectral characteristics do not result from enzyme instability. The thermostability is also normal with a melting temperature of 75 degrees C at pH 6.6, and 67 degrees C at pH 4.0 and 8......The major peroxidase of barley grain (BP 1) has enzymatic and spectroscopic properties that are very differeant from those of other known plant peroxidases (EC 1.11.1.7) and can therefore contribute to the understanding of the many physiological functions ascribed to these enzymes. To study.......3. It is clear that the unusual properties of BP 1 are genuine, and reflect a novel regulation of plant peroxidase function....

  9. Characterization of siRNAs derived from cucumber green mottle mosaic virus in infected cucumber plants.

    Science.gov (United States)

    Li, Yongqiang; Deng, Congliang; Shang, Qiaoxia; Zhao, Xiaoli; Liu, Xingliang; Zhou, Qi

    2016-02-01

    Virus-derived small interfering RNAs (vsiRNAs) of cucumber green mottle mosaic virus (CGMMV), a member of the genus Tobamovirus, were characterised in cucumber plants by deep sequencing. CGMMV vsiRNAs of 21-22 nt in length predominated, suggesting that there might be a conserved mechanism of DCL2 and DCL4 involvement in the biogenesis of vsiRNAs, as well as a common RNA silencing pathway in CGMMV-infected cucumber plants. The 5'-terminal base of vsiRNAs was biased towards C/A/U, suggesting that CGMMV vsiRNAs might be loaded into diverse AGO-containing RISCs to disturb the gene expression of host plants. Possible targets for some of the vsiRNAs were also predicted.

  10. Characterization of hypoglycemiant plants by total reflection X-ray fluorescence spectrometry.

    Science.gov (United States)

    Zucchi, Orghêda L A D; Moreira, Silvana; de Jesus, Edgar F O; Neto, Helio Salvio; Salvador, Marcos J

    2005-03-01

    In this work, synchrotron radiation total reflection X-ray fluorescence spectrometry (SRTXRF) was used to determine trace elements in eight hypoglycemiant plants (Trigonella foenum graecum, Panax ginseng, Pfaffia paniculata, Myrcia speciosa, Zea mays, Harpagophytum procumbens, Syzygium jambolona, and Bauhinia forficate). The elements P, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb, and Sr were detected in all medicinal plants investigated, whereas Si, S, Sc, V, Cr, Co, Ni, Se, Nb, Mo, Sn, Sb, Ba, Hg, and Pb were detected only in some of the samples. The concentration of elements in hypoglycemiant plants varied from 0.15 microg/g of Co to 3.0 x 10(4) microg/g of K and the mean of experimental limit of detection for these elements were 0.14 and 3.6 microg/g, respectively.

  11. Competing vegetation in ponderosa pine plantations: ecology and control

    Science.gov (United States)

    Philip M. McDonald; Gary O. Fiddler

    1989-01-01

    Planted ponderosa pine (Pinus ponderosa Dougl. ex Laws. var. ponderosa) seedlings in young plantations in California are at a disadvantage compared with competing shrubs, forbs, and grasses. In many instances, roots of competing plants begin expanding and exploiting the soil earlier and in greater numbers, thereby capturing the...

  12. Reactive trace gas emissions from stressed plants: a poorly characterized major source of atmospheric volatiles

    Science.gov (United States)

    Niinemets, Ülo

    2017-04-01

    Vegetation constitutes the greatest source of reactive volatile organic compounds in the atmosphere. The current emission estimates primarily rely on constitutive emissions that are present only in some plant species. However, all plant species can be induced to emit reactive volatiles by different abiotic and biotic stresses, but the stress-dependent emissions have been largely neglected in emission measurements and models. This presentation provides an overview of systematic screening of stress-dependent volatile emissions from a broad range of structurally and physiologically divergent plant species from temperate to tropical ecosystems. Ozone, heat, drought and wounding stress were the abiotic stresses considered in the screening, while biotic stress included herbivory, chemical elicitors simulating herbivory and fungal infections. The data suggest that any moderate to severe stress leads to significant emissions of a rich blend of volatiles, including methanol, green leaf volatiles (the lipoxygenase pathway volatiles, dominated by C6 aldehydes, alcohols and derivatives), different mono- and sesquiterpenes and benzenoids. The release of volatiles occurs in stress severity-dependent manner, although the emission responses are often non-linear with more severe stresses resulting in disproportionately greater emissions. Stress volatile release is induced in both non-constitutive and constitutive volatile emitters, whereas the rate of constitutive volatile emissions in constitutive emitters is often reduced under environmental and biotic stresses. Given that plants in natural conditions often experience stress, this analysis suggests that global volatile emissions have been significantly underestimated. Furthermore, in globally changing hotter climates, the frequency and severity of both abiotic and biotic stresses is expected to increase. Thus, the stress-induced volatile emissions are predicted to play a dominant role in plant-atmosphere interactions in near

  13. Demonstration, testing and evaluation of nonintrusive characterization technologies at operable Unit 2 of Rocky Flats Plant. Final report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-09-01

    A three-dimensional (3-D), high-resolution (HR) seismic reflection evaluation was conducted at the Rocky Flats Plant (RFP), near Golden, Colorado, to demonstrate the applicability of nonintrusive characterization techniques to detect buried objects, contamination, and geological/hydrological features at RFP. The evaluation was conducted as part of the U.S. Department of Energy`s (DOE) request for demonstration, testing and evaluation (DT&E) of nonintrusive techniques, under DOE Program Research and Development Announcement (PRDA) No. DE-RA05-09OR22000.

  14. Demonstration, testing and evaluation of nonintrusive characterization technologies at operable Unit 2 of Rocky Flats Plant. Final report

    International Nuclear Information System (INIS)

    1994-09-01

    A three-dimensional (3-D), high-resolution (HR) seismic reflection evaluation was conducted at the Rocky Flats Plant (RFP), near Golden, Colorado, to demonstrate the applicability of nonintrusive characterization techniques to detect buried objects, contamination, and geological/hydrological features at RFP. The evaluation was conducted as part of the U.S. Department of Energy's (DOE) request for demonstration, testing and evaluation (DT ampersand E) of nonintrusive techniques, under DOE Program Research and Development Announcement (PRDA) No. DE-RA05-09OR22000

  15. Executive summary of the guidebook on training to establish and maintain the qualification and competence of nuclear power plant operations personnel

    International Nuclear Information System (INIS)

    1989-01-01

    Since the IAEA published its Guidebook on the Qualification of Nuclear Power Plant Operations Personnel in 1984 (Technical Reports Series No. 242) there have been important developments in the approach for training adopted by many operating organizations in different countries. The Guidebook, described in this report, proposes an approach which is comprehensive and systematic in its methodology and cost effective in its implementation. 5 refs, 1 fig

  16. Preliminary plan for disposal-system characterization and long-term performance evaluation of the Waste Isolation Pilot Plant

    International Nuclear Information System (INIS)

    Bertram-Howery, S.G.; Hunter, R.L.

    1989-04-01

    The US Department of Energy is planning to dispose of transuranic wastes at the Waste Isolation Pilot Plant (WIPP) near Carlsbad, New Mexico. Sandia National Laboratories is responsible for evaluating the compliance of the WIPP with the Environmental Protection Agency's Environmental Standards for the Management and Disposal of Spent Nuclear Fuel, High-Level and Transuranic Radioactive Wastes (40 CFR 191, Subpart B). This plan has been developed to present the issues that will be addressed before compliance can be evaluated. These issues examine the procedural nature of the Standard, and the technical requirements for further characterizing the behavior of the disposal system, including uncertainties, to support the compliance assessment. The plan briefly describes the activities that will be conducted prior to 1993 by Sandia to characterize the WIPP disposal system's behavior and predict its performance. 41 refs., 35 figs., 21 tabs

  17. Characterization of solidified radioactive wastes produced at Montalto di Castro BWR plant with reference to the site storage

    International Nuclear Information System (INIS)

    Donato, A.; Ricci, G.; Pace, A.

    1985-01-01

    The cement solidification of the Montalto di Castro BWR plant radwastes has been studied both from the point of view of the mixtures of formulation and of the product characterization. Five radwaste types and mixtures of them have been taken into consideration, determining the best chemical formulations starting from the compressive strenght as leading parameter. The solidified products have been characterized from the point of view of the freeze and thawing resistance, the water immersion resistance, the leachability, the dimensional changes and the free standing water. All the tests have been performed taking into account the real site conditions, so the leaching tests and the water immersion tests have been carried out using sea water and table water as leachant

  18. Characterization of the Ac/Ds behaviour in transgenic tomato plants using plasmid rescue

    NARCIS (Netherlands)

    Rommens, Caius M.T.; Rudenko, George N.; Dijkwel, Paul P.; Haaren, Mark J.J. van; Ouwerkerk, Pieter B.F.; Blok, Karin M.; Nijkamp, H. John J.; Hille, Jacques

    1992-01-01

    We describe the use of plasmid rescue to facilitate studies on the behaviour of Ds and Ac elements in transgenic tomato plants. The rescue of Ds elements relies on the presence of a plasmid origin of replication and a marker gene selective in Escherichia coli within the element. The position within

  19. Ecophysiological characterization of carnivorous plant roots: oxygen fluxes, respiration, and water exudation

    Czech Academy of Sciences Publication Activity Database

    Adamec, Lubomír

    2005-01-01

    Roč. 49, č. 2 (2005), s. 247-255 ISSN 0006-3134 R&D Projects: GA AV ČR(CZ) IAA6005909 Institutional research plan: CEZ:AV0Z6005908 Keywords : terrestrial carnivorous plants * soil anoxia * Genlisea traps Subject RIV: EF - Botanics Impact factor: 0.792, year: 2005

  20. Multi-scale visualization and characterization of lignocellulosic plant cell wall deconstruction during thermochemical pretreatment

    Science.gov (United States)

    Shishir P. S. Chundawat; Bryon S. Donohoe; Leonardo da Costa Sousa; Thomas Elder; Umesh P. Agarwal; Fachuang Lu; John Ralph; Michael E. Himmel; Venkatesh Balan; Bruce E. Dale

    2011-01-01

    Deconstruction of lignocellulosic plant cell walls to fermentable sugars by thermochemical and/or biological means is impeded by several poorly understood ultrastructural and chemical barriers. A promising thermochemical pretreatment called ammonia fiber expansion (AFEX) overcomes the native recalcitrance of cell walls through subtle morphological and physicochemical...

  1. Characterization of the in situ ecophysiology of novel phylotypes in nutrient removal activated sludge treatment plants

    DEFF Research Database (Denmark)

    McIlroy, Simon Jon; Awata, Takanori; Nierychlo, Marta

    2015-01-01

    with nutrient removal indicate the presence of a core set of bacterial genera. These organisms are likely responsible for the bulk of nutrient transformations underpinning the functions of these plants. While the basic activities of some of these genera in situ are known, there is little to no information...

  2. Characterization of three plant biomass-degrading microbial consortia by metagenomics- and metasecretomics-based approaches

    NARCIS (Netherlands)

    Jiménez, Diego Javier; Brossi, Maria Julia de Lima; Schuckel, Julia; Kracun, Stjepan Kresimir; Willats, William George Tycho; van Elsas, Jan Dirk

    2016-01-01

    The selection of microbes by enrichment on plant biomass has been proposed as an efficient way to develop new strategies for lignocellulose saccharification. Here, we report an in-depth analysis of soil-derived microbial consortia that were trained to degrade once-used wheat straw (WS1-M),

  3. Chemical and microscopic characterization of outer seed coats of fossil and extant water plants

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Bergen, P.F. van; Goni, M.; Barrie, P.J.; Collinson, M.E.; Leeuw, J.W. de

    1995-01-01

    Sclerotic outer seed coat layers (testae) of three fossil and two extant water plant species were analyzed using scanning electron and light microscopy in addition to Curie-point pyrolysis, solid state 13C NMR, and CuO oxidation. Comparison between the chemical results from the fossil and extant

  4. Characterizing the Uptake, Accumulation and Toxicity of Silver Sulfide Nanoparticles in Plants

    Science.gov (United States)

    Silver nanoparticles (Ag-NPs) are used in a wide range of everyday products, leading to increasing concerns regarding their accumulation in soils and subsequent impact on plants. Using single particle inductively coupled plasma mass spectrometry (spICP-MS) and synchrotron-based t...

  5. Elemental Characterization of Romanian Crop Medicinal Plants by Neutron Activation Analysis

    Directory of Open Access Journals (Sweden)

    Daniela Haidu

    2017-01-01

    Full Text Available The metallic elements concentrations of medicinal plants (coriander, dill, Echinacea, lavender, chamomile, mint, and plantain, used for phytopharmaceutical products, cultivated in unpolluted region, were analyzed by neutron activation analysis. The essential nutrients, macro-, micro-, and trace elements (K, Ca, Mg, Na, Fe, Mn, Rb, Sr, and Zn, potentially toxic elements (Al, As, Ba, Co, Sb, Cr, and V, and rare earth elements were monitored and were compared with those presented in the literature. An estimation of their contributions to intake and toxicity for a person was made, which revealed that (a teas prepared from the examined plants represent useful contribution to the food provided intake of three essential macronutrients (K, Ca, and Mg; (b the Cu, Mn, Rb, Sr, Zn, and rare earths levels are normal or low; (c the quantities of As, Ba, Co, Sb, Cr, and V do not represent toxicological concerns; (d the examination of the estimated Al and Fe quantities recovered in infusions in the conditions of usual daily tea consumption is below the Tolerable Daily Intake values. The strategy of cultivation of medicinal plants in unpolluted areas is efficient and beneficial. However, individual plants ability to concentrate preferentially certain elements suggests controlling the contamination level of raw materials.

  6. Elemental Characterization of Romanian Crop Medicinal Plants by Neutron Activation Analysis.

    Science.gov (United States)

    Haidu, Daniela; Párkányi, Dénes; Moldovan, Radu Ioan; Savii, Cecilia; Pinzaru, Iulia; Dehelean, Cristina; Kurunczi, Ludovic

    2017-01-01

    The metallic elements concentrations of medicinal plants (coriander, dill, Echinacea , lavender, chamomile, mint, and plantain, used for phytopharmaceutical products), cultivated in unpolluted region, were analyzed by neutron activation analysis. The essential nutrients, macro-, micro-, and trace elements (K, Ca, Mg, Na, Fe, Mn, Rb, Sr, and Zn), potentially toxic elements (Al, As, Ba, Co, Sb, Cr, and V), and rare earth elements were monitored and were compared with those presented in the literature. An estimation of their contributions to intake and toxicity for a person was made, which revealed that (a) teas prepared from the examined plants represent useful contribution to the food provided intake of three essential macronutrients (K, Ca, and Mg); (b) the Cu, Mn, Rb, Sr, Zn, and rare earths levels are normal or low; (c) the quantities of As, Ba, Co, Sb, Cr, and V do not represent toxicological concerns; (d) the examination of the estimated Al and Fe quantities recovered in infusions in the conditions of usual daily tea consumption is below the Tolerable Daily Intake values. The strategy of cultivation of medicinal plants in unpolluted areas is efficient and beneficial. However, individual plants ability to concentrate preferentially certain elements suggests controlling the contamination level of raw materials.

  7. Purification, characterization and stability of barley grain peroxidase BP1, a new type of plant peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Christine B; Henriksen, Anette; Abelskov, A. Katrine

    1997-01-01

    The major peroxidase of barley grain (BP 1) has enzymatic and spectroscopic properties that are very differeant from those of other known plant peroxidases (EC 1.11.1.7) and can therefore contribute to the understanding of the many physiological functions ascribed to these enzymes. To study...

  8. Characterization of Arabidopsis thaliana FLAVONOL SYNTHASE 1 (FLS1) -overexpression plants in response to abiotic stress.

    Science.gov (United States)

    Nguyen, Nguyen Hoai; Kim, Jun Hyeok; Kwon, Jaeyoung; Jeong, Chan Young; Lee, Wonje; Lee, Dongho; Hong, Suk-Whan; Lee, Hojoung

    2016-06-01

    Flavonoids are an important group of secondary metabolites that are involved in plant growth and contribute to human health. Many studies have focused on the biosynthesis pathway, biochemical characters, and biological functions of flavonoids. In this report, we showed that overexpression of FLS1 (FLS1-OX) not only altered seed coat color (resulting in a light brown color), but also affected flavonoid accumulation. Whereas fls1-3 mutants accumulated higher anthocyanin levels, FLS1-OX seedlings had lower levels than those of the wild-type. Besides, shoot tissues of FLS1-OX plants exhibited lower flavonol levels than those of the wild-type. However, growth performance and abiotic stress tolerance of FLS1-OX, fls1-3, and wild-type plants were not significantly different. Taken together, FLS1 can be manipulated (i.e., silenced or overexpressed) to redirect the flavonoid biosynthetic pathway toward anthocyanin production without negative effects on plant growth and development. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  9. Leaf anatomy characterization of Coffea arabica plants at different seasonal periods

    Directory of Open Access Journals (Sweden)

    Rachel Benetti Queiroz-Voltan

    2014-12-01

    Full Text Available Drought is among the hindering factors for coffee plant growth and yield. This study aimed to analyze the anatomy of leaves grown during the rainy and dry seasons in nine Coffea arabica L. plants, previously described as tolerant or sensitive to water deicit, in order to identify structural features of drought tolerance. We measured the size and density of stomata and epidermal cells, the thickness of epidermis and mesophyll, the diameter of petiole and midrib, the thickness of phloem and xylem in the midrib and petiole, and the diameter and frequency of elements of xylem vessels. Differences observed between the leaf structure of coffee plants evaluated and the leaf growth conditions (rainy and dry seasons indicated that there is a favorable anatomical plasticity regarding drought conditions. Thicker palisade parenchyma and total limbo, larger radii of phloem and xylem in the petiole and midrib were considered as favorable structural features to cope with water scarcity and they could be used as criteria to select drought-resistant cultivars. The following coffee plants were considered as more adapted to drought: Geisha, Semperlorens, BA 10, IAC H 8105-7, IAC H 8421-2, and the cultivar Catuaí Vermelho IAC 81.

  10. Chemical and pharmacognostical characterization of two Malaysian plants both known as Ajisamat

    Directory of Open Access Journals (Sweden)

    Tengku Azlan S. Tengku Mohamad

    Full Text Available Ajisamat, an herb commonly used as an aphrodisiac in the Malaysian traditional medicine, corresponds to two different species from different families - Salacia macrophylla Blume, Celastraceae, and Prismatomeris glabra (Korth. Valeton, Rubiaceae. Macromorphological inspection of the vegetative parts both plants reveals only a slight difference in the arrangement of the petioles. Microscopic investigation of the plants roots used as crude drugs revealed however distinctive anatomical features. Prismatic calcium oxalate crystals and banded paratracheal parenchyma are characteristics of S. macrophylla while P. glabradisplays an abundance as crystals. Other features such as vessels diameters and arrangements are also of diagnostic importance. Some of these characters were also identified in the powder of thes e plant materials and proposed for diagnostic purpose. The values for extraction of ethanol and water as well as total ash, acid-insoluble ash, water-soluble ash and sulfated ash were determined for both plants. Phytochemical studies were carried out on hexane and chloroform extracts of S. macrophylla and methanolic extract of P. glabra. S. macrophylla was shown to contain highly oxidized pentacyclic triterpenes while P. glabra contains anthraquinones. The pharmacognostical and hytochemical information can be utilised as the identification tools for Salacia macrophylla and Prismatomeris glabra

  11. CHARACTERIZATION OF THE FUGITIVE MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT. OVERALL STUDY DESIGN

    Science.gov (United States)

    The paper discusses a detailed emissions measurement campaign that was conducted over a 9-day period within a mercury (Hg) cell chlor-alkali plant in the southeastern United States (U.S.). The principal focus of this study was to measure fugitive (non-ducted) airborne Hg emission...

  12. CHARACTERIZATION OF MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT: STUDY ORGANIZATION AND IMPLEMENTATION

    Science.gov (United States)

    The paper describes the organization and implementation of a detailed emissions measurement campaign conducted over a 2-week period at the Olin Corporation's mercury chlor-alkali plant in Augusta, GA. (NOTE: Since data analysis is continuing, study results will be provided later...

  13. Plant Productivity and Characterization of Zeoponic Substrates after Three Successive Crops of Radish (Raphanus sativus L.)

    Science.gov (United States)

    Gruener, J. E.; Ming, Douglas W.; Galindo, C., Jr.; Henderson, K. E.; Golden, D. C.

    2007-01-01

    The National Aeronautics and Space Administration (NASA) has developed a zeolite-based synthetic substrate, termed zeoponics. The zeoponic substrate (consisting of NH4(-) and K-exchanged clinoptilolite, synthetic apatite, and dolomite) provides all of the plant-essential nutrients through mineral dissolution and ion exchange, with only the addition of water. Previous studies have shown high productivity of wheat in zeoponic substrates; however, no experiments have been conducted on other crops. The objective of this study was to determine the productivity and nutrient uptake of radish (Raphanus sativus L.) grown in zeoponic substrates with three successive crops in the same substrate. Radish was chosen because of its sensitivities to NH4(+). Average fresh weights of edible roots were similar for radish grown in zeoponic substrates watered with deionized H2O (10.97 g/plant) and in potting mix control substrate irrigated with nutrient solution (10.92 g/plant). Average fresh weight production of edible roots for radish grown in same zeoponic substrate increased in yield over time with the lowest yield in the first crop (7.10 g/plant) and highest in the third crop (13.90 g/plant). The Ca plant tissue levels in radishes (1.8-2.9 wt. %) grown in zeoponic substrates are lower than the suggested sufficient range of 3.0-4.5 wt. % Ca; however, the Ca level is highest (2.9 wt. %) in radishes grown in the third crop in the same zeoponic substrates. The higher radish yield in the third crop was attributed to a reduction in an NH4(-) induced Ca deficiency that has been previously described for wheat grown in zeoponic substrates. The P levels in plant tissues of radish grown in the zeoponic substrates ranged from 0.94-1.15 wt. %; which is slightly higher than the sufficient levels of 0.3-0.7 wt. %. With the exception of Ca and P, other macronutrient and micronutrient levels in radish grown in zeoponic substrates were well within the recommended sufficient ranges. After three

  14. Characterization of multifarious plant growth promoting traits of rhizobacterial strain AR6 under Chromium (VI) stress.

    Science.gov (United States)

    Karthik, Chinnannan; Elangovan, Namasivayam; Kumar, Thamilarasan Senthil; Govindharaju, Subramani; Barathi, Selvaraj; Oves, Mohammad; Arulselvi, Padikasan Indra

    2017-11-01

    Plant growth promoting rhizobacteria (PGPR) can increase the host plant tolerance to cope up with heavy metal induced stress, which can be improve plant growth. Thus, the present study was designed to isolate Cr(VI) tolerant PGPR strain and evaluate its plant growth promoting (PGP) properties under Cr(VI) stress. Rhizobacterial strain AR6 was isolated from the rhizosphere of Phaseolus vulgaris L. and showed 99% homology with Cellulosimicrobium funkei (KM032184) in BLASTn analysis. Strain AR6 was specifically selected due to its high Cr(VI) tolerance (1200μg/ml) and substantial production of PGP substances. Strain AR6 produced 36.75μg/ml of indole acetic acid (IAA), 60.40μg/ml of ammonia and 14.23μg/ml of exopolysaccharide (EPS). Moreover, strain AR6 showed positive results for catalase, protease, amylase, lipase production and phosphate solubilization. A trend of Cr(VI) concentration dependent progressive decline for PGP traits of strain AR6 was observed excluding EPS which was regularly increased on increasing concentrations of Cr(VI). Among the four tested Cr(VI) concentrations, 250μg/ml showed the maximum toxicity to PGP activities of strain AR6. Inoculation of rhizobacterial strain AR6 significantly increased the root length of test crops in the presence of Cr(VI) and produced a considerable number of colonizes on the root of versatile dicot and monocot plants. Moreover, strain AR6 exhibited strong antagonistic activity against phytopathogen Aspergillus niger. Thus, the present study suggests that metal tolerant and PGP activities of the rhizobacterial strain AR6 could be exploited for environmental and agricultural issues. Copyright © 2017 Elsevier GmbH. All rights reserved.

  15. Characterization of coal blends for effective utilization in thermal power plants

    International Nuclear Information System (INIS)

    Santhosh Raaj, S.; Arumugam, S.; Muthukrishnan, M.; Krishnamoorthy, S.; Anantharaman, N.

    2016-01-01

    Highlights: • This work will assist utilities to decide on the choice of coals for blending. • Conventional and advanced analytical techniques were used for characterization. • Fuel ratio, burnout profile, ash chemistry and carbon burnout are key factors. • Basic properties were additive while carbon burnout was non additive for the blends. - Abstract: This paper deals with the characterization of coal blends using various conventional and advanced analytical techniques. There has been an increasing trend in utilizing imported coals for power generation in India and utilities are resorting to blended coal firing for various reasons, both financially as well as technically. Characterization studies were carried out on 2 combinations of Indian and imported coal blends. Conventional characterization such as proximate and ultimate analysis and determination of calorific value were carried out for the raw coals and blends as per ASTM standards. Following this thermal and mineral analysis of the samples were carried out using thermo gravimetric analyzer (TGA), X-ray fluorescence spectrometer (XRF) and computer controlled scanning electron microscope (CCSEM). Combustion experiments were also conducted using drop tube furnace (DTF) to determine the burnout of the raw coals and blends. The selection of technically suitable coal combination for blending, based on these characterization studies, has been detailed.

  16. Physiological and genetic characterization of plant growth and gravitropism in LED light sources

    Science.gov (United States)

    Deitzer, Gerald F.

    1994-01-01

    Among the many problems of growing plants in completely controlled environments, such as those anticipated for the space station and the CELSS program, is the need to provide light that is both adequate for photosynthesis and of proper quality for normal growth and development. NASA scientists and engineers have recently become interested in the possibility of utilizing densely packed, solid state, light emitting diodes (LED's) as a source for this light. Unlike more conventional incandescent or electrical discharge lamps, these sources are highly monochromatic and lack energy in spectral regions thought to be important for normal plant development. In addition, a recent observation by NASA scientist has suggested that infra-red LED's, that are routinely used as photographic safelights for plants grown in darkness, may interact with the ability of plants to detect gravity. In order to establish how plants respond to light from these LED light sources we carried out a series of experiments with known pigment mutants of the model mustard plant, Arabidopsis thaliana, growing in either a gravity field or on a clinostat to simulate a micro-gravity environment. Results indicate that only red light from the 665 nm LED's disrupts the ability of normal wildtype seedlings to detect a gravity stimulus. There was no consistent effect found for the far-red (735 nm) LED's or either of the infrared (880 nm or 935 nm) LED sources but both showed some effect in one or more of the genotypes tested. Of these five members of the phytochrome multigene family in Arabidopsis, only the phytochrome B pigment mutant (hy3) lacked the ability to detect gravity under all conditions. There was no effect of either micro-gravity (clinostat) or the infra-red LED's on the light induced inhibition of hypocotyl elongation. Measurements of the pigment phytochrome in oats also showed no photoconversion by 15 min irradiations with the infra-red LED's. We conclude that phytochrome B is required for the

  17. Site characterization summary report for dry weather surface water sampling upper East Fork Poplar Creek characterization area Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-08-01

    This report describes activities associated with conducting dry weather surface water sampling of Upper East Fork Poplar Creek (UEFPC) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. This activity is a portion of the work to be performed at UEFPC Operable Unit (OU) 1 [now known as the UEFPC Characterization Area (CA)], as described in the RCRA Facility Investigation Plan for Group 4 at the Oak- Ridge Y-12 Plant, Oak Ridge, Tennessee and in the Response to Comments and Recommendations on RCRA Facility Investigation Plan for Group 4 at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee, Volume 1, Operable Unit 1. Because these documents contained sensitive information, they were labeled as unclassified controlled nuclear information and as such are not readily available for public review. To address this issue the U.S. Department of Energy (DOE) published an unclassified, nonsensitive version of the initial plan, text and appendixes, of this Resource Conservation and Recovery Act (RCRA) Facility Investigation (RFI) Plan in early 1994. These documents describe a program for collecting four rounds of wet weather and dry weather surface water samples and one round of sediment samples from UEFPC. They provide the strategy for the overall sample collection program including dry weather sampling, wet weather sampling, and sediment sampling. Figure 1.1 is a schematic flowchart of the overall sampling strategy and other associated activities. A Quality Assurance Project Plan (QAPJP) was prepared to specifically address four rounds of dry weather surface water sampling and one round of sediment sampling. For a variety of reasons, sediment sampling has not been conducted and has been deferred to the UEFPC CA Remedial Investigation (RI), as has wet weather sampling.

  18. Identification of drought-responsive miRNAs and physiological characterization of tea plant (Camellia sinensis L.) under drought stress.

    Science.gov (United States)

    Guo, Yuqiong; Zhao, Shanshan; Zhu, Chen; Chang, Xiaojun; Yue, Chuan; Wang, Zhong; Lin, Yuling; Lai, Zhongxiong

    2017-11-21

    Drought stress is one of the major natural challenges in the main tea-producing regions of China. The tea plant (Camellia sinensis) is a traditional beverage plant whose growth status directly affects tea quality. Recent studies have revealed that microRNAs (miRNAs) play key functions in plant growth and development. Although some miRNAs have been identified in C. sinensis, little is known about their roles in the drought stress response of tea plants. Physiological characterization of Camellia sinensis 'Tieguanyin' under drought stress showed that the malondialdehyde concentration and electrical conductivity of leaves of drought-stressed plants increased when the chlorophyll concentration decreased under severe drought stress. We sequenced four small-RNA (sRNA) libraries constructed from leaves of plants subjected to four different treatments, normal water supply (CK); mild drought stress (T1); moderate drought stress (T2) and severe drought stress (T3). A total of 299 known mature miRNA sequences and 46 novel miRNAs were identified. Gene Ontology enrichment analysis revealed that most of the differentially expressed-miRNA target genes were related to regulation of transcription. Kyoto Encyclopedia of Genes and Genomes analysis revealed that the most highly enriched pathways under drought stress were D-alanine metabolism, sulfur metabolism, and mineral absorption pathways. Real-time quantitative PCR (qPCR) was used to validate the expression patterns of 21 miRNAs (2 up-regulated and 19 down-regulated under drought stress). The observed co-regulation of the miR166 family and their targets ATHB-14-like and ATHB-15-like indicate the presence of negative feedback regulation in miRNA pathways. Analyses of drought-responsive miRNAs in tea plants showed that most of differentially expressed-miRNA target genes were related to regulation of transcription. The results of study revealed that the expressions of phase-specific miRNAs vary with morphological, physiological, and

  19. Characterization of Potential Plant Growth Promoting Rhizobacteria Isolated from Maize (Zea mays L. in Central and Northern Benin (West Africa

    Directory of Open Access Journals (Sweden)

    Nadège A. Agbodjato

    2015-01-01

    Full Text Available Our study aims to characterize Plant Growth Promoting Rhizobacteria (PGPR isolated from maize roots in five agroecological zones of central and northern Benin. Sixty samples were collected at the rate of four samples per village and three villages per agroecological zone. Rhizobacteria strains were isolated from these samples and biochemically characterized. These strains were analyzed for some of their PGPR traits like ammonia production and hydrogen cyanide following conventional methods. Microbiological investigation of these samples has shown that maize rhizospheres in central and northern Benin contain a high diversity of microorganisms. A total of nine species of maize Plant Growth Promoting Rhizobacteria were identified. Those PGPR include five Bacillus species (B. polymyxa, B. pantothenticus, B. anthracis, B. thuringiensis, and B. circulans, three Pseudomonas species (P. cichorii, P. putida, and P. syringae, and Serratia marcescens. The microbial diversity does not depend on the soil types. The microbial density, generally high, varies according to both soil types and agroecological zones. All Serratia strains (100% have produced ammonia, whereas 80% of Bacillus and 77.77% of Pseudomonas produced this metabolite. The hydrogen cyanide was produced by all isolates (100% independent of their genus. These results suggest the possibility to use these rhizobacteria as biological fertilizers to increase maize production.

  20. Assessment of Innovation Competency

    DEFF Research Database (Denmark)

    Nielsen, Jan Alexis

    2015-01-01

    of the recorded talk in interaction that occurred in teacher group discussion sessions at 5 upper secondary schools. Based on the analysis, it was possible to extrapolate assessment criteria for 5 subcompetencies relevant to innovation (creative competency, collaboration competency, navigation competency, action...... competency, and communication competency) as well as assessment criteria for a number of skills relevant to these subcompetencies. These assessment criteria, it is argued, largely resonate with existing literature and they provide a detailed glimpse into how assessment of innovation competency could...

  1. SAP Nuclear Competence Centre

    International Nuclear Information System (INIS)

    Andrlova, Z.

    2009-01-01

    In this issue we continue and introduce the SAP Nuclear Competence Centre and its head Mr. Igor Dzama. SAP Nuclear Competence Centrum is one of the fi rst competence centres outside ENEL headquarters. It should operate in Slovakia and should have competencies within the whole Enel group. We are currently dealing with the issues of organisation and funding. We are trying to balance the accountability to the NPP directors and to the management of the competence centres at Enel headquarters; we are looking at the relations between the competence centres within the group and defining the services that we will provide for the NPPs. author)

  2. Radiation release characterization of PWR spent fuel assemblies generated from Korean nuclear power plants

    Directory of Open Access Journals (Sweden)

    Moon Hyun Joo

    2009-01-01

    Full Text Available Spent nuclear fuel should be kept under safe management until it is disposed of permanently. Because of this, it is important to understand its radiation release characteristics. In this paper, the Monte Carlo method is applied to evaluate the radiation release characteristics of two types of PWR spent fuel assembly generated from the operating plants in Korea: Westinghouse and Korea Standard Nuclear Power Plant. The source terms were calculated using ORIGEN-ARP. The neutron and photon (or gamma dose distributions along the vertical and horizontal directions of each spent fuel assembly were evaluated using MCNPX code. Compared with the two dose distributions, the photon dose was found to be about 105 times higher than the neutron dose.

  3. Characterization of Radiation Fields in Biological Shields of Nuclear Power Plants for Assessing Concrete Degradation*

    Directory of Open Access Journals (Sweden)

    Remec Igor

    2016-01-01

    Full Text Available Life extensions of nuclear power plants to 60 and potentially 80 years of operation have renewed interest in long-term material degradation. One material being considered is concrete, with a particular focus on radiation-induced effects. Based on the projected neutron fluence values (E > 0.1 MeV in the concrete biological shields of the US pressurized water reactor fleet and the available data on radiation effects on concrete, some decrease in mechanical properties of concrete cannot be ruled out during extended operation beyond 60 years. An expansion of the irradiated concrete database and a reliable determination of relevant neutron fluence energy cutoff value are necessary to ensure reliable risk assessment for extended operation of nuclear power plants.

  4. Characterization of Radiation Fields in Biological Shields of Nuclear Power Plants for Assessing Concrete Degradationa

    Energy Technology Data Exchange (ETDEWEB)

    Remec, Igor [ORNL; Rosseel, Thomas M [ORNL; Field, Kevin G [ORNL; Le Pape, Yann [ORNL

    2016-01-01

    Life extensions of nuclear power plants to 60 and potentially 80 years of operation have renewed interest in long-term material degradation. One material being considered is concrete, with a particular focus on radiation-induced effects. Based on the projected neutron fluence values (E > 0.1 MeV) in the concrete biological shields of the US pressurized water reactor fleet and the available data on radiation effects on concrete, some decrease in mechanical properties of concrete cannot be ruled out during extended operation beyond 60 years. An expansion of the irradiated concrete database and a reliable determination of relevant neutron fluence energy cutoff value are necessary to ensure reliable risk assessment for extended operation of nuclear power plants.

  5. Competences and life management programmes

    International Nuclear Information System (INIS)

    Brunatti, S.; Bergara, A.; Ranalli, J.; Versaci, R.

    2007-01-01

    surveillance. In some cases, it may be impossible to rebuild information. As a consequence assumptions may have to be made that cannot be easily substantiated. It is therefore essential that the strategies for plant life management are developed with sufficient clarity to enable the associated human resource strategy or long term Human Resources plan to be developed. This strategy/plan should be reviewed and updated periodically to verify that it is consistent with and supports the nuclear power plant life cycle needs. In this work we analyze the competences of young peoples for working in the Life Management and Life Extension of Nuclear Power Plants Programmes. Competences and skills are understood as including knowing and understanding (theoretical knowledge of an academic field, the capacity to know and understand), knowing how to act (practical and operational application of knowledge to certain situations), knowing how to be (values as an integral element of the way of perceiving and living with others and in a social context). Competences represent a combination of attributes (with respect to knowledge and its application, attitudes, skills and responsibilities) that describe the level or degree to which a person is capable of performing them. In this context, a competence or a set of competences mean that a person puts into play a certain capacity or skill and performs a task, where he/she is able to demonstrate that he/she can do so in a way that allows evaluation of the level of achievement. Competences can be carried out and assessed. It also means that a normally person does not either possess or lack a competence in absolute terms, but commands it to a varying degree, so that competences can be placed on a continuum. The following was taken as a working classification: - Instrumental Competences: Those having an instrumental function. They include: Cognitive abilities, capacity to understand and manipulate ideas and thoughts; Methodological capacities to

  6. Radiological characterization of waste products at a catalan drinking water treatment plant

    OpenAIRE

    Camacho García, Antonia; Montaña Gurrera, Montserrat; Serrano Carreño, M. Isabel; Blázquez Pérez, Sonia M.; Montes, Sergio; Ganzer Martí, Marta; Devesa, Ricard; Duch Guillen, María Amor

    2014-01-01

    Conventional Drinking Water Treatment Plants (DWTPs) have a fairly standard sequence of processes which essentially consist of solid separation using either physical processes such as settling and filtration, or chemical processes such as coagulation and disinfection. Consequently, large quantities of solid wastes (sludge, filtration media, exhausted ion exchange resin and astewaters) are generated every year by DWTPs. These solid wastes may contain all kinds of pollutants, some with signi...

