WorldWideScience

Sample records for competent plants characterization

  1. Phytochromes in photosynthetically competent plants

    Energy Technology Data Exchange (ETDEWEB)

    Pratt, L.H.

    1990-07-01

    Plants utilize light as a source of information in photomorphogenesis and of free energy in photosynthesis, two processes that are interrelated in that the former serves to increase the efficiency with which plants can perform the latter. Only one pigment involved in photomorphogenesis has been identified unequivocally, namely phytochrome. The thrust of this proposal is to investigate this pigment and its mode(s) of action in photosynthetically competent plants. Our long term objective is to characterize phytochrome and its functions in photosynthetically competent plants from molecular, biochemical and cellular perspectives. It is anticipated that others will continue to contribute indirectly to these efforts at the physiological level. The ultimate goal will be to develop this information from a comparative perspective in order to learn whether the different phytochromes have significantly different physicochemical properties, whether they fulfill independent functions and if so what these different functions are, and how each of the different phytochromes acts at primary molecular and cellular levels.

  2. Plant Phenotype Characterization System

    Energy Technology Data Exchange (ETDEWEB)

    Daniel W McDonald; Ronald B Michaels

    2005-09-09

    This report is the final scientific report for the DOE Inventions and Innovations Project: Plant Phenotype Characterization System, DE-FG36-04GO14334. The period of performance was September 30, 2004 through July 15, 2005. The project objective is to demonstrate the viability of a new scientific instrument concept for the study of plant root systems. The root systems of plants are thought to be important in plant yield and thus important to DOE goals in renewable energy sources. The scientific study and understanding of plant root systems is hampered by the difficulty in observing root activity and the inadequacy of existing root study instrumentation options. We have demonstrated a high throughput, non-invasive, high resolution technique for visualizing plant root systems in-situ. Our approach is based upon low-energy x-ray radiography and the use of containers and substrates (artificial soil) which are virtually transparent to x-rays. The system allows us to germinate and grow plant specimens in our containers and substrates and to generate x-ray images of the developing root system over time. The same plant can be imaged at different times in its development. The system can be used for root studies in plant physiology, plant morphology, plant breeding, plant functional genomics and plant genotype screening.

  3. Construction and characterization of a plant transformation-competent BIBAC library of the black Sigatoka-resistant banana Musa acuminata cv. Tuu Gia (AA).

    Science.gov (United States)

    Ortiz-Vázquez, E; Kaemmer, D; Zhang, H-B; Muth, J; Rodríguez-Mendiola, M; Arias-Castro, C; James, Andrew

    2005-02-01

    A plant transformation-competent binary bacterial artificial chromosome (BIBAC) library was constructed from Musa acuminata cv. Tuu Gia (AA), a black Sigatoka-resistant diploid banana. After digestion of high-molecular-weight banana DNA by HindIII, several methods of DNA size selection were tested, followed by ligation, using a vector/insert molar ratio of 4:1. The library consists of 30,700 clones stored in 80 384-well microtiter plates. The mean insert size was estimated to be 100 kb, and the frequency of inserts with internal NotI sites was 61%. The majority of insert sizes fell into the range of 100+/-20 kb, making them suitable for Agrobacterium-mediated transformation. Only 1% and 0.9% of the clones contain chloroplast and mitochondrial DNA, respectively. This is the first BIBAC library for banana, estimated to represent five times its haploid genome (600 Mbp). It was demonstrated by hybridization that the library contains typical members of resistance gene and defense gene families that can be used for transformation of disease susceptible banana cultivars for banana genetic improvement.

  4. Measures geared to maintain the competence of operating personnel at Grohnde nuclear power plant

    International Nuclear Information System (INIS)

    Bohr, H.

    1986-01-01

    Organizational structure of the German power plant 'Gemeinschaftskernkraftwerk Grohnde GmbH'. The plant characteristics of the tasks and duties and definition of competence. Measures to maintain competence. The experience by the realization of training programs to maintain competence. (orig.)

  5. Verifying competence of operations personnel in nuclear power plants

    International Nuclear Information System (INIS)

    Farber, G.H.

    1986-01-01

    To ensure that only competent people are authorized to fill positions in a nuclear power plant, both the initial competence of personnel and the continuous maintenance of competence have to be verified. Two main methods are normally used for verifying competence, namely evaluation of a person's performance over a period of time, and evaluation of his knowledge and skills at a particular time by means of an examination. Both methods have limitations, and in practice they are often used together to give different and to some extent complementary evaluations of a person's competence. Verification of competence itself is a problem area, because objective judging of human competence is extremely difficult. Formal verification methods, such as tests and examinations, are particularly or exclusively applied for the direct operating personnel in the control room (very rarely for management personnel). Out of the many elements contributing to a person's competence, the knowledge which is needed and the intellectual skills are the main subjects of the formal verification methods. Therefore the presentation will concentrate on the proof of the technical qualification of operators by means of examinations. The examination process in the Federal Republic of Germany for the proof of knowledge and skills will serve as an example to describe and analyze the important aspects. From that recommendations are derived regarding standardization of the procedure as well as validation. (orig./GL)

  6. Selection, competency development and assessment of nuclear power plant managers

    International Nuclear Information System (INIS)

    1998-06-01

    This publication provides information on proven methods and good practices with respect to the selection, development and assessment of nuclear power plant (NPP) managers. The report is organized into four sections, a glossary, two appendices, and several annexes. The Introduction (Section 1) provides the framework for the report. Section 2 describes how appropriate management competencies can be used for the selection, development and assessment of NPP managers, including: -Selection which includes recruitment, promotion and succession management. -Management development programmes including formal training, job rotation, on the job training, mentoring, and outside assignments. -Assessment of individual performance. Section 3 describes a systematic process for identifying the competencies needed by NPP managers. This section culminates in a set of suggested core competencies for NPP managers which are further expanded in Appendix A. The annexes included provide specific examples of competency-based management selection, development, and assessment programmes in several Member States. -Annex A is one method to organize and display competencies. -Annex B is an example of using competencies for selection of first line managers. -Annex C is an example of using management competencies for succession management. -Annexes -H are examples of management development programmes. -Annexes I and J are examples of management assessment programmes. A glossary of terms is provided at the end of the report to explain the use of some key terms explain the use of some key terms

  7. Competence and regulatory interactions during regeneration in plants

    Directory of Open Access Journals (Sweden)

    Ajai Joseph Pulianmackal

    2014-04-01

    Full Text Available The ability to regenerate is widely exploited by multitudes of organisms ranging from unicellular bacteria to multicellular plants for their propagation and repair. But the levels of competence for regeneration vary from species to species. While variety of living cells of a plant display regeneration ability, only a few set of cells maintain their stemness in mammals. This highly pliable nature of plant cells in-terms of regeneration can be attributed to their high developmental plasticity. De novo organ initiation can be relatively easily achieved in plants by proper hormonal regulations. Elevated levels of plant hormone auxin induces the formation of proliferating mass of pluripotent cells called callus, which predominantly express lateral root meristem markers and hence is having an identity similar to lateral root primordia. Organ formation can be induced from the callus by modulating the ratio of hormones. An alternative for de novo organogenesis is by the forced expression of plant specific transcription factors. The mechanisms by which plant cells attain competence for regeneration on hormonal treatment or forced expression remain largely elusive. Recent studies have provided some insight into how the epigenetic modifications in plants affect this competence. In this review we discuss the present understanding of regenerative biology in plants and scrutinize the future prospectives of this topic. While discussing about the regeneration in the sporophyte of angiosperms which is well studied, here we outline the regenerative biology of the gametophytic phase and discuss about various strategies of regeneration that have evolved in the domain of life so that a common consensus on the entire process of regeneration can be made.

  8. Plant-soil feedbacks and the coexistence of competing plants

    NARCIS (Netherlands)

    Revilla Rimbach, Tomas; Veen, G. F. (Ciska); Eppinga, Maarten B.; Weissing, Franz J.

    Plant-soil feedbacks can have important implications for the interactions among plants. Understanding these effects is a major challenge since it is inherently difficult to measure and manipulate highly diverse soil communities. Mathematical models may advance this understanding by making the

  9. Assuring the competence of nuclear power plant contractor personnel

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-07-01

    This report was prepared in response to a recommendation by the IAEA International Working Group on Training and Qualification of NPP Personnel (JWG-T and Q) and supported by a number of IAEA meetings on NPP personnel training. IAEA publications on NPP training are the only international documents available to all Member States with nuclear programmes. This report complements the following IAEA publications on NPP personnel training: Technical Reports Series No. 380, Nuclear Power Plant Personnel Training and its Evaluation, A Guidebook; IAEA-TECDOC-1057, Experience in the Use of Systematic Approach to Training (SAT) for Nuclear Power Plant Personnel and IAEA-TECDOC-1063, IAEA World Survey on Nuclear Power Plant Personnel Training. This TECDOC also supplements the IAEA Safety Guide 50-SG-O1 (Rev. 1), Staffing of Nuclear Power Plants and the Recruitment Training and Authorization of Operating Personnel and Safety Standards Series No. NS-R-2, Safety of Nuclear Power Plants. Operation. Within the context of this report NPP contractors are defined as any personnel working for a nuclear power plant who are not directly employed by the nuclear power plant. Competence is the ability to perform to identified standards; it comprises skills, knowledge and attitudes and may be developed through education, experience and training. Qualification is a formal statement of achievement, resulting from an auditable assessment; if competence is assessed, the qualification becomes a formal statement of competence and may be shown on a certificate, diploma, etc. It is recognized that personnel are used to perform tasks that are of a specialised or temporary nature where it is not feasible to hire or maintain a full-time NPP employee. Accordingly, contractors may be used in a variety of situations to support NPPs. Typical situations include: supplies and services being delivered by the contractors that are subject to different quality standards based on a graded approach to assuring

  10. Assuring the competence of nuclear power plant contractor personnel

    International Nuclear Information System (INIS)

    2001-07-01

    This report was prepared in response to a recommendation by the IAEA International Working Group on Training and Qualification of NPP Personnel (JWG-T and Q) and supported by a number of IAEA meetings on NPP personnel training. IAEA publications on NPP training are the only international documents available to all Member States with nuclear programmes. This report complements the following IAEA publications on NPP personnel training: Technical Reports Series No. 380, Nuclear Power Plant Personnel Training and its Evaluation, A Guidebook; IAEA-TECDOC-1057, Experience in the Use of Systematic Approach to Training (SAT) for Nuclear Power Plant Personnel and IAEA-TECDOC-1063, IAEA World Survey on Nuclear Power Plant Personnel Training. This TECDOC also supplements the IAEA Safety Guide 50-SG-O1 (Rev. 1), Staffing of Nuclear Power Plants and the Recruitment Training and Authorization of Operating Personnel and Safety Standards Series No. NS-R-2, Safety of Nuclear Power Plants. Operation. Within the context of this report NPP contractors are defined as any personnel working for a nuclear power plant who are not directly employed by the nuclear power plant. Competence is the ability to perform to identified standards; it comprises skills, knowledge and attitudes and may be developed through education, experience and training. Qualification is a formal statement of achievement, resulting from an auditable assessment; if competence is assessed, the qualification becomes a formal statement of competence and may be shown on a certificate, diploma, etc. It is recognized that personnel are used to perform tasks that are of a specialised or temporary nature where it is not feasible to hire or maintain a full-time NPP employee. Accordingly, contractors may be used in a variety of situations to support NPPs. Typical situations include: supplies and services being delivered by the contractors that are subject to different quality standards based on a graded approach to assuring

  11. Plant-soil feedbacks and the coexistence of competing plants

    NARCIS (Netherlands)

    Revilla, T.A.; Veen, G.F.; Eppinga, M.B.; Weissing, F.J.

    2013-01-01

    Plant–soil feedbacks can have important implications for the interactions among plants. Understanding these effects is a major challenge since it is inherently difficult to measure and manipulate highly diverse soil communities. Mathematical models may advance this understanding by making the

  12. Plant-soil feedbacks and the coexistence of competing plants

    NARCIS (Netherlands)

    Revilla, T.A.; Veen, G.F.; Eppinga, M.B.; Weissing, F.J.

    Plant–soil feedbacks can have important implications for the interactions among plants. Understanding these effects is a major challenge since it is inherently difficult to measure and manipulate highly diverse soil communities. Mathematical models may advance this understanding by making the

  13. Physiological and molecular characterization of genetic competence in Streptococcus sanguinis

    OpenAIRE

    Rodriguez, Alejandro Miguel; Callahan, Jill E.; Fawcett, Paul; Ge, Xiuchun; Xu, Ping; Kitten, Todd

    2011-01-01

    Streptococcus sanguinis is a major component of the oral flora and an important cause of infective endocarditis. Although S. sanguinis is naturally competent, genome sequencing has suggested significant differences in the S. sanguinis competence system relative to those of other streptococci. An S. sanguinis mutant possessing an in-frame deletion in the comC gene, which encodes competence-stimulating peptide (CSP), was created. Addition of synthetic CSP induced competence in this strain. Gene...

  14. Assuring Competency in Nuclear Power Plants: Regulatory Policy and Practice

    International Nuclear Information System (INIS)

    Durbin, Nancy E.; Melber, Barbara

    2004-06-01

    This report provides descriptive and comparative information on competency regulation and oversight in selected countries and identifies issues concerning competency. Interviews with competency experts in five countries: Sweden, Finland, Spain, Canada, and the United Kingdom were conducted and analyzed. The report provides a summary and comparison of the regulations used in these five countries. Regulations and policies in four areas are discussed: Licensing, certification and approvals; Educational qualifications; Training; Experience. Methods and tools used by regulators in the five countries are discussed with regard to how regulators: Assure that licensees determine the competencies needed for the safe operation of nuclear facilities and fill positions with competent staff; Oversee training and examinations in the areas of operations, engineering and maintenance; Assure competence of contractors; Oversee work group performance; Assure competency of managers; Assure competency of other personnel; Assure competency when modifications and other changes occur. Competency experts identified the following as the biggest challenges in regulating competency: The continued availability of qualified personnel; Determining appropriate criteria for competency and assuring those criteria are met. Determining whether licensees have adequately identified and met training needs, especially evaluating systematic approaches to training (SAT); Overseeing contractors. The following issues related to competency are discussed in the report: The sufficiency of qualified personnel; The evaluation of personnel requirements (determining appropriate criteria for competency and assuring those criteria are met); The effects of major organizational changes, including downsizing; Assurance of competency of contractors; International competency issues; The historical and current focus on technical and hardware issues over human factors issues; Selected examples illustrate regulatory

  15. Radiological characterization of nuclear plants under decommissioning

    International Nuclear Information System (INIS)

    Mincarini, M.

    1989-01-01

    In the present work a description of major problems encountered in qualitative and quantitative radiological characterization of nuclear plants for decommissioning and decontamination purpose is presented. Referring to several nuclear plant classes activation and contamination processes, direct and indirect radiological analysis and some italian significant experience are descripted

  16. Medicinal plants: production and biochemical characterization

    International Nuclear Information System (INIS)

    Chunzhao Liu; Zobayed, S.M.A; Murch, S.J.; Saxena, P.K.

    2002-01-01

    Recent advances in the area of biotechnology offer some possibility for the development of new technologies for the conservation, characterization and mass production of medicinal plant species, (i.e. in vitro cell culture techniques for the mass production of sterile, consistent, standardized medicinal plant materials). This paper discussed the following subjects - plant tissue culture, de novo shoot organogenesis, de novo root organogenesis, somatic embryogenesis, large scale propagation in bioreactors and discovery of unique biomolecules

  17. Characterizing Illusions of Competence in Introductory Chemistry Students

    Science.gov (United States)

    Pazicni, Samuel; Bauer, Christopher F.

    2014-01-01

    The Dunning-Kruger effect is a cognitive bias that plagues a particular population of students--the unskilled. This population suffers from illusory competence, as determined by inaccurate ratings of their own ability/performance. These mistakenly high self-ratings (i.e. ''illusions of competence'') are typically explained by a metacognitive…

  18. Training for the qualification and competence of nuclear power plant personnel. Working material

    International Nuclear Information System (INIS)

    1993-01-01

    This document contains summaries of the presentations prepared for the IAEA Review Meeting ''Training for the Qualification and Competence of Nuclear Power Plant Personnel''. The individual contributors have been indexed separately for the database. Refs, figs and tabs

  19. The use of plant experience for maintaining and improving competence

    International Nuclear Information System (INIS)

    Hoffmann, E.

    1986-01-01

    The following topics to be covered in this report are: documentation of plant experience (esp. operational events), derivation of training subjects and training goals, implementation of subjects and goals into retraining, effects of plant experience on tuning and refitting of nuclear power plant simulators and other training equipment. (orig.)

  20. Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.

    Science.gov (United States)

    Rodriguez, A M; Callahan, J E; Fawcett, P; Ge, X; Xu, P; Kitten, T

    2011-04-01

    Streptococcus sanguinis is a major component of the oral flora and an important cause of infective endocarditis. Although S. sanguinis is naturally competent, genome sequencing has suggested significant differences in the S. sanguinis competence system relative to those of other streptococci. An S. sanguinis mutant possessing an in-frame deletion in the comC gene, which encodes competence-stimulating peptide (CSP), was created. Addition of synthetic CSP induced competence in this strain. Gene expression in this strain was monitored by microarray analysis at multiple time-points from 2.5 to 30 min after CSP addition, and verified by quantitative reverse transcription-polymerase chain reaction. Over 200 genes were identified whose expression was altered at least two-fold in at least one time point, with the majority upregulated. The 'late' response was typical of that seen in previous studies. However, comparison of the 'early' response in S. sanguinis with that of other oral streptococci revealed unexpected differences with regard to the number of genes induced, the nature of those genes, and their putative upstream regulatory sequences. Streptococcus sanguinis possesses a comparatively limited early response, which may define a minimal streptococcal competence regulatory circuit. © 2011 John Wiley & Sons A/S.

  1. Competing values, tensions and trade-offs in management of nuclear power plants.

    Science.gov (United States)

    Reiman, Teemu; Rollenhagen, Carl

    2012-01-01

    The specific goal of the study is to look how tensions, competing values and trade-offs manifest in the management of nuclear power plants. Second goal is to inspect how existing frameworks, such as Competing Values Framework, can be used to model the tensions. Empirical data consists of thirty interviews that were conducted as part of a NKS study on safety culture in the Nordic nuclear branch. Eight trade-offs are identified based on a grounded theory based analysis of the interview data. The competing values and potential tensions involved in the trade-offs are discussed.

  2. Development of Behavioral Indicators of Competences for Safety Culture of Nuclear Power Plants: A Preliminary Study

    International Nuclear Information System (INIS)

    Moon, Kwangsu; Kim, Sa Kil; Oh, Yeon Ju; Shin, Youmin; Lee, Yong-Hee; Jang, Tong Il

    2015-01-01

    The term of safety competency in nuclear field was presented in the OECD/NEA workshop held in 1999. A model of the safety culture competencies in nuclear power plants was developed by KAERI (Korea Atomic Energy Research Institute). In general, a competency (competence) is defined as 'cluster of employee's attribute, knowledge, skill, ability or other characteristic that contributes to successful job performance'. We also defined safety culture competency as 'cluster of various internal characteristics (e.g., knowledge, skill, ability, motive, attitude and etc.) of employee that contribute to perform job safely and shape a healthy and strong safety culture.' By this definition, the safety culture competency is the broader construct including job competency. An employee having high level of safety culture competency shows extra discretionary effort to improve safety of peer, team and organization in addition to the individual's successful and safe job accomplishment. The behavioral indicators for each of the competencies are focal points of conversations on progress and are monitored continuously by self-assessment and managers or supervisors' intervention. Deficiencies in any of these indicators can point to coaching, training or other learning opportunities that employees may be required in order to improve. The purpose of this study was to derive a model of safety competencies for improving safety culture of NPPs and develop a set of behavioral indicators of each competency. In addition, the method of measuring behavioral indicators was suggested. For the application of developed safety culture competences and behavioral indicators, the most suitable measuring method for behavioral indicators must be developed. In the case of behavioral observations, behavioral dimensions (frequency, persistence and latency), observation possibility, occurrence basis of behavior (daily job performance, situational dependent) are considered to

  3. Development of Behavioral Indicators of Competences for Safety Culture of Nuclear Power Plants: A Preliminary Study

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Kwangsu; Kim, Sa Kil; Oh, Yeon Ju; Shin, Youmin; Lee, Yong-Hee; Jang, Tong Il [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2015-10-15

    The term of safety competency in nuclear field was presented in the OECD/NEA workshop held in 1999. A model of the safety culture competencies in nuclear power plants was developed by KAERI (Korea Atomic Energy Research Institute). In general, a competency (competence) is defined as 'cluster of employee's attribute, knowledge, skill, ability or other characteristic that contributes to successful job performance'. We also defined safety culture competency as 'cluster of various internal characteristics (e.g., knowledge, skill, ability, motive, attitude and etc.) of employee that contribute to perform job safely and shape a healthy and strong safety culture.' By this definition, the safety culture competency is the broader construct including job competency. An employee having high level of safety culture competency shows extra discretionary effort to improve safety of peer, team and organization in addition to the individual's successful and safe job accomplishment. The behavioral indicators for each of the competencies are focal points of conversations on progress and are monitored continuously by self-assessment and managers or supervisors' intervention. Deficiencies in any of these indicators can point to coaching, training or other learning opportunities that employees may be required in order to improve. The purpose of this study was to derive a model of safety competencies for improving safety culture of NPPs and develop a set of behavioral indicators of each competency. In addition, the method of measuring behavioral indicators was suggested. For the application of developed safety culture competences and behavioral indicators, the most suitable measuring method for behavioral indicators must be developed. In the case of behavioral observations, behavioral dimensions (frequency, persistence and latency), observation possibility, occurrence basis of behavior (daily job performance, situational dependent) are considered to

  4. Administrative competence of regions in connection with the establishment of power plants

    International Nuclear Information System (INIS)

    Poidomani, C.

    1980-03-01

    This paper which is divided into two parts, analyses the concept of competence underlying the regulations concerning the transfer of certain state duties to the regions. The author considers that this concept does not seem adaptable to the various functions the regions are required to discharge in the energy field. A description follows of the technical and administrative authority given to the regions in the licensing process for power-producing plants. The second part of the paper deals with recent regulations concerning energy conservation and development of alternative energy sources, in the context of regional competence. (NEA) [fr

  5. What Characterizes the Algebraic Competence of Norwegian Upper Secondary School Students? Evidence from TIMSS Advanced

    Science.gov (United States)

    Pedersen, Ida Friestad

    2015-01-01

    Algebra is the fundamental language of mathematics, and a profound understanding of school algebra is an important prerequisite for further studies in mathematical sciences. The aim of this study is to characterize the algebraic competence of the Norwegian upper secondary school students participating in Trends in International Mathematics and…

  6. Characterization of Savannah River Plant waste glass

    International Nuclear Information System (INIS)

    Plodinec, M.J.

    1985-01-01

    The objective of the glass characterization programs at the Savannah River Laboratory (SRL) is to ensure that glass containing Savannah River Plant high-level waste can be permanently stored in a federal repository, in an environmentally acceptable manner. To accomplish this objective, SRL is carrying out several experimental programs, including: fundamental studies of the reactions between waste glass and water, particularly repository groundwater; experiments in which candidate repository environments are simulated as accurately as possible; burial tests of simulated waste glass in candidate repository geologies; large-scale tests of glass durability; and determination of the effects of process conditions on glass quality. In this paper, the strategy and current status of each of these programs is discussed. The results indicate that waste packages containing SRP waste glass will satisfy emerging regulatory criteria

  7. Plant vegetative and animal cytoplasmic actins share functional competence for spatial development with protists.

    Science.gov (United States)

    Kandasamy, Muthugapatti K; McKinney, Elizabeth C; Roy, Eileen; Meagher, Richard B

    2012-05-01

    Actin is an essential multifunctional protein encoded by two distinct ancient classes of genes in animals (cytoplasmic and muscle) and plants (vegetative and reproductive). The prevailing view is that each class of actin variants is functionally distinct. However, we propose that the vegetative plant and cytoplasmic animal variants have conserved functional competence for spatial development inherited from an ancestral protist actin sequence. To test this idea, we ectopically expressed animal and protist actins in Arabidopsis thaliana double vegetative actin mutants that are dramatically altered in cell and organ morphologies. We found that expression of cytoplasmic actins from humans and even a highly divergent invertebrate Ciona intestinalis qualitatively and quantitatively suppressed the root cell polarity and organ defects of act8 act7 mutants and moderately suppressed the root-hairless phenotype of act2 act8 mutants. By contrast, human muscle actins were unable to support prominently any aspect of plant development. Furthermore, actins from three protists representing Choanozoa, Archamoeba, and green algae efficiently suppressed all the phenotypes of both the plant mutants. Remarkably, these data imply that actin's competence to carry out a complex suite of processes essential for multicellular development was already fully developed in single-celled protists and evolved nonprogressively from protists to plants and animals.

  8. How To Produce and Characterize Transgenic Plants.

    Science.gov (United States)

    Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

    2002-01-01

    Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

  9. Characterization plan for the Hanford Generating Plant (HGP)

    International Nuclear Information System (INIS)

    Marske, S.G.

    1996-09-01

    This characterization plan describes the sample collection and sample analysis activities to characterize the Hanford Generating Plant and associated solid waste management units (SWMUs). The analytical data will be used to identify the radiological contamination in the Hanford Generating Plant as well as the presence of radiological and hazardous materials in the SWMUs to support further estimates of decontamination interpretation for demolition

  10. Characterization of Cellulose Synthesis in Plant Cells

    Directory of Open Access Journals (Sweden)

    Samaneh Sadat Maleki

    2016-01-01

    Full Text Available Cellulose is the most significant structural component of plant cell wall. Cellulose, polysaccharide containing repeated unbranched β (1-4 D-glucose units, is synthesized at the plasma membrane by the cellulose synthase complex (CSC from bacteria to plants. The CSC is involved in biosynthesis of cellulose microfibrils containing 18 cellulose synthase (CesA proteins. Macrofibrils can be formed with side by side arrangement of microfibrils. In addition, beside CesA, various proteins like the KORRIGAN, sucrose synthase, cytoskeletal components, and COBRA-like proteins have been involved in cellulose biosynthesis. Understanding the mechanisms of cellulose biosynthesis is of great importance not only for improving wood production in economically important forest trees to mankind but also for plant development. This review article covers the current knowledge about the cellulose biosynthesis-related gene family.

  11. Characterization of Cellulose Synthesis in Plant Cells

    Science.gov (United States)

    Maleki, Samaneh Sadat; Mohammadi, Kourosh; Ji, Kong-shu

    2016-01-01

    Cellulose is the most significant structural component of plant cell wall. Cellulose, polysaccharide containing repeated unbranched β (1-4) D-glucose units, is synthesized at the plasma membrane by the cellulose synthase complex (CSC) from bacteria to plants. The CSC is involved in biosynthesis of cellulose microfibrils containing 18 cellulose synthase (CesA) proteins. Macrofibrils can be formed with side by side arrangement of microfibrils. In addition, beside CesA, various proteins like the KORRIGAN, sucrose synthase, cytoskeletal components, and COBRA-like proteins have been involved in cellulose biosynthesis. Understanding the mechanisms of cellulose biosynthesis is of great importance not only for improving wood production in economically important forest trees to mankind but also for plant development. This review article covers the current knowledge about the cellulose biosynthesis-related gene family. PMID:27314060

  12. On characterization of anisotropic plant protein structures

    NARCIS (Netherlands)

    Krintiras, G.A.; Göbel, J.; Bouwman, W.G.; Goot, van der A.J.; Stefanidis, G.D.

    2014-01-01

    In this paper, a set of complementary techniques was used to characterize surface and bulk structures of an anisotropic Soy Protein Isolate (SPI)–vital wheat gluten blend after it was subjected to heat and simple shear flow in a Couette Cell. The structured biopolymer blend can form a basis for a

  13. Preservation of competence and cooperation with universities. Initiatives of German nuclear power plant operators to further know-how and competence preservation

    International Nuclear Information System (INIS)

    Seidel, Andre; Mohrbach, Ludger

    2009-01-01

    Nuclear power plants and nuclear technology offer graduates of technical and scientific university disciplines ambitious challenges in an attractive working environment. Irrespective of the politically motivated opt-out of the peaceful use of nuclear power in Germany, nuclear industry will continue to need motivated and committed young scientists and engineers for the next few decades. They contribute to the success of nuclear power plant operators, manufacturers, and consulting institutions. German nuclear power plant operators promote institutions of learning and research focusing on nuclear topics by means of a coordinated initiative. In this way, they contribute to preserving competence, attracting young scientists and engineers, and expanding research and development in Germany beyond the confines of specific topics. VGB PowerTech e.V. (VGB) supports operators in organizing these activities also by establishing subject-related working parties as a platform for exchanging information and harmonizing specific measures. (orig.)

  14. Chromatography in characterization of polysaccharides from medicinal plants and fungi.

    Science.gov (United States)

    Hu, De-jun; Cheong, Kit-leong; Zhao, Jing; Li, Shao-ping

    2013-01-01

    Polysaccharides isolated from medicinal plants and fungi exhibit multiple pharmacological activities. The biological activities of polysaccharides depend on their chemical characteristics. However, characterization of polysaccahrides is a challenge because of their complicated structure and macromolecular mass. In this review, chromatography in characterization of polysaccharides, including physicochemical characterization (purity, molecular mass, and distribution), structural characterization (constituent monosaccharide composition and the ratio, the features of glycosidic linkages), and fingerprint of polysaccharides (acidic and enzymatic hydrolysates), from medicinal plants and fungi were reviewed and discussed according to the publications collected in Web of Science since 2007. The perspective for characterization of polysaccharides has also been described. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Isolation and characterization of Tn917lac-generated competence mutants of Bacillus subtilis

    International Nuclear Information System (INIS)

    Hahn, J.; Albano, M.; Dubnau, D.

    1987-01-01

    The authors isolated 28 mutants of Bacillus subtilis deficient in the development of competence by using the transposon Tn917lacZ as a mutagen. The mutant strains were poorly transformable with plasmid and chromosomal DNAs but were normally transducible and exhibited wild-type resistance to DNA-damaging agents. The mutations were genetically mapped, and the mutants were characterized with respect to their abilities to bind and take up radiolabeled DNA. All were defective in uptake, and some failed to bind significantly amounts of DNA. The abilities of the mutant strains to resolve into two buoyant density classes on Renografin gradients were studied. Most resolved normally, but several banded in Renografin only at the buoyant density of noncompetent cells. The genetic mapping studies and the other analyses suggested that the mutations define a minimum of seven distinct com genes

  16. Wildflower Plantings Do Not Compete With Neighboring Almond Orchards for Pollinator Visits.

    Science.gov (United States)

    Lundin, Ola; Ward, Kimiora L; Artz, Derek R; Boyle, Natalie K; Pitts-Singer, Theresa L; Williams, Neal M

    2017-06-01

    The engineering of flowering agricultural field borders has emerged as a research and policy priority to mitigate threats to pollinators. Studies have, however, rarely addressed the potential that flowering field borders might compete with neighboring crops for pollinator visits if they both are in bloom at the same time, despite this being a concern expressed by growers. We evaluated how wildflower plantings added to orchard borders in a large (512 ha) commercial almond orchard affected honey bee and wild bee visitation to orchard borders and the crop. The study was conducted over two consecutive seasons using three large (0.48 ha) wildflower plantings paired with control orchard borders in a highly simplified agricultural landscape in California. Honey bee (Apis mellifera L.) and wild bee visitation to wildflower plots were at least an order of magnitude higher than to control plots, but increased honey bee visitation to wildflower plots did not lead to any detectable shifts in honey bee visitation to almond flowers in the neighboring orchard. Wild bees were rarely observed visiting almond flowers irrespective of border treatment, indicating a limited short-term potential for augmenting crop pollination using wild bees in highly simplified agricultural landscapes. Although further studies are warranted on bee visitation and crop yield from spatially independent orchards, this study indicates that growers can support bees with alternative forage in almond orchards without risking competition between the wildflower plantings and the crop. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Resins characterization strategy at Kozloduy Nuclear Power Plant

    International Nuclear Information System (INIS)

    Fenoy, A.; González, R.; Molleda, P.; Sánchez, L.; Herrera, J.

    2013-01-01

    The Consortium ENSA- Gas Natural Fenosa Engineering has a contract with Kozloduy Nuclear Power Plant (KNPP) for the retrieval and conditioning of the resins. Before that, the project deals with resins characterization to verify the fulfillment the Bulgarian authorities’ requirements. The project includes all the resins generated during the operation of the BACKGROUND Resins characterization strategy at Kozloduy Nuclear Power Plant units 1, 2, 3 and 4, which were stored into six big dimensions tanks: four low tanks and two intermediate tanks. They only have a manhole above for tanks access. The methodology and the progress of the work are presented

  18. Lifetime extension of nuclear power plants. Exclusive competence of the Bundestag?

    International Nuclear Information System (INIS)

    Scholz, Rupert

    2010-01-01

    With the Act on the structured phase-out of the utilisation of nuclear energy for the commercial generation of electricity (Gesetz zur geordneten Beendigung der Kernenergienutzung zur gewerblichen Erzeugung von Elektrizitaet) of 22 April 2002 (Federal Gazette I p. 1351), the ''nuclear power phase-out'' was implemented into law. Ever since then, section 7 (1a) of the Atomic Energy Act (Atomgesetz - AtG) has provided that the authorisation to operate a nuclear power plant expires once the electricity volume for the respective installation as listed in Appendix 3, column 2 or the electricity volume derived from transfers has been produced. The coalition treaty of the current government factions provides for extending the operating periods of nuclear power plants. To this end, paragraphs 1a to 1d of section 7 AtG could be repealed, thus restoring the legal status prevailing prior to the ''phase-out''. As an alternative it would be conceivable to increase the values set forth in Appendix 3 for the energy volume quantity of a given installation accordingly. Both alternatives require an amendment of the Atomic Energy Act, over which the Deutsche Bundestag has exclusive competence. This is stated in the Grundgesetz (Constitution). Such a amendment would not require the consent of the Bundesrat, since the administrative tasks assigned to the Federal States (Laender) on behalf of the Federal Government pursuant to sec. 7, 24 (2) AtG would not be changing in a qualitative sense. Consequently, it would not constitute interference with the administrative powers of the Federal States from an organizational or procedural point of view. The quantitative change in the tasks to be performed by the Federal States on behalf of the Federal Government that would accompany an extension of the operating periods would not lead to a right of consent on the part of the Bundesrat pursuant to Art. 87c of the Grundgesetz. (orig.)

  19. Thermal treatment and competing technologies for remediation of MGP (manufactured gas plant) sites

    International Nuclear Information System (INIS)

    McGowan, T.F.; Greer, B.A.; Lawless, M.

    1995-01-01

    More than 1,500 MGP (manufactured gas plant) sites exist throughout the US. Many are contaminated with coal tar from coal-fueled gas works which produced ''town gas'' from the mid-1800s through the 1950s. Virtually all old US cities have such sites. Most are in downtown areas, as they were installed for central distribution of manufactured gas. While a few sites are CERCLA/Superfund, most are not. However, the contaminants and methods used for remediation are similar to those used for Superfund cleanups of coal tar contamination from wood-treating and coke oven facilities. Clean-up of sites is triggered by property transfers and re-development as well as releases to the environment--in particular, via ground water migration. This paper describes recent experience with high capacity/low cost thermal desorption process for this waste. It also reviews competing non-thermal technology, such as bio-treatment, capping, recycling, and dig and haul. Cost data are provided for all technologies, and a case study for thermal treatment is also presented

  20. Identification and primary characterization of a plant antimicrobial ...

    African Journals Online (AJOL)

    Then an agar-overlay method using fully separated proteins on sodium dodecyl sulphate-polyacryliamide gel electrophoresis (SDS-PAGE) gels was used for initial determination and primary characterization of active putative defensins in the plant seeds. Clear and remarkable zones of inhibition in a region corresponding to ...

  1. Pressurized water reactor nuclear power plant. Environmental characterization information report

    International Nuclear Information System (INIS)

    1981-01-01

    The typical plant chosen for characterization is a 10000-MWe nameplate rating with wet-natural-draft cooling towers and modern radwaste control and processing equipment. The process, plant operating parameters, resources needed, and the environmental residuals and products associated with the power plant are presented. Annual resource usage and pollutant discharges are shown in English and metric units, assuming an annual plant capacity factor of 70%. In addition to annual quantities, the summary table gives quantities in terms of 10 12 Btu (about 293 million kWh) of electrical energy produced for comparison among energy processes. Supporting information and calculation procedures for the data are given. Thirteen environmental points of interest are discussed individually. Cost information, typical radioactive releases, and use of cooling ponds as an alternative cooling method are discussed in appendixes. A glossary and list of acronyms and abbreviations are provided

  2. Characterization of ultrafine and fine particles from CHP Plants

    Energy Technology Data Exchange (ETDEWEB)

    2009-08-15

    Samples of particles collected at CHP plants in the project 'Survey of emissions from CHP Plants' have been analysed in this project to give information on the morphology and chemical composition of individual particle size classes. The objective of this project was to characterize ultrafine and fine particles emitted to the atmosphere from Danish CHP plants. Nine CHP plants were selected in the Emission Survey Project as being representative for the different types of CHP plants operating in Denmark: 1) Three Waste-to Energy (WTE) plants. 2) Three biomass fired (BM) plants (two straw fired, one wood/saw dust fired). 3) Two gas fired (GF) plants (one natural gas, one landfill gas fired). 4) One gasoil (GO) fired plant. At the WTE and BM plants, various types of emission control systems implemented. The results from these plants represent the composition and size distribution of combustion particles that are emitted from the plants emission control systems. The measured emissions of particles from the waste-to-energy plants WTE1-3 are generally very low. The number and mass concentrations of ultrafine particles (PM{sub 0.1}) were particularly low in the flue gas from WTE2 and WTE3, where bag filters are used for the reduction of particle emissions. The EDX analysis of particles from the WTE plants indicates that the PM{sub 0.1} that penetrates the ECS at WTE can contain high fractions of metals such as Fe, Mn and Cu. The SEM analysis of particles from WTE1-3 showed that the particles were generally porous and irregular in shape. The concentrations of particles in the flue gas from the biomass plants were generally higher than found for the WTE plants. The time series results showed that periodical, high concentration peaks of PM emissions occur from BM1 and BM2. The chemical composition of the particles emitted from the three biomass plants is generally dominated by C, O and S, and to some extend also Fe and Si. A high amount of Cu was found in selected

  3. Plant Vegetative and Animal Cytoplasmic Actins Share Functional Competence for Spatial Development with Protists[W][OA

    Science.gov (United States)

    Kandasamy, Muthugapatti K.; McKinney, Elizabeth C.; Roy, Eileen; Meagher, Richard B.

    2012-01-01

    Actin is an essential multifunctional protein encoded by two distinct ancient classes of genes in animals (cytoplasmic and muscle) and plants (vegetative and reproductive). The prevailing view is that each class of actin variants is functionally distinct. However, we propose that the vegetative plant and cytoplasmic animal variants have conserved functional competence for spatial development inherited from an ancestral protist actin sequence. To test this idea, we ectopically expressed animal and protist actins in Arabidopsis thaliana double vegetative actin mutants that are dramatically altered in cell and organ morphologies. We found that expression of cytoplasmic actins from humans and even a highly divergent invertebrate Ciona intestinalis qualitatively and quantitatively suppressed the root cell polarity and organ defects of act8 act7 mutants and moderately suppressed the root-hairless phenotype of act2 act8 mutants. By contrast, human muscle actins were unable to support prominently any aspect of plant development. Furthermore, actins from three protists representing Choanozoa, Archamoeba, and green algae efficiently suppressed all the phenotypes of both the plant mutants. Remarkably, these data imply that actin’s competence to carry out a complex suite of processes essential for multicellular development was already fully developed in single-celled protists and evolved nonprogressively from protists to plants and animals. PMID:22589468

  4. Entrepreneurial competence in agriculture : characterization, identification, development and the role of the work environment

    NARCIS (Netherlands)

    Lans, T.

    2009-01-01

    In the last few decades, primary agricultural production in the Netherlands has been
    significantly influenced by firm expansion, innovation and diversification. These
    developments suggest that, increasingly, farmers and growers require entrepreneurial
    competence to continuously

  5. Characterization of competence and biofilm development of a Streptococcus sanguinis endocarditis isolate.

    Science.gov (United States)

    Zhu, L; Zhang, Y; Fan, J; Herzberg, M C; Kreth, J

    2011-04-01

    Streptococcus sanguinis is an oral commensal bacterium and endogenous pathogen in the blood, which is generally naturally competent to take up extracellular DNA. Regarded as a stress response, competence development enables S. sanguinis to acquire new genetic material. The sequenced reference strain SK36 encodes and expresses the genes required for competence (com) and uptake of DNA. Isolated from blood cultures of a confirmed case of infective endocarditis, strain 133-79 encodes all necessary com genes but is not transformable under conditions permissive for competence development in SK36. Using synthetic competence-stimulating peptides (sCSP) based on sequences of SK36 and 133-79 comC, both strains developed competence at similar frequencies in cross-transformation experiments. Furthermore, downstream response pathways are similar in strains SK36 and 133-79 because platelet aggregation and biofilm formation appeared unaffected by CSP. Collectively, the data indicate that strains SK36 and 133-79 respond to CSP similarly, strongly suggesting that endogenous production or release of CSP from 133-79 is impaired. © 2011 John Wiley & Sons A/S.

  6. Characterization of competence and biofilm development of a Streptocccus sanguinis endocarditis isolate

    Science.gov (United States)

    Zhu, Lin; Zhang, Yongshu; Fan, Jingyuan; Herzberg, Mark C.; Kreth, Jens

    2010-01-01

    Streptococcus sanguinis is an oral commensal bacterium and endogenous pathogen in the blood, which generally is naturally competent to take up extracellular DNA. Regarded as a stress response, competence development enables S. sanguinis to acquire new genetic material. The sequenced reference strain SK36 encodes and expresses the genes required for competence (com) and uptake of DNA. Isolated from blood cultures of a confirmed case of infective endocarditis, strain 133–79 encodes all necessary com genes but is not transformable under conditions permissive for competence development in SK36. Using synthetic competence-stimulating peptides (sCSP) based on sequences of SK36 and 133–79 comC, both strains developed competence at similar frequencies in cross-transformation experiments. Furthermore, downstream response pathways are similar in strains SK36 and 133–79 since platelet aggregation and biofilm formation appeared unaffected by CSP. Collectively, the data indicate that strains SK36 and 133–79 respond to CSP similarly, strongly suggesting that endogenous production or release of CSP from 133–79 is impaired. PMID:21375702

  7. Omnivore-herbivore interactions: thrips and whiteflies compete via the shared host plant.

    Science.gov (United States)

    Pappas, Maria L; Tavlaki, Georgia; Triantafyllou, Anneta; Broufas, George

    2018-03-05

    Phytophagy is a common feature among pure herbivorous insects and omnivores that utilise both plant and prey as food resources; nevertheless, experimental evidence for factors affecting their interactions is restricted to intraguild predation and predator-mediated competition. We herein focused on plant-mediated effects that could result from plant defence activation or quality alteration and compared the performance of an omnivore, the western flower thrips Frankliniella occidentalis, and a pure herbivore, the greenhouse whitefly Trialeurodes vaporariorum, on cucumber plants previously infested with either species. Furthermore, we recorded their behavioural responses when given a choice among infested and clean plants. Whiteflies laid less eggs on plants previously exposed to thrips but more on whitefly-infested plants. Thrips survival was negatively affected on whitefly-infested than on thrips-infested or clean plants. Notably, whiteflies developed significantly faster on plants infested with conspecifics. In accordance, whiteflies avoided thrips-infested plants and preferred whitefly-infested over clean plants. Thrips showed no preference for either infested or clean plants. Our study is a first report on the role of plant-mediated effects in shaping omnivore-herbivore interactions. Considering the factors driving such interactions we will likely better understand the ecology of the more complex relationships among plants and pest organisms.

  8. Characterizing radionuclides in the B Plant HEPA filters

    International Nuclear Information System (INIS)

    Roege, P.E.

    1998-01-01

    B Plant was built during World War II to separate plutonium for nuclear weapons from reactor fuel. Later, the plant was re-equipped and used to separate radioactive fission products from the Hanford Site's nuclear processing waste tanks. The facility is now being deactivated: eliminating, stabilizing, and documenting existing hazards to allow safe surveillance and maintenance pending a final disposition which is yet to be determined. The processing areas of the plant, including process cells and exhaust air system, are heavily contaminated with radioactive cesium and strontium from the tank waste separation process. However, detailed characterization is difficult because many of these areas are inaccessible because of physical barriers and high radiological dose rates. The five existing canyon high efficiency particulate air (HEPA) filters were thought to contain a significant fraction of the inventory, but estimates were highly uncertain. This paper describes the process used to inspect and characterize the radionuclide content in one of these filters. The investigation required a collaborative effort among field and technical personnel. Sophisticated computer modeling and detector technologies were employed in conjunction with sound radiological control and field work practices. The outcome of the effort was a considerable reduction in the filter inventory estimate, accompanied by a greatly improved level of confidence in the data. The information derived from this project will provide a sound basis for future decisions regarding filter disposition

  9. Insight into Biochemical Characterization of Plant Sesquiterpene Synthases

    DEFF Research Database (Denmark)

    Manczak, Tom; Simonsen, Henrik Toft

    2016-01-01

    A fast and reproducible protocol was established for enzymatic characterization of plant sesquiterpene synthases that can incorporate radioactivity in their products. The method utilizes the 96-well format in conjunction with cluster tubes and enables processing of >200 samples a day. Along...... with reduced reagent usage, it allows further reduction in the use of radioactive isotopes and flammable organic solvents. The sesquiterpene synthases previously characterized were expressed in yeast, and the plant-derived Thapsia garganica kunzeaol synthase TgTPS2 was tested in this method. KM for TgTPS2...... was found to be 0.55 μM; the turnover number, kcat, was found to be 0.29 s-1, kcat for TgTPS2 is in agreement with that of terpene synthases of other plants, and kcat/KM was found to be 0.53 s-1 μM-1 for TgTPS2. The kinetic parameters were in agreement with previously published data....

  10. Effects of a Research-Infused Botanical Curriculum on Undergraduates’ Content Knowledge, STEM Competencies, and Attitudes toward Plant Sciences

    Science.gov (United States)

    Clarke, H. David; Horton, Jonathan L.

    2014-01-01

    In response to the American Association for the Advancement of Science's Vision and Change in Undergraduate Biology Education initiative, we infused authentic, plant-based research into majors’ courses at a public liberal arts university. Faculty members designed a financially sustainable pedagogical approach, utilizing vertically integrated curricular modules based on undergraduate researchers’ field and laboratory projects. Our goals were to 1) teach botanical concepts, from cells to ecosystems; 2) strengthen competencies in statistical analysis and scientific writing; 3) pique plant science interest; and 4) allow all undergraduates to contribute to genuine research. Our series of inquiry-centered exercises mitigated potential faculty barriers to adopting research-rich curricula, facilitating teaching/research balance by gathering publishable scholarly data during laboratory class periods. Student competencies were assessed with pre- and postcourse quizzes and rubric-graded papers, and attitudes were evaluated with pre- and postcourse surveys. Our revised curriculum increased students’ knowledge and awareness of plant science topics, improved scientific writing, enhanced statistical knowledge, and boosted interest in conducting research. More than 300 classroom students have participated in our program, and data generated from these modules’ assessment allowed faculty and students to present 28 contributed talks or posters and publish three papers in 4 yr. Future steps include analyzing the effects of repeated module exposure on student learning and creating a regional consortium to increase our project's pedagogical impact. PMID:25185223

  11. Characterization of some plant extracts by GC-MS

    International Nuclear Information System (INIS)

    Iordache, A.; Culea, M.; Gherman, C.; Cozar, O.

    2009-01-01

    Different types of herbs often used in pharmaceutical, cosmetic and food industry were extracted and then analyzed by gas chromatography and gas chromatography-mass spectrometry. The method validation parameters showed good linearity, precision and recovery for a standard mixture. Herbs from different zones of Romania were studied: melissa (Melissa officinalis), nettle (Urtica dioica, Lamium album), camomile (Matricaria chamomilla). The study was applied for fingerprint chromatograms to characterize the flavors extracted from herb plants of different sources. The identity and quantity of the measured active compounds was correlated with the expected therapeutic effects. The active principles content was determined for the same herb, and different amounts of the active principles were determined for plants of different origin.

  12. Characterization of some plant extracts by GC-MS

    Energy Technology Data Exchange (ETDEWEB)

    Iordache, A. [' Babes-Bolyai' University, Str. M. Kogalniceanu, Nr. 1, Cluj-Napoca 400084 (Romania)], E-mail: andres_iro2002@yahoo.com; Culea, M.; Gherman, C.; Cozar, O. [' Babes-Bolyai' University, Str. M. Kogalniceanu, Nr. 1, Cluj-Napoca 400084 (Romania)

    2009-01-15

    Different types of herbs often used in pharmaceutical, cosmetic and food industry were extracted and then analyzed by gas chromatography and gas chromatography-mass spectrometry. The method validation parameters showed good linearity, precision and recovery for a standard mixture. Herbs from different zones of Romania were studied: melissa (Melissa officinalis), nettle (Urtica dioica, Lamium album), camomile (Matricaria chamomilla). The study was applied for fingerprint chromatograms to characterize the flavors extracted from herb plants of different sources. The identity and quantity of the measured active compounds was correlated with the expected therapeutic effects. The active principles content was determined for the same herb, and different amounts of the active principles were determined for plants of different origin.

  13. Characterization of process air emissions in automotive production plants.

    Science.gov (United States)

    D'Arcy, J B; Dasch, J M; Gundrum, A B; Rivera, J L; Johnson, J H; Carlson, D H; Sutherland, J W

    2016-01-01

    During manufacturing, particles produced from industrial processes become airborne. These airborne emissions represent a challenge from an industrial hygiene and environmental standpoint. A study was undertaken to characterize the particles associated with a variety of manufacturing processes found in the auto industry. Air particulates were collected in five automotive plants covering ten manufacturing processes in the areas of casting, machining, heat treatment and assembly. Collection procedures provided information on air concentration, size distribution, and chemical composition of the airborne particulate matter for each process and insight into the physical and chemical processes that created those particles.

  14. Phytochemical evaluation and molecular characterization of some important medicinal plants

    Directory of Open Access Journals (Sweden)

    Varahalarao Vadlapudi

    2012-05-01

    Full Text Available Objective: Phytochemical evaluation and molecular characterization of plants is an important task in medicinal botany and drug discovery. In the current study, Ocimum species, Pimenta officinalis and Piper betel were considered as medicinal plants by evaluation of phytochemical composition like phenol content, Flavonoid content, antioxidant content and other activities like antibacterial, antifungal, lethal dosage (LD 50 of the plant extracts. Among the selected plants P. officinalis shown higher medicinal properties and is selected for molecular characterization. Methods: Antimicrobial activity by agar well diffusion method and also estimated Total phenols, flavonoids content, Total Antioxidants, Cytotoxic assay on Artemia salina for determining lethal dosage (LD50, matK gene was sequenced by using ABI Prism 3700. Leaf extract of P. officinalis plant is further selected for GC-chromatographic analysis to know its chemical composition. DNA was isolated by different protocols, optimized, and is used for the PCR amplification of trnL-gene which is a universal marker among plants in molecular taxonomy. The trnL-gene is amplified by using PCR. The product obtained from PCR is purified and the sample is used for sequencing so that it can be used for comparative studies. Results: P.offcinalis has shown good antimicrobial activity against all organisms . A. flavus is resistant against O. sanctum (B. Phenolic content (26.5 毺 g/g is found to be rich in P. betel where as flavonoid and Antioxidant content are significant in P. betel. The chromatogram revealed the presence of high concentration of Eugenol in the leaf sample. On submitting to BLASTN, the genetic sequence has found similarity with Pimenta dioica plastid partial matK gene and Ugni molinae trnK gene. MatK did not shown any interactions with trnK or trnL genes. MatK has shown interactions with various genes like ycf5, pclpp, psbh, atph, NDVI, rpoc1, ndha, ndhd, psai. Conclusions: we can

  15. Characterization recommendations for waste sites at the Savannah River Plant

    International Nuclear Information System (INIS)

    Carlton, W.H.; Gordon, D.E.; Johnson, W.F.; Kaback, D.S.; Looney, B.B.; Nichols, R.L.; Shedrow, C.B.

    1987-11-01

    One hundred and sixty six disposal facilities that received or may have received waste materials resulting from operations at the Savannah River Plant (SRP) have been identified. These waste range from innocuous solid and liquid materials (e.g., wood piles) to process effluents that contain hazardous and/or radioactive constituents. The waste sites have been grouped into 45 categories according the the type of waste materials they received. Waste sites are located with SRP coordinates, a local Department of Energy (DOE) grid system whose grid north is 36 degrees 22 minutes west of true north. DOE policy is to close all waste sites at SRP in a manner consistent with protecting human health and environment and complying with applicable environmental regulations (DOE 1984). A uniform, explicit characterization program for SRP waste sites will provide a sound technical basis for developing closure plans. Several elements are summarized in the following individual sections including (1) a review of the history, geohydrology, and available characterization data for each waste site and (2) recommendations for additional characterization necessary to prepare a reasonable closure plan. Many waste sites have been fully characterized, while others have not been investigated at all. The approach used in this report is to evaluate available groundwater quality and site history data. For example, groundwater data are compared to review criteria to help determine what additional information is required. The review criteria are based on regulatory and DOE guidelines for acceptable concentrations of constituents in groundwater and soil

  16. ISOLATION AND CHARACTERIZATION OF COML, A TRANSCRIPTION UNIT INVOLVED IN COMPETENCE DEVELOPMENT OF BACILLUS-SUBTILIS

    NARCIS (Netherlands)

    VANSINDEREN, D; WITHOFF, S; BOELS, H; VENEMA, G

    1990-01-01

    Using the transformation-deficient mutant M465, which was previously isolated by means of insertional mutagenesis with plasmid pHV60, a transcription unit comL required for genetic competence of Bacillus subtilis was identified. A chromosomal DNA fragment flanking the inserted pHV60 was isolated and

  17. Synthesis and characterization of nanoparticles capped with medicinal plant extracts

    Science.gov (United States)

    Rekulapally, Sujith R.

    In this study, synthesis, characterization and biological application of series nanometal (silver, Ag) and nanometal oxide (titania, TiO2) were carried out. These nanomaterials were prepared using wet-chemistry method and then coated using natural plant extract. Three medicinal plants, namely Zingiber officinale (Ginger), Allium sativum (Garlic) and Capsicum annuum (Chili) were chosen as grafting agent to decrease the side-effects and increase the efficiency of NPs towards living organism. Extraction conditions were controlled under 60-100 °C for 8 hrs. Ag and TiO2 NPs were fabricated using colloidal chemistry and variables were controlled at ambient condition. The band gap of TiO2 NPs used as disinfectant was also modified through coating the medicinal plant extracts. The medicinal plant extracts and coated NPs were measured using spectroscopic methods. Ultraviolet-visible spectra indicated the Ag NPs were formed. The peak at 410 nm resulted from the electrons transferred from their ground to the excited state. The broadened full width at half maximum (FWHM) suggested the ultrafine particles were obtained. The lipid soluble compounds, phenols, tri-terpenoids, flavanoids, capsaicinoids, flavonoids, carotenoids, steroids steroidal glycosides, and vitamins were determined from the high performance liquid chromatographical analyses. X-ray powder diffraction indicated that the face-centered cubic Ag (PDF: 00-004-0783, a = 4.0862A, a = 90°) and anatase TiO2 (PDF: 01-08-1285, a = 3.7845, c = 9.5143A, a = 90°) were obtained using colloidal chemistry. Bactericidal activity indicated that these core-shelled TiO 2 were effective (MBC=0.6 ppm, within 30 mins) at inactivating Gram-positive and Gram-negative bacteria. It is proposed that the medicinal extracts enhanced the potency of NPs against bacteria. From our previous study, the Ag NPs were highly effective at inactivating both bacteria.

  18. Analytical characterization of contaminated soils from former manufactured gas plants

    International Nuclear Information System (INIS)

    Haeseler, F.; Blanchet, D.; Vandecasteele, J.P.; Druelle, V.; Werner, P.; Technische Univ., Dresden,

    1999-01-01

    Detailed analytical characterization of the organic matter (OM) of aged polluted soils from five former manufactured gas plants (MGP) and of two coal tars was completed. It was aimed at obtaining information relevant to the physicochemical state of the polycyclic aromatic hydrocarbon (PAH) pollutants and to their in-situ evolution in time. Overall characterization of total OM (essentially polluting OM) was carried out directly on soil samples with or without prior extraction with solvent. It involved a technique of pyrolysis/oxidation coupled to flame ionization/thermal conductivity detection. Extracts in solvent were fractionated by liquid chromatography into saturated hydrocarbons, PAH, and resins, the first two fractions being further characterized by gas chromatography and mass spectrometry. The compositions of OM of soils were found to be very similar. A total of 28% of organic carbon, including all PAH, was extractable by solvent. The compositions of coal tars were qualitatively similar to those of OM of MGP soils but with a higher proportion (48%) of total extractable OM and of PAH, in particular lower PAH. Contamination of MGP soils appeared essentially as coal tar having undergone natural attenuation. The constant association of PAH with heavy OM in MGP soils is important with respect to the mobility and bioaccessibility of these pollutants

  19. Biochemical and Molecular Characterization of Plant-Parasitic Nematodes

    Directory of Open Access Journals (Sweden)

    I.M. de O. Abrantes

    2004-08-01

    Full Text Available Nematologists need correct species identification to carry out research, teaching, extension and other activities. Therefore, nematode taxonomy must be pursued diligently at all levels. The identification of plant-parasitic nematodes is not always easy and that of some species is especially difficult. Most of the information that nematologists use when characterizing and identifying specimens is based on morphological and morphometrical characters. Although these characters are of primary importance, in the last three decades they have been supplemented by biochemical/ molecular characters. Biochemical approaches include the separation of proteins (general proteins and isozymes by one-dimensional gel electrophoresis, isoelectric focusing, two-dimensional gel electrophoresis, and sodium dodecyl sulphate-capillary gel electrophoresis. Serology has also been found effective in the identification and quantification of nematodes, monoclonal antibodies being a more useful immunological tool than polyclonal antibodies. Identification based on the direct examination of DNA is potentially a more powerful method to characterize inter- and intra-specific variability. The development of techniques such as the polymerase chain reaction, restriction fragment length polymorphism, randomly amplified polymorphic DNA, and amplified fragment length polymorphism has increased the accuracy and speed of nematode characterization/identification. Progress continues to be made and more and more nematologists are using molecular techniques for diagnostic purposes and to assess genetic variation.

  20. Effects of a research-infused botanical curriculum on undergraduates' content knowledge, STEM competencies, and attitudes toward plant sciences.

    Science.gov (United States)

    Ward, Jennifer Rhode; Clarke, H David; Horton, Jonathan L

    2014-01-01

    In response to the American Association for the Advancement of Science's Vision and Change in Undergraduate Biology Education initiative, we infused authentic, plant-based research into majors' courses at a public liberal arts university. Faculty members designed a financially sustainable pedagogical approach, utilizing vertically integrated curricular modules based on undergraduate researchers' field and laboratory projects. Our goals were to 1) teach botanical concepts, from cells to ecosystems; 2) strengthen competencies in statistical analysis and scientific writing; 3) pique plant science interest; and 4) allow all undergraduates to contribute to genuine research. Our series of inquiry-centered exercises mitigated potential faculty barriers to adopting research-rich curricula, facilitating teaching/research balance by gathering publishable scholarly data during laboratory class periods. Student competencies were assessed with pre- and postcourse quizzes and rubric-graded papers, and attitudes were evaluated with pre- and postcourse surveys. Our revised curriculum increased students' knowledge and awareness of plant science topics, improved scientific writing, enhanced statistical knowledge, and boosted interest in conducting research. More than 300 classroom students have participated in our program, and data generated from these modules' assessment allowed faculty and students to present 28 contributed talks or posters and publish three papers in 4 yr. Future steps include analyzing the effects of repeated module exposure on student learning and creating a regional consortium to increase our project's pedagogical impact. © 2014 J. R. Ward et al. CBE—Life Sciences Education © 2014 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http

  1. CHARACTERIZATION OF CADMIUM UPTAKE BY ROOTS OF DURUM WHEAT PLANTS

    Directory of Open Access Journals (Sweden)

    Lyubka Koleva

    2009-03-01

    Full Text Available Root Cd uptake of durum wheat plants (cv. Beloslava was characterized in hydroponics conditions. The uptake experiments have been performed in Cd concentration range of 0 – 2 μM adjusted by both stable Cd and radiolabeled (109Cd tracer. Cd removal from the solution over duration of 1 hour reached 50%. The part of loosely adsorbed Cd ions on root surface accounted for about 20%. Over 30% of absorbed Cd at 0.5 μM Cd treatment was retained in root cell walls. The apparent root Cd accumulation showed concentration-dependant tendency with the highest accumulation value of 7.45 nmol Cd g FW-1.

  2. Socioeconomic baseline characterization for the Savannah River Plant area

    Energy Technology Data Exchange (ETDEWEB)

    1981-09-01

    This report presents the social and economic characteristics of the environs of the Savannah River Plant (SRP). The characterization is keyed to those areas of the social and economic environment that could be impacted by the construction and operation of major facilities at SRP. The data consists of past trends and existing characteristics of the area's land use; its demographic, social, and economic profile; regional government; community services; housing, transportation; and historical, scenic, and archeological resources. Published documents, reports, and brochures were the primary sources of all the data presented in this document. When current published data was unavailable, representatives of federal, state, and local agencies were contacted by telephone. Conversations were followed by letters of verification, which were reviewed and verified by the agency representative.

  3. Socioeconomic baseline characterization for the Savannah River Plant area

    International Nuclear Information System (INIS)

    1981-09-01

    This report presents the social and economic characteristics of the environs of the Savannah River Plant (SRP). The characterization is keyed to those areas of the social and economic environment that could be impacted by the construction and operation of major facilities at SRP. The data consists of past trends and existing characteristics of the area's land use; its demographic, social, and economic profile; regional government; community services; housing, transportation; and historical, scenic, and archeological resources. Published documents, reports, and brochures were the primary sources of all the data presented in this document. When current published data was unavailable, representatives of federal, state, and local agencies were contacted by telephone. Conversations were followed by letters of verification, which were reviewed and verified by the agency representative

  4. Identification, Characterization, and Palynology of High-Valued Medicinal Plants

    Directory of Open Access Journals (Sweden)

    Hina Fazal

    2013-01-01

    Full Text Available High-valued medicinal plants Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina, and Vetiveria zizanioides were identified with the help of taxonomical markers and investigated for characterization and palynological studies. These parameters are used to analyze their quality, safety, and standardization for their safe use. Botanical description and crude drug description is intended for their quality assurance at the time of collection, commerce stages, manufacturing, and production. For this purpose the detailed morphology was studied and compared with the Flora of Pakistan and other available literatures. Here we reported the pollen grain morphology of Origanum vulgare, Paeonia emodi, Psoralea corylifolia, and Rauwolfia serpentina for the first time. Similarly the crude drug study of Gymnema sylvestre (leaf, Origanum vulgare (aerial parts, Paeonia emodi (tubers, and Peganum harmala (seeds was also carried out for the first time.

  5. Identification, characterization, and palynology of high-valued medicinal plants.

    Science.gov (United States)

    Fazal, Hina; Ahmad, Nisar; Haider Abbasi, Bilal

    2013-01-01

    High-valued medicinal plants Achillea millefolium, Acorus calamus, Arnebia nobilis, Fumaria indica, Gymnema sylvestre, Origanum vulgare, Paeonia emodi, Peganum harmala, Psoralea corylifolia, Rauwolfia serpentina, and Vetiveria zizanioides were identified with the help of taxonomical markers and investigated for characterization and palynological studies. These parameters are used to analyze their quality, safety, and standardization for their safe use. Botanical description and crude drug description is intended for their quality assurance at the time of collection, commerce stages, manufacturing, and production. For this purpose the detailed morphology was studied and compared with the Flora of Pakistan and other available literatures. Here we reported the pollen grain morphology of Origanum vulgare, Paeonia emodi, Psoralea corylifolia, and Rauwolfia serpentina for the first time. Similarly the crude drug study of Gymnema sylvestre (leaf), Origanum vulgare (aerial parts), Paeonia emodi (tubers), and Peganum harmala (seeds) was also carried out for the first time.

  6. Competence is Competence

    DEFF Research Database (Denmark)

    Bramming, Pia

    2004-01-01

    The article will address competence, its' diffusion, application, and the consequence of this application within the field of Human Resource Management (HRM). The concept competence-in-practice will be presented and in conclusion the article will consider implications and possibilities...... of competence-in-practice as an alternative approach to Competence Development within Human Resource Management....

  7. Native plants ( and extracts act as antioxidants to support developmental competence of bovine blastocysts

    Directory of Open Access Journals (Sweden)

    Geon-Yeop Do

    2017-09-01

    Full Text Available Objective Phellodendron amurense (P. amurense and Humulus japonicus (H. japonicus are closely involved in anti-oxidative response and increasing antioxidant enzymes activities. However, the effects of their extracts on development of preimplantation bovine embryos have not been investigated. Therefore, we investigated the effects of P. amurense and H. japonicus extracts on developmental competence and quality of preimplantation bovine embryos. Methods After in vitro fertilization, bovine embryos were cultured for 7 days in Charles Rosenkrans amino acid medium supplemented with P. amurense (0.01 μg/mL and H. japonicus (0.01 μg/mL. The effect of this supplementation during in vitro culture on development competence and antioxidant was investigated. Results We observed that the blastocysts rate was significantly increased (p<0.05 in P. amurense (28.9%±2.9%, H. japonicus (30.9%±1.5%, and a mixture of P. amurense and H. japonicus (34.8%± 2.1% treated groups compared with the control group (25.4%±1.6%. We next confirmed that the intracellular levels of reactive oxygen species (ROS were significantly decreased (p<0.01 in P. amurense and/or H. japonicus extract treated groups when compared with the control group. Our results also showed that expression of cleaved caspase-3 and apoptotic cells of blastocysts were significantly decreased (p<0.05 in bovine blastocysts derived from both P. amurense and H. japonicus extract treated embryos. Conclusion These results suggest that proper treatment with P. amurense and H. japonicus extracts in the development of preimplantation bovine embryos improves the quality of blastocysts, which may be related to the reduction of ROS level and apoptosis.

  8. Characterization of NORM material produced in a water treatment plant

    Energy Technology Data Exchange (ETDEWEB)

    Suursoo, S.; Kiisk, M.; Jantsikene, A.; Koch, R.; Isakar, K.; Realo, E. [University of Tartu, Institute of Physics (Estonia); Lumiste, L. [Tallinn University of Technology (Estonia)

    2014-07-01

    In February 2012 a water treatment plant was opened in Viimsi, Estonia. The plant is designed for removal of iron, manganese, and radium from groundwater. The first 2 years of operation have shown that the purification process generates significant amounts of materials with elevated radium levels. The treatment plant is fed by nine wells, which open to radium-rich aquifers. Purification is achieved by aeration and filtration processes. Aerated water is led through two successive filter columns, first of them is filled with MnO{sub 2} coated material FMH and filtration sand, the second one with zeolite. The plant has five parallel treatment lines with a total of 95 tons of FMH + filtration sand, and 45 tons of zeolite. The average capacity of the facility has been 2400 m{sup 3}/day. Yearly input of radium to the plant is estimated to be 325 MBq for Ra-226, and 420 MBq for Ra-228. Most of the radium (about 90%) accumulates in the filter columns. Some 8-9% of it is removed by backwash water during regular filter backwash cycles. To characterize radium accumulation and its removal by backwash in detail, treatment line no. 5 is sampled monthly for filter materials and backwash water. A steady growth of radium activity concentrations is apparent in both filter materials. In the top layer of the first stage filter (FMH+sand), Ra-226 and Ra-228 activity concentrations (per unit dry weight) reached (1540 ± 60) Bq/kg and (2510 ± 50) Bq/kg (k=2), respectively, by April 2013. At the same time, radium content in the top layer of the second stage filter (zeolite) was an order of magnitude higher: (19 600 ± 130) Bq/kg for Ra-226, and (22 260 ± 170) Bq/kg for Ra-228 (k=2). Radium is not evenly distributed throughout the filter columns. A rough estimate can be given that after 1.25 years of operation (by April 2013) the accumulated activities in treatment line no. 5 reached 1000 MBq for Ra-226 and 1200 MBq for Ra-228. Although filters are the most important type of NORM

  9. Do rice water weevils and rice stem borers compete when sharing a host plant?

    Science.gov (United States)

    Shi, Sheng-Wei; He, Yan; Ji, Xiang-Hua; Jiang, Ming-Xing; Cheng, Jia-An

    2008-07-01

    The rice water weevil (RWW) Lissorhoptrus oryzophilus Kuschel (Coleoptera: Curculionidae) is an invasive insect pest of rice Oryza sativa L. in China. Little is known about the interactions of this weevil with indigenous herbivores. In the present study, adult feeding and population density of the weevil, injury level of striped stem borer Chilo suppressalis (Walker) (Lepidoptera: Pyralidae) and pink stem borer Sesamia inferens (Walker) (Lepidoptera: Noctuidae) to rice, as well as growth status of their host plants were surveyed in a rice field located in Southeastern Zhejiang, China, in 2004 with the objective to discover interspecific interactions on the rice. At tillering stage, both adult feeding of the weevil and injury of the stem borers tended to occur on larger tillers (bearing 5 leaves) compared with small tillers (bearing 2~4 leaves), but the insects showed no evident competition with each other. At booting stage, the stem borers caused more withering/dead hearts and the weevil reached a higher density on the plants which had more productive tillers and larger root system; the number of weevils per tiller correlated negatively with the percentage of withering/dead hearts of plants in a hill. These observations indicate that interspecific interactions exist between the rice water weevil and the rice stem borers with negative relations occurring at booting or earlier developmental stages of rice.

  10. Do rice water weevils and rice stem borers compete when sharing a host plant?*

    Science.gov (United States)

    Shi, Sheng-wei; He, Yan; Ji, Xiang-hua; Jiang, Ming-xing; Cheng, Jia-an

    2008-01-01

    The rice water weevil (RWW) Lissorhoptrus oryzophilus Kuschel (Coleoptera: Curculionidae) is an invasive insect pest of rice Oryza sativa L. in China. Little is known about the interactions of this weevil with indigenous herbivores. In the present study, adult feeding and population density of the weevil, injury level of striped stem borer Chilo suppressalis (Walker) (Lepidoptera: Pyralidae) and pink stem borer Sesamia inferens (Walker) (Lepidoptera: Noctuidae) to rice, as well as growth status of their host plants were surveyed in a rice field located in Southeastern Zhejiang, China, in 2004 with the objective to discover interspecific interactions on the rice. At tillering stage, both adult feeding of the weevil and injury of the stem borers tended to occur on larger tillers (bearing 5 leaves) compared with small tillers (bearing 2~4 leaves), but the insects showed no evident competition with each other. At booting stage, the stem borers caused more withering/dead hearts and the weevil reached a higher density on the plants which had more productive tillers and larger root system; the number of weevils per tiller correlated negatively with the percentage of withering/dead hearts of plants in a hill. These observations indicate that interspecific interactions exist between the rice water weevil and the rice stem borers with negative relations occurring at booting or earlier developmental stages of rice. PMID:18600788

  11. Molecular characterization of a novel cryptic virus infecting pigeonpea plants.

    Directory of Open Access Journals (Sweden)

    Surender Kumar

    Full Text Available A new member of the genus Deltapartitivirus was identified containing three dsRNAs with an estimated size of 1.71, 1.49 and 1.43 kb. The dsRNAs were extracted from symptomless pigeonpea [Cajanus cajan (L. Millspaugh] plants cv. Erra Kandulu. This new virus with 4.64 kb genome was tentatively named Arhar cryptic virus-1 (ArCV-1. The genomic RNAs were amplified and characterized by sequence independent single primer amplification. The dsRNAs shared a highly conserved 16 nt 5' non-coding region (5'-GATAATGATCCAAGGA-3'. The largest dsRNA (dsRNA-1 was identified as the viral RNA dependent RNA polymerase (replicase, predicted to encode a putative 55.34 kDa protein (P1. The two other smaller dsRNAs (dsRNA-2 and dsRNA-3 predicted to encode for putative capsid proteins of 38.50kDa (P2 and 38.51kDa (P3, respectively. Phylogenetic analysis indicated that ArCV-1 formed a clade together with Fragaria chiloensis cryptic virus, Rosa multiflora cryptic virus and Rose cryptic virus-1, indicating that ArCV-1 could be a new member of the genus Deltapartitivirus. ArCV-1 3Dpol structure revealed several interesting features. The 3Dpol in its full-length shares structural similarities with members of the family Caliciviridaeand family Picornaviridae. In addition, fourth dsRNA molecule (dsRNA-2A, not related to ArCV-1 genome, was found in the same plant tissue. The dsRNA-2A (1.6 kb encodes a protein (P4, with a predicted size of 44.5 kDa. P4 shares similarity with coat protein genes of several cryptic viruses, in particular the bipartite cryptic viruses including Raphanus sativus cryptic virus-3. This is the first report of occurrence of a cryptic virus in pigeonpea plants.

  12. Spent fuel characterization program in Jose Cabrera nuclear power plant

    International Nuclear Information System (INIS)

    Lloret, M.; Canencia, R.; Blanco, J.; POMAR, C.

    2010-01-01

    Jose Cabrera Nuclear Power Plant (NPP) is a 14x14 PWR reactor built in 1964 in Spain (160 MWe). The commercial operation started in 1969 and finished in 2006. During year 2009, 377 fuel assemblies from cycles 11 to 29 have been stored in 12 containers HI-STORM 100, and positioned in an Interim Spent Fuel Storage Installation built near the NPP. The spent fuel characterization and classification is a critical and complex activity that could impact all the storage process. As every container has a number of positions for damaged fuel, the loading plans and the quantity of containers depends on the total fuels classified as damaged. The classification of the spent fuel in Jose Cabrera has been performed on the basis of the Interim Staff Guidance ISG-1 from USNRC, 'Damaged Fuel'. As the storage system should assure thermal limitations, criticality control, retrievability, confinement and shielding for radioactive protection, the criteria analyzed for every spent fuel have been the existence/non existence of fuel leaks; damage that could affect the criticality analysis (as missing fuel pins) and any situation that could affect the future retrievability, as defects on the top nozzle. The first classification was performed based upon existing core records. If there were no indication of operating leakers during the concerned cycles and the structural integrity was adequate, the fuel was classified as intact or undamaged. When operating records indicated a fuel leaker, an additional inspection by ultrasonic testing of all the fuel in the concerned cycle was performed to determine the fuel leakers. If the examination results indicated that the fuel has cladding cracks, it was classified as damaged fuel without considering if it was a gross breach or a hairline crack. Additionally, it was confirmed that the water chemistry specifications for spent fuel pool has been fulfilled. Finally, a visual inspection before dry cask storage was performed and foreign particles were

  13. Spent fuel characterization program in Jose Cabrera nuclear power plant

    Energy Technology Data Exchange (ETDEWEB)

    Lloret, M.; Canencia, R. [Product Engineering, Enusa Industrias Avanzadas S.A., Santiago Rusinol 12, 28040 Madrid (Spain); Blanco, J.; POMAR, C. [Direction of Nuclear Generation, Gas Natural SDG, Avda. San Luis 77, 28033 Madrid (Spain)

    2010-07-01

    Jose Cabrera Nuclear Power Plant (NPP) is a 14x14 PWR reactor built in 1964 in Spain (160 MWe). The commercial operation started in 1969 and finished in 2006. During year 2009, 377 fuel assemblies from cycles 11 to 29 have been stored in 12 containers HI-STORM 100, and positioned in an Interim Spent Fuel Storage Installation built near the NPP. The spent fuel characterization and classification is a critical and complex activity that could impact all the storage process. As every container has a number of positions for damaged fuel, the loading plans and the quantity of containers depends on the total fuels classified as damaged. The classification of the spent fuel in Jose Cabrera has been performed on the basis of the Interim Staff Guidance ISG-1 from USNRC, 'Damaged Fuel'. As the storage system should assure thermal limitations, criticality control, retrievability, confinement and shielding for radioactive protection, the criteria analyzed for every spent fuel have been the existence/non existence of fuel leaks; damage that could affect the criticality analysis (as missing fuel pins) and any situation that could affect the future retrievability, as defects on the top nozzle. The first classification was performed based upon existing core records. If there were no indication of operating leakers during the concerned cycles and the structural integrity was adequate, the fuel was classified as intact or undamaged. When operating records indicated a fuel leaker, an additional inspection by ultrasonic testing of all the fuel in the concerned cycle was performed to determine the fuel leakers. If the examination results indicated that the fuel has cladding cracks, it was classified as damaged fuel without considering if it was a gross breach or a hairline crack. Additionally, it was confirmed that the water chemistry specifications for spent fuel pool has been fulfilled. Finally, a visual inspection before dry cask storage was performed and foreign particles

  14. Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Lee, Mi-Kyung; Zhang, Yang; Zhang, Meiping; Goebel, Mark; Kim, Hee Jin; Triplett, Barbara A; Stelly, David M; Zhang, Hong-Bin

    2013-03-28

    Cotton, one of the world's leading crops, is important to the world's textile and energy industries, and is a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction of a plant-transformation-competent binary bacterial artificial chromosome (BIBAC) library and comparative genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.) with one of its diploid putative progenitor species, G. raimondii Ulbr. We constructed the cotton BIBAC library in a vector competent for high-molecular-weight DNA transformation in different plant species through either Agrobacterium or particle bombardment. The library contains 76,800 clones with an average insert size of 135 kb, providing an approximate 99% probability of obtaining at least one positive clone from the library using a single-copy probe. The quality and utility of the library were verified by identifying BIBACs containing genes important for fiber development, fiber cellulose biosynthesis, seed fatty acid metabolism, cotton-nematode interaction, and bacterial blight resistance. In order to gain an insight into the Upland cotton genome and its relationship with G. raimondii, we sequenced nearly 10,000 BIBAC ends (BESs) randomly selected from the library, generating approximately one BES for every 250 kb along the Upland cotton genome. The retroelement Gypsy/DIRS1 family predominates in the Upland cotton genome, accounting for over 77% of all transposable elements. From the BESs, we identified 1,269 simple sequence repeats (SSRs), of which 1,006 were new, thus providing additional markers for cotton genome research. Surprisingly, comparative sequence analysis showed that Upland cotton is much more diverged from G. raimondii at the genomic sequence level than expected. There seems to be no significant difference between the relationships of the Upland cotton D- and A-subgenomes with the G. raimondii genome, even though G

  15. Characterization of Foliage Mutants for Plant Variety Registration

    International Nuclear Information System (INIS)

    Affrida Abu Hassan; Shuhaimi Shamsuddin; Zaiton Ahmad

    2011-01-01

    Breeding for new plant varieties requires a substantial investment in terms of skill, labour, material resources and financing. Thus, registration of new plant variety is important to ensure return of revenue and protection of the breeder's right. Before a new variety is registered, it has to comply certain requirements under Plant Variety Protection Act. One of the most important requirements is, the new species/variety must be morphologically distinguishable from existing plant varieties. This paper discusses detailed leaf characteristics of 4 foliage mutants produced by Malaysian Nuclear Agency as part of the requirement for new variety registration. (author)

  16. Characterization and structural properties of iron in plants.

    Science.gov (United States)

    Dewanamuni, Udya; Dehipawala, Sunil; Gafney, Harry

    Iron is one of the most abundant metals in the soil and occurs in a wide range of chemical forms. Humans receive iron through either meat products or plants. Non meat eaters depend on plant product for their daily iron requirement. The iron absorption by plants depends on other minerals present in the soil and soil pH value. The amount of iron present in plants grown with different soil compositions were investigated using X-ray absorption spectroscopy (XAS) and Mossbauer spectroscopy. Based on the X-ray absorption data, the amount of iron in plants vary significantly with soil pH value. The Mossbauer spectroscopy reveals that iron present in the samples has the form Fe3+ or electron density at the site of the iron nucleus similar to that of Fe3+. CUNY Research Scholar Program, MSEIP.

  17. Characterization of haemoglobin from Actinorhizal plants – An in ...

    Indian Academy of Sciences (India)

    2013-10-01

    Oct 1, 2013 ... Actinorhizal plant; haemoglobin (Hb); homology modelling; vesicle ..... specifies the overall quality of the models and determines the extent to which .... service for the recognition of errors in three-dimensional struc- tures of ...

  18. Visual Characterization of VX Droplets on Plant Foliage

    Science.gov (United States)

    2016-07-01

    droplets were dispensed onto plant leaves using a high-precision syringe. Digital photographs of the droplets were taken at intervals, saved, and...purposes of advertisement . Approved for public release; distribution is unlimited Acknowledgments The authors would like to thank Dr...alcohol (CAS no. 67-63-0) was used as an extractant. Miracle-Gro Water Soluble All Purpose Plant Food (Scotts Company; Marysville, OH) fertilizer

  19. Ensuring the sustainability of EDF power plant operating capacity; Assurer la perennite des competences d'exploitation des centrales d'EDF

    Energy Technology Data Exchange (ETDEWEB)

    Francois, J. [Institut de Radioprotection et de Surete Nucleaire (IRSN), Service d' Etude des Facteurs Humains, 92 - Clamart (France)

    2009-07-15

    The life extension of the power plants is considered whereas EDF must face an acceleration of the retirement rates due to the fact that the first generations of the baby-boom are ageing 60 years, now. Between 2000 and 2006, EDF gradually set up a system of management of competencies. On the one hand, EDF moved from logic of relatively standardized training to a more individualized logic of acquisition of competencies. In addition, the objective of maintenance of internat competencies defined in 2000 was supplemented in 2003 by a prospective dimension intended to anticipate the departures in inactivity. Then in 2006 competencies of sub-contractors were taken into account. During this period I.R.S.N. has assessed 3 times this system of management. This article briefly presents the principal lessons driven from these evaluations. It accounts for the undeniable effort made by EDF to ensure the maintenance of its competencies. However, it stresses that a high level of vigilance is still needed because it is not stabilized already. (author)

  20. Understanding the Biological Roles of Pectins in Plants through Physiological and Functional Characterizations of Plant and Fungal Mutants

    DEFF Research Database (Denmark)

    Stranne, Maria

    The plant cell wall is a dynamic structure and it is involved in regulating a number of physiological features of plants such as physical strength, growth, cell differentiation, intercellular communication, water movement and defense responses. Pectins constitute a major class of plant cell wall...... polysaccharides and consist of backbones rich in galacturonic acids, which are decorated with a range of functional groups including acetyl esters and arabinan sidechains. Although much effort has been made to uncover biological functions of pectins in plants and remarkable progresses have taken place, many...... aspects remain elusive. Studies described in this thesis aimed at gaining new insights into the biological roles of pectin acetylation and arabinosylation in the model plant Arabidopsis thaliana. The thesis consists of four chapters: physiological characterization of cell wall mutants affected in cell...

  1. Functional, genetic and chemical characterization of biosurfactants produced by plant growth-promoting Pseudomonas putida 267

    NARCIS (Netherlands)

    Kruijt, M.; Tran, H.; Raaijmakers, J.M.

    2009-01-01

    Aims: Plant growth-promoting Pseudomonas putida strain 267, originally isolated from the rhizosphere of black pepper, produces biosurfactants that cause lysis of zoospores of the oomycete pathogen Phytophthora capsici. The biosurfactants were characterized, the biosynthesis gene(s) partially

  2. Retention of phosphorous ions on natural and engineered waste pumice: Characterization, equilibrium, competing ions, regeneration, kinetic, equilibrium and thermodynamic study

    Energy Technology Data Exchange (ETDEWEB)

    Karimaian, Kamal Aldin [Department of Environmental Health Engineering, Faculty of Health, Kurdistan University of Medical Sciences, Sannandaj (Iran, Islamic Republic of); Amrane, Abdeltif [Ecole Nationale Supérieure de Chimie de Rennes, Université Rennes 1, CNRS, UMR 6226, Avenue du Général Leclerc, CS 50837, 35708 Rennes Cedex 7 (France); Kazemian, Hossein [Department of Chemical and Biochemical Engineering, Western University, London, ON, Canada N6A 5B9 (Canada); Panahi, Reza [Department of Biotechnology, Faculty of Chemical Engineering, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Zarrabi, Mansur, E-mail: mansor62@gmail.com [Department of Environmental Health Engineering, Faculty of Health, Alborz University of Medical Sciences, Karaj (Iran, Islamic Republic of)

    2013-11-01

    Natural and Mg{sup 2+} modified pumice were used for the removal of phosphorous. The adsorbents were characterized using XRF, XRD, SEM and FTIR instrumental techniques. In the optimal conditions, namely at equilibrium time (30 min), for a phosphorus concentration of 15 mg/L and pH 6, 69 and 97% phosphorus removals were achieved using 10 g/L of natural and modified pumice adsorbents, respectively. Maximum adsorption capacities were 11.88 and 17.71 mg/g by natural and modified pumice, respectively. Pseudo-second order kinetic model was the most relevant to describe the kinetic of phosphorus adsorption. External mass transfer coefficient decreased for increasing phosphorous concentration and film diffusion was found to be the rate-controlling step. Only a very low dissolution of the adsorbent was observed, leading to a low increase in conductivity and turbidity. Removal efficiency decreased for increasing ionic strength. It also decreased in the presence of competing ions; however modified pumice remained effective, since 67% of phosphorus was removed, versus only 17% for the natural pumice. The efficiency of the modified pumice was confirmed during the regeneration tests, since 96% regeneration yield was obtained after 510 min experiment, while only 22% was observed for the raw pumice.

  3. Induction and characterization of a replication competent cervid endogenous gammaretrovirus (CrERV) from mule deer cells.

    Science.gov (United States)

    Fábryová, Helena; Hron, Tomáš; Kabíčková, Hana; Poss, Mary; Elleder, Daniel

    2015-11-01

    Endogenous retroviruses (ERVs) were acquired during evolution of their host organisms after infection and mendelian inheritance in the germline by their exogenous counterparts. The ERVs can spread in the host genome and in some cases they affect the host phenotype. The cervid endogenous gammaretrovirus (CrERV) is one of only a few well-defined examples of evolutionarily recent invasion of mammalian genome by retroviruses. Thousands of insertionally polymorphic CrERV integration sites have been detected in wild ranging mule deer (Odocoileus hemionus) host populations. Here, we describe for the first time induction of replication competent CrERV by cocultivation of deer and human cells. We characterize the physical properties and tropism of the induced virus. The genomic sequence of the induced virus is phylogenetically related to the evolutionarily young endogenous CrERVs described so far. We also describe the level of replication block of CrERV on deer cells and its capacity to establish superinfection interference. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Characterization of Minnesota lunar simulant for plant growth

    Science.gov (United States)

    Oglesby, James P.; Lindsay, Willard L.; Sadeh, Willy Z.

    1993-01-01

    Processing of lunar regolith into a plant growth medium is crucial in the development of a regenerative life support system for a lunar base. Plants, which are the core of such a system, produce food and oxygen for humans and, at the same time, consume carbon dioxide. Because of the scarcity of lunar regolith, simulants must be used to infer its properties and to develop procedures for weathering and chemical analyses. The Minnesota Lunar Simulant (MLS) has been identified to date as the best available simulant for lunar regolith. Results of the dissolution studies reveal that appropriately fertilized MLS can be a suitable medium for plant growth. The techniques used in conducting these studies can be extended to investigate the suitability of actual lunar regolith as a plant growth medium. Dissolution experiments were conducted using the MLS to determine its nutritional and toxicity characteristics for plant growth and to develop weathering and chemical analysis techniques. Two weathering regimes, one with water and one with dilute organic acids simulating the root rhizosphere microenvironment, were investigated. Elemental concentrations were measured using inductively-coupled-plasma (ICP) emission spectrometry and ion chromatography (IC). The geochemical speciation model, MINTEQA2, was used to determine the major solution species and the minerals controlling them. Acidification was found to be a useful method for increasing cation concentrations to meaningful levels. Initial results indicate that MLS weathers to give neutral to slightly basic solutions which contain acceptable amounts of the essential elements required for plant nutrition (i.e., potassium, calcium, magnesium, sulfur, zinc, sodium, silicon, manganese, copper, chlorine, boron, molybdenum, and cobalt). Elements that need to be supplemented include carbon, nitrogen, and perhaps phosphorus and iron. Trace metals in solution were present at nontoxic levels.

  5. Mass spectrometry for characterizing plant cell wall polysaccharides

    Directory of Open Access Journals (Sweden)

    Stefan eBauer

    2012-03-01

    Full Text Available Mass spectrometry is a selective and powerful technique to obtain identification and structural information on compounds present in complex mixtures. Since it requires only small sample amount it is an excellent tool for researchers interested in detecting changes in composition of complex carbohydrates of plants. This mini-review gives an overview of common mass spectrometry techniques applied to the analysis of plant cell wall carbohydrates. It presents examples in which mass spectrometry has been used to elucidate the structure of oligosaccharides derived from hemicelluloses and pectins and illustrates how information on sequence, linkages, branching and modifications are obtained from characteristic fragmentation patterns.

  6. Characterization of a novel tymovirus on tomato plants in Brazil.

    Science.gov (United States)

    de Oliveira, Virgínia Carla; Nagata, Tatsuya; Guimarães, Felipe C; Ferreira, Fernanda A; Kitajima, Elliot Watanabe; Nicolini, Cícero; de Oliveira Resende, Renato; Inoue-Nagata, Alice Kazuko

    2013-02-01

    A tymovirus was isolated in Brazil from tomato plants with severe symptoms of leaf mosaic and blistering. The virus was mechanically transmissible to solanaceous indicator host species. The infected plants contained icosahedral particles and chloroplasts with membrane deformations which are typical cytopathic effects caused by tymoviruses. Its coat protein amino acid sequence shares the maximum of 64 % identity with the tymovirus Chiltepin yellow mosaic virus, which suggested that it can be considered as a distinct member of the genus Tymovirus. In a phylogenetic tree, this tymovirus was clustered with other solanaceous-infecting tymoviruses. It was tentatively named as Tomato blistering mosaic virus (ToBMV).

  7. Characterization of leaf area of Agave fourcroydes Lem. plants obtained from asexual propagation

    Directory of Open Access Journals (Sweden)

    Maryla Sosa del Castillo

    2014-01-01

    Full Text Available The henequen (Agave fourcroydes Lem. is a crop of great economic importance. This study was aimed to characterize the leaf surface of henequen plants variety `Sac Ki' obtained by asexual propagation methods. In vitro plants, shoots of bulbils of in vitro plants, shoots of rhizomes of in vitro plants, shoots of bulbils of field plants and shoots of field rhizomes were used. At 7 and 15 months after planting in the nursery, the epidermis was characterized through the stomatal index and stomatal density. Moreover, the conductor vessels and fiber bundles in leaf mesophyll, were characterized. It was found that the leaf surface of henequen plants variety `Sac Ki' obtained by different methods of asexual propagation showed similar anatomical structures. However, it was observed that in vitro plants were different from the rest in terms of stomatal index and stomatal density in both time points. It was suggesting a accommodate response to environmental conditions. Key words: stomatic density, stomatic index, in vitro plants

  8. Characterization of actinobacteria associated with three ant-plant mutualisms.

    Science.gov (United States)

    Hanshew, Alissa S; McDonald, Bradon R; Díaz Díaz, Carol; Djiéto-Lordon, Champlain; Blatrix, Rumsaïs; Currie, Cameron R

    2015-01-01

    Ant-plant mutualisms are conspicuous and ecologically important components of tropical ecosystems that remain largely unexplored in terms of insect-associated microbial communities. Recent work has revealed that ants in some ant-plant systems cultivate fungi (Chaetothyriales) within their domatia, which are fed to larvae. Using Pseudomyrmex penetrator/Tachigali sp. from French Guiana and Petalomyrmex phylax/Leonardoxa africana and Crematogaster margaritae/Keetia hispida, both from Cameroon, as models, we tested the hypothesis that ant-plant-fungus mutualisms co-occur with culturable Actinobacteria. Using selective media, we isolated 861 putative Actinobacteria from the three systems. All C. margaritae/K. hispida samples had culturable Actinobacteria with a mean of 10.0 colony forming units (CFUs) per sample, while 26 % of P. penetrator/Tachigali samples (mean CFUs 1.3) and 67 % of P. phylax/L. africana samples (mean CFUs 3.6) yielded Actinobacteria. The largest number of CFUs was obtained from P. penetrator workers, P. phylax alates, and C. margaritae pupae. 16S rRNA gene sequencing and phylogenetic analysis revealed the presence of four main clades of Streptomyces and one clade of Nocardioides within these three ant-plant mutualisms. Streptomyces with antifungal properties were isolated from all three systems, suggesting that they could serve as protective symbionts, as found in other insects. In addition, a number of isolates from a clade of Streptomyces associated with P. phylax/L. africana and C. margaritae/K. hispida were capable of degrading cellulose, suggesting that Streptomyces in these systems may serve a nutritional role. Repeated isolation of particular clades of Actinobacteria from two geographically distant locations supports these isolates as residents in ant-plant-fungi niches.

  9. Extraction and characterization of anthocyanin colorants from plant sources

    Directory of Open Access Journals (Sweden)

    S. Dyankova

    2016-03-01

    Full Text Available Abstract. Natural pigments (and especially those of anthocyanins are a valuable source of bioactive compounds and may be used in the production of new functional food ingredients. Furthermore, their applications in the treatment and prevention of chronic disorders are becoming more and more widespread. In the last few years consumers have focused their attention on the natural biologically active compounds as functional food ingredients, and therefore, it may be assumed that natural colorants are an alternative source of synthetic additives. The aim of the study was to determine the quantitative content of monomeric anthocyanin pigments in extracts obtained from eight plants. The total content of monomeric anthocyanin pigments was measured by a pH-differential method. The TLC analysis of the pigment extracts from the different plants showed intensive rose, red and violet stripes corresponding to the anthocyanin content. The extracts from chicory and lavender petals were unstable and their color decreased in intensity in 1 month. The analysis of the experimental data shows that the yield of pigment substances depends on a few factors: the type of plant, the preliminary treatment of the plant and the solvent that is used. The largest quantity of extracted substances in the studied plants were isolated from chokeberry (2 195.9 cyd eq mg/l, followed by blackberry (1 466.2 and one variety of the grapes (1 199.3 . In the case of chokeberry, the pigment content included a large number of anthocyanins and the combination of these components was the reason for the deep red/violet color of the extract. Fresh or frozen materials are the most suitable for extraction of anthocyanin pigments. On the whole, fruit pulp yielded a larger quantity of pigments than juice. Anthocyanins are water-soluble compounds and for that reason their isolation requires water and other polar solvents. Better stabilization of color is obtained by a slight acidification of the

  10. Characterization of Plant Growth under Single-Wavelength Laser Light Using the Model Plant Arabidopsis Thaliana

    KAUST Repository

    Ooi, Amanda

    2016-12-01

    Indoor horticulture offers a promising solution for sustainable food production and is becoming increasingly widespread. However, it incurs high energy and cost due to the use of artificial lighting such as high-pressure sodium lamps, fluorescent light or increasingly, the light-emitting diodes (LEDs). The energy efficiency and light quality of currently available lighting is suboptimal, therefore less than ideal for sustainable and cost-effective large-scale plant production. Here, we demonstrate the use of high-powered single-wavelength lasers for indoor horticulture. Lasers are highly energy-efficient and can be remotely guided to the site of plant growth, thus reducing on-site heat accumulation. Besides, laser beams can be tailored to match the absorption profiles of different plants. We have developed a prototype laser growth chamber and demonstrate that laser-grown plants can complete a full growth cycle from seed to seed with phenotypes resembling those of plants grown under LEDs. Importantly, the plants have lower expression of proteins diagnostic for light and radiation stress. The phenotypical, biochemical and proteomic data show that the singlewavelength laser light is suitable for plant growth and therefore, potentially able to unlock the advantages of this next generation lighting technology for highly energy-efficient horticulture. Furthermore, stomatal movement partly determines the plant productivity and stress management. Abscisic acid (ABA) induces stomatal closure by promoting net K+-efflux from guard cells through outwardrectifying K+ (K+ out) channels to regulate plant water homeostasis. Here, we show that the Arabidopsis thaliana guard cell outward-rectifying K+ (ATGORK) channel is a direct target for ABA in the regulation of stomatal aperture and hence gas exchange and transpiration. Addition of (±)-ABA, but not the biologically inactive (−)-isomer, increases K+ out channel activity in Vicia faba guard cell protoplast. A similar ABA

  11. Plants and microbes assisted selenium nanoparticles: characterization and application.

    Science.gov (United States)

    Husen, Azamal; Siddiqi, Khwaja Salahuddin

    2014-08-16

    Selenium is an essential trace element and is an essential component of many enzymes without which they become inactive. The Se nanoparticles of varying shape and size may be synthesized from Se salts especially selenite and selenates in presence of reducing agents such as proteins, phenols, alcohols and amines. These biomolecules can be used to reduce Se salts in vitro but the byproducts released in the environment may be hazardous to flora and fauna. In this review, therefore, we analysed in depth, the biogenic synthesis of Se nanoparticles, their characterization and transformation into t- Se, m-Se, Se-nanoballs, Se-nanowires and Se-hollow spheres in an innocuous way preventing the environment from pollution. Their shape, size, FTIR, UV-vis, Raman spectra, SEM, TEM images and XRD pattern have been analysed. The weak forces involved in aggregation and transformation of one nano structure into the other have been carefully resolved.

  12. In silico Characterization of Plant and Microbial Antifreeze Proteins

    Directory of Open Access Journals (Sweden)

    Abdul Mohin Sajib

    2012-12-01

    Full Text Available Antifreeze proteins (AFPs are class of proteins that protect organisms from the damage caused by freezing through their ability to inhibit ice growth and effectively lower the temperature at which water freezes. In this study, a total of 25 antifreeze proteins were selected from four different sources (plant, bacteria and fungus where they represent distinct physicochemical and structural features. Several Physico-chemical properties such as grand average hydropathy (GRAVY, aliphatic index (AI, extinction coefficient (EC, isolelectric point (pI, and instability index (II were computed. S-S bridges and secondary structures were analyzed using CYS_REC and SOPMA programs respectively. The three dimensional structure of Antifreeze proteins is predicted by using three homology modelling server Geno3D, Swiss-model and CPHmodels. These models were evaluated with PROCHECK, What If, and ProSA programs. Model visualization and analysis was done with Pymol. These structures will provide a good foundation for functional analysis of experimentally derived crystal structures.

  13. Characterization and possible uses of ashes from wastewater treatment plants

    International Nuclear Information System (INIS)

    Merino, Ignacio; Arevalo, Luis F.; Romero, Fernando

    2005-01-01

    This work, on the ashes from the wastewater treatment plant of Galindo (Vizcaya, Spain), has been outlined with the purpose of finding their physico-chemical properties and suggesting possible applications. Ashes contain important quantities of iron, calcium, silica, alumina and phosphates. X-Ray diffraction data make it possible to estimate the mineralogical compositions of the original ashes and also, after thermal treatment at 1200 and 1300 deg. C, the main reactions occurring in thermal treatment. Particle size analysis makes it possible to classify ashes as a very fine powdered material. The thermal treatment leads to a densification of the material and provokes losses of weight mainly due to the elimination of water, carbon dioxide and sulphur trioxide. Application tests show that ashes are not suitable for landfill and similar applications, because of their plastic properties. Testing for pozzolanic character, after the ashes had been heated at 1200 deg. C, did not lead to a strong material probably due to low contents in silica and alumina or to requiring a higher heating temperature. Thermal treatment leads to densification of the material with a considerable increase of compressive strength of the probes. The use of additives (clays and powdered glass) to improve ceramic properties of ashes will be the aim of a future work

  14. Biochemical characterization of selected plant species from Brazilian Savannas

    Directory of Open Access Journals (Sweden)

    Samantha Salomão Caramori

    2004-06-01

    Full Text Available The aim of this work was to analyze and quantify the presence of antinutritional compounds such as lectins and trypsin-like inhibitors, polyphenols and tannins, and enzymatic activity of peroxidases and proteases in the seeds of Annona crassiflora Mart. (araticum, Hymenaea courbaril L. var. courbaril (jatobá, Plathymenia reticulata Benth. (vinhático, Zanthoxylum rhoifolium Lam. (maminha de porca, Apeiba tibourbou Aubl. (pau jangada, Salacia crassiflora Mart G. Don. (bacupari, and Sclerolobium paniculatum Vog. (carvoeiro. The results suggested that these plants could be used as new source of food.O Cerrado é constituído por inúmeras espécies vegetais com potencial econômico, as quais são utilizadas para os mais variados fins, como medicinal e nutricional. O objetivo deste trabalho foi analisar e quantificar a presença de atividade enzimática de peroxidases e proteases e fatores antinutricionais, como lectinas e inibidores de proteases, além de polifenóis e taninos em algumas espécies nativas do Cerrado. O material vegetal utilizado foram sementes de Annona crassiflora Mart. (araticum, Hymenaea courbaril L. var. courbaril (jatobá, Plathymenia reticulata Benth. (vinhático, Zanthoxylum rhoifolium Lam. (maminha de porca, Apeiba tibourbou Aubl. (pau jangada, Salacia crassiflora (Mart. G. Don. (bacupari e Sclerolobium paniculatum Vog. (carvoeiro, coletadas na cidade de Goiânia e municípios de Jataí e Caldas Novas, estado de Goiás. O uso potencial destas plantas e suas enzimas na indústria de alimentos, poderia resultar em aplicações ao aparecimento de novos produtos a partir das matérias-primas tradicionais, além do uso de novas fontes de alimentos.

  15. Physico-chemical characterization of slag waste coming from GICC thermal power plant

    Energy Technology Data Exchange (ETDEWEB)

    Acosta, A.; Aineto, M.; Iglesias, I. [Laboratory of Applied Mineralogy, Universidad de Castilla-La Mancha, Ciudad Real Madrid (Spain); Romero, M.; Rincon, J.Ma. [The Glass-Ceramics Laboratory, Insituto Eduardo Torroja de Ciencias de la Construccion, CSIC, c/Serrano Galvache s/n, 28033, Madrid (Spain)

    2001-09-01

    The new gas installations of combined cycle (GICC) thermal power plants for production of electricity are more efficient than conventional thermal power plants, but they produce a high quantity of wastes in the form of slags and fly ashes. Nowadays, these by-products are stored within the production plants with, until now, no applications of recycling in other industrial processes. In order to evaluate the capability of these products for recycling in glass and ceramics inductory, an investigation for the full characterization has been made by usual physico-chemical methods such as: chemical analysis, mineralogical analysis by XRD, granulometry, BET, DTA/TG, heating microscopy and SEM/EDX.

  16. Materials characterization capabilities at DOE Nuclear Weapons Laboratories and Production Plants

    International Nuclear Information System (INIS)

    Pyper, J.W.

    1984-06-01

    The materials characterization and analytical chemistry capabilities at the 11 DOE Nuclear Weapons Laboratories or Production Plants have been surveyed and compared. In general, all laboratories have similar capabilities and equipment. Facilities or capabilities that are unique or that exist at only a few laboratories are described in detail

  17. Characterization of residual radionuclide contamination within and around commercial nuclear power plants

    International Nuclear Information System (INIS)

    Robertson, D.E.; Abel, K.H.; Thomas, C.W.; Lepel, E.A.; Evans, J.C.; Thomas, W.V.; Carrick, L.C.; Leale, M.W.

    1985-07-01

    To provide a statistically valid data base for the residual radionuclide inventories in nuclear power stations, Pacific Northwest Laboratory (PNL) was contracted to conduct an extensive sampling and measurements program at a number of nuclear power plants. This paper summarizes the results of the radionuclide characterization studies conducted at seven nuclear power stations from a decommissioning assessment viewpoint

  18. Advances in methods for identification and characterization of plant transporter function

    DEFF Research Database (Denmark)

    Larsen, Bo; Xu, Deyang; Halkier, Barbara Ann

    2017-01-01

    Transport proteins are crucial for cellular function at all levels. Numerous importers and exporters facilitate transport of a diverse array of metabolites and ions intra- and intercellularly. Identification of transporter function is essential for understanding biological processes at both......-based approaches. In this review, we highlight examples that illustrate how new technology and tools have advanced identification and characterization of plant transporter functions....

  19. Expression and characterization of plant aspartic protease nepenthesin-1 from Nepenthes gracilis

    Czech Academy of Sciences Publication Activity Database

    Kádek, Alan; Tretyachenko, V.; Mrázek, Hynek; Ivanova, Ljubina; Halada, Petr; Rey, M.; Schriemer, D. C.; Man, Petr

    2014-01-01

    Roč. 95, MAR 2014 (2014), s. 121-128 ISSN 1046-5928 R&D Projects: GA ČR GAP206/12/0503; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Plant aspartic protease * Nepenthesin * Protease characterization Subject RIV: CE - Biochemistry Impact factor: 1.695, year: 2014

  20. CHARACTERIZATION OF MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT, VOLUME II. APPENDICES F-J

    Science.gov (United States)

    The report gives results of a characterization of mercury (Hg) emissions at a chlor-alkali plant. Up to 160 short tons (146 Mg) of Hg is consumed by the chlor-alkali industry each year. Very little quantitative information is currently available however, on the actual Hg losses f...

  1. Characterization of the head end cells at the West Valley Nuclear Fuel Reprocessing Plant

    International Nuclear Information System (INIS)

    Vance, R.F.

    1986-11-01

    The head-end cells at the West Valley Nuclear Fuel Reprocessing Plant are characterized in this report. These cells consist of the Process Mechanical Cell (PMC) where irradiated nuclear fuel was trimmed of excess hardware and sheared into short segments; and the General Purpose Cell (GPC) where the segments were collected and stored prior to dissolution, and leached hulls were packaged for disposal. Between 1966 and 1972, while Nuclear Fuels Services operated the plant, these cells became highly contaminated with radioactive materials. The purpose of this characterization work was to develop technical information as a basis of decontamination and decommissioning planning and engineering. It was accomplished by performing remote in-cell visual examinations, radiation surveys, and sampling. Supplementary information was obtained from available written records, out-of-cell inspections, and interviews with plant personnel

  2. Characterization of Carambola (Averrhoa carambola L. Plant Collection of Cibinong Plant Germplasm Garden Based on Phenotypic and Genetic Characters

    Directory of Open Access Journals (Sweden)

    Dody Priadi

    2016-04-01

    Full Text Available Indonesia as a rich biodiversity country has many superior fruit plant germplasms such as sweet star fruit or carambola (Averrhoa carambola L.. Some varieties of carambola which collected at the Germplasm Garden of Research Center for Biotechnology-LIPI have been used for parent trees of fruit plant production. Therefore, they have to be characterized both phenotypically and genetically. The objective of the study was to analyze the relationship between eight varieties of carambola i.e. Malaysia, Penang, Rawasari, Bangkok, Sembiring, Dewabaru, Demak and Dewimurni at the germplasm garden based on phenotypic and genetic characters. Phenotypic characters were observed directly in the field, whereas genetic characters were observed with RAPD markers using 10 primers. Phylogenetic analysis was done using NT-SYS software showed that there were three clusters of carambola varieties. Meanwhile, Malaysia and Penang varieties have closed relationships (96% compared with the other varieties. The result of the study would be dedicated to updating and completing the existing fruit plant collection database of Plants Germplasm Garden. 

  3. ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES

    Directory of Open Access Journals (Sweden)

    Dominika Ďurechová

    2013-02-01

    Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.

  4. Resolving the role of plant glutamate dehydrogenase: II. Physiological characterization of plants overexpressing the two enzyme subunits individually or simultaneously.

    Science.gov (United States)

    Tercé-Laforgue, Thérèse; Bedu, Magali; Dargel-Grafin, Céline; Dubois, Frédéric; Gibon, Yves; Restivo, Francesco M; Hirel, Bertrand

    2013-10-01

    Glutamate dehydrogenase (GDH; EC 1.4.1.2) is able to carry out the deamination of glutamate in higher plants. In order to obtain a better understanding of the physiological function of GDH in leaves, transgenic tobacco (Nicotiana tabacum L.) plants were constructed that overexpress two genes from Nicotiana plumbaginifolia (GDHA and GDHB under the control of the Cauliflower mosiac virus 35S promoter), which encode the α- and β-subunits of GDH individually or simultaneously. In the transgenic plants, the GDH protein accumulated in the mitochondria of mesophyll cells and in the mitochondria of the phloem companion cells (CCs), where the native enzyme is normally expressed. Such a shift in the cellular location of the GDH enzyme induced major changes in carbon and nitrogen metabolite accumulation and a reduction in growth. These changes were mainly characterized by a decrease in the amount of sucrose, starch and glutamine in the leaves, which was accompanied by an increase in the amount of nitrate and Chl. In addition, there was an increase in the content of asparagine and a decrease in proline. Such changes may explain the lower plant biomass determined in the GDH-overexpressing lines. Overexpressing the two genes GDHA and GDHB individually or simultaneously induced a differential accumulation of glutamate and glutamine and a modification of the glutamate to glutamine ratio. The impact of the metabolic changes occurring in the different types of GDH-overexpressing plants is discussed in relation to the possible physiological function of each subunit when present in the form of homohexamers or heterohexamers.

  5. Application of RAPD for molecular characterization of plant species of medicinal value from an arid environment.

    Science.gov (United States)

    Arif, I A; Bakir, M A; Khan, H A; Al Farhan, A H; Al Homaidan, A A; Bahkali, A H; Al Sadoon, M; Shobrak, M

    2010-11-09

    The use of highly discriminatory methods for the identification and characterization of genotypes is essential for plant protection and appropriate use. We utilized the RAPD method for the genetic fingerprinting of 11 plant species of desert origin (seven with known medicinal value). Andrachne telephioides, Zilla spinosa, Caylusea hexagyna, Achillea fragrantissima, Lycium shawii, Moricandia sinaica, Rumex vesicarius, Bassia eriophora, Zygophyllum propinquum subsp migahidii, Withania somnifera, and Sonchus oleraceus were collected from various areas of Saudi Arabia. The five primers used were able to amplify the DNA from all the plant species. The amplified products of the RAPD profiles ranged from 307 to 1772 bp. A total of 164 bands were observed for 11 plant species, using five primers. The number of well-defined and major bands for a single plant species for a single primer ranged from 1 to 10. The highest pair-wise similarities (0.32) were observed between A. fragrantissima and L. shawii, when five primers were combined. The lowest similarities (0) were observed between A. telephioides and Z. spinosa; Z. spinosa and B. eriophora; B. eriophora and Z. propinquum. In conclusion, the RAPD method successfully discriminates among all the plant species, therefore providing an easy and rapid tool for identification, conservation and sustainable use of these plants.

  6. Isolation of Pantoea ananatis from sugarcane and characterization of its potential for plant growth promotion.

    Science.gov (United States)

    da Silva, J F; Barbosa, R R; de Souza, A N; da Motta, O V; Teixeira, G N; Carvalho, V S; de Souza, A L S R; de Souza Filho, G A

    2015-11-30

    Each year, approximately 170 million metric tons of chemical fertilizer are consumed by global agriculture. Furthermore, some chemical fertilizers contain toxic by-products and their long-term use may contaminate groundwater, lakes, and rivers. The use of plant growth-promoting bacteria may be a cost-effective strategy for partially replacing conventional chemical fertilizers, and may become an integrated plant nutrient solution for sustainable crop production. The main direct bacteria-activated mechanisms of plant growth promotion are based on improvement of nutrient acquisition, siderophore biosynthesis, nitrogen fixation, and hormonal stimulation. The aim of this study was to isolate and identify bacteria with growth-promoting activities from sugarcane. We extracted the bacterial isolate SCB4789F-1 from sugarcane leaves and characterized it with regard to its profile of growth-promoting activities, including its ability to colonize Arabidopsis thaliana. Based on its biochemical characteristics and 16S rDNA sequence analysis, this isolate was identified as Pantoea ananatis. The bacteria were efficient at phosphate and zinc solubilization, and production of siderophores and indole-3-acetic acid in vitro. The isolate was characterized by Gram staining, resistance to antibiotics, and use of carbon sources. This is the first report on zinc solubilization in vitro by this bacterium, and on plant growth promotion following its inoculation into A. thaliana. The beneficial effects to plants of this bacterium justify future analysis of inoculation of economically relevant crops.

  7. Introducing close-range photogrammetry for characterizing forest understory plant diversity and surface fuel structure at fine scales

    Science.gov (United States)

    Benjamin C. Bright; E. Louise Loudermilk; Scott M. Pokswinski; Andrew T. Hudak; Joseph J. O' Brien

    2016-01-01

    Methods characterizing fine-scale fuels and plant diversity can advance understanding of plant-fire interactions across scales and help in efforts to monitor important ecosystems such as longleaf pine (Pinus palustris Mill.) forests of the southeastern United States. Here, we evaluate the utility of close-range photogrammetry for measuring fuels and plant...

  8. Waste Isolation Pilot Plant transuranic wastes experimental characterization program: executive summary

    International Nuclear Information System (INIS)

    Molecke, M.A.

    1978-11-01

    A general overview of the Waste Isolation Pilot Plant transuranic wastes experimental characterization program is presented. Objectives and outstanding concerns of this program are discussed. Characteristics of transuranic wastes are also described. Concerns for the terminal isolation of such wastes in a deep bedded salt facility are divided into two phases, those during the short-term operational phase of the facility, and those potentially occurring in the long-term, after decommissioning of the repository. An inclusive summary covering individual studies, their importance to the Waste Isolation Pilot Plant, investigators, general milestones, and comments are presented

  9. On the phase characterization of the residues of the plant Comandante Pedro Soto Alba

    International Nuclear Information System (INIS)

    Diaz Ruano, A.; Fernandez Miranda, J.

    1980-04-01

    It has been studied of the phases present in the solid industrial residues of the plant Comandante Pedro Soto Alba (Moas's tails). It is done a preliminary qualitative characterization by X ray diffraction. It is done a characterization by differential and gravimetric thermal analysis and a quantitative valuation of SO 3 and H 2 O present in the samples. A complex of S and Al is detected. The results of SO 3 are compared with those obtained by the gravimetric method to verify those of Al, an elemental analysis by neutron activation was solicitated. A formula for the complex of S and Al is proposed. (author)

  10. Teacher competencies

    OpenAIRE

    Svatošová, Kateřina

    2012-01-01

    This diploma thesis deals with adult teacher competencies. It describes current situation in adult education and it focuses on measuring quality level of teacher competencies. There is given the main overview of adult education specifics. These are the prerequisites for defining adult teacher competencies. There is given specific adult teacher competencies and related roles which are generally based on teacher's activities during educational courses. Next part describes present conception of ...

  11. AAOHN Competencies.

    Science.gov (United States)

    2015-11-01

    The AAOHN Competency document is one of the core documents that define occupational health nursing practice. This article provides a description of the process used to update the competencies, as well as a description of the new competencies. © 2015 The Author(s).

  12. Characterization of a defective interfering RNA that contains a mosaic of a plant viral genome

    Energy Technology Data Exchange (ETDEWEB)

    Morris, T.J.; Jackson, A.O.

    1991-01-01

    Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.

  13. Effects of a Research-Infused Botanical Curriculum on Undergraduates' Content Knowledge, STEM Competencies, and Attitudes toward Plant Sciences

    Science.gov (United States)

    Ward, Jennifer Rhode; Clarke, H. David; Horton, Jonathan L.

    2014-01-01

    In response to the American Association for the Advancement of Science's Vision and Change in Undergraduate Biology Education initiative, we infused authentic, plant-based research into majors' courses at a public liberal arts university. Faculty members designed a financially sustainable pedagogical approach, utilizing vertically integrated…

  14. Construction of a plant-transformation-competent BIBAC library and genome sequence analysis of polyploid Upland cotton (Gossypium hirsutum L.)

    Science.gov (United States)

    Cotton is a world’s leading crop important to the world’s textile and energy industries, and a model species for studies of plant polyploidization, cellulose biosynthesis and cell wall biogenesis. Here, we report the construction and extensive analysis of a binary bacterial artificial chromosome (BI...

  15. Conservation, genetic characterization, phytochemical and biological investigation of black calla lily: A wild endangered medicinal plant

    Directory of Open Access Journals (Sweden)

    Mai Mohammed Farid

    2016-10-01

    Full Text Available Scientists continue to search for and conserve plants whose medicinal properties have become crucial in the fight against diseases. Moreover, lessons from folk medicine, indigenous knowledge and Chinese medicine on crude extracts points to possible findings of novel promising and strong pharmaceutically bioactive constituents. Arum palaestinum, commonly known as black calla lily, is one of the most important medicinal plants belonging to the family Araceae, which has not been well studied. Little is known about its pharmaceutically bioactive constituents and the effective conservation through the use of biotechnology. Thus, Arum Palaestinum is selected and reviewed for its phytochemical analysis and biological activities. Besides, the tissue culture and genetic characterization developed for effective conservation of the plant were also summarized.

  16. Characterization of past and present solid waste streams from the plutonium finishing plant

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, D.R.; Mayancsik, B.A. [Westinghouse Hanford Co., Richland, WA (United States); Pottmeyer, J.A.; Vejvoda, E.J.; Reddick, J.A.; Sheldon, K.M.; Weyns, M.I. [Los Alamos Technical Associates, Kennewick, WA (United States)

    1993-02-01

    During the next two decades the transuranic (TRU) wastes now stored in the burial trenches and storage facilities at the Hanford Site are to be retrieved, processed at the Waste Receiving and Processing (WRAP) Facility, and shipped to the Waste Isolation Pilot Plant (WIPP) near Carlsbad, New Mexico for final disposal. Over 50% of the TRU waste to be retrieved for shipment to the WIPP has been generated at the Plutonium Finishing Plant (PFP), also known as the Plutonium Processing and Storage Facility and Z Plant. The purpose of this report is to characterize the radioactive solid wastes generated by the PFP since its construction in 1947 using process knowledge, existing records, and history-obtained from interviews. The PFP is currently operated by Westinghouse Hanford Company (WHC) for the US Department of Energy (DOE).

  17. Characterization of past and present solid waste streams from the plutonium finishing plant

    International Nuclear Information System (INIS)

    Duncan, D.R.; Mayancsik, B.A.; Pottmeyer, J.A.; Vejvoda, E.J.; Reddick, J.A.; Sheldon, K.M.; Weyns, M.I.

    1993-02-01

    During the next two decades the transuranic (TRU) wastes now stored in the burial trenches and storage facilities at the Hanford Site are to be retrieved, processed at the Waste Receiving and Processing (WRAP) Facility, and shipped to the Waste Isolation Pilot Plant (WIPP) near Carlsbad, New Mexico for final disposal. Over 50% of the TRU waste to be retrieved for shipment to the WIPP has been generated at the Plutonium Finishing Plant (PFP), also known as the Plutonium Processing and Storage Facility and Z Plant. The purpose of this report is to characterize the radioactive solid wastes generated by the PFP since its construction in 1947 using process knowledge, existing records, and history-obtained from interviews. The PFP is currently operated by Westinghouse Hanford Company (WHC) for the US Department of Energy (DOE)

  18. Characterization of past and present solid waste streams from the Plutonium-Uranium Extraction Plant

    International Nuclear Information System (INIS)

    Pottmeyer, J.A.; Weyns, M.I.; Lorenzo, D.S.; Vejvoda, E.J.; Duncan, D.R.

    1993-04-01

    During the next two decades the transuranic wastes, now stored in the burial trenches and storage facilities at the Hanford Site, are to be retrieved, processed at the Waste Receiving and Processing Facility, and shipped to the Waste Isolation Pilot Plant near Carlsbad, New Mexico for final disposal. Over 7% of the transuranic waste to be retrieved for shipment to the Waste Isolation Pilot Plant has been generated at the Plutonium-Uranium Extraction (PUREX) Plant. The purpose of this report is to characterize the radioactive solid wastes generated by PUREX using process knowledge, existing records, and oral history interviews. The PUREX Plant is currently operated by the Westinghouse Hanford Company for the US Department of Energy and is now in standby status while being prepared for permanent shutdown. The PUREX Plant is a collection of facilities that has been used primarily to separate plutonium for nuclear weapons from spent fuel that had been irradiated in the Hanford Site's defense reactors. Originally designed to reprocess aluminum-clad uranium fuel, the plant was modified to reprocess zirconium alloy clad fuel elements from the Hanford Site's N Reactor. PUREX has provided plutonium for research reactor development, safety programs, and defense. In addition, the PUREX was used to recover slightly enriched uranium for recycling into fuel for use in reactors that generate electricity and plutonium. Section 2.0 provides further details of the PUREX's physical plant and its operations. The PUREX Plant functions that generate solid waste are as follows: processing operations, laboratory analyses and supporting activities. The types and estimated quantities of waste resulting from these activities are discussed in detail

  19. Characterization of livestock wastewater at various stages of wastewater treatment plant

    International Nuclear Information System (INIS)

    Ting Teo Ming; Kim, Tak Hyun; Lee, Myun Joo

    2007-01-01

    A characterization study has been conducted at Gongju Livestock Wastewater Treatment Plant, Gongju, South Korea. It is owned and operated by the government with treatment capacity of 250 tons per day. Livestock wastewater was collected from individual farmer and treated at the treatment plant. The centralized livestock wastewater treatment plant has various treatment processes namely pre-treatment, anaerobic digestion, nitrification, de-nitrification , chemical treatment, sand filtration and ozonization. The livestock wastewater was characterized by high COD, SS, T-N and T-P with concentration of 20600 mg/l, 6933 mg/l, 2820 mg/l and 700 mg/ l, respectively. After the wastewater has undergone various treatment processes it was discharged to waterways with concentration of COD, SS, T-N and T-P at 105 mg/l, 73 mg/l, 2.1 mg/l and 9 mg/l, respectively. This is part of the study to investigate the potential of irradiation to be applied at the centralized livestock wastewater treatment plant. Although livestock wastewater can be potentially applied to crop as source of nutrients it also affect the water quality due to runoff and leaching. When the wastewater applied at the rates in excess of crop uptake rates, the excess wastewater could potentially enter surface and groundwater and polluted them. (author)

  20. Guidebook on training to establish and maintain the qualification and competence of nuclear power plant operations personnel

    International Nuclear Information System (INIS)

    1994-03-01

    Since the IAEA published its Guidebook on the Qualification of Nuclear Power Plant Operations Personnel in 1984 (Technical Reports Series 242) there have been important developments in the approach to training adopted by many operating organizations in different countries. It is now accepted that developing training programmes based solely on experience is inappropriate for the nuclear power industry, and that a systematic approach to training is necessary. It has been recognized that inadequate knowledge and skills may lead to human errors, and it is therefore necessary to review and improve the development and implementation of initial and continuing training programmes. The present Guidebook proposes an approach which is comprehensive and systematic in its methodology and also cost effective in its implementation. This Guidebook is mainly intended for management and training staff of nuclear power plant operating organizations. Relevant examples of current training practices are presented in the Appendices, which constitute an integral part of the Guidebook. Ref, figs and tabs

  1. Guidebook on training to establish and maintain the qualification and competence of nuclear power plant operations personnel

    International Nuclear Information System (INIS)

    1989-11-01

    Since the IAEA published its Guidebook on the Qualification of Nuclear Power Plant Operations Personnel in 1984 (Technical Reports Series 242) there have been important developments in the approach to training adopted by many operating organizations in different countries. It is now accepted that developing training programmes based solely on experience is inappropriate for the nuclear power industry, and that a systematic approach to training is necessary. It has been recognized that inadequate knowledge and skills may lead to human errors, and it is therefore necessary to review and improve the development and implementation of initial and continuing training programmes. The present Guidebook proposes an approach which is comprehensive and systematic in its methodology and also cost effective in its implementation. This Guidebook is mainly intended for management and training staff of nuclear power plant operating organizations. Relevant examples of current training practices are presented in the Appendices, which constitute an integral part of the Guidebook. Refs, figs and tabs

  2. Biochemical and histological characterization of Agave fourcroydes Lem. plants in vitro acclimatized

    Directory of Open Access Journals (Sweden)

    Yunel Pérez Hernández

    2016-10-01

    Full Text Available Henequen (Agave fourcroydes Lem. is a representative crop of the province of Matanzas, Cuba, which has been exploited extensively for the quality of its fibers. The present work aimed to characterize from the biochemical and histological point of view henequen plants cv. 'Sac Ki' in vitro acclimatized. The biochemical indicators analyzed were concentration of soluble phenols, total soluble carbohydrates, reducing sugars, soluble proteins and total chlorophylls, as well as the relative contents of flavonoids, terpins and anthocyanins. In addition, a histological analysis of the epidermis was performed and the results were compared with plants of one month in rooting culture medium. In vitro acclimatized plants were subsequently transferred to the ex vitro conditions. The contents of total soluble carbohydrates, reducing sugars and chlorophylls decreased, whereas the levels of soluble phenols, proteins and secondary metabolites were higher in relation to in vitro plants rooted for 30 days. The epidermis of the in vitro acclimatized plants showed a greater development of the stomatal apparatus that could positively affect the ex vitro acclimatization, where a survival rate of 87% and a reduction of the acclimatization time were obtained.   Keywords: chlorophyll, henequen, phenol, reducing sugar

  3. Isolation and characterization of plant growth promoting endophytic diazotrophic bacteria from Korean rice cultivars.

    Science.gov (United States)

    Ji, Sang Hye; Gururani, Mayank Anand; Chun, Se-Chul

    2014-01-20

    We have isolated 576 endophytic bacteria from the leaves, stems, and roots of 10 rice cultivars and identified 12 of them as diazotrophic bacteria using a specific primer set of nif gene. Through 16S rDNA sequence analysis, nifH genes were confirmed in the two species of Penibacillus, three species of Microbacterium, three Bacillus species, and four species of Klebsiella. Rice seeds treated with these plant growth-promoting bacteria (PGPB) showed improved plant growth, increased height and dry weight and antagonistic effects against fungal pathogens. In addition, auxin and siderophore producing ability, and phosphate solubilizing activity were studied for the possible mechanisms of plant growth promotion. Among 12 isolates tested, 10 strains have shown higher auxin producing activity, 6 isolates were confirmed as strains with high siderophore producing activity while 4 isolates turned out to have high phosphate-solubilizing activity. These results strongly suggest that the endophytic diazotrophic bacteria characterized in this study could be successfully used to promote plant growth and inducing fungal resistance in plants. Copyright © 2013 Elsevier GmbH. All rights reserved.

  4. Characterization of in-containment cables for nuclear plant life extension

    International Nuclear Information System (INIS)

    DuCharme, A.R.; Bustard, L.D.

    1988-01-01

    Electrical cable is made by a large number of manufacturers and used for a variety of applications in nuclear plants. cables have been identified in the Monticello and Surry Pilot Plant life extension studies and the NRC Nuclear Plant Aging Research Program as components important to the economic and safety aspects of life extension. Currently, fitness for service is largely determined by preoperational testing. The US Department of Energy is supporting work at Sandia National Laboratories to assess the technical basis for the life extension of cables found inside containment at US nuclear plants. The work is being performed in coordination with the Nuclear Management and Resource Council's (NUMARC) NUPLEX Working Group. The initial task of this effort is to characterize the design attributes of in-containment cables. This has been completed via development of a data base depicting the manufacturer, type, material composition, use, qualification, and relative popularity of cables installed in containment. Other ongoing work is focused on a review of cable operational experience and assessment of the issues affecting cable life extension. In the long term, the work aims to identify the technical criteria and life extension strategies needed to support continued cable qualification by nuclear plant owner/operators. 7 refs., 4 tabs

  5. Twenty years of experience in spent fuel shipment from German nuclear power plants - a view of the competent authority

    International Nuclear Information System (INIS)

    Fasten, Ch.; Mueller, U.; Alter, U.

    1994-01-01

    A survey of the transport of spent fuel in and from Germany during the last 20 years is presented. The spent fuel is now transported from the German nuclear power facilities to the reprocessing plants in France and the United Kingdom. In the past, there were also shipments to the former reprocessing plant WAK Karlsruhe (Germany), to the long-term storage facility CLAB (Sweden) and also from the former German Democratic Republic to the USSR. The transport of the spent fuel is carried out in specially built flasks requiring an extensive quality assurance programme. Due to the heavy weight of these packages, the shipments are mostly carried out by rail, but also by road and sea. An overview is given of the following matters: (i) quantities of spent fuel transport, (ii) organisation of transport (iii) licensing matters, and (iv) reported incidents. In addition, an analysis is included of the radiation exposure for normal conditions of transport, especially of the transport workers. Difficulties and hindrances during transport are also reported. (author)

  6. High throughput generation and characterization of replication-competent clade C transmitter-founder simian human immunodeficiency viruses.

    Directory of Open Access Journals (Sweden)

    Debashis Dutta

    Full Text Available Traditional restriction endonuclease-based cloning has been routinely used to generate replication-competent simian-human immunodeficiency viruses (SHIV and simian tropic HIV (stHIV. This approach requires the existence of suitable restriction sites or the introduction of nucleotide changes to create them. Here, using an In-Fusion cloning technique that involves homologous recombination, we generated SHIVs and stHIVs based on epidemiologically linked clade C transmitted/founder HIV molecular clones from Zambia. Replacing vif from these HIV molecular clones with vif of SIVmac239 resulted in chimeric genomes used to generate infectious stHIV viruses. Likewise, exchanging HIV env genes and introducing N375 mutations to enhance macaque CD4 binding site and cloned into a SHIVAD8-EO backbone. The generated SHIVs and stHIV were infectious in TZMbl and ZB5 cells, as well as macaque PBMCs. Therefore, this method can replace traditional methods and be a valuable tool for the rapid generation and testing of molecular clones of stHIV and SHIV based on primary clinical isolates will be valuable to generate rapid novel challenge viruses for HIV vaccine/cure studies.

  7. Physiological and biochemical characterization of Azospirillum brasilense strains commonly used as plant growth-promoting rhizobacteria.

    Science.gov (United States)

    Di Salvo, Luciana P; Silva, Esdras; Teixeira, Kátia R S; Cote, Rosalba Esquivel; Pereyra, M Alejandra; García de Salamone, Inés E

    2014-12-01

    Azospirillum is a plant growth-promoting rhizobacteria (PGPR) genus vastly studied and utilized as agriculture inoculants. Isolation of new strains under different environmental conditions allows the access to the genetic diversity and improves the success of inoculation procedures. Historically, the isolation of this genus has been performed by the use of some traditional culture media. In this work we characterized the physiology and biochemistry of five different A. brasilense strains, commonly used as cereal inoculants. The aim of this work is to contribute to pose into revision some concepts concerning the most used protocols to isolate and characterize this bacterium. We characterized their growth in different traditional and non-traditional culture media, evaluated some PGPR mechanisms and characterized their profiles of fatty acid methyl esters and carbon-source utilization. This work shows, for the first time, differences in both profiles, and ACC deaminase activity of A. brasilense strains. Also, we show unexpected results obtained in some of the evaluated culture media. Results obtained here and an exhaustive knowledge revision revealed that it is not appropriate to conclude about bacterial species without analyzing several strains. Also, it is necessary to continue developing studies and laboratory techniques to improve the isolation and characterization protocols. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The Rocky Flats Plant Waste Stream and Residue Identification and Characterization Program (WSRIC): Progress and achievements

    International Nuclear Information System (INIS)

    Ideker, V.L.