  7. Molecular characterization of pathogenic Fusarium species in cucurbit plants from Kermanshah province, Iran.

    Science.gov (United States)

    Chehri, K; Salleh, B; Yli-Mattila, T; Reddy, K R N; Abbasi, S

    2011-10-01

    Fusarium is one of the important phytopathogenic genera of microfungi causing serious losses on cucurbit plants in Kermanshah province, the largest area of cucurbits plantation in Iran. Therefore, the objectives in this study were to isolate and identify disease-causing Fusarium spp. from infected cucurbit plants, to ascertain their pathogenicity, and to determine their phylogenetic relationships. A total of 100 Fusarium isolates were obtained from diseased cucurbit plants collected from fields in different geographic regions in Kermanshah province, Iran. According to morphological characters, all isolates were identified as Fusarium oxysporum, Fusarium proliferatum, Fusarium equiseti, Fusarium semitectum and Fusarium solani. All isolates of the five Fusarium spp. were evaluated for their pathogenicity on healthy cucumber (Cucumis sativus) and honeydew melon (Cucumis melo) seedlings in the glasshouse. F. oxysporum caused damping-off in 20-35 days on both cucurbit seedlings tested. Typical stem rot symptoms were observed within 15 days after inoculation with F. solani on both seedlings. Based on the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA) restriction fragment length polymorphism (RFLP) analysis, the five Fusarium species were divided into two major groups. In particular, isolates belonging to the F. solani species complex (FSSC) were separated into two RFLP types. Grouping among Fusarium strains derived from restriction analysis was in agreement with criteria used in morphological classification. Therefore, the PCR-ITS-RFLP method provides a simple and rapid procedure for the differentiation of Fusarium strains at species level. This is the first report on identification and pathogenicity of major plant pathogenic Fusarium spp. causing root and stem rot on cucurbits in Iran.

  8. Isolation and characterization of plant growth promoting traits of a rhizobacteria: Pantoea agglomerans lma2.

    Science.gov (United States)

    Silini-Chérif, H; Silini, A; Ghoul, M; Yadav, S

    2012-03-15

    The use of microbial technology in agriculture is expanding quickly with the identification of new bacterial strains which are more effective in promoting the growth of plants. The rhizobacteria that promote the growth of plants can have a positive effect on the productivity of crops especially when subjected to salt stress. A nitrogen-fixing bacterium was isolated from the wheat rhizosphere of an arid region. The strain was identified on the basis of tests API20E and 16S rRNA sequencing, as Pantoea agglomerans lma2. This strain degraded several carbon sources: sugars (fructose, ribose, dextrin, salicin...), lipids (lecithin, tributyrin and tween 80), proteins (gelatin, casein), grew on KCN and could grow from pH 4 to 8 and had an optimum at pH 7. The growth temperature showed a maximum at 30 degrees C and the bacteria could tolerate from 4 to 41 degrees C and the growth rate was higher when the NaCl concentration was between 100 and 300 mM. The performance of activities enhancing the growth of plants of P. agglomerans lma2 was significantly better in the presence of salt. Rates of Indole Acetic Acid (IAA), siderophores production and solubilization of phosphate increased between 100 and 400 mM NaCl compared to the control without salt. The maximum values were saved to 300 mM for the production of siderophores (18.32%) and solubilization of phosphate (1061.49 microg mL(-1)) and 100 mM for the production of IAA (161 microg mL(-1)). A significant correlation existed between these three activities. These results showed that P. agglomerans lma2 with its Plant Growth Promoting Rhizobacteria (PGPR) and halophilic properties could constitute a good fertilizer in arid and saline zone.

  9. Characterization of nonderivatized plant cell walls using high-resolution solution-state NMR spectroscopy

    Science.gov (United States)

    Daniel J. Yelle; John Ralph; Charles R. Frihart

    2008-01-01

    A recently described plant cell wall dissolution system has been modified to use perdeuterated solvents to allow direct in-NMR-tube dissolution and high-resolution solution-state NMR of the whole cell wall without derivatization. Finely ground cell wall material dissolves in a solvent system containing dimethylsulfoxide-d6 and 1-methylimidazole-d6 in a ratio of 4:1 (v/...

  10. Molecular characterization of homologues of both subunits A (SPO11) and B of the archaebacterial topoisomerase 6 in plants.

    Science.gov (United States)

    Hartung, F; Puchta, H

    2001-06-13

    The Spo11 protein is an eukaryotic homologue of the topoisomerase 6 subunit A from archaebacteria. In yeast Spo11p has been found to bind covalently to double-strand breaks (DSBs) during meiosis. Single homologues of the SPO11 gene exist in various eukaryotes, except plants. Previously, we found in the Arabidopsis thaliana genome two ancient paralogs, AtSPO11-1 and 2. Here we report on the molecular characterization of a third one, AtSPO11-3. This puzzling finding might be explained by the fact that we detected additionally--for the first time outside of the archaebacterial kingdom--a homologue of the subunit B of topoisomerase 6, AtTOP6B. Both AtSPO11-3 and AtTOP6B are abundantly expressed in Arabidopsis and EST comparisons indicate the presence of both genes in various plant species. Via two hybrid studies we could demonstrate that full length AtTop6B is able to interact with AtSpo11-2 and 3 but not with AtSpo11-1. Our data suggest that plants possess in contrast to other eukaryotes an additional archaebacterial kind of topoisomerase.

  11. Green synthesis and characterization of silver nanoparticles using aqueous petal extract of the medicinal plant Combretum indicum

    Science.gov (United States)

    Bahuguna, Gaurav; Kumar, Amit; Mishra, Neeraj K.; Kumar, Chitresh; Bahlwal, Aseema; Chaudhary, Pratibha; Singh, Rajeev

    2016-07-01

    For the first time, any type of plant extract from the medicinally important plant Combretum indicum has been used for the biosynthesis of silver nanoparticles (AgNPs). The present investigation reports the synthesis and characterization of AgNPs using the flower petal extract of Combretum indicum. For monitoring the formation and optical properties of the synthesized nanoparticles, they were analyzed using UV-visible spectroscopy. Apart from this, the luminescence properties were also studied by photoluminescence (PL) spectroscopy. Scanning electron microscopy (SEM) analysis revealed the formation of AgNPs and the surface morphology has been determined. The mean particle diameter using the dynamic light scattering (DLS) technique ranged from 50-120 nm depending upon the reaction time. The atomic percentage of Ag in synthesized NPs and the crystallinity were determined by energy dispersive x-ray (EDX) and x-ray diffraction (XRD), respectively. This green approach of synthesizing AgNPs, using a biologically important plant extract is found to be cost effective, economical, eco-friendly and convenient in synthesis.

  12. Ecology and characterization of polyhydroxyalkanoate-producing microorganisms on and in plants.

    Science.gov (United States)

    Gasser, Ilona; Müller, Henry; Berg, Gabriele

    2009-10-01

    Polyhydroxyalkanoates are energy reserve polymers produced by bacteria to survive periods of starvation in natural habitats. Little is known about the ecology of polyhydroxyalkanoate-producing bacteria. To analyse the occurrence of this specific group on/in seven different plant species, a combined strategy containing culture-dependent and -independent methods was applied. Using microbial fingerprint techniques (single-strand conformation polymorphism analysis with specific primers for phaC gene encoding the key enzyme of the polyhydroxyalkanoate synthesis), a high number of bands were especially found for the rhizosphere. Furthermore, cluster analysis revealed plant species-specific communities. Isolation of bacteria, recognition of brightly refractile cytoplasmatic inclusions, lipophilic stainings and a PCR strategy targeted on the phaC gene were used as a culture-dependent strategy for the detection of polyhydroxyalkanoate-producing bacteria. Results again represent a high degree of plant specificity: the rhizosphere of sugar beet contained the highest number of positive strains. This was confirmed by quantitative PCR: the relative copy number of phaC was statistically and significantly enhanced in all rhizospheres in comparison with bulk soil. New polyhydroxyalkanoate-producing bacterial species were detected: for example, Burkholderia terricola, Lysobacter gummosus, Pseudomonas extremaustralis, Pseudomonas brassicacearum and Pseudomonas orientalis. Our results confirm the hypothesis that the rhizosphere is an interesting hidden reservoir for polyhydroxyalkanoate producers.

  13. Characterization of a Type 1 Metallothionein Gene from the Stresses-Tolerant Plant Ziziphus jujuba

    Directory of Open Access Journals (Sweden)

    Mingxia Yang

    2015-07-01

    Full Text Available Plant metallothioneins (MTs are a family of low molecular weight, cysteine-rich, and metal-binding proteins, which play an important role in the detoxification of heavy metal ions, osmotic stresses, and hormone treatment. Sequence analysis revealed that the open-reading frame (ORF of ZjMT was 225 bp, which encodes a protein composed of 75 amino acid residues with a calculated molecular mass of 7.376 kDa and a predicated isoelectric point (pI of 4.83. ZjMT belongs to the type I MT, which consists of two highly conserved cysteine-rich terminal domains linked by a cysteine free region. Our studies showed that ZjMT was primarily localized in the cytoplasm and the nucleus of cells and ZjMT expression was up-regulated by NaCl, CdCl2 and polyethylene glycol (PEG treatments. Constitutive expression of ZjMT in wild type Arabidopsis plants enhanced their tolerance to NaCl stress during the germination stage. Compared with the wild type, transgenic plants accumulate more Cd2+ in root, but less in leaf, suggesting that ZjMT may have a function in Cd2+ retension in roots and, therefore, decrease the toxicity of Cd2+.

  14. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses.

    Science.gov (United States)

    Jansen, Jeroen J; van Dam, Nicole M; Hoefsloot, Huub C J; Smilde, Age K

    2009-12-16

    Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their favorable nutritional properties for humans. Each responding compound may have its own dynamic profile and metabolic relationships with other compounds. The chemical background of the induced response is therefore highly complex and may therefore not reveal all the properties of the response in any single model. This study therefore aims to describe the dynamics of the glucosinolate response, measured at three time points after induction in a feral Brassica, by a three-faceted approach, based on Principal Component Analysis. First the large-scale aspects of the response are described in a 'global model' and then each time-point in the experiment is individually described in 'local models' that focus on phenomena that occur at specific moments in time. Although each local model describes the variation among the plants at one time-point as well as possible, the response dynamics are lost. Therefore a novel method called the 'Crossfit' is described that links the local models of different time-points to each other. Each element of the described analysis approach reveals different aspects of the response. The crossfit shows that smaller dynamic changes may occur in the response that are overlooked by global models, as illustrated by the analysis of a metabolic profiling dataset of the same samples.

  15. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    Directory of Open Access Journals (Sweden)

    Smilde Age K

    2009-12-01

    Full Text Available Abstract Background Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their favorable nutritional properties for humans. Each responding compound may have its own dynamic profile and metabolic relationships with other compounds. The chemical background of the induced response is therefore highly complex and may therefore not reveal all the properties of the response in any single model. Results This study therefore aims to describe the dynamics of the glucosinolate response, measured at three time points after induction in a feral Brassica, by a three-faceted approach, based on Principal Component Analysis. First the large-scale aspects of the response are described in a 'global model' and then each time-point in the experiment is individually described in 'local models' that focus on phenomena that occur at specific moments in time. Although each local model describes the variation among the plants at one time-point as well as possible, the response dynamics are lost. Therefore a novel method called the 'Crossfit' is described that links the local models of different time-points to each other. Conclusions Each element of the described analysis approach reveals different aspects of the response. The crossfit shows that smaller dynamic changes may occur in the response that are overlooked by global models, as illustrated by the analysis of a metabolic profiling dataset of the same samples.

  16. Competencies of engineering staff in steelworks after their restructuring

    Directory of Open Access Journals (Sweden)

    K. SzczepańsKa-Woszczyna

    2016-04-01

    Full Text Available In the article changes in competencies of engineering staff were presented. The key element of the competencies is metallurgical knowledge. After restructuring process the scale of competencies was widened. Particular changes after restructuring were characterized. Competencies were identified from a broad range of literature and then rated by 101 respondents, managers in terms of importance to jobs of engineers The background for the case study was Human Resources data from ArcelorMittal, Poland.

  17. Hypothesis: Sparse floor vegetation is on account of Inter-plant ...

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Plant Interactions: Plant Interactions: Allelospoly: Interacting plants Compete for Resources. Allelopathy: Plant releases chemicals for keeping away competitors.

  18. Characterization of the internal resistance of a plant microbial fuel cell

    NARCIS (Netherlands)

    Timmers, R.A.; Strik, D.P.B.T.B.; Hamelers, H.V.M.; Buisman, C.J.N.

    2012-01-01

    The objective of this research was to clarify the internal resistance of the PMFC. To characterize internal resistances of the PMFC current interrupt and polarization were used, and partial resistances were calculated. The internal resistance consisted mainly of anode resistance and membrane

  19. Captive bubble and sessile drop surface characterization of a submerged aquatic plant, Hydrilla verticillata

    Science.gov (United States)

    The surface energy parameters of the invasive aquatic weed, Hydrilla verticillata, were determined using contact angle measurements using two different methods. The abaxial and adaxial surfaces of the leaves and stem were characterized for the weed while submerged in water using captive air and octa...

  20. Ash chemistry in MSW incineration plants: Advanced characterization and thermodynamic considerations

    Energy Technology Data Exchange (ETDEWEB)

    Frandsen, Flemming J.; Laursen, Karin; Arvelakis, S. (and others)

    2004-07-15

    A number of ash samples where collected at four Danish municipal solid waste incineration (MSWI) plants. Samples of bottom ash/slag, 2nd-3rd pass ashes and ESP/E-filter ash were collected at the plants. The ashes were analyzed by a number of standard chemical analyses, and a number of advanced analytical techniques. The wet chemical analyses of the different ash fractions revealed that residual ash is formed on the grate by interaction of the main ash forming elements, Al, Ca, Fe and Si. Some of this ash is entrained from the grate and carried with the flue gas along the flue gas duct, where volatile species of K, Na, Pb, Zn, Cl and S starts to condense heterogeneously on the fly ash, thereby causing a dilution of the main ash forming elements. When compared plant-by-plant, the ash chemical analyses showed that the plant with the highest S-content in the fly ash is the one with the most often operational problems in relation to deposition, while a high Cl-content is indicative of a high corrosive potential. An existing Computer Controlled Scanning Electron Microscopy (CCSEM) algorithm was extended with chemical classes covering Pb- and Zn-rich phases. This has made it possible also to analyze MSW-derived ashes by use of CCSEM. Representative samples of 2nd-3rd pass and ESP/E-filter ashes from the four plants have been analyzed by Quantitative X-Ray Diffraction (QXRD) analysis. Only a few crystalline phases were identified: KCl, NaCl, CaSO{sub 4}, SiO{sub 2} and CaCO{sub 3} being the main ones. No crystalline phases containing Pb or Zn were identified by QXRD. A comparison between CCSEM and QXRD revealed the expected surface nature of the CCSEM analysis. Samples of 2nd-3rd pass and ESP/E-filter ash from the four plants where investigated for melting behavior in the Simultaneous Thermal Analyzer (STA). It was shown that it is possible to quantify the melting behavior of these ashes, and that the melting goes on in two steps (salts followed by silicates/oxides). The

  1. Biogenesis of silver nanoparticles using selected plant leaf extract; characterization and comparative analysis of their antimicrobial activity

    Directory of Open Access Journals (Sweden)

    Nagarajan Arumugam

    2017-10-01

    Full Text Available Objective(s: To study the antimicrobial property of green synthesised silver nano metals with M.balbisiana, A.indica and O.tenuiflorm and their enhanced antibacterial activity, assessment of antimicrobial effect. And to explore the possible mechanism of AgNPs synthesis in the active constitutions of selected temperate plant extracts Materials and methods:Biosynthesis of AgNPs using plant extract was carried out and formation of AgNPs confirmed by perceptible observation, UV spectroscopy, Scanning electron microscope (SEM and Dynamic light scattering (DLS were used to characterize the AgNPs.  Results:Screening of the M.balbisiana, A.indica and O.tenuiflorm extracts was carried out using standard methods to find their constitutions. The antibacterial screening was carried out by agar well diffusion method against selected microorganisms. The absorption maxima of UV visible spectrum found in the range between 300 nm to 800 nm confirmed the formation of AgNPs. SEM images revealed relatively spherical shaped of AgNPs of biosynthesized AgNPs with mean diameter about 14.51±1.5nm in O.tenuiflourum, 09.10±1.50nm M.barbisiana and 11.00±1.50 in A indica. FTIR results expounded the functional groups of plant extract responsible for the bio-reduction of silver ions and their interaction between them. Conclusion:These results showed with changes in plants constituents are may be responsible to form nanoparticles with different size and characteristics

  2. Developing mathematical modelling competence

    DEFF Research Database (Denmark)

    Blomhøj, Morten; Jensen, Tomas Højgaard

    2003-01-01

    In this paper we introduce the concept of mathematical modelling competence, by which we mean being able to carry through a whole mathematical modelling process in a certain context. Analysing the structure of this process, six sub-competences are identified. Mathematical modelling competence...... cannot be reduced to these six sub-competences, but they are necessary elements in the development of mathematical modelling competence. Experience from the development of a modelling course is used to illustrate how the different nature of the sub-competences can be used as a tool for finding...... the balance between different kinds of activities in a particular educational setting. Obstacles of social, cognitive and affective nature for the students' development of mathematical modelling competence are reported and discussed in relation to the sub-competences....

  3. Friend or foe: genetic and functional characterization of plant endophytic Pseudomonas aeruginosa.

    Science.gov (United States)

    Kumar, A; Munder, A; Aravind, R; Eapen, S J; Tümmler, B; Raaijmakers, J M

    2013-03-01

    Endophytic Pseudomonas aeruginosa strain BP35 was originally isolated from black pepper grown in the rain forest in Kerala, India. Strain PaBP35 was shown to provide significant protection to black pepper against infections by Phytophthora capsici and Radopholus similis. For registration and implementation in disease management programmes, several traits of PaBP35 were investigated including its endophytic behaviour, biocontrol activity, phylogeny and toxicity to mammals. The results showed that PaBP35 efficiently colonized black pepper shoots and displayed a typical spatiotemporal pattern in its endophytic movement with concomitant suppression of Phytophthora rot. Confocal laser scanning microscopy revealed high populations of PaBP35::gfp2 inside tomato plantlets, supporting its endophytic behaviour in other plant species. Polyphasic approaches to genotype PaBP35, including BOX-PCR, recN sequence analysis, multilocus sequence typing and comparative genome hybridization analysis, revealed its uniqueness among P. aeruginosa strains representing clinical habitats. However, like other P. aeruginosa strains, PaBP35 exhibited resistance to antibiotics, grew at 25-41°C and produced rhamnolipids and phenazines. PaBP35 displayed strong type II secretion effectors-mediated cytotoxicity on mammalian A549 cells. Coupled with pathogenicity in a murine airway infection model, we conclude that this plant endophytic strain is as virulent as clinical P. aeruginosa strains. Safety issues related to the selection of plant endophytic bacteria for crop protection are discussed. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  4. Preparation of efficient excision repair competent cell-free extracts from C. reinhardtii cells.

    Directory of Open Access Journals (Sweden)

    Vishalsingh Chaudhari

    Full Text Available Chlamydomonas reinhardtii is a prospective model system for understanding molecular mechanisms associated with DNA repair in plants and algae. To explore this possibility, we have developed an in vitro repair system from C. reinhardtii cell-free extracts that can efficiently repair UVC damage (Thymine-dimers in the DNA. We observed that excision repair (ER synthesis based nucleotide incorporation, specifically in UVC damaged supercoiled (SC DNA, was followed by ligation of nicks. Photoreactivation efficiently competed out the ER in the presence of light. In addition, repair efficiency in cell-free extracts from ER deficient strains was several fold lower than that of wild-type cell extract. Interestingly, the inhibitor profile of repair DNA polymerase involved in C. reinhardtii in vitro ER system was akin to animal rather than plant DNA polymerase. The methodology to prepare repair competent cell-free extracts described in the current study can aid further molecular characterization of ER pathway in C. reinhardtii.

  5. Isolation and characterization of polymorphic microsatellite loci from the invasive plant Solidago canadensis (Asteraceae).

    Science.gov (United States)

    Zhao, S-Y; Sun, S-G; Guo, Y-H; Chen, J-M; Wang, Q-F

    2012-02-17

    Solidago canadensis, a clonal herb originally from North America (common name: Canada goldenrod), is an invasive species in many countries. We developed microsatellite primers for this species. Eleven polymorphic loci were generated and primers were designed. Polymorphism of these 11 loci was assessed in 35 plants from two populations (Wuhan and Shanghai) in China. The number of alleles per locus ranged from 3 to 14. The observed and expected heterozygosities varied from 0.0732 to 0.7391 and from 0.1177 to 0.8687, respectively. These microsatellite markers will be useful tools for studies of population genetics in the native and invasive range of this species.

  6. Characterization of Malassezia Furfur and its control by using plant extracts

    Directory of Open Access Journals (Sweden)

    Vijayakumar R

    2006-01-01

    Full Text Available Malassezia furfur, a lipophilic, dimorphic and yeast-like fungus, occurring in human skin as an opportunistic pathogen, causes diseases such as dandruff, pityriasis versicolar, seborrheic dermatitis, etc. Suitable media for culturing the organism were standardized. A modified medium for the culturing of M. furfur has been proposed. Growth of the fungus was also determined in the presence of different carbon sources under the influence of different temperature, pH and salinity. Plant extracts of 19 species were screened against the growth of the fungus by using disc diffusion method and the results are discussed.

  7. Characterization of Oxidative Stability of Fish Oil- and Plant Oil-Enriched Skimmed Milk

    DEFF Research Database (Denmark)

    Saga, Linda C.; Kristinova, Vera; Kirkhus, Bente

    2013-01-01

    oil was added to fish oil in only 5 and 10 %, whereas no protective effect of camelina oil was observed when evaluated by these methods. Moreover, fish oil blended with oat oil conferred the lowest PV and lower amounts of volatile compounds during the storage period of 14 days at 4 °C. Surprisingly......The objective of this research was to determine the oxidative stability of fish oil blended with crude plant oils rich in naturally occurring antioxidants, camelina oil and oat oil, respectively, in bulk and after supplementation of 1 wt% of oil blends to skimmed milk emulsions. Ability of crude...

  8. Highlighting the Need for Systems-level Experimental Characterization of Plant Metabolic Enzymes

    Directory of Open Access Journals (Sweden)

    Martin Karl Magnus Engqvist

    2016-07-01

    Full Text Available The biology of living organisms is determined by the action and interaction of a large number of individual gene products, each with specific functions. Discovering and annotating the function of gene products is key to our understanding of these organisms. Controlled experiments and bioinformatic predictions both contribute to functional gene annotation. For most species it is difficult to gain an overview of what portion of gene annotations are based on experiments and what portion represent predictions. Here, I survey the current state of experimental knowledge of enzymes and metabolism in Arabidopsis thaliana as well as eleven economically important crops and forestry trees – with a particular focus on reactions involving organic acids in central metabolism. I illustrate the limited availability of experimental data for functional annotation of enzymes in most of these species. Many enzymes involved in metabolism of citrate, malate, fumarate, lactate, and glycolate in crops and forestry trees have not been characterized. Furthermore, enzymes involved in key biosynthetic pathways which shape important traits in crops and forestry trees have not been characterized. I argue for the development of novel high-throughput platforms with which limited functional characterization of gene products can be performed quickly and relatively cheaply. I refer to this approach as systems-level experimental characterization. The data collected from such platforms would form a layer intermediate between bioinformatic gene function predictions and in-depth experimental studies of these functions. Such a data layer would greatly aid in the pursuit of understanding a multiplicity of biological processes in living organisms.

  9. Isolation and characterization of chitinase genes from pitchers of the carnivorous plant Nepenthes khasiana.

    Science.gov (United States)

    Eilenberg, Haviva; Pnini-Cohen, Smadar; Schuster, Silvia; Movtchan, Anna; Zilberstein, Aviah

    2006-01-01

    The genus Nepenthes represents carnivorous plants with pitcher traps capable of efficient prey capture and digestion. The possible involvement of plant chitinases in this process was studied in Nepenthes khasiana. Two different types of endochitinases were identified in the liquid of closed traps exhibiting substrate specificity for either long chitin polymers or N-acetylglucosamine (GlcNAc) oligomers. Injection of chitin into such closed sterile pitchers induced the appearance of additional endochitinase isoenzymes, with substrate specificity only for long chitin polymers. No significant exochitinase (N-acetyl-beta-glucosaminidase) or chitobiosidase activity could be detected in the non-induced or induced trap liquid. Four genes representing two subgroups of basic chitinases, denoted as Nkchit1b and Nkchit2b, were isolated from the secretory region of N. khasiana pitchers. The main differences between the two subgroups are the presence of a proline-rich hinge region only in NkCHIT1b and a C-terminal putative vacuole targeting extension only in NkCHIT2b, indicating different compartmentalization of the two enzymes. Reverse transcription-polymerase chain reaction (RT-PCR) evaluation of mRNA levels showed that the Nkchit2b genes are constitutively expressed in the secretory cells while transcription of Nkchit1b genes is induced by chitin injection. These results show for the first time the involvement of genes encoding chitinases in prey-trap interaction and their differential expression and activity during prey trapping.

  10. Characterization and remediation of a former manufactured gas plant (MGP) disposal site

    International Nuclear Information System (INIS)

    Murarka, I.P.; Neuhauser, E.F.; Sherman, M.W.; Taylor, B.B.; Mauro, D.M.; Ripp, J.A.; Taylor, T.D.

    1993-01-01

    From the early 1800s through the late 1940s, the production of gas using coal, coke or oil resulted in generation of large volumes of residues including coal tar, lamp black and wood chips containing cyanides at manufactured gas plant (MGP) sites. Often, these tarry residues were disposed of by burial at or near these plants. In recent years, old MGP sites have come under increased scrutiny from environmental regulators. To address the issues of groundwater contamination and need for clean-up, it is necessary to accurately determine where the tarry materials are now located and how different chemicals released from tars have migrated away from their sources. EPRI research at a coal-tar disposal site in New York has focused on examining and evaluating conventional and innovative methods for sampling and analysis to delineate the nature and extent of subsurface contamination, and to assess the efficacy of remedial actions. This paper presents some of the results of this research and offers recommendations on conducting size investigations as well as selecting appropriate remediation measures

  11. Leachate characterization and performance evaluation of leachate treatment plant in Cipayung landfill, Indonesia

    Science.gov (United States)

    Noerfitriyani, E.; Hartono, D. M.; Moersidik, S. S.; Gusniani, I.

    2018-01-01

    The operation of landfill can cause environmental problems due to waste decomposition in the form of leachate production. Cipayung Landfill has a leachate treatment plant using stabilization ponds. The objective of this research is to evaluate the performance of stabilization ponds at Cipayung Landfill. The data were analyzed based on leachate samples from treatment unit’s influent and effluent under rainy season condition from April to May 2017. The results show the average leachate quality based on parameters of temperature by 34.81°C, Total Suspended Solid (TSS) of 72.33 mg/L, pH of 7.83, Biochemical Oxygen Demand (BOD) of 3,959.63 mg/L, Chemical Oxygen Demand (COD) of 6,860 mg/L, Total Nitrogen of 373.33 mg/L, and heavy metal Mercury of 0.0016 mg/L. The treatment plant’s effluent quality exceeds the leachate standard limit based on Indonesia’s Ministry of Environment and Forestry Law No. 59 of 2016. The results of design evaluation show that the anaerobic pond, facultative pond, and maturation pond system do not meet the design criteria. Therefore, a design improvement is needed to increase the performance of the leachate treatment plant and to ensure that the leachate discharged to water bodies does not exceed the standard limit to prevent contamination of the environment.

  12. Genetic uniformity characterizes the invasive spread of water hyacinth (Eichhornia crassipes), a clonal aquatic plant.

    Science.gov (United States)

    Zhang, Yuan-Ye; Zhang, Da-Yong; Barrett, Spencer C H

    2010-05-01

    Aquatic plant invasions are often associated with long-distance dispersal of vegetative propagules and prolific clonal reproduction. These reproductive features combined with genetic bottlenecks have the potential to severely limit genetic diversity in invasive populations. To investigate this question we conducted a global scale population genetic survey using amplified fragment length polymorphism markers of the world's most successful aquatic plant invader -Eichhornia crassipes (water hyacinth). We sampled 1140 ramets from 54 populations from the native (South America) and introduced range (Asia, Africa, Europe, North America, Central America and the Caribbean). Although we detected 49 clones, introduced populations exhibited very low genetic diversity and little differentiation compared with those from the native range, and approximately 80% of introduced populations were composed of a single clone. A widespread clone ('W') detected in two Peruvian populations accounted for 70.9% of the individuals sampled and dominated in 74.5% of the introduced populations. However, samples from Bangladesh and Indonesia were composed of different genotypes, implicating multiple introductions to the introduced range. Nine of 47 introduced populations contained clonal diversity suggesting that sexual recruitment occurs in some invasive sites where environmental conditions favour seedling establishment. The global patterns of genetic diversity in E. crassipes likely result from severe genetic bottlenecks during colonization and prolific clonal propagation. The prevalence of the 'W' genotype throughout the invasive range may be explained by stochastic sampling, or possibly because of pre-adaptation of the 'W' genotype to tolerate low temperatures.

  13. Spectroscopic characterization of DOM and the nitrogen removal mechanism during wastewater reclamation plant.

    Science.gov (United States)

    Wang, Lei; Li, Ying-Jun; Xiong, Ying; Tan, Wen-Bing; Zhang, Lie-Yu; Li, Xiang; Wang, Xiao-Shu; Xu, Jian-Feng; Li, Tong-Tong; Wang, Jin-Sheng; Cai, Ming-Xuan; Xi, Bei-Dou; Wang, Di-Hua

    2017-01-01

    The performance of the Sha-he wastewater reclamation plant was evaluated in this study. To remove residual nitrogen after Anaerobic-Anoxic-Oxic (A2O) treatment, three multistage Anoxic-Oxic (A/O) were added to investigate the nitrogen removal efficiency and its mechanism. In addition, the constituents and evolution of dissolved organic matter (DOM) during wastewater reclamation was also investigated using a method combining fluorescence spectroscopy with fluorescence regional integration (FRI). The results suggested that multistage A/O treatment can effectively improve the nitrogen removal ability under low concentrations of carbon sources. The total nitrogen (TN) exhibits significantly positive correlation with fulvic acid-like materials and humic acid-like materials. The correlation coefficient for TN and fulvic acid-like substances (R2 = 0.810, P nitrogen removal may be achieved with the fulvic-like and humic-like substances, and the removal effects were higher by fulvic acid-like substances than humic-like substances, mostly due to that the latter were relatively more difficult to be utilized as carbon source during the nitrogen removal process. The effluent water quality of biological treatment reached the first grade A standard of "Cities sewage treatment plant pollutant discharge standard" (GB18918-2002). In addition, the effluent from the membrane bioreactor reached the "Standards of reclaimed water quality" (SL368-2006).

  14. Isolation and characterization of antimicrobial compounds in plant extracts against multidrug-resistant Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    Yoko Miyasaki

    Full Text Available The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii.

  15. Site Selection and Characterization Status Report for Next Generation Nuclear Plant (NGNP)

    International Nuclear Information System (INIS)

    Holbrook, Mark

    2007-01-01

    In the near future, the US Department of Energy (DOE) will need to make important decisions regarding design and construction of the Next Generation Nuclear Plant (NGNP). One part of making these decisions is considering the potential environmental impacts that this facility may have, if constructed here at the Idaho National Laboratory (INL). The National Environmental Policy Act (NEPA) of 1969 provides DOE decision makers with a process to systematically consider potential environmental consequences of agency decisions. In addition, the Energy Policy Act of 2005 (Title VI, Subtitel C, Section 644) states that the 'Nuclear Regulatory Commission (NRC) shall have licensing and regulatory authority for any reactor authorized under this subtitle.' This stipulates that the NRC will license the NGNP for operation. The NRC NEPA Regulations (10 CFR Part 51) require tha thte NRC prepare an Environmental Impact Statement (EIS) for a permit to construct a nuclear power plant. The applicant is required to submit an Environmental report (ER) to aid the NRC in complying with NEPA.

  16. Building Project Competence

    DEFF Research Database (Denmark)

    Pemsel, Sofia; Wiewiora, Anna

    This research investigates the development of project competence, and particularly, three related dynamic capabilities (shifting, adapting, leveraging) that contribute to project competence development. In doing so, we make use of the emerging literature on knowledge governance and theorize how...... of dynamic capability building promoting project competence development....

  17. Screening and characterization of endophytic Bacillus and Paenibacillus strains from medicinal plant Lonicera japonica for use as potential plant growth promoters

    Directory of Open Access Journals (Sweden)

    Longfei Zhao

    2015-12-01

    Full Text Available Abstract A total of 48 endophytic bacteria were isolated from surface-sterilized tissues of the medicinal plant Lonicera japonica, which is grown in eastern China; six strains were selected for further study based on their potential ability to promote plant growth in vitro (siderophore and indoleacetic acid production. The bacteria were characterized by phylogenetically analyzing their 16S rRNA gene similarity, by examining their effect on the mycelial development of pathogenic fungi, by testing their potential plant growth-promoting characteristics, and by measuring wheat growth parameters after inoculation. Results showed that the number of endophytic bacteria in L. japonica varied among different tissues, but it remained relatively stable in the same tissues from four different plantation locations. Among the three endophytic strains, strains 122 and 124 both had high siderophore production, with the latter showing the highest phosphate solubilization activity (45.6 mg/L and aminocyclopropane-1-carboxylic acid deaminase activity (47.3 nmol/mg/h. Strain 170 had the highest indoleacetic acid (IAA production (49.2 mg/L and cellulase and pectinase activities. After inoculation, most of the six selected isolates showed a strong capacity to promote wheat growth. Compared with the controls, the increase in the shoot length, root length, fresh weight, dry weight, and chlorophyll content was most remarkable in wheat seedlings inoculated with strain 130. The positive correlation between enzyme (cellulose and pectinase activity and inhibition rate on Fusarium oxysporum, the IAA production, and the root length of wheat seedlings inoculated with each tested endophytic strain was significant in regression analysis. Deformity of pathogenic fungal mycelia was observed under a microscope after the interaction with the endophytic isolates. Such deformity may be directly related to the production of hydrolytic bacterial enzymes (cellulose and pectinase. The six

  18. Isolation and characterization of a replication-competent molecular clone of an HIV-1 circulating recombinant form (CRF33_01B.

    Directory of Open Access Journals (Sweden)

    Kok Keng Tee

    Full Text Available A growing number of emerging HIV-1 recombinants classified as circulating recombinant forms (CRFs have been identified in Southeast Asia in recent years, establishing a molecular diversity of increasing complexity in the region. Here, we constructed a replication-competent HIV-1 clone for CRF33_01B (designated p05MYKL045.1, a newly identified recombinant comprised of CRF01_AE and subtype B. p05MYKL045.1 was reconstituted by cloning of the near full-length HIV-1 sequence from a newly-diagnosed individual presumably infected heterosexually in Kuala Lumpur, Malaysia. The chimeric clone, which contains the 5' LTR (long terminal repeat region of p93JP-NH1 (a previously isolated CRF01_AE infectious clone, showed robust viral replication in the human peripheral blood mononuclear cells. This clone demonstrated robust viral propagation and profound syncytium formation in CD4+, CXCR4-expressing human glioma NP-2 cells, indicating that p05MYKL045.1 is a CXCR4-using virus. Viral propagation, however, was not detected in various human T cell lines including MT-2, M8166, Sup-T1, H9, Jurkat, Molt-4 and PM1. p05MYKL045.1 appears to proliferate only in restricted host range, suggesting that unknown viral and/or cellular host factors may play a role in viral infectivity and replication in human T cell lines. Availability of a CRF33_01B molecular clone will be useful in facilitating the development of vaccine candidates that match the HIV-1 strains circulating in Southeast Asia.

  19. Characterization for plant height and flowering date in the biological species oat

    Directory of Open Access Journals (Sweden)

    Rodrigo Rodrigues Matiello

    1999-08-01

    Full Text Available The use of wild oat races in artificial hybridization with cultivated oat (Avena sativa L. has been used as a way of increasing the variability. This work aimed to identify the variability for plant height and flowering date of groups of cultivated oat genotypes, wild introductions of A. fatua L. and segregating populations of natural crosses between A. sativa and A. fatua. Wide genetic variability was observed for both traits in the groups and between them. The wild group of A. fatua L. showed high plants with early maturity, but in the segregating group there was reduced plant height and early maturity. The wild introductions of A. fatua L. studied in this work can be used in oat breeding programs to increase genetic variability by transferring specific characters into the cultivated germ plasm.A utilização de raças silvestres em hibridações com o grupo cultivado em aveia (Avena sativa L. tem sido fonte de incremento da variabilidade genética. Desta forma, o presente trabalho foi desenvolvido com o objetivo de identificar e caracterizar a variabilidade genética dos caracteres morfo-fisiológicos estatura de planta e dias da emergência à floração em grupos de genótipos cultivados de aveia, introduções silvestres de A. fatua L., e em populações segregantes dos cruzamentos naturais de A. sativa x A. fatua. Ampla variabilidade genética foi revelada para os caracteres avaliados tanto dentro como entre os grupos. O grupo silvestre A. fatua demonstrou plantas de elevada estatura e precoces. Foi possível encontrar populações segregantes de A. sativa x A. fatua com reduzida estatura e precocidade. As introduções silvestres de A. fatua avaliadas neste trabalho podem ser utilizadas em programas de melhoramento para incrementar a variabilidade genética, pela transferência de caracteres específicos para o germoplasma cultivado.