    1994-01-01

    The Waste Stream and Residue Identification and Characterization (WSRIC) Program, as described in the WSRIC Program Description delineates the process knowledge used to identify and characterize currently-generated waste from approximately 5404 waste streams originating from 576 processes in 288 buildings at Rocky Flats Plant (RFP). Annual updates to the WSRIC documents are required by the Federal Facilities Compliance Agreement between the US Department of Energy, the Colorado Department of Health and the Environmental Protection Agency. Accurate determination and characterization of waste is a crucial component in RFP's waste management strategy to assure compliance with Resource Conservation and Recovery Act (RCRA) storage and treatment requirements, as well as disposal acceptance criteria. The WSRIC Program was rebaselined in September 1992, and serves as the linchpin for documenting process knowledge in RFP's RCRA operating record. Enhancements to the WSRIC include strengthening the waste characterization rationale, expanding WSRIC training for waste generators, and incorporating analytical information into the WSRIC building books. These enhancements will improve credibility with the regulators and increase waste generators' understanding of the basis for credible waste characterizations

  9. Characterization of plant-derived carbon and phosphorus in lakes by sequential fractionation and NMR spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Shasha [College of Water Sciences, Beijing Normal University, Beijing 100875 (China); State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Zhu, Yuanrong, E-mail: zhuyuanrong07@mails.ucas.ac.cn [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Wu, Fengchang, E-mail: wufengchang@vip.skleg.cn [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Meng, Wei [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); He, Zhongqi [USDA-ARS Southern Regional Research Center, 1100 Robert E Lee Blvd, New Orleans, LA 70124 (United States); Giesy, John P. [State Key Laboratory of Environment Criteria and Risk Assessment, Chinese Research Academy of Environmental Sciences, Beijing 100012 (China); Department of Biomedical and Veterinary Biosciences and Toxicology Centre, University of Saskatchewan, Saskatoon, Saskatchewan (Canada)

    2016-10-01

    Although debris from aquatic macrophytes is one of the most important endogenous sources of organic matter (OM) and nutrients in lakes, its biogeochemical cycling and contribution to internal load of nutrients in eutrophic lakes are still poorly understood. In this study, sequential fractionation by H{sub 2}O, 0.1 M NaOH and 1.0 M HCl, combined with {sup 13}C and {sup 31}P NMR spectroscopy, was developed and used to characterize organic carbon (C) and phosphorus (P) in six aquatic plants collected from Tai Lake (Ch: Taihu), China. Organic matter, determined by total organic carbon (TOC), was unequally distributed in H{sub 2}O (21.2%), NaOH (29.9%), HCl (3.5%) and residual (45.3%) fractions. For P in debris of aquatic plants, 53.3% was extracted by H{sub 2}O, 31.9% by NaOH, and 11% by HCl, with 3.8% in residual fractions. Predominant OM components extracted by H{sub 2}O and NaOH were carbohydrates, proteins and aliphatic acids. Inorganic P (P{sub i}) was the primary form of P in H{sub 2}O fractions, whereas organic P (P{sub o}) was the primary form of P in NaOH fractions. The subsequent HCl fractions extracted fewer species of C and P. Some non-extractable carbohydrates, aromatics and metal phytate compounds remained in residual fractions. Based on sequential extraction and NMR analysis, it was proposed that those forms of C (54.7% of TOC) and P (96.2% of TP) in H{sub 2}O, NaOH and HCl fractions are potentially released to overlying water as labile components, while those in residues are stable and likely preserved in sediments of lakes. These results will be helpful in understanding internal loading of nutrients from debris of aquatic macrophytes and their recycling in lakes. - Highlights: • Sequential fractionation combined with NMR analysis was applied on aquatic plants. • Labile and stable C and P forms in aquatic plants were characterized. • 54.7% of OM and 96.2% of P in aquatic plants are potentially available. • 45.3% of OM and 3.8% of P in aquatic

  10. Timespacing competence

    DEFF Research Database (Denmark)

    Laursen, Helle Pia; Mogensen, Naja Dahlstrup

    2016-01-01

    -generated activity My linguistic world 2014, they are invited to map and talk about their lived experiences as multiple language users seen in the light of place and movement. By demythifying themselves and their linguistic worlds, the children also raise important questions about the notion of linguistic competence....... By perceiving competences from a subjective child perspective, we learn how children do what we call timespacing competence. On that basis, we suggest paying attention to how children themselves timespace competence by focusing (more consistently) on the subjective, social, spatial and temporal dimensions...

  11. NOM characterization and removal at six Southern African water treatment plants

    Directory of Open Access Journals (Sweden)

    J. Haarhoff

    2010-04-01

    Full Text Available Organic pollution is a major concern during drinking water treatment. Major challenges attributed to organic pollution include the proliferation of pathogenic micro-organisms, prevalence of toxic and physiologically disruptive organic micro-pollutants, and quality deterioration in water distribution systems. A major component of organic pollution is natural organic matter (NOM. The operational mechanisms of most unit processes are well understood. However, their interaction with NOM is still the subject of scientific research. This paper takes the form of a meta-study to capture some of the experiences with NOM monitoring and analysis at a number of Southern African Water Treatment Plants. It is written from the perspective of practical process selection, to try and coax some pointers from the available data for the design of more detailed pilot work. NOM was tracked at six water treatment plants using dissolved organic carbon (DOC measurements. Fractionation of the DOC based on biodegradability and molecular weight distribution was done at a water treatment plant in Namibia. A third fractionation technique using ion exchange resins was used to assess the impact of ozonation on DOC. DOC measurements alone did not give much insight into NOM evolution through the treatment train. The more detailed characterization techniques showed that different unit processes preferentially remove different NOM fractions. Therefore these techniques provide better information for process design and optimisation than the DOC measurement which is routinely done during full scale operation at these water treatment plants.

  12. Characterization of the damage of Spodoptera eridania (Cramer) and Spodoptera cosmioides (Walker) (Lepidoptera: Noctuidae) to structures of cotton plants

    OpenAIRE

    Santos, Karen B dos; Meneguim, Ana M; Santos, Walter J dos; Neves, Pedro M O J; Santos, Rachel B dos

    2010-01-01

    The cotton plant, Gossypium hirsutum, hosts various pests that damage different structures. Among these pests, Spodoptera cosmioides (Walker) and Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) are considered important. The objectives of this study were to characterize and to quantify the potential damage of S. eridania and S. cosmioides feeding on different structures of cotton plants. For this purpose, newly-hatched larvae were reared on the following plant parts: leaf and flower bud;...

  13. Characterization and Pathogenicity of Alternaria vanuatuensis, a New Record from Allium Plants in Korea and China.

    Science.gov (United States)

    Li, Mei Jia; Deng, Jian Xin; Paul, Narayan Chandra; Lee, Hyang Burm; Yu, Seung Hun

    2014-12-01

    Alternaria from different Allium plants was characterized by multilocus sequence analysis. Based on sequences of the β-tubulin (BT2b), the Alternaria allergen a1 (Alt a1), and the RNA polymerase II second largest subunit (RPB2) genes and phylogenetic data analysis, isolates were divided into two groups. The two groups were identical to representative isolates of A. porri (EGS48-147) and A. vanuatuensis (EGS45-018). The conidial characteristics and pathogenicity of A. vanuatuensis also well supported the molecular characteristics. This is the first record of A. vanuatuensis E. G. Simmons & C. F. Hill from Korea and China.

  14. Quality Assurance Program Plan for the Waste Isolation Pilot Plant Experimental-Waste Characterization Program

    International Nuclear Information System (INIS)

    1991-01-01

    This Quality Assurance Program Plan (QAPP) identifies the quality of data necessary to meet the specific objectives associated with the Department of Energy (DOE) Waste Isolation Pilot Plant (WIPP) Experimental-Waste Characterization Program (the Program). This experimental-waste characterization program is only one part of the WIPP Test Phase, both in the short- and long-term, to quantify and evaluate the characteristics and behavior of transuranic (TRU) wastes in the repository environment. Other parts include the bin-scale and alcove tests, drum-scale tests, and laboratory experiments. In simplified terms, the purpose of the Program is to provide chemical, physical, and radiochemical data describing the characteristics of the wastes that will be emplaced in the WIPP, while the remaining WIPP Test Phase is directed at examining the behavior of these wastes in the repository environment. 50 refs., 35 figs., 33 tabs

  15. Characterization of subjective uncertainty in the 1996 performance assessment for the Waste Isolation Pilot Plant

    International Nuclear Information System (INIS)

    HELTON, JON CRAIG; MARTELL, MARY-ALENA; TIERNEY, MARTIN S.

    2000-01-01

    The 1996 performance assessment (PA) for the Waste Isolation Pilot Plant (WIPP) maintains a separation between stochastic (i.e., aleatory) and subjective (i.e., epistemic) uncertainty, with stochastic uncertainty arising from the possible disruptions that could occur at the WIPP over the 10,000 yr regulatory period specified by the US Environmental Protection Agency (40 CFR 191,40 CFR 194) and subjective uncertainty arising from an inability to uniquely characterize many of the inputs required in the 1996 WIPP PA. The characterization of subjective uncertainty is discussed, including assignment of distributions, uncertain variables selected for inclusion in analysis, correlation control, sample size, statistical confidence on mean complementary cumulative distribution functions, generation of Latin hypercube samples, sensitivity analysis techniques, and scenarios involving stochastic and subjective uncertainty

  16. Isolation and characterization of 10 microsatellite loci in Cneorum tricoccon (Cneoraceae), a Mediterranean relict plant.

    Science.gov (United States)

    García-Fernández, Alfredo; Lázaro-Nogal, Ana; Traveset, Anna; Valladares, Fernando

    2012-08-01

    The main aim of this study was to isolate and characterize microsatellite loci in Cneorum tricoccon (Cneoraceae), a Mediterranean shrub relict of the early Tertiary, which inhabits western Mediterranean islands and coasts. Microsatellites will be useful for investigating biogeography and landscape genetics across the species distribution range, including current or past gene flow. Seventeen microsatellite loci were characterized, of which 10 were polymorphic and amplified for a total of 56 alleles in three populations of C. tricoccon. The markers revealed average coefficients of expected heterozygosity (H(e) = 0.425), observed heterozygosity (H(o) = 0.282), and inbreeding coefficient value per population (F(IS) = 0.408). These microsatellite primers will potentially be useful in the study of population and landscape genetics, conservation status of isolated populations, island-continental distribution, current or historical movements between populations, and in the investigation of the consequences of dispersal mechanisms of these plants.

  17. Characterization of subjective uncertainty in the 1996 performance assessment for the Waste Isolation Pilot Plant

    Energy Technology Data Exchange (ETDEWEB)

    HELTON,JON CRAIG; MARTELL,MARY-ALENA; TIERNEY,MARTIN S.

    2000-05-18

    The 1996 performance assessment (PA) for the Waste Isolation Pilot Plant (WIPP) maintains a separation between stochastic (i.e., aleatory) and subjective (i.e., epistemic) uncertainty, with stochastic uncertainty arising from the possible disruptions that could occur at the WIPP over the 10,000 yr regulatory period specified by the US Environmental Protection Agency (40 CFR 191,40 CFR 194) and subjective uncertainty arising from an inability to uniquely characterize many of the inputs required in the 1996 WIPP PA. The characterization of subjective uncertainty is discussed, including assignment of distributions, uncertain variables selected for inclusion in analysis, correlation control, sample size, statistical confidence on mean complementary cumulative distribution functions, generation of Latin hypercube samples, sensitivity analysis techniques, and scenarios involving stochastic and subjective uncertainty.

  18. CHARACTERIZATION AND MODELING OF THE FORMS OF MERCURY FROM COAL-FIRED POWER PLANTS

    Energy Technology Data Exchange (ETDEWEB)

    Dennis L. Laudal

    2001-08-01

    The 1990 Clean Air Act Amendments (CAAAs) required the U.S. Environmental Protection Agency (EPA) to determine whether the presence of mercury in the stack emissions from fossil fuel-fired electric utility power plants poses an unacceptable public health risk. EPA's conclusions and recommendations were presented in the Mercury Study Report to Congress (1) and the Utility Air Toxics Report to Congress (1). The first report addressed both the human health and environmental effects of anthropogenic mercury emissions, while the second addressed the risk to public health posed by the emission of mercury and other hazardous air pollutants from steam-electric generating units. Given the current state of the art, these reports did not state that mercury controls on coal-fired electric power stations would be required. However, they did indicate that EPA views mercury as a potential threat to human health. In fact, in December 2000, the EPA issued an intent to regulate for mercury from coal-fired boilers. However, it is clear that additional research needs to be done in order to develop economical and effective mercury control strategies. To accomplish this objective, it is necessary to understand mercury behavior in coal-fired power plants. The markedly different chemical and physical properties of the different mercury forms generated during coal combustion appear to impact the effectiveness of various mercury control strategies. The original Characterization and Modeling of the Forms of Mercury from Coal-Fired Power Plants project had two tasks. The first was to collect enough data such that mercury speciation could be predicted based on relatively simple inputs such as coal analyses and plant configuration. The second was to field-validate the Ontario Hydro mercury speciation method (at the time, it had only been validated at the pilot-scale level). However, after sampling at two power plants (the Ontario Hydro method was validated at one of them), the EPA issued

  19. Adjudicative Competence

    Science.gov (United States)

    Dawes, Sharron E.; Palmer, Barton W.; Jeste, Dilip V.

    2008-01-01

    Purpose of review Although the basic standards of adjudicative competence were specified by the U.S. Supreme Court in 1960, there remain a number of complex conceptual and practical issues in interpreting and applying these standards. In this report we provide a brief overview regarding the general concept of adjudicative competence and its assessment, as well as some highlights of recent empirical studies on this topic. Findings Most adjudicative competence assessments are conducted by psychiatrists or psychologists. There are no universal certification requirements, but some states are moving toward required certification of forensic expertise for those conducting such assessments. Recent data indicate inconsistencies in application of the existing standards even among forensic experts, but the recent publication of consensus guidelines may foster improvements in this arena. There are also ongoing efforts to develop and validate structured instruments to aid competency evaluations. Telemedicine-based competency interviews may facilitate evaluation by those with specific expertise for evaluation of complex cases. There is also interest in empirical development of educational methods to enhance adjudicative competence. Summary Adjudicative competence may be difficult to measure accurately, but the assessments and tools available are advancing. More research is needed on methods of enhancing decisional capacity among those with impaired competence. PMID:18650693

  20. Outsourcing competence

    NARCIS (Netherlands)

    Bergstra, J.; Delen, G.; van Vlijmen, B.

    2011-01-01

    The topic of this paper, competences needed for outsourcing, is organized by first providing a generic competence scheme, which is subsequently instantiated to the area of sourcing and outsourcing. Sourcing and outsourcing are positioned as different areas of activity, neither one of which is

  1. Ensemble Clustering Classification Applied to Competing SVM and One-Class Classifiers Exemplified by Plant MicroRNAs Data

    Directory of Open Access Journals (Sweden)

    Yousef Malik

    2016-12-01

    Full Text Available The performance of many learning and data mining algorithms depends critically on suitable metrics to assess efficiency over the input space. Learning a suitable metric from examples may, therefore, be the key to successful application of these algorithms. We have demonstrated that the k-nearest neighbor (kNN classification can be significantly improved by learning a distance metric from labeled examples. The clustering ensemble is used to define the distance between points in respect to how they co-cluster. This distance is then used within the framework of the kNN algorithm to define a classifier named ensemble clustering kNN classifier (EC-kNN. In many instances in our experiments we achieved highest accuracy while SVM failed to perform as well. In this study, we compare the performance of a two-class classifier using EC-kNN with different one-class and two-class classifiers. The comparison was applied to seven different plant microRNA species considering eight feature selection methods. In this study, the averaged results show that EC-kNN outperforms all other methods employed here and previously published results for the same data. In conclusion, this study shows that the chosen classifier shows high performance when the distance metric is carefully chosen.

  2. Competence Building

    DEFF Research Database (Denmark)

    Borrás, Susana; Edquist, Charles

    The main question that guides this paper is how governments are focusing (and must focus) on competence building (education and training) when designing and implementing innovation policies. With this approach, the paper aims at filling the gap between the existing literature on competences...... on the one hand, and the real world of innovation policy-making on the other, typically not speaking to each other. With this purpose in mind, this paper discusses the role of competences and competence-building in the innovation process from a perspective of innovation systems; it examines how governments...... and public agencies in different countries and different times have actually approached the issue of building, maintaining and using competences in their innovation systems; it examines what are the critical and most important issues at stake from the point of view of innovation policy, looking particularly...

  3. Ames expedited site characterization demonstration at the former manufactured gas plant site, Marshalltown, Iowa

    International Nuclear Information System (INIS)

    Bevolo, A.J.; Kjartanson, B.H.; Wonder, J.D.

    1996-03-01

    The goal of the Ames Expedited Site Characterization (ESC) project is to evaluate and promote both innovative technologies (IT) and state-of-the-practice technologies (SOPT) for site characterization and monitoring. In April and May 1994, the ESC project conducted site characterization, technology comparison, and stakeholder demonstration activities at a former manufactured gas plant (FMGP) owned by Iowa Electric Services (IES) Utilities, Inc., in Marshalltown, Iowa. Three areas of technology were fielded at the Marshalltown FMGP site: geophysical, analytical and data integration. The geophysical technologies are designed to assess the subsurface geological conditions so that the location, fate and transport of the target contaminants may be assessed and forecasted. The analytical technologies/methods are designed to detect and quantify the target contaminants. The data integration technology area consists of hardware and software systems designed to integrate all the site information compiled and collected into a conceptual site model on a daily basis at the site; this conceptual model then becomes the decision-support tool. Simultaneous fielding of different methods within each of the three areas of technology provided data for direct comparison of the technologies fielded, both SOPT and IT. This document reports the results of the site characterization, technology comparison, and ESC demonstration activities associated with the Marshalltown FMGP site. 124 figs., 27 tabs

  4. Cloning and functional characterization of MusaVND1 using transgenic banana plants.

    Science.gov (United States)

    Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

    2015-06-01

    Vascular related NAC (NAM, ATAF and CUC) domain-containing genes regulate secondary wall deposition and differentiation of xylem vessel elements. MusaVND1 is an ortholog of Arabidopsis VND1 and contains the highly conserved NAC domain. The expression of MusaVND1 is highest in developing corm and during lignification conditions, the increase in expression of MusaVND1 coincides with the expression of PAL, COMT and C4H genes. MusaVND1 encodes a nuclear localized protein as MusaVND1-GFP fusion protein gets localized to nucleus. Transient overexpression of MusaVND1 converts banana embryogenic cells to xylem vessel elements, with a final differentiation frequency of 33.54% at the end of tenth day. Transgenic banana plants overexpressing MusaVND1 showed stunted growth and were characterized by PCR and Southern blot analysis. Transgenic banana plants showed transdifferentiation of various types of cells into xylem vessel elements and ectopic deposition of lignin in cells of various plant organs such as leaf and corm. Tracheary element formation was seen in the cortical region of transgenic corm as well as in epidermal cells of leaves. Biochemical analysis indicates significantly higher levels of lignin and cellulose content in transgenic banana lines than control plants. MusaVND1 overexpressing transgenic banana plants showed elevated expression levels of genes involved in lignin and cellulose biosynthesis pathway. Further expression of different MYB transcription factors positively regulating secondary wall deposition was also up regulated in MusaVND1 transgenic lines.

  5. Radiological and chemical characterization report for the planned Quarry Construction Staging Area and Water Treatment Plant: Revision 1

    International Nuclear Information System (INIS)

    1989-03-01

    The Quarry Construction Staging Area and Water Treatment Plant (QCSA) will be used in the support of the bulk waste removal of the Weldon Spring Quarry. Radiological and chemical characterization was performed on a 12 acre site where the QCSA will be constructed. The characterization revealed approximately .5 acres of radiologically contaminated land. No chemical contamination was found. 8 refs., 5 figs., 7 tabs

  6. Nuclear safety and human competence

    International Nuclear Information System (INIS)

    Stefanescu, Petre

    2001-01-01

    Competence represents a very well defined ensemble of knowledge and skills, behavior modalities, standard procedures and judgement types that can be used in a given situation, without a priori learning. It is obvious that a person competence should fulfill the needs of the company he works for. For a Nuclear Power Plant operator competence is a constitutive part of his individuality. Competence includes: 1. Knowledge that can be classified in three main items: - procedural and declarative knowledge; - practical knowledge and skills; - fundamental knowledge. 2. 'Non cognitive' knowledge components, such as 'social information', team collective competence, safety education, risks perception and management. The last item presents a special interest for nuclear safety. On the other hand, competence level defines the quality of procedures applied in different operational situations. Competence - procedures relations are presented. Competence fundament results from operator activity analysis. The analyst has to take into consideration several phases of activity in which competence is highlighted like: - genesis, during formation; - transformation, during adaptation to a technical modification; - transfer, from expert to probationer. Competence is subject to a continuous transformation process due to technical and organizational evolutions and 'operator ageing'. Cognitive ageing of operators or the technical ageing of competence often appear to be superimposed. Technical progress acceleration increases the ageing effects of competence. Knowledge - skills dynamic relations are discussed. The changing of organizational form determines appearance of new competence gained from others domains or defined by multidisciplinary studies. Ergonomics can help the changing of organizational form through analysis of operators evolution activity which will generate new competence. Ergonomics can contribute to identify means of raising competence starting from learning process

  7. Biochemical characterization of systemic bacteria in bananas, sensitivity to antibiotics and plant phytotoxicity during shoot proliferation

    Directory of Open Access Journals (Sweden)

    Janiffe Peres de Oliveira

    2016-04-01

    Full Text Available The objective of this work was to characterize the biochemically systemic bacterial isolated from banana plants, to evaluate the bacterial sensitivity to antibiotics, and to determine the phytotoxicity of banana shoots during in vitro proliferation. Systemic bacteria belonging to the Klebsiella and Aeromonas genera were isolated from the “Maravilha” (FHIA 01 AAAB, “Preciosa” (PV 4285 AAAB and “Thap Maeo” (AAB varieties and were then characterized. Tests of shoot sensitivity to antibiotics were performed, and the minimum inhibitory concentration (MIC and phytotoxic effects of selected antibiotics to plants were determined. Among the 20 antibiotics evaluated, the strains showed sensitivity to cefaclor, cefalexin, cefalotin, nalidixic acid, chloramphenicol, and vancomycin. However, during MIC determination, the best results were obtained with cefaclor, vancomycin or nalidixic acid alone in concentrations ranging from 512 to 1,024 mg L-1. In culture medium, cefaclor at 1,024 mg L-1 was the only antibiotic to affect the multiplication and the shoot survival in culture.

  8. Characterization of plant polysaccharides from Dendrobium officinale by multiple chromatographic and mass spectrometric techniques.

    Science.gov (United States)

    Ma, Huiying; Zhang, Keke; Jiang, Qing; Dai, Diya; Li, Hongli; Bi, Wentao; Chen, David Da Yong

    2018-04-27

    Plant polysaccharides have numerous medicinal functions. Due to the differences in their origins, regions of production, and cultivation conditions, the quality and the functions of polysaccharides can vary significantly. They are macromolecules with large molecular weight (MW) and complex structure, and pose great challenge for the analytical technology used. Taking Dendrobium officinale (DO) from various origins and locations as model samples. In this investigation, mechanochemical extraction method was used to successfully extract polysaccharides from DO using water as solvent, the process is simple, fast (40 s) and with high yield. The MWs of the intact saccharides from calibration curve and light scattering measurement were determined and compared after separation with size exclusion chromatography (SEC). The large polysaccharide was acid hydrolyzed to oligosaccharides and the products were efficiently separated and identified using liquid chromatography coupled to a high resolution tandem mass spectrometry (LC-MS 2 ). Obvious differences were observed among LC-MS 2 chromatograms of digested products, and the chemical structures for the products were proposed based on accurate mass values. More importantly, isomeric digested carbohydrate compounds were explored and characterized. All the chromatographic and mass spectrometric results in this study provided a multi-dimensional characterization, fingerprint analysis, and molecular structure level assessment of plant polysaccharides. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil.

    Science.gov (United States)

    Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F

    2014-03-03

    This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Expression and characterization of plant aspartic protease nepenthesin-1 from Nepenthes gracilis.

    Science.gov (United States)

    Kadek, Alan; Tretyachenko, Vyacheslav; Mrazek, Hynek; Ivanova, Ljubina; Halada, Petr; Rey, Martial; Schriemer, David C; Man, Petr

    2014-03-01

    Carnivorous plants of the genus Nepenthes produce their own aspartic proteases, nepenthesins, to digest prey trapped in their pitchers. Nepenthesins differ significantly in sequence from other aspartic proteases in the animal or even plant kingdoms. This difference, which also brings more cysteine residues into the structure of these proteases, can be a cause of uniquely high temperature and pH stabilities of nepenthesins. Their detailed structure characterization, however, has not previously been possible due to low amounts of protease present in the pitcher fluid and also due to limited accessibility of Nepenthes plants. In the present study we describe a convenient way for obtaining high amounts of nepenthesin-1 from Nepenthes gracilis using heterologous production in Escherichia coli. The protein can be easily refolded in vitro and its characteristics are very close to those described for a natural enzyme isolated from the pitcher fluid. Similarly to the natural enzyme, recombinant nepenthesin-1 is sensitive to denaturing and reducing agents. It also has maximal activity around pH 2.5, shows unusual stability at high pH and its activity is not irreversibly inhibited even after prolonged incubation in the basic pH range. On the other hand, temperature stability of the recombinant enzyme is lower in comparison with the natural enzyme, which can be attributed to missing N-glycosylation in the recombinant protein. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Isolation, Characterization, and Genetic Diversity of Ice Nucleation Active Bacteria on Various Plants

    Directory of Open Access Journals (Sweden)

    DIANA ELIZABETH WATURANGI

    2009-06-01

    Full Text Available Ice nucleation active (INA bacteria is a group of bacteria with the ability to catalyze the ice formation at temperature above -10 °C and causing frost injury in plants. Since, most of the literature on INA bacteria were from subtropical area, studies of INA bacteria from tropical area are needed. We sampled eight fruits and 36 leaves of 21 plant species, and then identified through biochemical and genetic analysis. INA bacteria were characterized for INA protein classification, pH stability, and optimization of heat endurance. We discovered 15 INA bacteria from seven plants species. Most of bacteria are oxidase and H2S negative, catalase and citrate positive, gram negative, and cocoid formed. These INA bacteria were classified in to three classes based on their freezing temperature. Most of the isolates were active in heat and pH stability assay. Some isolates were analysed for 16S rRNA gene. We observed that isolates from Morinda citrifolia shared 97% similiarity with Pseudomonas sp. Isolate from Piper betle shared 93% similarity with P. pseudoalcaligenes. Isolate from Carica papaya shared 94% similarity with Pseudomonas sp. While isolate from Fragaria vesca shared 90% similarity with Sphingomonas sp.

  12. Isolation, Characterization, and Genetic Diversity of Ice Nucleation Active Bacteria on Various Plants

    Directory of Open Access Journals (Sweden)

    DIANA ELIZABETH WATURANGI

    2009-06-01

    Full Text Available Ice nucleation active (INA bacteria is a group of bacteria with the ability to catalyze the ice formation at temperature above -10 oC and causing frost injury in plants. Since, most of the literature on INA bacteria were from subtropical area, studies of INA bacteria from tropical area are needed. We sampled eight fruits and 36 leaves of 21 plant species, and then identified through biochemical and genetic analysis. INA bacteria were characterized for INA protein classification, pH stability, and optimization of heat endurance. We discovered 15 INA bacteria from seven plants species. Most of bacteria are oxidase and H2S negative, catalase and citrate positive, gram negative, and cocoid formed. These INA bacteria were classified in to three classes based on their freezing temperature. Most of the isolates were active in heat and pH stability assay. Some isolates were analysed for 16S rRNA gene. We observed that isolates from Morinda citrifolia shared 97% similiarity with Pseudomonas sp. Isolate from Piper betle shared 93% similarity with P. pseudoalcaligenes. Isolate from Carica papaya shared 94% similarity with Pseudomonas sp. While isolate from Fragaria vesca shared 90% similarity with Sphingomonas sp.

  13. Biological assessment for rare and endangered plant species: Related to CERCLA characterization activities

    International Nuclear Information System (INIS)

    Sackschewsky, M.R.

    1992-04-01

    Environmental characterization in support of hazardous, radioactive, and mixed waste cleanup (in accordance with the Comprehensive Environmental Response, Compensation, and Liability Act of 1980) can involve a large number of both nonintrusive and intrusive activities. Many of these activities could have a detrimental impact on listed plant species. These impacts can be minimized by following simple conservation policies while conducting the various field activities. For instance, frequent off-road vehicular traffic and have a severe impact on native habitats and, therefore, should be kept to a minimum. Personnel performing the field activities should be trained to preserve, respect, and minimize their impact on native habitat while performing work in the field. In addition, areas where sampling is planned should be surveyed for the presence of listed plant species before the initiation of the field activities. Extremely distributed areas could be exempted from this requirement provided adequate habitat assessments have been performed by qualified personnel. Twelve special status plant species are known to survive on or very near the Hanford Site. None of these species currently are listed as Federal Threatened or Endangered Species. However, four local species currently are candidates for federal protection. These species are the Northern Wormwood (Artemisia campestris ssp. borealis var. wormskioldii), Persistantsepal Yellowcress (Rorippa columbiae), Hoover's Desert Parsley (Lomatium tuberosum), and Columbia Milkvetch (Astragalus columbianus)

  14. Former manufactured gas plants of Missouri: 19th century enigmas of today's site and waste characterization

    International Nuclear Information System (INIS)

    Hatheway, A.W.; Anderson, D.R.

    1993-01-01

    Missouri's first gas works began operation in 1845 (St. Louis). By 1900, gas works operated in many northern-Missouri coal belt towns, major cities, and Hannibal and Cape Girardeau (Mississippi River supply). Today's 40-odd former manufactured gas plant (FMPGs) sites are fiscal nightmares for parent utility companies; all hazardous waste groups are prevalent to the plants. Tar residuals may migrate along/through geologic anomalies. Tar-water emulsions typically were disposed in tar wells or nearby drainages or many times plumbed directly into sewers, which typically leaked into the environment at unpredictable down gradient locations. Just as well site geologic characteristics and current groundwater usage may render FMPGs relatively harmless from the human exposure standpoint. Geologic deduction, photo interpretation, careful subsurface exploration and engineering geophysics can locate hot spots and delimit contaminant migration. Many types of historic documents chronicle changes in plant character and equipment, as well as mode of operation. Without such details, mistakes in characterization are likely and errors in risk assessment and selection of remedial technologies are possible

  15. Functional characterization of the Gentiana lutea zeaxanthin epoxidase (GlZEP) promoter in transgenic tomato plants.

    Science.gov (United States)

    Yang, Qingjie; Yuan, Dawei; Shi, Lianxuan; Capell, Teresa; Bai, Chao; Wen, Nuan; Lu, Xiaodan; Sandmann, Gerhard; Christou, Paul; Zhu, Changfu

    2012-10-01

    The accumulation of carotenoids in plants depends critically on the spatiotemporal expression profiles of the genes encoding enzymes in the carotenogenic pathway. We cloned and characterized the Gentiana lutea zeaxanthin epoxidase (GlZEP) promoter to determine its role in the regulation of carotenogenesis, because the native gene is expressed at high levels in petals, which contain abundant chromoplasts. We transformed tomato (Solanum lycopersicum cv. Micro-Tom) plants with the gusA gene encoding the reporter enzyme β-glucuronidase (GUS) under the control of the GlZEP promoter, and investigated the reporter expression profile at the mRNA and protein levels. We detected high levels of gusA expression and GUS activity in chromoplast-containing flowers and fruits, but minimal levels in immature fruits containing green chloroplasts, in sepals, leaves, stems and roots. GlZEP-gusA expression was strictly associated with fruit development and chromoplast differentiation, suggesting an evolutionarily-conserved link between ZEP and the differentiation of organelles that store carotenoid pigments. The impact of our results on current models for the regulation of carotenogenesis in plants is discussed.

  16. Spatially resolved investigation of competing nanocluster emission in quantum-disks-in-nanowires structure characterized by nanoscale cathodoluminescence

    KAUST Repository

    Prabaswara, Aditya; Stowe, David J.; Janjua, Bilal; Ng, Tien Khee; Anjum, Dalaver H.; Longo, Paolo; Zhao, Chao; Elafandy, Rami T.; Li, Xiaohang; Alyamani, Ahmed Y.; El-Desouki, Munir M.; Ooi, Boon S.

    2017-01-01

    We report on the study and characterization of nanoclusters-related recombination centers within quantum-disks-in-nanowires heterostructure by utilizing microphotoluminescence (mu-PL) and cathodoluminescence scanning transmission electron microscopy (CL-STEM). mu-PL measurement shows that the nanoclusters-related recombination center exhibits different temperature-dependent characteristics compared with the surrounding InGaN quantum-disksrelated recombination center. CL-STEM measurements reveal that these recombination centers mainly arise from irregularities within the quantum disks, with a strong, spatially localized emission when measured at low temperature. The spectra obtained from both CL-STEM and mu-PL correlate well with each other. Our work sheds light on the optical and structural properties of simultaneously coexisting recombination centers within nanowires heterostructures. (C) The Authors. Published by SPIE under a Creative Commons Attribution 3.0 Unported License. Distribution or reproduction of this work in whole or in part requires full attribution of the original publication, including its DOI.

  17. Spatially resolved investigation of competing nanocluster emission in quantum-disks-in-nanowires structure characterized by nanoscale cathodoluminescence

    KAUST Repository

    Prabaswara, Aditya

    2017-06-30

    We report on the study and characterization of nanoclusters-related recombination centers within quantum-disks-in-nanowires heterostructure by utilizing microphotoluminescence (mu-PL) and cathodoluminescence scanning transmission electron microscopy (CL-STEM). mu-PL measurement shows that the nanoclusters-related recombination center exhibits different temperature-dependent characteristics compared with the surrounding InGaN quantum-disksrelated recombination center. CL-STEM measurements reveal that these recombination centers mainly arise from irregularities within the quantum disks, with a strong, spatially localized emission when measured at low temperature. The spectra obtained from both CL-STEM and mu-PL correlate well with each other. Our work sheds light on the optical and structural properties of simultaneously coexisting recombination centers within nanowires heterostructures. (C) The Authors. Published by SPIE under a Creative Commons Attribution 3.0 Unported License. Distribution or reproduction of this work in whole or in part requires full attribution of the original publication, including its DOI.

  18. Role and structural characterization of plant aldehyde dehydrogenases from family 2 and family 7.

    Science.gov (United States)

    Končitíková, Radka; Vigouroux, Armelle; Kopečná, Martina; Andree, Tomáš; Bartoš, Jan; Šebela, Marek; Moréra, Solange; Kopečný, David

    2015-05-15

    Aldehyde dehydrogenases (ALDHs) are responsible for oxidation of biogenic aldehyde intermediates as well as for cell detoxification of aldehydes generated during lipid peroxidation. So far, 13 ALDH families have been described in plants. In the present study, we provide a detailed biochemical characterization of plant ALDH2 and ALDH7 families by analysing maize and pea ALDH7 (ZmALDH7 and PsALDH7) and four maize cytosolic ALDH(cALDH)2 isoforms RF2C, RF2D, RF2E and RF2F [the first maize ALDH2 was discovered as a fertility restorer (RF2A)]. We report the crystal structures of ZmALDH7, RF2C and RF2F at high resolution. The ZmALDH7 structure shows that the three conserved residues Glu(120), Arg(300) and Thr(302) in the ALDH7 family are located in the substrate-binding site and are specific to this family. Our kinetic analysis demonstrates that α-aminoadipic semialdehyde, a lysine catabolism intermediate, is the preferred substrate for plant ALDH7. In contrast, aromatic aldehydes including benzaldehyde, anisaldehyde, cinnamaldehyde, coniferaldehyde and sinapaldehyde are the best substrates for cALDH2. In line with these results, the crystal structures of RF2C and RF2F reveal that their substrate-binding sites are similar and are formed by an aromatic cluster mainly composed of phenylalanine residues and several nonpolar residues. Gene expression studies indicate that the RF2C gene, which is strongly expressed in all organs, appears essential, suggesting that the crucial role of the enzyme would certainly be linked to the cell wall formation using aldehydes from phenylpropanoid pathway as substrates. Finally, plant ALDH7 may significantly contribute to osmoprotection because it oxidizes several aminoaldehydes leading to products known as osmolytes.

  19. Identification and Characterization of Novel Plant Adenylate Cyclases – The Arabidopsis Thaliana Potassium Uptake Permeases

    KAUST Repository

    Al-Younis, Inas M.

    2018-05-01

    Adenylyl Cyclases (ACs) catalyze the formation of the key universal second messenger adenosine 3’, 5’-cyclic monophosphate (cAMP) from adenosine 5’- triphosphate. Cyclic AMP participates in several signal transduction pathways and is present in bacteria and higher and lower eukaryotes including higher plants. Previous studies in plants have shown a role for cAMP in signal transduction during e.g. the cell cycle, elongation of the pollen tube and stimulation of protein kinase activity. More recently cAMP has been shown to play a role in stress responses. Interestingly, cAMP has also been shown to regulate ion transport in plant cells. Here we used a similar strategy that led to the discovery of the first guanylyl cyclase in plants that was based on the alignment of conserved and functionally assigned amino acids in the catalytic centre of annotated nucleotide cyclases from lower and higher eukaryotes, to identify a novel candidate ACs in Arabidopsis (Arabidopsis thaliana K+ Uptake 5 and 7). ATKUP5 and 7 are homologous to K+ uptake permeases (KUPs) from bacteria and high-affinity K+ transporters (HAKs) from fungi. The AC activity was investigated by recombinantly expressing the ATKUP5 and 7 AC domain in vitro and by complementation of an E. coli AC mutant (cyaA). Furthermore, ATKUP5 was tested for its ability to functionally complement a yeast mutant deficient in Trk1 and Trk2 high affinity potassium uptake transporters. Site-mutagenesis in the AC domain was used to test the effect of both functions in each other. Furthermore, ATKUP5 was characterized electrophysiologically in HEK-293 cells to characterize the nature of this transporter. The localization of the ATKUP5 in Arabidopsis was examined using a Green Fluorescent Protein (GFP) fusion with the ATKUP5 to determine whether ATKUP5 is expressed at the plasma or tonoplast membrane. Arabiodpsis thaliana of the wild type, overexpressing ATKUP5 and atkup5 mutant lines were used to examine phenotypic differences.

  20. Atmospherical experiment in Angra I plant for characterizing the effluent transport threw in the atmospheric

    International Nuclear Information System (INIS)

    Silva Lobo, M.A. da; Kronemberger, B.M.E.

    1989-01-01

    Available as short communication only. The Environmental Safety Division of the Nuclear Safety and Fuel Department from FURNAS Electric Station S.A. joint with the National Oceanic and Atmospheric Administration (NOAA), achieved a field experiment for characterizing the atmospheric transport and diffusion in the site complex of Angra I Nuclear Power Plant. The complex topography with the thick vegetation and the neighbour building bring problems for the modelling of the effluent transport and the dispersion. The actual meteorological measure system is automatic and compound with four towers. An intensive atmospheric measure with captive balloon is included, and the collected data shows that the site flux is strongly influenced by the topography and insolation. (C.G.C.). 2 figs

  1. Quality Assurance Program Plan for the Waste Isolation Pilot Plant Experimental-Waste Characterization Program

    International Nuclear Information System (INIS)

    1991-01-01

    This Quality Assurance Program Plan (QAPP) identifies the quality of data necessary to meet the specific objectives associated with the Department of Energy (DOE) Waste Isolation Pilot Plant (WIPP) Experimental-Waste Characterization Program (the Program). DOE plans to conduct experiments in the WIPP during a Test Phase of approximately 5 years. These experiments will be conducted to reduce the uncertainties associated with the prediction of several processes (e.g., gas generation) that may influence repository performance. The results of the experiments will be used to assess the ability of the WIPP to meet regulatory requirements for the long-term protection of human health and the environment from the disposal of TRU wastes. 37 refs., 25 figs., 18 tabs

  2. Mineralogical, Microstructural and Thermal Characterization of Coal Fly Ash Produced from Kazakhstani Power Plants

    Science.gov (United States)

    Tauanov, Z.; Abylgazina, L.; Spitas, C.; Itskos, G.; Inglezakis, V.

    2017-09-01

    Coal fly ash (CFA) is a waste by-product of coal combustion. Kazakhstan has vast coal deposits and is major consumer of coal and hence produces huge amounts of CFA annually. The government aims to recycle and effectively utilize this waste by-product. Thus, a detailed study of the physical and chemical properties of material is required as the data available in literature is either outdated or not applicable for recently produced CFA samples. The full mineralogical, microstructural and thermal characterization of three types of coal fly ash (CFA) produced in two large Kazakhstani power plants is reported in this work. The properties of CFAs were compared between samples as well as with published values.

  3. Characterization and constructive utilization of sludge produced in clari-flocculation unit of water treatment plant

    Science.gov (United States)

    Ahmad, Tarique; Ahmad, Kafeel; Alam, Mehtab

    2018-03-01

    All water treatment plants produce waste/residue amid the treatment of raw water. This study selectively investigates the clariflocculator sludge for its physicochemical characteristics and potential reuse options. Sieve analysis, XRF, SEM, XRD, FTIR, and TG-DTA instrumental techniques have been used to characterize the sludge sample. Results show that clariflocculator sludge contains about 78% fine sand having grain size range 150-75 μm. SiO2, Al2O3, Fe2O3 and CaO constitute the maximum percentage of chemical compounds present in the sludge and quartz is the main crystalline phase of the sludge. Recycling and reuse of this sludge, especially, as fine sand in preparing mortar, concrete mix and other civil engineering products would pave the way for constructive utilization with safe and sustainable sludge management strategies.

  4. Characterization and mass balance of trace elements in an iron ore sinter plant

    Directory of Open Access Journals (Sweden)

    Lucas Ladeira Lau

    2016-04-01

    Full Text Available Environmental legislation is becoming more restrictive in several industrial sectors, especially in the steel industry, which is well known for its large pollution potential. With the recent growth of interest in effects of trace elements on the environment and health, the inclusion of emission limits on these elements in this legislation has become increasingly popular. This article aims to describe the partitioning of trace elements between the products (sinter and plant emissions in an iron ore sinter plant, aiming to better understand the behavior of these elements in the sintering process to eventually support interventions to modify these partitions. Chemical characterization of several sintering inputs was initially performed, revealing that the steel-making residues contained large concentrations of trace elements, whereas low concentrations were observed in the flux. Based on the trace element concentrations, we analyzed the injection of trace elements in a sintering pilot using a sintering mixture. Mass balance was then used to determine the theoretical partitioning of trace elements in the sinter and emissions; cadmium, nickel, lead, mercury, and copper exhibited greater tendencies to concentrate in atmospheric emissions.

  5. Characterization of the In Situ Ecophysiology of Novel Phylotypes in Nutrient Removal Activated Sludge Treatment Plants.

    Directory of Open Access Journals (Sweden)

    Simon Jon McIlroy

    Full Text Available An in depth understanding of the ecology of activated sludge nutrient removal wastewater treatment systems requires detailed knowledge of the community composition and metabolic activities of individual members. Recent 16S rRNA gene amplicon surveys of activated sludge wastewater treatment plants with nutrient removal indicate the presence of a core set of bacterial genera. These organisms are likely responsible for the bulk of nutrient transformations underpinning the functions of these plants. While the basic activities of some of these genera in situ are known, there is little to no information for the majority. This study applied microautoradiography coupled with fluorescence in situ hybridization (MAR-FISH for the in situ characterization of selected genus-level-phylotypes for which limited physiological information is available. These included Sulfuritalea and A21b, both within the class Betaproteobacteria, as well as Kaga01, within sub-group 10 of the phylum Acidobacteria. While the Sulfuritalea spp. were observed to be metabolically versatile, the A21b and Kaga01 phylotypes appeared to be highly specialized.

  6. Nuclear energy can compete, industry watchers say

    International Nuclear Information System (INIS)

    Cash, C.J.

    1995-01-01

    Nuclear power plants with outstanding operating records and cost-conscious management can continue to compete with other forms of generation as the electricity business becomes more competitive. Natural gas-fired units will set the pricing standard with which nuclear power plants must compete

  7. Characterization of acetate-utilizing methanogenic bacteria, depending on varying acetate concentrations, in a biogas plant. Phase 1

    International Nuclear Information System (INIS)

    Ahring, B.K.

    1994-12-01

    The present report contains the results of a project concerning behaviour of acetate-utilizing methanogenic bacteria in mesophilic and thermophilic biogas plants, collected in 1992 - 1994 period. Labelled acetates (2-C 14 -CH 3 COOH) have been used to characterize the types of methane bacteria populations in the Danish biogas plants, the optimum acetate concentration for these bacteria and acetate metabolism in mesophilic and thermophilic biogas reactors with low acetate concentrations. 2 publications are included. (EG)

  8. Dosimetry Characterization of the Neutron Fields of the Intermediate Temporary Storage of the Trillo Nuclear Power Plant

    International Nuclear Information System (INIS)

    Campo Blanco, X.

    2015-01-01

    The Neutron Standards Laboratory of CIEMAT, in collaboration with the Trillo Nuclear Power Plant, has conducted a detailed dosimetric and spectrometric characterization of the neutron fields at the Intermediate Temporary Storage of the Trillo Nuclear Power Plant, as well as the neutron fields of ENSA-DPT spent fuel casks. For neutron measurements, neutron monitors and a Bonner spheres spectrometry system have been used. In addition, a Monte Carlo model of the installation and the cask has been developed and validated.

  9. Desarrollo de la competencia determinación sistemática de organismos vegetales en la formación inicial de docentes Developing systematic plant organism identification competence in teachers’ training

    Directory of Open Access Journals (Sweden)

    Julio Cesar Rifá Téllez

    2016-09-01

    Full Text Available The article describes the structure of a model for developing systematic plant organism identification competence in Biology-Geography teachers’ training. The research implies not only the study of art, but historical and logical analysis and synthesis, induction and deduction, and modeling as main methods. The model includes tree subsystems: phytocultural appropriation, phytoreferential activation of knowledge and formative contextualization. The two first subsystems are complementary and subordinated to the third in the university environment, resulting in the acquisition of new meanings, personal sense strengthening, and integration of specialized methods and stimulating the use of theoretical and practices tools. The synergy develops a new quality in trainees: the independence in systematic plant organism identification and classification of plants under study in the teaching-learning process he is leading; as well as the accurate professional ability to employ the identity of these elements of plant diversity and its position in taxonomic systems aside from their constant refining

  10. Bacterial Structure and Characterization of Plant Growth Promoting and Oil Degrading Bacteria from the Rhizospheres of Mangrove Plants

    NARCIS (Netherlands)

    do Carmo, Flavia Lima; dos Santos, Henrique Fragoso; Martins, Edir Ferreira; van Elsas, Jan Dirk; Rosado, Alexandre Soares; Peixoto, Raquel Silva

    Most oil from oceanic spills converges on coastal ecosystems, such as mangrove forests, which are threatened with worldwide disappearance. Particular bacteria that inhabit the rhizosphere of local plant species can stimulate plant development through various mechanisms; it would be advantageous if

  11. Probabilistic environmental risk characterization of pharmaceuticals in sewage treatment plant discharges.

    Science.gov (United States)

    Christensen, Anne Munch; Markussen, Bo; Baun, Anders; Halling-Sørensen, Bent

    2009-10-01

    The occurrence of pharmaceuticals in different water bodies and the findings of effects on aquatic organisms in ecotoxicity tests have raised concerns about environmental risks of pharmaceuticals in receiving waters. Due to the fact that the amount of ecotoxicological studies has increased significantly during the last decade, probabilistic approaches for risk characterization of these compounds may be feasible. This approach was evaluated by applying it to 22 human-used pharmaceuticals covering both pharmaceuticals with a high volume and high ecotoxicity, using ecotoxicological effect data from laboratory studies and comparing these to monitoring data on the effluents from sewage treatment plants in Europe and pharmaceutical sales quantities. We found that for 19 of the 22 selected pharmaceuticals the existing data were sufficient for probabilistic risk characterizations. The subsequently modeled ratios between monitored concentrations and low-effect concentrations were mostly above a factor of 100. Compared to the current paradigm for EU environmental risk assessment where a safety factor of 10 or 100 might have been used it seems that for the modeled compounds there's a low environmental risk. However, similarly calculated ratios for five pharmaceuticals (propranolol, ibuprofen, furosemide, ofloxacin, and ciprofloxacin) were below 100, while ibuprofen and ciprofloxacin are considered to be of high concern due to lack of ecotoxicity studies. This paper shows that by applying probabilistic approaches, existing data can be used to execute a comprehensive study on probability of impacts, thereby contributing to a more comprehensive environmental risk assessment of pharmaceuticals.

  12. Characterization of process holdup material at the Portsmouth Gaseous Diffusion Plant

    International Nuclear Information System (INIS)

    Boyd, D.E.; Miller, R.R.

    1986-01-01

    The cascade material balance area at the Portsmouth Gaseous Diffusion Plant is characterized by continuous, large, in-process inventories of gaseous uranium hexafluoride (UF 6 ) and very large inputs and outputs of UF 6 over a complete range of 235 U enrichments. Monthly inventories are conducted to quantify the in-place material, but the inventory techniques are blind to material not in the gas phase. Material is removed from the gas phase by any one of four mechanisms: (1) freeze-outs which are the solidification of UF 6 , (2) inleakage of wet air which produces solid uranium oxyfluorides, (3) consumption of uranium through UF 6 reaction with internal metal surfaces, and (4) adsorption of UF 6 on internal surfaces. This presentation describes efforts to better characterize and, where possible, to eliminate or reduce the effects of these mechanisms on material accountability. Freeze-outs and wet air deposits occur under absormal operating conditions, and techniques are available to prevent, detect and reverse them. Consumption and adsorption occur under normal operating conditions and are more complex to manage, however, computer models have been developed to quantify monthly the net effects due to consumption and adsorption. These models have shown that consumption and adsorption effects on inventory differences are significant

  13. Integral parameters for characterizing water, energy, and aeration properties of soilless plant growth media

    Science.gov (United States)

    Chamindu Deepagoda, T. K. K.; Chen Lopez, Jose Choc; Møldrup, Per; de Jonge, Lis Wollesen; Tuller, Markus

    2013-10-01

    Over the last decade there has been a significant shift in global agricultural practice. Because the rapid increase of human population poses unprecedented challenges to production of an adequate and economically feasible food supply for undernourished populations, soilless greenhouse production systems are regaining increased worldwide attention. The optimal control of water availability and aeration is an essential prerequisite to successfully operate plant growth systems with soilless substrates such as aggregated foamed glass, perlite, rockwool, coconut coir, or mixtures thereof. While there are considerable empirical and theoretical efforts devoted to characterize water retention and aeration substrate properties, a holistic, physically-based approach considering water retention and aeration concurrently is lacking. In this study, the previously developed concept of integral water storage and energy was expanded to dual-porosity substrates and an analog integral oxygen diffusivity parameter was introduced to simultaneously characterize aeration properties of four common soilless greenhouse growth media. Integral parameters were derived for greenhouse crops in general, as well as for tomatoes. The integral approach provided important insights for irrigation management and for potential optimization of substrate properties. Furthermore, an observed relationship between the integral parameters for water availability and oxygen diffusivity can be potentially applied for the design of advanced irrigation and management strategies to ensure stress-free growth conditions, while conserving water resources.

  14. Characterization of the recombinant copper chaperone (CCS) from the plant Glycine (G.) max.

    Science.gov (United States)

    Sagasti, Sara; Yruela, Inmaculada; Bernal, Maria; Lujan, Maria A; Frago, Susana; Medina, Milagros; Picorel, Rafael

    2011-02-01

    The goal of the present work was to characterize the recombinant copper chaperone (CCS) from soybean. Very little is known about plant copper chaperones, which makes this study of current interest, and allows for a comparison with the better known homologues from yeast and humans. To obtain sizeable amounts of pure protein suitable for spectroscopic characterization, we cloned and overexpressed the G. max CCS chaperone in E. coli in the presence of 0.5 mM CuSO(4) and 0.5 mM ZnSO(4) in the broth. A pure protein preparation was obtained by using two IMAC steps and pH gradient chromatography. Most of the proteins were obtained as apo-form, devoid of copper atoms. The chaperone showed a high content (i.e., over 40%) of loops, turns and random coil as determined both by circular dichroism and homology modelling. The homology 3-D structural model suggests the protein might fold in three structural protein domains. The 3-D model along with the primary structure and spectroscopic data may suggest that copper atoms occupy the two metal binding sites, MKCEGC and CTC, within the N-terminal domain I and C-terminal domain III, respectively. But only one Zn-binding site was obtained spectroscopically.

  15. Physical and chemical characterization of airborne particles from welding operations in automotive plants.

    Science.gov (United States)

    Dasch, Jean; D'Arcy, James

    2008-07-01

    Airborne particles were characterized from six welding operations in three automotive plants, including resistance spot welding, metal inert gas (MIG) welding and tungsten inert gas (TIG) welding of aluminum and resistance spot welding, MIG welding and weld-through sealer of galvanized steel. Particle levels were measured throughout the process area to select a sampling location, followed by intensive particle sampling over one working shift. Temporal trends were measured, and particles were collected on filters to characterize their size and chemistry. In all cases, the particles fell into a bimodal size distribution with very large particles >20 mum in diameter, possibly emitted as spatter or metal expulsions, and very small particles about 1 mum in diameter, possibly formed from condensation of vaporized metal. The mass median aerodynamic diameter was about 1 mum, with only about 7% of the particle mass present as ultrafine particles welding particles could be accounted for by chemical analysis, with the remainder possibly present as oxygen. Predominant species were organic carbon, elemental carbon, iron, and aluminum. More than 80% of the particle mass could be accounted for from steel welding, primarily present as iron, organic carbon, zinc, and copper. Particle concentrations and elemental concentrations were compared with allowable concentrations as recommended by the Occupational Safety and Health Administration and the American Conference of Governmental Industrial Hygienists. In all cases, workplace levels were at least 11 times lower than recommended levels.

  16. Characterization of stochastic uncertainty in the 1996 performance assessment for the Waste Isolation Pilot Plant

    International Nuclear Information System (INIS)

    Helton, Jon Craig; Davis, Freddie J.; Johnson, J.D.

    2000-01-01

    The 1996 performance assessment (PA) for the Waste Isolation Pilot Plant (WIPP) maintains a separation between stochastic (i.e., aleatory) and subjective (i.e., epistemic) uncertainty, with stochastic uncertainty arising from the possible disruptions that could occur at the WIPP over the 10,000 yr regulatory period specified by the US Environmental Protection Agency (40 CFR 191, 40 CFR 194) and subjective uncertainty arising from an inability to uniquely characterize many of the inputs required in the 1996 WIPP PA. The characterization of stochastic uncertainty is discussed including drilling intrusion time, drilling location penetration of excavated/nonexcavated areas of the repository, penetration of pressurized brine beneath the repository, borehole plugging patterns, activity level of waste, and occurrence of potash mining. Additional topics discussed include sampling procedures, generation of individual 10,000 yr futures for the WIPP, construction of complementary cumulative distribution functions (CCDFs), mechanistic calculations carried out to support CCDF construction the Kaplan/Garrick ordered triple representation for risk and determination of scenarios and scenario probabilities

  17. Characterizing effects of hydropower plants on sub-daily flow regimes

    Science.gov (United States)

    Bejarano, María Dolores; Sordo-Ward, Álvaro; Alonso, Carlos; Nilsson, Christer

    2017-07-01

    A characterization of short-term changes in river flow is essential for understanding the ecological effects of hydropower plants, which operate by turning the turbines on or off to generate electricity following variations in the market demand (i.e., hydropeaking). The goal of our study was to develop an approach for characterizing the effects of hydropower plant operations on within-day flow regimes across multiple dams and rivers. For this aim we first defined ecologically meaningful metrics that provide a full representation of the flow regime at short time scales from free-flowing rivers and rivers exposed to hydropeaking. We then defined metrics that enable quantification of the deviation of the altered short-term flow regime variables from those of the unaltered state. The approach was successfully tested in two rivers in northern Sweden, one free-flowing and another regulated by cascades of hydropower plants, which were additionally classified based on their impact on short-term flows in sites of similar management. The largest differences between study sites corresponded to metrics describing sub-daily flow magnitudes such as amplitude (i.e., difference between the highest and the lowest hourly flows) and rates (i.e., rise and fall rates of hourly flows). They were closely followed by frequency-related metrics accounting for the numbers of within-day hourly flow patterns (i.e., rises, falls and periods of stability of hourly flows). In comparison, between-site differences for the duration-related metrics were smallest. In general, hydropeaking resulted in higher within-day flow amplitudes and rates and more but shorter periods of a similar hourly flow patterns per day. The impacted flow feature and the characteristics of the impact (i.e., intensity and whether the impact increases or decreases whatever is being described by the metric) varied with season. Our approach is useful for catchment management planning, defining environmental flow targets

  18. Surgical competence.

    Science.gov (United States)

    Patil, Nivritti G; Cheng, Stephen W K; Wong, John

    2003-08-01

    Recent high-profile cases have heightened the need for a formal structure to monitor achievement and maintenance of surgical competence. Logbooks, morbidity and mortality meetings, videos and direct observation of operations using a checklist, motion analysis devices, and virtual reality simulators are effective tools for teaching and evaluating surgical skills. As the operating theater is also a place for training, there must be protocols and guidelines, including mandatory standards for supervision, to ensure that patient care is not compromised. Patients appreciate frank communication and honesty from surgeons regarding their expertise and level of competence. To ensure that surgical competence is maintained and keeps pace with technologic advances, professional registration bodies have been promoting programs for recertification. They evaluate performance in practice, professional standing, and commitment to ongoing education.

  19. Characterization of ion exchange resins for nuclear power plants: Application and validation of a dedicated model

    International Nuclear Information System (INIS)

    Mabrouk, A.

    2012-01-01

    In pressurized water reactor, ion exchange resins (IER) are used in systems purification. In this thesis, a qualitative study has been performed to predict the behavior of IER while used in nuclear plants conditions. Then, we searched to characterize the IER behavior in column through a quantitative study using analytical solutions. But these solutions worked only for particular cases. In order to find a general solution, we used a new numerical solution: OPTIPUR. To validate this general solution and get a better understanding of the kinetic in column, we performed an experimental study to characterize the resistance to mass transfer in column and to study the sensibility on the parameters influencing this phenomenon. This study is based on the characterization of the initial leakage (initial pollutant concentration at the column outlet). We tested numerous parameters on the initial leakage. We understood the importance of the superficial velocity and indeed of the hydrodynamic conditions on the initial leakage. These numerous results about initial leakage were modeled with an empirical correlation of Dwivedi and Upadhyay in order to validate it. Then, we modeled our results with the two options of OPTIPUR software: option Mass Transfer Coefficient (MTC) and Nernst-Planck (NP). These options encircle experimental results. The MTC option of OPTIPUR gives lower results while those obtained with the NP option are higher than the experimental results. We observed also that only the NP option was valid for a ternary exchange. We proposed solutions to get a better fit with the results obtained with OPTIPUR. We performed other simulations to check the prediction abilities of the software for longer experiments (until the IER saturation). The tendencies were those expected. The OPTIPUR software showed is accuracy and robustness to study column kinetic. (author)

  20. Competence Map of Regulatory Body: Personal and Interpersonal Effectiveness Competencies

    International Nuclear Information System (INIS)

    Volkov, E.

    2016-01-01

    Full text: The paper presents implementation stages and outcomes of the project “Nuclear Facility Competences” fulfilled in JSC “Rosenergoatom” and outcomes of the project “Knowledge Management, Training and Staff Retention” fulfilled for Romania regulatory authority. The goal of the project was a development of competence profiles for nuclear power plant and corporate inspectorate key job positions. The paper is focused on personal and interpersonal effectiveness competencies for inspectorate job positions which are a part of well-known 4-Quadrant Competence Model. Each competence is described by one or two behavior scales. One can consider those competencies like common ones for organizations implementing inspection activity and could be used in human resource management processes like personnel selection, job assessment, career planning, training, mentoring. (author

  1. Molecular and Functional Characterization of a Wheat B2 Protein Imparting Adverse Temperature Tolerance and Influencing Plant Growth

    Directory of Open Access Journals (Sweden)

    akanksha esingh

    2016-05-01

    Full Text Available Genomic attempts were undertaken to elucidate the plant developmental responses to heat stress, and to characterize the roles of B2 protein in mediating those responses. A wheat EST for B2 protein was identified which was cloned and characterized to assess its functional relevance causing plant growth and development during stress adaptation. Here, we show that wheat B2 protein is highly expressed in root and shoot tissues as well as in developing seed tissues under high temperature stress conditions. Morphological studies of transgenic Arabidopsis overexpressing gene encoding wheat B2 protein and Δb2 mutant plants were studied at major developmental stages. The stunted growth phenotype of mutant plants, together with hypocotyl and root elongation analysis of transgenic plants showed that B2 protein exhibits a crucial role in plant growth and development. Additional physiological analyses highlights the role of B2 protein in increased tolerance to heat and cold stresses by maintaining high chlorophyll content, strong activity of photosystem II and less membrane damage of overexpression transgenics as compared with the wild-type. Furthermore, the constitutive overexpression of TaB2 in Arabidopsis resulted in ABA hypersensitivity. Taken together, these studies suggest a novel perspectives of B2 protein in plant development and in mediating the thermal stress tolerance.

  2. Functional characterization of CLE peptides from a plant-parasitic nematode Globodera rostochiensis

    Science.gov (United States)

    Plant CLAVATA3/ESR (CLE) proteins are a large family of secreted peptide ligands that play important roles in plant growth and development. Recent evidence suggests that plant-parasitic cyst nematodes secrete ligand mimics of plant CLE peptides to modify selected host root cells into multinucleate f...

  3. Characterization of Chloroplastic Fructose 1,6-Bisphosphate Aldolases as Lysine-methylated Proteins in Plants*

    Science.gov (United States)

    Mininno, Morgane; Brugière, Sabine; Pautre, Virginie; Gilgen, Annabelle; Ma, Sheng; Ferro, Myriam; Tardif, Marianne; Alban, Claude; Ravanel, Stéphane

    2012-01-01

    In pea (Pisum sativum), the protein-lysine methyltransferase (PsLSMT) catalyzes the trimethylation of Lys-14 in the large subunit (LS) of ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco), the enzyme catalyzing the CO2 fixation step during photosynthesis. Homologs of PsLSMT, herein referred to as LSMT-like enzymes, are found in all plant genomes, but methylation of LS Rubisco is not universal in the plant kingdom, suggesting a species-specific protein substrate specificity of the methyltransferase. In this study, we report the biochemical characterization of the LSMT-like enzyme from Arabidopsis thaliana (AtLSMT-L), with a focus on its substrate specificity. We show that, in Arabidopsis, LS Rubisco is not naturally methylated and that the physiological substrates of AtLSMT-L are chloroplastic fructose 1,6-bisphosphate aldolase isoforms. These enzymes, which are involved in the assimilation of CO2 through the Calvin cycle and in chloroplastic glycolysis, are trimethylated at a conserved lysyl residue located close to the C terminus. Both AtLSMT-L and PsLSMT are able to methylate aldolases with similar kinetic parameters and product specificity. Thus, the divergent substrate specificity of LSMT-like enzymes from pea and Arabidopsis concerns only Rubisco. AtLSMT-L is able to interact with unmethylated Rubisco, but the complex is catalytically unproductive. Trimethylation does not modify the kinetic properties and tetrameric organization of aldolases in vitro. The identification of aldolases as methyl proteins in Arabidopsis and other species like pea suggests a role of protein lysine methylation in carbon metabolism in chloroplasts. PMID:22547063

  4. Generation, characterization and reuse of solid wastes from a biodiesel production plant.

    Science.gov (United States)

    Oliveira, Fernando Jorge Santos; Santana, Daniele Dos Santos; Costa, Simone Soraya Brito; Oliveira, Lenise Diniz; Liduino, Vitor Silva; Servulo, Eliana Flávia Camporese

    2017-03-01

    The aim of this study was to identify and characterize industrial solid wastes generated by a biodiesel production plant in Brazil, as well as to present strategies for the management of these materials. This plant produces every year around 100,000tons of biodiesel from vegetable oils and animal fats. The methodology of the study included technical visits, interviews with the operational and environmental management staff as well as analysis of documents, reports and computerized data systems. An approach to reduce the generation of hazardous waste was investigated. It was take into account the amount of raw material that was processed, reduction of landfill disposal, and the maximization of the their recycling and reuse. The study also identified the sources of waste generation and accordingly prepared an evaluation matrix to determine the types of waste with the higher potential for minimization. The most important residue of the process was the filter material impregnated with oil and biodiesel, requiring, therefore, measures for its minimization. The use of these residues in the production of ceramic artefacts (light bricks) was considered to be very promising, since no significant effect on the physico-chemical and mechanical properties of the artefacts produced was observed. Phytotoxicity test using seeds of Lactuva sativa (lettuce), Brassica juncea (mustard), Abelmoschus esculentus (okra), Chrysanthemum leucanthemum (daisy), Dendranthema grandiflorum (chrysanthemum) and Allium porrum (leek) were carried out. The results clearly show incorporation of the waste material into bricks did not influence relative germination and relative root elongation in comparison to control tests. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Radioactive characterization of the terrestrial ecosystem in the area of location of the Juragua Nuclear Power Plant

    International Nuclear Information System (INIS)

    Sibello Hernandez, R.Y.; Alonso Hernandez, C.M.; Diaz Asencio, M.; Cartas Aguila, H. A.