  20. Purification and characterization of a beta-glucosidase from the root parasitic plant Orobanche minor Sm.

    Science.gov (United States)

    Sasanuma, Izumi; Hirakawa, Go

    2010-01-01

    The beta-glucosidase of a root parasitic angiosperm, Orobanche minor Sm., was purified and characterized. The optimum pH and temperature for activity of the enzyme were 5.0 and 50 degrees C. The beta-glucosidase was stable at up to 50 degrees C at pH 4.0-10.0. The M(r) was estimated to be 33 kD by SDS-PAGE. The enzyme hydrolyzed p-nitrophenyl-beta-D-glucopyranoside and salicin, but not the cell wall of O. minor or cellohexaose.

  1. Characterization of oils and chemical analyses of the seeds of wild plants.

    Science.gov (United States)

    Eromosele, I C; Eromosele, C O; Akintoye, A O; Komolafe, T O

    1994-12-01

    The Chemical compositions of the seeds of some wild plants have been investigated. The seeds of Hematostaphis berteri, Balanites aegytiaca and Ximenia americana contain high levels of oils with values in the range, 38.2-54.5% (w/w). The iodine values of the oils were determined and, for Ximenia americana, the value was high, i.e., 149.8 mg/100 g. The storage properties of the oil of Hematostaphis berteri were examined over a period of fifty six days by exposure to light at ambient temperature. The peroxide value of the oil over the period increased by 12-fold of its initial value of 27.5 mEq/kg, suggesting light susceptibility to photo-oxidative degradation. The proximate protein contents were low but the concentrations of mineral elements in the seeds examined were generally high, exceeding the values for the corresponding mesocarps by several orders of magnitude.

  2. Mössbauer characterization of feed coal, ash and fly ash from a thermal power plant

    International Nuclear Information System (INIS)

    Reyes Caballero, F.; Martínez Ovalle, S. A.; Moreno Gutiérrez, M.

    2015-01-01

    The aim of this work was apply 57 Fe Transmission Mössbauer Spectroscopy at room temperature in order to study the occurrence of iron-containing mineral phases in: 1) feed coal; 2) coal ash, obtained in different stages of the ASTM D3174 standard method; and 3) fly ash, produced when coal is burned in the TERMOPAIPA IV thermal power plant localized in Boyacá, Colombia. According to obtained results, we can conclude the occurrence of pyrite and jarosite in the feed coal; Fe 2+ and Fe 3+ crystalline paramagnetic phases, superparamagnetic hematite and hematite in coal ash; Fe 2+ and Fe 3+ noncrystalline and crystalline phases, magnetite and hematite in fly ash. Precisely, for a basic understanding, this work discusses some the possible transformations that take place during coal combustion

  3. Characterization of the cable fire in Block 1 of the Greifswald nuclear power plant

    International Nuclear Information System (INIS)

    Albrecht, L.; Gelfort, E.

    1996-01-01

    In December 1975 a cable fire was initiated in a stand-by power distribution by a short circuit and an incorrectly fitted diode. Unpredictably and accidentally, some control and power cables were destroyed during the fire. This caused the failure of safety-relevant components. Decay heat removal was achieved initially by natural convection in the primary loop, and finally by an emergency feed pump in the secondary loop, for which a preovisional power cable had been successfully installed after approximately 8.5 hours. This serious accident was caused by human failure and lack of experience, by the insufficiency of the redundancies as provided in the plant design, by the lack of spatial separation of safety systems, and by insufficient quality control. (orig.) [de

  4. Characterization of trace elements in Casearia medicinal plant by neutron activation analysis.

    Science.gov (United States)

    Yamashita, C I; Saiki, M; Vasconcellos, M B A; Sertié, J A A

    2005-01-01

    Leaves of Casearia sylvestris, Casearia decandra and Casearia obliqua plant species, collected at the Atlantic Forest in Brazil, were analyzed by using instrumental neutron activation analysis (INAA). Short and long irradiations using thermal neutron flux of the IEA-R1 nuclear reactor were carried out for these analyses. Concentrations of Ca, K and Mg were found in these samples at the percentage levels, Br, Cl, Fe, Mn, Na, Rb and Zn at the microg g(-1) levels and Co, Cr, Cs, La, and Sc at the microg kg(-1) levels. Comparisons were made among the element concentrations obtained in these three Casearia species and significant differences were found for the elements Cl, Co, Cs, Cr, La, Mn, Na and Sc. The precision and the accuracy of the results were evaluated by analyzing the certified reference materials NIST-1515 Apple Leaves and NIST-1573a Tomato Leaves.

  5. Radiochemical methodologies applied to analytical characterization of low and intermediate level wastes from nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Monteiro, Roberto Pellacani G.; Júnior, Aluísio Souza R.; Kastner, Geraldo F.; Temba, Eliane S.C.; Oliveira, Thiago C. de; Amaral, Ângela M.; Franco, Milton B., E-mail: rpgm@cdtn.br, E-mail: reisas@cdtn.br, E-mail: gfk@cdtn.br, E-mail: esct@cdtn.br, E-mail: tco@cdtn.br, E-mail: ama@cdtn.br, E-mail: francom@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2017-07-01

    The aim of this work is to present radiochemical methodologies developed at CDTN/CNEN in order to answer a program for isotopic inventory of radioactive wastes from Brazilian Nuclear Power Plants. In this program some radionuclides, {sup 3}H, {sup 14}C, {sup 55}Fe, {sup 59}Ni, {sup 63}Ni, {sup 90}Sr, {sup 93}Zr, {sup 94}Nb, {sup 99}Tc, {sup 129}I, {sup 235}U, {sup 238}U, {sup 238}Pu, {sup 239}+{sup 240}Pu, {sup 241}Pu, {sup 242}Pu, {sup 241}Am, {sup 242}Cm e {sup 243}+{sup 244}Cm, were determined in Low Level Wastes (LLW) and Intermediate Level Wastes (ILW) and a protocol of analytical methodologies based on radiochemical separation steps and spectrometric and nuclear techniques was established. (author)

  6. Functional Characterization of PaLAX1, a Putative Auxin Permease, in Heterologous Plant Systems

    Czech Academy of Sciences Publication Activity Database

    Hoyerová, Klára; Perry, Lucie; Hand, P.; Laňková, Martina; Kocábek, Tomáš; May, S.; Kottová, Jana; Pačes, Jan; Napier, R.; Zažímalová, Eva

    2008-01-01

    Roč. 146, č. 3 (2008), s. 1128-1141 ISSN 0032-0889 R&D Projects: GA ČR GP206/02/P106; GA ČR GA206/02/0967; GA AV ČR IAB6038203; GA AV ČR IAA6038303; GA AV ČR KJB600380702; GA MŠk(CZ) LC06034; GA MŠk(CZ) 1M0520 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50510513; CEZ:AV0Z50520514 Keywords : Plant hormones * auxin influx carrier * AUX1 * Arabidopsis * tobacco Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.110, year: 2008

  7. Characterization and engineering of glycosyltransferases responsible for steroid saponin biosynthesis in Solanaceous plants.

    Science.gov (United States)

    Kohara, Atsuko; Nakajima, Chiharu; Yoshida, Shigeo; Muranaka, Toshiya

    2007-02-01

    Solanaceous plants contain steroid saponins that have diverse biological and pharmacological activities. The structures of their sugar chains play an important role in their activities. A functional glucosyltransferase SaGT4A from Solanum aculeatissimum glucosylates both steroidal sapogenins and steroidal alkaloids. A potato (S. tuberosum) glycosyltransferase StSGT, which has a high degree of sequence homology with SaGT4A, exhibits the same substrate specificity toward steroidal compounds as SaGT4A. To identify the residues or domain structures responsible for these enzymatic activities, we determined the residues that are essential for SaGT4A activity, compared the specific activities of SaGT4A and StSGT, and constructed several SaGT4A/StSGT chimeric proteins, focusing on the donor-sugar recognition domain. These proteins were heterogeneously expressed in E. coli and purified, and their glycosyltransferase activities were evaluated using a coupled assay. His369 and Glu377, located in the consensus motif for plant glycosyltransferases, and Cys121, Cys247, and Cys370 were shown to be important for SaGT4A activity. StSGT exhibited more activity with UDP-galactose as a sugar donor than with UDP-glucose, whereas SaGT4A exhibited glucosyltransferase activity exclusively. The sugar selectivities of SaGT4A and StSGT were not altered by exchanging their domains, and some of the chimeric proteins showed no activity. These results suggest that the differences in the SaGT4A and StSGT amino acid sequences do not simply reflect their distinct sugar-donor specificities. We also successfully converted the non-functional SaGT4A homolog, SaGT4R, into an active glucosyltransferase.

  8. Biocontrol and Plant Growth Promotion Characterization of Bacillus Species Isolated from Calendula officinalis Rhizosphere.

    Science.gov (United States)

    Ait Kaki, Asma; Kacem Chaouche, Noreddine; Dehimat, Laid; Milet, Asma; Youcef-Ali, Mounia; Ongena, Marc; Thonart, Philippe

    2013-12-01

    The phenotypic and genotypic diversity of the plant growth promoting Bacillus genus have been widely investigated in the rhizosphere of various agricultural crops. However, to our knowledge this is the first report on the Bacillus species isolated from the rhizosphere of Calendula officinalis. 15 % of the isolated bacteria were screened for their important antifungal activity against Fusarium oxysporum, Botrytis cinerea, Aspergillus niger, Cladosporium cucumerinium and Alternaria alternata. The bacteria identification based on 16S r-RNA and gyrase-A genes analysis, revealed strains closely related to Bacillus amyloliquefaciens, B. velezensis, B. subtilis sub sp spizezenii and Paenibacillus polymyxa species. The electro-spray mass spectrometry coupled to liquid chromatography (ESI-LC MS) analysis showed that most of the Bacillus isolates produced the three lipopeptides families. However, the P. polymyxa (18SRTS) didn't produce any type of lipopeptides. All the tested Bacillus isolates produced cellulase but the protease activity was observed only in the B. amyloliquefaciens species (9SRTS). The Salkowsky colorimetric test showed that the screened bacteria synthesized 6-52 μg/ml of indole 3 acetic acid. These bacteria produced siderophores with more than 10 mm wide orange zones on chromazurol S. The greenhouse experiment using a naturally infested soil with Sclerotonia sclerotiorum showed that the B. amyloliquefaciens (9SRTS) had no significant (P > 0.05) effect on the pre-germination of the chickpea seeds. However, it increased the size of the chickpea plants and reduced the stem rot disease (P Bacillus strains isolated in this work may be further used as bioinoculants to improve the production of C. officinalis and other crop systems.

  9. Metagenomic characterization of biofilter microbial communities in a full-scale drinking water treatment plant.

    Science.gov (United States)

    Oh, Seungdae; Hammes, Frederik; Liu, Wen-Tso

    2018-01-01

    Microorganisms inhabiting filtration media of a drinking water treatment plant can be beneficial, because they metabolize biodegradable organic matter from source waters and those formed during disinfection processes, leading to the production of biologically stable drinking water. However, which microbial consortia colonize filters and what metabolic capacity they possess remain to be investigated. To gain insights into these issues, we performed metagenome sequencing and analysis of microbial communities in three different filters of a full-scale drinking water treatment plant (DWTP). Filter communities were sampled from a rapid sand filter (RSF), granular activated carbon filter (GAC), and slow sand filter (SSF), and from the Schmutzdecke (SCM, a biologically active scum layer accumulated on top of SSF), respectively. Analysis of community phylogenetic structure revealed that the filter bacterial communities significantly differed from those in the source water and final effluent communities, respectively. Network analysis identified a filter-specific colonization pattern of bacterial groups. Bradyrhizobiaceae were abundant in GAC, whereas Nitrospira were enriched in the sand-associated filters (RSF, SCM, and SSF). The GAC community was enriched with functions associated with aromatics degradation, many of which were encoded by Rhizobiales (∼30% of the total GAC community). Predicting minimum generation time (MGT) of prokaryotic communities suggested that the GAC community potentially select fast-growers (<15 h of MGT) among the four filter communities, consistent with the highest dissolved organic matter removal rate by GAC. Our findings provide new insights into the community phylogenetic structure, colonization pattern, and metabolic capacity that potentially contributes to organic matter removal achieved in the biofiltration stages of the full-scale DWTP. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Complementary Methods for the Characterization of Corrosion Products on a Plant-Exposed Superheater Tube

    DEFF Research Database (Denmark)

    Okoro, Sunday Chukwudi; Nießen, Frank; Villa, Matteo

    2017-01-01

    In this work, complex corrosion products on a superheater tube exposed to biomass firing were characterized by the complementary use of energy-dispersive synchrotron diffraction, electron microscopy, and energy-dispersive X-ray spectroscopy. Non-destructive synchrotron diffraction in transmission......-rich austenite phase to selective removal of Fe and Cr from the alloy, via a KCl-induced corrosion mechanism. Compositional variations were related to diffraction results and revealed a qualitative influence of the spinel cation concentration on the observed diffraction lines.......In this work, complex corrosion products on a superheater tube exposed to biomass firing were characterized by the complementary use of energy-dispersive synchrotron diffraction, electron microscopy, and energy-dispersive X-ray spectroscopy. Non-destructive synchrotron diffraction in transmission...... geometry measuring with a small gauge volume from the sample surface through the corrosion product allowed depth-resolved phase identification and revealed the presence of (Fe,Cr)2O3 and FeCr2O4. This was supplemented by microstructural and elemental analysis correlating the additional presence of a Ni...

  11. A review of characterization of tocotrienols from plant oils and foods.

    Science.gov (United States)

    Ahsan, Haseeb; Ahad, Amjid; Siddiqui, Waseem A

    2015-04-01

    Tocotrienols, members of the vitamin E family, are natural compounds found in a number of vegetable oils, wheat germ, barley and certain types of nuts and grains. Vegetable oils provide the best sources of these vitamin E forms, particularly palm oil and rice bran oil contain higher amounts of tocotrienols. Other sources of tocotrienols include grape fruit seed oil, oats, hazelnuts, maize, olive oil, buckthorn berry, rye, flax seed oil, poppy seed oil and sunflower oil. Tocotrienols are of four types, viz. alpha (α), beta (β), gamma (γ) and delta (δ). Unlike tocopherols, tocotrienols are unsaturated and possess an isoprenoid side chain. A number of researchers have developed methods for the extraction, analysis, identification and quantification of different types of vitamin E compounds. This article constitutes an in-depth review of the chemistry and extraction of the unsaturated vitamin E derivatives, tocotrienols, from various sources using different methods. This review article lists the different techniques that are used in the characterization and purification of tocotrienols such as soxhlet and solid-liquid extractions, saponification method, chromatography (thin layer, column chromatography, gas chromatography, supercritical fluid, high performance), capillary electrochromatography and mass spectrometry. Some of the methods described were able to identify one form or type while others could analyse all the analogues of tocotrienol molecules. Hence, this article will be helpful in understanding the various methods used in the characterization of this lesser known vitamin E variant.

  12. Characterization of large area ZnS(Ag) detector for gross alpha and beta activity measurements in tap water plants

    Energy Technology Data Exchange (ETDEWEB)

    Lunardon, M.; Cester, D.; Mistura, G.; Moretto, S.; Stevanato, L.; Viesti, G. [Department of Physics and Astronomy ' Galileo Galilei' , University of Padova, (Italy); Schotanus, P.; Bodewits, E. [SCIONIX Holland BV, (Netherlands)

    2015-07-01

    In this work we present the characterization of a large area 200 x 200 mm{sup 2} EJ-444 scintillation detector to be used for monitoring gross alpha and beta activity in tap water plants. Specific tests were performed to determine the best setup to readout the light from the detector side in order to have the possibility to stack many detectors and get a compact device with total active area of the order of 1 m{sup 2}. Alpha/Beta discrimination, efficiency and homogeneity tests were carried out with alpha and beta sources. Background from ambient radioactivity was measured as well. Alpha/beta real-time monitoring in drinking water is a goal of the EU project TAWARA{sub R}TM. (authors)

  13. Chemical characterization of bottom ashes generated during combustion of a Colombian mineral coal in a thermal power plant

    International Nuclear Information System (INIS)

    Pinheiro, H.S.; Nogueira, R.E.F.Q.; Lobo, C.J.S.; Nobre, A.I.S.; Sales, J.C.; Silva, C.J.M.

    2012-01-01

    Bottom ashes generated during combustion of a mineral coal from Colombia were characterized by X-ray fluorescence spectrometry and X-ray diffraction. The interest in this particular coal is due to the fact that it will be used by a thermal power plant in Ceara, Northeastern Brazil, where it could produce over 900 tons of different residues/combustion products every day. Results from Xray fluorescence allowed identification and quantification of elements present in the sample: silicon (59,17%), aluminum (13,17%), iron (10,74%), potassium (6,11%), titanium (2,91%), calcium (4,97%), sulphur (0,84%) and others (2,09%). The X-ray diffraction revealed patterns from silica, mullite, calcium sulphate and hydrated sodium. Results obtained so far indicate that the material is a potential raw-material for use in the formulation of ceramic components (author)

  14. Characterization of Pseudomonas Species Isolated from the Rhizosphere of Plants Grown in Serozem Soil, Semi-Arid Region of Uzbekistan

    Directory of Open Access Journals (Sweden)

    Dilfuza Egamberdiyeva

    2005-01-01

    Full Text Available Collections of native Pseudomonas spp. are kept at the NCAM of Uzbekistan. Some of those organisms were isolated from the rhizosphere of cotton, wheat, corn, melon, alfalfa, and tomato grown in field locations within a semi-arid region of Uzbekistan. Strains used for this study were Pseudomonas alcaligenes, P. aurantiaca, P. aureofaciens, P. denitrificans, P. mendocina, P. rathonis, and P. stutzeri. Some of the pseudomonads have been characterized in this report. These strains produced enzymes, phytohormone auxin (IAA, and were antagonist against plant pathogenic fungi in in vitro experiments. Most of the strains were salt tolerant and temperature resistant. Some of the Pseudomonas spp. isolated in this study have been found to increase the growth of wheat, corn, and tomato in pot experiments.

  15. Obtention and characterization of ceramic products with addition of the mineral coal bottom ashes from thermoelectric power plants

    International Nuclear Information System (INIS)

    Kniess, C.T.; Prates, P.B.; Brys, M.; Martins, G.J.; Riella, H.G.; Bernardin, A.

    2011-01-01

    The physical, chemical and mineralogical properties of mineral coal bottom ash derived from thermoelectric power plants are compatible with various raw materials used in ceramic industries, which indicates a possibility of partial or fully substitution of raw materials by this residue. This work intends to obtain and characterize ceramic products with additions of different percentages of bottom ash coal. For this, was used a commercial ceramic body (CI) made by an industry in the state of Santa Catarina. The formulations of the ceramics products were obtained by the mixture design (planning network Simplex). The byproduct of coal bottom ash was found to be an attractive raw material source of SiO 2 and Al 2 O 3 to obtain ceramic materials. Was demonstrated the possibility of developing a ceramic materials classified as semi-porous (6 10) with additions of up to 20% of coal bottom ash in the composition of the ceramic body. (author)

  16. Characterization of five typical agave plants used to produce mezcal through their simple lipid composition analysis by gas chromatography.

    Science.gov (United States)

    Martínez-Aguilar, Juan Fco; Peña-Alvarez, Araceli

    2009-03-11

    Five agave plants typically used in Mexico for making mezcal in places included in the Denomination of Origin (Mexican federal law that establishes the territory within which mezcal can be produced) of this spirit were analyzed: Agave salmiana ssp. crassispina, A. salmiana var. salmiana, Agave angustifolia, Agave cupreata, and Agave karwinskii. Fatty acid and total simple lipid profiles of the mature heads of each plant were determined by means of a modified Bligh-Dyer extraction and gas chromatography. Sixteen fatty acids were identified, from capric to lignoceric, ranging from 0.40 to 459 microg/g of agave. Identified lipids include free fatty acids, beta-sitosterol, and groups of mono-, di-, and triacylglycerols, their total concentration ranging from 459 to 992 microg/g of agave. Multivariate analyses performed on the fatty acid profiles showed a close similarity between A. cupreata and A. angustifolia. This fact can be ascribed to the taxa themselves or differences in growing conditions, an issue that is still to be explored. These results help to characterize the agaves chemically and can serve to relate the composition of mezcals from various states of Mexico with the corresponding raw material.

  17. Characterization and assessment of contaminated soil and groundwater at an organic chemical plant site in Chongqing, Southwest China.

    Science.gov (United States)

    Liu, Geng; Niu, Junjie; Zhang, Chao; Guo, Guanlin

    2016-04-01

    Contamination from organic chemical plants can cause serious pollution of soil and groundwater ecosystems. To characterize soil contamination and to evaluate the health risk posed by groundwater at a typical organic chemical plant site in Chongqing, China, 91 soil samples and seven groundwater samples were collected. The concentrations of different contaminants and their three-dimensional distribution were determined based on the 3D-krige method. Groundwater chemistry risk index (Chem RI) and cancer risk were calculated based on TRIAD and RBCA models. The chemistry risk indices of groundwater points SW5, SW18, SW22, SW39, SW52, SW80, and SW82 were 0.4209, 0.9972, 0.9324, 0.9990, 0.9991, 1.0000, and 1.0000, respectively, indicating that the groundwater has poor environmental status. By contrast, the reference Yangtse River water sample showed no pollution with a Chem RI of 0.1301. Benzene and 1,2-dichloroethane were the main contaminants in the groundwater and were responsible for the elevated cancer risk. The cumulative health risk of groundwater points (except SW5 and SW18) were all higher than the acceptable baselines of 10(-6), which indicates that the groundwater poses high cancer risk. Action is urgently required to control and remediate the risk for human health and groundwater ecosystems.

  18. Characterization of the Dual Subcellular Localization of Lilium LsGRP1, a Plant Class II Glycine-Rich Protein.

    Science.gov (United States)

    Lin, Chia-Hua; Chen, Chao-Ying

    2014-10-01

    The defense-related gene LsGRP1 exhibits an increased level of expression in Lilium spp. after being infected by Botrytis elliptica, the fungal pathogen of lily leaf blight. In this study, the expression profile of the LsGRP1 protein (a plant class II glycine-rich protein) was characterized biochemically and its subcellular localization in lily leaves was evaluated using immunohistochemistry, enhanced green fluorescent protein (EGFP) imaging, and protein extraction analysis. Using an LsGRP1-specific antibody, LsGRP1 was found to be most abundant in epidermal cells and phloem tissues. Leaves from lily plants at different growth stages demonstrated similar levels of 14- and 16-kDa LsGRP1 and a decreased amount of 23-kDa LsGRP1 at the senescence stage. LsGRP1-EGFP imaging and protein extraction assays revealed that 14-kDa LsGRP1 was located in the plasma membrane whereas 16- and 23-kDa LsGRP1 was weakly bound to the cell wall. The time course analyses of LsGRP1 expression in response to salicylic acid treatment or B. elliptica infection showed an increased accumulation of 14- and 23-kDa LsGRP1 over time. Because 23-kDa LsGRP1 could be detected by an ubiquitin antibody, conversion of 14-kDa to 23-kDa LsGRP1 via mono-ubiquitination was presumed, which is a phenomenon that has not been reported for a plant class II glycine-rich protein.

  19. Characterization of a eukaryotic translation initiation factor 5A homolog from Tamarix androssowii involved in plant abiotic stress tolerance.

    Science.gov (United States)

    Wang, Liuqiang; Xu, Chenxi; Wang, Chao; Wang, Yucheng

    2012-07-26

    The eukaryotic translation initiation factor 5A (eIF5A) promotes formation of the first peptide bond at the onset of protein synthesis. However, the function of eIF5A in plants is not well understood. In this study, we characterized the function of eIF5A (TaeIF5A1) from Tamarix androssowii. The promoter of TaeIF5A1 with 1,486 bp in length was isolated, and the cis-elements in the promoter were identified. A WRKY (TaWRKY) and RAV (TaRAV) protein can specifically bind to a W-box motif in the promoter of TaeIF5A1 and activate the expression of TaeIF5A1. Furthermore, TaeIF5A1, TaWRKY and TaRAV share very similar expression pattern and are all stress-responsive gene that functions in the abscisic acid (ABA) signaling pathway, indicating that they are components of a single regulatory pathway. Transgenic yeast and poplar expressing TaeIF5A1 showed elevated protein levels combined with improved abiotic stresses tolerance. Furthermore, TaeIF5A1-transformed plants exhibited enhanced superoxide dismutase (SOD) and peroxidase (POD) activities, lower electrolyte leakage and higher chlorophyll content under salt stress. These results suggested that TaeIF5A1 is involved in abiotic stress tolerance, and is likely regulated by transcription factors TaWRKY and TaRAV both of which can bind to the W-box motif. In addition, TaeIF5A1 may mediate stress tolerance by increasing protein synthesis, enhancing ROS scavenging by improving SOD and POD activities, and preventing chlorophyll loss and membrane damage. Therefore, eIF5A may play an important role in plant adaptation to changing environmental conditions.

  20. Salicornia as a crop plant in temperate regions: selection of genetically characterized ecotypes and optimization of their cultivation conditions.

    Science.gov (United States)

    Singh, Devesh; Buhmann, Anne K; Flowers, Tim J; Seal, Charlotte E; Papenbrock, Jutta

    2014-11-10

    Rising sea levels and salinization of groundwater due to global climate change result in fast-dwindling sources of freshwater. Therefore, it is important to find alternatives to grow food crops and vegetables. Halophytes are naturally evolved salt-tolerant plants that are adapted to grow in environments that inhibit the growth of most glycophytic crop plants substantially. Members of the Salicornioideae are promising candidates for saline agriculture due to their high tolerance to salinity. Our aim was to develop genetically characterized lines of Salicornia and Sarcocornia for further breeding and to determine optimal cultivation conditions. To obtain a large and diverse genetic pool, seeds were collected from different countries and ecological conditions. The external transcribed spacer (ETS) sequence of 62 Salicornia and Sarcocornia accessions was analysed: ETS sequence data showed a clear distinction between the two genera and between different Salicornia taxa. However, in some cases the ETS was not sufficiently variable to resolve morphologically distinct species. For the determination of optimal cultivation conditions, experiments on germination, seedling establishment and growth to a harvestable size were performed using different accessions of Salicornia spp. Experiments revealed that the percentage germination was greatest at lower salinities and with temperatures of 20/10 °C (day/night). Salicornia spp. produced more harvestable biomass in hydroponic culture than in sand culture, but the nutrient concentration requires optimization as hydroponically grown plants showed symptoms of stress. Salicornia ramosissima produced more harvestable biomass than Salicornia dolichostachya in artificial sea water containing 257 mM NaCl. Based on preliminary tests on ease of cultivation, gain in biomass, morphology and taste, S. dolichostachya was investigated in more detail, and the optimal salinity for seedling establishment was found to be 100 mM. Harvesting of S

  1. Characterization of a eukaryotic translation initiation factor 5A homolog from Tamarix androssowii involved in plant abiotic stress tolerance

    Directory of Open Access Journals (Sweden)

    Wang Liuqiang

    2012-07-01

    Full Text Available Abstract Background The eukaryotic translation initiation factor 5A (eIF5A promotes formation of the first peptide bond at the onset of protein synthesis. However, the function of eIF5A in plants is not well understood. Results In this study, we characterized the function of eIF5A (TaeIF5A1 from Tamarix androssowii. The promoter of TaeIF5A1 with 1,486 bp in length was isolated, and the cis-elements in the promoter were identified. A WRKY (TaWRKY and RAV (TaRAV protein can specifically bind to a W-box motif in the promoter of TaeIF5A1 and activate the expression of TaeIF5A1. Furthermore, TaeIF5A1, TaWRKY and TaRAV share very similar expression pattern and are all stress-responsive gene that functions in the abscisic acid (ABA signaling pathway, indicating that they are components of a single regulatory pathway. Transgenic yeast and poplar expressing TaeIF5A1 showed elevated protein levels combined with improved abiotic stresses tolerance. Furthermore, TaeIF5A1-transformed plants exhibited enhanced superoxide dismutase (SOD and peroxidase (POD activities, lower electrolyte leakage and higher chlorophyll content under salt stress. Conclusions These results suggested that TaeIF5A1 is involved in abiotic stress tolerance, and is likely regulated by transcription factors TaWRKY and TaRAV both of which can bind to the W-box motif. In addition, TaeIF5A1 may mediate stress tolerance by increasing protein synthesis, enhancing ROS scavenging by improving SOD and POD activities, and preventing chlorophyll loss and membrane damage. Therefore, eIF5A may play an important role in plant adaptation to changing environmental conditions.

  2. One-step green synthesis and characterization of plant protein-coated mercuric oxide (HgO) nanoparticles: antimicrobial studies

    Science.gov (United States)

    Das, Amlan Kumar; Marwal, Avinash; Sain, Divya; Pareek, Vikram

    2015-03-01

    The present study demonstrates the bioreductive green synthesis of nanosized HgO using flower extracts of an ornamental plant Callistemon viminalis. The flower extracts of Callistemon viminalis seem to be environmentally friendly, so this protocol could be used for rapid production of HgO. Till date, there is no report of synthesis of nanoparticles using flower extract of Callistemon viminalis. Mercuric acetate was taken as the metal precursor in the present experiment. The flower extract was found to act as a reducing as well as a stabilizing agent. The phytochemicals present in the flower extract act as reducing agent which include proteins, saponins, phenolic compounds, phytosterols, and flavonoids. FT-IR spectroscopy confirmed that the extract had the ability to act as a reducing agent and stabilizer for HgO nanoparticles. The formation of the plant protein-coated HgO nanoparticles was first monitored using UV-Vis absorption spectroscopy. The UV-Vis spectroscopy revealed the formation of HgO nanoparticles by exhibiting the typical surface plasmon absorption maxima at 243 nm. The average particle size formed ranges from 2 to 4 nm. The dried form of synthesized nanoparticles was further characterized using TGA, XRD, TEM, and FTIR spectroscopy. FT-IR spectra of synthesized HgO nanoparticles were performed to identify the possible bio-molecules responsible for capping and stabilization of nanoparticles, which confirm the formation of plant protein-coated HgO nanoparticles that is further corroborated by TGA study. The optical band gap of HgO nanoparticle was measured to be 2.48 eV using cutoff wavelength which indicates that HgO nanoparticles can be used in metal oxide semiconductor-based photovoltaic cells. A possible core-shell structure of the HgO nanobiocomposite has been proposed.

  3. Synthesis, characterizations and photocatalytic studies of mesoporous titania prepared by using four plant skins as templates

    Energy Technology Data Exchange (ETDEWEB)

    Miao Yingchun [Department of Applied Chemistry, Key Laboratory of Medicinal Chemistry for Natural Resource, Ministry of Education, Yunnan University, Kunming 650091 (China); Faculty of Chemical and Life Sciences, Qujing Normal University, Qujing 655000 (China); Zhai Zhongbiao [Department of Applied Chemistry, Key Laboratory of Medicinal Chemistry for Natural Resource, Ministry of Education, Yunnan University, Kunming 650091 (China); Kunming Metallurgy Research Institute, Kunming 650031 (China); He Jiao; Li Bin; Li Junjie [Department of Applied Chemistry, Key Laboratory of Medicinal Chemistry for Natural Resource, Ministry of Education, Yunnan University, Kunming 650091 (China); Wang Jiaqiang, E-mail: jqwang@ynu.edu.cn [Department of Applied Chemistry, Key Laboratory of Medicinal Chemistry for Natural Resource, Ministry of Education, Yunnan University, Kunming 650091 (China)

    2010-07-20

    Anatase mesoporous titania with novel morphologies were synthesized by using the skins of tomatoes, bulb onions, grapes, and garlic bulbs, respectively, as templates and used for the photodegradation of Gentian violet, methyl violet, xylenol orange, and Rhodamine B under UV light. The samples were characterized by a combination of various physicochemical techniques, such as X-ray diffraction, SEM, HRTEM, N{sub 2} adsorption/desorption, diffuse reflectance UV-Vis, and FT-IR. It was found that all of the synthesized mesoporous titania samples exhibited similar morphologies to those of the original templates. The photoactivity of P25 TiO{sub 2} for the four dyes is nearly the same while the mesoporous titania samples synthesized by using the four skins as templates exhibited varied photoactivities for the four dyes.

  4. Defect detection and characterization in power plant tubing using ultrasonic guided waves

    International Nuclear Information System (INIS)

    Shin, H.J.; Yi, R.; Rose, J.L.

    1996-01-01

    The purpose of this study is to develop the utility of ultrasonic guided waves in tubing inspection. Major emphasis is placed on the practical implementation of an ultrasonic inspection system for heat exchanger and steam generator tubing. For the experimental study, a specially designed ultrasonic bore probe is used to generate and receive high power tone burst signals. Theoretically calculated dispersion curves form the basis for identifying the proper modes for inspection. Successful implementation of various mode selection criteria shows the capability of guided waves when used in conjunction with frequency tuning and particle displacement distribution optimization. The large distance tube and U-bend tube inspection capability of ultrasonic guided waves was demonstrated. Sample results for tubing inspection includes the detection of standard notches and overall inspection results for 4.75m long stainless steel heat exchanger tubes. Finally, classification and characterization potential of flaws in tubing using pattern recognition is introduced. (author)

  5. Characterization of lead, chromium, and cadmium in dust emitted from municipal solid waste incineration plants

    International Nuclear Information System (INIS)

    Shiota, K; Imai, G; Oshita, K; Takaoka, M

    2013-01-01

    The dust is emitted from municipal solid waste incinerators (MSWIs). Volatile toxic heavy metals are abundant in smaller dust particles and influence the toxicity of particulate matter such as fine particles 2.5 ). However, little is known about the properties of these metals in fine dust particles. Therefore, X-ray absorption fine structure (XAFS) spectroscopy was used to investigate the chemical states of lead (Pb), chromium (Cr), and cadmium (Cd) in MSWI dust collected for nine particle size fractions at the inlet of the dust collector and the stacks of two MSWI plants. XAFS spectroscopy of the dust in the inlet of the dust collectors showed that finer dust contained predominantly Pb as PbCl 2 with some PbSiO 3 , coarser dust consisted of Cr forms, including more toxic Cr(VI) species, and all dust contained CdCl 2 . Although the dust collector removed almost all of the Pb, trace amounts of PbCl 2 remained in the stack gas after passing through the dust collector.

  6. Characterization of bottom ashes from coal pulverized power plants to determine their potential use feasibility

    International Nuclear Information System (INIS)

    Menendez, E.; Alvaro, A. M.; Argiz, C.; Parra, J. L.; Moragues, A.

    2013-01-01

    The disposal of coal by products represents environmental and economical problems around the world. Therefore, the reuse and valorisation of this waste has become an important issue in the last decades. While high-value construction products containing fly ash were developed and its use is actually totally accepted as an addition to cement, the use of the bottom ash as supplementary cementitious material has not been allow. This paper examines the chemical and physical properties of fly ashes and bottom ashes from two different coal power plants in order to compare them and analyse the potential feasibility of bottom ash as cement replacement. The mechanical properties of cement mortars made with different percentages of both ashes were also study. The results obtained showed similar chemical composition of both kinds of ashes. The compressive strength values of mortars with 10 % and 25 % of cement replacement (at 28 days) were above the limits established in European standards and there were not significant differences between fly ash and bottom ash from both origins. (Author)

  7. Spectroscopic and Chromatographic Characterization of Wastewater Organic Matter from a Biological Treatment Plant

    Directory of Open Access Journals (Sweden)

    Min-Hye Park

    2009-12-01

    Full Text Available Spectroscopic and chromatographic changes in dissolved organic matter (DOM characteristics of influent and treated sewage were investigated for a wastewater treatment plant (WWTP with a biological advanced process. Refractory DOM (R-DOM was defined as the dissolved organic carbon concentrations of the samples after 28-day incubation for this study. Specific UV absorbance (SUVA, hydrophobicity, synchronous fluorescence spectra and molecular weight (MW distributions were selected as DOM characteristics. The percent distribution of R-DOM for the effluent was much higher than that of the influent, indicating that biodegradable DOM was selectively removed during the process. Comparison of the influent versus the effluent sewage revealed that SUVA, fulvic-like fluorescence (FLF, humic-like fluorescence (HLF, the apparent MW values were enhanced during the treatment. This suggests that more aromatic and humic-like compounds were enriched during the biological process. No significant difference in the DOM characteristics was observed between the original effluent (i.e., prior to the incubation and the influent sewage after the incubation. This result suggests that the major changes in wastewater DOM characteristics occurring during the biological advanced process were similar to those for simple microbial incubation.