    1999-01-01

    In this work the results are exposed obtained by the Laboratory of Environmental Surveillance in the radioactive characterization of the existent terrestrial ecosystem in the area of location of the Juragua Nuclear Power Plants in Cienfuegos, Cuba, starting from 1986 and up to 1993

  6. CHARACTERIZATION OF MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT, VOLUME I. REPORT AND APPENDICES A-E

    Science.gov (United States)

    The report gives results of a characterization of mercury (Hg) emissions at a chlor-alkali plant. Up to 160 short tons (146 Mg) of Hg is consumed by the chlor-alkali industry each year. Very little quantitative information is currently available however, on the actual Hg losses f...

  7. Isolation, structural characterization and bioactivities of naturally occurring polysaccharide-polyphenolic conjugates from medicinal plants-A reivew.

    Science.gov (United States)

    Liu, Jun; Bai, Ruyu; Liu, Yunpeng; Zhang, Xin; Kan, Juan; Jin, Changhai

    2018-02-01

    In recent years, several medicinal plants have been demonstrated as valuable resources of naturally occurring polysaccharide-polyphenolic conjugates. For the first time, this article introduces recent advances of polysaccharide-polyphenolic conjugates isolated from different medicinal plants. The isolation, purification, structural characterization and biological activities of polysaccharide-polyphenolic conjugates are introduced in details. In general, polysaccharide-polyphenolic conjugates can be isolated by hot water or alkaline extraction followed by purification through anion exchange chromatography or gel filtration chromatography. The structures of conjugates are usually characterized by chemical composition analysis, UV-vis, Fourier-transform infrared and nuclear magnetic resonance spectroscopy. Moreover, polysaccharide-polyphenolic conjugates exhibit several biological activities including anticoagulant, antioxidant, radioprotective, anti-platelet, antitussive and bronchodilatory effects. Therefore, polysaccharide-polyphenolic conjugates isolated from medicinal plants are certain to have a bright prospect in the field of food and pharmaceutics. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Functional, genetic and chemical characterization of biosurfactants produced by plant growth-promoting Pseudomonas putida 267.

    Science.gov (United States)

    Kruijt, Marco; Tran, Ha; Raaijmakers, Jos M

    2009-08-01

    Plant growth-promoting Pseudomonas putida strain 267, originally isolated from the rhizosphere of black pepper, produces biosurfactants that cause lysis of zoospores of the oomycete pathogen Phytophthora capsici. The biosurfactants were characterized, the biosynthesis gene(s) partially identified, and their role in control of Phytophthora damping-off of cucumber evaluated. The biosurfactants were shown to lyse zoospores of Phy. capsici and inhibit growth of the fungal pathogens Botrytis cinerea and Rhizoctonia solani. In vitro assays further showed that the biosurfactants of strain 267 are essential in swarming motility and biofilm formation. In spite of the zoosporicidal activity, the biosurfactants did not play a significant role in control of Phytophthora damping-off of cucumber, since both wild type strain 267 and its biosurfactant-deficient mutant were equally effective, and addition of the biosurfactants did not provide control. Genetic characterization revealed that surfactant biosynthesis in strain 267 is governed by homologues of PsoA and PsoB, two nonribosomal peptide synthetases involved in production of the cyclic lipopeptides (CLPs) putisolvin I and II. The structural relatedness of the biosurfactants of strain 267 to putisolvins I and II was supported by LC-MS and MS-MS analyses. The biosurfactants produced by Ps. putida 267 were identified as putisolvin-like CLPs; they are essential in swarming motility and biofilm formation, and have zoosporicidal and antifungal activities. Strain 267 provides excellent biocontrol activity against Phytophthora damping-off of cucumber, but the lipopeptide surfactants are not involved in disease suppression. Pseudomonas putida 267 suppresses Phy. capsici damping-off of cucumber and provides a potential supplementary strategy to control this economically important oomycete pathogen. The putisolvin-like biosurfactants exhibit zoosporicidal and antifungal activities, yet they do not contribute to biocontrol of Phy

  9. Genetic and phenotypic characterization of Saccharomyces spp. strains isolated in distillery plants.

    Science.gov (United States)

    Úbeda, Juan F; Chacón-Ocaña, Maria; Díaz-Hellín, Patricia; Ramírez-Pérez, Hector; Briones, Ana

    2016-06-01

    In this study, the biodiversity and some interesting phenotypic properties of Saccharomyces wild yeasts isolated in distilleries, at least 100 years old, located in La Mancha (Spain), were determined. Strains were genetically characterized by RFLP-mtDNA, which confirmed a great genetic biodiversity with 73% of strains with different mtDNA profiles, highlighting the large variability found in sweet and fermented piquette substrata. The predominant species identified was S. cerevisiae, followed by S. paradoxus and S. bayanus Due to the residual sugar-alcohol extraction process using warm water, a great number of thermophilic Saccharomyces strains with a great cell vitality were found to have potential use as starters in distillery plants. Interesting technological properties such as cell vitality and growth rate at different temperatures were studied. The thermal washing process for the extraction of alcohol and reducing sugars of some raw materials contributes to the presence of Saccharomyces strains with technologically interesting properties, especially in terms of vitality and resistance to high temperatures. Due to the fact that fermentation is spontaneous, the yeast biota of these environments, Saccharomyces and non-Saccharomyces, is very varied so these ecological niches are microbial reserves of undoubted biotechnological interest. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Isolation and characterization of mesophilic, oxalate-degrading Streptomyces from plant rhizosphere and forest soils

    Science.gov (United States)

    Sahin, Nurettin

    2004-10-01

    The present work was aimed at the isolation of additional new pure cultures of oxalate-degrading Streptomyces and its preliminary characterization for further work in the field of oxalate metabolism and taxonomic studies. Mesophilic, oxalate-degrading Streptomyces were enriched and isolated from plant rhizosphere and forest soil samples. Strains were examined for cultural, morphological (spore chain morphology, spore mass colour, diffusible and melanin pigment production), physiological (antibiosis, growth in the presence of inhibitory compounds, assimilation of organic acids and enzyme substrates) and chemotaxonomic characters (cellular lipid components and diagnostic cell-wall diamino acid). The taxonomic data obtained were analysed by using the simple matching (SSM) and Jaccard (SJ) coefficients, clustering was achieved using the UPGMA algorithm. All strains were able to utilize sodium-, potassium-, calcium- and ammonium-oxalate salts. Based on the results of numerical taxonomy, isolates were grouped into five cluster groups with a ≥70% SSM similarity level. Streptomyces rochei was the most common of the cluster groups, with a Willcox probability of P>0.8. Streptomyces antibioticus, S. anulatus, S. fulvissimus, S. halstedii and S. violaceusniger are newly reported as oxalate-utilizing Streptomyces.

  11. Physical, chemical and mineralogical characterization of water treatment plant waste for use in soil-cement brick

    International Nuclear Information System (INIS)

    Pessin, L.R.; Destefani, A.Z.; Holanda, J.N.F.

    2011-01-01

    The water treatment plants (WTP) for human consumption generate huge amounts of waste in the form of sludge (sludge) that have been over the years mostly inadequately prepared in water resources and the environment. Moreover, traditional methods of disposal of waste water treatment plants commonly used are generally costly activities. An alternative method for disposal of this waste abundant is its incorporation in ceramic products. This work is focused on the physical-chemical and mineralogical composition of a sample of waste water treatment plants from the region of Campos dos Goytacazes-RJ to their use in the manufacture of soil-cement brick. Several characterization techniques were used including X-ray diffraction, X-ray fluorescence, scanning electron microscopy, picnometry, particle size analysis and plasticity. The experimental results indicate that the waste water treatment plants have the potential to be used in the manufacture of ecologic soil-cement bricks. (author)

  12. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    NARCIS (Netherlands)

    Jansen, J.J.; Van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.

    2009-01-01

    Background Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their

  13. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    NARCIS (Netherlands)

    Jansen, J.J.; van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.

    2009-01-01

    Background: Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their

  14. High-throughput phytochemical characterization of non-cannabinoid compounds of cannabis plant and seed, from Pakistan

    International Nuclear Information System (INIS)

    Ahmad, F.; Abbasi, T.; Farman, K.; Akrem, A.; Asif, M.; Mahmood, S.; Iqbal, M.U.

    2018-01-01

    The herbs are the natural resources for the infinite phenolic compounds that are used in pharmaceutical industry. These herbs are of significant importance due to their beneficial usage for the human health. Here, we studied a common herbs Cannabis sativa, an important member of the family Cannabaceae for phytochemical characterization. The methanol extract of whole Cannabis plant and seed was analyzed for the identification of non-cannabinoid compounds through High Performance Liquid Chromatography (HPLC) technique, because the non-cannabinoid compounds have not been much studied in C. sativa. These compounds are very useful in different diseases, used in cosmetics and as antioxidant agent. HPLC analysis revealed the presence of a variety of non-cannabinoid compounds including Quercetin, Gallic acid, p-Coumaric acid, m-Coumaric acid, Caffeic acid, Cinnamic acid, Ferulic acid, Benzoic acid and Kampferol. Furthermore, Quercetin was observed with high concentration in whole plant sample, whereas high Gallic acid and absence of m-coumaric acid was noted in the Cannabis seed. It was also observed that plant samples were with higher concentration of cinnamic acid as compared to seed. The Caffeic acid, Benzoic acid and Ferulic acid were in low concentration in both Cannabis plant and seed samples. Kampferol is another important non-cannabinoid compound that was also quantified in both samples. This research will be providing a foundation for further molecular characterization of Cannabis plant and seed for their beneficial usage. (author)

  15. Comparative genotyping of Clostridium thermocellum strains isolated from biogas plants: genetic markers and characterization of cellulolytic potential.

    Science.gov (United States)

    Koeck, Daniela E; Zverlov, Vladimir V; Liebl, Wolfgang; Schwarz, Wolfgang H

    2014-07-01

    Clostridium thermocellum is among the most prevalent of known anaerobic cellulolytic bacteria. In this study, genetic and phenotypic variations among C. thermocellum strains isolated from different biogas plants were determined and different genotyping methods were evaluated on these isolates. At least two C. thermocellum strains were isolated independently from each of nine different biogas plants via enrichment on cellulose. Various DNA-based genotyping methods such as ribotyping, RAPD (Random Amplified Polymorphic DNA) and VNTR (Variable Number of Tandem Repeats) were applied to these isolates. One novel approach - the amplification of unknown target sequences between copies of a previously discovered Random Inserted Mobile Element (RIME) - was also tested. The genotyping method with the highest discriminatory power was found to be the amplification of the sequences between the insertion elements, where isolates from each biogas plant yielded a different band pattern. Cellulolytic potentials, optimal growth conditions and substrate spectra of all isolates were characterized to help identify phenotypic variations. Irrespective of the genotyping method used, the isolates from each individual biogas plant always exhibited identical patterns. This is suggestive of a single C. thermocellum strain exhibiting dominance in each biogas plant. The genotypic groups reflect the results of the physiological characterization of the isolates like substrate diversity and cellulase activity. Conversely, strains isolated across a range of biogas plants differed in their genotyping results and physiological properties. Both strains isolated from one biogas plant had the best specific cellulose-degrading properties and might therefore achieve superior substrate utilization yields in biogas fermenters. Copyright © 2014 Elsevier GmbH. All rights reserved.

  16. Detection, characterization and quantification of salicylic acid conjugates in plant extracts by ESI tandem mass spectrometric techniques.

    Science.gov (United States)

    Pastor, Victoria; Vicent, Cristian; Cerezo, Miguel; Mauch-Mani, Brigitte; Dean, John; Flors, Victor

    2012-04-01

    An approach for the detection and characterization of SA derivatives in plant samples is presented based on liquid chromatography coupled to electrospray ionization (ESI) tandem mass spectrometric techniques. Precursor ion scan methods using an ESI triple quadrupole spectrometer for samples from plants challenged with the virulent Pseudomonas syringae pv tomato DC3000 allowed us to detect two potential SA derivatives. The criterion used to consider a potential SA derivative is based on the detection of analytes in the precursor ion scan chromatogram upon selecting m/z 137 and m/z 93 that correspond to the salicylate and its main product ion, respectively. Product ion spectra of the newly-detected analytes as well as accurate m/z determinations using an ESI Q-time-of-flight instrument were registered as means of characterization and strongly suggest that glucosylated forms of SA at the carboxylic and at the phenol functional groups are present in plant samples. The specific synthesis and subsequent chromatography of salicylic glucosyl ester (SGE) and glucosyl salicylate (SAG) standards confirmed the chemical identity of both peaks that were obtained applying different tandem mass spectrometric techniques and accurate m/z determinations. A multiple reaction monitoring method has been developed and applied to plant samples. The advantages of this LC-ESI-MS/MS methods with respect to the traditional analysis of glucosyl conjugates are also discussed. Preliminary results revealed that SA and the glucosyl conjugates are accumulated in Arabidopsis thaliana in a time dependent manner, accordingly to the up-regulation of SA-dependent defenses following P. syringae infection. This technique applied to plant hormones or fragment ions may be useful to obtain chemical family members of plant metabolites and help identify their contribution in the signaling of plant defenses. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  17. Characterization of a plant leaf cuticle model wax, phase behaviour of model wax–water systems

    International Nuclear Information System (INIS)

    Fagerström, Anton; Kocherbitov, Vitaly; Westbye, Peter; Bergström, Karin; Mamontova, Varvara; Engblom, Johan

    2013-01-01

    Highlights: • Four individual crystalline phases were discovered in the model wax–water system. • Eutectic melting occurred in both dry and hydrated model wax. • The total transition enthalpy is smaller for the cuticle wax than for the model wax. • Water has a large plasticizing effect on cuticle wax. • The thermotropic transitions of model wax fit in the window of extracted leaf waxes. - Abstract: We investigated the thermotropic phase behaviour of plant leaf intracuticular wax and two representatives of its main components, 1-docosanol (C 22 H 45 OH) and dotriacontane (C 32 H 66 ), in dry and hydrated state. One objective was to obtain a model wax, which can be used to estimate formulations effects on cuticle diffusivity in vitro. The two wax components were chosen based on results from Gas Chromatography coupled to Mass Spectrometry analysis of cuticular wax. The wax was extracted from Clivia Miniata Regel leaves and contained 68% primary alcohols (C 16 –C 32 ) and 16% n-alkanes (C 21 –C 33 ). Differential Scanning Calorimetry, Polarized Light Microscopy and Small- and Wide Angle X-ray Diffraction were used to characterize the cuticular extract and the phase behaviour of the C 22 H 45 OH/C 32 H 66 /H 2 O model system. Four individual crystalline phases were discovered in the model wax–water system and eutectic melting occurred in both dry and hydrated state. The thermotropic transitions of the model wax occur within the broader transition region of the extracted leaf wax

  18. Antibacterial activity and characterization of secondary metabolites isolated from mangrove plant Avicennia officinalis

    Institute of Scientific and Technical Information of China (English)

    Valentin Bhimba B; J Meenupriya; Elsa Lycias Joel; D Edaya Naveena; Suman kumar; M Thangaraj

    2010-01-01

    Objective:To explore antibacterial activity and characterization of secondary metabolites isolated from mangrove plant Avicennia officinalis (A. officinalis). Methods:In the present study the leaf extracts of A. officinalis were examined for its antibacterial potential using five different solvents against some reference strains of human pathogenic bacteria for the crude extract. Maximum activity was observed for ethyl acetate and hence different concentrations like 15μL, 25μL, and 50μL of ethyl extracts was checked for its antibacterial activity. Partial purification of crude extract was carried by column chromatography and fractions were analyzed using gas chromatography-mass spectrometry (GC-MS) to identify compounds. Results:The crude ethyl acetate extracts of A. officinalis showed remarkable antibacterial activity with zones of inhibition of 13 mm against Eschericia coli (E. coli) and 11 mm against Staphylococcus aureus (S. aureus). Fraction 13 (ethyl acetate÷methanol=8÷2) as the most potent one against with the minimal inhibitory concentration of 30 mm against E. coli and 25 mm against S. aureus. The GC-MS resultsof active column fraction (F13) revealed that the active principals were a mixture of hydroxy-4 methoxybenzoic acid, diethyl phthalate, oleic acid. Conclusions:The leaf extracts with proven antibacterial effects can clearly be directed towards cancer treatment as to inhibiting cancer cell growth. The limited number of test organisms owes to a constraint of resource. So, the effect of strong bursts of leaf extracts on human pathogenic bacteria should further be tested on a wide range of test organisms.

  19. Sampling and characterization of spent exchange resins of Atucha I nuclear power plant

    International Nuclear Information System (INIS)

    Varani, Jose L.; Cernadas, D.; Iglesias, Alberto M.; Raffo Calderon, Maria del C.

    2004-01-01

    The present storage facilities for spent resins in Atucha I NPP would be full within the next 5 years, accordingly some tasks are being planned to conditioning these waste and so generate enough storage capacity for the remaining life of the plant. Among this tasks is the characterization of spent resins that has several objectives: to know their chemical and radiochemical composition; the homogeneity of these parameters in the total volume of spent resins; the existence or not of compact zones; the proportion of 'crud'; the breakage degree of the micro-spheres; etc. The first step was to analyse the criterion to follow for sampling resins in the storage deposit of 40 m 3 . In order to take some samples from different points, a special device was required. It had to be introduced closed in the resin bed, opened to take the sample and then closed again to return to the surface. A device used in cereal industry for sampling silos to different depths was modified in its internal capacity for reducing operator dose and increasing the length of rod in order to reaching the bottom of the pit. The device was tested in cold mock up before to taking actual samples. Active resins samples, five in total up to now, were taken from deposit to different depths and kept in lead containers. After analysing the samples, the following average results were extracted: 1.7 x 10 5 Bq/g of Co-60, 9.7 x 10 5 Bq/g of Cs-137 and 774 Bq/g of total alpha, which corresponds to intermediate activity waste. The differences between the values of activity of the different samples are of up to 310 % for Co-60 and of up to 788 % for the Cs-137 what indicates a great inhomogeneity. The direct observation of resin grains, placed in a transparent glass burette, did not demonstrate an important proportion of broken or divided resins. (author)

  20. Characterization of a plant leaf cuticle model wax, phase behaviour of model wax–water systems

    Energy Technology Data Exchange (ETDEWEB)

    Fagerström, Anton, E-mail: anton.fagerstrom@mah.se [Biomedical Science, Faculty of Health and Society, Malmö University, Malmö (Sweden); Kocherbitov, Vitaly [Biomedical Science, Faculty of Health and Society, Malmö University, Malmö (Sweden); Westbye, Peter; Bergström, Karin [Agro Applications Europe, AkzoNobel Surface Chemistry AB, Stenungsund (Sweden); Mamontova, Varvara [Ecological and Chemical Research, St. Petersburg Scientific Research Center for Ecological Safety, Russian Academy of Sciences, St. Petersburg (Russian Federation); Engblom, Johan [Biomedical Science, Faculty of Health and Society, Malmö University, Malmö (Sweden)

    2013-11-10

    Highlights: • Four individual crystalline phases were discovered in the model wax–water system. • Eutectic melting occurred in both dry and hydrated model wax. • The total transition enthalpy is smaller for the cuticle wax than for the model wax. • Water has a large plasticizing effect on cuticle wax. • The thermotropic transitions of model wax fit in the window of extracted leaf waxes. - Abstract: We investigated the thermotropic phase behaviour of plant leaf intracuticular wax and two representatives of its main components, 1-docosanol (C{sub 22}H{sub 45}OH) and dotriacontane (C{sub 32}H{sub 66}), in dry and hydrated state. One objective was to obtain a model wax, which can be used to estimate formulations effects on cuticle diffusivity in vitro. The two wax components were chosen based on results from Gas Chromatography coupled to Mass Spectrometry analysis of cuticular wax. The wax was extracted from Clivia Miniata Regel leaves and contained 68% primary alcohols (C{sub 16}–C{sub 32}) and 16% n-alkanes (C{sub 21}–C{sub 33}). Differential Scanning Calorimetry, Polarized Light Microscopy and Small- and Wide Angle X-ray Diffraction were used to characterize the cuticular extract and the phase behaviour of the C{sub 22}H{sub 45}OH/C{sub 32}H{sub 66}/H{sub 2}O model system. Four individual crystalline phases were discovered in the model wax–water system and eutectic melting occurred in both dry and hydrated state. The thermotropic transitions of the model wax occur within the broader transition region of the extracted leaf wax.

  1. Nanometrology of Biomass for Bioenergy: The Role of Atomic Force Microscopy and Spectroscopy in Plant Cell Characterization

    Directory of Open Access Journals (Sweden)

    Anne M. Charrier

    2018-03-01

    Full Text Available Ethanol production using extracted cellulose from plant cell walls (PCW is a very promising approach to biofuel production. However, efficient throughput has been hindered by the phenomenon of recalcitrance, leading to high costs for the lignocellulosic conversion. To overcome recalcitrance, it is necessary to understand the chemical and structural properties of the plant biological materials, which have evolved to generate the strong and cohesive features observed in plants. Therefore, tools and methods that allow the investigation of how the different molecular components of PCW are organized and distributed and how this impacts the mechanical properties of the plants are needed but challenging due to the molecular and morphological complexity of PCW. Atomic force microscopy (AFM, capitalizing on the interfacial nanomechanical forces, encompasses a suite of measurement modalities for nondestructive material characterization. Here, we present a review focused on the utilization of AFM for imaging and determination of physical properties of plant-based specimens. The presented review encompasses the AFM derived techniques for topography imaging (AM-AFM, mechanical properties (QFM, and surface/subsurface (MSAFM, HPFM chemical composition imaging. In particular, the motivation and utility of force microscopy of plant cell walls from the early fundamental investigations to achieve a better understanding of the cell wall architecture, to the recent studies for the sake of advancing the biofuel research are discussed. An example of delignification protocol is described and the changes in morphology, chemical composition and mechanical properties and their correlation at the nanometer scale along the process are illustrated.

  2. Radiological characterization of waste products at a Catalan drinking water treatment plant - Radiological characterization of waste products of one Catalan drinking water treatment plant

    Energy Technology Data Exchange (ETDEWEB)

    Camacho, A.; Montana, M.; Serrano, I.; Blazquez, S.; Duch, M.A. [Institut de Tecniques Energetiques. Universitat Politecnica de Catalunya, ETSEIB. Diagonal 647. 08028 Barcelona (Spain); Montes, S.; Ganzer, M.; Devesa, R. [Aigues de Barcelona, AGBAR. Laboratory, General Batet, 5-7, 08028 Barcelona (Spain)

    2014-07-01

    Conventional Drinking Water Treatment Plants (DWTP) have a fairly standard sequence of processes which essentially consist in solids separation using physical processes such as settling and filtration, and chemical processes such as coagulation and disinfection. Consequently large quantities of solid wastes or sludge are generated every year by DWTP. These solid wastes may contain all kind of pollutants, including significant levels of radioactivity and may cause a radiological impact on the operating personnel, but also on the public if the waste is recycled, e.g. the use of sludge as fertilizer or cement manufacturing. In this work it has been studied the radioactivity content of waste products of one DWTP. The selected DWTP treats water mainly taken from the Llobregat River and also ground water. The treatment plant has a maximum treatment capacity of 5.5 m{sup 3}/s, and provides almost 50% of the annual drinking water in Barcelona metropolitan area (population equivalent of the plant: 4,856,579). This plant has been selected taking into account both variations in water source and the treatment applied. During the period July 2007 - March 2009 a temporal study of radio-nuclides present in sludge produced by the decanter cleaning process was conducted. The temporal study was made taking into account the particular weather conditions in Spain, at least one sampling campaign per season. In these samples naturally gamma emitters from the {sup 238}U and {sup 232}Th series were detected with activities similar to the arithmetic mean found in Spanish soils so no increase in natural radiation are produced by the uses of these sludge. Furthermore, no seasonal tendency could be observed in the studied period for both series within the uncertainties associated with the results. Radiological hazard effects were also evaluated by the external hazard index because one of the end-uses of this sludge is the cement manufacturing. In 2009 the treatment plant was modified and

  3. Characterization of a defective interfering RNA that contains a mosaic of a plant viral genome. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Morris, T.J.; Jackson, A.O.

    1991-12-31

    Our lab was the first to describe and characterize a defective interfering RNA (DI RNAs or DIs) in association with a small RNA plant virus. The features of the DIs that we discovered in infections of tomato bushy stunt virus were compatible with the properties of DIs identified in many animal virus infections. Animal virologists have generally recognized the importance of studying DIs because they are invaluable tools for identifying cis-acting sequences important in virus multiplication and because they offer the opportunity to elucidate mechanisms involved in viral persistence and disease attenuation. Hence our discovery offered a comparably valuable tool for use in plant virus studies for the first time. Since then, we have also discovered the second example of plant viral DI RNAs associated with turnip crinkle virus (TCV), a virus structurally related to TBSV. We proposed a thorough characterization of this unique class of symptom modulating RNAs with the overall objective of identifying viral RNA nucleotide, sequences involved in such fundamental processes as virus replication and encapsidation as well as the degree of symptom expression resulting from the viral-DI-host interaction. The proposed research focused on the molecular characterization of the DI RNAs and the helper virus. We had demonstrated that the DIs were collinear deletion mutants of the genome of a cherry strain of tomato bushy stunt virus (TBSV). We had also shown that these low molecular weight RNAs interfered with the helper plant virus and modulated disease expression by preventing the development of a lethal necrotic disease in susceptible host plants. We also suggested that by exploring the mechanisms associated with the symptom attenuation effect, we might be able to devise novel strategies useful for engineering viral disease resistance.

  4. Characterization of the serine acetyltransferase gene family of Vitis vinifera uncovers differences in regulation of OAS synthesis in woody plants

    OpenAIRE

    Silvia eTavares; Silvia eTavares; Markus eWirtz; Marcel Pascal Beier; Jochen eBogs; Jochen eBogs; Jochen eBogs; Ruediger eHell; Sara eAmâncio

    2015-01-01

    In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT protein fam...

  5. Characterization of the serine acetyltransferase gene family of Vitis vinifera uncovers differences in regulation of OAS synthesis in woody plants

    OpenAIRE

    Tavares, Sílvia; Wirtz, Markus; Beier, Marcel P.; Bogs, Jochen; Hell, Rüdiger; Amâncio, Sara

    2015-01-01

    In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT gene family...

  6. Characterization of ash pond ashes from 3rd thermal power plant by SEM/EDX and XRD methods

    OpenAIRE

    A Minjigmaa; Ts Zolzaya; E Bayanjargal; B Davaabal; J Temuujin

    2014-01-01

      Coal combustion by products from ash pond of 3rdthermal power plant of Ulaanbaatar city have been collected in 2010 and 2013 years. The ash samples have been characterized by XRD, XRF and SEM-EDX methods in order to evaluate their chemical and mineralogical composition changes with disposed times. The mineralogical composition of ash varies with time though the chemical composition of the ashes were close each other. Possibly, inefficient operating condition of the TPS shows influence on th...

  7. Hillslope characterization: Identifying key controls on local-scale plant communities' distribution using remote sensing and subsurface data fusion.

    Science.gov (United States)

    Falco, N.; Wainwright, H. M.; Dafflon, B.; Leger, E.; Peterson, J.; Steltzer, H.; Wilmer, C.; Williams, K. H.; Hubbard, S. S.

    2017-12-01

    Mountainous watershed systems are characterized by extreme heterogeneity in hydrological and pedological properties that influence biotic activities, plant communities and their dynamics. To gain predictive understanding of how ecosystem and watershed system evolve under climate change, it is critical to capture such heterogeneity and to quantify the effect of key environmental variables such as topography, and soil properties. In this study, we exploit advanced geophysical and remote sensing techniques - coupled with machine learning - to better characterize and quantify the interactions between plant communities' distribution and subsurface properties. First, we have developed a remote sensing data fusion framework based on the random forest (RF) classification algorithm to estimate the spatial distribution of plant communities. The framework allows the integration of both plant spectral and structural information, which are derived from multispectral satellite images and airborne LiDAR data. We then use the RF method to evaluate the estimated plant community map, exploiting the subsurface properties (such as bedrock depth, soil moisture and other properties) and geomorphological parameters (such as slope, curvature) as predictors. Datasets include high-resolution geophysical data (electrical resistivity tomography) and LiDAR digital elevation maps. We demonstrate our approach on a mountain hillslope and meadow within the East River watershed in Colorado, which is considered to be a representative headwater catchment in the Upper Colorado Basin. The obtained results show the existence of co-evolution between above and below-ground processes; in particular, dominant shrub communities in wet and flat areas. We show that successful integration of remote sensing data with geophysical measurements allows identifying and quantifying the key environmental controls on plant communities' distribution, and provides insights into their potential changes in the future

  8. Race-Specific Adult-Plant Resistance in Winter Wheat to Stripe Rust and Characterization of Pathogen Virulence Patterns.

    Science.gov (United States)

    Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten

    2015-08-01

    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.

  9. Development & Characterization of a Whole Plant Chamber for the Investigation of Environmental Perturbations on Biogenic VOC Emissions

    Science.gov (United States)

    Holder, J.; Riches, M.; Abeleira, A.; Farmer, D.

    2017-12-01

    Accurate prediction of both climate and air quality under a changing earth system requires a full understanding of the sources, feedbacks, and ultimate fate of all atmospherically relevant chemical species, including volatile organic compounds (VOCs). Biogenic VOCs (BVOC) from plant emissions are the main source of VOCs to the atmosphere. However, the impact of global change on BVOC emissions is poorly understood. For example, while short-term increases in temperature are typically associated with increased BVOC emissions, the impact of long-term temperature increases are less clear. Our study aims to investigate the effects of long-term, singular and combined environmental perturbations on plant BVOC emissions through the use of whole plant chambers in order to better understand the effects of global change on BVOC-climate-air quality feedbacks. To fill this knowledge gap and provide a fundamental understanding of how BVOC emissions respond to environmental perturbations, specifically elevated temperature, CO2, and drought, whole citrus trees were placed in home-built chambers and monitored for monoterpene and other BVOC emissions utilizing thermal desorption gas chromatography mass spectrometry (TD-GC-MS). Designing and building a robust whole plant chamber to study atmospherically relevant chemical species while accommodating the needs of live plants over timescales of days to weeks is not a trivial task. The environmental conditions within the chamber must be carefully controlled and monitored. The inter-plant and chamber variability must be characterized. Finally, target BVOCs need to be sampled and detected from the chamber. Thus, the chamber design, control and characterization considerations along with preliminary BVOC results will be presented and discussed.

  10. Characterization and Modeling of Atmospheric Flow Within and Above Plant Canopies

    Science.gov (United States)

    Souza Freire Grion, Livia

    The turbulent flow within and above plant canopies is responsible for the exchange of momentum, heat, gases and particles between vegetation and the atmosphere. Turbulence is also responsible for the mixing of air inside the canopy, playing an important role in chemical and biophysical processes occurring in the plants' environment. In the last fifty years, research has significantly advanced the understanding of and ability to model the flow field within and above the canopy, but important issues remain unsolved. In this work, we focus on (i) the estimation of turbulent mixing timescales within the canopy from field data; and (ii) the development of new computationally efficient modeling approaches for the coupled canopy-atmosphere flow field. The turbulent mixing timescale represents how quickly turbulence creates a well-mixed environment within the canopy. When the mixing timescale is much smaller than the timescale of other relevant processes (e.g. chemical reactions, deposition), the system can be assumed to be well-mixed and detailed modeling of turbulence is not critical to predict the system evolution. Conversely, if the mixing timescale is comparable or larger than the other timescales, turbulence becomes a controlling factor for the concentration of the variables involved; hence, turbulence needs to be taken into account when studying and modeling such processes. In this work, we used a combination of ozone concentration and high-frequency velocity data measured within and above the canopy in the Amazon rainforest to characterize turbulent mixing. The eddy diffusivity parameter (used as a proxy for mixing efficiency) was applied in a simple theoretical model of one-dimensional diffusion, providing an estimate of turbulent mixing timescales as a function of height within the canopy and time-of-day. Results showed that, during the day, the Amazon rainforest is characterized by well-mixed conditions with mixing timescales smaller than thirty minutes in the

  11. Purification, characterization and stability of barley grain peroxidase BP1, a new type of plant peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Christine B; Henriksen, Anette; Abelskov, A. Katrine

    1997-01-01

    peroxidase isoenzyme C (HRP C). However, when measuring the specific activity of BP 1 at pH 4.0 in the presence of 1 mM CaCl2, the enzyme was as competent as HRP C at neutral pH towards a variety of substrates (mM mg(-1) min(-1)): coniferyl alcohol (930+/-48), caffeic acid (795+/-53), ABTS (2,2(1)-azino...

  12. Exserohilum rostratum: characterization of a cross-kingdom pathogen of plants and humans.

    Directory of Open Access Journals (Sweden)

    Kalpana Sharma

    Full Text Available Pathogen host shifts represent a major source of new infectious diseases. There are several examples of cross-genus host jumps that have caused catastrophic epidemics in animal and plant species worldwide. Cross-kingdom jumps are rare, and are often associated with nosocomial infections. Here we provide an example of human-mediated cross-kingdom jumping of Exserohilum rostratum isolated from a patient who had received a corticosteroid injection and died of fungal meningitis in a Florida hospital in 2012. The clinical isolate of E. rostratum was compared with two plant pathogenic isolates of E. rostratum and an isolate of the closely related genus Bipolaris in terms of morphology, phylogeny, and pathogenicity on one C3 grass, Gulf annual rye grass (Lolium multiflorum, and two C4 grasses, Japanese stilt grass (Microstegium vimineum and bahia grass (Paspalum notatum. Colony growth and color, as well as conidia shape and size were the same for the clinical and plant isolates of E. rostratum, while these characteristics differed slightly for the Bipolaris sp. isolate. The plant pathogenic and clinical isolates of E. rostratum were indistinguishable based on morphology and ITS and 28S rDNA sequence analysis. The clinical isolate was as pathogenic to all grass species tested as the plant pathogenic strains that were originally isolated from plant hosts. The clinical isolate induced more severe symptoms on stilt grass than on rye grass, while this was the reverse for the plant isolates of E. rostratum. The phylogenetic similarity between the clinical and plant-associated E. rostratum isolates and the ability of the clinical isolate to infect plants suggests that a plant pathogenic strain of E. rostratum contaminated the corticosteroid injection fluid and was able to cause systemic disease in the affected patient. This is the first proof that a clinical isolate of E. rostratum is also an effective plant pathogen.

  13. Determination and use of scaling factors for waste characterization in nuclear power plants

    International Nuclear Information System (INIS)

    2009-01-01

    of nuclear power plants, the SF technique is also applicable to other situations where it is desirable to infer the activity of DTM nuclides from easy to make measurements, such as for research reactors, nuclear fuel manufacturing plants, nuclear fuel reprocessing plants, decommissioning waste, historical waste, contaminated land, etc. In each case, the technique employed is similar, but consideration must be given to the unique aspects of the situation, such as the radionuclides of concern. Development of SFs in Member States has been based on analysis of representative waste streams and/or on theoretical calculations and modelling of radionuclide production and transport mechanisms. There is general consensus among Member States that the results derived from the application of SFs must be reasonable without being overly conservative. For example, if the estimate of a DTM nuclide is overly conservative (i.e. too high), it may prematurely result in the radionuclide capacity or authorized limit of a repository being 'expended' before the repository is physically full. The acceptable degree of conservatism will vary depending on the application. Many Member States use the same set of key nuclides and apply similar sampling and analysis strategies. There is also an indication that Member States operating similar nuclear facilities (e.g. the same design of nuclear power plant) may be able to pool their data to develop common SFs for certain radionuclides and waste streams. This is especially useful for Member States with smaller nuclear programmes that may not be able on their own to support a large sampling and analysis programme to develop their own SFs or who lack the technical infrastructure to perform the complex measurements required. The experience compiled from Member States indicates that the development and use of SFs is a widely accepted practice by waste generators, facility operators and regulators in many countries. While the details and scope of SF

  14. Characterizing pathways of invasion using Sternorryhncha on imported plant material in cargo

    Science.gov (United States)

    Timothy T. Work

    2011-01-01

    Non-indigenous Homoptera, mainly scales, aphids, and mealy bugs, intercepted on plants destined for cultivation represent an elevated risk for the establishment of invasive insects in North America. These insects [grouped as the suborder Sternorrhyncha] are often parthenogenic and are imported on viable host plants.

  15. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  16. AtNEA1-identification and characterization of a novel plant nuclear ...

    African Journals Online (AJOL)

    In animal and yeast cells, a cross nuclear envelope structure linker of nucleoskeleton and cytoskeleton (LINC) is formed by outer nuclear membrane SUN proteins and inner nuclear membrane KASH proteins. However, little information was acquired about plant SUN-KASH structure until they were found in plant SUN ...

  17. Characterization of deposits and their influence on corrosion in waste incineration plants in Denmark

    DEFF Research Database (Denmark)

    Montgomery, Melanie; Larsen, OH

    2001-01-01

    A program has been initiated in Denmark to investigate the aggressive environment in various waste incineration plants. The results described are the preliminary results from one waste incineration plant. Deposits and corrosion products have been removed from various locations in the boiler...

  18. Characterization of ethno-medicinal plant resources of karamar valley Swabi, Pakistan

    Directory of Open Access Journals (Sweden)

    Muhammad Khalid

    2017-04-01

    Industrial relevance: Medicinal plants are still widely used for the treatment of different ailments in the area of Swabi, therefore survey of medicinal flora should be carried out to explore and bring up-to-date the catalogue of existing natural plant resources of the area especially in agricultural country like Pakistan. Small scale government processing units of agroforestry should be implemented to reduce the overuse and motivate the cultivation of valuable medicinal plants. Majority of the people use various formulations of medicinal plants for different ailments treatment. The phytochemicals greatly varied in medicinal plants and cause a marvelous effect on human illnesses. The objective of the present study was to document the information of folk medicines, its identification, collection of samples, study of its chemical constituents and uses by the local people of District Swabi, Pakistan.

  19. Isolation, Characterization, Screening, Formulation and Evaluation of Plant Growth Promoting Rhizobacteria

    Directory of Open Access Journals (Sweden)

    Puja Kumari

    2017-10-01

    Full Text Available Plant growth promoting rhizobacteria (PGPR are bioresources which may be viewed as a novel and potential tool for providing substantial benefits to the agriculture. Soil is the dynamic living matrix and the major source of food security providing various resources of plant growth and maintaining life processes. PGPR are originally defined as root- colonizing bacteria that cause either plant growth promotion or biological control of plant diseases. Chemical fertilizers are used for killing pathogens, increase crop yield but long term use of chemical fertilizers lead to adverse effect to the soil profile and is the reason for decrease in soil productivity, on the other hand PGPR promote plant growth directly by either facilitating resource acquisition (nitrogen, phosphorus and essential minerals or modulating plant hormone levels, or indirectly by decreasing the inhibitory effects of various pathogens on plant growth and development in the forms of biocontrol agents. PGPR is the indispensable part of rhizosphere biota that when grown in association with the host plants can stimulate the growth of the host. PGPR seemed as successful rhizobacteria in getting established in soil ecosystem due to their high adaptability in a wide variety of environments, faster growth rate and biochemical versatility to metabolize a wide range of natural and xenobiotic compounds. Isolated PGPRs from selective crop rizosphere soil were used for further growth promotion and biocontrol studies in the green house and field. Different studies have been carrying out to develop some new bioformulations and evaluate their efficacy in promoting crop seedlings growth characteristics. Field trials were performed to evaluate selective crops with formulations of several plants PGPR in a production system. The present review highlights the Plant growth promoting rhizobacteria as an alternative of chemical fertilizer for sustainable, environment friendly agriculture.

  20. [Characterization of the damage of Spodoptera eridania (Cramer) and Spodoptera cosmioides (Walker) (Lepidoptera: Noctuidae) to structures of cotton plants].

    Science.gov (United States)

    Santos, Karen B Dos; Meneguim, Ana M; Santos, Walter J Dos; Neves, Pedro M O J; Santos, Rachel B Dos

    2010-01-01

    The cotton plant, Gossypium hirsutum, hosts various pests that damage different structures. Among these pests, Spodoptera cosmioides (Walker) and Spodoptera eridania (Cramer) (Lepidoptera: Noctuidae) are considered important. The objectives of this study were to characterize and to quantify the potential damage of S. eridania and S. cosmioides feeding on different structures of cotton plants. For this purpose, newly-hatched larvae were reared on the following plant parts: leaf and flower bud; leaf and boll; flower bud or boll; and leaf, flower bud and boll. The survival of S. cosmioides and S. eridania was greater than 80% and 70% for larvae fed on cotton plant parts offered separately or together, respectively. One larva of S. eridania damaged 1.7 flower buds, but did not damage bolls, while one larva of S. cosmioides damaged 5.2 flower buds and 3.0 cotton bolls. Spodoptera eridania and S. cosmioides can be considered species with potential to cause economic damage to cotton plants because they can occur throughout cotton developmental stages causing defoliation and losses of reproductive structures. Therefore, the results validate field observations that these two species of Spodoptera are potential pests for cotton.

  1. Functional Characterization of PaLAX1, a Putative Auxin Permease, in Heterologous Plant Systems1[W][OA

    Science.gov (United States)

    Hoyerová, Klára; Perry, Lucie; Hand, Paul; Laňková, Martina; Kocábek, Tomáš; May, Sean; Kottová, Jana; Pačes, Jan; Napier, Richard; Zažímalová, Eva

    2008-01-01

    We have isolated the cDNA of the gene PaLAX1 from a wild cherry tree (Prunus avium). The gene and its product are highly similar in sequences to both the cDNAs and the corresponding protein products of AUX/LAX-type genes, coding for putative auxin influx carriers. We have prepared and characterized transformed Nicotiana tabacum and Arabidopsis thaliana plants carrying the gene PaLAX1. We have proved that constitutive overexpression of PaLAX1 is accompanied by changes in the content and distribution of free indole-3-acetic acid, the major endogenous auxin. The increase in free indole-3-acetic acid content in transgenic plants resulted in various phenotype changes, typical for the auxin-overproducing plants. The uptake of synthetic auxin, 2,4-dichlorophenoxyacetic acid, was 3 times higher in transgenic lines compared to the wild-type lines and the treatment with the auxin uptake inhibitor 1-naphthoxyacetic acid reverted the changes caused by the expression of PaLAX1. Moreover, the agravitropic response could be restored by expression of PaLAX1 in the mutant aux1 plants, which are deficient in auxin influx carrier activity. Based on our data, we have concluded that the product of the gene PaLAX1 promotes the uptake of auxin into cells, and, as a putative auxin influx carrier, it affects the content and distribution of free endogenous auxin in transgenic plants. PMID:18184737

  2. Field Trial and Molecular Characterization of RNAi-Transgenic Tomato Plants That Exhibit Resistance to Tomato Yellow Leaf Curl Geminivirus.

    Science.gov (United States)

    Fuentes, Alejandro; Carlos, Natacha; Ruiz, Yoslaine; Callard, Danay; Sánchez, Yadira; Ochagavía, María Elena; Seguin, Jonathan; Malpica-López, Nachelli; Hohn, Thomas; Lecca, Maria Rita; Pérez, Rosabel; Doreste, Vivian; Rehrauer, Hubert; Farinelli, Laurent; Pujol, Merardo; Pooggin, Mikhail M

    2016-03-01

    RNA interference (RNAi) is a widely used approach to generate virus-resistant transgenic crops. However, issues of agricultural importance like the long-term durability of RNAi-mediated resistance under field conditions and the potential side effects provoked in the plant by the stable RNAi expression remain poorly investigated. Here, we performed field trials and molecular characterization studies of two homozygous transgenic tomato lines, with different selection markers, expressing an intron-hairpin RNA cognate to the Tomato yellow leaf curl virus (TYLCV) C1 gene. The tested F6 and F4 progenies of the respective kanamycin- and basta-resistant plants exhibited unchanged field resistance to TYLCV and stably expressed the transgene-derived short interfering RNA (siRNAs) to represent 6 to 8% of the total plant small RNAs. This value outnumbered the average percentage of viral siRNAs in the nontransformed plants exposed to TYLCV-infested whiteflies. As a result of the RNAi transgene expression, a common set of up- and downregulated genes was revealed in the transcriptome profile of the plants selected from either of the two transgenic events. A previously unidentified geminivirus causing no symptoms of viral disease was detected in some of the transgenic plants. The novel virus acquired V1 and V2 genes from TYLCV and C1, C2, C3, and C4 genes from a distantly related geminivirus and, thereby, it could evade the repressive sequence-specific action of transgene-derived siRNAs. Our findings shed light on the mechanisms of siRNA-directed antiviral silencing in transgenic plants and highlight the applicability limitations of this technology as it may alter the transcriptional pattern of nontarget genes.

  3. Characterization of Effective Rhizobacteria Isolated from Velvet Bean (Mucuna Pruriens) to Enhance Plant Growth

    International Nuclear Information System (INIS)

    Saleem, A. R.; Mahmood, T.; Batool, A.; Khalid, A.

    2016-01-01

    Rhizobacteria with plant growth promoting ability exist in association with plant roots and ameliorate over all plant development and yield. Numerous species of rhizobacteria have been identified with plant growth promoting ability, which can be attributed to multiple microbial characteristics. In the current study rhizobacterial isolates with best plant growth promotion traits were subjected to screening for plant growth promotion under axenic condition. The results of lab assays revealed that out of five rhizobacterial isolates three of bacterial isolate were Gram -ve and two of them were Gram +ve bacterial group. All isolates found positive for the auxin production and ACC-demainase activity. The isolate HS9 showed highest ACC activity (331 ketobutyrate nmol mg-1 biomass hr-1) and auxin production (3.85 without L-TRP). PGPR increase plant growth by reducing the ethylene release and its inhibitory effects, the role of isolates to decrease ethylene effects was affirmed via classical triple response assay on velvet bean. Furthermore, isolate were assessed for resistance test, three efficient strains (G9, HS9 and H38) exhibited antibiotic resistance for streptomycin, kanamycin and rifampicin at 100 mg L-1in TSB medium. For the purpose of co-inoculation, all three isolates showed positive relation to grow together. The results concluded that rhizobacteria selected from rain fed areas were found effective to improve plant growth with their multiple growth enhancing traits. Therefore, PGPR with various characteristics could be a better option for inoculation and co-inoculation to improve plant growth in well watered and water stressed environment. (author)

  4. Carbon and Hydrogen Isotopic Composition of Plant Wax n-Alkanes: A Tool for Characterizing Soil Provenance in Forensic Science

    Science.gov (United States)

    Pedentchouk, N.; Wagner, T.; Jones, M.

    2009-04-01

    patterns result from physiological differences among the plants. The relative differences in deltaD and delta13C values of various plant types could be explained by differences in stomatal diffusive conductance to H2O vapour and CO2 gas, so that species with higher stomatal conductance would have D-enriched and 13C-depleted values. We are currently investigating the stomatal conductance of leaves and needles taken from the same plants that were sampled for deltaD and delta13C measurements. Comparison of the isotopic data from the deciduous angiosperm plants growing in Newcastle and Norwich shows that 6 species from Newcastle are more 13C-depleted (delta13C: c. -39 to -35 per mil) than 11 deciduous angiosperm species from Norwich (delta13C: c. -36 to -31 per mil). However, there is no significant difference in the deltaD values between the two locations since the Newcastle data (deltaD: c. -155 to -130 per mil) is within the range of the Norwich data (deltaD: c. -115 to -170 per mil). Our n-alkane isotope data from Newcastle indicate that deciduous angiosperm species have a very different delta13C/dD signature in comparison with that of the evergreen angiosperm species. On the other hand, gymnosperms have deltaD values similar to those of deciduous angiosperms and delta13C values similar to those of evergreen angiosperms. Further results from our compound-specific work, will reveal whether these patterns also characterize the same plant groups in Norwich and whether different weather patterns in Newcastle and Norwich lead to isotopic differences in the same species/plant types. The results of this study will provide a valuable dataset that could be used for higher plant and soil characterization by forensics experts in the UK and elsewhere.

  5. Chemical and biological characterization of phytotoxins produced by Diplodia species, fungi involved in forest plants diseases

    OpenAIRE

    Masi, Marco

    2013-01-01

    In recent years, numerous studies have been initiated in order to understand what are the microorganisms involved in forest plants diseases and the role played by phytotoxins produced in the pathogenesis processes. The aim of the present thesis was to study the fungi and the phytotoxins associated with canker disease of the Italian cypress (Cupressus sempervirens L.) and the branch dieback of juniper (Juniperus phoenicea L.) which are plant diseases with noteworthy social and economical impli...

  6. Establishing competence

    International Nuclear Information System (INIS)

    Ugedo, E.

    1986-01-01

    As suggested by the organizers, this lecture is based on actual practice in Spain. Description of the Spanish electricity generating system: The nuclear contribution. Codes and regulations applicable to training and qualification of nuclear power plant operating personnel. The licensing process. Description of SRO and RO training courses for initial qualification; differences between power stations in operation and under construction. The role of the academic institutions. The role of the training center. The role of the utility-owner. The training program efficiency verification: On-the-job performance feedback. Incorporating third parties experiences. Periodic requalification of the licensed personnel: Frequency, topics, schedule. Training programs for other NPP positions. (orig./GL)

  7. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  8. Functional characterization of a strong bi-directional constitutive plant promoter isolated from cotton leaf curl Burewala virus.

    Directory of Open Access Journals (Sweden)

    Zainul A Khan

    Full Text Available Cotton leaf curl Burewala virus (CLCuBuV, belonging to the genus Begomovirus, possesses single-stranded monopartite DNA genome. The bidirectional promoters representing Rep and coat protein (CP genes of CLCuBuV were characterized and their efficacy was assayed. Rep and CP promoters of CLCuBuV and 35S promoter of Cauliflower mosaic virus (CaMV were fused with β-glucuronidase (GUS and green fluorescent protein (GFP reporter genes. GUS activity in individual plant cells driven by Rep, CP and 35S promoters was estimated using real-time PCR and fluorometric GUS assay. Histochemical staining of GUS in transformed tobacco (Nicotiana tabacum cv. Xanthi leaves showed highest expression driven by Rep promoter followed by 35S promoter and CP promoter. The expression level of GUS driven by Rep promoter in transformed tobacco plants was shown to be two to four-fold higher than that of 35S promoter, while the expression by CP promoter was slightly lower. Further, the expression of GFP was monitored in agroinfiltrated leaves of N. benthamiana, N. tabacum and cotton (Gossypium hirsutum plants using confocal laser scanning microscopy. Rep promoter showed strong consistent transient expression in tobacco and cotton leaves as compared to 35S promoter. The strong constitutive CLCuBuV Rep promoter developed in this study could be very useful for high level expression of transgenes in a wide variety of plant cells.

  9. Plant productivity and characterization of zeoponic substrates after three successive crops of radish

    Science.gov (United States)

    Gruener, J. E.; Ming, Doug; Galindo, C., Jr.; Henderson, K. E.

    2006-01-01

    The National Aeronautics and Space Administration (NASA) has developed advanced life support (ALS) systems for long duration space missions that incorporate plants to regenerate the atmosphere (CO2 to O2), recycle water (via evapotranspiration), and produce food. NASA has also developed a zeolite-based synthetic substrate consisting of clinoptilolite and synthetic apatite to support plant growth for ALS systems (Ming et al., 1995). The substrate is called zeoponics and has been designed to slowly release all plant essential elements into "soil" solution. The substrate consists of K- and NH4-exchanged clinoptilolite and a synthetic hydroxyapatite that has Mg, S, and the plant-essential micronutrients incorporated into its structure in addition to Ca and P. Plant performance in zeoponic substrates has been improved by the addition of dolomite pH buffers, nitrifying bacteria, and other calcium-bearing minerals (Henderson et al., 2000; Gruener et al., 2003). Wheat was used as the test crop for all of these studies. The objectives of this study were to expand upon the previous studies to determine the growth and nutrient uptake of radish in zeoponic substrates and to determine the nutrient availability of the zeoponic substrate after three successive radish crops.

  10. Single-Step Purification and Characterization of A Recombinant Serine Proteinase Inhibitor from Transgenic Plants.

    Science.gov (United States)

    Jha, Shweta; Agarwal, Saurabh; Sanyal, Indraneel; Amla, D V

    2016-05-01

    Expression of recombinant therapeutic proteins in transgenic plants has a tremendous impact on safe and economical production of biomolecules for biopharmaceutical industry. The major limitation in their production is downstream processing of recombinant protein to obtain higher yield and purity of the final product. In this study, a simple and rapid process has been developed for purification of therapeutic recombinant α1-proteinase inhibitor (rα1-PI) from transgenic tomato plants, which is an abundant serine protease inhibitor in human serum and chiefly inhibits the activity of neutrophil elastase in lungs. We have expressed rα1-PI with modified synthetic gene in transgenic tomato plants at a very high level (≃3.2 % of total soluble protein). The heterologous protein was extracted with (NH4)2SO4 precipitation, followed by chromatographic separation on different matrices. However, only immunoaffinity chromatography resulted into homogenous preparation of rα1-PI with 54 % recovery. The plant-purified rα1-PI showed molecular mass and structural conformation comparable to native serum α1-PI, as shown by mass spectrometry and optical spectroscopy. The results of elastase inhibition assay revealed biological activity of the purified rα1-PI protein. This work demonstrates a simple and efficient one-step purification of rα1-PI from transgenic plants, which is an essential prerequisite for further therapeutic development.

  11. Y-12 Plant remedial action Technology Logic Diagram: Volume 3, Technology evaluation data sheets: Part B, Characterization; robotics/automation

    International Nuclear Information System (INIS)

    1994-09-01

    The Y-12 Plant Remedial Action Technology Logic Diagram (TLD) was developed to provide a decision-support tool that relates environmental restoration (ER) problems at the Y-12 Plant to potential technologies that can remediate theses problems. The TLD identifies the research, development, demonstration, testing, and evaluation needed for sufficient development of these technologies to allow for technology transfer and application to remedial action (RA) activities. The TLD consists of three volumes. Volume 1 contains an overview of the TLD, an explanation of the program-specific responsibilities, a review of identified technologies, and the rankings of remedial technologies. Volume 2 contains the logic linkages among environmental management goals, environmental problems, and the various technologies that have the potential to solve these problems. Volume 3 contains the TLD data sheets. This report is Part B of Volume 3 and contains the Characterization and Robotics/Automation sections

  12. Spectroscopic characterization of cell membranes and their constituents of the plant-associated soil bacterium Azospirillum brasilense

    Science.gov (United States)

    Kamnev, A. A.; Antonyuk, L. P.; Matora, L. Yu.; Serebrennikova, O. B.; Sumaroka, M. V.; Colina, M.; Renou-Gonnord, M.-F.; Ignatov, V. V.

    1999-05-01

    Structural and compositional features of bacterial membranes and some of their isolated constituents (cell surface lipopolysaccharide, phospholipids) of the plant-growth-promoting diazotrophic rhizobacterium Azospirillum brasilense (wild-type strain Sp245) were characterized using Fourier transform infrared (FTIR) spectroscopy and some other techniques. FTIR spectra of the cell membranes were shown to comprise the main vibration modes of the relevant lipopolysaccharide and protein components which are believed to be involved in associative plant-bacterium interactions, as well as of phospholipid constituents. The role and functions of metal cations in the structural organization and physicochemical properties of bacterial cell membranes are also discussed considering their accumulation in the membranes from the culture medium.

  13. Mechanical–biological treatment: Performance and potentials. An LCA of 8 MBT plants including waste characterization

    DEFF Research Database (Denmark)

    Montejo, Cristina; Tonini, Davide; Márquez, María del Carmen

    2013-01-01

    recovery through increased automation of the selection and to prioritize biogas-electricity production from the organic fraction over direct composting. The optimal strategy for refuse derived fuel (RDF) management depends upon the environmental compartment to be prioritized and the type of marginal...... of the MBT plants. These widely differed in type of biological treatment and recovery efficiencies. The results indicated that the performance is strongly connected with energy and materials recovery efficiency. The recommendation for upgrading and/or commissioning of future plants is to optimize materials...... electricity source in the system. It was estimated that, overall, up to ca. 180—190 kt CO2-eq. y−1 may be saved by optimizing the MBT plants under assessment....

  14. Collection and characterization of emissions from metal cutting in Caorso nuclear power plant decommissioning

    International Nuclear Information System (INIS)

    Cesari, F.G.; Terzi, L.A.; Giostri, A.; Bernini, C.; Sirito, E.; Sirito, M.

    2005-01-01

    The Caorso's Nuclear Power Plant (BWR, 870 MWe) has just started the decommissioning process, with the intent to reach, by almost ten years, the 'green field' conditions for the site. The plant has fully worked for a very short period of time, by 1981 to 1986, being shut down after 1987 Italy's poll that abrogated nuclear power use. The dismantling of the components and of the structural materials has already begun in the Turbine Building. The University of Bologna, on indication of the NPP's management, has started an experimental campaign to test the cutting processes and its filtering plant. The starting phase is the qualification of the cutting methods chosen by Caorso's management, oxyfuel and plasma cuttings. This campaign is set over no contaminated material, or, better, material with a contamination under the level of free release, and is now running in the University Labs. Next phase are filtering tests. This part of the qualifying campaign is set to highlight the kind of trouble that can emerge in the cutting processes, not yet taking into account radioactivity. Caorso's BWR is a plant designed and built in the 70s. Possible decommissioning problems weren't considered during the design phase so the cutting processes will be quite difficult, even on the conventional side. The final phase is settled in the plant. Cutting tests, following indications made by previous campaigns, will be conducted in the Turbine Building, where tests can be conducted on a low level of radioactivity (only some little part of it has a contamination level over the free release limit of 1 Bq/cm 2 ). The intent is to develop an extensive cutting procedure, with the obvious option of remote control, able to face difficulties connected with cutting processes in a nuclear plant like Caorso. This means handling with radioactivity and with not airy narrow rooms, fulfilled with pipes. (authors)

  15. Reactive trace gas emissions from stressed plants: a poorly characterized major source of atmospheric volatiles

    Science.gov (United States)

    Niinemets, Ülo

    2017-04-01

    Vegetation constitutes the greatest source of reactive volatile organic compounds in the atmosphere. The current emission estimates primarily rely on constitutive emissions that are present only in some plant species. However, all plant species can be induced to emit reactive volatiles by different abiotic and biotic stresses, but the stress-dependent emissions have been largely neglected in emission measurements and models. This presentation provides an overview of systematic screening of stress-dependent volatile emissions from a broad range of structurally and physiologically divergent plant species from temperate to tropical ecosystems. Ozone, heat, drought and wounding stress were the abiotic stresses considered in the screening, while biotic stress included herbivory, chemical elicitors simulating herbivory and fungal infections. The data suggest that any moderate to severe stress leads to significant emissions of a rich blend of volatiles, including methanol, green leaf volatiles (the lipoxygenase pathway volatiles, dominated by C6 aldehydes, alcohols and derivatives), different mono- and sesquiterpenes and benzenoids. The release of volatiles occurs in stress severity-dependent manner, although the emission responses are often non-linear with more severe stresses resulting in disproportionately greater emissions. Stress volatile release is induced in both non-constitutive and constitutive volatile emitters, whereas the rate of constitutive volatile emissions in constitutive emitters is often reduced under environmental and biotic stresses. Given that plants in natural conditions often experience stress, this analysis suggests that global volatile emissions have been significantly underestimated. Furthermore, in globally changing hotter climates, the frequency and severity of both abiotic and biotic stresses is expected to increase. Thus, the stress-induced volatile emissions are predicted to play a dominant role in plant-atmosphere interactions in near

  16. Characterization of reaction products of iron and iron salts and aqueous plant extracts

    Energy Technology Data Exchange (ETDEWEB)

    Jaen, J.A. [Universidad de Panama, Centro de Investigaciones con Tecnicas Nucleares/Depto. de Quimica (Panama); Garcia de Saldana, E.; Hernandez, C. [Universidad de Panama, Maestria en Ciencias Quimicas (Panama)

    1999-11-15

    The complexes formed in aqueous solution as a result of a reaction of iron and iron salts (Fe{sup 2+} and Fe{sup 3+}) and some plant extracts were analyzed using Moessbauer spectroscopy and Fourier transform infrared. The extracts were obtained from Opuntia elatior mill., Acanthocereus pentagonus (L.) Britton, Mimosa tenuiflora, Caesalpinia coriaria (Jacq.) Willd., Bumbacopsis quinata (Jacq.) Dugand and Acacia mangium Willd., plants growing wildly in different zones of the Isthmus of Panama. Results suggest the formation of mono- and bis-type complexes, and in some cases, the occurrence of a redox reaction. The feasibility of application of the studied extracts as atmospheric corrosion inhibitors is discussed.

  17. Characterization of calcium oxalate biominerals in some (non-Cactaceae) succulent plant species.

    Science.gov (United States)

    Monje, Paula V; Baran, Enrique J

    2010-01-01

    The water-accumulating leaves of crassulacean acid metabolism plants belonging to five different families were investigated for the presence of biominerals by infrared spectroscopic and microscopic analyses. Spectroscopic results revealed that the mineral present in succulent species of Agavaceae, Aizoaceae, and Asphodelaceae was calcium oxalate monohydrate (whewellite, CaC2O4 x H2O). Crystals were predominantly found as raphides or solitary crystals of various morphologies. However, representative Crassulaceae members and a succulent species of Asteraceae did not show the presence of biominerals. Overall, these results suggest no correlation between calcium oxalate generation and crassulacean acid metabolism in succulent plants.

  18. Estimation and characterization of decontamination and decommissioning solid waste expected from the Plutonium Finishing Plant

    International Nuclear Information System (INIS)

    Millar, J.S.; Pottmeyer, J.A.; Stratton, T.J.

    1995-01-01

    Purpose of the study was to estimate the amounts of equipment and other materials that are candidates for removal and subsequent processing in a solid waste facility when the Hanford Plutonium Finishing Plant is decontaminated and decommissioned. (Building structure and soil are not covered.) Results indicate that ∼5,500 m 3 of solid waste is expected to result from the decontamination and decommissioning of the Pu Finishing Plant. The breakdown of the volumes and percentages of waste by category is 1% dangerous solid waste, 71% low-level waste, 21% transuranic waste, 7% transuranic mixed waste

  19. Demonstration, testing and evaluation of nonintrusive characterization technologies at operable Unit 2 of Rocky Flats Plant. Final report

    International Nuclear Information System (INIS)

    1994-09-01

    A three-dimensional (3-D), high-resolution (HR) seismic reflection evaluation was conducted at the Rocky Flats Plant (RFP), near Golden, Colorado, to demonstrate the applicability of nonintrusive characterization techniques to detect buried objects, contamination, and geological/hydrological features at RFP. The evaluation was conducted as part of the U.S. Department of Energy's (DOE) request for demonstration, testing and evaluation (DT ampersand E) of nonintrusive techniques, under DOE Program Research and Development Announcement (PRDA) No. DE-RA05-09OR22000

  20. Demonstration, testing and evaluation of nonintrusive characterization technologies at operable Unit 2 of Rocky Flats Plant. Final report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-09-01

    A three-dimensional (3-D), high-resolution (HR) seismic reflection evaluation was conducted at the Rocky Flats Plant (RFP), near Golden, Colorado, to demonstrate the applicability of nonintrusive characterization techniques to detect buried objects, contamination, and geological/hydrological features at RFP. The evaluation was conducted as part of the U.S. Department of Energy`s (DOE) request for demonstration, testing and evaluation (DT&E) of nonintrusive techniques, under DOE Program Research and Development Announcement (PRDA) No. DE-RA05-09OR22000.

  1. Preliminary plan for disposal-system characterization and long-term performance evaluation of the Waste Isolation Pilot Plant

    International Nuclear Information System (INIS)

    Bertram-Howery, S.G.; Hunter, R.L.

    1989-04-01

    The US Department of Energy is planning to dispose of transuranic wastes at the Waste Isolation Pilot Plant (WIPP) near Carlsbad, New Mexico. Sandia National Laboratories is responsible for evaluating the compliance of the WIPP with the Environmental Protection Agency's Environmental Standards for the Management and Disposal of Spent Nuclear Fuel, High-Level and Transuranic Radioactive Wastes (40 CFR 191, Subpart B). This plan has been developed to present the issues that will be addressed before compliance can be evaluated. These issues examine the procedural nature of the Standard, and the technical requirements for further characterizing the behavior of the disposal system, including uncertainties, to support the compliance assessment. The plan briefly describes the activities that will be conducted prior to 1993 by Sandia to characterize the WIPP disposal system's behavior and predict its performance. 41 refs., 35 figs., 21 tabs

  2. Integration of Genome-Wide TF Binding and Gene Expression Data to Characterize Gene Regulatory Networks in Plant Development.

    Science.gov (United States)

    Chen, Dijun; Kaufmann, Kerstin

    2017-01-01

    Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.

  3. Characterization of solidified radioactive wastes produced at Montalto di Castro BWR plant with reference to the site storage

    International Nuclear Information System (INIS)

    Donato, A.; Ricci, G.; Pace, A.

    1985-01-01

    The cement solidification of the Montalto di Castro BWR plant radwastes has been studied both from the point of view of the mixtures of formulation and of the product characterization. Five radwaste types and mixtures of them have been taken into consideration, determining the best chemical formulations starting from the compressive strenght as leading parameter. The solidified products have been characterized from the point of view of the freeze and thawing resistance, the water immersion resistance, the leachability, the dimensional changes and the free standing water. All the tests have been performed taking into account the real site conditions, so the leaching tests and the water immersion tests have been carried out using sea water and table water as leachant

  4. Characterization of Arabidopsis thaliana FLAVONOL SYNTHASE 1 (FLS1) -overexpression plants in response to abiotic stress.