  8. Elicitor-Induced l-Tyrosine Decarboxylase from Plant Cell Suspension Cultures : II. Partial Characterization.

    Science.gov (United States)

    Marques, I A; Brodelius, P E

    1988-09-01

    Properties of purified l-tyrosine decarboxylase (EC 4.1.1.25) from elicitor-induced cell suspension cultures of Eschscholtzia californica Cham. and Thalictrum rugosum Ait. are described. l-Tyrosine decarboxylase is a dimeric enzyme with a molecular weight of 112,600 +/- 600 daltons. The isoelectric point was estimated to be at pH 5.2 and pH 5.4 for the enzyme from E. californica and T. rugosum, respectively. The purified enzymes were stabilized in the presence of pyridoxal-5-phosphate. Optimum pH for the enzyme from both plants was found to be 8.4. Enzyme activity was dependent on exogeneously supplied pyridoxal-5-phosphate. The enzyme decarboxylated l-tyrosine and l-beta-3,4-dihydroxyphenylalanine but was inactive toward l-phenylalanine and l-tryptophan. Apparent K(m) values of Eschscholtzia- and Thalictrum-decarboxylase for l-tyrosine were 0.25 +/- 0.03 and 0.27 +/- 0.04 millimolar, respectively. Similar affinities were found for l-3,4-dihydroxyphenylalanine. Eschscholtzial-tyrosine decarboxylase was strongly inhibited by the phenylalanine analogue l-alpha-aminooxy-beta-phenylpropionate and largely unaffected by d,l-alpha-monofluoromethyl-3,4-dihydroxyphenylalanine and alpha-difluoromethyltyrosine.

  9. CHARACTERIZATION OF THE SLUDGE OF IBN ZIAD CONSTANTINE SEWAGE TREATMENT PLANT FOR ITS LANDSPREADING

    Directory of Open Access Journals (Sweden)

    WASSILA CHEURFI

    2016-04-01

    Full Text Available The purpose of this study was to determine the content of metals elements in the sludge of Ibn Ziad sewage treatment plant of Constantine in order to preserve its quality for subsequent use in agriculture. The use of X-ray fluorescence spectroscopy allowed us to identify the following constituents in this mud: Mg, Al, Si, P, S, Cl, K, Ca, Ti, V, Cr, Mn Fe, Ni, Cu, Zn, Ga, As, Se, Br, Rb, Sr, Y, Zr, Ba, Pb. These elements represent 49.82 % of the total mass of the sludge. The elements present with regulated content limit are chromium, copper, nickel, lead and zinc. They occur respectively with the following concentrations: 0.27 mg·g-1, 0.48 mg·g-1, 0.11 mg·g-1, 0.35 mg·g-1 and 2.70 mg·g-1. We have achieved an extraction for evaluating the concentration of the dissolved nitrate ions, the chemical oxygen demand (COD, and pH. The nitrate ions were transformed into sodium paranitrosalicylate to be dosed by ultraviolet-visible (UV-Vis spectroscopy at 420 nm. The concentration measured was 0.12 mg·g-1. The measuring of the COD issued a value of 0.45 mg·g-1. pH was 7.1.

  10. Characterizing mercury emissions from a coal-fired power plant utilizing a venturi wet FGD system

    Energy Technology Data Exchange (ETDEWEB)

    Vann Bush, P.; Dismukes, E.B.; Fowler, W.K.

    1995-11-01

    Southern Research Institute (SRI) conducted a test program at a coal-fired utility plant from October 24 to October 29, 1994. The test schedule was chosen to permit us to collect samples during a period of consecutive days with a constant coal source. SRI collected the samples required to measured concentrations of anions and trace elements around two scrubber modules and in the stack. Anions of interest were CI{sup -}, F{sup -}, and SO{sub 4}{sup =}. We analyzed samples for five major elements (Al, Ca, Fe, Mg, and Ti) and 16 trace elements (As, B, Ba, Be, Cd, Co, Cr, Cu, Hg, Mn, Mo, Ni, Pb, Sb, Se, and V). SRI made measurements across two scrubber modules, each treating nominally 20% of the total effluent from the boiler. Across one module we examined the effects of changes in the liquid-to-gas ratio (L/G) on the efficiency with which the scrubber removes trace elements and anions from the flue gas. Across another module we examined the effects of slurry pH on the removal of trace elements and anions from the flue gas. Measurements in the stack quantified emissions rates of anions and trace elements.

  11. Quantification and kinetic characterization of soluble microbial products from municipal wastewater treatment plants.

    Science.gov (United States)

    Xie, Wen-Ming; Ni, Bing-Jie; Sheng, Guo-Ping; Seviour, Thomas; Yu, Han-Qing

    2016-01-01

    Soluble microbial products (SMP) formed by microorganisms in wastewater treatment plants (WWTPs) adversely affect final effluent quality and treatment efficiency. It is difficult to distinguish SMP from residual proteins, lipids and carbohydrates present in the influent that may persist during treatment. No method is currently available to determine quantitatively the extent to which SMP contribute to organic discharges from municipal WWTPs. In this work a modeling approach is presented which allows the SMP fraction of the effluent of a municipal WWTP to be quantified and described. The model is validated, in terms of utilization-associated products, biomass-associated products and extracellular polymeric substances, using influent from a municipal WWTP. SMP was found to account for, on average, 27 mg/L of chemical oxygen demand (COD), or 61% of the total COD in the WWTP effluent. Over 90% of the SMP was comprised of biomass-associated products. Five main factors influencing SMP formation in WWTP were evaluated. Neither wastewater composition nor mixed liquor suspended solids concentration was found to affect SMP production. On the other hand, a positive correlation was observed for SMP formation with both solids retention time and influent COD concentration, and a negative correlation with hydraulic retention time. Thus, operating or designing WWTPs with short solids retention and long hydraulic retention times could be considered as solutions for minimizing SMP production. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Functional characterization of the sucrose isomerase responsible for trehalulose production in plant-associated Pectobacterium species.

    Science.gov (United States)

    Nam, Cheon-Hyeon; Seo, Dong-Ho; Jung, Jong-Hyun; Koh, Young-Jin; Jung, Jae-Sung; Heu, Sunggi; Oh, Chang-Sik; Park, Cheon-Seok

    2014-02-05

    Fifty-three plant-associated microorganisms were investigated for their ability to convert sucrose to its isomers. These microorganisms included one Dickeya zeae isolate and 7 Enterobacter, 3 Pantoea, and 43 Pectobacterium species. Eleven out of the 53 strains (21%) showed the ability to transform sucrose to isomaltulose and trehalulose. Among those, Pectobacterium carotovorum KKH 3-1 showed the highest bioconversion yield (97.4%) from sucrose to its isomers. In this strain, the addition of up to 14% sucrose in the medium enhanced sucrose isomerase (SIase) production. The SIase activity at 14% sucrose (47.6 U/mg dcw) was about 3.6-fold higher than that of the negative control (13.3 U/mg dcw at 0% sucrose). The gene encoding SIase, which is comprised a 1776 bp open reading frame (ORF) encoding 591 amino acids, was cloned from P. carotovorum KKH 3-1 and expressed in Escherichia coli. The recombinant SIase (PCSI) was shown to have optimum activity at pH 6.0 and 40 °C. The reaction temperature significantly affected the ratio of sucrose isomers produced by PCSI. The amount of trehalulose increased from 47.5% to 79.1% as temperature was lowered from 50 °C to 30 °C, implying that SIase activity can be controlled by reaction temperature. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Isolation and characterization of Rhizobium sp. strain YS-1r that degrades lignin in plant biomass.

    Science.gov (United States)

    Jackson, C A; Couger, M B; Prabhakaran, M; Ramachandriya, K D; Canaan, P; Fathepure, B Z

    2017-04-01

    The aim of this work was to isolate novel lignin-degrading organisms. Several pure cultures of bacteria that degrade lignin were isolated from bacterial consortia developed from decaying biomass. Among the isolates, Rhizobium sp. strain YS-1r (closest relative of Rhizobium petrolearium strain SL-1) was explored for its lignin-degrading ability. Microcosm studies showed that strain YS-1r was able to degrade a variety of lignin monomers, dimers and also native lignin in switchgrass and alfalfa. The isolate demonstrated lignin peroxidase (LiP) activity when grown on alkali lignin, p-anisoin, switchgrass or alfalfa, and only negligible activity was measured in glucose-grown cells suggesting inducible nature of the LiP activity. Analysis of the strain YS-1r genome revealed the presence of a variety of genes that code for various lignin-oxidizing, H 2 O 2 -producing as well as polysaccharide-hydrolysing enzymes. This study shows both the genomic and physiological capability of bacteria in the genus Rhizobium to metabolize lignin and lignin-like compounds. This is the first detailed report on the lignocellulose-degrading ability of a Rhizobium species and thus this study expands the role of alpha-proteobacteria in the degradation of lignin. The organism's ability to degrade lignin is significant since Rhizobia are widespread in soil, water and plant rhizospheres and some fix atmospheric nitrogen and also have the ability to degrade aromatic hydrocarbons. © 2017 The Society for Applied Microbiology.

  14. Structural characterization of antibiotic self-immunity tRNA synthetase in plant tumour biocontrol agent.

    Science.gov (United States)

    Chopra, Shaileja; Palencia, Andrés; Virus, Cornelia; Schulwitz, Sarah; Temple, Brenda R; Cusack, Stephen; Reader, John

    2016-10-07

    Antibiotic-producing microbes evolved self-resistance mechanisms to avoid suicide. The biocontrol Agrobacterium radiobacter K84 secretes the Trojan Horse antibiotic agrocin 84 that is selectively transported into the plant pathogen A. tumefaciens and processed into the toxin TM84. We previously showed that TM84 employs a unique tRNA-dependent mechanism to inhibit leucyl-tRNA synthetase (LeuRS), while the TM84-producer prevents self-poisoning by expressing a resistant LeuRS AgnB2. We now identify a mechanism by which the antibiotic-producing microbe resists its own toxin. Using a combination of structural, biochemical and biophysical approaches, we show that AgnB2 evolved structural changes so as to resist the antibiotic by eliminating the tRNA-dependence of TM84 binding. Mutagenesis of key resistance determinants results in mutants adopting an antibiotic-sensitive phenotype. This study illuminates the evolution of resistance in self-immunity genes and provides mechanistic insights into a fascinating tRNA-dependent antibiotic with applications for the development of anti-infectives and the prevention of biocontrol emasculation.

  15. Elemental characterization of wild edible plants from countryside and urban areas.

    Science.gov (United States)

    Renna, Massimiliano; Cocozza, Claudio; Gonnella, Maria; Abdelrahman, Hamada; Santamaria, Pietro

    2015-06-15

    Thirteen elements (Na, K, Ca, Mg, Fe, Mn, Cu, Zn, Cr, Co, Cd, Ni and Pb) in 11 different wild edible plants (WEP) (Amaranthus retroflexus, Foeniculum vulgare, Cichorium intybus, Glebionis coronaria, Sonchus spp., Borago officinalis, Diplotaxis tenuifolia, Sinapis arvensis, Papaver rhoeas, Plantago lagopus and Portulaca oleracea) collected from countryside and urban areas of Bari (Italy) were determined. B.officinalis and P.rhoeas could represent good nutritional sources of Mn and Fe, respectively, as well as A.retroflexus and S.arvensis for Ca. High intake of Pb and Cd could come from P.lagopus and A.retroflexus (1.40 and 0.13 mg kg(-1) FW, respectively). WEP may give a substantial contribution to the elements intake for consumers, but in some cases they may supply high level of elements potentially toxic for human health. Anyway, both ANOVA and PCA analyses have highlighted the low influence of the harvesting site on the elements content. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Transfer characterization of sulfur from coal-burning emission to plant leaves by PIXE and XANES

    Energy Technology Data Exchange (ETDEWEB)

    Bao, L.M.; Zhang, G.L.; Zhang, Y.X.; Li, Y.; Lin, J.; Liu, W.; Cao, Q.C.; Zhao, Y.D.; Ma, C.Y.; Han, Y. [Chinese Academy of Sciences, Shanghai (China). Shanghai Institute of Applied Physics

    2009-11-15

    The impact of coal-burning emission on sulfur in camphor leaves was investigated using Proton Induced X-ray Emission (PIXE) and synchrotron radiation technique X-ray Absorption Near-Edge Structure (XANES) spectroscopy. The PIXE results show that the sulfur concentrations in the leaves collected at the polluted site are significantly higher than those in controls. The sulfur XANES spectra show the presence of organic (disulfides, thiols, thioethers, sulfonates and sulfoxides) and inorganic sulfur (sulfates) in the leaves. The inorganic sulfur in the leaves of camphor tree polluted by coal combustion is 15% more than that of the control site. The results suggest that the long-term coal-burning pollution resulted in an enhanced content of the total sulfur and sulfate in the leaves, and the uptake of sulfur by leaves had exceeded the metabolic requirement of plants and the excess of sulfur was stored as SO{sub 4}2{sup -}. It can monitor the sulfur pollution in atmosphere.

  17. A Novel Electron Microscopic Characterization of Core/Shell Nanobiostimulator Against Parasitic Plants.

    Science.gov (United States)

    Mejías, Francisco J R; López-Haro, Miguel; Gontard, Lionel C; Cala, Antonio; Fernández-Aparicio, Mónica; Molinillo, José M G; Calvino, José J; Macías, Francisco A

    2018-01-24

    Nanoencapsulation has proven to be an efficient route to increase significantly the solubility and bioavailability of organic compounds. This aspect of nanotechnology is illustrated for the case of phthalimide-lactone (PL), a recently synthesized strigolactone mimic whose very limited solubility in water, as a free chemical, precludes its practical use as an agrochemical in the fight against parasitic plants. Pluronic F-127 (P127) nanoparticles functionalized with PL have been synthesized and embedded in a polymeric matrix of poly(vinyl alcohol) (PVA). Low-voltage and medium voltage imaging and spectroscopic scanning electron microscopy (S(T)EM) techniques were combined to confirm the synthesis of multicore nanoparticles that were rich in nitrogen, a finding that is due to the successful encapsulation of PL. This PL@P127/PVA nanobiostimulator formulation has an impressive solubility in water, that is, 27 times higher than that of pure phthalimide-lactone. Also critical from the functional point of view, comparative bioassays clearly showed that the intrinsic stimulatory activity of this agrochemical is fully maintained in the nanoencapsulated formulation.

  18. Molecular Characterization of a Trisegmented Mycovirus from the Plant Pathogenic Fungus Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Jie Zhong

    2016-09-01

    Full Text Available A novel double-stranded RNA (dsRNA mycovirus, consisting of three dsRNA genome segments and possibly belonging to the family Chrysoviridae, was isolated from the filamentous phytopathogenic fungus Colletotrichum gloeosporioides and designated as Colletotrichum gloeosprioides chrysovirus 1 (CgCV1. The three dsRNAs of the CgCV1 genome with lengths of 3397, 2869, and 2630 bp (dsRNAs1–3 were found to contain a single open reading frame (ORF putatively encoding the RNA-dependent RNA polymerase (RdRp, a capsid protein, and a protease, respectively, all of which exhibited some degree of sequence similarity to the comparable putative proteins encoded by the genus Chrysovirus. The 5′- and 3′-untranslated regions in each dsRNA segment contained similar sequences that were strictly conserved at the termini. Moreover, isometric virus-like particles (VLPs with a diameter of approximately 40 nm were extracted from fungal mycelia. Phylogenetic analysis based on the conserved dsRNA1-encoded RdRp showed that CgCV1 is a new virus belonging to the Chrysoviridae family. BLAST analysis revealed the presence of CgCV1-like sequences in the chromosomes of Medicago truncatula and Solanum tuberosum. Moreover, some sequences in the transcriptome shotgun assembly (TSA library and expressed sequence tag database (ESTdb of other eudicot and monocot plants were also found to be related to CgCV1.

  19. Characterization of low-temperature properties of plant-produced rap mixtures in the Northeast

    Science.gov (United States)

    Medeiros, Marcelo S., Junior

    The dissertation outlined herein results from a Federal Highway Administration sponsored project intended to investigate the impacts of high percentages of RAP material in the performance of pavements under cold climate conditions. It is comprised of two main sections that were incorporated into the body of this dissertation as Part I and Part II. In Part I a reduced testing framework for analysis of HMA mixes was proposed to replace the IDT creep compliance and strength testing by dynamic modulus and fatigue tests performed on an AMPT device. A continuum damage model that incorporates the nonlinear constitutive behavior of the HMA mixtures was also successfully implemented and validated. Mixtures with varying percentages of reclaimed material (RAP) ranging from 0 to 40% were used in this research effort in order to verify the applicability of the proposed methodology to RAP mixtures. Part II is concerned with evaluating the effects of various binder grades on the properties of plant-produced mixtures with various percentages of RAP. The effects of RAP on mechanical and rheological properties of mixtures and extracted binders were studied in order to identify some of the deficiencies in the current production methodologies. The results of this dissertation will help practitioners to identify optimal RAP usage from a material property perspective. It also establishes some guidelines and best practices for the use of higher RAP percentages in HMA.

  20. Characterization of Chemical Composition and Antioxidant Properties of Trachyspermum ammi Seed as a Potential Medicinal Plant

    Directory of Open Access Journals (Sweden)

    Hashem Akhlaghi

    2014-12-01

    Full Text Available In this study, the essential oil obtained by hydrodistillation of the seed of Trachyspermum ammi (Umbelliferae, growing wild in Sabzevar, Khorasan Razavi province (Iran, were analyzed by GC and GC/MS. The yield of total volatiles was 2.3% (w/w. Forty four compounds representing 91.6% of the aerial parts oil were identified.  The main components of the oil were Hexadecanoic acid (27.5%, ethyl linoleate (8.5%, 6-methyl-α-ionone (8.0%, isobutyl phthalate (5.8%, α-cadinol (4.7%, germacrene D (4.3% and δ-cadinene (3.5%. The oil was rich in nonterpenoids (56.0%. The total flavonoid content of different extracts of the plant was found to be in the range 53.2-164.5 mg/g while the maximum amount concern to methanol extract. The antioxidant activity of the extracts was also measured by radical scavenging activity of antioxidants against free radical 1, 1-diphenyl-2-picrylhydrazyl (DPPH method. Results showed that IC50 of the extracts of Trachyspermum ammi seed are higher than the standard synthetic antioxidants, BHT, ascorbic acid and gallic acid.

  1. Characterization of energy use in 300 mm DRAM (Dynamic Random Access Memory) wafer fabrication plants (fabs) in Taiwan

    International Nuclear Information System (INIS)

    Hu, Shih-Cheng; Xu, Tengfang; Chaung, Tony; Chan, David Y.-L.

    2010-01-01

    Driven by technology advances and demand for enhanced productivity, migration of wafer fabrication for DRAM (Dynamic Random Access Memory) toward increased wafer size has become the fast-growing trend in semiconductor industry. Taiwan accounts for about 18% of the total DRAM wafer production in the world. The energy use required for operating wafer fabrication plants (fabs) is intensive and has become one of the major concerns to production power reliability in the island. This paper characterizes the energy use in four 300 mm DRAM wafer fabs in Taiwan through performing surveys and on-site measurements. Specifically, the objectives of this study are to characterize the electric energy consumption and production of 300 mm DRAM fabs by using various performance metrics, including PEI ((production efficiency index), annual electric power consumption normalized by annual produced wafer area) and EUI ((electrical utilization index), annual electric power consumption normalized by UOP (units of production), which is defined as the product of annual produced wafer area and the average number of mask layers of a wafer). The results show that the PEI and EUI values are 0.743 kWh/cm 2 and 0.0272 kWh/UOP, respectively. Using EUI in assessing energy efficiency of the fab production provides more consistent comparisons than using PEI alone.

  2. Biosorption of Cd+2 by green plant biomass, Araucaria heterophylla: characterization, kinetic, isotherm and thermodynamic studies

    Science.gov (United States)

    Sarada, B.; Krishna Prasad, M.; Kishore Kumar, K.; Murthy, Ch V. R.

    2017-11-01

    The present study attempted to analyze the biosorption behavior of novel biosorbent, Araucaria heterophylla (green plant) biomass, to remove Cd+2 from solutions against various parameters, i.e., initial metal ion concentration, pH, temperature, sorbent dosage and biomass particle size. The maximum biosorption was found to be 90.02% at pH 5.5 and biosorption capacity ( q e) of Cd+2 is 9.2506 mg g-1. The Langmuir and Freundlich equilibrium adsorption isotherms were studied and it was observed that Freundlich model is the best fit than the Langmuir model with correlation co-efficient of 0.999. Kinetic studies indicated that the biosorption process of Cd+2 well followed the pseudo-second-order model with R 2 0.999. Thermodynamic studies observed that the process is exothermic (Δ H ° negative). Free energy change (Δ G °) with negative sign reflected the feasibility and spontaneous nature of the process. The chemical functional -OH groups, CH2 stretching vibrations, C=O carbonyl group of alcohol, C=O carbonyl group of amide, P=O stretching vibrations and -CH groups were involved in the biosorption process. The XRD pattern of the A. heterophylla was found to be mostly amorphous in nature. The SEM studies showed Cd+2 biosorption on selective grains of the biosorbent. It was concluded that A. heterophylla leaf powder can be used as an effective, low-cost, and environmentally friendly biosorbent for the removal of Cd+2 from aqueous solution.

  3. Technical characterization and economic evaluation of recovery of flare gas in various gas-processing plants

    International Nuclear Information System (INIS)

    Zolfaghari, Mohabbat; Pirouzfar, Vahid; Sakhaeinia, Hossein

    2017-01-01

    Today in the worldwide quest for production and economic preference, only industries will survive that have proper solutions for waste disposal and environmental pollution. In industrial applications, a blow down network of gases is used in order to control system pressure and safety instruments. At the end of this network, the excess gases are burnt in the flare tower, which have severe consequences on the environment. Different methods have been proposed and several alternatives have been introduced for reduction and recovery of flaring gases. In this paper, three methods including gas to liquid (GTL), gas turbines generation (GTG) and gas to ethylene (GTE) are introduced and compared with the best method from economic point of view being identified. For this purpose, a natural gas sample is taken from Asalloyeh Refinery Plant and the process has been simulated using Aspen HYSYS. Meanwhile, estimation of the capital and operating costs and evaluation of the processes involved were made using Aspen Capital Cost Estimator. According to the results obtained, production of the electric power from flaring gases is one of the most economical methods. GTG method, with an annual profit of about 480e+006 $, has a greater ROR percent. - Highlights: • Three methods including GTL, GTG and GTE are developed for flare gas recovery. • The processes has been simulated using Aspen HYSYS. • Estimation of the capital and operating costs of the processes were made. • According to the results obtained, GTG is one of the most economical methods. • GTE method has the highest annual benefit, it has the lowest ROR percent.

  4. On the ASR and ASR thermal residues characterization of full scale treatment plant.

    Science.gov (United States)

    Mancini, G; Viotti, P; Luciano, A; Fino, D

    2014-02-01

    In order to obtain 85% recycling, several procedures on Automotive Shredder Residue (ASR) could be implemented, such as advanced metal and polymer recovery, mechanical recycling, pyrolysis, the direct use of ASR in the cement industry, and/or the direct use of ASR as a secondary raw material. However, many of these recovery options appear to be limited, due to the possible low acceptability of ASR based products on the market. The recovery of bottom ash and slag after an ASR thermal treatment is an option that is not usually considered in most countries (e.g. Italy) due to the excessive amount of contaminants, especially metals. The purpose of this paper is to provide information on the characteristics of ASR and its full-scale incineration residues. Experiments have been carried out, in two different experimental campaigns, in a full-scale tyre incineration plant specifically modified to treat ASR waste. Detailed analysis of ASR samples and combustion residues were carried out and compared with literature data. On the basis of the analytical results, the slag and bottom ash from the combustion process have been classified as non-hazardous wastes, according to the EU waste acceptance criteria (WAC), and therefore after further tests could be used in future in the construction industry. It has also been concluded that ASR bottom ash (EWC - European Waste Catalogue - code 19 01 12) could be landfilled in SNRHW (stabilized non-reactive hazardous waste) cells or used as raw material for road construction, with or without further treatment for the removal of heavy metals. In the case of fly ash from boiler or Air Pollution Control (APC) residues, it has been found that the Cd, Pb and Zn concentrations exceeded regulatory leaching test limits therefore their removal, or a stabilization process, would be essential prior to landfilling the use of these residues as construction material. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. [Radioecological monitoring of the Yenisei River and citological characterization of a submerged aquatic plant Elodea canadensis].

    Science.gov (United States)

    Bolsunovskiĭ, A Ia; Muratova, E N; Sukovatyĭ, A G; Pimenov, A V; Sanzharaeva, E A; Zotina, T A; Sedel'nikova, T S; Pan'kov, E V; Kornilova, M G

    2007-01-01

    The study was devoted to investigation of the contents of radionuclides and of heavy metals and to evaluate the frequency of chromosomal aberrations in samples of Elodea canadensis, a submerged plant, collected in different parts of the Yenisei River. The samples were collected in the area subjected to radioactive impact of the Mining-and-Chemical Combine (MCC) at Zheleznogorsk and in the control area, upstream of the MCC. The investigations shown that elodea biomass in the area affected by MCC operation contained a long inventory of artificial radionuclides typical for the MCC discharges. The upstream of the MCC, in the control sampling area, the sediments and the elodea biomass contained only one artificial radionuclide--137Cs. Thus, the exposure doses to elodea shoots and roots upstream of the MCC are small (not more than 8 microGy/d) and the main contribution info the dose is made by natural radionuclides. At the MCC discharge site (the village of Atamanovo) and at the downstream of it, the total dose rate increases almost an order of magnitude, reaching its maximal values--72 microGy/d for elodea shoots and 58 microGy/d for its roots. Cytogenetic investigations of elodea roots shown that at the MCC discharge site (the village of Atamanovo) and at downstream of it the occurrence of chromosomal aberrations in ana-telophase and in metaphase cells of elodea was considerably higher than in the control area. It is highly probable that this simultaneous dramatic increase in the total exposure rate and the occurrence of chromosomal aberrations in elodea is associated with the radiation factor. It is suggested that elodea is affected not only by the radiation factor but also by the chemical factor--toxicity of heavy metals.

  6. Microbial community functional structures in wastewater treatment plants as characterized by GeoChip.

    Directory of Open Access Journals (Sweden)

    Xiaohui Wang

    Full Text Available BACKGROUND: Biological WWTPs must be functionally stable to continuously and steadily remove contaminants which rely upon the activity of complex microbial communities. However, knowledge is still lacking in regard to microbial community functional structures and their linkages to environmental variables. AIMS: To investigate microbial community functional structures of activated sludge in wastewater treatment plants (WWTPs and to understand the effects of environmental factors on their structure. METHODS: 12 activated sludge samples were collected from four WWTPs in Beijing. A comprehensive functional gene array named GeoChip 4.2 was used to determine the microbial functional genes involved in a variety of biogeochemical processes such as carbon, nitrogen, phosphorous and sulfur cycles, metal resistance, antibiotic resistance and organic contaminant degradation. RESULTS: High similarities of the microbial community functional structures were found among activated sludge samples from the four WWTPs, as shown by both diversity indices and the overlapped genes. For individual gene category, such as egl, amyA, lip, nirS, nirK, nosZ, ureC, ppx, ppk, aprA, dsrA, sox and benAB, there were a number of microorganisms shared by all 12 samples. Canonical correspondence analysis (CCA showed that the microbial functional patterns were highly correlated with water temperature, dissolved oxygen (DO, ammonia concentrations and loading rate of chemical oxygen demand (COD. Based on the variance partitioning analyses (VPA, a total of 53% of microbial community variation from GeoChip data can be explained by wastewater characteristics (25% and operational parameters (23%, respectively. CONCLUSIONS: This study provided an overall picture of microbial community functional structures of activated sludge in WWTPs and discerned the linkages between microbial communities and environmental variables in WWTPs.

  7. Screening, isolation, and characterization of glycosyl-hydrolase-producing fungi from desert halophyte plants.

    Science.gov (United States)

    Luziatelli, Francesca; Crognale, Silvia; D'Annibale, Alessandro; Moresi, Mauro; Petruccioli, Maurizio; Ruzzi, Maurizio

    2014-03-01

    Fungal strains naturally occurring on the wood and leaves of the salt-excreting desert tree Tamarix were isolated and characterized for their ability to produce cellulose- and starch-degrading enzymes. Of the 100 isolates, six fungal species were identified by ITS1 sequence analysis. No significant differences were observed among taxa isolated from wood samples of different Tamarix species, while highly salt-tolerant forms related to the genus Scopulariopsis (an anamorphic ascomycete) occurred only on the phylloplane of T. aphylla. All strains had cellulase and amylase activities, but the production of these enzymes was highest in strain D, a Schizophyllum-commune-related form. This strain, when grown on pretreated Tamarix biomass, produced an enzymatic complex containing levels of filter paperase (414 +/- 16 IU/ml) that were higher than those of other S. commune strains. The enzyme complex was used to hydrolyze different lignocellulosic substrates, resulting in a saccharification rate ofpretreated milk thistle (73.5 +/- 1.2%) that was only 10% lower than that obtained with commercial cellulases. Our results support the use of Tamarix biomass as a useful source of cellulolytic and amylolytic fungi and as a good feedstock for the economical production of commercially relevant cellulases and amylases.

  8. Process competencies in a problem and project based learning environment

    DEFF Research Database (Denmark)

    Du, Xiangyun; Kolmos, Anette

    2006-01-01

    with the expected professional competencies. Based on the educational practice of PBL Aalborg Model, which is characterized by problem-orientation, project-organization and team work, this paper examines the process of developing process competencies through studying engineering in a PBL environment from...... process competencies through doing problem and project based work in teams? 2) How do students perceive their achievement of these process competencies?......Future engineers are not only required to master technological competencies concerning solving problems, producing and innovating technology, they are also expected to have capabilities of cooperation, communication, and project management in diverse social context, which are referred to as process...

  9. Molecular characterization of activated sludge from a seawater‐processing wastewater treatment plant

    Science.gov (United States)

    Sánchez, Olga; Garrido, Laura; Forn, Irene; Massana, Ramon; Maldonado, Manuel Ignacio; Mas, Jordi

    2011-01-01

    Summary The prokaryotic community composition of activated sludge from a seawater‐processing wastewater treatment plant (Almeria, Spain) was investigated by using the rRNA approach, combining different molecular techniques such as denaturing gradient gel electrophoresis (DGGE), clone libraries and in situ hybridization (FISH and CARD‐FISH). Most of the sequences retrieved in the DGGE and the clone libraries were similar to uncultured members of different phyla. The most abundant sequence recovered from Bacteria in the clone library corresponded to a bacterium from the Deinococcus–Thermus cluster (almost 77% of the clones), and the library included members from other groups such as the Alpha, Gamma and Delta subclasses of Proteobacteria, the Bacteroidetes and Firmicutes. Concerning the archaeal clone library, we basically found sequences related to different orders of methanogenic Archaea, in correspondence with the recovered DGGE bands. Enumeration of DAPI (4′,6‐diamidino‐2‐phenylindole) stained cells from two different activated sludge samples after a mechanical flocculation disruption revealed a mean cell count of 1.6 × 109 ml−1. Around 94% of DAPI counts (mean value from both samples) hybridized with a Bacteria specific probe. Alphaproteobacteria were the dominant bacterial group (36% of DAPI counts), while Beta‐, Delta‐ and Gammaproteobacteria, Bacteroidetes, Actinobacteria and Firmicutes contributed to lower proportions (between 0.5–5.7% of DAPI counts). Archaea accounted only for 6% of DAPI counts. In addition, specific primers for amplification of the amoA (ammonia monooxygenase) gene were used to detect the presence of Beta, Gamma and archaeal nitrifiers, yielding positive amplifications only for Betaproteobacteria. This, together with negative in situ hybridizations with probes for well‐known nitrifiying bacteria, suggests that nitrification is performed by still undetected microorganisms. In summary, the combination of the

  10. Characterization of commercial humic acid samples and their impact on growth of fungi and plants

    Directory of Open Access Journals (Sweden)

    Asma Lodhi, Shermeen Tahir, Zafar Iqbal, Ansar Mahmood, Muhammad Akhtar, Tariq Mahmood Qureshi, Muhammad Yaqub and Asif Naeem

    2013-05-01

    Full Text Available Naturally occurring humates like leonardite and brown coal or lignite are marketed under different brand names e.g. Pak Humates, Humate Fertilizer, Pak Humax, Humkara and Humide etc. However, their efficacy is needed to be confirmed before their use. Different studies were conducted for the comparison of four commercial humates for their physico-chemical, optical properties, plant growth promoting ability in terms of seed germination and seedling vigour in wheat (cv Sehr, mung bean (Mung-54, maize (C-12 and sesbania and their effect on growth of some fungi. Moisture content of four humates varied from 0.52 to 71.11%, while solubility in water varied from 30.2 to 98.2% and density differed from 1.67 to 4.17. A 2% solution of humates had pH and EC varying from 5.39 to 10.11 and 3.140 to 1.143 mS cm-1, respectively. Carbon and nitrogen concentrations varied from 22.95 to 36.56% and 0.658 to 1.183, respectively with a C/N ratio of 30.91 to 44.16. Humates dissolved in 0.1N NaOH were partitioned into humic acid and fulvic acid fractions. Of the total C in humates, 40.3 to 77.5% was ranged in humic acid and 22.5 to 59.7% in fulvic acid fraction. The HA was also studied for optical properties at 400, 500, 600, and 700 nm besides that at 465 and 665 to calculate E4/E6 (extinction coefficient; the later varied between 3.64 and 5.48. Optical density of the humic acid decreased at increasing wavelength and was correlated significantly with the carbon contents of humic compounds. Three fungi, Trichoderma harzianum, T. hamatum and Alternaria alternata showed maximum growth at 0.025% HA in the growth medium on the basis of colony diameter. Humates inhibited seed germination in wheat, maize and mung bean except for sesbania. Root length and shoot dry matter increased in wheat and maize but no effect was found in mung bean and sesbania. The studies revealed that humates available in the market vary widely and therefore some sort of quality monitoring is required

  11. Characterization of bottom ashes from coal pulverized power plants to determine their potential use feasibility

    Directory of Open Access Journals (Sweden)

    Menéndez, E.

    2013-12-01

    Full Text Available The disposal of coal by products represents environmental and economical problems around the world. Therefore, the reuse and valorisation of this waste has become an important issue in the last decades. While high-value construction products containing fly ash were developed and its use is actually totally accepted as an addition to cement, the use of the bottom ash as supplementary cementitious material has not been allow. This paper examines the chemical and physical properties of fly ashes and bottom ashes from two different coal power plants in order to compare them and analyse the potential feasibility of bottom ash as cement replacement. The mechanical properties of cement mortars made with different percentages of both ashes were also study. The results obtained showed similar chemical composition of both kinds of ashes. The compressive strength values of mortars with 10 % and 25 % of cement replacement (at 28 days were above the limits established in European standards and there were not significant differences between fly ash and bottom ash from both origins.La eliminación de subproductos del carbón supone problemas ambientales y económicos en todo el mundo por lo que la reutilización y valorización de los mismos se ha convertido en un tema importante en las últimas décadas. Mientras que las cenizas volantes se han utilizado en aplicaciones de alto valor y se han desarrollado productos de construcción en los que se ha utilizado esta ceniza como adición al cemento, no se ha sido permitido la utilización de la ceniza de fondo como en cementos. Este artículo examina las propiedades químicas y físicas de las cenizas volantes y de fondo procedentes de dos centrales termoeléctricas con el objetivo de compararlas y analizar la potencial utilización de la ceniza de fondo como adición al cemento. Se han estudiado también las propiedades mecánicas de morteros de cemento fabricados con distintos porcentajes de ambas cenizas como

  12. Discussion of the question whether a local authority can claim to be affected in its planning competence by a permit issued for construction of a radwaste processing plant. High Administrative Court Lueneburg, judgement of 21.1.1993 - 7 K 5/90

    International Nuclear Information System (INIS)

    Czajka, D.

    1993-01-01

    A local authority has taken legal action against the first partial permit for the construction of a radwaste conditioning pilot plant at Gorleben, claiming to be affected in its planning competence by the fact that transport of spent fuel elements between the spent fuel storage facility and the pilot plant 2 km away would have to proceed on the rural district road. The action has been discussed. Appealable head notes: A local authority is not affected in its planning competence by a permit issued for construction of a facility for radwaste processing, although the operation of said facility may result in radwaste being transported by a road crossing the local authority's territory. (orig.) [de

  13. High-resolution gas chromatography/mas spectrometry method for characterization and quantitative analysis of ginkgolic acids in ginkgo biloba plants, extracts, and dietary supplements

    Science.gov (United States)

    A high resolution GC/MS with Selected Ion Monitor (SIM) method focusing on the characterization and quantitative analysis of ginkgolic acids (GAs) in Ginkgo biloba L. plant materials, extracts and commercial products was developed and validated. The method involved sample extraction with (1:1) meth...

  14. Use of an In Vitro, Nuclear Receptor Assay Panel to Characterize the Endocrine-Disrupting Activity Load of Wastewater Treatment Plant Effluent Extracts

    Science.gov (United States)

    Use of an In Vitro, Nuclear Receptor Assay Panel to Characterize the Endocrine-Disrupting Activity Load of Wastewater Treatment Plant Effluent Extracts Katie B. Paul 1.2, Ruth Marfil-Vega 1 Marc A. Mills3, Steve 0. Simmons2, Vickie S. Wilson4, Kevin M. Crofton2 10ak Rid...

  15. Characterization of plant communities adjacent to the B-C Cribs controlled area and REDOX pond areas on the 200 area plateau

    International Nuclear Information System (INIS)

    Cline, J.F.; Uresk, D.W.; Rickard, W.H.

    1975-01-01

    The plant communities at the Hanford B-C Cribs controlled area and REDOX study areas are characterized. It is concluded that they are probably very much like the communities that existed prior to 1943 when the Hanford Reservation was established. (CH)

  16. Functional characterization of a class III acid endochitinase from the traps of the carnivorous pitcher plant genus, Nepenthes.

    Science.gov (United States)

    Rottloff, Sandy; Stieber, Regina; Maischak, Heiko; Turini, Florian G; Heubl, Günther; Mithöfer, Axel

    2011-08-01

    Carnivory in plants is an adaptation strategy to nutrient-poor environments and soils. Carnivorous plants obtain some additional mineral nutrients by trapping and digesting prey; the genus Nepenthes is helped by its specialized pitcher traps. To make the nutrients available, the caught prey needs to be digested, a process that requires the concerted activity of several hydrolytic enzymes. To identify and investigate the various enzymes involved in this process, fluid from Nepenthes traps has been analysed in detail. In this study, a novel type of Nepenthes endochitinase was identified in the digestion fluid of closed pitchers. The encoding endochitinase genes have been cloned from eight different Nepenthes species. Among these, the deduced amino acid sequence similarity was at least 94.9%. The corresponding cDNA from N. rafflesiana was heterologously expressed, and the purified protein, NrChit1, was biochemically characterized. The enzyme, classified as a class III acid endochitinase belonging to family 18 of the glycoside hydrolases, is secreted into the pitcher fluid very probably due to the presence of an N-terminal signal peptide. Transcriptome analyses using real-time PCR indicated that the presence of prey in the pitcher up-regulates the endochitinase gene not only in the glands, which are responsible for enzyme secretion, but at an even higher level, in the glands' surrounding tissue. These results suggest that in the pitchers' tissues, the endochitinase as well as other proteins from the pitcher fluid might fulfil a different, primary function as pathogenesis-related proteins. © 2011 The Author(s).

  17. Identification and molecular characterization of MYB Transcription Factor Superfamily in C4 model plant foxtail millet (Setaria italica L..

    Directory of Open Access Journals (Sweden)

    Mehanathan Muthamilarasan

    Full Text Available MYB proteins represent one of the largest transcription factor families in plants, playing important roles in diverse developmental and stress-responsive processes. Considering its significance, several genome-wide analyses have been conducted in almost all land plants except foxtail millet. Foxtail millet (Setaria italica L. is a model crop for investigating systems biology of millets and bioenergy grasses. Further, the crop is also known for its potential abiotic stress-tolerance. In this context, a comprehensive genome-wide survey was conducted and 209 MYB protein-encoding genes were identified in foxtail millet. All 209 S. italica MYB (SiMYB genes were physically mapped onto nine chromosomes of foxtail millet. Gene duplication study showed that segmental- and tandem-duplication have occurred in genome resulting in expansion of this gene family. The protein domain investigation classified SiMYB proteins into three classes according to number of MYB repeats present. The phylogenetic analysis categorized SiMYBs into ten groups (I-X. SiMYB-based comparative mapping revealed a maximum orthology between foxtail millet and sorghum, followed by maize, rice and Brachypodium. Heat map analysis showed tissue-specific expression pattern of predominant SiMYB genes. Expression profiling of candidate MYB genes against abiotic stresses and hormone treatments using qRT-PCR revealed specific and/or overlapping expression patterns of SiMYBs. Taken together, the present study provides a foundation for evolutionary and functional characterization of MYB TFs in foxtail millet to dissect their functions in response to environmental stimuli.

  18. Hydrothermal carbonization of biomass residues: mass spectrometric characterization for ecological effects in the soil-plant system.

    Science.gov (United States)

    Jandl, Gerald; Eckhardt, Kai-Uwe; Bargmann, Inge; Kücke, Martin; Greef, Jörg-Michael; Knicker, Heike; Leinweber, Peter

    2013-01-01

    Hydrochars, technically manufactured by hydrothermal carbonization (HTC) of biomass residues, are recently tested in high numbers for their suitability as feedstock for bioenergy production, the bioproduct industry, and as long-term carbon storage in soil, but ecological effects in the soil-plant system are not sufficiently known. Therefore, we investigated the influence of different biomass residues and process duration on the molecular composition of hydrochars, and how hydrochar addition to soils affected the germination of spring barley ( L.) seeds. Samples from biomass residues and the corresponding hydrochars were analyzed by pyrolysis-field ionization mass spectrometry (Py-FIMS) and gaseous emissions from the germination experiments with different soil-hydrochar mixtures by gas chromatography/mass spectrometry (GC/MS). The molecular-level characterization of various hydrochars by Py-FIMS clearly showed that the kind of biomass residue influenced the chemical composition of the corresponding hydrochars more strongly than the process duration. In addition to various detected possible toxic substances, two independent mass spectrometric methods (Py-FIMS and GC/MS) indicated long C-chain aliphatic compounds which are typically degraded to the C-unit ethylene that can evoke phytotoxic effects in high concentrations. This showed for the first time possible chemical compounds to explain toxic effects of hydrochars on plant growth. It is concluded that the HTC process did not result in a consistent product with defined chemical composition. Furthermore, possible toxic effects urgently need to be investigated for each individual hydrochar to assess effects on the soil organic matter composition and the soil biota before hydrochar applications as an amendment on agricultural soils. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  19. Isolation and characterization of an n-hexadecane degrading Acinetobacter baumannii KSS1060 from a petrochemical wastewater treatment plant

    International Nuclear Information System (INIS)

    Shiri, Z.; Kermanshahi, R. K.; Soudi, M. R.; Farajzadeh, D.

    2015-01-01

    Hydrocarbons are widespread in the environment, but because of the massive utilization of petroleum products, they are nowadays strongly involved in environmental pollution. Bioremediation is the obliging technology for the treatment of hydrocarbon-contaminated sites. Therefore, to investigate the potential of petrochemical hydrocarbon (HC)-degrading indigenous microorganisms in wastewater samples collected from Fajr petrochemical wastewater treatment plants, a strain of Acinetobacter baumannii was isolated from this hydrocarbon-contaminated wastewater and examined for its ability to utilize hexadecane. This strain was capable to grow on n-hexadecane as the sole source of carbon and energy. The ability of the isolate to degrade n-hexadecane was assessed by growth assays and gas chromatography/mass spectrometry analysis. Using GC analysis, it was shown that the strain KSS1060 was able to degrade 62 % of n-hexadecane within 6 days, which mostly (51.6 %) occurred within the first 24 h. Identification of this hexadecane-degrader bacterium was carried out using 16S rDNA sequence analysis. Additionally, characterization of chemical composition of wastewater samples by the use of gas chromatography/mass spectrometry analysis indicated the presence of Hexanal, Benzene methanol, Indanol, 1,2-benzenedicarboxylic acid diethyl ester, diisobutyl phthalate, and Phenol,4,4′-(1-methylethylidene) in the major constituents of wastewater. In conclusion, this study can focus on more cost-efficient applications of native bacterial strains for the large-scale biodegradation of wastewater samples from petrochemical plant in industry, where it causes disturbing problems due to its harmful effects on different organisms and human beings.

  20. Functional Characterization of UDP-apiose Synthases from Bryophytes and Green Algae Provides Insight into the Appearance of Apiose-containing Glycans during Plant Evolution*

    Science.gov (United States)

    Smith, James; Yang, Yiwen; Levy, Shahar; Adelusi, Oluwatoyin Oluwayemi; Hahn, Michael G.; O'Neill, Malcolm A.; Bar-Peled, Maor

    2016-01-01

    Apiose is a branched monosaccharide that is present in the cell wall pectic polysaccharides rhamnogalacturonan II and apiogalacturonan and in numerous plant secondary metabolites. These apiose-containing glycans are synthesized using UDP-apiose as the donor. UDP-apiose (UDP-Api) together with UDP-xylose is formed from UDP-glucuronic acid (UDP-GlcA) by UDP-Api synthase (UAS). It was hypothesized that the ability to form Api distinguishes vascular plants from the avascular plants and green algae. UAS from several dicotyledonous plants has been characterized; however, it is not known if avascular plants or green algae produce this enzyme. Here we report the identification and functional characterization of UAS homologs from avascular plants (mosses, liverwort, and hornwort), from streptophyte green algae, and from a monocot (duckweed). The recombinant UAS homologs all form UDP-Api from UDP-glucuronic acid albeit in different amounts. Apiose was detected in aqueous methanolic extracts of these plants. Apiose was detected in duckweed cell walls but not in the walls of the avascular plants and algae. Overexpressing duckweed UAS in the moss Physcomitrella patens led to an increase in the amounts of aqueous methanol-acetonitrile-soluble apiose but did not result in discernible amounts of cell wall-associated apiose. Thus, bryophytes and algae likely lack the glycosyltransferase machinery required to synthesize apiose-containing cell wall glycans. Nevertheless, these plants may have the ability to form apiosylated secondary metabolites. Our data are the first to provide evidence that the ability to form apiose existed prior to the appearance of rhamnogalacturonan II and apiogalacturonan and provide new insights into the evolution of apiose-containing glycans. PMID:27551039

  1. Occurrence, molecular characterization and antibiogram of water quality indicator bacteria in river water serving a water treatment plant

    Energy Technology Data Exchange (ETDEWEB)

    Okeke, Benedict C., E-mail: bokeke@aum.edu [Department of Biology, Auburn University at Montgomery, P.O. Box 244023, Montgomery, AL 36124 (United States); Thomson, M. Sue [Department of Biology, Auburn University at Montgomery, P.O. Box 244023, Montgomery, AL 36124 (United States); Moss, Elica M. [Department of Natural Resources and Environmental Science, Alabama A and M University, AL 35762 (United States)

    2011-11-01

    Water pollution by microorganisms of fecal origin is a current world-wide public health concern. Total coliforms, fecal coliforms (Escherichia coli) and enterococci are indicators commonly used to assess the microbiological safety of water resources. In this study, influent water samples and treated water were collected seasonally from a water treatment plant and two major water wells in a Black Belt county of Alabama and evaluated for water quality indicator bacteria. Influent river water samples serving the treatment plant were positive for total coliforms, fecal coliforms (E. coli), and enterococci. The highest number of total coliform most probable number (MPN) was observed in the winter (847.5 MPN/100 mL) and the lowest number in the summer (385.6 MPN/100 mL). Similarly E. coli MPN was substantially higher in the winter (62.25 MPN/100 mL). Seasonal variation of E. coli MPN in influent river water samples was strongly correlated with color (R{sup 2} = 0.998) and turbidity (R{sup 2} = 0.992). Neither E. coli nor other coliform type bacteria were detected in effluent potable water from the treatment plant. The MPN of enterococci was the highest in the fall and the lowest in the winter. Approximately 99.7 and 51.5 enterococci MPN/100 mL were recorded in fall and winter seasons respectively. One-way ANOVA tests revealed significant differences in seasonal variation of total coliforms (P < 0.05), fecal coliforms (P < 0.01) and enterococci (P < 0.01). Treated effluent river water samples and well water samples revealed no enterococci contamination. Representative coliform bacteria selected by differential screening on Coliscan Easygel were identified by 16S ribosomal RNA gene sequence analysis. E. coli isolates were sensitive to gentamicin, trimethoprim/sulfamethazole, ciprofloxacin, vancomycin, tetracycline, ampicillin, cefixime, and nitrofurantoin. Nonetheless, isolate BO-54 displayed decreased sensitivity compared to other E. coli isolates. Antibiotic sensitivity

  2. Occurrence, molecular characterization and antibiogram of water quality indicator bacteria in river water serving a water treatment plant

    International Nuclear Information System (INIS)

    Okeke, Benedict C.; Thomson, M. Sue; Moss, Elica M.

    2011-01-01

    Water pollution by microorganisms of fecal origin is a current world-wide public health concern. Total coliforms, fecal coliforms (Escherichia coli) and enterococci are indicators commonly used to assess the microbiological safety of water resources. In this study, influent water samples and treated water were collected seasonally from a water treatment plant and two major water wells in a Black Belt county of Alabama and evaluated for water quality indicator bacteria. Influent river water samples serving the treatment plant were positive for total coliforms, fecal coliforms (E. coli), and enterococci. The highest number of total coliform most probable number (MPN) was observed in the winter (847.5 MPN/100 mL) and the lowest number in the summer (385.6 MPN/100 mL). Similarly E. coli MPN was substantially higher in the winter (62.25 MPN/100 mL). Seasonal variation of E. coli MPN in influent river water samples was strongly correlated with color (R 2 = 0.998) and turbidity (R 2 = 0.992). Neither E. coli nor other coliform type bacteria were detected in effluent potable water from the treatment plant. The MPN of enterococci was the highest in the fall and the lowest in the winter. Approximately 99.7 and 51.5 enterococci MPN/100 mL were recorded in fall and winter seasons respectively. One-way ANOVA tests revealed significant differences in seasonal variation of total coliforms (P < 0.05), fecal coliforms (P < 0.01) and enterococci (P < 0.01). Treated effluent river water samples and well water samples revealed no enterococci contamination. Representative coliform bacteria selected by differential screening on Coliscan Easygel were identified by 16S ribosomal RNA gene sequence analysis. E. coli isolates were sensitive to gentamicin, trimethoprim/sulfamethazole, ciprofloxacin, vancomycin, tetracycline, ampicillin, cefixime, and nitrofurantoin. Nonetheless, isolate BO-54 displayed decreased sensitivity compared to other E. coli isolates. Antibiotic sensitivity pattern

  3. GAINING CULTURAL COMPETENCE THROUGH THE GLOTTODRAMA PROJECT

    Directory of Open Access Journals (Sweden)

    Cristina Anca COLIBABA

    2014-04-01

    Full Text Available In a world characterized by globalization and mobility understanding cultures and communicating with people of different cultures has become significantly important. As cultural competence is part of communicative competence, integrating culture into language learning has become a must in education. Culture helps learners to be culturally competent and communicate efficiently in different societies. The European Glottodrama project run by EuroEd Foundation Iasi initiated an innovative language teaching methodology. The language course combining drama and language techniques with a very strong cultural component was applied to a group of 20 international students from the University of Medicine in Iasi studying Romanian as a foreign language. According to the Glottodrama method, the cultural element is very important as a profound understanding of a dramatic text means presenting culture in action. The article highlights the learners’ opinions and attitudes towards the role of culture in foreign language learning and some of the activities designed to develop cultural competence.

  4. Core Competence and Education.

    Science.gov (United States)

    Holmes, Gary; Hooper, Nick

    2000-01-01

    Outlines the concept of core competence and applies it to postcompulsory education in the United Kingdom. Adopts an educational perspective that suggests accreditation as the core competence of universities. This economic approach suggests that the market trend toward lifetime learning might best be met by institutions developing a core competence…

  5. Competencies and Their Assessment

    Science.gov (United States)

    Drisko, James W.

    2014-01-01

    This article explores competencies and methods for their assessment in higher education and in social work's accreditation standards. Many contemporary policy and educational accreditation efforts employ the model of competency assessment. The current emphasis on accountability in higher education, including the Council on Social Work…

  6. Financing Competency Based Programs.

    Science.gov (United States)

    Daniel, Annette

    Literature on the background, causes, and current prevalence of competency based programs is synthesized in this report. According to one analysis of the actual and probable costs of minimum competency testing, estimated costs for test development, test administration, bureaucratic structures, and remedial programs for students who cannot pass the…

  7. Developing Clinical Competence

    NARCIS (Netherlands)

    P.F. Wimmers (Paul)

    2006-01-01

    textabstractThe development of clinical competence is the main purpose of medical education. The long road to become clinically competent starts on the first day of medical school, and every institution strives to select the best students. The responsibility of medical schools is to train

  8. Competencies in Ornamental Horticulture

    Science.gov (United States)

    Loewen, Curtis E.

    1974-01-01

    Based on the author's dissertation, this article pertains to the identification of competencies for ornamental horticulture workers in Oregon. Findings were based on interviews with 56 ornamental horticulture business employers regarding 100 competencies. The method used can serve as a model for obtaining occupational information to develop and…

  9. ICT Competences: Algorithmic Thinking

    Science.gov (United States)

    Zsakó, László; Szlávi, Péter

    2012-01-01

    A lot has been said about what to teach in ICT in primary and secondary education. There are serious discussions even debates about it. Much less has been said about why ICT should be taught. [1] Competences are related actions and tasks done by people (somebody is competent in a certain field if they are able to solve common tasks related to that…

  10. Teaching Competences and Inclusive Education

    Directory of Open Access Journals (Sweden)

    José María Fernández Batanero

    2013-08-01

    Full Text Available This paper focuses on teaching competencies that are conducive to good educational practices in relation to inclusion, from the perspective of teachers. The methodology employed in the study is descriptive/comprehensive, and of an exploratory nature. By means of four case studies, the perceptions of teachers from two secondary schools—characterized by the Spanish Educational Administration as having “good practices”— are examined. The techniques used for information collection in this study include documentary analysis, in-depth interviews and focus groups. The findings emphasize the importance of strategic skills, combined with innovation and creativity, among others.

  11. Characterization of Leishmania donovani aquaporins shows presence of subcellular aquaporins similar to tonoplast intrinsic proteins of plants.

    Directory of Open Access Journals (Sweden)

    Neha Biyani

    Full Text Available Leishmania donovani, a protozoan parasite, resides in the macrophages of the mammalian host. The aquaporin family of proteins form important components of the parasite-host interface. The parasite-host interface could be a potential target for chemotherapy. Analysis of L. major and L. infantum genomes showed the presence of five aquaporins (AQPs annotated as AQP9 (230aa, AQP putative (294aa, AQP-like protein (279aa, AQP1 (314aa and AQP-like protein (596aa. We report here the structural modeling, localization and functional characterization of the AQPs from L. donovani. LdAQP1, LdAQP9, LdAQP2860 and LdAQP2870 have the canonical NPA-NPA motifs, whereas LdAQP putative has a non-canonical NPM-NPA motif. In the carboxyl terminal to the second NPA box of all AQPs except AQP1, a valine/alanine residue was found instead of the arginine. In that respect these four AQPs are similar to tonoplast intrinsic proteins in plants, which are localized to intracellular organelles. Confocal microscopy of L. donovani expressing GFP-tagged AQPs showed an intracellular localization of LdAQP9 and LdAQP2870. Real-time PCR assays showed expression of all aquaporins except LdAQP2860, whose level was undetectable. Three-dimensional homology modeling of the AQPs showed that LdAQP1 structure bears greater topological similarity to the aquaglyceroporin than to aquaporin of E. coli. The pore of LdAQP1 was very different from the rest in shape and size. The cavity of LdAQP2860 was highly irregular and undefined in geometry. For functional characterization, four AQP proteins were heterologously expressed in yeast. In the fps1Δ yeast cells, which lacked the key aquaglyceroporin, LdAQP1 alone displayed an osmosensitive phenotype indicating glycerol transport activity. However, expression of LdAQP1 and LdAQP putative in a yeast gpd1Δ strain, deleted for glycerol production, conferred osmosensitive phenotype indicating water transport activity or aquaporin function. Our analysis

  12. Characterizing aquifer hydrogeology and anthropogenic chemical influences on groundwater near the Idaho Chemical Processing Plant, Idaho National Engineering Laboratory, Idaho

    International Nuclear Information System (INIS)

    Fromm, J.M.

    1995-01-01

    A conceptual model of the Eastern Snake River Plain aquifer in the vicinity of monitoring well USGS-44, downgradient of the Idaho Chemical Processing Plant (ICPP) on the Idaho National Engineering Laboratory (INEL), was developed by synthesis and comparison of previous work (40 years) and new investigations into local natural hydrogeological conditions and anthropogenic influences. Quantitative tests of the model, and other recommendations are suggested. The ICPP recovered fissionable uranium from spent nuclear fuel rods and disposed of waste fluids by release to the regional aquifer and lithosphere. Environmental impacts were assessed by a monitoring well network. The conceptual model identifies multiple, highly variable, interacting, and transient components, including INEL facilities multiple operations and liquid waste handling, systems; the anisotropic, in homogeneous aquifer; the network of monitoring and production wells, and the intermittent flow of the Big Lost River. Pre anthropogenic natural conditions and early records of anthropogenic activities were sparsely or unreliably documented making reconstruction of natural conditions or early hydrologic impacts impossible or very broad characterizations

  13. Development and characterization of novel microsatellite markers in Trillium govanianum: a threatened plant species from North-Western Himalaya.

    Science.gov (United States)

    Sharma, Vikas; Wani, Mohammad Saleem; Singh, Vijay; Kaur, Kuljit; Gupta, Raghbir Chand

    2017-07-01

    Trillium govanianum is a temperate forest understory plant species of high value belonging to the family Melanthiaceae. It is endemic to Himalayan region and facing a bottleneck situation due to reckless extractions from its natural strands. In the present study, 21 microsatellite markers were developed and characterized in 20 accessions of T. govanianum. Collectively, the polymorphic markers amplified 31 alleles in a range of 2-4 with an average of 2.6 alleles per marker. The mean observed heterozygosity (H o ), expected heterozygosity (H e ), and Shannon information index (I) were 0.46, 0.48, and 0.73, respectively. Average polymorphism information content (PIC) was 0.385. The cross-transferability in a related species, namely, Polygonatum verticillatum, showed amplification of ten markers. The newly developed microsatellite markers efficiently distinguished the different accessions on the basis of their geographic origin. Thus, these microsatellites can be useful in exploring genetic diversity in various existing populations of T. govanianum in north-western Himalaya, which may be useful for their conservation, management, and improvement in future.

  14. Characterization of Essential Oils Obtained from Abruzzo Autochthonous Plants: Antioxidant and Antimicrobial Activities Assessment for Food Application

    Directory of Open Access Journals (Sweden)

    Marika Pellegrini

    2018-02-01

    Full Text Available In the present study, the essential oils (EOs of some officinal plants from Abruzzo territory (Italy were evaluated for their antimicrobial and antioxidant activities and their volatile fraction chemical characterization. The EOs were extracted from Rosmarinus officinalis, Origanum vulgare, Salvia officinalis, Mentha piperita, Allium sativum, Foeniculum vulgare, Satureja montana, Thymus vulgaris and Coriandrum sativum seeds. The antimicrobial activity was screened against thirteen Gram-positive and Gram-negative strains to determine the Minimal Inhibitory Concentration (MIC. The total phenolic content (TPC and the antioxidant capacity (AOC were assessed by means of Folin-Ciocâlteu method, and Trolox Equivalent Antioxidant Capacity with 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid (TEAC/ABTS, Ferric Reducing Antioxidant Power (FRAP and 2,2-diphenyl-1-picrylhydrazyl (DPPH assays respectively. Among the nine EOs tested, T. vulgaris, S. montana, O. vulgare and C. sativum EOs showed MIC values ranging from 0.625 to 5 μL/mL. The AOC and TPC results for these species were also interesting. The major components for these EOs were thymol for T. vulgaris (44% and O. vulgare (40%, linalool (77% for C. sativum, and carvacrol for S. montana (54%. The results allowed the study to establish that these EOs are good candidates for potential application as biopreservatives in foods and/or food manufacture environments.

  15. Phenotypic characterization, genetic mapping and candidate gene analysis of a source conferring reduced plant height in sunflower.

    Science.gov (United States)

    Ramos, María Laura; Altieri, Emiliano; Bulos, Mariano; Sala, Carlos A

    2013-01-01

    Reduced height germplasm has the potential to increase stem strength, standability, and also yields potential of the sunflower crop (Helianthus annuus L. var. macrocarpus Ckll.). In this study, we report on the inheritance, mapping, phenotypic and molecular characterization of a reduced plant height trait in inbred lines derived from the source DDR. This trait is controlled by a semidominant allele, Rht1, which maps on linkage group 12 of the sunflower public consensus map. Phenotypic effects of this allele include shorter height and internode length, insensibility to exogenous gibberellin application, normal skotomorphogenetic response, and reduced seed set under self-pollination conditions. This later effect presumably is related to the reduced pollen viability observed in all DDR-derived lines studied. Rht1 completely cosegregated with a haplotype of the HaDella1 gene sequence. This haplotype consists of a point mutation converting a leucine residue in a proline within the conserved DELLA domain. Taken together, the phenotypic, genetic, and molecular results reported here indicate that Rht1 in sunflower likely encodes an altered DELLA protein. If the DELPA motif of the HaDELLA1 sequence in the Rht1-encoded protein determines by itself the observed reduction in height is a matter that remains to be investigated.

  16. Morphological and agronomic characterization of potato plants cv. `Andinita' starting from planting in field of microtubers obtained in temporary immersion systems

    Directory of Open Access Journals (Sweden)

    Janet Igarza

    2014-04-01

    Full Text Available The potato (Solanum tuberosum L. is one of the most important crops worldwide. Use microtubers as planting material could mean a breakthrough for seed production programs. This study aimed to determine the morphological characteristics and field agronomic response of potato plants cv. `Andinita' obtained from microtubers of different diameters and fresh mass produced in temporary immersion systems. The microtubers were classified in four diameters, 10 mm and stored in plastic containers at a temperature ranging between 11.0 and 15.0°C. At the time of planting was observed the microtubers with a diameter less than 4.0 mm were dehydrated and therefore were not used. At 21 days of the plantation differences in the survival of plants were significant, the highest percentage (93.9% was achieved by planting microtubers with more than 10 mm diameter. Microtubers obtaining in temporary immersion systems did not affect the morphological characteristics of the plants during their growth cycle and from the point of view agricultural an average of 8.5 at 9.5 tubers by plant was achieved. With a relative yield per plant between 1.9 - 2.3 kg and 16 to 23% of tubers with desired characteristics for conservation as seed. It was shown that both the vegetative development of the plantation as the number and fresh weight of tubers obtained depended on the size and fresh weight of microtubers used as planting material and that may use them for direct planting in the field. Key words: microtubers, seed, Solanum tuberosum subsp. andigenum

  17. To effectively adapt and renew workforce competences

    International Nuclear Information System (INIS)

    Pezzani, P.

    2007-01-01

    Full text: Most of French operating nuclear plants were constructed within a small time window. Few new plants have come on line within the last decade. As a result, most operating plants today have an ageing workforce that is going to retire in large numbers. In the next ten years, 40% of EDF nuclear workforce is going to retire, in average 600 people per year. At the same time, potential restructurings are opportunities to provide internal personnel for Nuclear Power Plants. The first generation of nuclear industry workers was hired during nuclear plant starting and testing. That was an opportunity to for training in the field without nuclear hazard. In addition, the NPP requirements increased dramatically through the last twenty years. This situation led to start a project to effectively adapt and renew workforce competences in the 19 EDF NPP in France. This Paper describes three steps to successfully ensure this transition to the new generation of nuclear industry workers. Acting in the field from their initial training, recruits are earlier ready to perform: 1. A Nuclear Job Academy in each French region based on Team Building and Sister Plants association, new training techniques and field training regarding behaviour and craft. All the new comers in Nuclear Power Station are led by an experienced technical mentor and trained by managers and experienced staff. 2. Flow loop maintenance simulator in each plant.On line training and test for periodic training.Step by Step qualification process. Internal workforce moving and rotation become a consistent, safe and successful opportunity to renew competences: EDF Group promotes the mobility of human resources by improving skills management (training programs, encouraging profession mobility, and reorientation towards priority jobs). To ensure that each nuclear new comer from internal workforce meets the nuclear requirements (as hired people), we build strong process witch guaranty internal people recruitment with

  18. Ten-Competence: Life-Long Competence Development and Learning

    NARCIS (Netherlands)

    Koper, Rob; Specht, Marcus

    2006-01-01

    Koper, R., & Specht, M. (2008). Ten-Competence: Life-Long Competence Development and Learning. In M-A. Cicilia (Ed.), Competencies in Organizational e-learning: concepts and tools (pp. 234-252). Hershey: IGI-Global.

  19. Characterization of MADS genes in the gymnosperm Gnetum parvifolium and its implication on the evolution of reproductive organs in seed plants.

    Science.gov (United States)

    Shindo, S; Ito, M; Ueda, K; Kato, M; Hasebe, M

    1999-01-01

    Gnetales, one of the extant gymnosperm orders, has traditionally been recognized to be most closely related to flowering plants, because the reproductive organ of Gnetales has some morphological characteristics similar to flowering plants. Most recent molecular phylogenetic studies do not support the sister relationship of the Gnetales and flowering plants, but instead support a close relationship between Gnetales and other extant gymnosperms. The MADS genes are transcription factors, some of which are involved in reproductive organ development in flowering plants. To resolve the discrepancy in phylogenetic inferences, and to provide insights into the evolution of reproductive organs in seed plants, four MADS genes (GpMADS1-4) were cloned from Gnetum parvifolium. GpMADS2 is likely to be a pseudogene and the other three genes were characterized. A MADS gene tree based on partial amino acid sequences showed that GpMADS3 is included in the AGL6 group, but the other two genes do not cluster with any previously reported MADS gene. The three GpMADS genes were expressed during the early stage of ovule development in the differentiating nucellus and three envelopes. A comparison of MADS gene expression among conifers, Gnetum, and flowering plants suggests that the comparable reproductive organs in Gnetum and flowering plants evolved in parallel, and is likely to support the homology between the ovule-ovuliferous scale complex of conifers and the Gnetum ovules, including the three envelopes.

  20. Caracterização morfológica de plantas de rambutan = Morphological characterization of rambutan plants

    Directory of Open Access Journals (Sweden)

    Renata Aparecida de Andrade

    2009-10-01

    Full Text Available Em certas espécies vegetais, a distinção entre variedades pode ser realizada com base em aspectos morfológicos das plantas, o que permite a identificação mesmo quando não apresentam flores e/ou frutos. Diante disso, realizou-se o presente trabalho cujo objetivo foi a caracterização morfológica e o agrupamento de plantas de rambutan. Foram avaliados: altura da planta (cm, diâmetro e geometria da copa (entre linhas e entre plantas,em cm, diâmetro do tronco (cm e disposição dos ramos no tronco, tamanho de folhas efolíolos (comprimento e largura, em cm, número de folíolos,comprimento da ráquis (cm,comprimento do pecíolo (cm, área foliar (cm2, vigor das plantas, sensibilidade ao frio,formato dos folíolos, pilosidade, coloração dos folíolos (faces superior e inferior, tipo de nervação e disposição dos folíolos na ráquis. Os dados foram submetidos à análise de agrupamento pelo método UPGMA, a partir da distância de Mahalanobis. Com base nos resultados obtidos, pode-se concluir que o uso de descritores morfológicos é eficiente nadeterminação de divergência genética entre os materiais de rambutan estudados, não sendo,porém, possível sua distinção visual, por não existir uma característica discriminatória satisfatória.In some vegetable species, the distinction between varieties can be made based on morphological aspects of the leaves, permitting the differentiation even when these ones do not display flowers and/or fruits. Consequently, the present research was conducted, aiming at the morphological characterization and grouping of rambutan plants. Were evaluated: plant height (cm, cup diameter and geometry (between lines and plants, in cm, trunk diameter (cm, leaves and leaflet size (length and width, in cm, leaflet number, stem length (cm,length of the petiolate (cm, left area (cm², plant vigor, cold sensibility, leaflet format,pilosity, coloration of the leaflet (inferior and superior sides, veining

  1. Isolation and characterization of novel plant growth promoting Micrococcus sp NII-0909 and its interaction with cowpea

    Digital Repository Service at National Institute of Oceanography (India)

    Dastager, S.G.; Deepa, C.K.; Pandey, A.

    effectiveness can be enhanced [36]. A potential Micrococcus strain NII-0909 isolated from Western ghat forest possessed multiple plant growth traits, like P-solubilization, IAA and Siderophore production. Plant hormones are central endogenous regulators...

  2. Developing Approaches to Competence: Away from the Metaphor of Competence as a Hidden Object.

    Science.gov (United States)

    Byers, Patrick

    2017-03-01

    Assessments of linguistic ability amongst inner city African American children in the 1960's and cross-cultural assessments of problem solving skills amongst participants without formal education in several contexts around the world have both demonstrated the need for investigators to distinguish the possible existence of some form of competency from the matter of whether evidence of that competency can be elicited with a particular assessment tool. In both of the previously mentioned cases, the evidence suggests that participants had the competencies in question and failed to demonstrate them (at least partially) as a result of the nature of the assessment context. The current article takes these demonstrations of the need for culturally sensitive assessment as a point of departure, and argues that today, a further development in how competence is understood is necessary. For all its benefits, the idea of culturally sensitive assessment still relies on the problematic characterization of competencies as discrete sets of stable underlying dispositions. Current research from the dynamic systems perspective in psychology suggests that intelligent human action involves the contextual and self-organized emergence of adaptive behavioral solutions, rather than the expression of preplanned, latent competencies. An adequate conceptualization of competence must therefore account for this emergence, rather than positing competencies as hidden or latent behavioral performances.

  3. Biochemical characterization of the tomato phosphatidylinositol-specific phospholipase C (PI-PLC) family and its role in plant immunity

    NARCIS (Netherlands)

    Abd-El-Haliem, Ahmed; Vossen, J.H.; Zeijl, van Arjan; Dezhsetan, Sara; Testerink, Christa; Seidl, M.F.; Beck, Martina; Strutt, James; Robatzek, Silke; Joosten, M.H.A.J.

    2016-01-01

    Plants possess effective mechanisms to quickly respond to biotic and abiotic stresses. The rapid activation of phosphatidylinositol-specific phospholipase C (PLC) enzymes occurs early after the stimulation of plant immune-receptors. Genomes of different plant species encode multiple PLC homologs

  4. Genomic characterization of plant cell wall degrading enzymes and in silico analysis of xylanses and polygalacturonases of Fusarium virguliforme

    Science.gov (United States)

    Plant cell wall degrading enzymes (PCWDEs) are important effectors for plant pathogens to invade plants. In this study, the composition of PCWDEs in Fusarium virguliforme that were grown for 5-days and 20 days in liquid medium was determined by RNA-Seq. Differential expression analysis showed more P...

  5. ACCP Clinical Pharmacist Competencies.

    Science.gov (United States)

    Saseen, Joseph J; Ripley, Toni L; Bondi, Deborah; Burke, John M; Cohen, Lawrence J; McBane, Sarah; McConnell, Karen J; Sackey, Bryan; Sanoski, Cynthia; Simonyan, Anahit; Taylor, Jodi; Vande Griend, Joseph P

    2017-05-01

    The purpose of the American College of Clinical Pharmacy (ACCP) is to advance human health by extending the frontiers of clinical pharmacy. Consistent with this mission and its core values, ACCP is committed to ensuring that clinical pharmacists possess the knowledge, skills, attitudes, and behaviors necessary to deliver comprehensive medication management (CMM) in team-based, direct patient care environments. These components form the basis for the core competencies of a clinical pharmacist and reflect the competencies of other direct patient care providers. This paper is an update to a previous ACCP document and includes the expectation that clinical pharmacists be competent in six essential domains: direct patient care, pharmacotherapy knowledge, systems-based care and population health, communication, professionalism, and continuing professional development. Although these domains align with the competencies of physician providers, they are specifically designed to better reflect the clinical pharmacy expertise required to provide CMM in patient-centered, team-based settings. Clinical pharmacists must be prepared to complete the education and training needed to achieve these competencies and must commit to ongoing efforts to maintain competence through ongoing professional development. Collaboration among stakeholders will be needed to ensure that these competencies guide clinical pharmacists' professional development and evaluation by educational institutions, postgraduate training programs, professional societies, and employers. © 2017 Pharmacotherapy Publications, Inc.

  6. On Verbal Competence

    Directory of Open Access Journals (Sweden)

    Zhongxin Dai

    2014-04-01

    Full Text Available This paper explored a new concept, verbal competence, to present a challenge to Chomsky’s linguistic competence and Hymes’ communicative competence. It is generally acknowledged that Chomsky concerned himself only with the syntactic/grammatical structures, and viewed the speaker’s generation and transformation of syntactic structures as the production of language. Hymes challenged Chomsky’s conception of linguistic competence and argued for an ethnographic or sociolinguistic concept, communicative competence, but his concept is too broad to be adequately grasped and followed in such fields as linguistics and second language acquisition. Communicative competence can include abilities to communicate with nonverbal behaviors, e.g. gestures, postures or even silence. The concept of verbal competence concerns itself with the mental and psychological processes of verbal production in communication. These processes originate from the speaker’s personal experience, in a certain situation of human communication, and with the sudden appearance of the intentional notion, shape up as the meaning images and end up in the verbal expression.

  7. Isolation and functional characterization of JcFT, a FLOWERING LOCUS T (FT) homologous gene from the biofuel plant Jatropha curcas.

    Science.gov (United States)

    Li, Chaoqiong; Luo, Li; Fu, Qiantang; Niu, Longjian; Xu, Zeng-Fu

    2014-05-08

    Physic nut (Jatropha curcas L.) is a potential feedstock for biofuel production because Jatropha oil is highly suitable for the production of the biodiesel and bio-jet fuels. However, Jatropha exhibits low seed yield as a result of unreliable and poor flowering. FLOWERING LOCUS T (FT) -like genes are important flowering regulators in higher plants. To date, the flowering genes in Jatropha have not yet been identified or characterized. To better understand the genetic control of flowering in Jatropha, an FT homolog was isolated from Jatropha and designated as JcFT. Sequence analysis and phylogenetic relationship of JcFT revealed a high sequence similarity with the FT genes of Litchi chinensis, Populus nigra and other perennial plants. JcFT was expressed in all tissues of adult plants except young leaves, with the highest expression level in female flowers. Overexpression of JcFT in Arabidopsis and Jatropha using the constitutive promoter cauliflower mosaic virus 35S or the phloem-specific promoter Arabidopsis SUCROSE TRANSPORTER 2 promoter resulted in an extremely early flowering phenotype. Furthermore, several flowering genes downstream of JcFT were up-regulated in the JcFT-overexpression transgenic plant lines. JcFT may encode a florigen that acts as a key regulator in flowering pathway. This study is the first to functionally characterize a flowering gene, namely, JcFT, in the biofuel plant Jatropha.

  8. Critical Roles of Vacuolar Invertase in Floral Organ Development and Male and Female Fertilities Are Revealed through Characterization of GhVIN1-RNAi Cotton Plants.