    Science.gov (United States)

    Nguyen, Nguyen Hoai; Kim, Jun Hyeok; Kwon, Jaeyoung; Jeong, Chan Young; Lee, Wonje; Lee, Dongho; Hong, Suk-Whan; Lee, Hojoung

    2016-06-01

    Flavonoids are an important group of secondary metabolites that are involved in plant growth and contribute to human health. Many studies have focused on the biosynthesis pathway, biochemical characters, and biological functions of flavonoids. In this report, we showed that overexpression of FLS1 (FLS1-OX) not only altered seed coat color (resulting in a light brown color), but also affected flavonoid accumulation. Whereas fls1-3 mutants accumulated higher anthocyanin levels, FLS1-OX seedlings had lower levels than those of the wild-type. Besides, shoot tissues of FLS1-OX plants exhibited lower flavonol levels than those of the wild-type. However, growth performance and abiotic stress tolerance of FLS1-OX, fls1-3, and wild-type plants were not significantly different. Taken together, FLS1 can be manipulated (i.e., silenced or overexpressed) to redirect the flavonoid biosynthetic pathway toward anthocyanin production without negative effects on plant growth and development. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  5. Characterization of three plant biomass-degrading microbial consortia by metagenomics- and metasecretomics-based approaches

    NARCIS (Netherlands)

    Jiménez, Diego Javier; Brossi, Maria Julia de Lima; Schuckel, Julia; Kracun, Stjepan Kresimir; Willats, William George Tycho; van Elsas, Jan Dirk

    2016-01-01

    The selection of microbes by enrichment on plant biomass has been proposed as an efficient way to develop new strategies for lignocellulose saccharification. Here, we report an in-depth analysis of soil-derived microbial consortia that were trained to degrade once-used wheat straw (WS1-M),

  6. Characterization of the temporary radiation workforce at US nuclear power plants

    International Nuclear Information System (INIS)

    Cehn, J.I.

    1984-01-01

    The temporary radiation worker is the subject of this recent study by the National Environmental Studies Project. ''Lenny'', an imaginary worker, is actually a composite of the estimated 22,000 radiation workers employed at various times at the 80 nuclear power plants in the U.S. Lenny reports to a trailer on the plant site to check in and spends the next day and a half in a training class that covers radiation safety, federal regulations and exposure limits and plant procedures. He must take and pass a written exam, then he fills out a medical history, indicating whether or not he has received any industrial radiation exposure. After three days of training and ''processing'' he dons a radiation measuring dosimeter and begins work. A key question to this study is whether the temporary employees are getting assigned the dirty work. It has been alleged that temps are used as ''glowboys'' or ''radiation sponges''. The new study finds no basis for this allegation. Data show that permanent plant staff received nearly the same average annual radiation dose as temporary employees

  7. Diffusivity-Based Characterization of Plant Growth Media for Earth and Space

    DEFF Research Database (Denmark)

    Chamindu, Deepagoda; Møldrup, Per; Jones, Scot B.

    will likely fulfill diffusion requirements when designing safe plant growth media for earth and space. The CWD concept was also applied to a natural volcanic ash soil (Nishi-Tokyo, Japan), and natural volcanic ash soil exhibited a CWD performance fully comparable with the best among the aggregated growth...

  8. Characterizing the effects of brassinosteroids on root development in monocot plant species

    DEFF Research Database (Denmark)

    de Bang, Louise

    . With TILLING, two mutants of selected BR-related genes were identified in a Brachypodium distachyon mutant population. However, compared to the wild type, the mutants did not produce more biomass. The work with BR effects on plant root growth stimulated an interest for roots and root development, which...

  9. Ecophysiological characterization of carnivorous plant roots: oxygen fluxes, respiration, and water exudation

    Czech Academy of Sciences Publication Activity Database

    Adamec, Lubomír

    2005-01-01

    Roč. 49, č. 2 (2005), s. 247-255 ISSN 0006-3134 R&D Projects: GA AV ČR(CZ) IAA6005909 Institutional research plan: CEZ:AV0Z6005908 Keywords : terrestrial carnivorous plants * soil anoxia * Genlisea traps Subject RIV: EF - Botanics Impact factor: 0.792, year: 2005

  10. Chemical and pharmacognostical characterization of two Malaysian plants both known as Ajisamat

    Directory of Open Access Journals (Sweden)

    Tengku Azlan S. Tengku Mohamad

    Full Text Available Ajisamat, an herb commonly used as an aphrodisiac in the Malaysian traditional medicine, corresponds to two different species from different families - Salacia macrophylla Blume, Celastraceae, and Prismatomeris glabra (Korth. Valeton, Rubiaceae. Macromorphological inspection of the vegetative parts both plants reveals only a slight difference in the arrangement of the petioles. Microscopic investigation of the plants roots used as crude drugs revealed however distinctive anatomical features. Prismatic calcium oxalate crystals and banded paratracheal parenchyma are characteristics of S. macrophylla while P. glabradisplays an abundance as crystals. Other features such as vessels diameters and arrangements are also of diagnostic importance. Some of these characters were also identified in the powder of thes e plant materials and proposed for diagnostic purpose. The values for extraction of ethanol and water as well as total ash, acid-insoluble ash, water-soluble ash and sulfated ash were determined for both plants. Phytochemical studies were carried out on hexane and chloroform extracts of S. macrophylla and methanolic extract of P. glabra. S. macrophylla was shown to contain highly oxidized pentacyclic triterpenes while P. glabra contains anthraquinones. The pharmacognostical and hytochemical information can be utilised as the identification tools for Salacia macrophylla and Prismatomeris glabra

  11. CHARACTERIZATION OF THE FUGITIVE MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT. OVERALL STUDY DESIGN

    Science.gov (United States)

    The paper discusses a detailed emissions measurement campaign that was conducted over a 9-day period within a mercury (Hg) cell chlor-alkali plant in the southeastern United States (U.S.). The principal focus of this study was to measure fugitive (non-ducted) airborne Hg emission...

  12. CHARACTERIZATION OF MERCURY EMISSIONS AT A CHLOR-ALKALI PLANT: STUDY ORGANIZATION AND IMPLEMENTATION

    Science.gov (United States)

    The paper describes the organization and implementation of a detailed emissions measurement campaign conducted over a 2-week period at the Olin Corporation's mercury chlor-alkali plant in Augusta, GA. (NOTE: Since data analysis is continuing, study results will be provided later...

  13. Genetic and functional characterization of culturable plant-beneficial actinobacteria associated with yam rhizosphere.

    Science.gov (United States)

    Arunachalam Palaniyandi, Sasikumar; Yang, Seung Hwan; Damodharan, Karthiyaini; Suh, Joo-Won

    2013-12-01

    Actinobacteria were isolated from the rhizosphere of yam plants from agricultural fields from Yeoju, South Korea and analyzed for their genetic and plant-beneficial functional diversity. A total of 29 highly occurring actinobacterial isolates from the yam rhizosphere were screened for various plant-beneficial traits such as antimicrobial activity on fungi and bacteria; biocontrol traits such as production of siderophore, protease, chitinase, endo-cellulase, and β-glucanase. The isolates were also screened for plant growth-promoting (PGP) traits such as auxin production, phosphate solubilization, 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase activity, and in vitro Arabidopsis growth promotion. 16S rDNA sequence-based phylogenetic analysis was carried out on the actinobacterial isolates to determine their genetic relatedness to known actinobacteria. BOX-PCR analysis revealed high genetic diversity among the isolates. Several isolates were identified to belong to the genus Streptomyces and a few to Kitasatospora. The actinobacterial strains exhibited high diversity in their functionality and were identified as novel and promising candidates for future development into biocontrol and PGP agents. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Characterization and application of dried plants to remove heavy metals, nitrate, and phosphate ions from industrial wastewaters

    Energy Technology Data Exchange (ETDEWEB)

    Chiban, Mohamed; Soudani, Amina; Sinan, Fouad [Department of Chemistry, Faculty of Sciences, Agadir (Morocco); Tahrouch, Saida [Department of Biology, Faculty of Sciences, Agadir (Morocco); Persin, Michel [European Membrane Institute, CRNS, Montpellier (France)

    2011-04-15

    Low cost adsorbents were prepared from dried plants for the removal of heavy metals, nitrate, and phosphate ions from industrial wastewaters. The efficiency of these adsorbents was investigated using batch adsorption technique at room temperature. The dried plant particles were characterized by N{sub 2} at 77 K adsorption, scanning electron microscopy, energy dispersive X-ray spectroscopy, Fourier transform infrared spectroscopy, and phytochemical screening. The adsorption experiments showed that the microparticles of the dried plants presented a good adsorption of heavy metals, phosphate, and nitrate ions from real wastewaters. This adsorption increased with increasing contact time. The equilibrium time was found to be 30 min for heavy metals and nitrate ions and 240 min for phosphate ions. After the adsorption process, the Pb(II) concentrations, as well as those of Cd(II), Cu(II), and Zn(II) were below the European drinking water norms concentrations. The percentage removal of heavy metals, nitrates, and phosphates from industrial wastewaters by dried plants was {proportional_to}94% for Cd{sup 2+}, {proportional_to}92% for Cu{sup 2+}, {proportional_to}99% for Pb{sup 2+}, {proportional_to}97% for Zn{sup 2+}, {proportional_to}100% for NO{sub 3}{sup -} and {proportional_to}77% for PO{sub 4}{sup 3-} ions. It is proved that dried plants can be one alternative source for low cost absorbents to remove heavy metals, nitrate, and phosphate ions from municipal and industrial wastewaters. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  15. Behavior of radionuclides and related elements in plants. Screening and characterization of cesium requirement mutants from mutagenized arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Yamagami, Mutsumi; Yanai, Masumi; Hisamatsu, Shunichi; Inaba, Jiro [Inst. for Environmental Sciences, Rokkasho, Aomori (Japan)

    2002-07-01

    We have investigated the effect of climate on the metabolic behavior of various elements in a specific plant. The following items have been examined: the effect of climate conditions including Yamase (prevailing windows from the Pacific Ocean side area of Aomori Prefecture) on the elemental transfer factor of rice, the effect of light conditions on metabolism of elements in a plant, the effect of environmental factors on elemental movements at a cell level, and establishment of a mutant plant strain to obtain elemental requirement. This paper describes the development of a method for screening and characterizing cesium resistance mutants from Arabidopsis thaliana. Arabidopsis is a small herbaceous plant which is used for experimental molecular botany. To isolate mutant in cesium uptake or accumulation, we have devised a screening method using energy-dispersive x-ray microanalysis (EDX) of mutagenized Arabidopsis leaves. The seeds for the selection were M{sub 2} seeds derived from ethyl methane sulfonate (EMS)-treated plants. A double screening method was used to isolate about 50 Cs-resistant mutants. In the first screening experiment, EMS-mutagenized seeds were grown in medium containing 3 mM Cs. The wild type Arabidopsis usually died, but Cs-resistant mutants survived. These were transferred into soil for harvest of first-screening-seeds. In the successive experiment, first-screening-seeds were grown in medium containing 1 mM Cs, and Cs of the leaves was analyzed by EDX. We identified about 50 mutants in Cs uptake or accumulation after screening over 100,000 seedlings. These mutants showed either excessive accumulation of Cs in leaves or an inability to accumulate Cs at a normal concentration. The uptake rates of Cs in those mutants were also examined by using {sup 134}Cs radioactive tracer. (author)

  16. Characterization of coal blends for effective utilization in thermal power plants

    International Nuclear Information System (INIS)

    Santhosh Raaj, S.; Arumugam, S.; Muthukrishnan, M.; Krishnamoorthy, S.; Anantharaman, N.

    2016-01-01

    Highlights: • This work will assist utilities to decide on the choice of coals for blending. • Conventional and advanced analytical techniques were used for characterization. • Fuel ratio, burnout profile, ash chemistry and carbon burnout are key factors. • Basic properties were additive while carbon burnout was non additive for the blends. - Abstract: This paper deals with the characterization of coal blends using various conventional and advanced analytical techniques. There has been an increasing trend in utilizing imported coals for power generation in India and utilities are resorting to blended coal firing for various reasons, both financially as well as technically. Characterization studies were carried out on 2 combinations of Indian and imported coal blends. Conventional characterization such as proximate and ultimate analysis and determination of calorific value were carried out for the raw coals and blends as per ASTM standards. Following this thermal and mineral analysis of the samples were carried out using thermo gravimetric analyzer (TGA), X-ray fluorescence spectrometer (XRF) and computer controlled scanning electron microscope (CCSEM). Combustion experiments were also conducted using drop tube furnace (DTF) to determine the burnout of the raw coals and blends. The selection of technically suitable coal combination for blending, based on these characterization studies, has been detailed.

  17. Eleventh-year response of loblolly pine and competing vegetation to woody and herbaceous plant control on a Georgia flatwoods site

    Science.gov (United States)

    Bruce R. Zutter; James H. Miller

    1998-01-01

    Through 11 growing seasons, growth of loblolly pine (Pinus taeda L.) increased after control of herbaceous, woody, or both herbaceous and woody vegetation (total control) for the first 3 years after planting on a bedded site in the Georgia coastal flatwoods. Gains in stand volume index from controlling either herbaceous or woody vegetation alone were approximately two-...

  18. Impact of an Educational Hands-on Project on the Antimicrobial, Antitumor and Anti-Inflammatory Properties of Plants on Portuguese Students’ Awareness, Knowledge, and Competences

    Directory of Open Access Journals (Sweden)

    Maria-Manuel Azevedo

    2015-02-01

    Full Text Available Promoting environmental and health education is crucial to allow students to make conscious decisions based on scientific criteria. The study is based on the outcomes of an Educational Project implemented with Portuguese students and consisted of several activities, exploring pre-existent Scientific Gardens at the School, aiming to investigate the antibacterial, antitumor and anti-inflammatory properties of plant extracts, with posterior incorporation in soaps and creams. A logo and a webpage were also created. The effectiveness of the project was assessed via the application of a questionnaire (pre- and post-test and observations of the participants in terms of engagement and interaction with all individuals involved in the project. This project increased the knowledge about autochthonous plants and the potential medical properties of the corresponding plant extracts and increased the awareness about the correct design of scientific experiments and the importance of the use of experimental models of disease. The students regarded their experiences as exciting and valuable and believed that the project helped to improve their understanding and increase their interest in these subjects and in science in general. This study emphasizes the importance of raising students’ awareness on the valorization of autochthonous plants and exploitation of their medicinal properties.

  19. Rhododendron aureum Georgi formed a special soil microbial community and competed with above-ground plants on the tundra of the Changbai Mountain, China.

    Science.gov (United States)

    Wang, Xiaolong; Li, Lin; Zhao, Wei; Zhao, Jiaxin; Chen, Xia

    2017-09-01

    Rhododendron aureum Georgi is a perennial evergreen dwarf shrub that grows at all elevations within the alpine tundra of northern China. Previous research has investigated the plant communities of R. aureum ; however, little information is available regarding interspecific competition and underground soil microbial community composition. The objective of our study was to determine whether the presence of R. aureum creates a unique soil microbiome and to investigate the relationship between R. aureum and other plant species. Our study site ranged from 1,800 to 2,600 m above sea level on the northern slope of the Changbai Mountain. The results show that the soil from sites with an R. aureum community had a higher abundance of nitrogen-fixing bacteria and a higher resistance to pathogens than soils from sites without R. aureum . We emphasize that R. aureum promotes a unique soil microbial community structure that is distinct from those associated with other plants. Elevation and microbial biomass were the main influencing factors for plant community structure. Analysis of interspecific relationships reveals that R. aureum is negatively associated with most other dominant shrubs and herbs, suggesting interspecific competition. It is necessary to focus on other dominant species if protection and restoration of the R. aureum competition is to occur. In the future, more is needed to prove whether R. aureum decreases species diversity in the tundra ecosystems of Changbai Mountain.

  20. Site characterization summary report for dry weather surface water sampling upper East Fork Poplar Creek characterization area Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-08-01

    This report describes activities associated with conducting dry weather surface water sampling of Upper East Fork Poplar Creek (UEFPC) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. This activity is a portion of the work to be performed at UEFPC Operable Unit (OU) 1 [now known as the UEFPC Characterization Area (CA)], as described in the RCRA Facility Investigation Plan for Group 4 at the Oak- Ridge Y-12 Plant, Oak Ridge, Tennessee and in the Response to Comments and Recommendations on RCRA Facility Investigation Plan for Group 4 at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee, Volume 1, Operable Unit 1. Because these documents contained sensitive information, they were labeled as unclassified controlled nuclear information and as such are not readily available for public review. To address this issue the U.S. Department of Energy (DOE) published an unclassified, nonsensitive version of the initial plan, text and appendixes, of this Resource Conservation and Recovery Act (RCRA) Facility Investigation (RFI) Plan in early 1994. These documents describe a program for collecting four rounds of wet weather and dry weather surface water samples and one round of sediment samples from UEFPC. They provide the strategy for the overall sample collection program including dry weather sampling, wet weather sampling, and sediment sampling. Figure 1.1 is a schematic flowchart of the overall sampling strategy and other associated activities. A Quality Assurance Project Plan (QAPJP) was prepared to specifically address four rounds of dry weather surface water sampling and one round of sediment sampling. For a variety of reasons, sediment sampling has not been conducted and has been deferred to the UEFPC CA Remedial Investigation (RI), as has wet weather sampling.

  1. Characterization of viruses infecting potato plants from a single location in Shetland, an isolated scottish archipelago

    DEFF Research Database (Denmark)

    Mortensen, R.J.; Shen, Xinyi; Reid, Alex

    2010-01-01

    , as were 29 Scottish mainland isolates of the same four potato virus species, and these 58 isolates were compared to previously published sequence data. This has allowed the characterization of viruses from a relatively isolated location, where there is little production of ware potatoes and no seed potato...... production. Phylogenetic homogeneity of the Shetland isolates of PVS and PVV was apparent. PVX was more heterogeneous, and Shetland isolates cluster with the Scottish isolates in a group which includes Asian and European isolates. For PVA, the majority of the Shetland and Scottish mainland isolates formed...... a predominantly Scottish grouping, with the remaining Shetland and Scottish mainland isolates clustering with a previously characterized Scottish isolate. There were three main groups of PVA, of which the Scottish grouping was the only one which did not have a fully characterized representative. To extend...

  2. Identification of drought-responsive miRNAs and physiological characterization of tea plant (Camellia sinensis L.) under drought stress.

    Science.gov (United States)

    Guo, Yuqiong; Zhao, Shanshan; Zhu, Chen; Chang, Xiaojun; Yue, Chuan; Wang, Zhong; Lin, Yuling; Lai, Zhongxiong

    2017-11-21

    Drought stress is one of the major natural challenges in the main tea-producing regions of China. The tea plant (Camellia sinensis) is a traditional beverage plant whose growth status directly affects tea quality. Recent studies have revealed that microRNAs (miRNAs) play key functions in plant growth and development. Although some miRNAs have been identified in C. sinensis, little is known about their roles in the drought stress response of tea plants. Physiological characterization of Camellia sinensis 'Tieguanyin' under drought stress showed that the malondialdehyde concentration and electrical conductivity of leaves of drought-stressed plants increased when the chlorophyll concentration decreased under severe drought stress. We sequenced four small-RNA (sRNA) libraries constructed from leaves of plants subjected to four different treatments, normal water supply (CK); mild drought stress (T1); moderate drought stress (T2) and severe drought stress (T3). A total of 299 known mature miRNA sequences and 46 novel miRNAs were identified. Gene Ontology enrichment analysis revealed that most of the differentially expressed-miRNA target genes were related to regulation of transcription. Kyoto Encyclopedia of Genes and Genomes analysis revealed that the most highly enriched pathways under drought stress were D-alanine metabolism, sulfur metabolism, and mineral absorption pathways. Real-time quantitative PCR (qPCR) was used to validate the expression patterns of 21 miRNAs (2 up-regulated and 19 down-regulated under drought stress). The observed co-regulation of the miR166 family and their targets ATHB-14-like and ATHB-15-like indicate the presence of negative feedback regulation in miRNA pathways. Analyses of drought-responsive miRNAs in tea plants showed that most of differentially expressed-miRNA target genes were related to regulation of transcription. The results of study revealed that the expressions of phase-specific miRNAs vary with morphological, physiological, and

  3. Characterization of Potential Plant Growth Promoting Rhizobacteria Isolated from Maize (Zea mays L. in Central and Northern Benin (West Africa

    Directory of Open Access Journals (Sweden)

    Nadège A. Agbodjato

    2015-01-01

    Full Text Available Our study aims to characterize Plant Growth Promoting Rhizobacteria (PGPR isolated from maize roots in five agroecological zones of central and northern Benin. Sixty samples were collected at the rate of four samples per village and three villages per agroecological zone. Rhizobacteria strains were isolated from these samples and biochemically characterized. These strains were analyzed for some of their PGPR traits like ammonia production and hydrogen cyanide following conventional methods. Microbiological investigation of these samples has shown that maize rhizospheres in central and northern Benin contain a high diversity of microorganisms. A total of nine species of maize Plant Growth Promoting Rhizobacteria were identified. Those PGPR include five Bacillus species (B. polymyxa, B. pantothenticus, B. anthracis, B. thuringiensis, and B. circulans, three Pseudomonas species (P. cichorii, P. putida, and P. syringae, and Serratia marcescens. The microbial diversity does not depend on the soil types. The microbial density, generally high, varies according to both soil types and agroecological zones. All Serratia strains (100% have produced ammonia, whereas 80% of Bacillus and 77.77% of Pseudomonas produced this metabolite. The hydrogen cyanide was produced by all isolates (100% independent of their genus. These results suggest the possibility to use these rhizobacteria as biological fertilizers to increase maize production.

  4. Elemental characterization of the Persian Gulf sediments near the Bushehr Nuclear Power Plant

    International Nuclear Information System (INIS)

    Sohrabpour, M.

    2004-01-01

    Thirty-three sediment samples from four shoreline and three sea positions in a defined sampling grid around the Bushehr Nuclear Power Plant (BNPP) have been taken over six sampling periods during 1996-1997. Elemental analysis of the samples has been performed with neutron activation and concentrations of seventeen elements have been obtained. Cross-correlation analysis has been carried out and four categories of related elements have been defined. (author)

  5. Characterization of nonderivatized plant cell walls using high-resolution solution-state NMR spectroscopy

    Science.gov (United States)

    Daniel J. Yelle; John Ralph; Charles R. Frihart

    2008-01-01

    A recently described plant cell wall dissolution system has been modified to use perdeuterated solvents to allow direct in-NMR-tube dissolution and high-resolution solution-state NMR of the whole cell wall without derivatization. Finely ground cell wall material dissolves in a solvent system containing dimethylsulfoxide-d6 and 1-methylimidazole-d6 in a ratio of 4:1 (v/...

  6. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses.

    Science.gov (United States)

    Jansen, Jeroen J; van Dam, Nicole M; Hoefsloot, Huub C J; Smilde, Age K

    2009-12-16

    Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their favorable nutritional properties for humans. Each responding compound may have its own dynamic profile and metabolic relationships with other compounds. The chemical background of the induced response is therefore highly complex and may therefore not reveal all the properties of the response in any single model. This study therefore aims to describe the dynamics of the glucosinolate response, measured at three time points after induction in a feral Brassica, by a three-faceted approach, based on Principal Component Analysis. First the large-scale aspects of the response are described in a 'global model' and then each time-point in the experiment is individually described in 'local models' that focus on phenomena that occur at specific moments in time. Although each local model describes the variation among the plants at one time-point as well as possible, the response dynamics are lost. Therefore a novel method called the 'Crossfit' is described that links the local models of different time-points to each other. Each element of the described analysis approach reveals different aspects of the response. The crossfit shows that smaller dynamic changes may occur in the response that are overlooked by global models, as illustrated by the analysis of a metabolic profiling dataset of the same samples.

  7. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    Directory of Open Access Journals (Sweden)

    Smilde Age K

    2009-12-01

    Full Text Available Abstract Background Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their favorable nutritional properties for humans. Each responding compound may have its own dynamic profile and metabolic relationships with other compounds. The chemical background of the induced response is therefore highly complex and may therefore not reveal all the properties of the response in any single model. Results This study therefore aims to describe the dynamics of the glucosinolate response, measured at three time points after induction in a feral Brassica, by a three-faceted approach, based on Principal Component Analysis. First the large-scale aspects of the response are described in a 'global model' and then each time-point in the experiment is individually described in 'local models' that focus on phenomena that occur at specific moments in time. Although each local model describes the variation among the plants at one time-point as well as possible, the response dynamics are lost. Therefore a novel method called the 'Crossfit' is described that links the local models of different time-points to each other. Conclusions Each element of the described analysis approach reveals different aspects of the response. The crossfit shows that smaller dynamic changes may occur in the response that are overlooked by global models, as illustrated by the analysis of a metabolic profiling dataset of the same samples.

  8. Isolation and characterization of a plant growth-promoting rhizobacterium, Serratia sp. SY5.

    Science.gov (United States)

    Koo, So-Yeon; Cho, Kyung-Suk

    2009-11-01

    The role of plant growth-promoting rhizobacteria (PGPR) in the phytoremediation of heavy-metal-contaminated soils is important in overcoming its limitations for field application. A plant growth-promoting rhizobacterium, Serratia sp. SY5, was isolated from the rhizoplane of barnyard grass (Echinochloa crus-galli) grown in petroleum and heavy-metal-contaminated soil. This isolate has shown capacities for indole acetic acid production and siderophores synthesis. Compared with a non-inoculated control, the radicular root growth of Zea mays seedlings inoculated with SY5 can be increased by 27- or 15.4-fold in the presence of 15 mg-Cd/l or 15 mg-Cu/l, respectively. The results from hydroponic cultures showed that inoculation of Serratia sp. SY5 had a favorable influence on the initial shoot growth and biomass of Zea mays under noncontaminated conditions. However, under Cd-contaminated conditions, the inoculation of SY5 significantly increased the root biomass of Zea mays. These results indicate that Serratia sp. SY5 can serve as a promising microbial inoculant for increased plant growth in heavy-metal-contaminated soils to improve the phytoremediation efficiency.

  9. Identification and partial characterization of C-glycosylflavone markers in Asian plant dyes using liquid chromatography-tandem mass spectrometry.

    Science.gov (United States)

    Mouri, Chika; Laursen, Richard

    2011-10-14

    Flavonoids in the grasses (Poaceae family), Arthraxon hispidus (Thunb.) Makino and Miscanthus tinctorius (Steudel) Hackel have long histories of use for producing yellow dyes in Japan and China, but up to now there have been no analytical procedures for characterizing the dye components in textiles dyed with these materials. LC-MS analysis of plant material and of silk dyed with extracts of these plants shows the presence, primarily, of flavonoid C-glycosides, three of which have been tentatively identified as luteolin 8-C-rhamnoside, apigenin 8-C-rhamnoside and luteolin 8-C-(4-ketorhamnoside). Two of these compounds, luteolin 8-C-rhamnoside (M=432), apigenin 8-C-rhamnoside (M=416), along with the previously known tricin (M=330) and several other flavonoids that appear in varying amounts, serve as unique markers for identifying A. hispidus and M. tinctorius as the source of yellow dyes in textiles. Using this information, we have been able to identify grass-derived dyes in Japanese textiles dated to the Nara and Heian periods. However, due to the high variability in the amounts of various flavonoid components, our goal of distinguishing between the two plant sources remains elusive. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Examining Factors Predicting Students’ Digital Competence

    Directory of Open Access Journals (Sweden)

    Ove Edvard Hatlevik

    2015-02-01

    Full Text Available The purpose of this study was to examine factors predicting lower secondary school students’ digital competence and to explore differences between students when it comes to digital competence. Results from a digital competence test and survey in lower secondary school will be presented. It is important to learn more about and investigate what characterizes students’ digital competence. A sample of 852 ninth-grade Norwegian students from 38 schools participated in the study. The students answered a 26 item multiple-choice digital competence test and a self-report questionnaire about family background, motivation, and previous grades. Structural equation modeling was used to test a model of the hypothesised relationship between family background, mastery orientation, previous achievements, and digital competence. The results indicate variation in digital competence among the ninth-graders. Further, analyses showed that students’ conditions at home, i.e., language integration and cultural capital, together with mastery orientation and academic achievements predict students digital competence. This study indicates that that there is evidence of digital diversity between lower secondary students. It does not seem like the development of digital competence among the students happens automatically. Students’ family background and school performance are the most important factors. Therefore, as this study shows, it is necessary to further investigate how schools can identify students’ level of competence and to develop plans and actions for how schools can help to try to equalize differences.

  11. Executive summary of the guidebook on training to establish and maintain the qualification and competence of nuclear power plant operations personnel

    International Nuclear Information System (INIS)

    1990-01-01

    Since the IAEA published its guidebook on the qualification of nuclear power plant operation personnel in 1984 (Technical Reports Series no. 242) there have been important developments in the approach for training adopted by many operating organizations in different countries. The guidebook, described in this report, proposes an approach which is comprehensive and systematic in its methodology and cost effective in its implementation. 5 refs. 1 fig

  12. Executive summary of the guidebook on training to establish and maintain the qualification and competence of nuclear power plant operations personnel

    International Nuclear Information System (INIS)

    1989-01-01

    Since the IAEA published its Guidebook on the Qualification of Nuclear Power Plant Operations Personnel in 1984 (Technical Reports Series No. 242) there have been important developments in the approach for training adopted by many operating organizations in different countries. The Guidebook, described in this report, proposes an approach which is comprehensive and systematic in its methodology and cost effective in its implementation. 5 refs, 1 fig

  13. Diaphorina citri (Hemiptera: Liviidae) Vector Competence for the Citrus Greening Pathogen 'Candidatus Liberibacter Asiaticus'.

    Science.gov (United States)

    Tabachnick, Walter J

    2015-06-01

    Characterizing the vector competence of Diaphorina citri Kuwayama for 'Candidatus Liberibacter asiaticus,' the pathogen causing citrus greening, is essential for understanding the epidemiology of this disease that is threatening the U.S. citrus industry. Vector competence studies have been difficult because of the biology of D. citri, the inability to culture the pathogen, and the available diagnostic methods used to detect the bacteria in plant and insect tissues. The methods employed in many studies of D. citri vector competence may have overestimated amounts of live 'Ca. L. asiaticus' in both plant and insect tissues, and it is possible that the amounts of phloem ingested by psyllids may not contain sufficient detectable pathogen using current diagnostic methods. As a result of the difficulty in characterizing D. citri vector competence, the several daunting challenges for providing D. citri that are unable to inoculate 'Ca. L. asiaticus', as a novel method to control greening are discussed. Suggestions to overcome some of these challenges are provided. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Bio-physicochemical characterization and applied studies of carotovoricin na5 (crna5) on blb affected rice plants

    International Nuclear Information System (INIS)

    Jabeen, N.; Rasool, S.A.; Naz, S.A.

    2014-01-01

    Erwinia carotovora is a common soil borne plant pathogen, which generally infects plants of family Solanacea. In the present study, bacteriocin (CrNA5), produced by an indigenously isolated E. carotovora NA5 has been characterized and its possible anti phytopathogenic potential was shown in the field studies. CrNA5 showed its antimicrobial activity against many gram-positive and gram-negative bacteria including those associated with the plant diseases. The bacteriocin showed substantial stability against wide range of temperatures and pH. Additionally, it was also found resistant to the treatment of metal ions, organic solvents and non-proteolytic enzymes. Conversely, its inactivation by proteinase K and protease suggested its protein nature. Mode of action studies revealed that CrNA5 is bactericidal, particularly against Xanthomonas oryzae oryzae. The electron micrograph of CrNA5 revealed spherical particle (empty head) like structures implicating the vestigial bacteriophage based origin of carotovoricin. In silico analyses were also conducted in order to deduce the plausible ratio of the amino acids present in the protein. The In vivo experiments showed the efficacy of CrNA5 against X. oryzae oryzae (Xoo), the causative agent of bacterial leaf blight (BLB) of rice, both in controlled conditions (green house) as well as in field trials. To the best of our knowledge, the present study is the first of its kind with the bacteriocin of Erwinia origin (tested against the BLB infected plants in the field). It is expected that the present study will help visit new insights of the bacteriocins produced by Erwinia carotovora and their potential (application) as anti phytopathogenic agent. (author)

  15. Analyses of charophyte chloroplast genomes help characterize the ancestral chloroplast genome of land plants.

    Science.gov (United States)

    Civaň, Peter; Foster, Peter G; Embley, Martin T; Séneca, Ana; Cox, Cymon J

    2014-04-01

    Despite the significance of the relationships between embryophytes and their charophyte algal ancestors in deciphering the origin and evolutionary success of land plants, few chloroplast genomes of the charophyte algae have been reconstructed to date. Here, we present new data for three chloroplast genomes of the freshwater charophytes Klebsormidium flaccidum (Klebsormidiophyceae), Mesotaenium endlicherianum (Zygnematophyceae), and Roya anglica (Zygnematophyceae). The chloroplast genome of Klebsormidium has a quadripartite organization with exceptionally large inverted repeat (IR) regions and, uniquely among streptophytes, has lost the rrn5 and rrn4.5 genes from the ribosomal RNA (rRNA) gene cluster operon. The chloroplast genome of Roya differs from other zygnematophycean chloroplasts, including the newly sequenced Mesotaenium, by having a quadripartite structure that is typical of other streptophytes. On the basis of the improbability of the novel gain of IR regions, we infer that the quadripartite structure has likely been lost independently in at least three zygnematophycean lineages, although the absence of the usual rRNA operonic synteny in the IR regions of Roya may indicate their de novo origin. Significantly, all zygnematophycean chloroplast genomes have undergone substantial genomic rearrangement, which may be the result of ancient retroelement activity evidenced by the presence of integrase-like and reverse transcriptase-like elements in the Roya chloroplast genome. Our results corroborate the close phylogenetic relationship between Zygnematophyceae and land plants and identify 89 protein-coding genes and 22 introns present in the chloroplast genome at the time of the evolutionary transition of plants to land, all of which can be found in the chloroplast genomes of extant charophytes.

  16. Char characterization and DTF assays as tools to predict burnout of coal blends in power plants

    Energy Technology Data Exchange (ETDEWEB)

    C. Ulloa; A.G. Borrego; S. Helle; A.L. Gordon; X. Garcia [Universidad de Concepcion, Concepcion (Chile). Departamento de Ingenieria Quimica

    2005-02-01

    The aim of this study is to predict efficiency deviations in the combustion of coal blends in power plants. Combustion of blends, as compared to its single coals, shows that for some blends the behavior is non-additive in nature. Samples of coal feed and fly ashes from combustion of blends at two power plants, plus chars of the parent coals generated in a drop-tube furnace (DTF) at temperatures and heating rates similar to those found in the industrial boilers were used. Intrinsic kinetic parameters, burning profiles and petrographic characteristics of these chars correlated well with the burnout in power plants and DTF experiments. The blend combustion in a DTF reproduces both positive and negative burnout deviations from the expected weighted average. These burnout deviations have been previously attributed to parallel or parallel-series pathways of competition for oxygen. No deviations were found for blends of low rank coals of similar characteristics yielding chars close in morphology, optical texture and reactivity. Negative deviations were found for blends of coals differing moderately in rank and were interpreted as associated with long periods of competition. In this case, fly-ashes were enriched in material derived from the least reactive char, but also unburnt material attributed to the most reactive char was identified. Improved burnout compared to the weighted average was observed for blends of coals very different in rank, and interpreted as the result of a short interaction period, followed by a period where the less reactive char burns under conditions that are more favorable to its combustion. In this case, only unburned material from the least reactive char was identified in the fly-ashes. 20 refs., 9 figs., 5 tabs.

  17. Highlighting the Need for Systems-level Experimental Characterization of Plant Metabolic Enzymes

    Directory of Open Access Journals (Sweden)

    Martin Karl Magnus Engqvist

    2016-07-01

    Full Text Available The biology of living organisms is determined by the action and interaction of a large number of individual gene products, each with specific functions. Discovering and annotating the function of gene products is key to our understanding of these organisms. Controlled experiments and bioinformatic predictions both contribute to functional gene annotation. For most species it is difficult to gain an overview of what portion of gene annotations are based on experiments and what portion represent predictions. Here, I survey the current state of experimental knowledge of enzymes and metabolism in Arabidopsis thaliana as well as eleven economically important crops and forestry trees – with a particular focus on reactions involving organic acids in central metabolism. I illustrate the limited availability of experimental data for functional annotation of enzymes in most of these species. Many enzymes involved in metabolism of citrate, malate, fumarate, lactate, and glycolate in crops and forestry trees have not been characterized. Furthermore, enzymes involved in key biosynthetic pathways which shape important traits in crops and forestry trees have not been characterized. I argue for the development of novel high-throughput platforms with which limited functional characterization of gene products can be performed quickly and relatively cheaply. I refer to this approach as systems-level experimental characterization. The data collected from such platforms would form a layer intermediate between bioinformatic gene function predictions and in-depth experimental studies of these functions. Such a data layer would greatly aid in the pursuit of understanding a multiplicity of biological processes in living organisms.

  18. Isolation and characterization of polymorphic microsatellite loci from the invasive plant Solidago canadensis (Asteraceae).

    Science.gov (United States)

    Zhao, S-Y; Sun, S-G; Guo, Y-H; Chen, J-M; Wang, Q-F

    2012-02-17

    Solidago canadensis, a clonal herb originally from North America (common name: Canada goldenrod), is an invasive species in many countries. We developed microsatellite primers for this species. Eleven polymorphic loci were generated and primers were designed. Polymorphism of these 11 loci was assessed in 35 plants from two populations (Wuhan and Shanghai) in China. The number of alleles per locus ranged from 3 to 14. The observed and expected heterozygosities varied from 0.0732 to 0.7391 and from 0.1177 to 0.8687, respectively. These microsatellite markers will be useful tools for studies of population genetics in the native and invasive range of this species.

  19. Radiochemical methodologies applied to analytical characterization of low and intermediate level wastes from nuclear power plants

    International Nuclear Information System (INIS)

    Monteiro, Roberto Pellacani G.; Júnior, Aluísio Souza R.; Kastner, Geraldo F.; Temba, Eliane S.C.; Oliveira, Thiago C. de; Amaral, Ângela M.; Franco, Milton B.

    2017-01-01

    The aim of this work is to present radiochemical methodologies developed at CDTN/CNEN in order to answer a program for isotopic inventory of radioactive wastes from Brazilian Nuclear Power Plants. In this program some radionuclides, 3 H, 14 C, 55 Fe, 59 Ni, 63 Ni, 90 Sr, 93 Zr, 94 Nb, 99 Tc, 129 I, 235 U, 238 U, 238 Pu, 239 + 240 Pu, 241 Pu, 242 Pu, 241 Am, 242 Cm e 243 + 244 Cm, were determined in Low Level Wastes (LLW) and Intermediate Level Wastes (ILW) and a protocol of analytical methodologies based on radiochemical separation steps and spectrometric and nuclear techniques was established. (author)

  20. Characterization and remediation of a former manufactured gas plant (MGP) disposal site

    International Nuclear Information System (INIS)

    Murarka, I.P.; Neuhauser, E.F.; Sherman, M.W.; Taylor, B.B.; Mauro, D.M.; Ripp, J.A.; Taylor, T.D.

    1993-01-01

    From the early 1800s through the late 1940s, the production of gas using coal, coke or oil resulted in generation of large volumes of residues including coal tar, lamp black and wood chips containing cyanides at manufactured gas plant (MGP) sites. Often, these tarry residues were disposed of by burial at or near these plants. In recent years, old MGP sites have come under increased scrutiny from environmental regulators. To address the issues of groundwater contamination and need for clean-up, it is necessary to accurately determine where the tarry materials are now located and how different chemicals released from tars have migrated away from their sources. EPRI research at a coal-tar disposal site in New York has focused on examining and evaluating conventional and innovative methods for sampling and analysis to delineate the nature and extent of subsurface contamination, and to assess the efficacy of remedial actions. This paper presents some of the results of this research and offers recommendations on conducting size investigations as well as selecting appropriate remediation measures

  1. Characterizing the landscape dynamics of an invasive plant and risk of invasion using remote sensing.

    Science.gov (United States)

    Bradley, Bethany A; Mustard, John F

    2006-06-01

    Improved understanding of the spatial dynamics of invasive plant species may lead to more effective land management and reduced future invasion. Here, we identified the spatial extents of nonnative cheatgrass (Bromus tectorum) in the north central Great Basin using remotely sensed data from Landsat MSS, TM, and ETM+. We compared cheatgrass extents in 1973 and 2001 to six spatially explicit landscape variables: elevation, aspect, hydrographic channels, cultivation, roads, and power lines. In 2001, Cheatgrass was 10% more likely to be found in elevation ranges from 1400 to 1700 m (although the data suggest a preferential invasion into lower elevations by 2001), 6% more likely on west and northwest facing slopes, and 3% more likely within hydrographic channels. Over this time period, cheatgrass expansion was also closely linked to proximity to land use. In 2001, cheatgrass was 20% more likely to be found within 3 km of cultivation, 13% more likely to be found within 700 m of a road, and 15% more likely to be found within 1 km of a power line. Finally, in 2001 cheatgrass was 26% more likely to be present within 150 m of areas occupied by cheatgrass in 1973. Using these relationships, we created a risk map of future cheatgrass invasion that may aid land management. These results highlight the importance of including land use variables and the extents of current plant invasion in predictions of future risk.

  2. Site Selection and Characterization Status Report for Next Generation Nuclear Plant (NGNP)

    International Nuclear Information System (INIS)

    Holbrook, Mark

    2007-01-01

    In the near future, the US Department of Energy (DOE) will need to make important decisions regarding design and construction of the Next Generation Nuclear Plant (NGNP). One part of making these decisions is considering the potential environmental impacts that this facility may have, if constructed here at the Idaho National Laboratory (INL). The National Environmental Policy Act (NEPA) of 1969 provides DOE decision makers with a process to systematically consider potential environmental consequences of agency decisions. In addition, the Energy Policy Act of 2005 (Title VI, Subtitel C, Section 644) states that the 'Nuclear Regulatory Commission (NRC) shall have licensing and regulatory authority for any reactor authorized under this subtitle.' This stipulates that the NRC will license the NGNP for operation. The NRC NEPA Regulations (10 CFR Part 51) require tha thte NRC prepare an Environmental Impact Statement (EIS) for a permit to construct a nuclear power plant. The applicant is required to submit an Environmental report (ER) to aid the NRC in complying with NEPA.

  3. Isolation and characterization of antimicrobial compounds in plant extracts against multidrug-resistant Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    Yoko Miyasaki

    Full Text Available The number of fully active antibiotic options that treat nosocomial infections due to multidrug-resistant Acinetobacter baumannii (A. baumannii is extremely limited. Magnolia officinalis, Mahonia bealei, Rabdosia rubescens, Rosa rugosa, Rubus chingii, Scutellaria baicalensis, and Terminalia chebula plant extracts were previously shown to have growth inhibitory activity against a multidrug-resistant clinical strain of A. baumannii. In this study, the compounds responsible for their antimicrobial activity were identified by fractionating each plant extract using high performance liquid chromatography, and determining the antimicrobial activity of each fraction against A. baumannii. The chemical structures of the fractions inhibiting >40% of the bacterial growth were elucidated by liquid chromatography/mass spectrometry analysis and nuclear magnetic resonance spectroscopy. The six most active compounds were identified as: ellagic acid in Rosa rugosa; norwogonin in Scutellaria baicalensis; and chebulagic acid, chebulinic acid, corilagin, and terchebulin in Terminalia chebula. The most potent compound was identified as norwogonin with a minimum inhibitory concentration of 128 µg/mL, and minimum bactericidal concentration of 256 µg/mL against clinically relevant strains of A. baumannii. Combination studies of norwogonin with ten anti-Gram negative bacterial agents demonstrated that norwogonin did not enhance the antimicrobial activity of the synthetic antibiotics chosen for this study. In conclusion, of all identified antimicrobial compounds, norwogonin was the most potent against multidrug-resistant A. baumannii strains. Further studies are warranted to ascertain the prophylactic and therapeutic potential of norwogonin for infections due to multidrug-resistant A. baumannii.

  4. [The characterization of biosolids produced by the San Fernando wastewater treatment plant in Itagui, Antioquia, Colombia].

    Science.gov (United States)

    Bedoya-Urrego, Katherine; Acevedo-Ruíz, José M; Peláez-Jaramillo, Carlos A; Agudelo-López, Sonia Del Pilar

    2013-01-01

    ABSTRACT Objective This study was aimed at evaluating pertinent physicochemical and microbiological (bacteria and parasites) parameters regarding the biosolids produced by the San Fernando wastewater treatment plant (WWTP) in Itagui, Antioquia, Colombia. Methods Twelve samples were collected and evaluated every month from January to December during 2010. The chemical, physical and microbiological tests followed the protocol described in Colombian technical guideline 5167. The protocol described in Mexican official Norm 004 (with some modifications) was used for identifying helminth ova and assessing their viability. Results All samples proved positive for Ascarislumbricoides, viable ova count ranging from 4 to 22 eggs/2gTS. Both Salmonella and Enterobacteriawere detected in all samples evaluated, the latter having 3,000 colony forming unit (CFU)/g minimum concentration. Biosolid sample values met the heavy metal concentration requirement established by national guidelines. There was no statistical association between rainfall and the pathogen's presence in the biosolids. Conclusion Our results suggested that the biosolids being produced by the San Fernando wastewater treatment plant (WWTP) could be used as organic fertilizer; however they should be treated/sanitized to meet the stipulations in Colombian technical guideline 5167.

  5. Leachate characterization and performance evaluation of leachate treatment plant in Cipayung landfill, Indonesia

    Science.gov (United States)

    Noerfitriyani, E.; Hartono, D. M.; Moersidik, S. S.; Gusniani, I.

    2018-01-01

    The operation of landfill can cause environmental problems due to waste decomposition in the form of leachate production. Cipayung Landfill has a leachate treatment plant using stabilization ponds. The objective of this research is to evaluate the performance of stabilization ponds at Cipayung Landfill. The data were analyzed based on leachate samples from treatment unit’s influent and effluent under rainy season condition from April to May 2017. The results show the average leachate quality based on parameters of temperature by 34.81°C, Total Suspended Solid (TSS) of 72.33 mg/L, pH of 7.83, Biochemical Oxygen Demand (BOD) of 3,959.63 mg/L, Chemical Oxygen Demand (COD) of 6,860 mg/L, Total Nitrogen of 373.33 mg/L, and heavy metal Mercury of 0.0016 mg/L. The treatment plant’s effluent quality exceeds the leachate standard limit based on Indonesia’s Ministry of Environment and Forestry Law No. 59 of 2016. The results of design evaluation show that the anaerobic pond, facultative pond, and maturation pond system do not meet the design criteria. Therefore, a design improvement is needed to increase the performance of the leachate treatment plant and to ensure that the leachate discharged to water bodies does not exceed the standard limit to prevent contamination of the environment.

  6. Hypothesis: Sparse floor vegetation is on account of Inter-plant ...

    Indian Academy of Sciences (India)

    First page Back Continue Last page Graphics. Plant Interactions: Plant Interactions: Allelospoly: Interacting plants Compete for Resources. Allelopathy: Plant releases chemicals for keeping away competitors.

  7. Screening and characterization of endophytic Bacillus and Paenibacillus strains from medicinal plant Lonicera japonica for use as potential plant growth promoters

    Directory of Open Access Journals (Sweden)

    Longfei Zhao

    2015-12-01

    Full Text Available Abstract A total of 48 endophytic bacteria were isolated from surface-sterilized tissues of the medicinal plant Lonicera japonica, which is grown in eastern China; six strains were selected for further study based on their potential ability to promote plant growth in vitro (siderophore and indoleacetic acid production. The bacteria were characterized by phylogenetically analyzing their 16S rRNA gene similarity, by examining their effect on the mycelial development of pathogenic fungi, by testing their potential plant growth-promoting characteristics, and by measuring wheat growth parameters after inoculation. Results showed that the number of endophytic bacteria in L. japonica varied among different tissues, but it remained relatively stable in the same tissues from four different plantation locations. Among the three endophytic strains, strains 122 and 124 both had high siderophore production, with the latter showing the highest phosphate solubilization activity (45.6 mg/L and aminocyclopropane-1-carboxylic acid deaminase activity (47.3 nmol/mg/h. Strain 170 had the highest indoleacetic acid (IAA production (49.2 mg/L and cellulase and pectinase activities. After inoculation, most of the six selected isolates showed a strong capacity to promote wheat growth. Compared with the controls, the increase in the shoot length, root length, fresh weight, dry weight, and chlorophyll content was most remarkable in wheat seedlings inoculated with strain 130. The positive correlation between enzyme (cellulose and pectinase activity and inhibition rate on Fusarium oxysporum, the IAA production, and the root length of wheat seedlings inoculated with each tested endophytic strain was significant in regression analysis. Deformity of pathogenic fungal mycelia was observed under a microscope after the interaction with the endophytic isolates. Such deformity may be directly related to the production of hydrolytic bacterial enzymes (cellulose and pectinase. The six

  8. Purification and characterization of a beta-glucosidase from the root parasitic plant Orobanche minor Sm.

    Science.gov (United States)

    Sasanuma, Izumi; Hirakawa, Go

    2010-01-01

    The beta-glucosidase of a root parasitic angiosperm, Orobanche minor Sm., was purified and characterized. The optimum pH and temperature for activity of the enzyme were 5.0 and 50 degrees C. The beta-glucosidase was stable at up to 50 degrees C at pH 4.0-10.0. The M(r) was estimated to be 33 kD by SDS-PAGE. The enzyme hydrolyzed p-nitrophenyl-beta-D-glucopyranoside and salicin, but not the cell wall of O. minor or cellohexaose.

  9. Radiochemical methodologies applied to analytical characterization of low and intermediate level wastes from nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Monteiro, Roberto Pellacani G.; Júnior, Aluísio Souza R.; Kastner, Geraldo F.; Temba, Eliane S.C.; Oliveira, Thiago C. de; Amaral, Ângela M.; Franco, Milton B., E-mail: rpgm@cdtn.br, E-mail: reisas@cdtn.br, E-mail: gfk@cdtn.br, E-mail: esct@cdtn.br, E-mail: tco@cdtn.br, E-mail: ama@cdtn.br, E-mail: francom@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2017-07-01

    The aim of this work is to present radiochemical methodologies developed at CDTN/CNEN in order to answer a program for isotopic inventory of radioactive wastes from Brazilian Nuclear Power Plants. In this program some radionuclides, {sup 3}H, {sup 14}C, {sup 55}Fe, {sup 59}Ni, {sup 63}Ni, {sup 90}Sr, {sup 93}Zr, {sup 94}Nb, {sup 99}Tc, {sup 129}I, {sup 235}U, {sup 238}U, {sup 238}Pu, {sup 239}+{sup 240}Pu, {sup 241}Pu, {sup 242}Pu, {sup 241}Am, {sup 242}Cm e {sup 243}+{sup 244}Cm, were determined in Low Level Wastes (LLW) and Intermediate Level Wastes (ILW) and a protocol of analytical methodologies based on radiochemical separation steps and spectrometric and nuclear techniques was established. (author)

  10. Combustion synthesis of MgO nanoparticles using plant extract: Structural characterization and photoluminescence studies

    Science.gov (United States)

    Kumar, Danith; Yadav, L. S. Reddy; Lingaraju, K.; Manjunath, K.; Suresh, D.; Prasad, Daruka; Nagabhushana, H.; Sharma, S. C.; Naika, H. Raja; Chikkahanumantharayappa, Nagaraju, G.

    2015-06-01

    Magnesium oxide nanoparticles (MgO Nps) have been successfully synthesized via solution combustion method using Parthenium plant extract as fuel for the first time. Powder X-ray diffraction (PXRD) pattern reveal that product belongs to the cubic phase (Periclase). FTIR spectrum shows the band at 822 cm-1 indicates the formation of cubic periclase MgO. The optical band gap of MgO Nps estimated from UV -Vis spectrum was found to be in the range 5.40-5.45 eV. SEM images showed that, the product is agglomerated and particle in nature. Photoluminescence (PL) studies shows violet emission at 390 nm, blue emission at 470 nm and green emission at 550 nm. MgO Nps shows good photocatalytic activity for the degradation of methylene blue (MB) dye under UV/Sun light irradiation.

  11. Combustion synthesis of MgO nanoparticles using plant extract: Structural characterization and photoluminescence studies

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Danith; Chikkahanumantharayappa [Dept. of Physics, Vivekananda First grade College, Bangalore - 560055 (India); Yadav, L. S. Reddy; Nagaraju, G., E-mail: nagarajugn@rediffmail.com [Dept of Chemistry, Siddaganga Institute of Technology, Tumkur, Karnataka-572103 (India); Lingaraju, K.; Naika, H. Raja [Dept. of Environmental Science, Tumkur University, Tumkur, Karnataka-572103 (India); Manjunath, K. [Centre for Nano and Material Sciences, Jain University, Jakkasandra, Karnataka-562112 (India); Suresh, D. [Dept. of Chemistry, Tumkur University, Tumkur, Karnataka-572103 (India); Prasad, Daruka [Dept. of Physics, BMS Institute of Technology, Bangalore-560064 (India); Nagabhushana, H. [CNR Rao Center for Advanced Materials, Tumkur University, Tumkur, Karnataka-572103 (India); Sharma, S. C. [Chattisgarh Swami Vivekananda Technological University, Bhilai, Chattisgarh-490009 (India)

    2015-06-24

    Magnesium oxide nanoparticles (MgO Nps) have been successfully synthesized via solution combustion method using Parthenium plant extract as fuel for the first time. Powder X-ray diffraction (PXRD) pattern reveal that product belongs to the cubic phase (Periclase). FTIR spectrum shows the band at 822 cm{sup −1} indicates the formation of cubic periclase MgO. The optical band gap of MgO Nps estimated from UV –Vis spectrum was found to be in the range 5.40–5.45 eV. SEM images showed that, the product is agglomerated and particle in nature. Photoluminescence (PL) studies shows violet emission at 390 nm, blue emission at 470 nm and green emission at 550 nm. MgO Nps shows good photocatalytic activity for the degradation of methylene blue (MB) dye under UV/Sun light irradiation.

  12. Combustion synthesis of MgO nanoparticles using plant extract: Structural characterization and photoluminescence studies

    International Nuclear Information System (INIS)

    Kumar, Danith; Chikkahanumantharayappa; Yadav, L. S. Reddy; Nagaraju, G.; Lingaraju, K.; Naika, H. Raja; Manjunath, K.; Suresh, D.; Prasad, Daruka; Nagabhushana, H.; Sharma, S. C.

    2015-01-01

    Magnesium oxide nanoparticles (MgO Nps) have been successfully synthesized via solution combustion method using Parthenium plant extract as fuel for the first time. Powder X-ray diffraction (PXRD) pattern reveal that product belongs to the cubic phase (Periclase). FTIR spectrum shows the band at 822 cm −1 indicates the formation of cubic periclase MgO. The optical band gap of MgO Nps estimated from UV –Vis spectrum was found to be in the range 5.40–5.45 eV. SEM images showed that, the product is agglomerated and particle in nature. Photoluminescence (PL) studies shows violet emission at 390 nm, blue emission at 470 nm and green emission at 550 nm. MgO Nps shows good photocatalytic activity for the degradation of methylene blue (MB) dye under UV/Sun light irradiation

  13. Characterization of the cable fire in Block 1 of the Greifswald nuclear power plant

    International Nuclear Information System (INIS)

    Albrecht, L.; Gelfort, E.

    1996-01-01

    In December 1975 a cable fire was initiated in a stand-by power distribution by a short circuit and an incorrectly fitted diode. Unpredictably and accidentally, some control and power cables were destroyed during the fire. This caused the failure of safety-relevant components. Decay heat removal was achieved initially by natural convection in the primary loop, and finally by an emergency feed pump in the secondary loop, for which a preovisional power cable had been successfully installed after approximately 8.5 hours. This serious accident was caused by human failure and lack of experience, by the insufficiency of the redundancies as provided in the plant design, by the lack of spatial separation of safety systems, and by insufficient quality control. (orig.) [de

  14. Functional Characterization of PaLAX1, a Putative Auxin Permease, in Heterologous Plant Systems

    Czech Academy of Sciences Publication Activity Database

    Hoyerová, Klára; Perry, Lucie; Hand, P.; Laňková, Martina; Kocábek, Tomáš; May, S.; Kottová, Jana; Pačes, Jan; Napier, R.; Zažímalová, Eva

    2008-01-01

    Roč. 146, č. 3 (2008), s. 1128-1141 ISSN 0032-0889 R&D Projects: GA ČR GP206/02/P106; GA ČR GA206/02/0967; GA AV ČR IAB6038203; GA AV ČR IAA6038303; GA AV ČR KJB600380702; GA MŠk(CZ) LC06034; GA MŠk(CZ) 1M0520 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50510513; CEZ:AV0Z50520514 Keywords : Plant hormones * auxin influx carrier * AUX1 * Arabidopsis * tobacco Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.110, year: 2008

  15. Competences and life management programmes

    International Nuclear Information System (INIS)

    Brunatti, S.; Bergara, A.; Ranalli, J.; Versaci, R.

    2007-01-01

    surveillance. In some cases, it may be impossible to rebuild information. As a consequence assumptions may have to be made that cannot be easily substantiated. It is therefore essential that the strategies for plant life management are developed with sufficient clarity to enable the associated human resource strategy or long term Human Resources plan to be developed. This strategy/plan should be reviewed and updated periodically to verify that it is consistent with and supports the nuclear power plant life cycle needs. In this work we analyze the competences of young peoples for working in the Life Management and Life Extension of Nuclear Power Plants Programmes. Competences and skills are understood as including knowing and understanding (theoretical knowledge of an academic field, the capacity to know and understand), knowing how to act (practical and operational application of knowledge to certain situations), knowing how to be (values as an integral element of the way of perceiving and living with others and in a social context). Competences represent a combination of attributes (with respect to knowledge and its application, attitudes, skills and responsibilities) that describe the level or degree to which a person is capable of performing them. In this context, a competence or a set of competences mean that a person puts into play a certain capacity or skill and performs a task, where he/she is able to demonstrate that he/she can do so in a way that allows evaluation of the level of achievement. Competences can be carried out and assessed. It also means that a normally person does not either possess or lack a competence in absolute terms, but commands it to a varying degree, so that competences can be placed on a continuum. The following was taken as a working classification: - Instrumental Competences: Those having an instrumental function. They include: Cognitive abilities, capacity to understand and manipulate ideas and thoughts; Methodological capacities to

  16. Biocontrol and Plant Growth Promotion Characterization of Bacillus Species Isolated from Calendula officinalis Rhizosphere.

    Science.gov (United States)

    Ait Kaki, Asma; Kacem Chaouche, Noreddine; Dehimat, Laid; Milet, Asma; Youcef-Ali, Mounia; Ongena, Marc; Thonart, Philippe

    2013-12-01

    The phenotypic and genotypic diversity of the plant growth promoting Bacillus genus have been widely investigated in the rhizosphere of various agricultural crops. However, to our knowledge this is the first report on the Bacillus species isolated from the rhizosphere of Calendula officinalis. 15 % of the isolated bacteria were screened for their important antifungal activity against Fusarium oxysporum, Botrytis cinerea, Aspergillus niger, Cladosporium cucumerinium and Alternaria alternata. The bacteria identification based on 16S r-RNA and gyrase-A genes analysis, revealed strains closely related to Bacillus amyloliquefaciens, B. velezensis, B. subtilis sub sp spizezenii and Paenibacillus polymyxa species. The electro-spray mass spectrometry coupled to liquid chromatography (ESI-LC MS) analysis showed that most of the Bacillus isolates produced the three lipopeptides families. However, the P. polymyxa (18SRTS) didn't produce any type of lipopeptides. All the tested Bacillus isolates produced cellulase but the protease activity was observed only in the B. amyloliquefaciens species (9SRTS). The Salkowsky colorimetric test showed that the screened bacteria synthesized 6-52 μg/ml of indole 3 acetic acid. These bacteria produced siderophores with more than 10 mm wide orange zones on chromazurol S. The greenhouse experiment using a naturally infested soil with Sclerotonia sclerotiorum showed that the B. amyloliquefaciens (9SRTS) had no significant (P > 0.05) effect on the pre-germination of the chickpea seeds. However, it increased the size of the chickpea plants and reduced the stem rot disease (P Bacillus strains isolated in this work may be further used as bioinoculants to improve the production of C. officinalis and other crop systems.

  17. SAP Nuclear Competence Centre

    International Nuclear Information System (INIS)

    Andrlova, Z.

    2009-01-01

    In this issue we continue and introduce the SAP Nuclear Competence Centre and its head Mr. Igor Dzama. SAP Nuclear Competence Centrum is one of the fi rst competence centres outside ENEL headquarters. It should operate in Slovakia and should have competencies within the whole Enel group. We are currently dealing with the issues of organisation and funding. We are trying to balance the accountability to the NPP directors and to the management of the competence centres at Enel headquarters; we are looking at the relations between the competence centres within the group and defining the services that we will provide for the NPPs. author)

  18. Assessment of Innovation Competency

    DEFF Research Database (Denmark)

    Nielsen, Jan Alexis

    2015-01-01

    competency, and communication competency) as well as assessment criteria for a number of skills relevant to these subcompetencies. These assessment criteria, it is argued, largely resonate with existing literature and they provide a detailed glimpse into how assessment of innovation competency could...... of the recorded talk in interaction that occurred in teacher group discussion sessions at 5 upper secondary schools. Based on the analysis, it was possible to extrapolate assessment criteria for 5 subcompetencies relevant to innovation (creative competency, collaboration competency, navigation competency, action...

  19. A review of characterization of tocotrienols from plant oils and foods.

    Science.gov (United States)

    Ahsan, Haseeb; Ahad, Amjid; Siddiqui, Waseem A

    2015-04-01

    Tocotrienols, members of the vitamin E family, are natural compounds found in a number of vegetable oils, wheat germ, barley and certain types of nuts and grains. Vegetable oils provide the best sources of these vitamin E forms, particularly palm oil and rice bran oil contain higher amounts of tocotrienols. Other sources of tocotrienols include grape fruit seed oil, oats, hazelnuts, maize, olive oil, buckthorn berry, rye, flax seed oil, poppy seed oil and sunflower oil. Tocotrienols are of four types, viz. alpha (α), beta (β), gamma (γ) and delta (δ). Unlike tocopherols, tocotrienols are unsaturated and possess an isoprenoid side chain. A number of researchers have developed methods for the extraction, analysis, identification and quantification of different types of vitamin E compounds. This article constitutes an in-depth review of the chemistry and extraction of the unsaturated vitamin E derivatives, tocotrienols, from various sources using different methods. This review article lists the different techniques that are used in the characterization and purification of tocotrienols such as soxhlet and solid-liquid extractions, saponification method, chromatography (thin layer, column chromatography, gas chromatography, supercritical fluid, high performance), capillary electrochromatography and mass spectrometry. Some of the methods described were able to identify one form or type while others could analyse all the analogues of tocotrienol molecules. Hence, this article will be helpful in understanding the various methods used in the characterization of this lesser known vitamin E variant.

  20. Complementary Methods for the Characterization of Corrosion Products on a Plant-Exposed Superheater Tube

    DEFF Research Database (Denmark)

    Okoro, Sunday Chukwudi; Nießen, Frank; Villa, Matteo

    2017-01-01

    In this work, complex corrosion products on a superheater tube exposed to biomass firing were characterized by the complementary use of energy-dispersive synchrotron diffraction, electron microscopy, and energy-dispersive X-ray spectroscopy. Non-destructive synchrotron diffraction in transmission......-rich austenite phase to selective removal of Fe and Cr from the alloy, via a KCl-induced corrosion mechanism. Compositional variations were related to diffraction results and revealed a qualitative influence of the spinel cation concentration on the observed diffraction lines.......In this work, complex corrosion products on a superheater tube exposed to biomass firing were characterized by the complementary use of energy-dispersive synchrotron diffraction, electron microscopy, and energy-dispersive X-ray spectroscopy. Non-destructive synchrotron diffraction in transmission...... geometry measuring with a small gauge volume from the sample surface through the corrosion product allowed depth-resolved phase identification and revealed the presence of (Fe,Cr)2O3 and FeCr2O4. This was supplemented by microstructural and elemental analysis correlating the additional presence of a Ni...

  1. Chemical characterization of bottom ashes generated during combustion of a Colombian mineral coal in a thermal power plant

    International Nuclear Information System (INIS)

    Pinheiro, H.S.; Nogueira, R.E.F.Q.; Lobo, C.J.S.; Nobre, A.I.S.; Sales, J.C.; Silva, C.J.M.

    2012-01-01

    Bottom ashes generated during combustion of a mineral coal from Colombia were characterized by X-ray fluorescence spectrometry and X-ray diffraction. The interest in this particular coal is due to the fact that it will be used by a thermal power plant in Ceara, Northeastern Brazil, where it could produce over 900 tons of different residues/combustion products every day. Results from Xray fluorescence allowed identification and quantification of elements present in the sample: silicon (59,17%), aluminum (13,17%), iron (10,74%), potassium (6,11%), titanium (2,91%), calcium (4,97%), sulphur (0,84%) and others (2,09%). The X-ray diffraction revealed patterns from silica, mullite, calcium sulphate and hydrated sodium. Results obtained so far indicate that the material is a potential raw-material for use in the formulation of ceramic components (author)

  2. Characterization of ash pond ashes from 3rd thermal power plant by SEM/EDX and XRD methods

    Directory of Open Access Journals (Sweden)

    A Minjigmaa

    2014-10-01

    Full Text Available   Coal combustion by products from ash pond of 3rdthermal power plant of Ulaanbaatar city have been collected in 2010 and 2013 years. The ash samples have been characterized by XRD, XRF and SEM-EDX methods in order to evaluate their chemical and mineralogical composition changes with disposed times. The mineralogical composition of ash varies with time though the chemical composition of the ashes were close each other. Possibly, inefficient operating condition of the TPS shows influence on the mineralogical composition.DOI: http://dx.doi.org/10.5564/mjc.v14i0.201Mongolian Journal of Chemistry 14 (40, 2013, p61-65

  3. Obtention and characterization of ceramic products with addition of the mineral coal bottom ashes from thermoelectric power plants

    International Nuclear Information System (INIS)

    Kniess, C.T.; Prates, P.B.; Brys, M.; Martins, G.J.; Riella, H.G.; Bernardin, A.

    2011-01-01

    The physical, chemical and mineralogical properties of mineral coal bottom ash derived from thermoelectric power plants are compatible with various raw materials used in ceramic industries, which indicates a possibility of partial or fully substitution of raw materials by this residue. This work intends to obtain and characterize ceramic products with additions of different percentages of bottom ash coal. For this, was used a commercial ceramic body (CI) made by an industry in the state of Santa Catarina. The formulations of the ceramics products were obtained by the mixture design (planning network Simplex). The byproduct of coal bottom ash was found to be an attractive raw material source of SiO_2 and Al_2O_3 to obtain ceramic materials. Was demonstrated the possibility of developing a ceramic materials classified as semi-porous (6 10) with additions of up to 20% of coal bottom ash in the composition of the ceramic body. (author)

  4. Evolutionary characterization and transcript profiling of β-tubulin genes in flax (Linum usitatissimum L.) during plant development.

    Science.gov (United States)

    Gavazzi, Floriana; Pigna, Gaia; Braglia, Luca; Gianì, Silvia; Breviario, Diego; Morello, Laura

    2017-12-08

    Microtubules, polymerized from alpha and beta-tubulin monomers, play a fundamental role in plant morphogenesis, determining the cell division plane, the direction of cell expansion and the deposition of cell wall material. During polarized pollen tube elongation, microtubules serve as tracks for vesicular transport and deposition of proteins/lipids at the tip membrane. Such functions are controlled by cortical microtubule arrays. Aim of this study was to first characterize the flax β-tubulin family by sequence and phylogenetic analysis and to investigate differential expression of β-tubulin genes possibly related to fibre elongation and to flower development. We report the cloning and characterization of the complete flax β-tubulin gene family: exon-intron organization, duplicated gene comparison, phylogenetic analysis and expression pattern during stem and hypocotyl elongation and during flower development. Sequence analysis of the fourteen expressed β-tubulin genes revealed that the recent whole genome duplication of the flax genome was followed by massive retention of duplicated tubulin genes. Expression analysis showed that β-tubulin mRNA profiles gradually changed along with phloem fibre development in both the stem and hypocotyl. In flowers, changes in relative tubulin transcript levels took place at anthesis in anthers, but not in carpels. Phylogenetic analysis supports the origin of extant plant β-tubulin genes from four ancestral genes pre-dating angiosperm separation. Expression analysis suggests that particular tubulin subpopulations are more suitable to sustain different microtubule functions such as cell elongation, cell wall thickening or pollen tube growth. Tubulin genes possibly related to different microtubule functions were identified as candidate for more detailed studies.

  5. Chemical characterization and bioactive properties of Geranium molle L.: from the plant to the most active extract and its phytochemicals.

    Science.gov (United States)

    Graça, V C; Barros, Lillian; Calhelha, Ricardo C; Dias, Maria Inês; Carvalho, Ana Maria; Santos-Buelga, Celestino; Ferreira, Isabel C F R; Santos, P F

    2016-05-18

    After a period of indifference, in which synthetic compounds were favored, there is an increasing interest in the study of the biological properties of plants and the active principles responsible for their therapeutic properties. Geranium molle L. has been used in the Portuguese folk medicine for the treatment of various ailments including cancer but, unlike many of the species from the Geranium genus, its phytochemical characterization and biological activity are virtually unexplored. In this study a G. molle sample from Trás-os-Montes, north-eastern Portugal, was chemically characterized regarding nutritional value, free sugars, organic acids, fatty acids and tocopherols, and several aqueous (decoction, infusion) and organic (n-hexane, dichloromethane, ethyl acetate, acetone, methanol) extracts of the plant were assessed for their bioactive properties. The antioxidant activity was evaluated by means of the free radicals scavenging activity, reducing power and inhibition of lipid peroxidation. The cytotoxicity of the different extracts was assessed in vitro against several human cancer cell lines (breast, lung, cervical and hepatocellular carcinomas) and, additionally, their hepatotoxicity was evaluated using a porcine liver primary cell culture. G. molle was shown to be rich in carbohydrates and proteins, providing tocopherols and essential fatty acids. Amongst the various extracts, the acetone extract was found to have the highest content of phenolic compounds (mainly ellagitannins, but also some flavone and flavonol glycosides) as well as the highest antioxidant and cytotoxic activities. To the best of our knowledge, this is the first report on the chemical composition and bioactive properties of G. molle.

  6. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  7. Isolation and characterization of a replication-competent molecular clone of an HIV-1 circulating recombinant form (CRF33_01B.

    Directory of Open Access Journals (Sweden)

    Kok Keng Tee

    Full Text Available A growing number of emerging HIV-1 recombinants classified as circulating recombinant forms (CRFs have been identified in Southeast Asia in recent years, establishing a molecular diversity of increasing complexity in the region. Here, we constructed a replication-competent HIV-1 clone for CRF33_01B (designated p05MYKL045.1, a newly identified recombinant comprised of CRF01_AE and subtype B. p05MYKL045.1 was reconstituted by cloning of the near full-length HIV-1 sequence from a newly-diagnosed individual presumably infected heterosexually in Kuala Lumpur, Malaysia. The chimeric clone, which contains the 5' LTR (long terminal repeat region of p93JP-NH1 (a previously isolated CRF01_AE infectious clone, showed robust viral replication in the human peripheral blood mononuclear cells. This clone demonstrated robust viral propagation and profound syncytium formation in CD4+, CXCR4-expressing human glioma NP-2 cells, indicating that p05MYKL045.1 is a CXCR4-using virus. Viral propagation, however, was not detected in various human T cell lines including MT-2, M8166, Sup-T1, H9, Jurkat, Molt-4 and PM1. p05MYKL045.1 appears to proliferate only in restricted host range, suggesting that unknown viral and/or cellular host factors may play a role in viral infectivity and replication in human T cell lines. Availability of a CRF33_01B molecular clone will be useful in facilitating the development of vaccine candidates that match the HIV-1 strains circulating in Southeast Asia.

  8. Characterization of the molluscicidal activity of Bauhinia variegata and Mimusops elengi plant extracts against the fasciola vector Lymnaea acuminata.

    Science.gov (United States)

    Singh, Kanchan Lata; Singh, D K; Singh, Vinay Kumar

    2012-01-01

    The molluscicidal activity of Bauhinia variegata leaf and Mimusops elengi bark was studied against vector snail Lymnaea acuminata. The toxicity of both plants was time and concentration-dependent. Among organic extracts, ethanol extracts of both plants were more toxic. Toxicity of B. variegata leaf ethanolic extract (96h LC50- 14.4 mg/L) was more pronounced than M. elengi bark ethanolic extract (96h LC50-15.0 mg/L). The 24h LC50 of column purified fraction of B. variegata and M. elengi bark were 20.3 mg/L and 18.3 mg/L, respectively. Saponin and quercetin were characterized and identified as active molluscicidal component. Co-migration of saponin (Rf 0.48) and quercetin (Rf 0.52) with column purified bark of M. elengi and leaf of B. variegata on thin layer chromatography demonstrate same Rf value i.e. 0.48 and 0.52, respectively. The present study clearly indicates the possibility of using M. elengi and/or B. variegata as potent molluscicide.

  9. Characterization of five typical agave plants used to produce mezcal through their simple lipid composition analysis by gas chromatography.

    Science.gov (United States)

    Martínez-Aguilar, Juan Fco; Peña-Alvarez, Araceli

    2009-03-11

    Five agave plants typically used in Mexico for making mezcal in places included in the Denomination of Origin (Mexican federal law that establishes the territory within which mezcal can be produced) of this spirit were analyzed: Agave salmiana ssp. crassispina, A. salmiana var. salmiana, Agave angustifolia, Agave cupreata, and Agave karwinskii. Fatty acid and total simple lipid profiles of the mature heads of each plant were determined by means of a modified Bligh-Dyer extraction and gas chromatography. Sixteen fatty acids were identified, from capric to lignoceric, ranging from 0.40 to 459 microg/g of agave. Identified lipids include free fatty acids, beta-sitosterol, and groups of mono-, di-, and triacylglycerols, their total concentration ranging from 459 to 992 microg/g of agave. Multivariate analyses performed on the fatty acid profiles showed a close similarity between A. cupreata and A. angustifolia. This fact can be ascribed to the taxa themselves or differences in growing conditions, an issue that is still to be explored. These results help to characterize the agaves chemically and can serve to relate the composition of mezcals from various states of Mexico with the corresponding raw material.

  10. Characterization of Ni-tolerant methylobacteria associated with the hyperaccumulating plant Thlaspi goesingense and description of Methylobacterium goesingense sp. nov.

    Science.gov (United States)

    Idris, Rughia; Kuffner, Melanie; Bodrossy, Levente; Puschenreiter, Markus; Monchy, Sebastien; Wenzel, Walter W; Sessitsch, Angela

    2006-12-01

    Various pink-pigmented facultative methylotrophic (PPFM) bacteria (strains iEII3, iEIV1, iEI6, iEII1, iEIII3 iEIII4, iEIII5, iRII1, iRII2, iRIII1, iRIV1 and iRIV2) were obtained from the rhizosphere and endosphere of hyperaccumulating plant Thlaspi goesingense grown in Redschlag, Austria [R. Idris, R. Trifonova, M. Puschenreiter, W.W. Wenzel, A. Sessitsch, Bacterial communities associated with flowering plants of the Ni hyperaccumulator Thlaspi goesingense, Appl. Environ. Microbiol. 70 (2004) 2667-2677]. Due to their unexpected diversity, abundance and nickel tolerance they were further characterized by detailed 16S rRNA gene analysis, DNA-DNA hybridization, fatty acid analysis, heavy metal tolerance, screening for known Ni resistance genes and phenotypic analysis. These strains were found to exhibit different multiple heavy metal resistance characteristics to Ni, Cd, Co, Zn and Cr. On the basis of their physiological and genotypic properties, strains could be grouped with Methylobacterium extorquens and M. mesophilicum. One endophyte, strain iEII3, was found to belong to a novel species for which the name M. goesingense is proposed.

  11. Characterization and isolation of some genes of the shikimate pathway in sensitive and resistant Centaurea jacea plants after ozone exposure

    Energy Technology Data Exchange (ETDEWEB)

    Francini, A. [Dipartimento di Coltivazione e Difesa delle Specie Legnose ' Giovanni Scaramuzzi' , University of Pisa, Via del Borghetto 80, 56124 Pisa (Italy); Nali, C. [Dipartimento di Coltivazione e Difesa delle Specie Legnose ' Giovanni Scaramuzzi' , University of Pisa, Via del Borghetto 80, 56124 Pisa (Italy)], E-mail: cristina.nali@agr.unipi.it; Pellegrini, E.; Lorenzini, G. [Dipartimento di Coltivazione e Difesa delle Specie Legnose ' Giovanni Scaramuzzi' , University of Pisa, Via del Borghetto 80, 56124 Pisa (Italy)

    2008-01-15

    Centaurea jacea has been suggested as a potential bioindicator for ozone, but little is known about its intraspecific variation in sensitivity, especially at molecular level. The effects of ozone (200 ppb, 5 h) on sensitive and resistant lines of Centaurea have been investigated at the end of fumigation. Sensitive plants showed characteristic symptoms of injury in the form of diffuse discoloration stipples on leaves. A PCR-based approach was used to identify and isolate a partial-length cDNA coding for PAL and CHS genes. The northern analysis of PAL showed accumulation of transcript in both lines correlated with a typical increase of PAL activity (+41 and +91% in resistant and sensitive material, respectively, compared to controls). On the contrary, the transcripts of CHS, in resistant and sensitive plants, did not change after treatment. Total phenols were not affected by ozone, while anthocyanins were quickly utilised by resistant clone as antioxidant compounds. - Characterization and isolation of PAL and CHS genes in Centaurea jacea exposed to O{sub 3}.

  12. Synthesis, characterizations and photocatalytic studies of mesoporous titania prepared by using four plant skins as templates

    Energy Technology Data Exchange (ETDEWEB)

    Miao Yingchun [Department of Applied Chemistry, Key Laboratory of Medicinal Chemistry for Natural Resource, Ministry of Education, Yunnan University, Kunming 650091 (China); Faculty of Chemical and Life Sciences, Qujing Normal University, Qujing 655000 (China); Zhai Zhongbiao [Department of Applied Chemistry, Key Laboratory of Medicinal Chemistry for Natural Resource, Ministry of Education, Yunnan University, Kunming 650091 (China); Kunming Metallurgy Research Institute, Kunming 650031 (China); He Jiao; Li Bin; Li Junjie [Department of Applied Chemistry, Key Laboratory of Medicinal Chemistry for Natural Resource, Ministry of Education, Yunnan University, Kunming 650091 (China); Wang Jiaqiang, E-mail: jqwang@ynu.edu.cn [Department of Applied Chemistry, Key Laboratory of Medicinal Chemistry for Natural Resource, Ministry of Education, Yunnan University, Kunming 650091 (China)

    2010-07-20

    Anatase mesoporous titania with novel morphologies were synthesized by using the skins of tomatoes, bulb onions, grapes, and garlic bulbs, respectively, as templates and used for the photodegradation of Gentian violet, methyl violet, xylenol orange, and Rhodamine B under UV light. The samples were characterized by a combination of various physicochemical techniques, such as X-ray diffraction, SEM, HRTEM, N{sub 2} adsorption/desorption, diffuse reflectance UV-Vis, and FT-IR. It was found that all of the synthesized mesoporous titania samples exhibited similar morphologies to those of the original templates. The photoactivity of P25 TiO{sub 2} for the four dyes is nearly the same while the mesoporous titania samples synthesized by using the four skins as templates exhibited varied photoactivities for the four dyes.

  13. Characterization of a eukaryotic translation initiation factor 5A homolog from Tamarix androssowii involved in plant abiotic stress tolerance

    Directory of Open Access Journals (Sweden)

    Wang Liuqiang

    2012-07-01

    Full Text Available Abstract Background The eukaryotic translation initiation factor 5A (eIF5A promotes formation of the first peptide bond at the onset of protein synthesis. However, the function of eIF5A in plants is not well understood. Results In this study, we characterized the function of eIF5A (TaeIF5A1 from Tamarix androssowii. The promoter of TaeIF5A1 with 1,486 bp in length was isolated, and the cis-elements in the promoter were identified. A WRKY (TaWRKY and RAV (TaRAV protein can specifically bind to a W-box motif in the promoter of TaeIF5A1 and activate the expression of TaeIF5A1. Furthermore, TaeIF5A1, TaWRKY and TaRAV share very similar expression pattern and are all stress-responsive gene that functions in the abscisic acid (ABA signaling pathway, indicating that they are components of a single regulatory pathway. Transgenic yeast and poplar expressing TaeIF5A1 showed elevated protein levels combined with improved abiotic stresses tolerance. Furthermore, TaeIF5A1-transformed plants exhibited enhanced superoxide dismutase (SOD and peroxidase (POD activities, lower electrolyte leakage and higher chlorophyll content under salt stress. Conclusions These results suggested that TaeIF5A1 is involved in abiotic stress tolerance, and is likely regulated by transcription factors TaWRKY and TaRAV both of which can bind to the W-box motif. In addition, TaeIF5A1 may mediate stress tolerance by increasing protein synthesis, enhancing ROS scavenging by improving SOD and POD activities, and preventing chlorophyll loss and membrane damage. Therefore, eIF5A may play an important role in plant adaptation to changing environmental conditions.

  14. Characterization of a eukaryotic translation initiation factor 5A homolog from Tamarix androssowii involved in plant abiotic stress tolerance.

    Science.gov (United States)

    Wang, Liuqiang; Xu, Chenxi; Wang, Chao; Wang, Yucheng

    2012-07-26

    The eukaryotic translation initiation factor 5A (eIF5A) promotes formation of the first peptide bond at the onset of protein synthesis. However, the function of eIF5A in plants is not well understood. In this study, we characterized the function of eIF5A (TaeIF5A1) from Tamarix androssowii. The promoter of TaeIF5A1 with 1,486 bp in length was isolated, and the cis-elements in the promoter were identified. A WRKY (TaWRKY) and RAV (TaRAV) protein can specifically bind to a W-box motif in the promoter of TaeIF5A1 and activate the expression of TaeIF5A1. Furthermore, TaeIF5A1, TaWRKY and TaRAV share very similar expression pattern and are all stress-responsive gene that functions in the abscisic acid (ABA) signaling pathway, indicating that they are components of a single regulatory pathway. Transgenic yeast and poplar expressing TaeIF5A1 showed elevated protein levels combined with improved abiotic stresses tolerance. Furthermore, TaeIF5A1-transformed plants exhibited enhanced superoxide dismutase (SOD) and peroxidase (POD) activities, lower electrolyte leakage and higher chlorophyll content under salt stress. These results suggested that TaeIF5A1 is involved in abiotic stress tolerance, and is likely regulated by transcription factors TaWRKY and TaRAV both of which can bind to the W-box motif. In addition, TaeIF5A1 may mediate stress tolerance by increasing protein synthesis, enhancing ROS scavenging by improving SOD and POD activities, and preventing chlorophyll loss and membrane damage. Therefore, eIF5A may play an important role in plant adaptation to changing environmental conditions.

  15. Salicornia as a crop plant in temperate regions: selection of genetically characterized ecotypes and optimization of their cultivation conditions.

    Science.gov (United States)

    Singh, Devesh; Buhmann, Anne K; Flowers, Tim J; Seal, Charlotte E; Papenbrock, Jutta

    2014-11-10

    Rising sea levels and salinization of groundwater due to global climate change result in fast-dwindling sources of freshwater. Therefore, it is important to find alternatives to grow food crops and vegetables. Halophytes are naturally evolved salt-tolerant plants that are adapted to grow in environments that inhibit the growth of most glycophytic crop plants substantially. Members of the Salicornioideae are promising candidates for saline agriculture due to their high tolerance to salinity. Our aim was to develop genetically characterized lines of Salicornia and Sarcocornia for further breeding and to determine optimal cultivation conditions. To obtain a large and diverse genetic pool, seeds were collected from different countries and ecological conditions. The external transcribed spacer (ETS) sequence of 62 Salicornia and Sarcocornia accessions was analysed: ETS sequence data showed a clear distinction between the two genera and between different Salicornia taxa. However, in some cases the ETS was not sufficiently variable to resolve morphologically distinct species. For the determination of optimal cultivation conditions, experiments on germination, seedling establishment and growth to a harvestable size were performed using different accessions of Salicornia spp. Experiments revealed that the percentage germination was greatest at lower salinities and with temperatures of 20/10 °C (day/night). Salicornia spp. produced more harvestable biomass in hydroponic culture than in sand culture, but the nutrient concentration requires optimization as hydroponically grown plants showed symptoms of stress. Salicornia ramosissima produced more harvestable biomass than Salicornia dolichostachya in artificial sea water containing 257 mM NaCl. Based on preliminary tests on ease of cultivation, gain in biomass, morphology and taste, S. dolichostachya was investigated in more detail, and the optimal salinity for seedling establishment was found to be 100 mM. Harvesting of S

  16. Characterization study of cesium concentrated particles in the soils near the Fukushima Daiichi nuclear power plant

    Science.gov (United States)

    Satou, Yukihiko; Sueki, Keisuke; Sasa, Kimikazu; Adachi, Kouji; Igarashi, Yasuhito

    2015-04-01

    Radionuclides from the Fukushima Dai-ichi Nuclear Power Plant (FDNPP) accident contaminated a vast area. Two types of contamination, spread and spot types, were observed in soils with autoradiography using an imaging plate. Other samples such as dust filters, vegetation, X-ray films, and so on, also indicate the spot type contamination in the early stage of the FDNPP accident. The source of spot type contamination is well known as hot particles at the Chernobyl Nuclear Power Plant (ChNPP) accident in 1986. Hot particles were divided into two groups, fuel hot particles and fission product particles, and they were emitted directly from reactor core with phreatic explosion and fire. In contrast, the official reports of the FDNPP accident did not conforme core explosion. In addition, the emitted total amount of Uranium was very few (Yamamoto et al., 2014). Thus, the spot type contaminations were not identified as the same of hot particles yet. Therefore, the present study aimed to pick up and identify the spot contaminations in soils. Surface soil samples were collected at 20 km northwest from the FDNPP in June 2013. Soils were spread in plastic bags for autoradiography with imaging plate analysis. Then, the soil particles were collected on a sticky carbon tape and analyzed by SEM-EDS to detect radioactive particles. Finally, particles were confirmed to contain photo peaks in the γ-spectrum by a germanium semiconductor detector. Four radioactive particles were isolated from the soil samples in the present study. Detected γ-ray emission radionuclides were only Cs-134 and Cs-137. The X-ray spectra on the SEM-EDS of all particles showed a Cs peak as well as O, Fe, Zn, and Rb peaks, and these elements were distributed uniformly within the particles. In addition, uniform distribution of Si was also shown. Moreover, U was detected from one of the particles, but U concentration was very low and existed locally in the particle. These characters are very similar to previous

  17. Characterization of bottom ashes from coal pulverized power plants to determine their potential use feasibility

    International Nuclear Information System (INIS)

    Menendez, E.; Alvaro, A. M.; Argiz, C.; Parra, J. L.; Moragues, A.

    2013-01-01

    The disposal of coal by products represents environmental and economical problems around the world. Therefore, the reuse and valorisation of this waste has become an important issue in the last decades. While high-value construction products containing fly ash were developed and its use is actually totally accepted as an addition to cement, the use of the bottom ash as supplementary cementitious material has not been allow. This paper examines the chemical and physical properties of fly ashes and bottom ashes from two different coal power plants in order to compare them and analyse the potential feasibility of bottom ash as cement replacement. The mechanical properties of cement mortars made with different percentages of both ashes were also study. The results obtained showed similar chemical composition of both kinds of ashes. The compressive strength values of mortars with 10 % and 25 % of cement replacement (at 28 days) were above the limits established in European standards and there were not significant differences between fly ash and bottom ash from both origins. (Author)

  18. Processing Pipeline of Sugarcane Spectral Response to Characterize the Fallen Plants Phenomenon

    International Nuclear Information System (INIS)

    Solano, Agustín; Hadad, Alejandro; Kemerer, Alejandra

    2016-01-01

    Nowadays, in agronomic systems it is possible to make a variable management of inputs to improve the efficiency of agronomic industry and optimize the logistics of the harvesting process. In this way, it was proposed for sugarcane culture the use of remote sensing tools and computational methods to identify useful areas in the cultivated lands. The objective was to use these areas to make variable management of the crop. When at the moment of harvesting the sugarcane there are fallen stalks, together with them some strange material (vegetal or mineral) is collected. This strange material is not millable and when it enters onto the sugar mill it causes important looses of efficiency in the sugar extraction processes and affects its quality. Considering this issue, the spectral response of sugarcane plants in aerial multispectral images was studied. The spectral response was analyzed in different bands of the electromagnetic spectrum. Then, the aerial images were segmented to obtain homogeneous regions useful for producers to make decisions related to the use of inputs and resources according to the variability of the system (existence of fallen cane and standing cane). The obtained segmentation results were satisfactory. It was possible to identify regions with fallen cane and regions with standing cane with high precision rates. (paper)

  19. Characterizing mercury emissions from a coal-fired power plant utilizing a venturi wet FGD system

    International Nuclear Information System (INIS)

    Vann Bush, P.; Dismukes, E.B.; Fowler, W.K.

    1995-01-01

    Southern Research Institute (SRI) conducted a test program at a coal-fired utility plant from October 24 to October 29, 1994. The test schedule was chosen to permit us to collect samples during a period of consecutive days with a constant coal source. SRI collected the samples required to measured concentrations of anions and trace elements around two scrubber modules and in the stack. Anions of interest were CI - , F - , and SO 4 = . We analyzed samples for five major elements (Al, Ca, Fe, Mg, and Ti) and 16 trace elements (As, B, Ba, Be, Cd, Co, Cr, Cu, Hg, Mn, Mo, Ni, Pb, Sb, Se, and V). SRI made measurements across two scrubber modules, each treating nominally 20% of the total effluent from the boiler. Across one module we examined the effects of changes in the liquid-to-gas ratio (L/G) on the efficiency with which the scrubber removes trace elements and anions from the flue gas. Across another module we examined the effects of slurry pH on the removal of trace elements and anions from the flue gas. Measurements in the stack quantified emissions rates of anions and trace elements

  20. Characterizing mercury emissions from a coal-fired power plant utilizing a venturi wet FGD system

    Energy Technology Data Exchange (ETDEWEB)

    Vann Bush, P.; Dismukes, E.B.; Fowler, W.K.

    1995-11-01

    Southern Research Institute (SRI) conducted a test program at a coal-fired utility plant from October 24 to October 29, 1994. The test schedule was chosen to permit us to collect samples during a period of consecutive days with a constant coal source. SRI collected the samples required to measured concentrations of anions and trace elements around two scrubber modules and in the stack. Anions of interest were CI{sup -}, F{sup -}, and SO{sub 4}{sup =}. We analyzed samples for five major elements (Al, Ca, Fe, Mg, and Ti) and 16 trace elements (As, B, Ba, Be, Cd, Co, Cr, Cu, Hg, Mn, Mo, Ni, Pb, Sb, Se, and V). SRI made measurements across two scrubber modules, each treating nominally 20% of the total effluent from the boiler. Across one module we examined the effects of changes in the liquid-to-gas ratio (L/G) on the efficiency with which the scrubber removes trace elements and anions from the flue gas. Across another module we examined the effects of slurry pH on the removal of trace elements and anions from the flue gas. Measurements in the stack quantified emissions rates of anions and trace elements.

  1. CHARACTERIZATION OF THE SLUDGE OF IBN ZIAD CONSTANTINE SEWAGE TREATMENT PLANT FOR ITS LANDSPREADING

    Directory of Open Access Journals (Sweden)

    WASSILA CHEURFI

    2016-04-01

    Full Text Available The purpose of this study was to determine the content of metals elements in the sludge of Ibn Ziad sewage treatment plant of Constantine in order to preserve its quality for subsequent use in agriculture. The use of X-ray fluorescence spectroscopy allowed us to identify the following constituents in this mud: Mg, Al, Si, P, S, Cl, K, Ca, Ti, V, Cr, Mn Fe, Ni, Cu, Zn, Ga, As, Se, Br, Rb, Sr, Y, Zr, Ba, Pb. These elements represent 49.82 % of the total mass of the sludge. The elements present with regulated content limit are chromium, copper, nickel, lead and zinc. They occur respectively with the following concentrations: 0.27 mg·g-1, 0.48 mg·g-1, 0.11 mg·g-1, 0.35 mg·g-1 and 2.70 mg·g-1. We have achieved an extraction for evaluating the concentration of the dissolved nitrate ions, the chemical oxygen demand (COD, and pH. The nitrate ions were transformed into sodium paranitrosalicylate to be dosed by ultraviolet-visible (UV-Vis spectroscopy at 420 nm. The concentration measured was 0.12 mg·g-1. The measuring of the COD issued a value of 0.45 mg·g-1. pH was 7.1.

  2. Transfer characterization of sulfur from coal-burning emission to plant leaves by PIXE and XANES

    Energy Technology Data Exchange (ETDEWEB)

    Bao, L.M.; Zhang, G.L.; Zhang, Y.X.; Li, Y.; Lin, J.; Liu, W.; Cao, Q.C.; Zhao, Y.D.; Ma, C.Y.; Han, Y. [Chinese Academy of Sciences, Shanghai (China). Shanghai Institute of Applied Physics

    2009-11-15

    The impact of coal-burning emission on sulfur in camphor leaves was investigated using Proton Induced X-ray Emission (PIXE) and synchrotron radiation technique X-ray Absorption Near-Edge Structure (XANES) spectroscopy. The PIXE results show that the sulfur concentrations in the leaves collected at the polluted site are significantly higher than those in controls. The sulfur XANES spectra show the presence of organic (disulfides, thiols, thioethers, sulfonates and sulfoxides) and inorganic sulfur (sulfates) in the leaves. The inorganic sulfur in the leaves of camphor tree polluted by coal combustion is 15% more than that of the control site. The results suggest that the long-term coal-burning pollution resulted in an enhanced content of the total sulfur and sulfate in the leaves, and the uptake of sulfur by leaves had exceeded the metabolic requirement of plants and the excess of sulfur was stored as SO{sub 4}2{sup -}. It can monitor the sulfur pollution in atmosphere.

  3. Molecular Characterization of a Trisegmented Mycovirus from the Plant Pathogenic Fungus Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Jie Zhong

    2016-09-01

    Full Text Available A novel double-stranded RNA (dsRNA mycovirus, consisting of three dsRNA genome segments and possibly belonging to the family Chrysoviridae, was isolated from the filamentous phytopathogenic fungus Colletotrichum gloeosporioides and designated as Colletotrichum gloeosprioides chrysovirus 1 (CgCV1. The three dsRNAs of the CgCV1 genome with lengths of 3397, 2869, and 2630 bp (dsRNAs1–3 were found to contain a single open reading frame (ORF putatively encoding the RNA-dependent RNA polymerase (RdRp, a capsid protein, and a protease, respectively, all of which exhibited some degree of sequence similarity to the comparable putative proteins encoded by the genus Chrysovirus. The 5′- and 3′-untranslated regions in each dsRNA segment contained similar sequences that were strictly conserved at the termini. Moreover, isometric virus-like particles (VLPs with a diameter of approximately 40 nm were extracted from fungal mycelia. Phylogenetic analysis based on the conserved dsRNA1-encoded RdRp showed that CgCV1 is a new virus belonging to the Chrysoviridae family. BLAST analysis revealed the presence of CgCV1-like sequences in the chromosomes of Medicago truncatula and Solanum tuberosum. Moreover, some sequences in the transcriptome shotgun assembly (TSA library and expressed sequence tag database (ESTdb of other eudicot and monocot plants were also found to be related to CgCV1.

  4. Developing mathematical modelling competence

    DEFF Research Database (Denmark)

    Blomhøj, Morten; Jensen, Tomas Højgaard

    2003-01-01

    In this paper we introduce the concept of mathematical modelling competence, by which we mean being able to carry through a whole mathematical modelling process in a certain context. Analysing the structure of this process, six sub-competences are identified. Mathematical modelling competence...... cannot be reduced to these six sub-competences, but they are necessary elements in the development of mathematical modelling competence. Experience from the development of a modelling course is used to illustrate how the different nature of the sub-competences can be used as a tool for finding...... the balance between different kinds of activities in a particular educational setting. Obstacles of social, cognitive and affective nature for the students' development of mathematical modelling competence are reported and discussed in relation to the sub-competences....

  5. Competence and Professional Expertise

    NARCIS (Netherlands)

    Evers, A.T.; Heijden, B.I.J.M. van der; Mulder, M.

    2017-01-01

    Theoretical and empirical controversies exist about the understanding and potentials of the concepts of competence and professional expertise. In this chapter, both concepts will be thoroughly conceptualised and discussed. Competence and professional expertise are important as all professionals need

  6. Competence and Professional Expertise

    NARCIS (Netherlands)

    Evers, Arnoud; Van der Heijden, Beatrice

    2018-01-01

    Theoretical and empirical controversies exist about the understanding and potentials of the concepts competence and professional expertise. In this chapter, both concepts will be thoroughly conceptualised and discussed. Competence and professional expertise are important as all professionals need to

  7. Molecular and phylogenetic characterization of the sieve element occlusion gene family in Fabaceae and non-Fabaceae plants.

    Science.gov (United States)

    Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2010-10-08

    The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected

  8. Microbial community functional structures in wastewater treatment plants as characterized by GeoChip.

    Science.gov (United States)

    Wang, Xiaohui; Xia, Yu; Wen, Xianghua; Yang, Yunfeng; Zhou, Jizhong

    2014-01-01

    Biological WWTPs must be functionally stable to continuously and steadily remove contaminants which rely upon the activity of complex microbial communities. However, knowledge is still lacking in regard to microbial community functional structures and their linkages to environmental variables. To investigate microbial community functional structures of activated sludge in wastewater treatment plants (WWTPs) and to understand the effects of environmental factors on their structure. 12 activated sludge samples were collected from four WWTPs in Beijing. A comprehensive functional gene array named GeoChip 4.2 was used to determine the microbial functional genes involved in a variety of biogeochemical processes such as carbon, nitrogen, phosphorous and sulfur cycles, metal resistance, antibiotic resistance and organic contaminant degradation. High similarities of the microbial community functional structures were found among activated sludge samples from the four WWTPs, as shown by both diversity indices and the overlapped genes. For individual gene category, such as egl, amyA, lip, nirS, nirK, nosZ, ureC, ppx, ppk, aprA, dsrA, sox and benAB, there were a number of microorganisms shared by all 12 samples. Canonical correspondence analysis (CCA) showed that the microbial functional patterns were highly correlated with water temperature, dissolved oxygen (DO), ammonia concentrations and loading rate of chemical oxygen demand (COD). Based on the variance partitioning analyses (VPA), a total of 53% of microbial community variation from GeoChip data can be explained by wastewater characteristics (25%) and operational parameters (23%), respectively. This study provided an overall picture of microbial community functional structures of activated sludge in WWTPs and discerned the linkages between microbial communities and environmental variables in WWTPs.

  9. Microbial community functional structures in wastewater treatment plants as characterized by GeoChip.

    Directory of Open Access Journals (Sweden)

    Xiaohui Wang

    Full Text Available BACKGROUND: Biological WWTPs must be functionally stable to continuously and steadily remove contaminants which rely upon the activity of complex microbial communities. However, knowledge is still lacking in regard to microbial community functional structures and their linkages to environmental variables. AIMS: To investigate microbial community functional structures of activated sludge in wastewater treatment plants (WWTPs and to understand the effects of environmental factors on their structure. METHODS: 12 activated sludge samples were collected from four WWTPs in Beijing. A comprehensive functional gene array named GeoChip 4.2 was used to determine the microbial functional genes involved in a variety of biogeochemical processes such as carbon, nitrogen, phosphorous and sulfur cycles, metal resistance, antibiotic resistance and organic contaminant degradation. RESULTS: High similarities of the microbial community functional structures were found among activated sludge samples from the four WWTPs, as shown by both diversity indices and the overlapped genes. For individual gene category, such as egl, amyA, lip, nirS, nirK, nosZ, ureC, ppx, ppk, aprA, dsrA, sox and benAB, there were a number of microorganisms shared by all 12 samples. Canonical correspondence analysis (CCA showed that the microbial functional patterns were highly correlated with water temperature, dissolved oxygen (DO, ammonia concentrations and loading rate of chemical oxygen demand (COD. Based on the variance partitioning analyses (VPA, a total of 53% of microbial community variation from GeoChip data can be explained by wastewater characteristics (25% and operational parameters (23%, respectively. CONCLUSIONS: This study provided an overall picture of microbial community functional structures of activated sludge in WWTPs and discerned the linkages between microbial communities and environmental variables in WWTPs.

  10. Methodological considerations for characterizing potential antioxidant actions of bioactive components in plant foods.

    Science.gov (United States)

    Aruoma, Okezie I

    2003-01-01

    The study of free radicals and antioxidants in biology is producing medical revolution that promises a new age of health and disease management. From prevention of the oxidative reactions in foods, pharmaceuticals and cosmetics to the role of reactive oxygen species (ROS) in chronic degenerative diseases including cancer, autoimmune, inflammatory, cardiovascular and neurodegenerative (e.g. Alzheimer's disease, Parkinson's disease, multiple sclerosis, Downs syndrome) and aging challenges continue to emerge from difficulties associated with methods used in evaluating antioxidant actions in vivo. Our interest presently is focused on development of neurodegeneration models based on the integrity of neuronal cells in the central nervous system and how they are protected by antioxidants when challenged by neurotoxins as well as Fenton chemistry models based on the profile of polyunsaturated fatty acids (PUFAs) for the assessment of antioxidant actions in vivo. Use continues to be made of several in vitro analytical tools to characterise the antioxidant propensity of bioactive compounds in plant foods and supplements. For example, the oxygen radical absorbance capacity (ORAC), ferric reducing antioxidant power (FRAP), total oxidant scavenging capacity (TOSC), the deoxyribose assay, assays involving oxidative DNA damage, assays involving reactive nitrogen intermediates (e.g. ONOO(-)), Trolox equivalent antioxidant capacity (TEAC) and the 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay. There is need to agree governance on in vitro antioxidant methods based on an understanding of the mechanisms involved. Because some of the assays are done in non-physiological pH values, it is impossible to extrapolate the results to physiological environment. The consensus of opinion is that a mix of these tools should be used in assessing the antioxidant activities in vitro. The proof of bio-efficacy must emanate from application of reliable in vivo models where markers of baseline oxidative

  11. [Radioecological monitoring of the Yenisei River and citological characterization of a submerged aquatic plant Elodea canadensis].

    Science.gov (United States)

    Bolsunovskiĭ, A Ia; Muratova, E N; Sukovatyĭ, A G; Pimenov, A V; Sanzharaeva, E A; Zotina, T A; Sedel'nikova, T S; Pan'kov, E V; Kornilova, M G

    2007-01-01

    The study was devoted to investigation of the contents of radionuclides and of heavy metals and to evaluate the frequency of chromosomal aberrations in samples of Elodea canadensis, a submerged plant, collected in different parts of the Yenisei River. The samples were collected in the area subjected to radioactive impact of the Mining-and-Chemical Combine (MCC) at Zheleznogorsk and in the control area, upstream of the MCC. The investigations shown that elodea biomass in the area affected by MCC operation contained a long inventory of artificial radionuclides typical for the MCC discharges. The upstream of the MCC, in the control sampling area, the sediments and the elodea biomass contained only one artificial radionuclide--137Cs. Thus, the exposure doses to elodea shoots and roots upstream of the MCC are small (not more than 8 microGy/d) and the main contribution info the dose is made by natural radionuclides. At the MCC discharge site (the village of Atamanovo) and at the downstream of it, the total dose rate increases almost an order of magnitude, reaching its maximal values--72 microGy/d for elodea shoots and 58 microGy/d for its roots. Cytogenetic investigations of elodea roots shown that at the MCC discharge site (the village of Atamanovo) and at downstream of it the occurrence of chromosomal aberrations in ana-telophase and in metaphase cells of elodea was considerably higher than in the control area. It is highly probable that this simultaneous dramatic increase in the total exposure rate and the occurrence of chromosomal aberrations in elodea is associated with the radiation factor. It is suggested that elodea is affected not only by the radiation factor but also by the chemical factor--toxicity of heavy metals.

  12. On the ASR and ASR thermal residues characterization of full scale treatment plant.

    Science.gov (United States)

    Mancini, G; Viotti, P; Luciano, A; Fino, D

    2014-02-01

    In order to obtain 85% recycling, several procedures on Automotive Shredder Residue (ASR) could be implemented, such as advanced metal and polymer recovery, mechanical recycling, pyrolysis, the direct use of ASR in the cement industry, and/or the direct use of ASR as a secondary raw material. However, many of these recovery options appear to be limited, due to the possible low acceptability of ASR based products on the market. The recovery of bottom ash and slag after an ASR thermal treatment is an option that is not usually considered in most countries (e.g. Italy) due to the excessive amount of contaminants, especially metals. The purpose of this paper is to provide information on the characteristics of ASR and its full-scale incineration residues. Experiments have been carried out, in two different experimental campaigns, in a full-scale tyre incineration plant specifically modified to treat ASR waste. Detailed analysis of ASR samples and combustion residues were carried out and compared with literature data. On the basis of the analytical results, the slag and bottom ash from the combustion process have been classified as non-hazardous wastes, according to the EU waste acceptance criteria (WAC), and therefore after further tests could be used in future in the construction industry. It has also been concluded that ASR bottom ash (EWC - European Waste Catalogue - code 19 01 12) could be landfilled in SNRHW (stabilized non-reactive hazardous waste) cells or used as raw material for road construction, with or without further treatment for the removal of heavy metals. In the case of fly ash from boiler or Air Pollution Control (APC) residues, it has been found that the Cd, Pb and Zn concentrations exceeded regulatory leaching test limits therefore their removal, or a stabilization process, would be essential prior to landfilling the use of these residues as construction material. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Technical characterization and economic evaluation of recovery of flare gas in various gas-processing plants

    International Nuclear Information System (INIS)

    Zolfaghari, Mohabbat; Pirouzfar, Vahid; Sakhaeinia, Hossein

    2017-01-01

    Today in the worldwide quest for production and economic preference, only industries will survive that have proper solutions for waste disposal and environmental pollution. In industrial applications, a blow down network of gases is used in order to control system pressure and safety instruments. At the end of this network, the excess gases are burnt in the flare tower, which have severe consequences on the environment. Different methods have been proposed and several alternatives have been introduced for reduction and recovery of flaring gases. In this paper, three methods including gas to liquid (GTL), gas turbines generation (GTG) and gas to ethylene (GTE) are introduced and compared with the best method from economic point of view being identified. For this purpose, a natural gas sample is taken from Asalloyeh Refinery Plant and the process has been simulated using Aspen HYSYS. Meanwhile, estimation of the capital and operating costs and evaluation of the processes involved were made using Aspen Capital Cost Estimator. According to the results obtained, production of the electric power from flaring gases is one of the most economical methods. GTG method, with an annual profit of about 480e+006 $, has a greater ROR percent. - Highlights: • Three methods including GTL, GTG and GTE are developed for flare gas recovery. • The processes has been simulated using Aspen HYSYS. • Estimation of the capital and operating costs of the processes were made. • According to the results obtained, GTG is one of the most economical methods. • GTE method has the highest annual benefit, it has the lowest ROR percent.

  14. Enzymes in biogenesis of plant cell wall polysaccharides. Enzyme characterization using tracer techniques

    International Nuclear Information System (INIS)

    Dickinson, D.B.

    1975-01-01

    Enzymes and metabolic pathways, by which starch and cell wall polysaccharides are formed, were investigated in order to learn how these processes are regulated and to identify the enzymatic regulatory mechanisms involved. Germinating lily pollen was used for studies of cell wall formation, and pollen and maize endosperm for studies of starch biosynthesis. Hexokinase being the first step in conversion of hexoses to starch, wall polysaccharides and respiratory substrates, maize endosperm enzyme was assayed by its conversion of 14 C-hexose to 14 C-hexose-6-P, and rapid separation of the two labelled compounds on anion-exchange paper. This enzyme did not appear to be under tight regulation by feed-back inhibition or activation, nor to be severely inhibited by glucose-6-P or activated by citrate. ADP-glucose pyrophosphorylase and other pyrophosphorylases were assayed radiochemically with 14 C-glucose-1-P (forward direction) or 32-PPsub(i) (reverse direction). They showed that the maize endosperm enzyme was activated by the glycolytic intermediates fructose-6-P and 3-phosphoglycerate, and that low levels of the enzyme were present in the high sucrose-low starch mutant named shrunken-2. Under optimal in-vitro assay conditions, the pollen enzyme reacted four times faster than the observed in-vivo rate of starch accumulation. Biogenesis of plant cell wall polysaccharides requires the conversion of hexose phosphates to various sugar nucleotides and utilization of the latter by the appropriate polysaccharide synthetases. Lily pollen possesses a β-1,3-glucan synthetase which is activated up to six-fold by β-linked oligosaccharides. Hence, the in-vivo activity of this enzyme may be modulated by such effector molecules

  15. Characterization of Glomerella strains recovered from anthracnose lesions on common bean plants in Brazil.

    Science.gov (United States)

    Barcelos, Quélen L; Pinto, Joyce M A; Vaillancourt, Lisa J; Souza, Elaine A

    2014-01-01

    Anthracnose caused by Colletotrichum lindemuthianum is an important disease of common bean, resulting in major economic losses worldwide. Genetic diversity of the C. lindemuthianum population contributes to its ability to adapt rapidly to new sources of host resistance. The origin of this diversity is unknown, but sexual recombination, via the Glomerella teleomorph, is one possibility. This study tested the hypothesis that Glomerella strains that are frequently recovered from bean anthracnose lesions represent the teleomorph of C. lindemuthianum. A large collection of Glomerella isolates could be separated into two groups based on phylogenetic analysis, morphology, and pathogenicity to beans. Both groups were unrelated to C. lindemuthianum. One group clustered with the C. gloeosporioides species complex and produced mild symptoms on bean tissues. The other group, which belonged to a clade that included the cucurbit anthracnose pathogen C. magna, caused no symptoms. Individual ascospores recovered from Glomerella perithecia gave rise to either fertile (perithecial) or infertile (conidial) colonies. Some pairings of perithecial and conidial strains resulted in induced homothallism in the conidial partner, while others led to apparent heterothallic matings. Pairings involving two perithecial, or two conidial, colonies produced neither outcome. Conidia efficiently formed conidial anastomosis tubes (CATs), but ascospores never formed CATs. The Glomerella strains formed appressoria and hyphae on the plant surface, but did not penetrate or form infection structures within the tissues. Their behavior was similar whether the beans were susceptible or resistant to anthracnose. These same Glomerella strains produced thick intracellular hyphae, and eventually acervuli, if host cell death was induced. When Glomerella was co-inoculated with C. lindemuthianum, it readily invaded anthracnose lesions. Thus, the hypothesis was not supported: Glomerella strains from anthracnose

  16. Biosorption of Cd+2 by green plant biomass, Araucaria heterophylla: characterization, kinetic, isotherm and thermodynamic studies

    Science.gov (United States)

    Sarada, B.; Krishna Prasad, M.; Kishore Kumar, K.; Murthy, Ch V. R.

    2017-11-01

    The present study attempted to analyze the biosorption behavior of novel biosorbent, Araucaria heterophylla (green plant) biomass, to remove Cd+2 from solutions against various parameters, i.e., initial metal ion concentration, pH, temperature, sorbent dosage and biomass particle size. The maximum biosorption was found to be 90.02% at pH 5.5 and biosorption capacity ( q e) of Cd+2 is 9.2506 mg g-1. The Langmuir and Freundlich equilibrium adsorption isotherms were studied and it was observed that Freundlich model is the best fit than the Langmuir model with correlation co-efficient of 0.999. Kinetic studies indicated that the biosorption process of Cd+2 well followed the pseudo-second-order model with R 2 0.999. Thermodynamic studies observed that the process is exothermic (Δ H ° negative). Free energy change (Δ G °) with negative sign reflected the feasibility and spontaneous nature of the process. The chemical functional -OH groups, CH2 stretching vibrations, C=O carbonyl group of alcohol, C=O carbonyl group of amide, P=O stretching vibrations and -CH groups were involved in the biosorption process. The XRD pattern of the A. heterophylla was found to be mostly amorphous in nature. The SEM studies showed Cd+2 biosorption on selective grains of the biosorbent. It was concluded that A. heterophylla leaf powder can be used as an effective, low-cost, and environmentally friendly biosorbent for the removal of Cd+2 from aqueous solution.

  17. Building Project Competence

    DEFF Research Database (Denmark)

    Pemsel, Sofia; Wiewiora, Anna

    This research investigates the development of project competence, and particularly, three related dynamic capabilities (shifting, adapting, leveraging) that contribute to project competence development. In doing so, we make use of the emerging literature on knowledge governance and theorize how...... of dynamic capability building promoting project competence development....

  18. Athletic Coaching Competencies.

    Science.gov (United States)

    Nathanson, Stephen J.

    1979-01-01

    This article describes a study conducted to identify the competencies appropriate for an athletic coach and to incorporate those competencies into a competency based coaching education program for the four-year colleges and universities within the New York state systems. (JMF)

  19. Characterization of the serine acetyltransferase gene family of Vitis vinifera uncovers differences in regulation of OAS synthesis in woody plants

    Science.gov (United States)

    Tavares, Sílvia; Wirtz, Markus; Beier, Marcel P.; Bogs, Jochen; Hell, Rüdiger; Amâncio, Sara

    2015-01-01

    In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT gene family of the crop plant Vitis vinifera. The identified four members of the VvSERAT protein family are assigned to three distinct groups upon their sequence similarities to Arabidopsis SERATs. Expression of fluorescently labeled VvSERAT proteins uncover that the sub-cellular localization of VvSERAT1;1 and VvSERAT3;1 is the cytosol and that VvSERAT2;1 and VvSERAT2;2 localize in addition in plastids and mitochondria, respectively. The purified VvSERATs of group 1 and 2 have higher enzymatic activity than VvSERAT3;1, which display a characteristic C-terminal extension also present in AtSERAT3;1. VvSERAT1;1 and VvSERAT2;2 are evidenced to form the CSC. CSC formation activates VvSERAT2;2, by releasing CSC-associated VvSERAT2;2 from cysteine inhibition. Thus, subcellular distribution of SERAT isoforms and CSC formation in cytosol and mitochondria is conserved between Arabidopsis and grapevine. Surprisingly, VvSERAT2;1 lack the canonical C-terminal tail of plant SERATs, does not form the CSC and is almost insensitive to cysteine inhibition (IC50 = 1.9 mM cysteine). Upon sulfate depletion VvSERAT2;1 is strongly induced at the transcriptional level, while transcription of other VvSERATs is almost unaffected in sulfate deprived grapevine cell suspension cultures. Application of abiotic stresses to soil grown grapevine plants revealed isoform-specific induction of VvSERAT2;1 in leaves upon drought, whereas high light- or temperature- stress hardly trigger VvSERAT2;1 transcription. PMID:25741355

  20. Competence for Contract and Competence to Consent to Treatment

    OpenAIRE

    前田, 泰

    2008-01-01

    This paper analyzes assessing competence to consent to treatment. It focuses on problems of competence for contract and competence to consent to treatment. Finally, it discusses the degree of assessing competence to consent to treatment.

  1. Characterization of commercial humic acid samples and their impact on growth of fungi and plants

    Directory of Open Access Journals (Sweden)

    Asma Lodhi, Shermeen Tahir, Zafar Iqbal, Ansar Mahmood, Muhammad Akhtar, Tariq Mahmood Qureshi, Muhammad Yaqub and Asif Naeem

    2013-05-01

    Full Text Available Naturally occurring humates like leonardite and brown coal or lignite are marketed under different brand names e.g. Pak Humates, Humate Fertilizer, Pak Humax, Humkara and Humide etc. However, their efficacy is needed to be confirmed before their use. Different studies were conducted for the comparison of four commercial humates for their physico-chemical, optical properties, plant growth promoting ability in terms of seed germination and seedling vigour in wheat (cv Sehr, mung bean (Mung-54, maize (C-12 and sesbania and their effect on growth of some fungi. Moisture content of four humates varied from 0.52 to 71.11%, while solubility in water varied from 30.2 to 98.2% and density differed from 1.67 to 4.17. A 2% solution of humates had pH and EC varying from 5.39 to 10.11 and 3.140 to 1.143 mS cm-1, respectively. Carbon and nitrogen concentrations varied from 22.95 to 36.56% and 0.658 to 1.183, respectively with a C/N ratio of 30.91 to 44.16. Humates dissolved in 0.1N NaOH were partitioned into humic acid and fulvic acid fractions. Of the total C in humates, 40.3 to 77.5% was ranged in humic acid and 22.5 to 59.7% in fulvic acid fraction. The HA was also studied for optical properties at 400, 500, 600, and 700 nm besides that at 465 and 665 to calculate E4/E6 (extinction coefficient; the later varied between 3.64 and 5.48. Optical density of the humic acid decreased at increasing wavelength and was correlated significantly with the carbon contents of humic compounds. Three fungi, Trichoderma harzianum, T. hamatum and Alternaria alternata showed maximum growth at 0.025% HA in the growth medium on the basis of colony diameter. Humates inhibited seed germination in wheat, maize and mung bean except for sesbania. Root length and shoot dry matter increased in wheat and maize but no effect was found in mung bean and sesbania. The studies revealed that humates available in the market vary widely and therefore some sort of quality monitoring is required

  2. Isolation and characterization of an n-hexadecane degrading Acinetobacter baumannii KSS1060 from a petrochemical wastewater treatment plant

    International Nuclear Information System (INIS)

    Shiri, Z.; Kermanshahi, R. K.; Soudi, M. R.; Farajzadeh, D.

    2015-01-01

    Hydrocarbons are widespread in the environment, but because of the massive utilization of petroleum products, they are nowadays strongly involved in environmental pollution. Bioremediation is the obliging technology for the treatment of hydrocarbon-contaminated sites. Therefore, to investigate the potential of petrochemical hydrocarbon (HC)-degrading indigenous microorganisms in wastewater samples collected from Fajr petrochemical wastewater treatment plants, a strain of Acinetobacter baumannii was isolated from this hydrocarbon-contaminated wastewater and examined for its ability to utilize hexadecane. This strain was capable to grow on n-hexadecane as the sole source of carbon and energy. The ability of the isolate to degrade n-hexadecane was assessed by growth assays and gas chromatography/mass spectrometry analysis. Using GC analysis, it was shown that the strain KSS1060 was able to degrade 62 % of n-hexadecane within 6 days, which mostly (51.6 %) occurred within the first 24 h. Identification of this hexadecane-degrader bacterium was carried out using 16S rDNA sequence analysis. Additionally, characterization of chemical composition of wastewater samples by the use of gas chromatography/mass spectrometry analysis indicated the presence of Hexanal, Benzene methanol, Indanol, 1,2-benzenedicarboxylic acid diethyl ester, diisobutyl phthalate, and Phenol,4,4′-(1-methylethylidene) in the major constituents of wastewater. In conclusion, this study can focus on more cost-efficient applications of native bacterial strains for the large-scale biodegradation of wastewater samples from petrochemical plant in industry, where it causes disturbing problems due to its harmful effects on different organisms and human beings.

  3. Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

    Science.gov (United States)

    Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

    2012-03-01

    Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

  4. Identification and molecular characterization of MYB Transcription Factor Superfamily in C4 model plant foxtail millet (Setaria italica L.).

    Science.gov (United States)

    Muthamilarasan, Mehanathan; Khandelwal, Rohit; Yadav, Chandra Bhan; Bonthala, Venkata Suresh; Khan, Yusuf; Prasad, Manoj

    2014-01-01

    MYB proteins represent one of the largest transcription factor families in plants, playing important roles in diverse developmental and stress-responsive processes. Considering its significance, several genome-wide analyses have been conducted in almost all land plants except foxtail millet. Foxtail millet (Setaria italica L.) is a model crop for investigating systems biology of millets and bioenergy grasses. Further, the crop is also known for its potential abiotic stress-tolerance. In this context, a comprehensive genome-wide survey was conducted and 209 MYB protein-encoding genes were identified in foxtail millet. All 209 S. italica MYB (SiMYB) genes were physically mapped onto nine chromosomes of foxtail millet. Gene duplication study showed that segmental- and tandem-duplication have occurred in genome resulting in expansion of this gene family. The protein domain investigation classified SiMYB proteins into three classes according to number of MYB repeats present. The phylogenetic analysis categorized SiMYBs into ten groups (I-X). SiMYB-based comparative mapping revealed a maximum orthology between foxtail millet and sorghum, followed by maize, rice and Brachypodium. Heat map analysis showed tissue-specific expression pattern of predominant SiMYB genes. Expression profiling of candidate MYB genes against abiotic stresses and hormone treatments using qRT-PCR revealed specific and/or overlapping expression patterns of SiMYBs. Taken together, the present study provides a foundation for evolutionary and functional characterization of MYB TFs in foxtail millet to dissect their functions in response to environmental stimuli.

  5. Identification and molecular characterization of MYB Transcription Factor Superfamily in C4 model plant foxtail millet (Setaria italica L..

    Directory of Open Access Journals (Sweden)

    Mehanathan Muthamilarasan

    Full Text Available MYB proteins represent one of the largest transcription factor families in plants, playing important roles in diverse developmental and stress-responsive processes. Considering its significance, several genome-wide analyses have been conducted in almost all land plants except foxtail millet. Foxtail millet (Setaria italica L. is a model crop for investigating systems biology of millets and bioenergy grasses. Further, the crop is also known for its potential abiotic stress-tolerance. In this context, a comprehensive genome-wide survey was conducted and 209 MYB protein-encoding genes were identified in foxtail millet. All 209 S. italica MYB (SiMYB genes were physically mapped onto nine chromosomes of foxtail millet. Gene duplication study showed that segmental- and tandem-duplication have occurred in genome resulting in expansion of this gene family. The protein domain investigation classified SiMYB proteins into three classes according to number of MYB repeats present. The phylogenetic analysis categorized SiMYBs into ten groups (I-X. SiMYB-based comparative mapping revealed a maximum orthology between foxtail millet and sorghum, followed by maize, rice and Brachypodium. Heat map analysis showed tissue-specific expression pattern of predominant SiMYB genes. Expression profiling of candidate MYB genes against abiotic stresses and hormone treatments using qRT-PCR revealed specific and/or overlapping expression patterns of SiMYBs. Taken together, the present study provides a foundation for evolutionary and functional characterization of MYB TFs in foxtail millet to dissect their functions in response to environmental stimuli.

  6. Characterization of a protease produced by a Trichoderma harzianum isolate which controls cocoa plant witches' broom disease

    Directory of Open Access Journals (Sweden)

    Felix Carlos

    2002-01-01

    Full Text Available Abstract Background Several Trichoderma strains have been reported to be effective in controlling plant diseases, and the action of fungal hydrolytic enzymes has been considered as the main mechanism involved in the antagonistic process. However, although Trichoderma strains were found to impair development of Crinipellis perniciosa, the causal agent of cocoa plant witches' broom disease, no fungal strain is available for effective control of this disease. We have then undertaken a program of construction of hydrolytic enzyme-overproducing Trichoderma strains aiming improvement of the fungal antagonistic capacity. The protease of an indian Trichoderma isolate showing antagonistic activity against C. perniciosa was purified to homogeneity and characterized for its kinetic properties and action on the phytopathogen cell wall. Results A protease produced by the Trichoderma harzianum isolate 1051 was purified to homogeneity by precipitation with ammonium sulfate followed by hydrophobic chromatography. The molecular mass of this protease as determined by SDS-polyacrylamide gel electrophoresis was about 18.8 kDa. Its N-terminal amino acid sequence shares no homology with any other protease. The purified enzyme substantially affected the cell wall of the phytopathogen C. perniciosa. Western-blotting analysis showed that the enzyme was present in the culture supernatant 24 h after the Trichoderma started to grow in casein-containing liquid medium. Conclusions The capacity of the Trichoderma harzianum protease to hydrolyze the cell wall of C. perniciosa indicates that this enzyme may be actually involved in the antagonistic process between the two fungi. This fact strongly suggest that hydrolytic enzyme over-producing transgenic fungi may show superior biocontrol capacity.

  7. High-resolution gas chromatography/mas spectrometry method for characterization and quantitative analysis of ginkgolic acids in ginkgo biloba plants, extracts, and dietary supplements

    Science.gov (United States)

    A high resolution GC/MS with Selected Ion Monitor (SIM) method focusing on the characterization and quantitative analysis of ginkgolic acids (GAs) in Ginkgo biloba L. plant materials, extracts and commercial products was developed and validated. The method involved sample extraction with (1:1) meth...

  8. Use of an In Vitro, Nuclear Receptor Assay Panel to Characterize the Endocrine-Disrupting Activity Load of Wastewater Treatment Plant Effluent Extracts

    Science.gov (United States)

    Use of an In Vitro, Nuclear Receptor Assay Panel to Characterize the Endocrine-Disrupting Activity Load of Wastewater Treatment Plant Effluent Extracts Katie B. Paul 1.2, Ruth Marfil-Vega 1 Marc A. Mills3, Steve 0. Simmons2, Vickie S. Wilson4, Kevin M. Crofton2 10ak Rid...

  9. Characterization of plant communities adjacent to the B-C Cribs controlled area and REDOX pond areas on the 200 area plateau

    International Nuclear Information System (INIS)

    Cline, J.F.; Uresk, D.W.; Rickard, W.H.

    1975-01-01

    The plant communities at the Hanford B-C Cribs controlled area and REDOX study areas are characterized. It is concluded that they are probably very much like the communities that existed prior to 1943 when the Hanford Reservation was established. (CH)

  10. Characterization of a Highly Biodiverse Floodplain Meadow Using Hyperspectral Remote Sensing within a Plant Functional Trait Framework

    Directory of Open Access Journals (Sweden)

    Suvarna Punalekar

    2016-02-01

    Full Text Available We assessed the potential for using optical functional types as effective markers to monitor changes in vegetation in floodplain meadows associated with changes in their local environment. Floodplain meadows are challenging ecosystems for monitoring and conservation because of their highly biodiverse nature. Our aim was to understand and explain spectral differences among key members of floodplain meadows and also characterize differences with respect to functional traits. The study was conducted on a typical floodplain meadow in UK (MG4-type, mesotrophic grassland type 4, according to British National Vegetation Classification. We compared two approaches to characterize floodplain communities using field spectroscopy. The first approach was sub-community based, in which we collected spectral signatures for species groupings indicating two distinct eco-hydrological conditions (dry and wet soil indicator species. The other approach was “species-specific”, in which we focused on the spectral reflectance of three key species found on the meadow. One herb species is a typical member of the MG4 floodplain meadow community, while the other two species, sedge and rush, represent wetland vegetation. We also monitored vegetation biophysical and functional properties as well as soil nutrients and ground water levels. We found that the vegetation classes representing meadow sub-communities could not be spectrally distinguished from each other, whereas the individual herb species was found to have a distinctly different spectral signature from the sedge and rush species. The spectral differences between these three species could be explained by their observed differences in plant biophysical parameters, as corroborated through radiative transfer model simulations. These parameters, such as leaf area index, leaf dry matter content, leaf water content, and specific leaf area, along with other functional parameters, such as maximum carboxylation capacity

  11. Occurrence, molecular characterization and antibiogram of water quality indicator bacteria in river water serving a water treatment plant

    Energy Technology Data Exchange (ETDEWEB)

    Okeke, Benedict C., E-mail: bokeke@aum.edu [Department of Biology, Auburn University at Montgomery, P.O. Box 244023, Montgomery, AL 36124 (United States); Thomson, M. Sue [Department of Biology, Auburn University at Montgomery, P.O. Box 244023, Montgomery, AL 36124 (United States); Moss, Elica M. [Department of Natural Resources and Environmental Science, Alabama A and M University, AL 35762 (United States)

    2011-11-01

    Water pollution by microorganisms of fecal origin is a current world-wide public health concern. Total coliforms, fecal coliforms (Escherichia coli) and enterococci are indicators commonly used to assess the microbiological safety of water resources. In this study, influent water samples and treated water were collected seasonally from a water treatment plant and two major water wells in a Black Belt county of Alabama and evaluated for water quality indicator bacteria. Influent river water samples serving the treatment plant were positive for total coliforms, fecal coliforms (E. coli), and enterococci. The highest number of total coliform most probable number (MPN) was observed in the winter (847.5 MPN/100 mL) and the lowest number in the summer (385.6 MPN/100 mL). Similarly E. coli MPN was substantially higher in the winter (62.25 MPN/100 mL). Seasonal variation of E. coli MPN in influent river water samples was strongly correlated with color (R{sup 2} = 0.998) and turbidity (R{sup 2} = 0.992). Neither E. coli nor other coliform type bacteria were detected in effluent potable water from the treatment plant. The MPN of enterococci was the highest in the fall and the lowest in the winter. Approximately 99.7 and 51.5 enterococci MPN/100 mL were recorded in fall and winter seasons respectively. One-way ANOVA tests revealed significant differences in seasonal variation of total coliforms (P < 0.05), fecal coliforms (P < 0.01) and enterococci (P < 0.01). Treated effluent river water samples and well water samples revealed no enterococci contamination. Representative coliform bacteria selected by differential screening on Coliscan Easygel were identified by 16S ribosomal RNA gene sequence analysis. E. coli isolates were sensitive to gentamicin, trimethoprim/sulfamethazole, ciprofloxacin, vancomycin, tetracycline, ampicillin, cefixime, and nitrofurantoin. Nonetheless, isolate BO-54 displayed decreased sensitivity compared to other E. coli isolates. Antibiotic sensitivity

  12. Occurrence, molecular characterization and antibiogram of water quality indicator bacteria in river water serving a water treatment plant

    International Nuclear Information System (INIS)

    Okeke, Benedict C.; Thomson, M. Sue; Moss, Elica M.

    2011-01-01

    Water pollution by microorganisms of fecal origin is a current world-wide public health concern. Total coliforms, fecal coliforms (Escherichia coli) and enterococci are indicators commonly used to assess the microbiological safety of water resources. In this study, influent water samples and treated water were collected seasonally from a water treatment plant and two major water wells in a Black Belt county of Alabama and evaluated for water quality indicator bacteria. Influent river water samples serving the treatment plant were positive for total coliforms, fecal coliforms (E. coli), and enterococci. The highest number of total coliform most probable number (MPN) was observed in the winter (847.5 MPN/100 mL) and the lowest number in the summer (385.6 MPN/100 mL). Similarly E. coli MPN was substantially higher in the winter (62.25 MPN/100 mL). Seasonal variation of E. coli MPN in influent river water samples was strongly correlated with color (R 2 = 0.998) and turbidity (R 2 = 0.992). Neither E. coli nor other coliform type bacteria were detected in effluent potable water from the treatment plant. The MPN of enterococci was the highest in the fall and the lowest in the winter. Approximately 99.7 and 51.5 enterococci MPN/100 mL were recorded in fall and winter seasons respectively. One-way ANOVA tests revealed significant differences in seasonal variation of total coliforms (P < 0.05), fecal coliforms (P < 0.01) and enterococci (P < 0.01). Treated effluent river water samples and well water samples revealed no enterococci contamination. Representative coliform bacteria selected by differential screening on Coliscan Easygel were identified by 16S ribosomal RNA gene sequence analysis. E. coli isolates were sensitive to gentamicin, trimethoprim/sulfamethazole, ciprofloxacin, vancomycin, tetracycline, ampicillin, cefixime, and nitrofurantoin. Nonetheless, isolate BO-54 displayed decreased sensitivity compared to other E. coli isolates. Antibiotic sensitivity pattern

  13. Process competencies in a problem and project based learning environment

    DEFF Research Database (Denmark)

    Du, Xiangyun; Kolmos, Anette

    2006-01-01

    with the expected professional competencies. Based on the educational practice of PBL Aalborg Model, which is characterized by problem-orientation, project-organization and team work, this paper examines the process of developing process competencies through studying engineering in a PBL environment from...... process competencies through doing problem and project based work in teams? 2) How do students perceive their achievement of these process competencies?......Future engineers are not only required to master technological competencies concerning solving problems, producing and innovating technology, they are also expected to have capabilities of cooperation, communication, and project management in diverse social context, which are referred to as process...