    Science.gov (United States)

    Wang, Lu; Ruan, Yong-Ling

    2016-05-01

    Seed number and quality are key traits determining plant fitness and crop yield and rely on combined competence in male and female fertilities. Sucrose metabolism is central to reproductive success. It remains elusive, though, how individual sucrose metabolic enzymes may regulate the complex reproductive processes. Here, by silencing vacuolar invertase (VIN) genes in cotton (Gossypium hirsutum) reproductive organs, we revealed diverse roles that VIN plays in multiple reproductive processes. A set of phenotypic and genetic studies showed significant reductions of viable seeds in GhVIN1-RNAi plants, attributed to pollination failure and impaired male and female fertilities. The former was largely owing to the spatial mismatch between style and stamen and delayed pollen release from the anthers, whereas male defects came from poor pollen viability. The transgenic stamen exhibited altered expression of the genes responsible for starch metabolism and auxin and jasmonic acid signaling. Further analyses identified the reduction of GhVIN expression in the seed coat as the major cause for the reduced female fertility, which appeared to disrupt the expression of some key genes involved in trehalose and auxin metabolism and signaling, leading to programmed cell death or growth repression in the filial tissues. Together, the data provide an unprecedented example of how VIN is required to synchronize style and stamen development and the formation of male and female fertilities for seed development in a crop species, cotton. © 2016 American Society of Plant Biologists. All Rights Reserved.

  9. Detection and Molecular Characterization of Hepatitis A Virus from Tunisian Wastewater Treatment Plants with Different Secondary Treatments.

    Science.gov (United States)

    Ouardani, Imen; Turki, Syrine; Aouni, Mahjoub; Romalde, Jesús L

    2016-07-01

    Hepatitis A virus (HAV) is the main causative agent of hepatitis infection associated with waterborne outbreaks worldwide. In Tunisia, there is no specific surveillance system for HAV and current secondary wastewater treatment processes are unable to remove viral particles, which present a potential public health problem. Qualitative and quantitative analysis of HAV in 271 raw and treated wastewater samples from five sewage treatment plants (STPs) during 13 months was performed. Moreover, the efficiency of three secondary wastewater treatment processes (conventional activated sludge, extended aeration, and oxidation ditch activated sludge) was evaluated. Data obtained demonstrated that HAV is endemic in Tunisia and circulates with high prevalence in both raw (66.9%) and treated (40.7%) wastewater. HAV circulates throughout the year in the coastal areas, with the highest rates found during summer and autumn, whereas in central Tunisia, high levels were shown in autumn and winter. Total virus removal was not achieved, since no difference in mean HAV loads was observed in effluents (6.0 × 10(3) genome copies [GC]/ml) and influents (2.7 × 10(3) GC/ml). The comparison of the HAV removal values of the three different wastewater treatment methods indicates that extended aeration and oxidation ditch activated sludge had better efficiency in removing viruses than conventional activated sludge did. Molecular characterization revealed that the vast majority of HAV strains belonged to subgenotype IA, with the cocirculation of subgenotype IB in wastewater treatment plants that collect tourism wastewater. This report provides important data on the incidence, behavior, seasonality, and genotype distribution of HAV in the environment in Tunisia, as well as the risk of infection derived from its occurrence in effluents due to inadequate wastewater treatment. In addition, these findings seem to confirm that the prevalence of HAV depends on socioeconomic level, sanitary conditions

  10. Bidirectional Associations among Sensitive Parenting, Language Development, and Social Competence

    Science.gov (United States)

    Barnett, Melissa A.; Gustafsson, Hanna; Deng, Min; Mills-Koonce, W. Roger; Cox, Martha

    2012-01-01

    Rapid changes in language skills and social competence, both of which are linked to sensitive parenting, characterize early childhood. The present study examines bidirectional associations among mothers' sensitive parenting and children's language skills and social competence from 24 to 36?months in a community sample of 174 families. In addition,…

  11. Key competences in the new ventures: a model for evaluating

    NARCIS (Netherlands)

    Castillo, S.M.; Hormiga-Pérez, E.; Coromina Soler, L.; Valls Pasola, J.

    2010-01-01

    This research studies from an internal view based on the Competency-Based Perspective (CBP), key organizational competencies developed for small new business. CBP is chosen in an attempt to explain the differences characterizing the closed companies from the consolidated ones. The main contribution

  12. Cyclotide Discovery in Gentianales Revisited—Identification and Characterization of Cyclic Cystine-Knot Peptides and Their Phylogenetic Distribution in Rubiaceae Plants

    Science.gov (United States)

    Koehbach, Johannes; Attah, Alfred F.; Berger, Andreas; Hellinger, Roland; Kutchan, Toni M.; Carpenter, Eric J.; Rolf, Megan; Sonibare, Mubo A.; Moody, Jones O.; Ka-Shu Wong, Gane; Dessein, Steven; Greger, Harald; Gruber, Christian W.

    2013-01-01

    Cyclotides are a unique class of ribosomally synthesized cysteine-rich miniproteins characterized by a head-to-tail cyclized backbone and three conserved disulfide-bonds in a knotted arrangement. Originally they were discovered in the coffee-family plant Oldenlandia affinis (Rubiaceae) and have since been identified in several species of the violet, cucurbit, pea, potato, and grass families. However, the identification of novel cyclotide-containing plant species still is a major challenge due to the lack of a rapid and accurate analytical workflow in particular for large sampling numbers. As a consequence, their phylogeny in the plant kingdom remains unclear. To gain further insight into the distribution and evolution of plant cyclotides, we analyzed ~300 species of >40 different families, with special emphasis on plants from the order Gentianales. For this purpose, we have developed a refined screening methodology combining chemical analysis of plant extracts and bioinformatic analysis of transcript databases. Using mass spectrometry and transcriptome-mining, we identified nine novel cyclotide-containing species and their related cyclotide precursor genes in the tribe Palicoureeae. The characterization of novel peptide sequences underlines the high variability and plasticity of the cyclotide framework, and a comparison of novel precursor proteins from Carapichea ipecacuanha illustrated their typical cyclotide gene architectures. Phylogenetic analysis of their distribution within the Psychotria alliance revealed cyclotides to be restricted to Palicourea, Margaritopsis, Notopleura, Carapichea, Chassalia, and Geophila. In line with previous reports, our findings confirm cyclotides to be one of the largest peptide families within the plant kingdom and suggest that their total number may exceed tens of thousands. PMID:23897543

  13. Biochemical characterization of the triticale TsPAP1, a new type of plant prolyl aminopeptidase, and its impact on proline content and flowering time in transgenic Arabidopsis plants.

    Science.gov (United States)

    Zdunek-Zastocka, Edyta; Grabowska, Agnieszka; Branicki, Tomasz; Michniewska, Beata

    2017-07-01

    Proline aminopeptidase (PAP, EC 3.4.11.5) is the only enzyme that effectively releases proline from the N-termini of peptides. The amino acid sequence of the PAP from Triticosecale, TsPAP1, comprises conserved regions, characteristic of the monomeric forms of PAP found in bacteria but not yet identified in plants. Therefore, we aimed to obtain and biochemically characterize the TsPAP1 protein. The recombinant TsPAP1 protein was received through heterologous expression of the TsPAP1 coding sequence in a bacterial expression system and purified with affinity chromatography. Gel filtration chromatography and SDS electrophoresis revealed that TsPAP1 is a monomer with a molecular mass of 37.5 kDa. TsPAP1 prefers substrates with proline at the N-terminus but is also capable of hydrolyzing β-naphthylamides of hydroxyproline and alanine. Among the peptides tested, the most preferred were di- and tripeptides, especially those with glycine in the Y position. The use of diagnostic inhibitors indicated that TsPAP1 is a serine peptidase; however, further characterization revealed that the SH residues are also important for maintaining its activity. To examine the role of TsPAP1 under physiological conditions, we developed transgenic Arabidopsis plants overexpressing TsPAP1. Compared with wild-type plants, the transgenic lines accumulated more proline, flowered an average of 3.5 days earlier, and developed more siliques than did untransformed controls. Our paper is the first to describe the biochemical properties of a novel monomeric plant PAP and contributes to the functional characterization of PAP proteins in plants. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. VOZ; isolation and characterization of novel vascular plant transcription factors with a one-zinc finger from Arabidopsis thaliana.

    Science.gov (United States)

    Mitsuda, Nobutaka; Hisabori, Toru; Takeyasu, Kunio; Sato, Masa H

    2004-07-01

    A 38-bp pollen-specific cis-acting region of the AVP1 gene is involved in the expression of the Arabidopsis thaliana V-PPase during pollen development. Here, we report the isolation and structural characterization of AtVOZ1 and AtVOZ2, novel transcription factors that bind to the 38-bp cis-acting region of A. thaliana V-PPase gene, AVP1. AtVOZ1 and AtVOZ2 show 53% amino acid sequence similarity. Homologs of AtVOZ1 and AtVOZ2 are found in various vascular plants as well as a moss, Physcomitrella patens. Promoter-beta-glucuronidase reporter analysis shows that AtVOZ1 is specifically expressed in the phloem tissue and AtVOZ2 is strongly expressed in the root. In vivo transient effector-reporter analysis in A. thaliana suspension-cultured cells demonstrates that AtVOZ1 and AtVOZ2 function as transcriptional activators in the Arabidopsis cell. Two conserved regions termed Domain-A and Domain-B were identified from an alignment of AtVOZ proteins and their homologs of O. sativa and P. patens. AtVOZ2 binds as a dimer to the specific palindromic sequence, GCGTNx7ACGC, with Domain-B, which is comprised of a functional novel zinc coordinating motif and a conserved basic region. Domain-B is shown to function as both the DNA-binding and the dimerization domains of AtVOZ2. From highly the conservative nature among all identified VOZ proteins, we conclude that Domain-B is responsible for the DNA binding and dimerization of all VOZ-family proteins and designate it as the VOZ-domain.

  15. Use of borehole geophysical logs for improved site characterization at Naval Weapons Industrial Reserve Plant, Dallas, Texas

    Science.gov (United States)

    Anaya, Roberto; Braun, Christopher L.; Kuniansky, Eve L.

    2000-01-01

    A shallow alluvial aquifer at the Naval Weapons Industrial Reserve Plant near Dallas, Texas, has been contaminated by organic solvents used in the fabrication and assembly of aircraft and aircraft parts. Natural gamma-ray and electromagnetic-induction log data collected during 1997 from 162 wells were integrated with existing lithologic and cone-penetrometer test log data to improve characterization of the subsurface alluvium at the site. The alluvium, consisting of mostly fine-grained, low-permeability sediments, was classified into low, intermediate, and high clay-content sediments on the basis of the gamma-ray logs. Low clay-content sediments were interpreted as being relatively permeable, whereas high clay-content sediments were interpreted as being relatively impermeable. Gamma-ray logs, cone-penetrometer test logs, and electromagnetic-induction logs were used to develop a series of intersecting sections to delineate the spatial distribution of low, intermediate, and high clay-content sediments and to delineate zones of potentially contaminated sediments. The sections indicate three major sedimentary units in the shallow alluvial aquifer at NWIRP. The lower unit consists of relatively permeable, low clay-content sediments and is absent over the southeastern and northwestern part of the site. Permeable zones in the complex, discontinuous middle unit are present mostly in the western part of the site. In the eastern and southeastern part of the site, the upper unit has been eroded away and replaced by fill material. Zones of potentially contaminated sediments are generally within the uppermost clay layer or fill material. In addition, the zones tend to be local occurrences.

  16. Characterization of the inside and outside oxide surfaces of irradiated pressure tubes of Embalse nuclear power plant

    International Nuclear Information System (INIS)

    Bordoni, Roberto A.; Olmedo, Ana M.

    2004-01-01

    The inside and outside surfaces of two pressure tubes (PT) removed from Embalse nuclear power plant (CNE) after 10 of effective full power years (EFPY) were characterized. The oxide thickness of both faces, in different zones, was also measured. The inside surfaces of both PTs, B-102 (A-14) and B-298 (L-12), were covered with a black oxide that replicates the original PT surface. A network of microcracks perpendicular to the inside surface in contact with the coolant was found. In some cases, near the outlet of the PT, some spalling of the oxide was also found. These small microcracks and spalling do not affect the protective character of the oxide since a thickness about 5 or 6 μm of an undamaged oxide is found at the metal/oxide interface side. The oxide thickness changes between approximately 6 to 12 μm for B-102 tube and around 7 to 15 μm for B-298 tube. The average corrosion rate is 1.16 μm/10 4 HH for B-102 tube and 1.35 μm/10 4 HH for B-298 tube at 5.8 m position for both PTs. These corrosion rates show good corrosion behaviour of CNE PTs. The average corrosion rate of the inside surface of the PTs depends on the coolant temperature but not on fast neutron flux. The outside oxide film is black, shiny, compact and protective, replicating also the original surface. The oxide thickness changes between 2 to 6.5 μm in B-102 tube and between 1.8 to 3.7 μm B-298 tube. These oxide thicknesses are within the values reported for PTs in CANDU Stations. (author) [es

  17. Screening and identification of phytotoxic volatile compounds in medicinal plants and characterizations of a selected compound, eucarvone.

    Science.gov (United States)

    Sunohara, Yukari; Baba, Yohei; Matsuyama, Shigeru; Fujimura, Kaori; Matsumoto, Hiroshi

    2015-07-01

    Screening and identification of phytotoxic volatile compounds were performed using 71 medicinal plant species to find new natural compounds, and the characterization of the promising compound was investigated to understand the mode of action. The volatile compounds from Asarum sieboldii Miq. showed the strongest inhibitory effect on the hypocotyl growth of lettuce seedlings (Lactuca sativa L.cv. Great Lakes 366), followed by those from Schizonepeta tenuifolia Briquet and Zanthoxylum piperitum (L.) DC.. Gas chromatography-mass spectrometry (GC/MS) identified four volatile compounds, α-pinene (2,6,6-trimethylbicyclo[3.1.1]hept-2-ene), β-pinene (6,6-dimethyl-2-methylenebicyclo[3.1.1]heptane), 3-carene (3,7,7-trimethylbicyclo[4.1.0]hept-3-ene), and eucarvone (2,6,6-trimethy-2,4-cycloheptadien-1-one), from A. sieboldii, and three volatile compounds, limonene (1-methyl-4-(1-methylethenyl)-cyclohexene), menthone (5-methyl-2-(propan-2-yl)cyclohexan-1-one), and pulegone (5-methyl-2-propan-2-ylidenecyclohexan-1-one), from S. tenuifolia. Among these volatile compounds, eucarvone, menthone, and pulegone exhibited strong inhibitory effects on both the root and shoot growth of lettuce seedlings. Eucarvone-induced growth inhibition was species-selective. Cell death, the generation of reactive oxygen species (ROS), and lipid peroxidation were induced in susceptible finger millet seedlings by eucarvone treatment, whereas this compound (≤158 μM) did not cause the increase of lipid peroxidation and ROS production in tolerant maize. The results of the present study show that eucarvone can have strong phytotoxic activity, which may be due to ROS overproduction and subsequent oxidative damage in finger millet seedlings.

  18. Characterization of corn landraces planted grown in the campos gerais region (Paraná, Brazil for industrial utilization

    Directory of Open Access Journals (Sweden)

    Alessandra Teixeira Barbosa Pinto

    2009-11-01

    Full Text Available This work has the objective of characterizing twenty corn landraces grown in the Campos Gerais region (Paraná State in relation to its chemical composition (moisture, ash, protein, ether extract, dietary fiber and starch and physical properties (weight of 1000 grains, real density, flotation index, granulometry and color. In addition, also the lab scale processing of the kernels from the varieties was carried out for producing starch; starch purity was evaluated by measuring its protein contamination. Amylose contents and viscoamylograph profile were also evaluated. The results showed that the evaluated landraces have differences in chemical composition as well as in pericarp/endosperm/germ proportions and consequently it should have different industrial applications and interest for plant breeding.Esse trabalho teve o objetivo de caracterizar vinte variedades de milho crioulo cultivadas na região dos Campos Gerais (Estado do Paraná em relação a sua composição química (umidade, cinzas, proteína, extrato etéreo, fibra alimentar e amido e propriedades físicas (peso de 1000 grãos, densidade real, índice de flotação, granulometria e cor Além disso, foi feito o processamento dos grãos em escala de laboratório para a extração do amido, sendo mensurado o teor de proteína. Foram avaliados os conteúdos de amilose e o perfil viscoamilográfico. Os resultados mostraram que os milhos apresentaram diferentes composições químicas e proporções pericarpo/endosperma/ gérmen e consequentemente podem ter diferentes aplicações industriais e interesse ao melhoramento de plantas.

  19. Novel Hypovirulence-Associated RNA Mycovirus in the Plant-Pathogenic Fungus Botrytis cinerea: Molecular and Biological Characterization

    Science.gov (United States)

    Yu, Lin; Sang, Wen; Wu, Ming-De; Zhang, Jing; Yang, Long; Zhou, Ying-Jun; Chen, Wei-Dong

    2015-01-01

    Botrytis cinerea is a pathogenic fungus causing gray mold on numerous economically important crops and ornamental plants. This study was conducted to characterize the biological and molecular features of a novel RNA mycovirus, Botrytis cinerea RNA virus 1 (BcRV1), in the hypovirulent strain BerBc-1 of B. cinerea. The genome of BcRV1 is 8,952 bp long with two putative overlapped open reading frames (ORFs), ORF1 and ORF2, coding for a hypothetical polypeptide (P1) and RNA-dependent RNA polymerase (RdRp), respectively. A −1 frameshifting region (designated the KNOT element) containing a shifty heptamer, a heptanucleotide spacer, and an H-type pseudoknot was predicted in the junction region of ORF1 and ORF2. The −1 frameshifting role of the KNOT element was experimentally confirmed through determination of the production of the fusion protein red fluorescent protein (RFP)-green fluorescent protein (GFP) by the plasmid containing the construct dsRed-KNOT-eGFP in Escherichia coli. BcRV1 belongs to a taxonomically unassigned double-stranded RNA (dsRNA) mycovirus group. It is closely related to grapevine-associated totivirus 2 and Sclerotinia sclerotiorum nonsegmented virus L. BcRV1 in strain BerBc-1 was found capable of being transmitted vertically through macroconidia and horizontally to other B. cinerea strains through hyphal contact. The presence of BcRV1 was found to be positively correlated with hypovirulence in B. cinerea, with the attenuation effects of BcRV1 on mycelial growth and pathogenicity being greatly affected by the accumulation level of BcRV1. PMID:25595766

  20. Morphological and Morphometrical Characterization of Meloidogyne incognita from Different Host Plants in Four Districts of Punjab, India.

    Science.gov (United States)

    Kaur, Harpreet; Attri, Rajni

    2013-06-01

    The population of M. incognita, the root knot nematode (RKN) was found infesting five different host plants (okra, banana, sunflower, bottle gourd, and brinjal) out of 24 examined from four districts of Punjab, India (Gurdaspur, Ludhiana, Patiala, and Hoshiarpur). Morphological and morphometrical characterization indicated that in the case of mature female, the characters of body length and width, neck length, ratio 'a', anus to tail terminus (ATT), interphasmid distance (IPD), and perineal pattern were recorded as stable characters. These taxonomic characters can be reliable for identification. All characters of second-stage juvenile (J2) such as body length, stylet length, head to median bulb length (H-MB), distance from median bulb to excretory pore (MB-EP), tail length, anal body width (ABW), and ratios C and C' were highly variable. Analysis of interpopulation morphometric characters of mature female of M. incognita, namely, body length, width, and ratio 'a' were moderately variable characters (CV 0.26% to 20%) and stylet length, neck length, length of median bulb (LMB), and width of median bulb (WMB) were highly variable (CV 1.0% to 36.1%). In the perineal pattern, the two characters ATT and IPD were moderately variable (CV 8.8% to 17.6%) and two characters, anus to vulval slit (AVS) and length of vulval slit (LVS), were highly variable (CV 2.1% to 40.5%). In J2, body length, stylet length, H-MB, MB-EP, ABW, tail length, ratios C, and C' were highly variable characters (CV > 12%).

  1. Identification and characterization of plant cell wall degrading enzymes from three glycoside hydrolase families in the cerambycid beetle Apriona japonica.

    Science.gov (United States)

    Pauchet, Yannick; Kirsch, Roy; Giraud, Sandra; Vogel, Heiko; Heckel, David G

    2014-06-01

    Xylophagous insects have evolved to thrive in a highly challenging environment. For example, wood-boring beetles from the family Cerambycidae feed exclusively on woody tissues, and to efficiently access the nutrients present in this sub-optimal environment, they have to cope with the lignocellulose barrier. Whereas microbes of the insect's gut flora were hypothesized to be responsible for the degradation of lignin, the beetle itself depends heavily on the secretion of a range of enzymes, known as plant cell wall degrading enzymes (PCWDEs), to efficiently digest both hemicellulose and cellulose networks. Here we sequenced the larval gut transcriptome of the Mulberry longhorn beetle, Apriona japonica (Cerambycidae, Lamiinae), in order to investigate the arsenal of putative PCWDEs secreted by this species. We combined our transcriptome with all available sequencing data derived from other cerambycid beetles in order to analyze and get insight into the evolutionary history of the corresponding gene families. Finally, we heterologously expressed and functionally characterized the A. japonica PCWDEs we identified from the transcriptome. Together with a range of endo-β-1,4-glucanases, we describe here for the first time the presence in a species of Cerambycidae of (i) a xylanase member of the subfamily 2 of glycoside hydrolase family 5 (GH5 subfamily 2), as well as (ii) an exopolygalacturonase from family GH28. Our analyses greatly contribute to a better understanding of the digestion physiology of this important group of insects, many of which are major pests of forestry worldwide. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Unleashing Natural Competence in Lactococcus lactis by Induction of the Competence Regulator ComX

    Science.gov (United States)

    Mulder, Joyce; Wels, Michiel; Kuipers, Oscar P.; Bron, Peter A.

    2017-01-01

    ABSTRACT In biotechnological workhorses like Streptococcus thermophilus and Bacillus subtilis, natural competence can be induced, which facilitates genetic manipulation of these microbes. However, in strains of the important dairy starter Lactococcus lactis, natural competence has not been established to date. However, in silico analysis of the complete genome sequences of 43 L. lactis strains revealed complete late competence gene sets in 2 L. lactis subsp. cremoris strains (KW2 and KW10) and at least 10 L. lactis subsp. lactis strains, including the model strain IL1403 and the plant-derived strain KF147. The remainder of the strains, including all dairy isolates, displayed genomic decay in one or more of the late competence genes. Nisin-controlled expression of the competence regulator comX in L. lactis subsp. lactis KF147 resulted in the induction of expression of the canonical competence regulon and elicited a state of natural competence in this strain. In contrast, comX expression in L. lactis NZ9000, which was predicted to encode an incomplete competence gene set, failed to induce natural competence. Moreover, mutagenesis of the comEA-EC operon in strain KF147 abolished the comX-driven natural competence, underlining the involvement of the competence machinery. Finally, introduction of nisin-inducible comX expression into nisRK-harboring derivatives of strains IL1403 and KW2 allowed the induction of natural competence in these strains also, expanding this phenotype to other L. lactis strains of both subspecies. IMPORTANCE Specific bacterial species are able to enter a state of natural competence in which DNA is taken up from the environment, allowing the introduction of novel traits. Strains of the species Lactococcus lactis are very important starter cultures for the fermentation of milk in the cheese production process, where these bacteria contribute to the flavor and texture of the end product. The activation of natural competence in this industrially

  3. TENCompetence Competence Observatory

    NARCIS (Netherlands)

    Vervenne, Luk

    2010-01-01

    Vervenne, L. (2007) TENCompetence Competence Observatory. Sources available http://tencompetence.cvs.sourceforge.net/viewvc/tencompetence/wp8/org.tencompetence.co/. Available under the three clause BSD license, copyright TENCompetence Foundation.

  4. Competent poverty training.

    Science.gov (United States)

    Stabb, Sally D; Reimers, Faye A

    2013-02-01

    Despite numerous calls to the discipline, attention to poverty and social class remains minimal in psychology even though most human experience is significantly affected by social ranking. As a result, educators lack models for training in the context of poverty. Recent and concerted efforts to define and implement competency-based models for the practice of professional psychology have resulted in the creation of Competency Benchmarks (American Psychological Association, 2011). Here, these Competency Benchmarks frame the integration of best practices in working with poor and working-class clients with what we know about what constitutes good training. The result is a competency-based approach for those who are training psychologists-to-be to work effectively with economically challenged clients. © 2012 Wiley Periodicals, Inc.

  5. Production competence revisited

    DEFF Research Database (Denmark)

    Szász, Levente; Demeter, Krisztina; Boer, Harry

    2015-01-01

    Purpose – The purpose of this paper is to seek remedy to two major flaws of the production competence literature, which concern: the way the production competence construct is operationalized and the way its effects on performance are measured. Design/methodology/approach – The paper proposes...... to measure production competence as the two-dimensional operational level construct it actually is, and to use Slack’s (1994) importance performance matrix to study its business level performance effects. The three hypotheses developed are tested using a subsample of the International Manufacturing Strategy...... Survey database, which includes 465 manufacturing companies from 21 countries. Findings – The study offers additional empirical support for production competence theory. Going beyond supporting existing theory, the results give more detailed insight by indicating that low operational performance on even...

  6. Developing Leadership Competencies.

    Science.gov (United States)

    Croft, Lucy; Seemiller, Corey

    2017-12-01

    This chapter provides an overview of leadership competencies including the history of emergence, contemporary uses, common frameworks, challenges, benefits, and future implications. © 2017 Wiley Periodicals, Inc., A Wiley Company.

  7. Adult educators' core competences

    DEFF Research Database (Denmark)

    Wahlgren, Bjarne

    2016-01-01

    Abstract Which competences do professional adult educators need? This research note discusses the topic from a comparative perspective, finding that adult educators’ required competences are wide-ranging, heterogeneous and complex. They are subject to context in terms of national and cultural...... environment as well as the kind of adult education concerned (e.g. basic education, work-related education etc.). However, it seems that it is possible to identify certain competence requirements which transcend national, cultural and functional boundaries. This research note summarises these common or “core......” requirements, organising them into four thematic subcategories: (1) communicating subject knowledge; (2) taking students’ prior learning into account; (3) supporting a learning environment; and (4) the adult educator’s reflection on his or her own performance. At the end of his analysis of different competence...

  8. Strong Regionality and Dominance of Anaerobic Bacterial Taxa Characterize Diazotrophic Bacterial Communities of the Arcto-Alpine Plant Species Oxyria digyna and Saxifraga oppositifolia

    Directory of Open Access Journals (Sweden)

    Manoj Kumar

    2017-10-01

    Full Text Available Arctic and alpine biomes are most often strongly nitrogen-limited, and hence biological nitrogen fixation is a strong driver of these ecosystems. Both biomes are characterized by low temperatures and short growing seasons, but they differ in seasonality of solar radiation and in soil water balance due to underlying permafrost in the Arctic. Arcto-alpine plant species are well-adapted to the low temperatures that prevail in their habitats, and plant growth is mainly limited by the availability of nutrients, in particular nitrogen, due to slow mineralization. Nitrogen fixing bacteria are likely important for plant growth in these habitats, but very little is known of these bacteria or forces shaping their communities. In this study, we characterized the potential nitrogen fixing bacterial (PNFB communities associated with two arcto-alpine pioneer plant species, Oxyria digyna (mountain sorrel and Saxifraga oppositifolia (blue saxifrage, in three climate regions. Both of these plants readily colonize low nutrient mineral soils. Our goal was to investigate how climate (region and, on the other hand, host plant and plant species shape these communities. To our knowledge, this is the first comprehensive study describing PNFB communities associated with pioneer plants in different arcto-alpine biomes. Replicate samples were taken from two arctic regions, Kilpisjärvi and Ny-Ålesund, and one alpine region, Mayrhofen. In these, the PNFB communities in the bulk and rhizosphere soils and the plant endospheres were characterized by nifH-targeted PCR and massive parallel sequencing. The data revealed strong effects of climatic region on the dominating nitrogen fixers. Specifically, nifH sequences related to Geobacter (δ-Proteobacteria were present in high relative abundances in the nitrogen-fixing communities in the Mayrhofen and Kilpisjärvi regions, while members of the Clostridiales prevailed in the Kilpisjärvi and Ny-Ålesund regions. The bulk and

  9. Strategic Leader Competencies

    Science.gov (United States)

    1992-05-08

    competencies in line with his "visionary leadership theory ." His concept draws extensively from sound, quantitative research and social learning theory . A key...element of Sashkin’s theory identifies and distinguishes between "behavioral skills" required at the highest leadership levels and "personal... LEADERSHIP COMPETENCIES: - drawn from theory and research .... Co, sistent with broad groups of personality characteristics identified by Stogdill (1948

  10. Managing Regulatory Body Competence

    International Nuclear Information System (INIS)

    2013-01-01

    In 2001, the IAEA published TECDOC 1254, which examined the way in which the recognized functions of a regulatory body for nuclear facilities results in competence needs. Using the systematic approach to training (SAT), TECDOC 1254 provided a framework for regulatory bodies for managing training and developing and their maintaining their competence. It has been successfully used by many regulators. The IAEA has also introduced a methodology and an assessment tool - Guidelines for Systematic Assessment of Regulatory Competence Needs (SARCoN) - which provides practical guidance on analysing the training and development needs of a regulatory body and, through a gap analysis, guidance on establishing competence needs and how to meet them. In 2009, the IAEA established a steering committee (supported by a bureau) with the mission to advise the IAEA on how it could best assist Member States to develop suitable competence management systems for their regulatory bodies. The committee recommended the development of a safety report on managing staff competence as an integral part of a regulatory body's management system. This Safety Report was developed in response to this request. It supersedes TECDOC 1254, broadens its application to regulatory bodies for all facilities and activities, and builds upon the experience gained through the application of TECDOC 1254 and SARCoN and the feedback received from Member States. This Safety Report applies to the management of adequate competence as needs change, and as such is equally applicable to the needs of States 'embarking' on a nuclear power programme. It also deals with the special case of building up the competence of regulatory bodies as part of the overall process of establishing an 'embarking' State's regulatory system

  11. Effects of competing vegetation on growth of loblolly pine plantations in the West Gulf Coastal Plain

    Science.gov (United States)

    Dean W. Coble

    2015-01-01

    Competing woody vegetation negatively affects the growth of planted loblolly pine (Pinus taeda L.) trees by seizing site resources that otherwise would be used by the planted trees (Burkhart and Sprinz 1984).

  12. Time horizon dependent characterization factors for acidification in life-cycle assessment based on forest plant species occurrence in Europe

    NARCIS (Netherlands)

    Zelm, van R.; Huijbregts, M.J.A.; Jaarsveld, van H.A.; Reinds, G.J.; Zwart, de D.; Struijs, J.; Meent, van de D.

    2007-01-01

    This paper describes a new approach in life-cycle impact assessment to derive characterization factors for acidification in European forests. Time horizon dependent characterization factors for acidification were calculated, whereas before only steady-state factors were available. The

  13. Strengthening Regulatory Competence in Pakistan

    International Nuclear Information System (INIS)

    Sadiq, M.

    2016-01-01

    Capacity building of Pakistan Nuclear Regulatory Authority is considered an essential element in pursuit of its vision to become a world class regulatory body. Since its inception in 2001, PNRA has continuously endeavoured to invest in its people, develop training infrastructure and impart sound knowledge and professional skills with the aim to improve its regulatory effectiveness. The use of nuclear and radioactive material in Pakistan has increased manifold in recent years, thus induction of more manpower was needed for regulatory oversight. PNRA adopted two pronged approach for meeting the manpower demand (a) employment of university graduates through fast track recruitment drive and (b) induction of graduates by offering fellowships for Master degree programs. Although, the newly employed staff was selected on the basis of their excellent academic qualifications in basic and applied sciences, but they required rigorous knowledge and skills in regulatory perspectives. In order to implement a structured training program, PNRA conducted Training Needs Assessment (TNA) and identified competency gaps of the regulatory staff in legal, technical, regulatory practice and behavioural domains. PNRA took several initiatives for capacity building which included establishment of a training centre for sustainability of trainings, initiation of a fellowship scheme for Master program, attachment of staff at local institutes for on-the-job training and placement at foreign regulatory bodies and organizations for technical development with the assistance of IAEA. The above strategies have been very beneficial in competence building of the PNRA staff to perform all regulatory activities indigenously for nuclear power plants, research reactors and radiation facilities. Provision of vibrant technical support to IAEA and Member States in various programs by PNRA is a landmark of these competence development efforts. This paper summarizes PNRA initiatives and the International Atomic

  14. Engineered Plants as Biosensors

    National Research Council Canada - National Science Library

    Stewart, C

    2003-01-01

    The aim of the research was the creation of a model biosensing plant that could detect plant diseases and to characterize the utility of laser induced fluorescence imaging for detecting the inducible (LIFI) plant signal...

  15. Characterization of the Pratylenchus penetrans transcriptome including data mining of putative nematode genes involved in plant parasitism

    Science.gov (United States)

    The root lesion nematode Pratylenchus penetrans is considered one of the most economically important species within the genus. Host range studies have shown that nearly 400 plant species can be parasitized by this species. To obtain insight into the transcriptome of this migratory plant-parasitic ne...

  16. Characterization of staphylococci in urban wastewater treatment plants in Spain, with detection of methicillin resistant Staphylococcus aureus ST398.

    Science.gov (United States)

    Gómez, Paula; Lozano, Carmen; Benito, Daniel; Estepa, Vanesa; Tenorio, Carmen; Zarazaga, Myriam; Torres, Carmen

    2016-05-01

    The objective of this study was to determine the prevalence of Staphylococcus in urban wastewater treatment plants (UWTP) of La Rioja (Spain), and to characterize de obtained isolates. 16 wastewater samples (8 influent, 8 effluent) of six UWTPs were seeded on mannitol-salt-agar and oxacillin-resistance-screening-agar-base for staphylococci and methicillin-resistant Staphylococcus aureus recovery. Antimicrobial susceptibility profile was determined for 16 antibiotics and the presence of 35 antimicrobial resistance genes and 14 virulence genes by PCR. S. aureus was typed by spa, agr, and multilocus-sequence-typing, and the presence of immune-evasion-genes cluster was analyzed. Staphylococcus spp. were detected in 13 of 16 tested wastewater samples (81%), although the number of CFU/mL decreased after treatment. 40 staphylococci were recovered (1-5/sample), and 8 of them were identified as S. aureus being typed as (number of strains): spa-t011/agr-II/ST398 (1), spa-t002/agr-II/ST5 (2), spa-t3262/agr-II/ST5 (1), spa-t605/agr-II/ST126 (3), and spa-t878/agr-III/ST2849 (1). S. aureus ST398 strain was methicillin-resistant and showed a multidrug resistance phenotype. Virulence genes tst, etd, sea, sec, seg, sei, sem, sen, seo, and seu, were detected among S. aureus and only ST5 strains showed genes of immune evasion cluster. Thirty-two coagulase-negative Staphylococcus of 12 different species were recovered (number of strains): Staphylococcus equorum (7), Staphylococcus vitulinus (4), Staphylococcus lentus (4), Staphylococcus sciuri (4), Staphylococcus fleurettii (2), Staphylococcus haemolyticus (2), Staphylococcus hominis (2), Staphylococcus saprophyticus (2), Staphylococcus succinus (2), Staphylococcus capitis (1), Staphylococcus cohnii (1), and Staphylococcus epidermidis (1). Five presented a multidrug resistance phenotype. The following resistance and virulence genes were found: mecA, lnu(A), vga(A), tet(K), erm(C), msr(A)/(B), mph(C), tst, and sem. We found that

  17. Acquiring specific interpreting competence

    Directory of Open Access Journals (Sweden)

    Jana Zidar Forte

    2012-12-01

    Full Text Available In postgraduate interpreter training, the main objective of the course is to help trainees develop various competences, from linguistic, textual and cultural competence, to professional and specific interpreting competence. For simultaneous interpreting (SI, the main focus is on mastering the SI technique and strategies as well as on developing and strengthening communicative skills, which is discussed and illustrated with examples in the present paper. First, a brief overview is given of all the necessary competences of a professional interpreter with greater emphasis on specific interpreting competence for SI. In the second part of the paper, various approaches are described in terms of acquiring specific skills and strategies, specifically through a range of exercises. Besides interpreting entire speeches, practical courses should also consist of targeted exercises, which help trainees develop suitable coping strategies and mechanisms (later on almost automatisms, while at the same time "force" them to reflect on their individual learning process and interpreting performance. This provides a solid base on which trained interpreters can progress and develop their skills also after joining the professional sphere.

  18. Detection of TiO2Nanoparticles in Municipal Sewage Treatment Plant and Their Characterization Using Single Particle ICP-MS.

    Science.gov (United States)

    Bitragunta, Siva Prasad; Palani, Sankar Ganesh; Gopala, Anil; Sarkar, Santosh Kumar; Kandukuri, Venugopal Reddy

    2017-05-01

    Establishment of analytical methods for detection and characterization of nanoparticles in the environment are gaining prominence across the globe. The present study was designed to quantify titanium (Ti) and to characterize titanium dioxide nanoparticles (TNP) from a municipal sewage treatment plant, by inductively coupled plasma mass spectrometry (ICP-MS). The concentrations of Ti & TNP were 1085 & 13.6 mg/kg in the influent sewage and 298 & 3.3 mg/kg in the aeration tank contents, respectively. The size of TNP ranged between 71-145 nm in the sludge fraction. Determining environmentally realistic concentrations of TNP could serve as a tracer material for characterization of those nanomaterials with similar size and aggregation properties. Furthermore, inference of Ti and TNP in municipal sewage in the study will also help in environmental risk assessment of nanomaterials.