  14. Purification and biochemical characterization of NpABCG5/NpPDR5, a plant pleiotropic drug resistance transporter expressed in Nicotiana tabacum BY-2 suspension cells.

    Science.gov (United States)

    Toussaint, Frédéric; Pierman, Baptiste; Bertin, Aurélie; Lévy, Daniel; Boutry, Marc

    2017-05-04

    Pleiotropic drug resistance (PDR) transporters belong to the ABCG subfamily of ATP-binding cassette (ABC) transporters and are involved in the transport of various molecules across plasma membranes. During evolution, PDR genes appeared independently in fungi and in plants from a duplication of a half-size ABC gene. The enzymatic properties of purified PDR transporters from yeast have been characterized. This is not the case for any plant PDR transporter, or, incidentally, for any purified plant ABC transporter. Yet, plant PDR transporters play important roles in plant physiology such as hormone signaling or resistance to pathogens or herbivores. Here, we describe the expression, purification, enzymatic characterization and 2D analysis by electron microscopy of NpABCG5/NpPDR5 from Nicotiana plumbaginifolia , which has been shown to be involved in the plant defense against herbivores. We constitutively expressed NpABCG5/NpPDR5, provided with a His-tag in a homologous system: suspension cells from Nicotiana tabacum (Bright Yellow 2 line). NpABCG5/NpPDR5 was targeted to the plasma membrane and was solubilized by dodecyl maltoside and purified by Ni-affinity chromatography. The ATP-hydrolyzing specific activity (27 nmol min -1  mg -1 ) was stimulated seven-fold in the presence of 0.1% asolectin. Electron microscopy analysis indicated that NpABCG5/NpPDR5 is monomeric and with dimensions shorter than those of known ABC transporters. Enzymatic data (optimal pH and sensitivity to inhibitors) confirmed that plant and fungal PDR transporters have different properties. These data also show that N. tabacum suspension cells are a convenient host for the purification and biochemical characterization of ABC transporters. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  15. Characterization of Essential Oils Obtained from Abruzzo Autochthonous Plants: Antioxidant and Antimicrobial Activities Assessment for Food Application

    Science.gov (United States)

    Pellegrini, Marika; Chaves-López, Clemencia; Mazzarrino, Giovanni; D’Amato, Serena; Lo Sterzo, Claudio

    2018-01-01

    In the present study, the essential oils (EOs) of some officinal plants from Abruzzo territory (Italy) were evaluated for their antimicrobial and antioxidant activities and their volatile fraction chemical characterization. The EOs were extracted from Rosmarinus officinalis, Origanum vulgare, Salvia officinalis, Mentha piperita, Allium sativum, Foeniculum vulgare, Satureja montana, Thymus vulgaris and Coriandrum sativum seeds. The antimicrobial activity was screened against thirteen Gram-positive and Gram-negative strains to determine the Minimal Inhibitory Concentration (MIC). The total phenolic content (TPC) and the antioxidant capacity (AOC) were assessed by means of Folin-Ciocâlteu method, and Trolox Equivalent Antioxidant Capacity with 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid (TEAC/ABTS), Ferric Reducing Antioxidant Power (FRAP) and 2,2-diphenyl-1-picrylhydrazyl (DPPH) assays respectively. Among the nine EOs tested, T. vulgaris, S. montana, O. vulgare and C. sativum EOs showed MIC values ranging from 0.625 to 5 μL/mL. The AOC and TPC results for these species were also interesting. The major components for these EOs were thymol for T. vulgaris (44%) and O. vulgare (40%), linalool (77%) for C. sativum, and carvacrol for S. montana (54%). The results allowed the study to establish that these EOs are good candidates for potential application as biopreservatives in foods and/or food manufacture environments. PMID:29393893

  16. Development and characterization of novel microsatellite markers in Trillium govanianum: a threatened plant species from North-Western Himalaya.

    Science.gov (United States)

    Sharma, Vikas; Wani, Mohammad Saleem; Singh, Vijay; Kaur, Kuljit; Gupta, Raghbir Chand

    2017-07-01

    Trillium govanianum is a temperate forest understory plant species of high value belonging to the family Melanthiaceae. It is endemic to Himalayan region and facing a bottleneck situation due to reckless extractions from its natural strands. In the present study, 21 microsatellite markers were developed and characterized in 20 accessions of T. govanianum. Collectively, the polymorphic markers amplified 31 alleles in a range of 2-4 with an average of 2.6 alleles per marker. The mean observed heterozygosity (H o ), expected heterozygosity (H e ), and Shannon information index (I) were 0.46, 0.48, and 0.73, respectively. Average polymorphism information content (PIC) was 0.385. The cross-transferability in a related species, namely, Polygonatum verticillatum, showed amplification of ten markers. The newly developed microsatellite markers efficiently distinguished the different accessions on the basis of their geographic origin. Thus, these microsatellites can be useful in exploring genetic diversity in various existing populations of T. govanianum in north-western Himalaya, which may be useful for their conservation, management, and improvement in future.

  17. Characterization of Essential Oils Obtained from Abruzzo Autochthonous Plants: Antioxidant and Antimicrobial Activities Assessment for Food Application

    Directory of Open Access Journals (Sweden)

    Marika Pellegrini

    2018-02-01

    Full Text Available In the present study, the essential oils (EOs of some officinal plants from Abruzzo territory (Italy were evaluated for their antimicrobial and antioxidant activities and their volatile fraction chemical characterization. The EOs were extracted from Rosmarinus officinalis, Origanum vulgare, Salvia officinalis, Mentha piperita, Allium sativum, Foeniculum vulgare, Satureja montana, Thymus vulgaris and Coriandrum sativum seeds. The antimicrobial activity was screened against thirteen Gram-positive and Gram-negative strains to determine the Minimal Inhibitory Concentration (MIC. The total phenolic content (TPC and the antioxidant capacity (AOC were assessed by means of Folin-Ciocâlteu method, and Trolox Equivalent Antioxidant Capacity with 2,2′-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid (TEAC/ABTS, Ferric Reducing Antioxidant Power (FRAP and 2,2-diphenyl-1-picrylhydrazyl (DPPH assays respectively. Among the nine EOs tested, T. vulgaris, S. montana, O. vulgare and C. sativum EOs showed MIC values ranging from 0.625 to 5 μL/mL. The AOC and TPC results for these species were also interesting. The major components for these EOs were thymol for T. vulgaris (44% and O. vulgare (40%, linalool (77% for C. sativum, and carvacrol for S. montana (54%. The results allowed the study to establish that these EOs are good candidates for potential application as biopreservatives in foods and/or food manufacture environments.

  18. Characterizing aquifer hydrogeology and anthropogenic chemical influences on groundwater near the Idaho Chemical Processing Plant, Idaho National Engineering Laboratory, Idaho

    International Nuclear Information System (INIS)

    Fromm, J.M.

    1995-01-01

    A conceptual model of the Eastern Snake River Plain aquifer in the vicinity of monitoring well USGS-44, downgradient of the Idaho Chemical Processing Plant (ICPP) on the Idaho National Engineering Laboratory (INEL), was developed by synthesis and comparison of previous work (40 years) and new investigations into local natural hydrogeological conditions and anthropogenic influences. Quantitative tests of the model, and other recommendations are suggested. The ICPP recovered fissionable uranium from spent nuclear fuel rods and disposed of waste fluids by release to the regional aquifer and lithosphere. Environmental impacts were assessed by a monitoring well network. The conceptual model identifies multiple, highly variable, interacting, and transient components, including INEL facilities multiple operations and liquid waste handling, systems; the anisotropic, in homogeneous aquifer; the network of monitoring and production wells, and the intermittent flow of the Big Lost River. Pre anthropogenic natural conditions and early records of anthropogenic activities were sparsely or unreliably documented making reconstruction of natural conditions or early hydrologic impacts impossible or very broad characterizations

  19. Phenotypic characterization, genetic mapping and candidate gene analysis of a source conferring reduced plant height in sunflower.

    Science.gov (United States)

    Ramos, María Laura; Altieri, Emiliano; Bulos, Mariano; Sala, Carlos A

    2013-01-01

    Reduced height germplasm has the potential to increase stem strength, standability, and also yields potential of the sunflower crop (Helianthus annuus L. var. macrocarpus Ckll.). In this study, we report on the inheritance, mapping, phenotypic and molecular characterization of a reduced plant height trait in inbred lines derived from the source DDR. This trait is controlled by a semidominant allele, Rht1, which maps on linkage group 12 of the sunflower public consensus map. Phenotypic effects of this allele include shorter height and internode length, insensibility to exogenous gibberellin application, normal skotomorphogenetic response, and reduced seed set under self-pollination conditions. This later effect presumably is related to the reduced pollen viability observed in all DDR-derived lines studied. Rht1 completely cosegregated with a haplotype of the HaDella1 gene sequence. This haplotype consists of a point mutation converting a leucine residue in a proline within the conserved DELLA domain. Taken together, the phenotypic, genetic, and molecular results reported here indicate that Rht1 in sunflower likely encodes an altered DELLA protein. If the DELPA motif of the HaDELLA1 sequence in the Rht1-encoded protein determines by itself the observed reduction in height is a matter that remains to be investigated.

  20. Phenotypic and genomic characterization of the antimicrobial producer Rheinheimera sp. EpRS3 isolated from the medicinal plant Echinacea purpurea: insights into its biotechnological relevance.

    Science.gov (United States)

    Presta, Luana; Bosi, Emanuele; Fondi, Marco; Maida, Isabel; Perrin, Elena; Miceli, Elisangela; Maggini, Valentina; Bogani, Patrizia; Firenzuoli, Fabio; Di Pilato, Vincenzo; Rossolini, Gian Maria; Mengoni, Alessio; Fani, Renato

    2017-04-01

    In recent years, there has been increasing interest in plant microbiota; however, despite medicinal plant relevance, very little is known about their highly complex endophytic communities. In this work, we report on the genomic and phenotypic characterization of the antimicrobial compound producer Rheinheimera sp. EpRS3, a bacterial strain isolated from the rhizospheric soil of the medicinal plant Echinacea purpurea. In particular, EpRS3 is able to inhibit growth of different bacterial pathogens (Bcc, Acinetobacter baumannii, and Klebsiella pneumoniae) which might be related to the presence of gene clusters involved in the biosynthesis of different types of secondary metabolites. The outcomes presented in this work highlight the fact that the strain possesses huge biotechnological potential; indeed, it also shows antimicrobial effects upon well-described multidrug-resistant (MDR) human pathogens, and it affects plant root elongation and morphology, mimicking indole acetic acid (IAA) action. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  1. Discussion of the question whether a local authority can claim to be affected in its planning competence by a permit issued for construction of a radwaste processing plant. High Administrative Court Lueneburg, judgement of 21.1.1993 - 7 K 5/90

    International Nuclear Information System (INIS)

    Czajka, D.

    1993-01-01

    A local authority has taken legal action against the first partial permit for the construction of a radwaste conditioning pilot plant at Gorleben, claiming to be affected in its planning competence by the fact that transport of spent fuel elements between the spent fuel storage facility and the pilot plant 2 km away would have to proceed on the rural district road. The action has been discussed. Appealable head notes: A local authority is not affected in its planning competence by a permit issued for construction of a facility for radwaste processing, although the operation of said facility may result in radwaste being transported by a road crossing the local authority's territory. (orig.) [de

  2. Caracterização morfológica de plantas de rambutan = Morphological characterization of rambutan plants

    Directory of Open Access Journals (Sweden)

    Renata Aparecida de Andrade

    2009-10-01

    Full Text Available Em certas espécies vegetais, a distinção entre variedades pode ser realizada com base em aspectos morfológicos das plantas, o que permite a identificação mesmo quando não apresentam flores e/ou frutos. Diante disso, realizou-se o presente trabalho cujo objetivo foi a caracterização morfológica e o agrupamento de plantas de rambutan. Foram avaliados: altura da planta (cm, diâmetro e geometria da copa (entre linhas e entre plantas,em cm, diâmetro do tronco (cm e disposição dos ramos no tronco, tamanho de folhas efolíolos (comprimento e largura, em cm, número de folíolos,comprimento da ráquis (cm,comprimento do pecíolo (cm, área foliar (cm2, vigor das plantas, sensibilidade ao frio,formato dos folíolos, pilosidade, coloração dos folíolos (faces superior e inferior, tipo de nervação e disposição dos folíolos na ráquis. Os dados foram submetidos à análise de agrupamento pelo método UPGMA, a partir da distância de Mahalanobis. Com base nos resultados obtidos, pode-se concluir que o uso de descritores morfológicos é eficiente nadeterminação de divergência genética entre os materiais de rambutan estudados, não sendo,porém, possível sua distinção visual, por não existir uma característica discriminatória satisfatória.In some vegetable species, the distinction between varieties can be made based on morphological aspects of the leaves, permitting the differentiation even when these ones do not display flowers and/or fruits. Consequently, the present research was conducted, aiming at the morphological characterization and grouping of rambutan plants. Were evaluated: plant height (cm, cup diameter and geometry (between lines and plants, in cm, trunk diameter (cm, leaves and leaflet size (length and width, in cm, leaflet number, stem length (cm,length of the petiolate (cm, left area (cm², plant vigor, cold sensibility, leaflet format,pilosity, coloration of the leaflet (inferior and superior sides, veining

  3. Genomic characterization of plant cell wall degrading enzymes and in silico analysis of xylanses and polygalacturonases of Fusarium virguliforme

    Science.gov (United States)

    Plant cell wall degrading enzymes (PCWDEs) are important effectors for plant pathogens to invade plants. In this study, the composition of PCWDEs in Fusarium virguliforme that were grown for 5-days and 20 days in liquid medium was determined by RNA-Seq. Differential expression analysis showed more P...

  4. Biochemical characterization of the tomato phosphatidylinositol-specific phospholipase C (PI-PLC) family and its role in plant immunity

    NARCIS (Netherlands)

    Abd-El-Haliem, Ahmed; Vossen, J.H.; Zeijl, van Arjan; Dezhsetan, Sara; Testerink, Christa; Seidl, M.F.; Beck, Martina; Strutt, James; Robatzek, Silke; Joosten, M.H.A.J.

    2016-01-01

    Plants possess effective mechanisms to quickly respond to biotic and abiotic stresses. The rapid activation of phosphatidylinositol-specific phospholipase C (PLC) enzymes occurs early after the stimulation of plant immune-receptors. Genomes of different plant species encode multiple PLC homologs

  5. Isolation and functional characterization of JcFT, a FLOWERING LOCUS T (FT) homologous gene from the biofuel plant Jatropha curcas.

    Science.gov (United States)

    Li, Chaoqiong; Luo, Li; Fu, Qiantang; Niu, Longjian; Xu, Zeng-Fu

    2014-05-08

    Physic nut (Jatropha curcas L.) is a potential feedstock for biofuel production because Jatropha oil is highly suitable for the production of the biodiesel and bio-jet fuels. However, Jatropha exhibits low seed yield as a result of unreliable and poor flowering. FLOWERING LOCUS T (FT) -like genes are important flowering regulators in higher plants. To date, the flowering genes in Jatropha have not yet been identified or characterized. To better understand the genetic control of flowering in Jatropha, an FT homolog was isolated from Jatropha and designated as JcFT. Sequence analysis and phylogenetic relationship of JcFT revealed a high sequence similarity with the FT genes of Litchi chinensis, Populus nigra and other perennial plants. JcFT was expressed in all tissues of adult plants except young leaves, with the highest expression level in female flowers. Overexpression of JcFT in Arabidopsis and Jatropha using the constitutive promoter cauliflower mosaic virus 35S or the phloem-specific promoter Arabidopsis SUCROSE TRANSPORTER 2 promoter resulted in an extremely early flowering phenotype. Furthermore, several flowering genes downstream of JcFT were up-regulated in the JcFT-overexpression transgenic plant lines. JcFT may encode a florigen that acts as a key regulator in flowering pathway. This study is the first to functionally characterize a flowering gene, namely, JcFT, in the biofuel plant Jatropha.

  6. Preparation and characterization of carbons for the retention of halogens in the condenser vacuum system of a thermonuclear plant

    International Nuclear Information System (INIS)

    Roman, S.; Gonzalez, J.F.; Ganan, J.; Sabio, E.; Gonzalez-Garcia, C.M.; Ramiro, A.; Mangut, V.

    2006-01-01

    Activated carbons were prepared by air and carbon dioxide activation, from almond tree pruning, with the aim of obtaining carbons that reproduce the textural and mechanical properties of the carbons currently used in the filtering system of the condenser vacuum installation of a Thermonuclear Plant (CNA; Central Nuclear de Almaraz in Caceres, Spain), produced from coconut shell. The variables studied in non-catalytic gasification series with air were the temperature (215-270 deg. C) and the time (1-16 h) and the influence of the addition of one catalyst (Co) and the time (1-2 h) in catalytic gasification. In the case of activation with CO 2 , the influence of the temperature (700-950 deg. C) and the time (1-8 h) was studied. The resulting carbons were characterized in terms of their BET surface, porosity, and pore size distribution. The N 2 adsorption isotherms at 77 K for both series showed a type I behaviour, typical of microporous materials. The isotherms showed that with both gasificant agents the temperature rise produced an increase in the carbon porosity. With regards to the activation time, a positive effect on the N 2 adsorbed volume on the carbons was observed. The best carbons of each series, as well as the CNA (carbon currently used in the CNA), were characterized by mercury porosimetry and iodine solution adsorption isotherms. The results obtained allowed to state that several of the carbons produced had characteristics similar to the carbon that is target of reproduction (which has S BET of 741 m 2 g -1 , V mi of 0.39 cm 3 g -1 and a iodine retention capacity of 429.3 mg g -1 ): carbon C (gasification with CO 2 at 850 deg. Cduring 1 h), with S BET of 523 m 2 g -1 , V mi of 0.33 cm 3 g -1 and a iodine retention capacity of 402.5 mg g -1 , and carbon D (gasification with CO 2 at 900 deg. Cduring 1 h), whose S BET is 672 m 2 g -1 , V mi is 0.28 cm 3 g -1 and has a iodine retention capacity of 345.2 mg g -1

  7. Teaching Competences and Inclusive Education

    Directory of Open Access Journals (Sweden)

    José María Fernández Batanero

    2013-08-01

    Full Text Available This paper focuses on teaching competencies that are conducive to good educational practices in relation to inclusion, from the perspective of teachers. The methodology employed in the study is descriptive/comprehensive, and of an exploratory nature. By means of four case studies, the perceptions of teachers from two secondary schools—characterized by the Spanish Educational Administration as having “good practices”— are examined. The techniques used for information collection in this study include documentary analysis, in-depth interviews and focus groups. The findings emphasize the importance of strategic skills, combined with innovation and creativity, among others.

  8. Cultural Competence Revisited

    Science.gov (United States)

    Garran, Ann Marie; Werkmeister Rozas, Lisa

    2013-01-01

    In 2001, the National Association of Social Workers (NASW) adopted 10 discrete standards of culturally competent practice which undergird our commitment to diversity and social justice. The concept of intersectionality is newly emerging in social work, though, causing us to reflect on our current conceptualizations of cultural competence.…

  9. Financing Competency Based Programs.

    Science.gov (United States)

    Daniel, Annette

    Literature on the background, causes, and current prevalence of competency based programs is synthesized in this report. According to one analysis of the actual and probable costs of minimum competency testing, estimated costs for test development, test administration, bureaucratic structures, and remedial programs for students who cannot pass the…

  10. Competencies and Their Assessment

    Science.gov (United States)

    Drisko, James W.

    2014-01-01

    This article explores competencies and methods for their assessment in higher education and in social work's accreditation standards. Many contemporary policy and educational accreditation efforts employ the model of competency assessment. The current emphasis on accountability in higher education, including the Council on Social Work…

  11. Developing Clinical Competence

    NARCIS (Netherlands)

    P.F. Wimmers (Paul)

    2006-01-01

    textabstractThe development of clinical competence is the main purpose of medical education. The long road to become clinically competent starts on the first day of medical school, and every institution strives to select the best students. The responsibility of medical schools is to train

  12. Characterization of pyrolysis products derived from three biological wastes and their effect on plant growth and soil water retention

    Science.gov (United States)

    Bouqbis, Laila; Werner Koyro, Hans; Kammann, Claudia; Zohra Ainlhout, Lalla Fatima; Boukhalef, Laila; Cherif Harrouni, Moulay

    2018-05-01

    Over two-thirds of Morocco can be classified as semiarid, arid and desert with low and variable rainfalls. While the country is subject to frequent drought, groundwater resources are predominantly consume by irrigated agriculture leading to the depletion of water resources and degradation of soil quality. Application of bio-resources wastes to soils after pyrolysis process is well documented to help retain water and nutrients in soils. In this study, three bio-resources wastes derived from argan shells, wood chip, a blend of paper sludge and wheat husks are characterized for physical and chemical properties. To determine the potential impact of salt stress and toxic substances the second part of this study focused on the effect these bio-resources wastes have on germination of salad and barley respectively. The three bio-resources obtained from different biomass showed some unique properties compared to the soil, such as high electrical conductivity (EC), high content of K, Na and Mg, low content of heavy metals. Moreover, the water holding capacities increased with increasing application of bio-resources wastes. Concerning the phytotoxic tests, no negative effect was observed neither for salad (Lactuca sativa L.) nor for barley (Hordeum vulgare) indicating that the three bio-resources could be safely used for agriculture. Collectively, the use of these bio-resources wastes as a soil amendment is anticipated to increase both water and nutrient and could provide the potential for a better plant growth mainly in semiarid, arid and desert climatic conditions like the case of Morocco in which the agricultural practices reserve a majority of the water resources to be used for irrigation.

  13. Characterization of pyrolysis products derived from three biological wastes and their effect on plant growth and soil water retention

    Directory of Open Access Journals (Sweden)

    Bouqbis Laila

    2018-01-01

    Full Text Available Over two-thirds of Morocco can be classified as semiarid, arid and desert with low and variable rainfalls. While the country is subject to frequent drought, groundwater resources are predominantly consume by irrigated agriculture leading to the depletion of water resources and degradation of soil quality. Application of bio-resources wastes to soils after pyrolysis process is well documented to help retain water and nutrients in soils. In this study, three bio-resources wastes derived from argan shells, wood chip, a blend of paper sludge and wheat husks are characterized for physical and chemical properties. To determine the potential impact of salt stress and toxic substances the second part of this study focused on the effect these bio-resources wastes have on germination of salad and barley respectively. The three bio-resources obtained from different biomass showed some unique properties compared to the soil, such as high electrical conductivity (EC, high content of K, Na and Mg, low content of heavy metals. Moreover, the water holding capacities increased with increasing application of bio-resources wastes. Concerning the phytotoxic tests, no negative effect was observed neither for salad (Lactuca sativa L. nor for barley (Hordeum vulgare indicating that the three bio-resources could be safely used for agriculture. Collectively, the use of these bio-resources wastes as a soil amendment is anticipated to increase both water and nutrient and could provide the potential for a better plant growth mainly in semiarid, arid and desert climatic conditions like the case of Morocco in which the agricultural practices reserve a majority of the water resources to be used for irrigation.

  14. Dosimetry characterization of the Tunisian Cobalt-60 gamma irradiation pilot plant for the irradiation of the mediterranean fruit fly

    International Nuclear Information System (INIS)

    Bettaieb, Nasreddine; Farah, Kaled; Kadri, Omrane; Jerbi, Taieb; Gharbi, Foued; Manai, Kais

    2005-01-01

    Cobalt-60 gamma irradiation pilot plant has been put into operation in 1999 at the National Center for nuclear scinces and technologies, Sidi-Thabet, Tunisia. An initial characterization of this pilot was performed to determine the overall performance of the irradiator in delivering absorbed dose to a product prior to routine processing, in particular sterilisation of medical devices and food irradiation. A new irradiation holder was recently installed; it was designed especially for the irradiation of pupae of the Meditterranean fruit fly. It consists of four turn plates which makes it possible to rotate the canisters holding the pupae within the radiation field. The axis of ratation is vertical and parallel to the source pencils. Prior to routine irradiation using the new irradiation holder, validation procedures are necessary to establish conditions of the irradiation within the specification. In the course of these procedures, detailed dose mapping on a vertical plane in the middel of the canister of insect pupae with bulk density of 0.446 g /cm3 was carried out for two irradiation configurations : fixed plates and turned plates. GafChromic dosimeter calibrated against Alanine / ESR dosimetry system was used for the dose measurements. The maximum and minimum dose locations were determined and the dose uniformity ratio calculated and discussed. Detailed analyses of the isodose curves and histogram of the frequency distribution of absorbed dose were also given. Transit dose and dose rate in the reference position inside the canister were measured using Fricke dosimeters. The results of measurements of absorbed dose and dose distribution in insect pupae do not show any significant difference in the dose uniformity ratio (U=Dmax / Dmin) between the two irradiation configurations. At the same time we observed with turned plates configuration an improvement of the homogeneity of the absorbed dose distribution in the insect pupae showed by the increasing of the pipae

  15. Screening and identification of phytotoxic volatile compounds in medicinal plants and characterizations of a selected compound, eucarvone.

    Science.gov (United States)

    Sunohara, Yukari; Baba, Yohei; Matsuyama, Shigeru; Fujimura, Kaori; Matsumoto, Hiroshi

    2015-07-01

    Screening and identification of phytotoxic volatile compounds were performed using 71 medicinal plant species to find new natural compounds, and the characterization of the promising compound was investigated to understand the mode of action. The volatile compounds from Asarum sieboldii Miq. showed the strongest inhibitory effect on the hypocotyl growth of lettuce seedlings (Lactuca sativa L.cv. Great Lakes 366), followed by those from Schizonepeta tenuifolia Briquet and Zanthoxylum piperitum (L.) DC.. Gas chromatography-mass spectrometry (GC/MS) identified four volatile compounds, α-pinene (2,6,6-trimethylbicyclo[3.1.1]hept-2-ene), β-pinene (6,6-dimethyl-2-methylenebicyclo[3.1.1]heptane), 3-carene (3,7,7-trimethylbicyclo[4.1.0]hept-3-ene), and eucarvone (2,6,6-trimethy-2,4-cycloheptadien-1-one), from A. sieboldii, and three volatile compounds, limonene (1-methyl-4-(1-methylethenyl)-cyclohexene), menthone (5-methyl-2-(propan-2-yl)cyclohexan-1-one), and pulegone (5-methyl-2-propan-2-ylidenecyclohexan-1-one), from S. tenuifolia. Among these volatile compounds, eucarvone, menthone, and pulegone exhibited strong inhibitory effects on both the root and shoot growth of lettuce seedlings. Eucarvone-induced growth inhibition was species-selective. Cell death, the generation of reactive oxygen species (ROS), and lipid peroxidation were induced in susceptible finger millet seedlings by eucarvone treatment, whereas this compound (≤158 μM) did not cause the increase of lipid peroxidation and ROS production in tolerant maize. The results of the present study show that eucarvone can have strong phytotoxic activity, which may be due to ROS overproduction and subsequent oxidative damage in finger millet seedlings.

  16. Characterization of corn landraces planted grown in the campos gerais region (Paraná, Brazil for industrial utilization

    Directory of Open Access Journals (Sweden)

    Alessandra Teixeira Barbosa Pinto

    2009-11-01

    Full Text Available This work has the objective of characterizing twenty corn landraces grown in the Campos Gerais region (Paraná State in relation to its chemical composition (moisture, ash, protein, ether extract, dietary fiber and starch and physical properties (weight of 1000 grains, real density, flotation index, granulometry and color. In addition, also the lab scale processing of the kernels from the varieties was carried out for producing starch; starch purity was evaluated by measuring its protein contamination. Amylose contents and viscoamylograph profile were also evaluated. The results showed that the evaluated landraces have differences in chemical composition as well as in pericarp/endosperm/germ proportions and consequently it should have different industrial applications and interest for plant breeding.Esse trabalho teve o objetivo de caracterizar vinte variedades de milho crioulo cultivadas na região dos Campos Gerais (Estado do Paraná em relação a sua composição química (umidade, cinzas, proteína, extrato etéreo, fibra alimentar e amido e propriedades físicas (peso de 1000 grãos, densidade real, índice de flotação, granulometria e cor Além disso, foi feito o processamento dos grãos em escala de laboratório para a extração do amido, sendo mensurado o teor de proteína. Foram avaliados os conteúdos de amilose e o perfil viscoamilográfico. Os resultados mostraram que os milhos apresentaram diferentes composições químicas e proporções pericarpo/endosperma/ gérmen e consequentemente podem ter diferentes aplicações industriais e interesse ao melhoramento de plantas.

  17. Characterization of the inside and outside oxide surfaces of irradiated pressure tubes of Embalse nuclear power plant

    International Nuclear Information System (INIS)

    Bordoni, Roberto A.; Olmedo, Ana M.

    2004-01-01

    The inside and outside surfaces of two pressure tubes (PT) removed from Embalse nuclear power plant (CNE) after 10 of effective full power years (EFPY) were characterized. The oxide thickness of both faces, in different zones, was also measured. The inside surfaces of both PTs, B-102 (A-14) and B-298 (L-12), were covered with a black oxide that replicates the original PT surface. A network of microcracks perpendicular to the inside surface in contact with the coolant was found. In some cases, near the outlet of the PT, some spalling of the oxide was also found. These small microcracks and spalling do not affect the protective character of the oxide since a thickness about 5 or 6 μm of an undamaged oxide is found at the metal/oxide interface side. The oxide thickness changes between approximately 6 to 12 μm for B-102 tube and around 7 to 15 μm for B-298 tube. The average corrosion rate is 1.16 μm/10 4 HH for B-102 tube and 1.35 μm/10 4 HH for B-298 tube at 5.8 m position for both PTs. These corrosion rates show good corrosion behaviour of CNE PTs. The average corrosion rate of the inside surface of the PTs depends on the coolant temperature but not on fast neutron flux. The outside oxide film is black, shiny, compact and protective, replicating also the original surface. The oxide thickness changes between 2 to 6.5 μm in B-102 tube and between 1.8 to 3.7 μm B-298 tube. These oxide thicknesses are within the values reported for PTs in CANDU Stations. (author) [es

  18. Characterizing the correlation between dephosphorization and solution pH in a calcined water treatment plant sludge.

    Science.gov (United States)

    Zhou, Zhenming; Liu, Qidi; Li, Shuwen; Li, Fei; Zou, Jing; Liao, Xiaobin; Yuan, Baoling; Sun, Wenjie

    2018-04-26

    This study focused on characterizing the correlation between the dephosphorization process of calcined water treatment plant sludge (C-WTPS) and the solution initial pH in batch experiments. The specific aim was to illustrate the effect of different initial pH on the adsorption and desorption of phosphorous in C-WTPS. In addition, the effects of solution initial pH on the release of ammonia nitrogen and total organic carbon (TOC) from C-WTPS and the change of pH after adsorption were also investigated. The results demonstrated that the initial pH significantly influenced the adsorption of phosphorus on C-WTPS. When initial pH was increased from 3 to 10, the phosphorous absorption capacity reduced by 76.5%. Especially, when the initial pH reached to 11, the phosphorus adsorption capacity became a negative value, indicating that C-WTPS released phosphorus into the solution. The addition of C-WTPS to the solution had little impact on the initial pH of the solution. The absorbed phosphorous on C-WTPS was relatively stable in the pH range of 3 to 10. Nevertheless, when the solution pH was higher than 11, it can be easily released into the solution. Furthermore, by comparison with WTPS, C-WTPS released less ammonia nitrogen and TOC into the solution and adsorbed more phosphorus from the solution in the experimental pH range. Therefore, C-WTPS is more suitable to serve as a cost-effective sorbent for phosphorus removal.

  19. To effectively adapt and renew workforce competences

    International Nuclear Information System (INIS)

    Pezzani, P.

    2007-01-01

    Full text: Most of French operating nuclear plants were constructed within a small time window. Few new plants have come on line within the last decade. As a result, most operating plants today have an ageing workforce that is going to retire in large numbers. In the next ten years, 40% of EDF nuclear workforce is going to retire, in average 600 people per year. At the same time, potential restructurings are opportunities to provide internal personnel for Nuclear Power Plants. The first generation of nuclear industry workers was hired during nuclear plant starting and testing. That was an opportunity to for training in the field without nuclear hazard. In addition, the NPP requirements increased dramatically through the last twenty years. This situation led to start a project to effectively adapt and renew workforce competences in the 19 EDF NPP in France. This Paper describes three steps to successfully ensure this transition to the new generation of nuclear industry workers. Acting in the field from their initial training, recruits are earlier ready to perform: 1. A Nuclear Job Academy in each French region based on Team Building and Sister Plants association, new training techniques and field training regarding behaviour and craft. All the new comers in Nuclear Power Station are led by an experienced technical mentor and trained by managers and experienced staff. 2. Flow loop maintenance simulator in each plant.On line training and test for periodic training.Step by Step qualification process. Internal workforce moving and rotation become a consistent, safe and successful opportunity to renew competences: EDF Group promotes the mobility of human resources by improving skills management (training programs, encouraging profession mobility, and reorientation towards priority jobs). To ensure that each nuclear new comer from internal workforce meets the nuclear requirements (as hired people), we build strong process witch guaranty internal people recruitment with

  20. Biochemical characterization of the triticale TsPAP1, a new type of plant prolyl aminopeptidase, and its impact on proline content and flowering time in transgenic Arabidopsis plants.

    Science.gov (United States)

    Zdunek-Zastocka, Edyta; Grabowska, Agnieszka; Branicki, Tomasz; Michniewska, Beata

    2017-07-01

    Proline aminopeptidase (PAP, EC 3.4.11.5) is the only enzyme that effectively releases proline from the N-termini of peptides. The amino acid sequence of the PAP from Triticosecale, TsPAP1, comprises conserved regions, characteristic of the monomeric forms of PAP found in bacteria but not yet identified in plants. Therefore, we aimed to obtain and biochemically characterize the TsPAP1 protein. The recombinant TsPAP1 protein was received through heterologous expression of the TsPAP1 coding sequence in a bacterial expression system and purified with affinity chromatography. Gel filtration chromatography and SDS electrophoresis revealed that TsPAP1 is a monomer with a molecular mass of 37.5 kDa. TsPAP1 prefers substrates with proline at the N-terminus but is also capable of hydrolyzing β-naphthylamides of hydroxyproline and alanine. Among the peptides tested, the most preferred were di- and tripeptides, especially those with glycine in the Y position. The use of diagnostic inhibitors indicated that TsPAP1 is a serine peptidase; however, further characterization revealed that the SH residues are also important for maintaining its activity. To examine the role of TsPAP1 under physiological conditions, we developed transgenic Arabidopsis plants overexpressing TsPAP1. Compared with wild-type plants, the transgenic lines accumulated more proline, flowered an average of 3.5 days earlier, and developed more siliques than did untransformed controls. Our paper is the first to describe the biochemical properties of a novel monomeric plant PAP and contributes to the functional characterization of PAP proteins in plants. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  1. Strong Regionality and Dominance of Anaerobic Bacterial Taxa Characterize Diazotrophic Bacterial Communities of the Arcto-Alpine Plant Species Oxyria digyna and Saxifraga oppositifolia.

    Science.gov (United States)

    Kumar, Manoj; van Elsas, Jan Dirk; Nissinen, Riitta

    2017-01-01

    Arctic and alpine biomes are most often strongly nitrogen-limited, and hence biological nitrogen fixation is a strong driver of these ecosystems. Both biomes are characterized by low temperatures and short growing seasons, but they differ in seasonality of solar radiation and in soil water balance due to underlying permafrost in the Arctic. Arcto-alpine plant species are well-adapted to the low temperatures that prevail in their habitats, and plant growth is mainly limited by the availability of nutrients, in particular nitrogen, due to slow mineralization. Nitrogen fixing bacteria are likely important for plant growth in these habitats, but very little is known of these bacteria or forces shaping their communities. In this study, we characterized the potential nitrogen fixing bacterial (PNFB) communities associated with two arcto-alpine pioneer plant species, Oxyria digyna (mountain sorrel) and Saxifraga oppositifolia (blue saxifrage), in three climate regions. Both of these plants readily colonize low nutrient mineral soils. Our goal was to investigate how climate (region) and, on the other hand, host plant and plant species shape these communities. To our knowledge, this is the first comprehensive study describing PNFB communities associated with pioneer plants in different arcto-alpine biomes. Replicate samples were taken from two arctic regions, Kilpisjärvi and Ny-Ålesund, and one alpine region, Mayrhofen. In these, the PNFB communities in the bulk and rhizosphere soils and the plant endospheres were characterized by nifH -targeted PCR and massive parallel sequencing. The data revealed strong effects of climatic region on the dominating nitrogen fixers. Specifically, nifH sequences related to Geobacter (δ- Proteobacteria ) were present in high relative abundances in the nitrogen-fixing communities in the Mayrhofen and Kilpisjärvi regions, while members of the Clostridiales prevailed in the Kilpisjärvi and Ny-Ålesund regions. The bulk and rhizosphere soil

  2. Strong Regionality and Dominance of Anaerobic Bacterial Taxa Characterize Diazotrophic Bacterial Communities of the Arcto-Alpine Plant Species Oxyria digyna and Saxifraga oppositifolia

    Directory of Open Access Journals (Sweden)

    Manoj Kumar

    2017-10-01

    Full Text Available Arctic and alpine biomes are most often strongly nitrogen-limited, and hence biological nitrogen fixation is a strong driver of these ecosystems. Both biomes are characterized by low temperatures and short growing seasons, but they differ in seasonality of solar radiation and in soil water balance due to underlying permafrost in the Arctic. Arcto-alpine plant species are well-adapted to the low temperatures that prevail in their habitats, and plant growth is mainly limited by the availability of nutrients, in particular nitrogen, due to slow mineralization. Nitrogen fixing bacteria are likely important for plant growth in these habitats, but very little is known of these bacteria or forces shaping their communities. In this study, we characterized the potential nitrogen fixing bacterial (PNFB communities associated with two arcto-alpine pioneer plant species, Oxyria digyna (mountain sorrel and Saxifraga oppositifolia (blue saxifrage, in three climate regions. Both of these plants readily colonize low nutrient mineral soils. Our goal was to investigate how climate (region and, on the other hand, host plant and plant species shape these communities. To our knowledge, this is the first comprehensive study describing PNFB communities associated with pioneer plants in different arcto-alpine biomes. Replicate samples were taken from two arctic regions, Kilpisjärvi and Ny-Ålesund, and one alpine region, Mayrhofen. In these, the PNFB communities in the bulk and rhizosphere soils and the plant endospheres were characterized by nifH-targeted PCR and massive parallel sequencing. The data revealed strong effects of climatic region on the dominating nitrogen fixers. Specifically, nifH sequences related to Geobacter (δ-Proteobacteria were present in high relative abundances in the nitrogen-fixing communities in the Mayrhofen and Kilpisjärvi regions, while members of the Clostridiales prevailed in the Kilpisjärvi and Ny-Ålesund regions. The bulk and

  3. Ten-Competence: Life-Long Competence Development and Learning

    NARCIS (Netherlands)

    Koper, Rob; Specht, Marcus

    2006-01-01

    Koper, R., & Specht, M. (2008). Ten-Competence: Life-Long Competence Development and Learning. In M-A. Cicilia (Ed.), Competencies in Organizational e-learning: concepts and tools (pp. 234-252). Hershey: IGI-Global.

  4. AREVA Germany. International competence in nuclear technology

    International Nuclear Information System (INIS)

    Graeber, Ulrich

    2011-01-01

    AREVA NP was created in 2001 by the merger of the French nuclear technology specialist Framatome with the nuclear sector of Siemens. The company is headquartered in Paris and has regional subsidiaries in Germany and the United States. The joint venture's strength lies in its all-round competence in nuclear power plants, from reactor development to power plant services and modernization of operating plants, design and production of fuel assemblies and turn-key construction of nuclear power reactors. Major core competences are located in Germany including the test facilities which are unique in the entire group as well as electrical engineering and instrumentation and control systems. AREVA NP is part of the globally acting AREVA group which pursues a unique integrated business model. The concept covers the entire nuclear fuel cycle from uranium mining to reprocessing used fuel assemblies. At present, AREVA has 48,000 employees worldwide, of which 5,700 are Germany-based. (orig.)

  5. Characterization of plant growth-promoting traits of free-living diazotrophic bacteria and their inoculation effects on growth and nitrogen uptake of crop plants.

    Science.gov (United States)

    Islam, Md Rashedul; Madhaiyan, M; Deka Boruah, Hari P; Yim, Woojong; Lee, Gillseung; Saravanan, V S; Fu, Qingling; Hu, Hongqing; Sa, Tongmin

    2009-10-01

    The search for diverse plant growth-promoting (PGP) diazotrophic bacteria is gaining momentum as efforts are made to exploit them as biofertilizers for various economically important crops. In the present study, 17 diazotrophic strains belonging to eight different genera isolated from rice paddy fields were screened for multiple PGP traits and evaluated for their inoculation effects on canola and rice plants. All of the strains tested positive for 1- aminocyclopropane-1-carboxylate (ACC) deaminase activity and production of indole 3-acetic acid (IAA) and ammonia (NH3). Additionally, four of the strains were able to solubilize phosphorus (P), five tested positive for zinc (Zn) solubilization and sulfur (S) oxidation, and eight strains produced siderophores. Based on the presence of multiple PGP traits, 10 strains were selected for inoculation studies. Treatment with Herbaspirillum sp. RFNB26 resulted in maximum root length (54.3%), seedling vigor, and dry biomass in canola, whereas Paenibacillus sp. RFNB4 exhibited the lowest activity under gnotobiotic conditions. However, under pot culture conditions, Paenibacillus sp. RFNB4 significantly increased plant height and dry biomass production by 42.3% and 29.5%, respectively. Canola plants and rhizosphere soils inoculated with Bacillus sp. RFNB6 exhibited significantly higher nitrogenase activity. In greenhouse experiments, Serratia sp. RFNB18 increased rice plant height by 35.1%, Xanthomonas sp. RFNB24 enhanced biomass production by 84.6%, and rice rhizosphere soils inoculated with Herbaspirillum sp. RFNB26 exhibited the highest nitrogenase activity. Our findings indicate that most of the selected strains possess multiple PGP properties that significantly improve the growth parameters of the two plants when tested under controlled conditions.

  6. Genetic and Physiological Characterization of Two Clusters of Quantitative Trait Loci Associated With Seed Dormancy and Plant Height in Rice

    OpenAIRE

    Ye, Heng; Beighley, Donn H.; Feng, Jiuhuan; Gu, Xing-You

    2013-01-01

    Seed dormancy and plant height have been well-studied in plant genetics, but their relatedness and shared regulatory mechanisms in natural variants remain unclear. The introgression of chromosomal segments from weedy into cultivated rice (Oryza sativa) prompted the detection of two clusters (qSD1-2/qPH1 and qSD7-2/qPH7) of quantitative trait loci both associated with seed dormancy and plant height. Together, these two clusters accounted for >96% of the variances for plant height and ~71% of t...

  7. Functional expression and characterization of plant ABC transporters in Xenopus laevis oocytes for transport engineering purposes

    DEFF Research Database (Denmark)

    Xu, Deyang; Veres, Dorottya; Belew, Zeinu Mussa

    2016-01-01

    the question whether the oocytes system is suitable to express and characterize ABC transporters. Thus we have selected AtABCG25, previously characterized in insect cells as the exporter of commercially valuable abscisic acid—as case study for optimizing of characterization in Xenopus oocytes. The tools...

  8. On Verbal Competence

    Directory of Open Access Journals (Sweden)

    Zhongxin Dai

    2014-04-01

    Full Text Available This paper explored a new concept, verbal competence, to present a challenge to Chomsky’s linguistic competence and Hymes’ communicative competence. It is generally acknowledged that Chomsky concerned himself only with the syntactic/grammatical structures, and viewed the speaker’s generation and transformation of syntactic structures as the production of language. Hymes challenged Chomsky’s conception of linguistic competence and argued for an ethnographic or sociolinguistic concept, communicative competence, but his concept is too broad to be adequately grasped and followed in such fields as linguistics and second language acquisition. Communicative competence can include abilities to communicate with nonverbal behaviors, e.g. gestures, postures or even silence. The concept of verbal competence concerns itself with the mental and psychological processes of verbal production in communication. These processes originate from the speaker’s personal experience, in a certain situation of human communication, and with the sudden appearance of the intentional notion, shape up as the meaning images and end up in the verbal expression.

  9. ACCP Clinical Pharmacist Competencies.

    Science.gov (United States)

    Saseen, Joseph J; Ripley, Toni L; Bondi, Deborah; Burke, John M; Cohen, Lawrence J; McBane, Sarah; McConnell, Karen J; Sackey, Bryan; Sanoski, Cynthia; Simonyan, Anahit; Taylor, Jodi; Vande Griend, Joseph P

    2017-05-01

    The purpose of the American College of Clinical Pharmacy (ACCP) is to advance human health by extending the frontiers of clinical pharmacy. Consistent with this mission and its core values, ACCP is committed to ensuring that clinical pharmacists possess the knowledge, skills, attitudes, and behaviors necessary to deliver comprehensive medication management (CMM) in team-based, direct patient care environments. These components form the basis for the core competencies of a clinical pharmacist and reflect the competencies of other direct patient care providers. This paper is an update to a previous ACCP document and includes the expectation that clinical pharmacists be competent in six essential domains: direct patient care, pharmacotherapy knowledge, systems-based care and population health, communication, professionalism, and continuing professional development. Although these domains align with the competencies of physician providers, they are specifically designed to better reflect the clinical pharmacy expertise required to provide CMM in patient-centered, team-based settings. Clinical pharmacists must be prepared to complete the education and training needed to achieve these competencies and must commit to ongoing efforts to maintain competence through ongoing professional development. Collaboration among stakeholders will be needed to ensure that these competencies guide clinical pharmacists' professional development and evaluation by educational institutions, postgraduate training programs, professional societies, and employers. © 2017 Pharmacotherapy Publications, Inc.

  10. Leadership Competences Among Managers

    Directory of Open Access Journals (Sweden)

    Anna Baczynska

    2017-06-01

    Full Text Available Purpose: The aim of this paper is to present the results of a survey conducted among managers (N=38 in the framework of the project “Development of the Bounded Leadership Theory”. The research juxtaposes two types of variables: (1 leadership competencies outlined in Kozminski’s theory (i.e. anticipatory, visionary, value-creating, mobilizing, self-reflection with (2 three psychological predispositions of leaders, such as intelligence, personality and ability to influence others. The tested predispositions represented three groups: non-variable traits, or permanent characteristics (intelligence, partially variable characteristics (personality and variable characteristics (influence tactics. Methodology: A total of 38 middle and senior managers, students of the MBA programme at Kozminski University, took part in the survey. Participants flled out a preliminary version of the Leadership Competence Questionnaire, as well as tests pertaining to intelligence, personality and influence tactics. The hypotheses were tested using Spearman’s rho correlation. The research has brought interesting results relating to the correlation between the fve tested competencies and leadership predispositions. Findings: Permanent and partly stable characteristics do not correlate with leadership competencies, i.e. a high score in leadership competencies is not necessarily synonymous with high intelligence levels or positive personality traits. Correlations have been observed between mobilization skills and influence tactics in the surveyed sample, i.e. legitimacy and personal appeals that leaders have recourse to and, in the case of value-creating competencies, an interesting correlation with legitimacy. Originality: The study constitutes an important contribution to the extant literature, as – first and foremost – it represents a new approach to the understanding of leadership competencies. Secondly, it reveals correlations between complex skills, i

  11. Bidirectional Associations among Sensitive Parenting, Language Development, and Social Competence

    Science.gov (United States)

    Barnett, Melissa A.; Gustafsson, Hanna; Deng, Min; Mills-Koonce, W. Roger; Cox, Martha

    2012-01-01

    Rapid changes in language skills and social competence, both of which are linked to sensitive parenting, characterize early childhood. The present study examines bidirectional associations among mothers' sensitive parenting and children's language skills and social competence from 24 to 36?months in a community sample of 174 families. In addition,…

  12. Competence development in UAS

    DEFF Research Database (Denmark)

    Thorslund, Jørgen; Brodersen, Anne Mygind

    As a University of Applied Science (UAS) University College Lillebaelt in Denmark is addressing education, knowledge production and professional development in perspective of life-long and life-wide learning. It is our basic assumption that that internal competence development ? individually...... and organizationally - among UAS educators should be based on same learning concepts as used in professional development to avoid parallelism. Do for yourself, what you preach for others. Second, competence development of faculty is a central element in transformation of our institutions from schools of higher...... education to universities of applied science (UAS). Competence development strategies should thus include objectives for the institutions ability to contribute to knowledge production....

  13. Competency profile of Fitness Instructor

    OpenAIRE

    Peterová, Marta

    2011-01-01

    Title: COMPETENCY PROFILE OF FITNESS INSTRUCTOR Objectives: The aim of this work is to find out competencies of fitness instructor and make a competency profile, containing competencies, which are important for excellent fitness instructor. Methods: I applied the method of interview and the method of research in my thesis. The interview was used to make a list of competencies of fitness instructor. The research was applied in the final part of making competency profile, for an attestation of ...

  14. Structure of the higher plant light harvesting complex I: In vivo characterization and structural interdependence of the Lhca proteins

    NARCIS (Netherlands)

    Klimmek, F.; Ganeteg, U.; Ihalainen, J.A.; van Roon, H.; Jensen, P.E.; Scheller, H.V.; Dekker, J.P.; Jansson, S.

    2005-01-01

    We have investigated the structure of the higher plant light harvesting complex of photosystem I (LHCI) by analyzing PSI-LHCI particles isolated from a set of Arabidopsis plant lines, each lacking a specific Lhca (Lhca1-4) polypeptide. Functional antenna size measurements support the recent finding

  15. Characterization of the Pratylenchus penetrans transcriptome including data mining of putative nematode genes involved in plant parasitism

    Science.gov (United States)

    The root lesion nematode Pratylenchus penetrans is considered one of the most economically important species within the genus. Host range studies have shown that nearly 400 plant species can be parasitized by this species. To obtain insight into the transcriptome of this migratory plant-parasitic ne...

  16. Characterization of staphylococci in urban wastewater treatment plants in Spain, with detection of methicillin resistant Staphylococcus aureus ST398.

    Science.gov (United States)

    Gómez, Paula; Lozano, Carmen; Benito, Daniel; Estepa, Vanesa; Tenorio, Carmen; Zarazaga, Myriam; Torres, Carmen

    2016-05-01

    The objective of this study was to determine the prevalence of Staphylococcus in urban wastewater treatment plants (UWTP) of La Rioja (Spain), and to characterize de obtained isolates. 16 wastewater samples (8 influent, 8 effluent) of six UWTPs were seeded on mannitol-salt-agar and oxacillin-resistance-screening-agar-base for staphylococci and methicillin-resistant Staphylococcus aureus recovery. Antimicrobial susceptibility profile was determined for 16 antibiotics and the presence of 35 antimicrobial resistance genes and 14 virulence genes by PCR. S. aureus was typed by spa, agr, and multilocus-sequence-typing, and the presence of immune-evasion-genes cluster was analyzed. Staphylococcus spp. were detected in 13 of 16 tested wastewater samples (81%), although the number of CFU/mL decreased after treatment. 40 staphylococci were recovered (1-5/sample), and 8 of them were identified as S. aureus being typed as (number of strains): spa-t011/agr-II/ST398 (1), spa-t002/agr-II/ST5 (2), spa-t3262/agr-II/ST5 (1), spa-t605/agr-II/ST126 (3), and spa-t878/agr-III/ST2849 (1). S. aureus ST398 strain was methicillin-resistant and showed a multidrug resistance phenotype. Virulence genes tst, etd, sea, sec, seg, sei, sem, sen, seo, and seu, were detected among S. aureus and only ST5 strains showed genes of immune evasion cluster. Thirty-two coagulase-negative Staphylococcus of 12 different species were recovered (number of strains): Staphylococcus equorum (7), Staphylococcus vitulinus (4), Staphylococcus lentus (4), Staphylococcus sciuri (4), Staphylococcus fleurettii (2), Staphylococcus haemolyticus (2), Staphylococcus hominis (2), Staphylococcus saprophyticus (2), Staphylococcus succinus (2), Staphylococcus capitis (1), Staphylococcus cohnii (1), and Staphylococcus epidermidis (1). Five presented a multidrug resistance phenotype. The following resistance and virulence genes were found: mecA, lnu(A), vga(A), tet(K), erm(C), msr(A)/(B), mph(C), tst, and sem. We found that

  17. Unleashing Natural Competence in Lactococcus lactis by Induction of the Competence Regulator ComX

    Science.gov (United States)

    Mulder, Joyce; Wels, Michiel; Kuipers, Oscar P.; Bron, Peter A.

    2017-01-01

    ABSTRACT In biotechnological workhorses like Streptococcus thermophilus and Bacillus subtilis, natural competence can be induced, which facilitates genetic manipulation of these microbes. However, in strains of the important dairy starter Lactococcus lactis, natural competence has not been established to date. However, in silico analysis of the complete genome sequences of 43 L. lactis strains revealed complete late competence gene sets in 2 L. lactis subsp. cremoris strains (KW2 and KW10) and at least 10 L. lactis subsp. lactis strains, including the model strain IL1403 and the plant-derived strain KF147. The remainder of the strains, including all dairy isolates, displayed genomic decay in one or more of the late competence genes. Nisin-controlled expression of the competence regulator comX in L. lactis subsp. lactis KF147 resulted in the induction of expression of the canonical competence regulon and elicited a state of natural competence in this strain. In contrast, comX expression in L. lactis NZ9000, which was predicted to encode an incomplete competence gene set, failed to induce natural competence. Moreover, mutagenesis of the comEA-EC operon in strain KF147 abolished the comX-driven natural competence, underlining the involvement of the competence machinery. Finally, introduction of nisin-inducible comX expression into nisRK-harboring derivatives of strains IL1403 and KW2 allowed the induction of natural competence in these strains also, expanding this phenotype to other L. lactis strains of both subspecies. IMPORTANCE Specific bacterial species are able to enter a state of natural competence in which DNA is taken up from the environment, allowing the introduction of novel traits. Strains of the species Lactococcus lactis are very important starter cultures for the fermentation of milk in the cheese production process, where these bacteria contribute to the flavor and texture of the end product. The activation of natural competence in this industrially

  18. Engineered Plants as Biosensors

    National Research Council Canada - National Science Library

    Stewart, C

    2003-01-01

    The aim of the research was the creation of a model biosensing plant that could detect plant diseases and to characterize the utility of laser induced fluorescence imaging for detecting the inducible (LIFI) plant signal...

  19. TENCompetence Competence Observatory

    NARCIS (Netherlands)

    Vervenne, Luk

    2010-01-01

    Vervenne, L. (2007) TENCompetence Competence Observatory. Sources available http://tencompetence.cvs.sourceforge.net/viewvc/tencompetence/wp8/org.tencompetence.co/. Available under the three clause BSD license, copyright TENCompetence Foundation.

  20. Presumptions respecting mental competence.

    Science.gov (United States)

    Madigan, K V; Checkland, D; Silberfeld, M

    1994-04-01

    This paper addresses the role(s) played by presumptions regarding mental competence in the context of clinical assessment of decision-making capacity. In particular, the issue of whether or not the usual common law presumption of competence is appropriate and applicable in cases of reassessment of persons previously found incompetent is discussed. Arguments can be made for either retaining a presumption of competence or adopting a presumption of incompetence in reassessment cases. In addressing the issue and the arguments, the authors conclude that the question is really a public policy issue which requires legislative resolution. In writing this paper, the authors have drawn on their joint clinical experience at the Baycrest Competency Clinic. Though the authors' jurisdiction is the province of Ontario, their intent is to raise awareness and to prompt consideration of this issue both inside and outside Ontario.

  1. Adult educators' core competences

    DEFF Research Database (Denmark)

    Wahlgren, Bjarne

    2016-01-01

    ” requirements, organising them into four thematic subcategories: (1) communicating subject knowledge; (2) taking students’ prior learning into account; (3) supporting a learning environment; and (4) the adult educator’s reflection on his or her own performance. At the end of his analysis of different competence......Abstract Which competences do professional adult educators need? This research note discusses the topic from a comparative perspective, finding that adult educators’ required competences are wide-ranging, heterogeneous and complex. They are subject to context in terms of national and cultural...... environment as well as the kind of adult education concerned (e.g. basic education, work-related education etc.). However, it seems that it is possible to identify certain competence requirements which transcend national, cultural and functional boundaries. This research note summarises these common or “core...

  2. Developing Leadership Competencies.

    Science.gov (United States)

    Croft, Lucy; Seemiller, Corey

    2017-12-01

    This chapter provides an overview of leadership competencies including the history of emergence, contemporary uses, common frameworks, challenges, benefits, and future implications. © 2017 Wiley Periodicals, Inc., A Wiley Company.

  3. Managing Regulatory Body Competence

    International Nuclear Information System (INIS)

    2013-01-01

    In 2001, the IAEA published TECDOC 1254, which examined the way in which the recognized functions of a regulatory body for nuclear facilities results in competence needs. Using the systematic approach to training (SAT), TECDOC 1254 provided a framework for regulatory bodies for managing training and developing and their maintaining their competence. It has been successfully used by many regulators. The IAEA has also introduced a methodology and an assessment tool - Guidelines for Systematic Assessment of Regulatory Competence Needs (SARCoN) - which provides practical guidance on analysing the training and development needs of a regulatory body and, through a gap analysis, guidance on establishing competence needs and how to meet them. In 2009, the IAEA established a steering committee (supported by a bureau) with the mission to advise the IAEA on how it could best assist Member States to develop suitable competence management systems for their regulatory bodies. The committee recommended the development of a safety report on managing staff competence as an integral part of a regulatory body's management system. This Safety Report was developed in response to this request. It supersedes TECDOC 1254, broadens its application to regulatory bodies for all facilities and activities, and builds upon the experience gained through the application of TECDOC 1254 and SARCoN and the feedback received from Member States. This Safety Report applies to the management of adequate competence as needs change, and as such is equally applicable to the needs of States 'embarking' on a nuclear power programme. It also deals with the special case of building up the competence of regulatory bodies as part of the overall process of establishing an 'embarking' State's regulatory system

  4. Competence within Maintenance

    OpenAIRE

    Nerland, Annette Smørholm

    2010-01-01

    Maintenance can be a contributing factor to unwanted events, as well as desired events and states. Human competence can be defined as the ability to perform a specific task, action or function successfully, and is therefore a key factor to proper execution of maintenance tasks. Hence,maintenance will have negative consequences if done wrong, and give positive results when done right. The purpose of this report is to study the many aspects of maintenance competence. Endeavoring to improve ...

  5. Designing for competences

    DEFF Research Database (Denmark)

    Christiansen, Rene B; Gundersen, Peter Bukovica

    2014-01-01

    of these professionals has changed - and has become more cross-professional, more complex and analytic and reflective competencies have entered the policy papers of these human-professions as central, important forms of knowledge. These bachelor degrees in Denmark within the field of education (teaching and preschool...... and generating solutions in the form of design principles when moving from a focus of knowledge to a focus of competences....

  6. Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

    Science.gov (United States)

    Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

    2014-01-01

    Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

  7. De novo assembly and characterization of the transcriptome of the parasitic weed dodder identifies genes associated with plant parasitism.

    Science.gov (United States)

    Ranjan, Aashish; Ichihashi, Yasunori; Farhi, Moran; Zumstein, Kristina; Townsley, Brad; David-Schwartz, Rakefet; Sinha, Neelima R

    2014-11-01

    Parasitic flowering plants are one of the most destructive agricultural pests and have major impact on crop yields throughout the world. Being dependent on finding a host plant for growth, parasitic plants penetrate their host using specialized organs called haustoria. Haustoria establish vascular connections with the host, which enable the parasite to steal nutrients and water. The underlying molecular and developmental basis of parasitism by plants is largely unknown. In order to investigate the process of parasitism, RNAs from different stages (i.e. seed, seedling, vegetative strand, prehaustoria, haustoria, and flower) were used to de novo assemble and annotate the transcriptome of the obligate plant stem parasite dodder (Cuscuta pentagona). The assembled transcriptome was used to dissect transcriptional dynamics during dodder development and parasitism and identified key gene categories involved in the process of plant parasitism. Host plant infection is accompanied by increased expression of parasite genes underlying transport and transporter categories, response to stress and stimuli, as well as genes encoding enzymes involved in cell wall modifications. By contrast, expression of photosynthetic genes is decreased in the dodder infective stages compared with normal stem. In addition, genes relating to biosynthesis, transport, and response of phytohormones, such as auxin, gibberellins, and strigolactone, were differentially expressed in the dodder infective stages compared with stems and seedlings. This analysis sheds light on the transcriptional changes that accompany plant parasitism and will aid in identifying potential gene targets for use in controlling the infestation of crops by parasitic weeds. © 2014 American Society of Plant Biologists. All Rights Reserved.

  8. Water vs. carbon: An evaluation of SMAP soil moisture and OCO-2 solar-induced fluorescence to characterize global plant stress

    Science.gov (United States)

    Purdy, A. J.; Fisher, J.; Goulden, M.; Randerson, J. T.; Famiglietti, J. S.

    2017-12-01

    Plants link the carbon and water cycles through photosynthesis and evapotranspiration (ET). When plants take in CO2 for photosynthesis, water evaporates to the atmosphere. This exchange of carbon and water is sensitive to a number of environmental variables including: soil water availability, temperature, atmospheric water vapor, and radiation. When the atmospheric demand for water is high, plants avoid hydraulic failure by regulating the amount of water exiting leaves at the expense of inhibiting carbon uptake. Over time, stress caused by this response limits plant growth and can even result in death by carbon starvation. With increasing atmospheric demand for water, impending expansion of arid regions, and more frequent droughts, understanding how vegetation responds to regulate photosynthesis and ET is important to quantify potential feedbacks between the carbon and water cycles. Despite its importance, to what extent plants respond to stressful conditions is an open science question. An important step forward is to characterize the dominant controls in these stress events and identify geographic areas that are vulnerable to climate change. The 2015-2016 El Nino and subsequent 2016-2017 La Nina transition provides an opportunity to quantify the extent and magnitude of vegetation regulation of these carbon and water variables in response to changes in environmental conditions. We present results from a space-based analysis using global observations of solar induced fluorescence (SIF) from the Orbiting Carbon Observatory-2 (OCO-2), soil moisture from Soil Moisture Active Passive (SMAP), and two widely used ET models (PT-JPL and MOD-16) to characterize the dominant controls on gross primary production and ET.

  9. Strengthening Regulatory Competence in Pakistan

    International Nuclear Information System (INIS)

    Sadiq, M.

    2016-01-01

    Capacity building of Pakistan Nuclear Regulatory Authority is considered an essential element in pursuit of its vision to become a world class regulatory body. Since its inception in 2001, PNRA has continuously endeavoured to invest in its people, develop training infrastructure and impart sound knowledge and professional skills with the aim to improve its regulatory effectiveness. The use of nuclear and radioactive material in Pakistan has increased manifold in recent years, thus induction of more manpower was needed for regulatory oversight. PNRA adopted two pronged approach for meeting the manpower demand (a) employment of university graduates through fast track recruitment drive and (b) induction of graduates by offering fellowships for Master degree programs. Although, the newly employed staff was selected on the basis of their excellent academic qualifications in basic and applied sciences, but they required rigorous knowledge and skills in regulatory perspectives. In order to implement a structured training program, PNRA conducted Training Needs Assessment (TNA) and identified competency gaps of the regulatory staff in legal, technical, regulatory practice and behavioural domains. PNRA took several initiatives for capacity building which included establishment of a training centre for sustainability of trainings, initiation of a fellowship scheme for Master program, attachment of staff at local institutes for on-the-job training and placement at foreign regulatory bodies and organizations for technical development with the assistance of IAEA. The above strategies have been very beneficial in competence building of the PNRA staff to perform all regulatory activities indigenously for nuclear power plants, research reactors and radiation facilities. Provision of vibrant technical support to IAEA and Member States in various programs by PNRA is a landmark of these competence development efforts. This paper summarizes PNRA initiatives and the International Atomic

  10. Isolation and characterization of novel plant growth promoting Micrococcus sp NII-0909 and its interaction with cowpea

    Digital Repository Service at National Institute of Oceanography (India)

    Dastager, S.G.; Deepa, C.K.; Pandey, A.

    , and 16S rRNA gene sequence. The strain exhibited the plant growthpromoting attributes of phosphate solubilization, auxin production, 1-aminocyclopropane-1-carboxylate deaminase activity, and siderophore production. It was able to solubilize (122.4 mg...

  11. Molecular Characterization of the Plant Growth Promoting Bacterium Enterobacter sp. SA187 upon Contact with Arabidopsis thaliana

    KAUST Repository

    Alsharif, Wiam

    2018-01-01

    Salt stress is a severe environmental challenge in agriculture, limiting the quality and productivity of the crops around the globe. Plant growth promoting rhizobacteria (PGPR) is proposed as a friendly solution to overcome those challenges

  12. Transcriptome Characterization and Sequencing-Based Identification of Salt-Responsive Genes in Millettia pinnata, a Semi-Mangrove Plant

    OpenAIRE

    Huang, Jianzi; Lu, Xiang; Yan, Hao; Chen, Shouyi; Zhang, Wanke; Huang, Rongfeng; Zheng, Yizhi

    2012-01-01

    Semi-mangroves form a group of transitional species between glycophytes and halophytes, and hold unique potential for learning molecular mechanisms underlying plant salt tolerance. Millettia pinnata is a semi-mangrove plant that can survive a wide range of saline conditions in the absence of specialized morphological and physiological traits. By employing the Illumina sequencing platform, we generated ∼192 million short reads from four cDNA libraries of M. pinnata and processed them into 108 ...