  19. Characterization of plant growth promoting traits of bacterial isolates from the rhizosphere of barley (Hordeum vulgare L.) and tomato (Solanum lycopersicon L.) grown under Fe sufficiency and deficiency.

    Science.gov (United States)

    Scagliola, M; Pii, Y; Mimmo, T; Cesco, S; Ricciuti, P; Crecchio, C

    2016-10-01

    Plant Growth Promoting Bacteria (PGPB) are considered a promising approach to replace the conventional agricultural practices, since they have been shown to affect plant nutrient-acquisition processes by influencing nutrient availability in the rhizosphere and/or those biochemical processes determining the uptake at root level of nitrogen (N), phosphorus (P), and iron (Fe), that represent the major constraints for crop productivity worldwide. We have isolated novel bacterial strains from the rhizosphere of barley (Hordeum vulgare L.) and tomato (Solanum lycopersicon L.) plants, previously grown in hydroponic solution (either Fe deficient or Fe sufficient) and subsequently transferred onto an agricultural calcareous soil. PGPB have been identified by molecular tools and characterized for their capacity to produce siderophores and indole-3-acetic acid (IAA), and to solubilize phosphate. Selected bacterial isolates, showing contemporarily high levels of the three activities investigated, were finally tested for their capacity to induce Fe reduction in cucumber roots two isolates, from barley and tomato plants under Fe deficiency, significantly increased the root Fe-chelate reductase activity; interestingly, another isolate enhanced the reduction of Fe-chelate reductase activity in cucumber plant roots, although grown under Fe sufficiency. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  20. PROSPECTIVE PRIMARY SCHOOL TEACHERS’ FOREIGN LANGUAGE SOCIOCULTURAL COMPETENCE: MONITORING PRINCIPLES

    Directory of Open Access Journals (Sweden)

    Olena Ishutina

    2016-04-01

    Full Text Available The paper substantiates the necessity and importance of the organization of prospective primary school teachers’ foreign language sociocultural competence monitoring in the educational process of high school. The author notes that prospective primary school teachers’ foreign language sociocultural competence is inseparably linked with linguomethodological competence. It is proved that the measurement of foreign language sociocultural competence of primary school foreign language teachers should be performed in the process of lingvomethodological training of the students as lingvomethodological competence occupies a dominant place and is a unifying and a backbone for other competencies of the future teacher’s professiogram. In this regard, the concept of “foreign language sociocultural competence of prospective primary school teacher” is clarified, the essence of lingvomethodological monitoring of foreign language sociocultural competence is revealed. It is emphasized that linguistic disciplines (“The practice of oral and written language”, “Practical grammar of a foreign language”, “Practical phonetics of a foreign language”, etc. and linguomethodological courses (“Methods of teaching English at primary school”, “ICT in learning foreign languages”, “Innovative technologies of learning foreign languages”, etc. play very important role in forming “foreign language sociocultural competence of prospective primary school teacher”. Specific principles of lingvomethodological monitoring of foreign language sociocultural competence are identified and characterized. They are complexity, lingvomethodological orientation, validity, multi-vector monitoring procedures.

  1. Advances made in development of competence of refining plant operators. The REPAR case, PR, Brazil; Avancos realizados no desenvolvimento de competencias de operadores de plantas de refino: o caso da REPAR

    Energy Technology Data Exchange (ETDEWEB)

    Reis, Mario [PETROBRAS, Rio de Janeiro, RJ (Brazil). Centro de Pesquisas. Recursos Humanos]. E-mail: marioreis@petrobras.com.br

    2004-12-01

    The work presents a synthesis of the outcome of two years of research and experiments for the development of competence of Refinery operators in a project carried out by REPAR - Presidente Getulio Vargas Refinery in partnership with the Parana Federal University Education sector. From the Refinery need to reformulate its operators formation and development process, an important perspective was open to discuss and implement pedagogical principles based on the competence category as praxis. Such category brings forth the commitment to transform the workers educational processes and the production social relations excelling the models based on Taylorian/Fordian paradigm.(author)

  2. What is physics problem solving competency?

    DEFF Research Database (Denmark)

    Niss, Martin

    2018-01-01

    on the nature of physics problem- solving competency. The first, Sommerfeld’s, is a “theory first, phenomenon second” approach. Here the relevant problems originate in one of the theories of physics and the job goal of the problem- solver is to make a mathematical analysis of the suitable equation......A central goal of physics education is to teach problem-solving competency, but the nature of this competency is not well-described in the literature. The present paperarticle uses recent historical scholarship on Arnold Sommerfeld and Enrico Fermi to identify and characterize two positions......(s) and then give a qualitative analysis of the phenomenon that arise from these mathematical results. Fermi’s position is a “phenomenon first, theory second” approach, where the starting point is a physical phenomenon that is analyzed and then brought into the realm of a physics theory. The two positions...

  3. Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

    Science.gov (United States)

    Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

    2014-01-01

    Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

  4. Developing Creative Competencies

    DEFF Research Database (Denmark)

    Friis, Silje Alberthe Kamille

    2012-01-01

    This paper offers a theoretical framework for how to think about and understand creativity – and how to work with the development of creative competencies in design education. Most design students experience recurrent, individual challenges in design work, which have to do with their personal...... from the field of psychology, as well as research-in-practice with students at the Kolding School of Design and presents the outline of a model for how to work with and facilitate the development of creative competencies. While the research is still in its early phases, response from participants...

  5. Competence development in UAS

    DEFF Research Database (Denmark)

    Thorslund, Jørgen; Brodersen, Anne Mygind

    As a University of Applied Science (UAS) University College Lillebaelt in Denmark is addressing education, knowledge production and professional development in perspective of life-long and life-wide learning. It is our basic assumption that that internal competence development ? individually...... and organizationally - among UAS educators should be based on same learning concepts as used in professional development to avoid parallelism. Do for yourself, what you preach for others. Second, competence development of faculty is a central element in transformation of our institutions from schools of higher...

  6. Characterization of a new class of blue-fluorescent lipid droplet markers for live-cell imaging in plants.

    Science.gov (United States)

    Kuntam, Soujanya; Puskás, László G; Ayaydin, Ferhan

    2015-04-01

    The present work demonstrates the use and advantages of novel, live cell permeable, lipid droplet localizing, non toxic, blue fluorochromes for use in live plant cells. Lipid droplets (LDs) are ubiquitous components of both animal and plant cells. They consist of a core of neutral lipids surrounded by a monolayer of phospholipids, glycolipids and/or sterols with embedded amphipathic proteins. Although initially considered to be simple energy depots, they have recently emerged as organelles that serve important regulatory functions. Here we report three new fluorochromes as markers for LDs in plants. These bright blue fluorochromes with their unique spectral properties can easily be combined with other green and red fluorescent reporters for multicolor fluorescence imaging. The fluorochromes are non-toxic and photo-stable. All in all, they represent a reliable tool to use, for the investigation of dynamic LD biology within living plant cells using fluorescence microscopy.

  7. Transcriptome Characterization and Sequencing-Based Identification of Salt-Responsive Genes in Millettia pinnata, a Semi-Mangrove Plant

    OpenAIRE

    Huang, Jianzi; Lu, Xiang; Yan, Hao; Chen, Shouyi; Zhang, Wanke; Huang, Rongfeng; Zheng, Yizhi

    2012-01-01

    Semi-mangroves form a group of transitional species between glycophytes and halophytes, and hold unique potential for learning molecular mechanisms underlying plant salt tolerance. Millettia pinnata is a semi-mangrove plant that can survive a wide range of saline conditions in the absence of specialized morphological and physiological traits. By employing the Illumina sequencing platform, we generated ∼192 million short reads from four cDNA libraries of M. pinnata and processed them into 108 ...

  8. Phenotypic and molecular characterization of plants regenerated from non-cryopreserved and cryopreserved wild Solanum lycopersicum mill. Seeds.

    Science.gov (United States)

    Zevallos, B; Cejas, I; Engelmann, F; Carputo, D; Aversano, R; Scarano, M T; Yanes, E; Martinez-Montero, M; Lorenzo, J C

    2014-01-01

    Before cryopreservation is routinely used, its effect on the trueness-to-type of the regenerated plant material needs to be evaluated. In this work, we studied the effect of seed cryopreservation on the phenotypic and molecular characteristics of wild Solanum lycopersicum Mill. plants. Thirty-five morphological traits of plants regenerated from cryopreserved seeds were compared to those measured on plants regenerated from non-cryopreserved seeds. No statistically significant differences were observed between cryopreserved and non-cryopreserved samples, either in the first or in the second generation post-liquid nitrogen exposure. However, at the molecular level, the genetic analyses performed on the second generation plants germinated from control and cryopreserved seeds using 14 nuclear Simple Sequences Repeats (SSR) markers uncovered some changes in microsatellite length between control and cryopreserved samples. These results confirm at the botanical phenotype level the effectiveness of seed cryostorage for conservation and regeneration of true-to-type S. lycopersicum plants. Further experiments are required to clarify potential phenotypic effects of the changes observed in the DNA.

  9. Two phosphoenolpyruvate carboxykinases coexist in the Crassulacean Acid Metabolism plant Ananas comosus. Isolation and characterization of the smaller 65 kDa form.

    Science.gov (United States)

    Martín, Mariana; Rius, Sebastián Pablo; Podestá, Florencio Esteban

    2011-06-01

    Two phosphoenolpyruvate carboxykinase (PEPCK, EC 4.1.1.49) isoforms of 74 and 65 kDa were found to coexist in vivo in pineapple leaves, a constitutive Crassulacean Acid Metabolism plant. The 65 kDa form was not the result of proteolytic cleavage of the larger form since extraction methods reported to prevent PEPCK proteolysis in other plant tissues failed to yield a single immunoreactive PEPCK polypeptide in leaf extracts. In this work, the smaller form of 65 kDa was purified to homogeneity and physically and kinetically characterized and showed parameters compatible with a fully active enzyme. The specific activity was nearly twice higher for decarboxylation of oxaloacetate when compared to carboxylation of phosphoenolpyruvate. Kinetic parameters fell within the range of those estimated for other plant PEPCKs. Its activity was affected by several metabolites, as shown by inhibition by 3-phosphoglycerate, citrate, malate, fructose-1,6-bisphosphate, l-asparagine and activation of the decarboxylating activity by succinate. A break in the Arrhenius plot at about 30°C indicates that PEPCK structure is responsive to changes in temperature. The results indicate that pineapple leaves contain two PEPCK forms. The biochemical characterization of the smaller isoform performed in this work suggests that it could participate in both carbon and nitrogen metabolism in vivo by acting as a decarboxylase. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  10. Pragmatics and Communicative Competences

    Science.gov (United States)

    Lin, Grace Hui Chin; Su, Simon Chun Feng; Ho, Max Ming Hsuang

    2009-01-01

    Pragmatics is included in one of four communicative competences (Canale, 1980). It is necessary and important to teach pragmatics at school in our globalized world in order to avoid as much as misunderstanding, which is likely to stem from cultural difference. As a result, greater importance should be attached to diverse customs and pragmatics.…

  11. The MUPPLE competence continuum

    NARCIS (Netherlands)

    Wild, Joanna; Wild, Fridolin; Kalz, Marco; Specht, Marcus; Hofer, Margit

    2009-01-01

    Wild, J., Wild, F., Kalz, M., Specht, M., & Hofer, M. (2009). The MUPPLE competence continuum. In F. Wild, M. Kalz, M. Palmér & D. Müller (Eds.), Proceedings of 2nd Workshop Mash-Up Personal Learning Envrionments (MUPPLE'09). Workshop in conjunction with 4th European Conference on Technology

  12. Evolution of subsidiary competences

    DEFF Research Database (Denmark)

    Geisler Asmussen, Christian; Pedersen, Torben; Dhanaraj, Charles

    of competitive advantage of nations, we hypothesize the contingencies under which heterogeneity in host environments influences subsidiary competence configuration. We test our model with data from more than 2,000 subsidiaries in seven Western European countries. Our results provide new insights on the evolution...

  13. Competing for Criminal Money

    NARCIS (Netherlands)

    Rawlings, G.; Unger, B.

    2005-01-01

    To compete for criminal money by means of low bank secrecy seems a tempting strategy for countries in order to attract additional funds. We show in a model that this “Seychelles-strategy” can increase national output, in particular if a country takes a (Stackelberg ) leadership in the competition

  14. Diesel Vehicle Maintenance Competencies.

    Science.gov (United States)

    Braswell, Robert; And Others

    Designed to provide a model set of competencies, this manual presents tasks which were identified by employers, employees, and teachers as important in a postsecondary diesel vehicle maintenance curriculum. The tasks are divided into seven major component areas of instruction: chassis and suspension, diesel engines, diesel fuel, electrical,…

  15. Competencies, skills and assessment

    DEFF Research Database (Denmark)

    Højgaard, Tomas

    2009-01-01

    This paper is an analysis of the challenge of assessing student learning and how that is affected by using descriptions of competencies as a core element when describing the aims of the learning process. Assessment is modelled as a three step process; characterising, identifying and judging, to a...... the characterisation part of an assessment process. From a teaching and teachers' perspective, the latter is far more important than the former.......This paper is an analysis of the challenge of assessing student learning and how that is affected by using descriptions of competencies as a core element when describing the aims of the learning process. Assessment is modelled as a three step process; characterising, identifying and judging......, to allow for the following argument: Working with competency descriptions is rightly said to make judging more difficult. This potentially lowers the reliability of the assessment. But competency descriptions also carry a great potential of raising the validity of the assessment by focusing...

  16. Competence preservation through education

    International Nuclear Information System (INIS)

    Ham, U.; Koessler, M.

    2013-01-01

    For fulfilling their tasks GNS depends on personnel with specific knowledge and competence. GNS answers to these challenges by various measures for education and training in order to have skilled personnel available nowadays and in the future. By these measures and the internal organisation regarding responsibilities in radiation protection requirements resulting from the expected Euratom Basic Safety Standards (BSS) are met. (orig.)

  17. Promoting Intercultural Competencies

    International Nuclear Information System (INIS)

    Bachner, Katherine M.

    2014-01-01

    What is culture? • Culture is the acquired knowledge people use to interpret experience and generate behavior. • It is the way of life a people pass down from one generation to the next through learning. • It is the rules for living and functioning in society that come from growing up in a specific society, and it is a set of acquired skills, habits and society-specific training that gives a group of people its identity. What is intercultural competency? • Cultures can have widely varying perspectives. • These perspectives influence the way that a person develops relationships, responds to situations, and operates in a professional setting. • Intercultural competency is the ability to comprehend and navigate the ways that culture can influence behavior, relationships, and the results of collaboration and interaction. What does becoming interculturally competent entail? • Intercultural preparedness is not merely travelling, learning a foreign language, or being exposed to other cultures. • Developing competency requires thinking about the challenges posed to our work by a multi-cultural workforce in a way that prepares employees and staff for potential incidents or misunderstandings. • It is impossible to avoid all intercultural misunderstandings, but learning to anticipate them and deal with them is key to developing any training program on culture

  18. Classical competing risks

    CERN Document Server

    Crowder, Martin J

    2001-01-01

    If something can fail, it can often fail in one of several ways and sometimes in more than one way at a time. There is always some cause of failure, and almost always, more than one possible cause. In one sense, then, survival analysis is a lost cause. The methods of Competing Risks have often been neglected in the survival analysis literature. Written by a leading statistician, Classical Competing Risks thoroughly examines the probability framework and statistical analysis of data of Competing Risks. The author explores both the theory of the subject and the practicalities of fitting the models to data. In a coherent, self-contained, and sequential account, the treatment moves from the bare bones of the Competing Risks setup and the associated likelihood functions through survival analysis using hazard functions. It examines discrete failure times and the difficulties of identifiability, and concludes with an introduction to the counting-process approach and the associated martingale theory.With a dearth of ...

  19. Competing Auctions of Skills

    DEFF Research Database (Denmark)

    Kennes, John; le Maire, Christian Daniel

    The model of competing sellers McAfee (1993) is applied to a labor market environment with heterogeneous workers, who differ by outside option and skill type, and heterogeneous firms, who differ by the amount of output produced when matched to each possible worker tyoe. We derive both a static...

  20. Competence and the Workplace

    NARCIS (Netherlands)

    Van Yperen, Nico W.; Elliot, Andrew J.; Dweck, Carol S.; Yeager, David S.

    2017-01-01

    The focus of this chapter on competence at the workplace is on workers’ willingness to perform, which is defined as individuals’ psychological characteristics that affect the degree to which they are inclined to perform their tasks. People may be motivated by either the positive, appetitive

  1. Assessing cataract surgical competency

    NARCIS (Netherlands)

    Lee, Andrew G.; Greenlee, Emily; Oetting, Thomas A.; Beaver, Hilary A.; Johnson, A. Tim; Boldt, H. Culver; Abramoff, Michael; Olson, Richard; Carter, Keith

    2007-01-01

    The Accreditation Council for Graduate Medical Education has mandated that all residency training programs teach and assess 6 general competencies.1 A.G. Lee and K.D. Carter, Managing the new mandate in resident education: A blueprint for translating a national mandate into local compliance,

  2. Calibrating Communication Competencies

    Science.gov (United States)

    Surges Tatum, Donna

    2016-11-01

    The Many-faceted Rasch measurement model is used in the creation of a diagnostic instrument by which communication competencies can be calibrated, the severity of observers/raters can be determined, the ability of speakers measured, and comparisons made between various groups.

  3. Skills and Competencies

    Directory of Open Access Journals (Sweden)

    Nasios Orinos

    2013-07-01

    Full Text Available This article presents the results of a study aimed to investigate the requirements of the business sector in light of the skills and competencies students should have in order to be recruited. In this fashion, the study intended to measure the importance of the skills and competencies sought by the business world, revealing ways through which students can develop such skills. This project portrayed that, some of the required classes will certainly give students a strong theoretical background but they will neither completely prepare this student with all possible skills or competencies nor provide the student with any practical experience that will enable him/her to be more competitive when entering the business market. In some classes, however, like Public Speaking, which is designed to teach presentation skills, successful students are able to build good communication and interpersonal skills. Additionally, an English writing class will certainly attempt to provide them with strong writing skills, and a business class will possibly demand reading skills. Moreover, a calculus and a statistics class will provide basic arithmetic/mathematical skills. However, through this project it is proven that all of these classes will neglect the indoctrination of creative thinking in students, or make students believe in their own self-worth (self-esteem skills; the courses will also fail to develop the sense of urgency, drive and determination that students should possess not just to compete but also to survive in a business world.

  4. Equal opportunity to compete

    International Development Research Centre (IDRC) Digital Library (Canada)

    advantage of their customers by fixing prices or skimping on quality. The underlying idea is that true competition in the marketplace produces a range of efficiencies and asso- ciated benefits that the competing firms, in their quest to win customer loyalty, will feel compelled to pass along to consumers. In recent years, many ...

  5. Nursing Informatics Competency Program

    Science.gov (United States)

    Dunn, Kristina

    2017-01-01

    Currently, C Hospital lacks a standardized nursing informatics competency program to validate nurses' skills and knowledge in using electronic medical records (EMRs). At the study locale, the organization is about to embark on the implementation of a new, more comprehensive EMR system. All departments will be required to use the new EMR, unlike…

  6. Competence, governance, and entrepreneurship

    DEFF Research Database (Denmark)

    Foss, Nicolai Juul; Mahnke, Volker

    This title illustrates modern economics. Because it informs strategic choices, it is relevant to business administration in general, and for strategic management in particular. Two dominant streams may be identified in the literature, namely the "competence" and "governance" perspectives on the f......, and entrepreneurship to advance and stimulate economic strategy research....

  7. Competences of IT Architects

    NARCIS (Netherlands)

    Wieringa, Roelf J.; van Eck, Pascal; Steghuis, Claudia; Proper, Erik

    2009-01-01

    The field of architecture in the digital world uses a plethora of terms to refer to different kinds of architects, and recognises a confusing variety of competences that these architects are required to have. Different service providers use different terms for similar architects and even if they use

  8. Competences of IT Architects

    NARCIS (Netherlands)

    Wieringa, Roelf J.; van Eck, Pascal; Steghuis, C.; Proper, E.

    2008-01-01

    The field of architecture in the digital world uses a plethora of terms to refer to different kinds of architects, and recognizes a confusing variety of competences that these architects are required to have. Different service providers use different terms for similar architects and even if they use

  9. Characterization and Functional Identification of a Novel Plant 4,5-Extradiol Dioxygenase Involved in Betalain Pigment Biosynthesis in Portulaca grandiflora

    Science.gov (United States)

    Christinet, Laurent; Burdet, Frédéric X.; Zaiko, Maïa; Hinz, Ursula; Zrÿd, Jean-Pierre

    2004-01-01

    Betalains are pigments that replace anthocyanins in the majority of families of the plant order Caryophyllales. Betalamic acid is the common chromophore of betalains. The key enzyme of the betalain biosynthetic pathway is an extradiol dioxygenase that opens the cyclic ring of dihydroxy-phenylalanine (DOPA) between carbons 4 and 5, thus producing an unstable seco-DOPA that rearranges nonenzymatically to betalamic acid. A gene for a 4,5-DOPA-dioxygenase has already been isolated from the fungus Amanita muscaria, but no homolog was ever found in plants. To identify the plant gene, we constructed subtractive libraries between different colored phenotypes of isogenic lines of Portulaca grandiflora (Portulacaceae) and between different stages of flower bud formation. Using in silico analysis of differentially expressed cDNAs, we identified a candidate showing strong homology at the level of translated protein with the LigB domain present in several bacterial extradiol 4,5-dioxygenases. The gene was expressed only in colored flower petals. The function of this gene in the betalain biosynthetic pathway was confirmed by biolistic genetic complementation in white petals of P. grandiflora genotypes lacking the gene for color formation. This gene named DODA is the first characterized member of a novel family of plant dioxygenases phylogenetically distinct from Amanita sp. DOPA-dioxygenase. Homologs of DODA are present not only in betalain-producing plants but also, albeit with some changes near the catalytic site, in other angiosperms and in the bryophyte Physcomitrella patens. These homologs are part of a novel conserved plant gene family probably involved in aromatic compound metabolism. PMID:14730069

  10. Characterization of cysteine-degrading and H2S-releasing enzymes of higher plants - from the field to the test tube and back.

    Science.gov (United States)

    Papenbrock, J; Riemenschneider, A; Kamp, A; Schulz-Vogt, H N; Schmidt, A

    2007-09-01

    Due to the clean air acts and subsequent reduction of emission of gaseous sulfur compounds sulfur deficiency became one of the major nutrient disorders in Northern Europe. Typical sulfur deficiency symptoms can be diagnosed. Especially plants of the Cruciferae family are more susceptible against pathogen attack. Sulfur fertilization can in part recover or even increase resistance against pathogens in comparison to sulfur-deficient plants. The term sulfur-induced resistance (SIR) was introduced, however, the molecular basis for SIR is largely unknown. There are several sulfur-containing compounds in plants which might be involved in SIR, such as high levels of thiols, glucosinolates, cysteine-rich proteins, phytoalexins, elemental sulfur, or H2S. Probably more than one strategy is used by plants. Species- or even variety-dependent differences in the development of SIR are probably used. Our research focussed mainly on the release of H2S as defence strategy. In field experiments using different BRASSICA NAPUS genotypes it was shown that the genetic differences among BRASSICA genotypes lead to differences in sulfur content and L-cysteine desulfhydrase activity. Another field experiment demonstrated that sulfur supply and infection with PYRENOPEZIZA BRASSICA influenced L-cysteine desulfhydrase activity in BRASSICA NAPUS. Cysteine-degrading enzymes such as cysteine desulfhydrases are hypothesized to be involved in H2S release. Several L- and D-cysteine-specific desulfhydrase candidates have been isolated and partially analyzed from the model plant ARABIDOPSIS THALIANA. However, it cannot be excluded that H2S is also released in a partial back reaction of O-acetyl-L-serine(thiol)lyase or enzymes not yet characterized. For the exact determination of the H2S concentration in the cell a H2S-specific microsensor was used the first time for plant cells. The transfer of the results obtained for application back on BRASSICA was initiated.

  11. Isolation and characterization of endophytic plant growth-promoting bacteria from date palm tree (Phoenix dactylifera L.) and their potential role in salinity tolerance.

    Science.gov (United States)

    Yaish, Mahmoud W; Antony, Irin; Glick, Bernard R

    2015-06-01

    Endophytic bacteria were isolated from date palm (Phoenix dactylifera L.) seedling roots, characterized and tested for their ability to help plants grow under saline conditions. Molecular characterization showed that the majority of these strains belonged to the genera Bacillus and Enterobacter and had different degrees of resistance to various antibiotics. Some of these strains were able to produce the enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase and the plant growth regulatory hormone indole-3-acetic acid (IAA). Some strains were also able to chelate ferric iron (Fe(3+)) and solubilize potassium (K(+)), phosphorus (PO 4 (3-) ) and zinc (Zn(2+)), and produce ammonia. The results also showed that ACC deaminase activity and IAA production was slightly increased in some strains in response to an increase in NaCl concentration in the growth media. Consistent with these results, selected strains such as PD-R6 (Paenibacillus xylanexedens) and PD-P6 (Enterobacter cloacae) were able to enhance canola root elongation when grown under normal and saline conditions as demonstrated by a gnotobiotic root elongation assay. These results suggest that the isolated and characterized endophytic bacteria can alter ethylene and IAA levels and also facilitate nutrient uptake in roots and therefore have the potential role to promote the growth and development of date palm trees growing under salinity stress.

  12. Characterization of staphylococci in urban wastewater treatment plants in Spain, with detection of methicillin resistant Staphylococcus aureus ST398

    International Nuclear Information System (INIS)

    Gómez, Paula; Lozano, Carmen; Benito, Daniel; Estepa, Vanesa; Tenorio, Carmen; Zarazaga, Myriam; Torres, Carmen

    2016-01-01

    The objective of this study was to determine the prevalence of Staphylococcus in urban wastewater treatment plants (UWTP) of La Rioja (Spain), and to characterize de obtained isolates. 16 wastewater samples (8 influent, 8 effluent) of six UWTPs were seeded on mannitol-salt-agar and oxacillin-resistance-screening-agar-base for staphylococci and methicillin-resistant Staphylococcus aureus recovery. Antimicrobial susceptibility profile was determined for 16 antibiotics and the presence of 35 antimicrobial resistance genes and 14 virulence genes by PCR. S. aureus was typed by spa, agr, and multilocus-sequence-typing, and the presence of immune-evasion-genes cluster was analyzed. Staphylococcus spp. were detected in 13 of 16 tested wastewater samples (81%), although the number of CFU/mL decreased after treatment. 40 staphylococci were recovered (1–5/sample), and 8 of them were identified as S. aureus being typed as (number of strains): spa-t011/agr-II/ST398 (1), spa-t002/agr-II/ST5 (2), spa-t3262/agr-II/ST5 (1), spa-t605/agr-II/ST126 (3), and spa-t878/agr-III/ST2849 (1). S. aureus ST398 strain was methicillin-resistant and showed a multidrug resistance phenotype. Virulence genes tst, etd, sea, sec, seg, sei, sem, sen, seo, and seu, were detected among S. aureus and only ST5 strains showed genes of immune evasion cluster. Thirty-two coagulase-negative Staphylococcus of 12 different species were recovered (number of strains): Staphylococcus equorum (7), Staphylococcus vitulinus (4), Staphylococcus lentus (4), Staphylococcus sciuri (4), Staphylococcus fleurettii (2), Staphylococcus haemolyticus (2), Staphylococcus hominis (2), Staphylococcus saprophyticus (2), Staphylococcus succinus (2), Staphylococcus capitis (1), Staphylococcus cohnii (1), and Staphylococcus epidermidis (1). Five presented a multidrug resistance phenotype. The following resistance and virulence genes were found: mecA, lnu(A), vga(A), tet(K), erm(C), msr(A)/(B), mph(C), tst, and sem. We found that

  13. Characterization of plant growth-promoting Bacillus edaphicus NBT and its effect on lead uptake by Indian mustard in a lead-amended soil.

    Science.gov (United States)

    Sheng, Xia Fang; Jiang, Chun Yu; He, Lin Yan

    2008-05-01

    The plant growth promotion characteristics of a heavy-metal-resistant strain of Bacillus edaphicus NBT was characterized. The strain was also evaluated for promoting plant growth and lead (Pb) uptake of Brassica juncea L. Czern (Indian mustard) in soil artificially contaminated with 0, 400, and 800 mg Pb.kg-1 soil. Atomic absorption spectrometer analysis demonstrated that strain NBT could release water-soluble Pb from lead carbonate in the solution. Strain NBT had the capacity to produce indole acetic acid, siderophores, and 1-aminocyclopropane-1-carboxylate deaminase. Low and high Pb treatments significantly decreased the growth of Indian mustard. Inoculation with strain NBT was found to increase root dry mass (ranging from 16% to 22%) and above-ground tissue dry mass (ranging from 24% to 30%) of Indian mustard in the Pb-amended soil. Strain NBT was able to mobilize Pb efficiently in plants in Pb-amended soil. In the soil treated with 400 and 800 mg Pb.kg-1 soil, the increase in Pb uptake varied from 18% to 46% in live bacterium-inoculated Indian mustard plants compared with dead bacterium-inoculated control. The strain was also able to colonize and develop in the rhizosphere soil of Indian mustard after root inoculation.

  14. Comparison of Health Outcomes Among Children with Different Levels of Motor Competence

    Directory of Open Access Journals (Sweden)

    Chagas Daniel V.

    2017-06-01

    Full Text Available Purpose. While evidence suggests that children with the developmental coordination disorder (DCD have worse health outcomes than their typically developing peers, it remains unclear whether children with low motor competence but without DCD are also characterized by worse health outcomes than those with average motor competence. The main purpose of this study was to compare health outcomes between children with low motor competence without DCD and those with average motor competence.

  15. Beyond the replication-competent HIV reservoir: transcription and translation-competent reservoirs.

    Science.gov (United States)

    Baxter, Amy E; O'Doherty, Una; Kaufmann, Daniel E

    2018-02-02

    Recent years have seen a substantial increase in the number of tools available to monitor and study HIV reservoirs. Here, we discuss recent technological advances that enable an understanding of reservoir dynamics beyond classical assays to measure the frequency of cells containing provirus able to propagate a spreading infection (replication-competent reservoir). Specifically, we focus on the characterization of cellular reservoirs containing proviruses able to transcribe viral mRNAs (so called transcription-competent) and translate viral proteins (translation-competent). We suggest that the study of these alternative reservoirs provides complementary information to classical approaches, crucially at a single-cell level. This enables an in-depth characterization of the cellular reservoir, both following reactivation from latency and, importantly, directly ex vivo at baseline. Furthermore, we propose that the study of cellular reservoirs that may not contain fully replication-competent virus, but are able to produce HIV mRNAs and proteins, is of biological importance. Lastly, we detail some of the key contributions that the study of these transcription and translation-competent reservoirs has made thus far to investigations into HIV persistence, and outline where these approaches may take the field next.

  16. The Interrelations between Competences for Sustainable Development and Research Competences

    Science.gov (United States)

    Lambrechts, Wim; Van Petegem, Peter

    2016-01-01

    Purpose: The purpose of this paper is to explore how competences for sustainable development and research interrelate within a context of competence-based higher education. Specific focus is oriented towards strengthening research competences for sustainability. Design/methodology/approach: Following a hermeneutic-interpretive methodology, this…

  17. Competency Analytics Tool: Analyzing Curriculum Using Course Competencies

    Science.gov (United States)

    Gottipati, Swapna; Shankararaman, Venky

    2018-01-01

    The applications of learning outcomes and competency frameworks have brought better clarity to engineering programs in many universities. Several frameworks have been proposed to integrate outcomes and competencies into course design, delivery and assessment. However, in many cases, competencies are course-specific and their overall impact on the…

  18. Characterization and heterologous expression of a PR-1 protein from traps of the carnivorous plant Nepenthes mirabilis.

    Science.gov (United States)

    Buch, Franziska; Pauchet, Yannick; Rott, Matthias; Mithöfer, Axel

    2014-04-01

    Carnivorous plants capture and digest prey to obtain additional nutrients. Therefore, different trapping mechanisms were developed in different species. Plants of the genus Nepenthes possess pitfall-traps filled with a digestive fluid, which is secreted by the plants themselves. This pitcher fluid is composed of various enzymes to digest the captured prey. Besides hydrolytic enzymes, defense-related proteins have been identified in the fluid. The present study describes the identification and heterologous expression of a pathogenesis-related protein, NmPR-1, from pitchers of Nepenthes mirabilis with features that are unusual for PR-1 proteins. In particular, it was proven to be highly glycosylated and, furthermore, it exhibited antibacterial instead of antifungal activities. These properties are probably due to the specific environment of the pitcher fluid. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Use of synchrotron radiation to characterize metals in plants: the case of Cd in the hyperacumulator Arabidopsis halleri

    Science.gov (United States)

    Isaure, M.; Sarret, G.; Verbruggen, N.

    2010-12-01

    Phytoremediation uses plants to extract (phytoextraction) or stabilize (phytostabilization) metals accumulated in soils, and can be an alternative to invasive physico-chemical remediation techniques. Its development requires the knowledge of the mechanisms involved in metal tolerance and accumulation in plants, and particularly the way that plants transfer and store metals. In that context, synchrotron radiation based techniques such as micro-focused X-Ray Fluorescence (µXRF), and micro-focused X-ray Absorption Spectroscopy, including Extended X-ray Absorption Fine Structure and X-ray Absorption Near Edge Structure, are particularly suited to determine the localization and the chemical forms of metals in the different tissues, cells and sub-cellular compartments. Arabidopsis halleri is a Zn, Cd hyperaccumulating plant, naturally growing on contaminated sites, and is a model plant to investigate metal hyperaccumulation. This work presents the application of µXRF and Cd µXANES to determine the distribution and speciation of Cd in this species. Results showed that Cd was mainly located in the mesophyll and veins of leaves. It is bound to S ligands in some leaves and to O/N ligands in other ones, and the observed variations may be related to the age of the leaves. Cd speciation seems to differ from other metals, and particularly Zn, generally encountered in hyperaccumulators. High local Cd concentrations were also detected at the base of trichomes, epidermal hairs of leaves, associated to O/N ligands, probably to the cell wall. This phenomenon was also observed on non-hyperaccumulators and is clearly not the major sink for Cd, but trichomes might play a role in the detoxification process. This study illustrates the suitability of synchrotron radiation based techniques to investigate metal distribution and speciation in plants.

  20. Temporal characterization of bacterial communities in a phytoremediation pilot plant aimed at decontaminating polluted sediments dredged from Leghorn harbor, Italy.

    Science.gov (United States)

    Chiellini, Carolina; Iannelli, Renato; Petroni, Giulio

    2013-09-25

    The AGRIPORT project (Agricultural Reuse of Polluted Dredged Sediments, Eco-innovation EU Project n. ECO/08/239065) aims at developing a new technology for the treatment of polluted sediments dredged from the seabed of commercial ports through phytoremediation processes. Through plant activities and microorganism metabolisms, it is possible to recover dredged saline sediments by decontaminating them until an artificially prepared soil that is reusable in the terrestrial environment is obtained. This is an important advantage from the environmental point of view, and allows to partially solve one of the main problems of most commercial ports, that is the accumulation, storage and disposal of polluted dredged sediments. Considering that bacteria provide a significant contribution to phytoremediation process. Aim of the present study is the monitoring of temporal variation of microbial communities developing in an experimental phytoremediation plant during the decontamination process. The treatment plant consists of a sealed 80 m(3) basin that is filled with a mixture of dredged sediments (75%) and natural soil (25%). It was planted with three plant species, and has been properly cultivated and fertilized for two years. Terminal Restriction Fragment Length Polymorphism (T-RFLP) on 16S rRNA gene was used to study the composition of bacterial communities at different times and points in the basin. Cluster Analysis (CA) and Non Metric Multidimensional Scaling (NMDS) multivariate statistics were applied for data interpretation. At the onset, the bacterial communities were heterogeneous and discrete, reflecting those inherited from the sediment-soil mixture, from compost and from plant's rhizospheres. The communities' composition rapidly changed to become stabilized after one year. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Isolation and characterization of antimicrobial compound from the stem-bark of the traditionally used medicinal plant Adenium obesum

    Directory of Open Access Journals (Sweden)

    Mohammed Sohail Akhtar

    2017-07-01

    Conclusion: The results indicate that walnut chloroform fraction may contain effective compounds with a broad spectrum of curative applications. This is the first report on isolation and characterization of a compound from chloroform crude extract of A. obesum.

  2. Ecophysiological characterization of rhizosphere bacterial communities at different root locations and plant developmental stages of cucumber grown on rockwool

    NARCIS (Netherlands)

    Folman, L.B.; Postma, J.; Veen, van J.A.

    2001-01-01

    Bacterial communities from the rhizosphere of cucumber were characterized with respect to growth rates and carbon source utilization, in order to develop a selection strategy for biocontrol agents against Pythium aphanidermatum. Rhizosphere samples were collected from different root regions (root

  3. Experts views' on Digital Competence

    NARCIS (Netherlands)

    Janssen, José; Stoyanov, Slavi

    2013-01-01

    Janssen, J., & Stoyanov, S. (2012, 20 November). Online Consultation for a Digital Competence Framework: Experts' views on Digital Competence. Workshop presentation at the Institute for Prospective Technological Studies, Seville, Spain.

  4. CONTROL AND GRADE COMPETENCE FUTURE TEACHERS OF MATHEMATICS

    Directory of Open Access Journals (Sweden)

    Vladimir Tatochenko

    2016-04-01

    Full Text Available The article is devoted to the theoretical study of the problem of formation of control and grade competence of the students - future teachers of mathematics while studying special subjects. The essence of such notions as competence, professional competence, methodical competence, control and grade competence of the Mathematics teacher are differentiated. The following subjects are described: the goal orientation, the resource potential of the educational process and its objectives: to form the system of necessary methodological knowledge and skills, the system of pedagogical values that form the willingness for the control and grade activities at all stages of learning, which are derived from the objectives and available resources: content and training tools. Identified approaches (system, personal active, competent, technological, communicative active and the dominant principles necessary to form control and grade competence of the future Mathematics teachers (consistency, functionality of knowledge and skills, personal orientation, assessment of academic achievements of the student in accordance with the quality of Mathematics education. Contradictions are described and pedagogical conditions to provide this process are justified. The structure of the control and grade competence is characterized, including the motivation, professional skills, acquired knowledge and skills, activities of the subjects of the study; and its following components: motivational, cognitive, activity, reflective. The following stages of the formation of the control and grade competence are defined: motivational, informative, technological, assessment and effective. To form the control and grade competence of the students - future Mathematics teachers the technology of construction and solving of methodological situational tasks is suggested. The following criteria are identified: motivational, essential, activity; the following indicators are stated: motivation

  5. Visualizing and characterizing In Vivo DNA-Binding Events and Direct Target Genes of Plant Transcription Factors.

    NARCIS (Netherlands)

    Muino, J.M.; Angenent, G.C.; Kaufmann, K.

    2011-01-01

    Physical interactions between transcription factors and specific DNA sites are essential for gene regulation. Recent progress in genome-wide in vivo techniques, like chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-SEQ), enables plant researchers to generate genome-wide,

  6. Isolation and Molecular Characterization of a Model Antagonistic Pseudomonas aeruginosa Divulging In Vitro Plant Growth Promoting Characteristics

    Directory of Open Access Journals (Sweden)

    Bushra Uzair

    2018-01-01

    Full Text Available The use of microbial technologies in agriculture is currently expanding quite rapidly with the identification of new bacterial strains, which are more effective in promoting plant growth. In the present study 18 strains of Pseudomonas were isolated from soil sample of Balochistan coastline. Among isolated Pseudomonas strains four designated as SP19, SP22, PS24, and SP25 exhibited biocontrol activities against phytopathogenic fungi, that is, Rhizopus microsporus, Fusarium oxysporum, Aspergillus niger, Alternaria alternata, and Penicillium digitatum; PS24 identified as Pseudomonas aeruginosa by 16srRNA gene bank accession number EU081518 was selected on the basis of its antifungal activity to explore its potential as plant growth promotion. PS24 showed multiple plant growth promoting attributes such as phosphate solubilization activity, indole acetic acid (IAA, siderophore, and HCN production. In order to determine the basis for antifungal properties, antibiotics were extracted from King B broth of PS24 and analyzed by TLC. Pyrrolnitrin antibiotic was detected in the culture of strain PS24. PS24 exhibited antifungal activities found to be positive for hydrogen cyanide synthase Hcn BC gene. Sequencing of gene of Hcn BC gene of strain PS24 revealed 99% homology with the Pseudomonas aeruginosa strain PA01. The sequence of PS24 had been submitted in gene bank accession number KR605499. Ps. aeruginosa PS24 with its multifunctional biocontrol possessions can be used to bioprotect the crop plants from phytopathogens.

  7. Characterization of low molecular weight fragments from gamma irradiated κ-carrageenan used as plant growth promoter

    Science.gov (United States)

    Abad, Lucille V.; Aurigue, Fernando B.; Relleve, Lorna S.; Montefalcon, Djowel Recto V.; Lopez, Girlie Eunice P.

    2016-01-01

    Radiation degraded κ-carrageenan (1% solution at absorbed doses of 20 kGy and 30 kGy) were tested for its plant growth promoter (PGP) effect on pechay plants under hydroponics condition. Results revealed that higher PGP effects were found in κ-carrageenan irradiated at an absorbed dose of 30 kGy. Mw of irradiated κ-carrageenan as measured by GPC were determined to be 7362 Da and 6762 Da for 20 kGy and 30 kGy, respectively. Fractionation of the irradiated κ-carrageenan (30 kGy) was done to separate different Mw fractions using Mw cut-off filters of 1 kDa, 3 kDa, and 5 kDa. The PGP effect of the different retentates showed that biological activity in plants followed the order of 5 kDa>3 kDa>1 kDa using hydroponics condition but the reverse was observed in the order of 1 kDa>3 kDa>5 kDa when absorbed in plants by foliar spraying. GPC chromatogram indicated at least three (3) low molecular weight (LMW) fragments from radiation modified κ-carrageenan solution with an Mw<2000 Da. A fragment has also been identified with an Mw of as low as 160 Da which was produced under acidic (un-neutralized) condition. This may be attributed to the formation of 5-hydroxymethylfurfural (5-HMF).

  8. A plant class V chitinase from a cycad (Cycas revoluta): biochemical characterization, cDNA isolation, and posttranslational modification.

    Science.gov (United States)

    Taira, Toki; Hayashi, Hiroko; Tajiri, Yoshiko; Onaga, Shoko; Uechi, Gen-ichiro; Iwasaki, Hironori; Ohnuma, Takayuki; Fukamizo, Tamo

    2009-12-01

    Chitinase-A (CrChi-A) was purified from leaf rachises of Cycas revoluta by several steps of column chromatography. It was found to be a glycoprotein with a molecular mass of 40 kDa and an isoelectric point of 5.6. CrChi-A produced mainly (GlcNAc)(3) from the substrate (GlcNAc)(6) through a retaining mechanism. More interestingly, CrChi-A exhibited transglycosylation activity, which has not been observed in plant chitinases investigated so far. A cDNA encoding CrChi-A was cloned by rapid amplification of cDNA ends and polymerase chain reaction procedures. It consisted of 1399 nucleotides and encoded an open reading frame of 387-amino-acid residues. Sequence analysis indicated that CrChi-A belongs to the group of plant class V chitinases. From peptide mapping and mass spectrometry of the native and recombinant enzyme, we found that an N-terminal signal peptide and a C-terminal extension were removed from the precursor (M1-A387) to produce a mature N-glycosylated protein (Q24-G370). This is the first report on a plant chitinase with transglycosylation activity and posttranslational modification of a plant class V chitinase.

  9. Isolation and Molecular Characterization of Potential Plant Growth Promoting Bacillus cereus GGBSTD1 and Pseudomonas spp. GGBSTD3 from Vermisources

    Directory of Open Access Journals (Sweden)

    Balayogan Sivasankari

    2014-01-01

    Full Text Available Vermicompost was prepared from leaf materials of Gliricidia sepium + Cassia auriculata + Leucaena leucocephala with cow dung (1 : 1 : 2 using Eudrilus eugeniae (Kinberg and Eisenia fetida for 60 days. Nineteen bacterial strains which have the capability to fix nitrogen, solubilize inorganic phosphate, and produce phytohormones were isolated from vermicompost, vermisources, and earthworm (fore, mid, and hind guts and tested for plant growth studies. Among the bacterial strains only five strains had both activities; among the five Bacillus spp. showed more nitrogen fixing activity and Pseudomonas spp. showed more phosphate solubilizing activity. Hence these bacterial strains were selected for further molecular analysis and identified Bacillus cereus GGBSTD1 and Pseudomonas spp. GGBSTD3. Plant growth studies use these two organisms separately and as consortium (Bacillus cereus + Pseudomonas spp. in (1 : 1 ratio at different concentrations using Vigna unguiculata (L. Walp. at different day intervals. The germination percent, shoot length, root length, leaf area, chlorophyll a content of the leaves, chlorophyll b content of the leaves, total chlorophyll content of the leaves, fresh weight of the whole plant, and dry weight of the whole plant were significantly enhanced by the consortium (Bacillus cereus + Pseudomonas spp. of two organisms at 5 mL concentrations on the 15th day compared to others.

  10. CHARACTERIZATION OF FUGITIVE MERCURY EMISSIONS FROM THE CELL BUILDING AT A U.S. CHLOR-ALKALI PLANT

    Science.gov (United States)

    The paper discusses an extensive measurement campaign that was conducted of the fugitive (non-ducted) airborne elemental mercury [Hg(0)] emissions from the cell building of a chlor-alkali plant (CAP) located in the southeastern United States. The objectives of this study were to ...

  11. International collaboration for nuclear competence building

    International Nuclear Information System (INIS)

    Haapalehto, T.; Storey, P.

    2004-01-01

    The life cycle of the nuclear industry is no different to that of any other industry, indeed to most forms of human activity: birth, growth, maturity, decline, rebirth and renewal or death. As a result of the twin facets of long time scales and essential technical competence the industry now faces two problems: how to retain existing skills and competences for the 50 plus years that a plant is operating and how to develop and retain new skills and competences in the areas of decommissioning and radioactive waste management. Different countries are at different stages of the nuclear technology life cycle, a competence that may have declined or be lost in one country may be strong in another. And therein lies one solution to the problems the sector faces - international collaboration. The initiatives such as the NEA Halden project and the Generation IV International Forum lay a ground for quiet optimism that collaboration, information exchange and exchange of personnel continue to be an integral part of the development of nuclear power. Also there is evidence that myriad initiatives are underway in the area of nuclear education and training. Though, national surveys show that still more engineers and scientists having nuclear knowledge are required than are graduating. (author)

  12. Documentation of Improvement Competences

    DEFF Research Database (Denmark)

    Johansen, Jørn; Back, Karsten Kristensen; Korsaa, Morten

    2017-01-01

    competences, which should or could be brought into play during the project – and therefor also in one way or another addresses the quality of the activated competences in the improvement project – a kind of qualification. The clue is that the structure of the report follows the units and element in the SPI......This paper demonstrates how a report used in a Master in Project management and Process improvement training at Roskilde University Denmark can be used to evaluate if a student can pass the ECQA SPI Manager exam. It also demonstrates how the structure of the report addresses all necessary...... Manager job role, which is based on the SPI Manifesto and the ImprovAbilityTM model (part of ISO/IEC 33014 Guideline for Process Improvement) among other types of knowledge and research....

  13. Language competence in movement

    DEFF Research Database (Denmark)

    Laursen, Helle Pia; Mogensen, Naja Dahlstrup

    2016-01-01

    This article examines how, in a multilingual perspective, language competence is experienced, talked about and practiced by language users themselves. By viewing children as active co-creators of the spaces in which language is used, this article contributes to a research tradition in which focus...... multilingual children's language and literacy acquisition processes, we direct our focus to a single child's active exploration of what it means to know a language. Through analysis of interviews and researcher generated activities, we see how this child both describes and does language competence...... as a phenomenon that has several meanings, is social, is dependent on location and is unpredictable. Thus, we demonstrate how focus on the child's perspective of what it means to ‘know language’ can lead to insights into the creative, complex and dynamic processes that are part of children's active meaning making...

  14. Intercultural Competence: Another Challenge

    Directory of Open Access Journals (Sweden)

    Norma Barletta Manjarrés

    2009-04-01

    Full Text Available This paper intends to draw the attention of language teachers and educational authorities to the area of culture teaching in foreign language education at a time when the recently issued Basic Standards of Competencies in Foreign Language have conferred modest attention to this aspect of language education. The paper first describes the notion of Intercultural communicative competence. It then discusses the tensions between this new understanding of the teaching of culture and the prevailing teaching practices, approaches, beliefs and discourses associated with the learning and teaching of culture. Third, it reports on the results of a study which critically analyzed the academic discourses of in-service teachers in Colombia regarding the cultural component of foreign language programs; finally, it proposes ways to start taking new directions.

  15. WHO NEEDS INTERCULTURAL COMPETENCES?

    Directory of Open Access Journals (Sweden)

    Carmen-Laura ZARZU

    2013-06-01

    Full Text Available The current essay focuses on the need for formal education in the area of intercultural communication and training of intercultural competences. It builds on cultural identity and diversity literature, on the experiment conducted in the Low Countries in introducing a new topic for students from social sciences referring to intercultural communication and on reports and papers of international companies, organizations and agencies. The argument of globalization which should give equal opportunities to each and every world’s citizen adds pressure on managers dealing with multicultural teams. Intercultural competences gain importance in recruiting, while turning cultural diversity in team performance requires skills, knowledge and experience. Managing cultural diversity presupposes that people are aware, recognize, understand and deal with differences. Thus intercultural communication should be studied as a stand-alone topic or imbedded in other subjects in different forms of education or training, so people are prepared for intercultural, social and professional relationships.

  16. Competence, governance, and entrepreneurship

    DEFF Research Database (Denmark)

    Foss, Nicolai Juul; Mahnke, Volker

    This title illustrates modern economics. Because it informs strategic choices, it is relevant to business administration in general, and for strategic management in particular. Two dominant streams may be identified in the literature, namely the "competence" and "governance" perspectives on the f......This title illustrates modern economics. Because it informs strategic choices, it is relevant to business administration in general, and for strategic management in particular. Two dominant streams may be identified in the literature, namely the "competence" and "governance" perspectives...... on the firm. While there has been little direct discussion between the main proponents of these perspectives, both claim that they are reaching for a "strategic theory of the firm". Such a theory would not only shed light on the classical questions considered in the theory of the firm (e.g. why firms exist......, and entrepreneurship to advance and stimulate economic strategy research....

  17. FIRST robots compete

    Science.gov (United States)

    2000-01-01

    FIRST teams and their robots work to go through the right motions at the FIRST competition. Students from all over the country are at the KSC Visitor Complex for the FIRST (For Inspiration and Recognition of Science and Technology) Southeast Regional competition March 9-11 in the Rocket Garden. Teams of high school students are testing the limits of their imagination using robots they have designed, with the support of business and engineering professionals and corporate sponsors, to compete in a technological battle against other schools' robots. Of the 30 high school teams competing, 16 are Florida teams co-sponsored by NASA and KSC contractors. Local high schools participating are Astronaut, Bayside, Cocoa Beach, Eau Gallie, Melbourne, Melbourne Central Catholic, Palm Bay, Rockledge, Satellite, and Titusville.

  18. Spiritual Competency Scale: Further Analysis

    Science.gov (United States)

    Dailey, Stephanie F.; Robertson, Linda A.; Gill, Carman S.

    2015-01-01

    This article describes a follow-up analysis of the Spiritual Competency Scale, which initially validated ASERVIC's (Association for Spiritual, Ethical and Religious Values in Counseling) spiritual competencies. The study examined whether the factor structure of the Spiritual Competency Scale would be supported by participants (i.e., ASERVIC…

  19. Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

    Directory of Open Access Journals (Sweden)

    Mojtaba Sankian

    2014-05-01

    Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

  20. Characterization of small interfering RNAs derived from Rice black streaked dwarf virus in infected maize plants by deep sequencing.

    Science.gov (United States)

    Li, Mingjun; Li, Yongqiang; Xia, Zihao; Di, Dianping; Zhang, Aihong; Miao, Hongqin; Zhou, Tao; Fan, Zaifeng

    2017-01-15

    Rice black streaked dwarf virus (RBSDV) is the casual agent of maize rough dwarf disease, which frequently causes severe yield loss in China. However, the interaction between RBSDV and maize plants is largely unknown. RNA silencing is a conserved mechanism against viruses in plants. To understand the antiviral RNA interfering response in RBSDV-infected plants, the profile of virus-derived small interfering RNAs (vsiRNAs) from RBSDV in infected maize plants was obtained by deep sequencing in this study. Our data showed that vsiRNAs, accumulated preferentially as 21- and 22-nucleotide (nt) species, were mapped against all 10 genomic RNA segments of RBSDV and derived almost equally overall from both positive and negative strands, while there were significant differences in the accumulation level of vsiRNAs from segments 2, 4, 6, 7 and 10. The vsiRNAs (21 and 22 nt) generated from each segment of RBSDV genome had a 5'-terminal nucleotide bias toward adenine and uracil. The single-nucleotide resolution maps showed that RBSDV-derived siRNAs preferentially distributed in the 5'- or 3'-terminal regions of several genomic segments. In addition, our results showed that the mRNA levels of some components involved in antiviral RNA silencing pathway were differentially modified during RBSDV infection. Among them, the accumulation levels of ZmDCL1, ZmDCL2, ZmDCL3a, ZmAGO1a, ZmAGO1b, ZmAGO2a, ZmAGO18a and ZmRDR6 mRNAs were significantly up-regulated, while those of ZmDCL3b, ZmDCL4 and ZmAGO1c mRNAs showed no obvious changes in RBSDV-infected maize plants. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Characterization of plant growth-promoting traits of bacteria isolated from larval guts of diamondback moth Plutella xylostella (lepidoptera: plutellidae).

    Science.gov (United States)

    Indiragandhi, P; Anandham, R; Madhaiyan, M; Sa, T M

    2008-04-01

    Eight bacterial isolates from the larval guts of Diamondback moths (Plutella xylostella) were tested for their plant growth-promoting (PGP) traits and effects on early plant growth. All of the strains tested positive for nitrogen fixation and indole 3-acetic acid (IAA) and salicylic acid production but negative for hydrogen cyanide and pectinase production. In addition, five of the isolates exhibited significant levels of tricalcium phosphate and zinc oxide solubilization; six isolates were able to oxidize sulfur in growth media; and four isolates tested positive for chitinase and beta-1,3-glucanase activities. Based on their IAA production, six strains including four that were 1-aminocyclopropane-1-carboxylate (ACC) deaminase positive and two that were ACC deaminase negative were tested for PGP activity on the early growth of canola and tomato seeds under gnotobiotic conditions. Acinetobacter sp. PSGB04 significantly increased root length (41%), seedling vigor, and dry biomass (30%) of the canola test plants, whereas Pseudomonas sp. PRGB06 inhibited the mycelial growth of Botrytis cinerea, Colletotrichum coccodes, C. gleospoiroides, Rhizoctonia solani, and Sclerotia sclerotiorum under in vitro conditions. A significant increase, greater than that of the control, was also noted for growth parameters of the tomato test plants when the seeds were treated with PRGB06. Therefore, the results of the present study suggest that bacteria associated with insect larval guts possess PGP traits and positively influence plant growth. Therefore, insect gut bacteria as effective PGP agents represent an unexplored niche and may broaden the spectrum of beneficial bacteria available for crop production.

  2. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  3. Dementia and Legal Competency

    OpenAIRE

    Filaković, Pavo; Petek Erić, Anamarija; Mihanović, Mate; Glavina, Trpimir; Molnar, Sven

    2011-01-01

    The legal competency or capability to exercise rights is level of judgment and decision-making ability needed to manage one's own affairs and to sign official documents. With some exceptions, the person entitles this right in age of majority. It is acquired without legal procedures, however the annulment of legal capacity requires a juristic process. This resolution may not be final and could be revoked thorough the procedure of reverting legal capacity – fully or partially. Given ...

  4. [Competence based medical education].

    Science.gov (United States)

    Bernabó, Jorge G; Buraschi, Jorge; Olcese, Juan; Buraschi, María; Duro, Eduardo

    2007-01-01

    The strategy of curriculum planning in the majority of the Schools of Medicine has shifted, in the past years, from curriculum models based in contents to outcome oriented curricula. Coincidently the interest in defining and evaluating the clinical competences that a graduate must have has grown. In our country, and particularly in the Associated Hospitals belonging to the Unidad Regional de Enseñanza IV of the UBA School of Medicine, evidence has been gathered showing that the acquisition of clinical competences during the grade is in general insufficient. The foundations and characteristics of PREM (Programa de Requisitos Esenciales Mínimos) are described. PREM is a tool to promote the apprenticeship of abilities and necessary skills for the practice of medicine. The objective of the program is to promote the apprenticeship of a well defined list of core competences considered indispensable for a general practitioner. An outcome oriented curriculum with a clear definition of the expected knowledge, skills and attitudes of a graduate of the programme, the promotion of learning experiences centered in the practice and evaluation tools based in direct observation of the student's performance should contribute to close the gap between what the Medicine Schools traditionally teach and evaluate, and what the doctor needs to know and needs to do to perform correctly its profession.

  5. Dissociative State and Competence

    Directory of Open Access Journals (Sweden)

    Yu-Ju Lin

    2007-10-01

    Full Text Available This report presents the results of forensic evaluation of the civil competence of a case of alleged dissociative identity disorder (DID and discusses whether such dissociative states substantially jeopardize civil competence. A 40-year-old woman claimed that she had had many personalities since her college days. From the age of 37 to 40, she shopped excessively, which left her with millions of dollars of debt. She ascribed her shopping to a certain identity state, over which she had no control. (In this article, we use the term identity state to replace personality as an objective description of a mental state. She thus raised the petition of civil incompetence. During the forensic evaluation, it was found that the identity states were relatively stable and mutually aware of each other. The switch into another identity state was sometimes under voluntary control. The subject showed consistency and continuity in behavioral patterns across the different identity states, and no matter which identity state she was in, there was no evidence of impairment in her factual knowledge of social situations and her capacity for managing personal affairs. We hence concluded that she was civilly competent despite the claimed DID. Considering that the existence and diagnosis of DID are still under dispute and a diagnosis of DID alone is not sufficient to interdict a person's civil right, important clinical and forensic issues remain to be answered.

  6. Dementia and legal competency.

    Science.gov (United States)

    Filaković, Pavo; Erić, Anamarija Petek; Mihanović, Mate; Glavina, Trpimir; Molnar, Sven

    2011-06-01

    The legal competency or capability to exercise rights is level of judgment and decision-making ability needed to manage one's own affairs and to sign official documents. With some exceptions, the person entitles this right in age of majority. It is acquired without legal procedures, however the annulment of legal capacity requires a juristic process. This resolution may not be final and could be revoked thorough the procedure of reverting legal capacity - fully or partially. Given the increasing number of persons with dementia, they are often subjects of legal expertise concerning their legal capacity. On the other part, emphasis on the civil rights of mentally ill also demands their maximal protection. Therefore such distinctive issue is approached with particular attention. The approach in determination of legal competency is more focused on gradation of it's particular aspects instead of existing dual concept: legally capable - legally incapable. The main assumption represents how person with dementia is legally capable and should enjoy all the rights, privileges and obligations as other citizens do. The aspects of legal competency for which person with dementia is going to be deprived, due to protection of one's rights and interests, are determined in legal procedure and then passed over to the guardian decided by court. Partial annulment of legal competency is measure applied when there is even one existing aspect of preserved legal capability (pension disposition, salary or pension disposition, ability of concluding contract, making testament, concluding marriage, divorce, choosing whereabouts, independent living, right to vote, right to decide course of treatment ect.). This measure is most often in favour of the patient and rarely for protection of other persons and their interests. Physicians are expected to precisely describe early dementia symptoms which may influence assessment of specific aspects involved in legal capacity (memory loss, impaired task

  7. I. Identification and characterization of dasheen mosaic virus in Chinese evergreen plants (Aglaonema commutatum) in California. II. New approaches for detecting plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Kositratana, W.

    1985-01-01

    Chinese evergreen plants (Aglaonema commutatum) with symptoms of mild stunting, chlorosis, leaf distortion and mosaic, were observed in Southern California. Flexuous rods (ca. 750 nm) were detected in leaf dip and partially purified preparations. Dasheen mosac virus (DMV) was identified as the causal agent on the basis of host range, morphology and reaction with DMV antiserum in immunodouble diffusion and immunosorbent electron microscopy (ISEM) tests. Tetragonia expansa was found to be a new host of this virus. Surveys indicate that DMV is not widespread in cultivars of A. commutatum in Southern California. The virus was purified from leaves of seedling Philodendron selloum by clarification with CCl/sub 4/, CHCl/sub 3/, and Triton X-100, precipitation with PEG-8000 and centrifugation in either Cs/sub 2/SO/sub 4/-sucrose cushion gradients or Cs/sub 2/SO/sub 4/ equilibrium density gradients. Purified virions formed a single UV-absorbing infectious band with densities of 1.31 and 1.245 g/ml in CsCl/sub 2/ and Cs/sub 2/SO/sub 4/ equilibrium density gradients, respectively, and a sedimentation coefficient of 154 S as determined by a linear-log sucrose density gradient centrifugation. Dasheen mosaic virus has a plus-sense ssRNA with the M.W. of 3.2 x 10/sup 6/ under denaturing conditions. Molecular hybridization analysis using /sup 3/H-complementary DNA specific to DMV-Ca RNA showed that DMV-Ca isolate was more closely related to DMV-Fiji isolate than to DMV-Fla isolate, and was very distantly related to ZYMV, TEV. PeMoC and PVY.

  8. Traditional Mediterranean plants: characterization and use of an essential oils mixture to treat Malassezia otitis externa in atopic dogs.

    Science.gov (United States)

    Nardoni, Simona; Pistelli, Luisa; Baronti, Ilenia; Najar, Basma; Pisseri, Francesca; Bandeira Reidel, Rose Vanessa; Papini, Roberto; Perrucci, Stefania; Mancianti, Francesca

    2017-08-01

    Several plants extracts from Mediterranean countries are traditionally employed in skin troubles both in humans and in animals. Malassezia pachydermatis is a lipophylic yeast responsible for otitis externa and dermatitis in dogs and for cutaneous and systemic disease in humans. Five mixtures of essential oils obtained from Mediterranean plants (Citrus paradisi, Salvia sclarea, Ocimum basilicum, Rosmarinus officinalis, Citrus limon, Anthemis nobilis, Lavandula hybrida and Thymus vulgaris) provided with antifungal and/or anti-inflammatory action assayed in vitro, were tested in vivo versus M. pachydermatis to treat once daily for 2 weeks 25 atopic dogs with Malassezia otitis externa. Mixture composed by C. limon 1%, S. sclarea 0,5%, R. officinalis 1%, A. nobilis 0,5% yielded excellent results in all treated dogs. Despite of clinical resolution after all treatments the number of blastospores did not decrease. This study confirms recent findings suggesting a multifactorial alternative approach for the management of canine Malassezia otitis.

  9. MECHANICAL CHARACTERIZATION AND SHRINKAGE OF Sclerolobium paniculatum Vogel WOOD IN A HOMOGENEOUS PLANTING UNDER DIFFERENT LEVELS OF FERTILIZATION

    Directory of Open Access Journals (Sweden)

    Joselito Bonifácio Oliveira

    2010-08-01

    Full Text Available The purposa of this work was to study the influence of fertilization on wood quality of Sclerolobium paniculatum Vogel. A homogeneous planting trial, under different levels of liming and phosphorus, was established by Embrapa-Cerrados 18 years ago in Planaltina, Distrito Federal, Brazil, tropical wood savanna region. Mechanical tests conducted were static bending, parallel compression to grain, shear strength and shrinkage. No significant differences were observed for mechanical properties or for shrinkage, which presented: ¦b = 650kg/cm2, E = 59.877kg/cm2, ¦c = 296kg/cm2 e ¦n = 131kg/cm2. Control treatment showed highest values for shear strength and compression parallel to grain. Too many branches in all trees and also too many knots in lumber were observed. Pruning is recommended for homogeneous planting of Sclerolobium paniculatum to avoid knots in order to be produced wood of superior quality.

  10. Chemical and molecular characterization of Phomopsis and Cytospora-like endophytes from different host plants in Brazil

    DEFF Research Database (Denmark)

    Abreu, Lucas M.; Costa, Sarah S.; Pfenning, Ludwig H.

    2012-01-01

    affinities. Additional phenotypic characters, such as profiles of secondary metabolites, are needed for practical species recognition. We investigated 36 strains of Phomopsis spp. and Cytospora-like fungi, obtained as endophytes of different host plants in Brazil, using metabolite profiling based on HPLC......Phomopsis and related taxa comprise important endophytic and plant pathogenic species, and are known for the production of a diverse array of secondary metabolites. Species concepts within this group based on morphological characters and assumed host specificity do not reflect phylogenetic...... markers. Cytospora-like endophytes (chemotype 6) produced a characteristic set of metabolites including cytosporones and dothiorelones. Bayesian and Maximum Parsimony (MP) trees classified strains of each chemotype into single phylogenetic lineages or closely related groups. Strains of chemotypes 1 and 2...

  11. Bioassay guided screening, optimization and characterization of antioxidant compounds from high altitude wild edible plants of Ladakh.

    Science.gov (United States)

    Avasthi, Anupama Sharma; Bhatnagar, Manisha; Sarkar, Nandan; Kitchlu, Surinder; Ghosal, Sabari

    2016-08-01

    Seven edible plants including three unexplored species of high altitude (Ladakh) region were screened for antioxidant activity by bioassay guided fractionation method. The objective of the study was to dereplicate the complex phytochemical matrix of a plant in reference to antioxidant activity in vitro. The screening result showed that ethylacetate fraction of Nepeta longibracteata possesses maximum antioxidant activity, comparable to that of green tea. It also exhibited significant protecting effect against oxidative stress induced by t -BHP in human RBCs. Phytochemical profiling of the most active fraction by nontargeted RP-HPLC-MS and MS/MS technique showed that rosmarinic acid and methylrosmarinate constituted nearly 51 % of the total metabolites apart from twelve other major chemotypes.

  12. Plant-bacteria interactions: identification, characterization and localization of beneficial bacterial endophytes isolated from Vitis vinifera cv. Glera

    OpenAIRE

    Nigris, Sebastiano

    2015-01-01

    This thesis reports the results obtained during the three years PhD course focused on the study of culturable bacterial endophytes of Vitis vinifera Glera and their beneficial activities. The study, part of a large project named “EndoFlorVit project” (FEARS-UE and Regione Del Veneto), aims at investigate the biodiversity and the plant growth promoting activities of culturable endophytes isolated from Glera grapevine in vineyards of Conegliano-Valdobbiadene DOCG production area. This thesis re...

  13. Characterization of high temperature superconductor cables for magnet toroidal field coils of the DEMO fusion power plant

    Energy Technology Data Exchange (ETDEWEB)

    Bayer, Christoph M.

    2017-05-01

    Nuclear fusion is a key technology to satisfy the basic demand for electric energy sustainably. The official EUROfusion schedule foresees a first industrial DEMOnstration Fusion Power Plant for 2050. In this work several high temperature superconductor sub-size cables are investigated for their applicability in large scale DEMO toroidal field coils. Main focus lies on the electromechanical stability under the influence of high Lorentz forces at peak magnetic fields of up to 12 T.

  14. Characterization of high temperature superconductor cables for magnet toroidal field coils of the DEMO fusion power plant

    CERN Document Server

    Bayer, Christoph M

    2017-01-01

    Nuclear fusion is a key technology to satisfy the basic demand for electric energy sustainably. The official EUROfusion schedule foresees a first industrial DEMOnstration Fusion Power Plant for 2050. In this work several high temperature superconductor sub-size cables are investigated for their applicability in large scale DEMO toroidal field coils. Main focus lies on the electromechanical stability under the influence of high Lorentz forces at peak magnetic fields of up to 12 T.

  15. Characterization of small interfering RNAs derived from Sugarcane mosaic virus in infected maize plants by deep sequencing.

    Science.gov (United States)

    Xia, Zihao; Peng, Jun; Li, Yongqiang; Chen, Ling; Li, Shuai; Zhou, Tao; Fan, Zaifeng

    2014-01-01

    RNA silencing is a conserved surveillance mechanism against viruses in plants. It is mediated by Dicer-like (DCL) proteins producing small interfering RNAs (siRNAs), which guide specific Argonaute (AGO)-containing complexes to inactivate viral genomes and may promote the silencing of host mRNAs. In this study, we obtained the profile of virus-derived siRNAs (vsiRNAs) from Sugarcane mosaic virus (SCMV) in infected maize (Zea mays L.) plants by deep sequencing. Our data showed that vsiRNAs which derived almost equally from sense and antisense SCMV RNA strands accumulated preferentially as 21- and 22-nucleotide (nt) species and had an adenosine bias at the 5'-terminus. The single-nucleotide resolution maps revealed that vsiRNAs were almost continuously but heterogeneously distributed throughout the SCMV genome and the hotspots of sense and antisense strands were mainly distributed in the HC-Pro coding region. Moreover, dozens of host transcripts targeted by vsiRNAs were predicted, several of which encode putative proteins involved in ribosome biogenesis and in biotic and abiotic stresses. We also found that ZmDCL2 mRNAs were up-regulated in SCMV-infected maize plants, which may be the cause of abundant 22-nt vsiRNAs production. However, ZmDCL4 mRNAs were down-regulated slightly regardless of the most abundant 21-nt vsiRNAs. Our results also showed that SCMV infection induced the accumulation of AGO2 mRNAs, which may indicate a role for AGO2 in antiviral defense. To our knowledge, this is the first report on vsiRNAs in maize plants.

  16. Characterization of small interfering RNAs derived from Sugarcane mosaic virus in infected maize plants by deep sequencing.

    Directory of Open Access Journals (Sweden)

    Zihao Xia

    Full Text Available RNA silencing is a conserved surveillance mechanism against viruses in plants. It is mediated by Dicer-like (DCL proteins producing small interfering RNAs (siRNAs, which guide specific Argonaute (AGO-containing complexes to inactivate viral genomes and may promote the silencing of host mRNAs. In this study, we obtained the profile of virus-derived siRNAs (vsiRNAs from Sugarcane mosaic virus (SCMV in infected maize (Zea mays L. plants by deep sequencing. Our data showed that vsiRNAs which derived almost equally from sense and antisense SCMV RNA strands accumulated preferentially as 21- and 22-nucleotide (nt species and had an adenosine bias at the 5'-terminus. The single-nucleotide resolution maps revealed that vsiRNAs were almost continuously but heterogeneously distributed throughout the SCMV genome and the hotspots of sense and antisense strands were mainly distributed in the HC-Pro coding region. Moreover, dozens of host transcripts targeted by vsiRNAs were predicted, several of which encode putative proteins involved in ribosome biogenesis and in biotic and abiotic stresses. We also found that ZmDCL2 mRNAs were up-regulated in SCMV-infected maize plants, which may be the cause of abundant 22-nt vsiRNAs production. However, ZmDCL4 mRNAs were down-regulated slightly regardless of the most abundant 21-nt vsiRNAs. Our results also showed that SCMV infection induced the accumulation of AGO2 mRNAs, which may indicate a role for AGO2 in antiviral defense. To our knowledge, this is the first report on vsiRNAs in maize plants.

  17. Nutritional Value and Bioactive Compounds Characterization of Plant Parts From Cynara cardunculus L. (Asteraceae Cultivated in Central Greece

    Directory of Open Access Journals (Sweden)

    Spyridon A. Petropoulos

    2018-04-01

    Full Text Available In the present study, the nutritional value of the edible parts (immature capitula of cardoon plants was evaluated, while further analyses were carried out in order to assess antioxidant properties and phenolic compounds composition of the various plant parts and seed oils. Cardoon capitula (heads were a rich source of carbohydrates, with the main detected free sugar being sucrose, as well as of macro- and micro-minerals (K, Ca, Mg, and Fe. Heads were also abundant in saturated fatty acids (palmitic, behenic, linoleic, stearic, caproic, and oleic acid, whereas seed oils in unsaturated fatty acids (linoleic, oleic, palmitic, and stearic acid. Total phenolic compounds (TPC content and phenolics composition differed between the various plant parts, with heads and leaf blades having higher TPC than midribs and petioles. Moreover, heads and leaf midribs and petioles consisted mainly of phenolic acids (5-O-caffeoylquinic and 3,5-O-dicaffeoylquinic acid, with flavonoids being detected in lower amounts. In contrast, the composition of polyphenols in leaf blades consisted mostly of flavonoids (Luteolin-7-O-glucoside and luteolin-7-O-malonylhexoside, whereas phenolic acids were also detected in considerable amounts (5-O-feruloylquinic and 3-O-caffeoylquinic acid. Regarding antioxidant properties, leaf blades and seeds exhibited the highest potency for all the tested assays which could be partly attributed to the synergistic effects of the phenolic compounds present in each sample. In conclusion, cardoon plant parts may find various uses in the food and pharmaceutical industry, since they contain considerable amounts of bioactive molecules, while seed oils can be considered as alternative vegetable oils for human consumption.

  18. Two and three dimensional characterization of Zucchini Yellow Mosaic Virus induced structural alterations in Cucurbita pepo L. plants.

    Science.gov (United States)

    Zellnig, Günther; Pöckl, Michael Herbert; Möstl, Stefan; Zechmann, Bernd

    2014-05-01

    Infection of plants by Zucchini Yellow Mosaic Virus (ZYMV) induces severe ultrastructural changes. The aim of this study was to investigate ultrastructural changes during ZYMV-infection in Cucurbita pepo L. plants on the two and three dimensional (2D and 3D) level and to correlate these changes with the spread of ZYMV throughout the plant by transmission electron microscopy (TEM) and image analysis. This study revealed that after inoculation of the cotyledons ZYMV moved into roots [3 days post inoculation (dpi)], then moved upwards into the stem and apical meristem (5 dpi), then into the first true leaf (7 dpi) and could finally be found in all plant parts (9 dpi). ZYMV-infected cells contained viral inclusion bodies in the form of cylindrical inclusions (CIs). These CIs occurred in four different forms throughout the cytosol of roots and leaves: scrolls and pinwheels when cut transversely and long tubular structures and bundles of filaments when cut longitudinally. 3D reconstruction of ZYMV-infected cells containing scrolls revealed that they form long tubes throughout the cytosol. The majority has a preferred orientation and an average length and width of 3 μm and 120 nm, respectively. Image analysis revealed an increased size of cells and vacuoles (107% and 447%, respectively) in younger ZYMV-infected leaves leading to a similar ratio of cytoplasm to vacuole (about 1:1) in older and younger ZYMV-infected leaves which indicates advanced cell growth in younger tissues. The collected data advances the current knowledge about ZYMV-induced ultrastructural changes in Cucurbita pepo. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Cameron Habib

    Full Text Available The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR, which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA. Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA, which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  20. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.