  13. Two phosphoenolpyruvate carboxykinases coexist in the Crassulacean Acid Metabolism plant Ananas comosus. Isolation and characterization of the smaller 65 kDa form.

    Science.gov (United States)

    Martín, Mariana; Rius, Sebastián Pablo; Podestá, Florencio Esteban

    2011-06-01

    Two phosphoenolpyruvate carboxykinase (PEPCK, EC 4.1.1.49) isoforms of 74 and 65 kDa were found to coexist in vivo in pineapple leaves, a constitutive Crassulacean Acid Metabolism plant. The 65 kDa form was not the result of proteolytic cleavage of the larger form since extraction methods reported to prevent PEPCK proteolysis in other plant tissues failed to yield a single immunoreactive PEPCK polypeptide in leaf extracts. In this work, the smaller form of 65 kDa was purified to homogeneity and physically and kinetically characterized and showed parameters compatible with a fully active enzyme. The specific activity was nearly twice higher for decarboxylation of oxaloacetate when compared to carboxylation of phosphoenolpyruvate. Kinetic parameters fell within the range of those estimated for other plant PEPCKs. Its activity was affected by several metabolites, as shown by inhibition by 3-phosphoglycerate, citrate, malate, fructose-1,6-bisphosphate, l-asparagine and activation of the decarboxylating activity by succinate. A break in the Arrhenius plot at about 30°C indicates that PEPCK structure is responsive to changes in temperature. The results indicate that pineapple leaves contain two PEPCK forms. The biochemical characterization of the smaller isoform performed in this work suggests that it could participate in both carbon and nitrogen metabolism in vivo by acting as a decarboxylase. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  14. Strategies for developing competency models.

    Science.gov (United States)

    Marrelli, Anne F; Tondora, Janis; Hoge, Michael A

    2005-01-01

    There is an emerging trend within healthcare to introduce competency-based approaches in the training, assessment, and development of the workforce. The trend is evident in various disciplines and specialty areas within the field of behavioral health. This article is designed to inform those efforts by presenting a step-by-step process for developing a competency model. An introductory overview of competencies, competency models, and the legal implications of competency development is followed by a description of the seven steps involved in creating a competency model for a specific function, role, or position. This modeling process is drawn from advanced work on competencies in business and industry.

  15. Characterization and Functional Identification of a Novel Plant 4,5-Extradiol Dioxygenase Involved in Betalain Pigment Biosynthesis in Portulaca grandiflora

    Science.gov (United States)

    Christinet, Laurent; Burdet, Frédéric X.; Zaiko, Maïa; Hinz, Ursula; Zrÿd, Jean-Pierre

    2004-01-01

    Betalains are pigments that replace anthocyanins in the majority of families of the plant order Caryophyllales. Betalamic acid is the common chromophore of betalains. The key enzyme of the betalain biosynthetic pathway is an extradiol dioxygenase that opens the cyclic ring of dihydroxy-phenylalanine (DOPA) between carbons 4 and 5, thus producing an unstable seco-DOPA that rearranges nonenzymatically to betalamic acid. A gene for a 4,5-DOPA-dioxygenase has already been isolated from the fungus Amanita muscaria, but no homolog was ever found in plants. To identify the plant gene, we constructed subtractive libraries between different colored phenotypes of isogenic lines of Portulaca grandiflora (Portulacaceae) and between different stages of flower bud formation. Using in silico analysis of differentially expressed cDNAs, we identified a candidate showing strong homology at the level of translated protein with the LigB domain present in several bacterial extradiol 4,5-dioxygenases. The gene was expressed only in colored flower petals. The function of this gene in the betalain biosynthetic pathway was confirmed by biolistic genetic complementation in white petals of P. grandiflora genotypes lacking the gene for color formation. This gene named DODA is the first characterized member of a novel family of plant dioxygenases phylogenetically distinct from Amanita sp. DOPA-dioxygenase. Homologs of DODA are present not only in betalain-producing plants but also, albeit with some changes near the catalytic site, in other angiosperms and in the bryophyte Physcomitrella patens. These homologs are part of a novel conserved plant gene family probably involved in aromatic compound metabolism. PMID:14730069

  16. Characterization of cysteine-degrading and H2S-releasing enzymes of higher plants - from the field to the test tube and back.

    Science.gov (United States)

    Papenbrock, J; Riemenschneider, A; Kamp, A; Schulz-Vogt, H N; Schmidt, A

    2007-09-01

    Due to the clean air acts and subsequent reduction of emission of gaseous sulfur compounds sulfur deficiency became one of the major nutrient disorders in Northern Europe. Typical sulfur deficiency symptoms can be diagnosed. Especially plants of the Cruciferae family are more susceptible against pathogen attack. Sulfur fertilization can in part recover or even increase resistance against pathogens in comparison to sulfur-deficient plants. The term sulfur-induced resistance (SIR) was introduced, however, the molecular basis for SIR is largely unknown. There are several sulfur-containing compounds in plants which might be involved in SIR, such as high levels of thiols, glucosinolates, cysteine-rich proteins, phytoalexins, elemental sulfur, or H2S. Probably more than one strategy is used by plants. Species- or even variety-dependent differences in the development of SIR are probably used. Our research focussed mainly on the release of H2S as defence strategy. In field experiments using different BRASSICA NAPUS genotypes it was shown that the genetic differences among BRASSICA genotypes lead to differences in sulfur content and L-cysteine desulfhydrase activity. Another field experiment demonstrated that sulfur supply and infection with PYRENOPEZIZA BRASSICA influenced L-cysteine desulfhydrase activity in BRASSICA NAPUS. Cysteine-degrading enzymes such as cysteine desulfhydrases are hypothesized to be involved in H2S release. Several L- and D-cysteine-specific desulfhydrase candidates have been isolated and partially analyzed from the model plant ARABIDOPSIS THALIANA. However, it cannot be excluded that H2S is also released in a partial back reaction of O-acetyl-L-serine(thiol)lyase or enzymes not yet characterized. For the exact determination of the H2S concentration in the cell a H2S-specific microsensor was used the first time for plant cells. The transfer of the results obtained for application back on BRASSICA was initiated.

  17. Characterization of staphylococci in urban wastewater treatment plants in Spain, with detection of methicillin resistant Staphylococcus aureus ST398

    International Nuclear Information System (INIS)

    Gómez, Paula; Lozano, Carmen; Benito, Daniel; Estepa, Vanesa; Tenorio, Carmen; Zarazaga, Myriam; Torres, Carmen

    2016-01-01

    The objective of this study was to determine the prevalence of Staphylococcus in urban wastewater treatment plants (UWTP) of La Rioja (Spain), and to characterize de obtained isolates. 16 wastewater samples (8 influent, 8 effluent) of six UWTPs were seeded on mannitol-salt-agar and oxacillin-resistance-screening-agar-base for staphylococci and methicillin-resistant Staphylococcus aureus recovery. Antimicrobial susceptibility profile was determined for 16 antibiotics and the presence of 35 antimicrobial resistance genes and 14 virulence genes by PCR. S. aureus was typed by spa, agr, and multilocus-sequence-typing, and the presence of immune-evasion-genes cluster was analyzed. Staphylococcus spp. were detected in 13 of 16 tested wastewater samples (81%), although the number of CFU/mL decreased after treatment. 40 staphylococci were recovered (1–5/sample), and 8 of them were identified as S. aureus being typed as (number of strains): spa-t011/agr-II/ST398 (1), spa-t002/agr-II/ST5 (2), spa-t3262/agr-II/ST5 (1), spa-t605/agr-II/ST126 (3), and spa-t878/agr-III/ST2849 (1). S. aureus ST398 strain was methicillin-resistant and showed a multidrug resistance phenotype. Virulence genes tst, etd, sea, sec, seg, sei, sem, sen, seo, and seu, were detected among S. aureus and only ST5 strains showed genes of immune evasion cluster. Thirty-two coagulase-negative Staphylococcus of 12 different species were recovered (number of strains): Staphylococcus equorum (7), Staphylococcus vitulinus (4), Staphylococcus lentus (4), Staphylococcus sciuri (4), Staphylococcus fleurettii (2), Staphylococcus haemolyticus (2), Staphylococcus hominis (2), Staphylococcus saprophyticus (2), Staphylococcus succinus (2), Staphylococcus capitis (1), Staphylococcus cohnii (1), and Staphylococcus epidermidis (1). Five presented a multidrug resistance phenotype. The following resistance and virulence genes were found: mecA, lnu(A), vga(A), tet(K), erm(C), msr(A)/(B), mph(C), tst, and sem. We found that

  18. PROSPECTIVE PRIMARY SCHOOL TEACHERS’ FOREIGN LANGUAGE SOCIOCULTURAL COMPETENCE: MONITORING PRINCIPLES

    Directory of Open Access Journals (Sweden)

    Olena Ishutina

    2016-04-01

    Full Text Available The paper substantiates the necessity and importance of the organization of prospective primary school teachers’ foreign language sociocultural competence monitoring in the educational process of high school. The author notes that prospective primary school teachers’ foreign language sociocultural competence is inseparably linked with linguomethodological competence. It is proved that the measurement of foreign language sociocultural competence of primary school foreign language teachers should be performed in the process of lingvomethodological training of the students as lingvomethodological competence occupies a dominant place and is a unifying and a backbone for other competencies of the future teacher’s professiogram. In this regard, the concept of “foreign language sociocultural competence of prospective primary school teacher” is clarified, the essence of lingvomethodological monitoring of foreign language sociocultural competence is revealed. It is emphasized that linguistic disciplines (“The practice of oral and written language”, “Practical grammar of a foreign language”, “Practical phonetics of a foreign language”, etc. and linguomethodological courses (“Methods of teaching English at primary school”, “ICT in learning foreign languages”, “Innovative technologies of learning foreign languages”, etc. play very important role in forming “foreign language sociocultural competence of prospective primary school teacher”. Specific principles of lingvomethodological monitoring of foreign language sociocultural competence are identified and characterized. They are complexity, lingvomethodological orientation, validity, multi-vector monitoring procedures.

  19. Advances made in development of competence of refining plant operators. The REPAR case, PR, Brazil; Avancos realizados no desenvolvimento de competencias de operadores de plantas de refino: o caso da REPAR

    Energy Technology Data Exchange (ETDEWEB)

    Reis, Mario [PETROBRAS, Rio de Janeiro, RJ (Brazil). Centro de Pesquisas. Recursos Humanos]. E-mail: marioreis@petrobras.com.br

    2004-12-01

    The work presents a synthesis of the outcome of two years of research and experiments for the development of competence of Refinery operators in a project carried out by REPAR - Presidente Getulio Vargas Refinery in partnership with the Parana Federal University Education sector. From the Refinery need to reformulate its operators formation and development process, an important perspective was open to discuss and implement pedagogical principles based on the competence category as praxis. Such category brings forth the commitment to transform the workers educational processes and the production social relations excelling the models based on Taylorian/Fordian paradigm.(author)

  20. Students' communicative competence

    Directory of Open Access Journals (Sweden)

    Šafranj Jelisaveta

    2009-01-01

    Full Text Available Communicative competence is the ability to send messages which promote attainment of goals while maintaining social acceptability. Competent communicators attempt to align themselves with each others goals and methods to produce a smooth, productive and often enjoyable dialogue. The aim of this research was to investigate self-perceived communicative competence (SPCC of students of Engineering Management in General English and English for Specific Purposes (ESP. A longitudinal study was carried out starting with the first year students at the Faculty of Technical Sciences in Novi Sad and was repeated with the same sample of students during their second and third year of study. Participation was voluntary and took place during regular class time. The measure of communicative competence employed was the Self-perceived Communication Competence Scale. The results of the study indicated that differences in SPCC between the years do exist. The SPCC gradually improved between the first, the second and the third year. The research was also motivated by gaining better overview of the teaching activity. An anonymous questionnaire provided many useful hints and ideas for further work and thus, language teacher made a thorough analysis of the overall teaching procedure. However, it is essential to get some feedback and talk to students in order to evaluate both them and ourselves as well as the teaching syllabus.

  1. Chemical Characterization and in Vitro Antibacterial Activity of Myrcianthes hallii (O. Berg McVaugh (Myrtaceae, a Traditional Plant Growing in Ecuador

    Directory of Open Access Journals (Sweden)

    Patricia Chavez Carvajal

    2016-06-01

    Full Text Available Myrcianthes hallii (O. Berg McVaugh (Myrtaceae is a plant native to Ecuador, traditionally used for its antiseptic properties. The composition of the hydro-methanolic extract of this plant was determined by submitting it to ultra-high performance liquid chromatography (UHPLC hyphenated to heated-electrospray ionization mass spectrometry and UV detection. The presence of antimicrobial components prompted us to test the extract against methicillin-resistant and methicillin-susceptible Staphylococcus aureus, multidrug-resistant and susceptible Escherichia coli, Pseudomonas aeruginosa, Enterococcus spp. and Streptococcus pyogenes strains. The chromatographic analysis led to the identification of 38 compounds, including polyphenols and organic acids, and represents the first chemical characterization of this plant. The extract showed modest antibacterial activity against all tested bacteria, with the exception of E. coli which was found to be less sensitive. Whilst methicillin-resistant strains usually display resistance to several drugs, no relevant differences were observed between methicillin-susceptible and resistant strains. Considering its long-standing use in folk medicine, which suggests the relative safety of the plant, and the presence of many known antibacterial polyphenolic compounds responsible for its antibacterial activity, the results show that M. hallii extract could be used as a potential new antiseptic agent. Moreover, new anti-infective biomaterials and nanomaterials could be designed through the incorporation of M. hallii polyphenols. This prospective biomedical application is also discussed.

  2. Isolation and characterization of an atypical LEA protein coding cDNA and its promoter from drought-tolerant plant Prosopis juliflora.

    Science.gov (United States)

    George, Suja; Usha, B; Parida, Ajay

    2009-05-01

    Plant growth and productivity are adversely affected by various abiotic and biotic stress factors. Despite the wealth of information on abiotic stress and stress tolerance in plants, many aspects still remain unclear. Prosopis juliflora is a hardy plant reported to be tolerant to drought, salinity, extremes of soil pH, and heavy metal stress. In this paper, we report the isolation and characterization of the complementary DNA clone for an atypical late embryogenesis abundant (LEA) protein (Pj LEA3) and its putative promoter sequence from P. juliflora. Unlike typical LEA proteins, rich in glycine, Pj LEA3 has alanine as the most abundant amino acid followed by serine and shows an average negative hydropathy. Pj LEA3 is significantly different from other LEA proteins in the NCBI database and shows high similarity to indole-3 acetic-acid-induced protein ARG2 from Vigna radiata. Northern analysis for Pj LEA3 in P. juliflora leaves under 90 mM H2O2 stress revealed up-regulation of transcript at 24 and 48 h. A 1.5-kb fragment upstream the 5' UTR of this gene (putative promoter) was isolated and analyzed in silico. The possible reasons for changes in gene expression during stress in relation to the host plant's stress tolerance mechanisms are discussed.

  3. Molecular Characterization of the Plant Growth Promoting Bacterium Enterobacter sp. SA187 upon Contact with Arabidopsis thaliana

    KAUST Repository

    Alsharif, Wiam

    2018-05-01

    Salt stress is a severe environmental challenge in agriculture, limiting the quality and productivity of the crops around the globe. Plant growth promoting rhizobacteria (PGPR) is proposed as a friendly solution to overcome those challenges. The desert plant endophytic bacterium, Enterobacter sp. SA187 has shown plant growth promotion and salt stress tolerance beneficial effect on the model plant Arabidopsis thaliana in vitro as well as under the field conditions on different crops. SA187 has a distinguished morphology of yellow colonies (SA187Y) that could be due to carotenoid biosynthesis. However, the bacteria tend to lose the yellow color upon incubation with the plants and the colonies turn to white (SA187W). In comparison to SA187Y, SA187W shows 50% reduction on the beneficial impact on A. thaliana fresh and dry weight of root and shoot system. By counting the CFU/plant, we showed that SA187Y and SA187W both have similar colonization rate in both shoots and roots. Under non-salt conditions, optimal bacterial colonization was observed on day 8 after inocubation, however, under the salt stress condition, the optimal colonization was observed at day 4. Moreover, during the time period of the incubation of the SA187Y with the plants, there was a consistent noticeable loss of the yellow color of the colonies. This change in color is only observed eight days after transfer and the number of white colonies increases with the increase of the incubation time. In addition, SA187W was GFP-tagged by Tn7 transposon system and visualized by confocal laser scanning microscopy. The SA187W-GFP colonies have shown a similar colonization pattern as SA187Y-GFP, bacteria were colonizing the differentiation zone and cell elongation zone in the roots. Finally, the gene expression of the carotenoid biosynthesis pathways genes in SA187Y showed an overall higher gene expression compared to SA187W. In conclusion, the color loss seems to affect the beneficial impact of the bacteria on

  4. What is physics problem solving competency?

    DEFF Research Database (Denmark)

    Niss, Martin

    2018-01-01

    on the nature of physics problem- solving competency. The first, Sommerfeld’s, is a “theory first, phenomenon second” approach. Here the relevant problems originate in one of the theories of physics and the job goal of the problem- solver is to make a mathematical analysis of the suitable equation......A central goal of physics education is to teach problem-solving competency, but the nature of this competency is not well-described in the literature. The present paperarticle uses recent historical scholarship on Arnold Sommerfeld and Enrico Fermi to identify and characterize two positions......(s) and then give a qualitative analysis of the phenomenon that arise from these mathematical results. Fermi’s position is a “phenomenon first, theory second” approach, where the starting point is a physical phenomenon that is analyzed and then brought into the realm of a physics theory. The two positions...

  5. Language competence in movement

    DEFF Research Database (Denmark)

    Laursen, Helle Pia; Mogensen, Naja Dahlstrup

    2016-01-01

    multilingual children's language and literacy acquisition processes, we direct our focus to a single child's active exploration of what it means to know a language. Through analysis of interviews and researcher generated activities, we see how this child both describes and does language competence......This article examines how, in a multilingual perspective, language competence is experienced, talked about and practiced by language users themselves. By viewing children as active co-creators of the spaces in which language is used, this article contributes to a research tradition in which focus...... is shifted from viewing the individual's language competence as a mental linguistic or communicative property, to viewing language as a series of social and spatial practices. Looking at data from the research project Tegn på Sprog (in the following referred to as Signs of Language), which examines...

  6. Isolation and characterization of antimicrobial compound from the stem-bark of the traditionally used medicinal plant Adenium obesum

    Directory of Open Access Journals (Sweden)

    Mohammed Sohail Akhtar

    2017-07-01

    Conclusion: The results indicate that walnut chloroform fraction may contain effective compounds with a broad spectrum of curative applications. This is the first report on isolation and characterization of a compound from chloroform crude extract of A. obesum.

  7. Characterization of low molecular weight fragments from gamma irradiated κ-carrageenan used as plant growth promoter

    Science.gov (United States)

    Abad, Lucille V.; Aurigue, Fernando B.; Relleve, Lorna S.; Montefalcon, Djowel Recto V.; Lopez, Girlie Eunice P.

    2016-01-01

    Radiation degraded κ-carrageenan (1% solution at absorbed doses of 20 kGy and 30 kGy) were tested for its plant growth promoter (PGP) effect on pechay plants under hydroponics condition. Results revealed that higher PGP effects were found in κ-carrageenan irradiated at an absorbed dose of 30 kGy. Mw of irradiated κ-carrageenan as measured by GPC were determined to be 7362 Da and 6762 Da for 20 kGy and 30 kGy, respectively. Fractionation of the irradiated κ-carrageenan (30 kGy) was done to separate different Mw fractions using Mw cut-off filters of 1 kDa, 3 kDa, and 5 kDa. The PGP effect of the different retentates showed that biological activity in plants followed the order of 5 kDa>3 kDa>1 kDa using hydroponics condition but the reverse was observed in the order of 1 kDa>3 kDa>5 kDa when absorbed in plants by foliar spraying. GPC chromatogram indicated at least three (3) low molecular weight (LMW) fragments from radiation modified κ-carrageenan solution with an Mw<2000 Da. A fragment has also been identified with an Mw of as low as 160 Da which was produced under acidic (un-neutralized) condition. This may be attributed to the formation of 5-hydroxymethylfurfural (5-HMF).

  8. Isolation and Molecular Characterization of Potential Plant Growth Promoting Bacillus cereus GGBSTD1 and Pseudomonas spp. GGBSTD3 from Vermisources

    Directory of Open Access Journals (Sweden)

    Balayogan Sivasankari

    2014-01-01

    Full Text Available Vermicompost was prepared from leaf materials of Gliricidia sepium + Cassia auriculata + Leucaena leucocephala with cow dung (1 : 1 : 2 using Eudrilus eugeniae (Kinberg and Eisenia fetida for 60 days. Nineteen bacterial strains which have the capability to fix nitrogen, solubilize inorganic phosphate, and produce phytohormones were isolated from vermicompost, vermisources, and earthworm (fore, mid, and hind guts and tested for plant growth studies. Among the bacterial strains only five strains had both activities; among the five Bacillus spp. showed more nitrogen fixing activity and Pseudomonas spp. showed more phosphate solubilizing activity. Hence these bacterial strains were selected for further molecular analysis and identified Bacillus cereus GGBSTD1 and Pseudomonas spp. GGBSTD3. Plant growth studies use these two organisms separately and as consortium (Bacillus cereus + Pseudomonas spp. in (1 : 1 ratio at different concentrations using Vigna unguiculata (L. Walp. at different day intervals. The germination percent, shoot length, root length, leaf area, chlorophyll a content of the leaves, chlorophyll b content of the leaves, total chlorophyll content of the leaves, fresh weight of the whole plant, and dry weight of the whole plant were significantly enhanced by the consortium (Bacillus cereus + Pseudomonas spp. of two organisms at 5 mL concentrations on the 15th day compared to others.

  9. Isolation and Molecular Characterization of a Model Antagonistic Pseudomonas aeruginosa Divulging In Vitro Plant Growth Promoting Characteristics

    Directory of Open Access Journals (Sweden)

    Bushra Uzair

    2018-01-01

    Full Text Available The use of microbial technologies in agriculture is currently expanding quite rapidly with the identification of new bacterial strains, which are more effective in promoting plant growth. In the present study 18 strains of Pseudomonas were isolated from soil sample of Balochistan coastline. Among isolated Pseudomonas strains four designated as SP19, SP22, PS24, and SP25 exhibited biocontrol activities against phytopathogenic fungi, that is, Rhizopus microsporus, Fusarium oxysporum, Aspergillus niger, Alternaria alternata, and Penicillium digitatum; PS24 identified as Pseudomonas aeruginosa by 16srRNA gene bank accession number EU081518 was selected on the basis of its antifungal activity to explore its potential as plant growth promotion. PS24 showed multiple plant growth promoting attributes such as phosphate solubilization activity, indole acetic acid (IAA, siderophore, and HCN production. In order to determine the basis for antifungal properties, antibiotics were extracted from King B broth of PS24 and analyzed by TLC. Pyrrolnitrin antibiotic was detected in the culture of strain PS24. PS24 exhibited antifungal activities found to be positive for hydrogen cyanide synthase Hcn BC gene. Sequencing of gene of Hcn BC gene of strain PS24 revealed 99% homology with the Pseudomonas aeruginosa strain PA01. The sequence of PS24 had been submitted in gene bank accession number KR605499. Ps. aeruginosa PS24 with its multifunctional biocontrol possessions can be used to bioprotect the crop plants from phytopathogens.

  10. Utilizing next generation sequencing to characterize microsatellite loci in a tropical aquatic plant species Cryptocoryne cordata var. cordata (Araceae)

    DEFF Research Database (Denmark)

    Rosazlina, Rusly; Jacobsen, Niels; Ørgaard, Marian

    2015-01-01

    Abstract Cryptocoryne cordata var. cordata (2n = 34) is an aquatic plant species distributed from the southern part of Peninsular Thailand through the Malay Peninsula. It propagates both sexually and asexually via stolons. The current study is aimed at developing nuclear microsatellite markers...

  11. CHARACTERIZATION OF FUGITIVE MERCURY EMISSIONS FROM THE CELL BUILDING AT A U.S. CHLOR-ALKALI PLANT

    Science.gov (United States)

    The paper discusses an extensive measurement campaign that was conducted of the fugitive (non-ducted) airborne elemental mercury [Hg(0)] emissions from the cell building of a chlor-alkali plant (CAP) located in the southeastern United States. The objectives of this study were to ...

  12. Chemical and molecular characterization of Phomopsis and Cytospora-like endophytes from different host plants in Brazil

    DEFF Research Database (Denmark)

    Abreu, Lucas M.; Costa, Sarah S.; Pfenning, Ludwig H.

    2012-01-01

    affinities. Additional phenotypic characters, such as profiles of secondary metabolites, are needed for practical species recognition. We investigated 36 strains of Phomopsis spp. and Cytospora-like fungi, obtained as endophytes of different host plants in Brazil, using metabolite profiling based on HPLC...

  13. Identification an characterization of QTL underlying whole plant physiology in Arabidopsis taliana: 13C, stomatal conduction and transpiration efficiency

    NARCIS (Netherlands)

    Juenger, T.E.; McKay, J.K.; Hausmann, N.; Keurentjes, J.J.B.; Sen, S.; Stowe, K.A.; Dawson, T.E.; Simms, E.L.; Richards, J.H.

    2005-01-01

    Water limitation is one of the most important factors limiting crop productivity world-wide and has likely been an important selective regime influencing the evolution of plant physiology. Understanding the genetic and physiological basis of drought adaptation is therefore important for improving

  14. Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

    Directory of Open Access Journals (Sweden)

    Mojtaba Sankian

    2014-05-01

    Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

  15. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  16. Characterizing the Status (Disturbed, Hybrid or Novel) of Swamp Forest Fragments in a Caribbean Ramsar Wetland: The Impact of Anthropogenic Degradation and Invasive Plant Species.

    Science.gov (United States)

    Prospere, Kurt; McLaren, Kurt P; Wilson, Byron

    2016-10-01

    The last remaining Amazonian-type swamp forest fragments in Black River Lower Morass, Jamaica, have been subjected to a myriad of anthropogenic disturbances, compounded by the establishment and spread of several invasive plant species. We established 44 permanent sample plots (covering 3.92 ha) across 10 of these swamp forest fragments and sampled all non-woody plants and all trees ≥2 cm DBH found in the plots. These data were used to (1) identify thresholds of hybridity and novelty, (2) derive several diversity and structural descriptors used to characterize the swamp forest fragments and (3) identify possible indicators of anthropogenic degradation. These were incorporated into a framework and used to determine the status of the swamp forest fragments so that appropriate management and conservation measures can be implemented. We recorded 43 woody plant species (9 endemic, 28 native and 4 non-native) and 21 non-tree species. The composition and structure of all the patches differed significantly due to the impact of the herbaceous invasive plant Alpinia allughas, the presence and diversity of other non-native plants, and differing intensities of anthropogenic disturbance (e.g., burning, cutting and harvesting of non-timber forest products). We ranked forest patches along a continuum representing deviations from a historical proxy (least disturbed) swamp forest to those with dramatically altered structural and floristic attributes (=novel swamp forests). Only one fragment overrun with A. allughas was classified as novel. If effective conservation and management does not come to the BRLM, the remaining swamp forest fragments appear doomed to further degradation and will soon disappear altogether.

  17. Eating before competing.

    Science.gov (United States)

    Clark, N

    1998-09-01

    Many casual exercisers and competitive athletes believe they should avoid food for several hours before they exercise or compete. Others wonder if they should snack, perhaps on an energy bar before a soccer game. And a few are so nervous that even the thought of food is nauseating.

  18. Competence and the Workplace

    NARCIS (Netherlands)

    Van Yperen, Nico W.; Elliot, Andrew J.; Dweck, Carol S.; Yeager, David S.

    2017-01-01

    The focus of this chapter on competence at the workplace is on workers’ willingness to perform, which is defined as individuals’ psychological characteristics that affect the degree to which they are inclined to perform their tasks. People may be motivated by either the positive, appetitive

  19. Developing professional competence

    DEFF Research Database (Denmark)

    Wahlgren, Bjarne

    2015-01-01

    The purpose of university programs for professionals is to qualify the students to act competently in a subsequent job situation. Practical experiences as well as comprehensive research studies have shown that only a limited part of what is learned during the coursework is applied in the subsequent...

  20. Classical competing risks

    CERN Document Server

    Crowder, Martin J

    2001-01-01

    If something can fail, it can often fail in one of several ways and sometimes in more than one way at a time. There is always some cause of failure, and almost always, more than one possible cause. In one sense, then, survival analysis is a lost cause. The methods of Competing Risks have often been neglected in the survival analysis literature. Written by a leading statistician, Classical Competing Risks thoroughly examines the probability framework and statistical analysis of data of Competing Risks. The author explores both the theory of the subject and the practicalities of fitting the models to data. In a coherent, self-contained, and sequential account, the treatment moves from the bare bones of the Competing Risks setup and the associated likelihood functions through survival analysis using hazard functions. It examines discrete failure times and the difficulties of identifiability, and concludes with an introduction to the counting-process approach and the associated martingale theory.With a dearth of ...

  1. Assessing cataract surgical competency

    NARCIS (Netherlands)

    Lee, Andrew G.; Greenlee, Emily; Oetting, Thomas A.; Beaver, Hilary A.; Johnson, A. Tim; Boldt, H. Culver; Abramoff, Michael; Olson, Richard; Carter, Keith

    2007-01-01

    The Accreditation Council for Graduate Medical Education has mandated that all residency training programs teach and assess 6 general competencies.1 A.G. Lee and K.D. Carter, Managing the new mandate in resident education: A blueprint for translating a national mandate into local compliance,

  2. Assessing Culturally Competent Scholarship.

    Science.gov (United States)

    Mendias, Elnora P.; Guevara, Edilma B.

    2001-01-01

    Eight criteria for culturally competent scholarship (contextuality, relevance, communication styles, awareness of identity and power differences, disclosure, reciprocation, empowerment, time) were applied to an international education/research nursing program. Appropriate measures for each were developed and ways to improve the program were…

  3. Evolution of subsidiary competences

    DEFF Research Database (Denmark)

    Geisler Asmussen, Christian; Pedersen, Torben; Dhanaraj, Charles

    of competitive advantage of nations, we hypothesize the contingencies under which heterogeneity in host environments influences subsidiary competence configuration. We test our model with data from more than 2,000 subsidiaries in seven Western European countries. Our results provide new insights on the evolution...

  4. Promoting Intercultural Competencies

    Energy Technology Data Exchange (ETDEWEB)

    Bachner, Katherine M., E-mail: kbachner@bnl.gov [Brookhaven National Laboratory (United States)

    2014-07-01

    What is culture? • Culture is the acquired knowledge people use to interpret experience and generate behavior. • It is the way of life a people pass down from one generation to the next through learning. • It is the rules for living and functioning in society that come from growing up in a specific society, and it is a set of acquired skills, habits and society-specific training that gives a group of people its identity. What is intercultural competency? • Cultures can have widely varying perspectives. • These perspectives influence the way that a person develops relationships, responds to situations, and operates in a professional setting. • Intercultural competency is the ability to comprehend and navigate the ways that culture can influence behavior, relationships, and the results of collaboration and interaction. What does becoming interculturally competent entail? • Intercultural preparedness is not merely travelling, learning a foreign language, or being exposed to other cultures. • Developing competency requires thinking about the challenges posed to our work by a multi-cultural workforce in a way that prepares employees and staff for potential incidents or misunderstandings. • It is impossible to avoid all intercultural misunderstandings, but learning to anticipate them and deal with them is key to developing any training program on culture.

  5. Promoting Intercultural Competencies

    International Nuclear Information System (INIS)

    Bachner, Katherine M.

    2014-01-01

    What is culture? • Culture is the acquired knowledge people use to interpret experience and generate behavior. • It is the way of life a people pass down from one generation to the next through learning. • It is the rules for living and functioning in society that come from growing up in a specific society, and it is a set of acquired skills, habits and society-specific training that gives a group of people its identity. What is intercultural competency? • Cultures can have widely varying perspectives. • These perspectives influence the way that a person develops relationships, responds to situations, and operates in a professional setting. • Intercultural competency is the ability to comprehend and navigate the ways that culture can influence behavior, relationships, and the results of collaboration and interaction. What does becoming interculturally competent entail? • Intercultural preparedness is not merely travelling, learning a foreign language, or being exposed to other cultures. • Developing competency requires thinking about the challenges posed to our work by a multi-cultural workforce in a way that prepares employees and staff for potential incidents or misunderstandings. • It is impossible to avoid all intercultural misunderstandings, but learning to anticipate them and deal with them is key to developing any training program on culture

  6. Competence preservation through education

    International Nuclear Information System (INIS)

    Ham, U.; Koessler, M.

    2013-01-01

    For fulfilling their tasks GNS depends on personnel with specific knowledge and competence. GNS answers to these challenges by various measures for education and training in order to have skilled personnel available nowadays and in the future. By these measures and the internal organisation regarding responsibilities in radiation protection requirements resulting from the expected Euratom Basic Safety Standards (BSS) are met. (orig.)

  7. Intercultural competence @ SMEs

    NARCIS (Netherlands)

    van der Poel, Marcel H.

    2015-01-01

    The experiences with intercultural competence training at the Hanze International Business School Groningen may serve as a blueprint for augmenting professional intercultural behaviour at the SME work floor. The set-up of the training is based on current intercultural communication theory and

  8. Nursing Informatics Competency Program

    Science.gov (United States)

    Dunn, Kristina

    2017-01-01

    Currently, C Hospital lacks a standardized nursing informatics competency program to validate nurses' skills and knowledge in using electronic medical records (EMRs). At the study locale, the organization is about to embark on the implementation of a new, more comprehensive EMR system. All departments will be required to use the new EMR, unlike…

  9. Assessment Mathematics Teacher's Competencies

    Science.gov (United States)

    Alnoor, A. G.; Yuanxiang, Guo; Abudhuim, F. S.

    2007-01-01

    This paper aimed to identifying the professional efficiencies for the intermediate schools mathematics teachers and tries to know at what level the math teachers experience those competencies. The researcher used a descriptive research approach, the study data collected from specialist educators and teacher's experts and previous studies to…

  10. Adult educators' core competences

    Science.gov (United States)

    Wahlgren, Bjarne

    2016-06-01

    Which competences do professional adult educators need? This research note discusses the topic from a comparative perspective, finding that adult educators' required competences are wide-ranging, heterogeneous and complex. They are subject to context in terms of national and cultural environment as well as the kind of adult education concerned (e.g. basic education, work-related education etc.). However, it seems that it is possible to identify certain competence requirements which transcend national, cultural and functional boundaries. This research note summarises these common or "core" requirements, organising them into four thematic subcategories: (1) communicating subject knowledge; (2) taking students' prior learning into account; (3) supporting a learning environment; and (4) the adult educator's reflection on his or her own performance. At the end of his analysis of different competence profiles, the author notes that adult educators' ability to train adult learners in a way which then enables them to apply and use what they have learned in practice (thus performing knowledge transfer) still seems to be overlooked.

  11. Skills and Competencies

    Directory of Open Access Journals (Sweden)

    Nasios Orinos

    2013-07-01

    Full Text Available This article presents the results of a study aimed to investigate the requirements of the business sector in light of the skills and competencies students should have in order to be recruited. In this fashion, the study intended to measure the importance of the skills and competencies sought by the business world, revealing ways through which students can develop such skills. This project portrayed that, some of the required classes will certainly give students a strong theoretical background but they will neither completely prepare this student with all possible skills or competencies nor provide the student with any practical experience that will enable him/her to be more competitive when entering the business market. In some classes, however, like Public Speaking, which is designed to teach presentation skills, successful students are able to build good communication and interpersonal skills. Additionally, an English writing class will certainly attempt to provide them with strong writing skills, and a business class will possibly demand reading skills. Moreover, a calculus and a statistics class will provide basic arithmetic/mathematical skills. However, through this project it is proven that all of these classes will neglect the indoctrination of creative thinking in students, or make students believe in their own self-worth (self-esteem skills; the courses will also fail to develop the sense of urgency, drive and determination that students should possess not just to compete but also to survive in a business world.

  12. [Children and motor competence].

    Science.gov (United States)

    Sigmundsson, H; Haga, M

    2000-10-20

    Recently, the topic of motor competence has figured prominently in the media. The claims made are many, but the research that support the statements is seldom cited. The aim of this review article is to address that deficiency by documenting what is really known about the motor competence of children. Motor competence not only allows children to carry out everyday practical tasks, but it is also an important determinant of their level of self-esteem and of their popularity and status in their peer group. While many studies have shown a significant correlation between motor problems and other problems in the social sphere, it has been difficult to establish causal relationships with any degree of confidence, as there appear to be several interactions which need to be taken into account. Research has shown that 6-10% of Norwegian children in the 7 to 10 year age group have a motor competence well below the norm. It is unusual for motor problems to simply disappear over time. In the absence of intervention the syndrome is likely to continue to manifest itself. More recent research points to some of the circularity in this causal network, children with motor problems having been shown to be less physically active than their peers. In a larger health perspective this in itself can have very serious consequences for the child.

  13. Competing Auctions of Skills

    DEFF Research Database (Denmark)

    Kennes, John; le Maire, Christian Daniel

    The model of competing sellers McAfee (1993) is applied to a labor market environment with heterogeneous workers, who differ by outside option and skill type, and heterogeneous firms, who differ by the amount of output produced when matched to each possible worker tyoe. We derive both a static...

  14. Competencies in the Heartland

    Science.gov (United States)

    Cejda, Brent

    2012-01-01

    Although many of the issues facing community colleges are similar, rural community colleges face additional leadership challenges due to limited resources, geographic isolation, and static economies. This chapter focuses on the impact of location on the interpretation and development of the leadership competencies. The chapter concludes with…

  15. Teacher Educator Technology Competencies

    Science.gov (United States)

    Foulger, Teresa S.; Graziano, Kevin J.; Schmidt-Crawford, Denise A.; Slykhuis, David A.

    2017-01-01

    The U.S. National Educational Technology Plan recommends the need to have a common set of technology competencies specifically for teacher educators who prepare teacher candidates to teach with technology (U.S. Department of Education, Office of Educational Technology, 2017). This study facilitated the co-creation of the Teacher Educator…

  16. Competencies, skills and assessment

    DEFF Research Database (Denmark)

    Højgaard, Tomas

    2009-01-01

    This paper is an analysis of the challenge of assessing student learning and how that is affected by using descriptions of competencies as a core element when describing the aims of the learning process. Assessment is modelled as a three step process; characterising, identifying and judging, to a...

  17. Comparison of Health Outcomes Among Children with Different Levels of Motor Competence

    Directory of Open Access Journals (Sweden)

    Chagas Daniel V.

    2017-06-01

    Full Text Available Purpose. While evidence suggests that children with the developmental coordination disorder (DCD have worse health outcomes than their typically developing peers, it remains unclear whether children with low motor competence but without DCD are also characterized by worse health outcomes than those with average motor competence. The main purpose of this study was to compare health outcomes between children with low motor competence without DCD and those with average motor competence.

  18. Genetic and physiological characterization of two clusters of quantitative trait Loci associated with seed dormancy and plant height in rice.

    Science.gov (United States)

    Ye, Heng; Beighley, Donn H; Feng, Jiuhuan; Gu, Xing-You

    2013-02-01

    Seed dormancy and plant height have been well-studied in plant genetics, but their relatedness and shared regulatory mechanisms in natural variants remain unclear. The introgression of chromosomal segments from weedy into cultivated rice (Oryza sativa) prompted the detection of two clusters (qSD1-2/qPH1 and qSD7-2/qPH7) of quantitative trait loci both associated with seed dormancy and plant height. Together, these two clusters accounted for >96% of the variances for plant height and ~71% of the variances for germination rate in an isogenic background across two environments. On the initial introgression segments, qSD1-2/qPH1 was dissected genetically from OsVp1 for vivipary and qSD7-2/qPH7 separated from Sdr4 for seed dormancy. The narrowed qSD1-2/qPH1 region encompasses the semidwarf1 (sd1) locus for gibberellin (GA) biosynthesis. The qSD1-2/qPH1 allele from the cultivar reduced germination and stem elongation and the mutant effects were recovered by exogenous GA, suggesting that sd1 is a candidate gene of the cluster. In contrast, the effect-reducing allele at qSD7-2/qPH7 was derived from the weedy line; this allele was GA-insensitive and blocked GA responses of qSD1-2/qPH1, including the transcription of a GA-inducible α-amylase gene in imbibed endosperm, suggesting that qSD7-2/qPH7 may work downstream from qSD1-2/qPH1 in GA signaling. Thus, this research established the seed dormancy-plant height association that is likely mediated by GA biosynthesis and signaling pathways in natural populations. The detected association contributed to weed mimicry for the plant stature in the agro-ecosystem dominated by semidwarf cultivars and revealed the potential benefit of semidwarf genes in resistance to preharvest sprouting.

  19. Verde plant bug (Hemiptera: Miridae) feeding injury to cotton bolls characterized by boll age, size, and damage ratings.

    Science.gov (United States)

    Armstrong, J Scott; Brewer, Michael J; Parker, Roy D; Adamczyk, J J

    2013-02-01

    The verde plant bug, Creontiades signatus (Distant), has been present in south Texas for several years but has more recently been documented as an economic threat to cultivated cotton, (Gossypium hirsutum L. Our studies over 2 yr (2009 and 2010) and two locations (Weslaco and Corpus Christi, TX) investigated feeding-injury of the verde plant bug to a range of cotton boll age classes defined by boll diameter and accumulated degree-days (anthesis to the time of infesting) for first-position cotton bolls infested with the plant bugs. The most detrimental damage to younger cotton holls from verde plant bug feeding was boll abscission. Cotton bolls verde plant bug injured bolls compared with the controls up to 162 ACDD or a mean boll diameter 2.0 cm. Cotton seed weights were significantly reduced up to 179 ACDD or a boll diameter of 2.0 cm at Weslaco in 2009, and up to 317 ACDD or boll diameter 2.6 cm for Weslaco in 2010 when compared with the noninfested controls. Lint weight per cotton boll for infested and noninfested bolls was significantly reduced up to 262 ACDD or boll diameter 2.5 for Corpus Christi in 2010 and up to 288 ACCD or boll diameter 2.6 cm for Weslaco, TX, in 2010. Damage ratings (dependant variable) regressed against infested and noninfested seed-cotton weights showed that in every instance, the infested cotton bolls had a strong and significant relationship with damage ratings for all age classes of bolls. Damage ratings for the infested cotton bolls that did not abscise by harvest showed visual signs of verde plant bug feeding injury and the subsequent development ofboll rot; however, these two forms of injury causing lint and seed mass loss are hard to differentiate from open or boll-locked cotton bolls. Based on the results of both lint and seed loss over 2 yr and four studies cotton bolls should be protected up to approximately 300 ACDD or a boll diameter of 2.5 cm. This equilibrates to bolls that are 12-14 d of age dependent upon daily maximum

  20. Traditional Mediterranean plants: characterization and use of an essential oils mixture to treat Malassezia otitis externa in atopic dogs.

    Science.gov (United States)

    Nardoni, Simona; Pistelli, Luisa; Baronti, Ilenia; Najar, Basma; Pisseri, Francesca; Bandeira Reidel, Rose Vanessa; Papini, Roberto; Perrucci, Stefania; Mancianti, Francesca

    2017-08-01

    Several plants extracts from Mediterranean countries are traditionally employed in skin troubles both in humans and in animals. Malassezia pachydermatis is a lipophylic yeast responsible for otitis externa and dermatitis in dogs and for cutaneous and systemic disease in humans. Five mixtures of essential oils obtained from Mediterranean plants (Citrus paradisi, Salvia sclarea, Ocimum basilicum, Rosmarinus officinalis, Citrus limon, Anthemis nobilis, Lavandula hybrida and Thymus vulgaris) provided with antifungal and/or anti-inflammatory action assayed in vitro, were tested in vivo versus M. pachydermatis to treat once daily for 2 weeks 25 atopic dogs with Malassezia otitis externa. Mixture composed by C. limon 1%, S. sclarea 0,5%, R. officinalis 1%, A. nobilis 0,5% yielded excellent results in all treated dogs. Despite of clinical resolution after all treatments the number of blastospores did not decrease. This study confirms recent findings suggesting a multifactorial alternative approach for the management of canine Malassezia otitis.

  1. MECHANICAL CHARACTERIZATION AND SHRINKAGE OF Sclerolobium paniculatum Vogel WOOD IN A HOMOGENEOUS PLANTING UNDER DIFFERENT LEVELS OF FERTILIZATION

    Directory of Open Access Journals (Sweden)

    Joselito Bonifácio Oliveira

    2010-08-01

    Full Text Available The purposa of this work was to study the influence of fertilization on wood quality of Sclerolobium paniculatum Vogel. A homogeneous planting trial, under different levels of liming and phosphorus, was established by Embrapa-Cerrados 18 years ago in Planaltina, Distrito Federal, Brazil, tropical wood savanna region. Mechanical tests conducted were static bending, parallel compression to grain, shear strength and shrinkage. No significant differences were observed for mechanical properties or for shrinkage, which presented: ¦b = 650kg/cm2, E = 59.877kg/cm2, ¦c = 296kg/cm2 e ¦n = 131kg/cm2. Control treatment showed highest values for shear strength and compression parallel to grain. Too many branches in all trees and also too many knots in lumber were observed. Pruning is recommended for homogeneous planting of Sclerolobium paniculatum to avoid knots in order to be produced wood of superior quality.

  2. I. Identification and characterization of dasheen mosaic virus in Chinese evergreen plants (Aglaonema commutatum) in California. II. New approaches for detecting plant viruses

    International Nuclear Information System (INIS)

    Kositratana, W.

    1985-01-01

    Chinese evergreen plants (Aglaonema commutatum) with symptoms of mild stunting, chlorosis, leaf distortion and mosaic, were observed in Southern California. Flexuous rods (ca. 750 nm) were detected in leaf dip and partially purified preparations. Dasheen mosac virus (DMV) was identified as the causal agent on the basis of host range, morphology and reaction with DMV antiserum in immunodouble diffusion and immunosorbent electron microscopy (ISEM) tests. Tetragonia expansa was found to be a new host of this virus. Surveys indicate that DMV is not widespread in cultivars of A. commutatum in Southern California. The virus was purified from leaves of seedling Philodendron selloum by clarification with CCl 4 , CHCl 3 , and Triton X-100, precipitation with PEG-8000 and centrifugation in either Cs 2 SO 4 -sucrose cushion gradients or Cs 2 SO 4 equilibrium density gradients. Purified virions formed a single UV-absorbing infectious band with densities of 1.31 and 1.245 g/ml in CsCl 2 and Cs 2 SO 4 equilibrium density gradients, respectively, and a sedimentation coefficient of 154 S as determined by a linear-log sucrose density gradient centrifugation. Dasheen mosaic virus has a plus-sense ssRNA with the M.W. of 3.2 x 10 6 under denaturing conditions. Molecular hybridization analysis using 3 H-complementary DNA specific to DMV-Ca RNA showed that DMV-Ca isolate was more closely related to DMV-Fiji isolate than to DMV-Fla isolate, and was very distantly related to ZYMV, TEV. PeMoC and PVY

  3. Characterization of high temperature superconductor cables for magnet toroidal field coils of the DEMO fusion power plant

    CERN Document Server

    Bayer, Christoph M

    2017-01-01

    Nuclear fusion is a key technology to satisfy the basic demand for electric energy sustainably. The official EUROfusion schedule foresees a first industrial DEMOnstration Fusion Power Plant for 2050. In this work several high temperature superconductor sub-size cables are investigated for their applicability in large scale DEMO toroidal field coils. Main focus lies on the electromechanical stability under the influence of high Lorentz forces at peak magnetic fields of up to 12 T.

  4. Two and three dimensional characterization of Zucchini Yellow Mosaic Virus induced structural alterations in Cucurbita pepo L. plants.

    Science.gov (United States)

    Zellnig, Günther; Pöckl, Michael Herbert; Möstl, Stefan; Zechmann, Bernd

    2014-05-01

    Infection of plants by Zucchini Yellow Mosaic Virus (ZYMV) induces severe ultrastructural changes. The aim of this study was to investigate ultrastructural changes during ZYMV-infection in Cucurbita pepo L. plants on the two and three dimensional (2D and 3D) level and to correlate these changes with the spread of ZYMV throughout the plant by transmission electron microscopy (TEM) and image analysis. This study revealed that after inoculation of the cotyledons ZYMV moved into roots [3 days post inoculation (dpi)], then moved upwards into the stem and apical meristem (5 dpi), then into the first true leaf (7 dpi) and could finally be found in all plant parts (9 dpi). ZYMV-infected cells contained viral inclusion bodies in the form of cylindrical inclusions (CIs). These CIs occurred in four different forms throughout the cytosol of roots and leaves: scrolls and pinwheels when cut transversely and long tubular structures and bundles of filaments when cut longitudinally. 3D reconstruction of ZYMV-infected cells containing scrolls revealed that they form long tubes throughout the cytosol. The majority has a preferred orientation and an average length and width of 3 μm and 120 nm, respectively. Image analysis revealed an increased size of cells and vacuoles (107% and 447%, respectively) in younger ZYMV-infected leaves leading to a similar ratio of cytoplasm to vacuole (about 1:1) in older and younger ZYMV-infected leaves which indicates advanced cell growth in younger tissues. The collected data advances the current knowledge about ZYMV-induced ultrastructural changes in Cucurbita pepo. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  6. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  7. Characterization of high temperature superconductor cables for magnet toroidal field coils of the DEMO fusion power plant

    Energy Technology Data Exchange (ETDEWEB)

    Bayer, Christoph M.

    2017-05-01

    Nuclear fusion is a key technology to satisfy the basic demand for electric energy sustainably. The official EUROfusion schedule foresees a first industrial DEMOnstration Fusion Power Plant for 2050. In this work several high temperature superconductor sub-size cables are investigated for their applicability in large scale DEMO toroidal field coils. Main focus lies on the electromechanical stability under the influence of high Lorentz forces at peak magnetic fields of up to 12 T.

  8. Nutritional Value and Bioactive Compounds Characterization of Plant Parts From Cynara cardunculus L. (Asteraceae Cultivated in Central Greece

    Directory of Open Access Journals (Sweden)

    Spyridon A. Petropoulos

    2018-04-01

    Full Text Available In the present study, the nutritional value of the edible parts (immature capitula of cardoon plants was evaluated, while further analyses were carried out in order to assess antioxidant properties and phenolic compounds composition of the various plant parts and seed oils. Cardoon capitula (heads were a rich source of carbohydrates, with the main detected free sugar being sucrose, as well as of macro- and micro-minerals (K, Ca, Mg, and Fe. Heads were also abundant in saturated fatty acids (palmitic, behenic, linoleic, stearic, caproic, and oleic acid, whereas seed oils in unsaturated fatty acids (linoleic, oleic, palmitic, and stearic acid. Total phenolic compounds (TPC content and phenolics composition differed between the various plant parts, with heads and leaf blades having higher TPC than midribs and petioles. Moreover, heads and leaf midribs and petioles consisted mainly of phenolic acids (5-O-caffeoylquinic and 3,5-O-dicaffeoylquinic acid, with flavonoids being detected in lower amounts. In contrast, the composition of polyphenols in leaf blades consisted mostly of flavonoids (Luteolin-7-O-glucoside and luteolin-7-O-malonylhexoside, whereas phenolic acids were also detected in considerable amounts (5-O-feruloylquinic and 3-O-caffeoylquinic acid. Regarding antioxidant properties, leaf blades and seeds exhibited the highest potency for all the tested assays which could be partly attributed to the synergistic effects of the phenolic compounds present in each sample. In conclusion, cardoon plant parts may find various uses in the food and pharmaceutical industry, since they contain considerable amounts of bioactive molecules, while seed oils can be considered as alternative vegetable oils for human consumption.

  9. Critical Analysis on Characterization, Systemic Effect, and Therapeutic Potential of Beta-Sitosterol: A Plant-Derived Orphan Phytosterol

    Directory of Open Access Journals (Sweden)

    Muhammad Shahdaat Bin Sayeed

    2016-11-01

    Full Text Available Beta-sitosterol (BS is a phytosterol, widely distributed throughout the plant kingdom and known to be involved in the stabilization of cell membranes. To compile the sources, physical and chemical properties, spectral and chromatographic analytical methods, synthesis, systemic effects, pharmacokinetics, therapeutic potentials, toxicity, drug delivery and finally, to suggest future research with BS, classical as well as on-line literature were studied. Classical literature includes classical books on ethnomedicine and phytochemistry, and the electronic search included Pubmed, SciFinder, Scopus, the Web of Science, Google Scholar, and others. BS could be obtained from different plants, but the total biosynthetic pathway, as well as its exact physiological and structural function in plants, have not been fully understood. Different pharmacological effects have been studied, but most of the mechanisms of action have not been studied in detail. Clinical trials with BS have shown beneficial effects in different diseases, but long-term study results are not available. These have contributed to its current status as an “orphan phytosterol”. Therefore, extensive research regarding its effect at cellular and molecular level in humans as well as addressing the claims made by commercial manufacturers such as the cholesterol lowering ability, immunological activity etc. are highly recommended.

  10. High resolution UHPLC-MS characterization and isolation of main compounds from the antioxidant medicinal plant Parastrephia lucida (Meyen

    Directory of Open Access Journals (Sweden)

    Carlos Echiburu-Chau

    2017-11-01

    Full Text Available High-resolution mass spectrometry is currently used to determine the mass of biologically active compounds in medicinal plants and food and UHPLC-Orbitrap is a relatively new technology that allows fast fingerprinting and metabolomics analysis. Forty-two metabolites including several phenolic acids, flavonoids, coumarines, tremetones and ent-clerodane diterpenes were accurately identified for the first time in the resin of the medicinal plant Parastrephia lucida (Asteraceae a Chilean native species, commonly called umatola, collected in the pre-cordillera and altiplano regions of northern Chile, by means of UHPLC-PDA-HR-MS. This could be possible by the state of the art technology employed, which allowed well resolved total ion current peaks and the proposal of some biosynthetic relationships between the compounds detected. Some mayor compounds were also isolated using HSCCC. The ethanolic extract showed high total polyphenols content and significant antioxidant capacity. Furthermore, several biological assays were performed that determined the high antioxidant capacity found for the mayor compound isolated from the plant, 11- p-coumaroyloxyltremetone.

  11. Probabilistic Seismic Hazard Characterization and Design Parameters for the Sites of the Nuclear Power Plants of Ukraine

    International Nuclear Information System (INIS)

    Savy, J.B.; Foxall, W.

    2000-01-01

    The U.S. Department of Energy (US DOE), under the auspices of the International Nuclear Safety Program (INSP) is supporting in-depth safety assessments (ISA) of nuclear power plants in Eastern Europe and the former Soviet Union for the purpose of evaluating the safety and upgrades necessary to the stock of nuclear power plants in Ukraine. For this purpose the Hazards Mitigation Center at Lawrence Livermore National Laboratory (LLNL) has been asked to assess the seismic hazard and design parameters at the sites of the nuclear power plants in Ukraine. The probabilistic seismic hazard (PSH) estimates were updated using the latest available data and knowledge from LLNL, the U.S. Geological Survey, and other relevant recent studies from several consulting companies. Special attention was given to account for the local seismicity, the deep focused earthquakes of the Vrancea zone, in Romania, the region around Crimea and for the system of potentially active faults associated with the Pripyat Dniepro Donnetts rift. Aleatory (random) uncertainty was estimated from the available data and the epistemic (knowledge) uncertainty was estimated by considering the existing models in the literature and the interpretations of a small group of experts elicited during a workshop conducted in Kiev, Ukraine, on February 2-4, 1999

  12. Characterization of viruses associated with garlic plants propagated from different reproductive tissues from Italy and other geographic regions

    Directory of Open Access Journals (Sweden)

    Leonardo PARRANO

    2013-01-01

    Full Text Available Garlic is an important crop cultivated worldwide and several different viruses have been associated with propagative material. Garlic is propagated from bulbs and/or from vegetative topsets of the inflorescences known as bulbils. The effects of the geographic origin and the type of the propagative material on the phylogenetic relationships and genetic variability of the coat protein genes of four allium viruses are presented here. Onion yellow dwarf virus (OYDV, Leek yellow stripe virus (LYSV, Garlic virus X (GVX, and Garlic common latent virus (GCLV were detected in single and mixed infections in plants grown either from bulbils and/or bulbs originating from Italy, China, Argentina, and the U.S.A. OYDV and LYSV fell into five and three well supported clades respectively whereas isolates of GVX and GCLV all clustered into one well-supported clade each. Some of the OYDV and LYSV clades presented evidence of host tissue selection while some phylogenetic structuring based on the geographic origin or host was also observed for some virus clades. Unique haplotypes and novel coat protein amino acid sequence patterns were identified for all viruses. An OYDV coat protein amino acid signature unique to Chenopodium quinoa, an uncommon host of the virus, was of particular interest. The type of propagative material affected the population dynamics of all of the viruses. The virus populations in plants propagated from bulbs were more diverse than in plants propagated from bulbils.

  13. Characterization of epiphytic bacterial communities from grapes, leaves, bark and soil of grapevine plants grown, and their relations.

    Directory of Open Access Journals (Sweden)

    Guilherme Martins

    Full Text Available Despite its importance in plant health and crop quality, the diversity of epiphytic bacteria on grape berries and other plant parts, like leaves and bark, remains poorly described, as does the role of telluric bacteria in plant colonization. In this study, we compare the bacterial community size and structure in vineyard soils, as well as on grapevine bark, leaves and berries. Analyses of culturable bacteria revealed differences in the size and structure of the populations in each ecosystem. The highest bacteria population counts and the greatest diversity of genera were found in soil samples, followed by bark, grapes and leaves. The identification of isolates revealed that some genera - Pseudomonas, Curtobacterium, and Bacillus - were present in all ecosystems, but in different amounts, while others were ecosystem-specific. About 50% of the genera were common to soil and bark, but absent from leaves and grapes. The opposite was also observed: grape and leaf samples presented 50% of genera in common that were absent from trunk and soil. The bacterial community structure analyzed by T-RFLP indicated similarities between the profiles of leaves and grapes, on the one hand, and bark and soil, on the other, reflecting the number of shared T-RFs. The results suggest an interaction between telluric bacterial communities and the epiphytic bacteria present on the different grapevine parts.

  14. An application of safer for the Upper East Fork Poplar Creek characterization area at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    International Nuclear Information System (INIS)

    Lutz, C.T.; Provost, C.A.

    1996-01-01

    The Streamlined Approach for Environmental Restoration (SAFER) has been applied at the US Department of Energy's Y-12 Plant in Oak Ridge, Tennessee. The Y-12 Plant is an operationally and hydrogeologically complex area located within the watershed of Upper East Fork Poplar Creek (UEFPC). The plant has been in operation since 1943 and nearly 175 potentially contaminated sites resulting from past waste management practices have been identified. The need to complete Remedial Investigations (RIs) for the sites in a timely and cost-effective manner has resulted in an approach that considers the entire watershed of UEFPC, which has been designated a open-quotes Characterization Areaclose quotes (CA). This approach emphasizes the watershed rather than individual sites, focuses on key questions and issues, and maximizes the use of existing data. The goal of this approach is to focus work toward the resolution of key questions and decisions necessary to complete the remediation of the CA. An evaluation of the potentially contaminated sites, the development of key questions, and the compilation and analysis of existing data are progressing. A SAFER workshop will be held in 1996, which will allow the project team and stakeholders to discuss the status of the RI, identify additional key questions and issues, and determine the activities necessary to complete the RI. This investigation demonstrates an approach to streamlining the RI process that could be applied successfully to other complex sites

  15. Isolation and characterization of a cDNA encoding phytochrome A in the non-photosynthetic parasitic plant, Orobanche minor Sm.

    Science.gov (United States)

    Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

    2005-01-01

    In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.

  16. The Interrelations between Competences for Sustainable Development and Research Competences

    Science.gov (United States)

    Lambrechts, Wim; Van Petegem, Peter

    2016-01-01

    Purpose: The purpose of this paper is to explore how competences for sustainable development and research interrelate within a context of competence-based higher education. Specific focus is oriented towards strengthening research competences for sustainability. Design/methodology/approach: Following a hermeneutic-interpretive methodology, this…

  17. Competency Analytics Tool: Analyzing Curriculum Using Course Competencies

    Science.gov (United States)

    Gottipati, Swapna; Shankararaman, Venky

    2018-01-01

    The applications of learning outcomes and competency frameworks have brought better clarity to engineering programs in many universities. Several frameworks have been proposed to integrate outcomes and competencies into course design, delivery and assessment. However, in many cases, competencies are course-specific and their overall impact on the…

  18. Functional characterization of AGAMOUS-subfamily members from cotton during reproductive development and in response to plant hormones.

    Science.gov (United States)

    de Moura, Stéfanie Menezes; Artico, Sinara; Lima, Cássio; Nardeli, Sarah Muniz; Berbel, Ana; Oliveira-Neto, Osmundo Brilhante; Grossi-de-Sá, Maria Fátima; Ferrándiz, Cristina; Madueño, Francisco; Alves-Ferreira, Márcio

    2017-03-01

    Expression analysis of the AG -subfamily members from G. hirsutum during flower and fruit development. Reproductive development in cotton, including the fruit and fiber formation, is a complex process; it involves the coordinated action of gene expression regulators, and it is highly influenced by plant hormones. Several studies have reported the identification and expression of the transcription factor family MADS-box members in cotton ovules and fibers; however, their roles are still elusive during the reproductive development in cotton. In this study, we evaluated the expression profiles of five MADS-box genes (GhMADS3, GhMADS4, GhMADS5, GhMADS6 and GhMADS7) belonging to the AGAMOUS-subfamily in Gossypium hirsutum. Phylogenetic and protein sequence analyses were performed using diploid (G. arboreum, G. raimondii) and tetraploid (G. barbadense, G. hirsutum) cotton genomes, as well as the AG-subfamily members from Arabidopsis thaliana, Petunia hybrida and Antirrhinum majus. qPCR analysis showed that the AG-subfamily genes had high expression during flower and fruit development in G. hirsutum. In situ hybridization analysis also substantiates the involvement of AG-subfamily members on reproductive tissues of G. hirsutum, including ovule and ovary. The effect of plant hormones on AG-subfamily genes expression was verified in cotton fruits treated with gibberellin, auxin and brassinosteroid. All the genes were significantly regulated in response to auxin, whereas only GhMADS3, GhMADS4 and GhMADS7 genes were also regulated by brassinosteroid treatment. In addition, we have investigated the GhMADS3 and GhMADS4 overexpression effects in Arabidopsis plants. Interestingly, the transgenic plants from both cotton AG-like genes in Arabidopsis significantly altered the fruit size compared to the control plants. This alteration suggests that cotton AG-like genes might act regulating fruit formation. Our results demonstrate that members of the AG-subfamily in G. hirsutum

  19. Supplement analysis of transuranic waste characterization and repackaging activities at the Idaho National Engineering Laboratory in support of the Waste Isolation Pilot Plant test program

    International Nuclear Information System (INIS)

    1991-03-01

    This supplement analysis has been prepared to describe new information relevant to waste retrieval, handling, and characterization at the Idaho National Engineering Laboratory (INEL) and to evaluate the need for additional documentation to satisfy the National Environmental Policy Act (NEPA). The INEL proposes to characterize and repackage contact-handled transuranic waste to support the Waste Isolation Pilot Plant (WIPP) Test Phase. Waste retrieval, handling and processing activities in support of test phase activities at the WIPP were addressed in the Supplemental Environmental Impact Statement (SEIS) for the WIPP. To ensure that test-phase wastes are properly characterized and packaged, waste containers would be retrieved, nondestructively examined, and transported from the Radioactive Waste Management Complex (RWMC) to the Hot-Fuel Examination Facility for headspace gas analysis, visual inspections to verify content code, and waste acceptance criteria compliance, then repackaging into WIPP experimental test bins or returned to drums. Following repackaging the characterized wastes would be returned to the RWMC. Waste characterization would help DOE determine WIPP compliance with US Environmental Protection Agency regulations governing disposal of transuranic waste and hazardous waste. Additionally, this program supports onsite compliance with Resource Conservation and Recovery Act (RCRA) requirements, compliance with the terms of the No-Migration Variance at WIPP, and provides data to support future waste shipments to WIPP. This analysis will help DOE determine whether there have been substantial changes made to the proposed action at the INEL, or if preparation of a supplement to the WIPP Final Environmental Impact Statement (DOE, 1980) and SEIS (DOE, 1990a) is required. This analysis is based on current information and includes details not available to the SEIS

  20. International collaboration for nuclear competence building

    International Nuclear Information System (INIS)

    Haapalehto, T.; Storey, P.

    2004-01-01

    The life cycle of the nuclear industry is no different to that of any other industry, indeed to most forms of human activity: birth, growth, maturity, decline, rebirth and renewal or death. As a result of the twin facets of long time scales and essential technical competence the industry now faces two problems: how to retain existing skills and competences for the 50 plus years that a plant is operating and how to develop and retain new skills and competences in the areas of decommissioning and radioactive waste management. Different countries are at different stages of the nuclear technology life cycle, a competence that may have declined or be lost in one country may be strong in another. And therein lies one solution to the problems the sector faces - international collaboration. The initiatives such as the NEA Halden project and the Generation IV International Forum lay a ground for quiet optimism that collaboration, information exchange and exchange of personnel continue to be an integral part of the development of nuclear power. Also there is evidence that myriad initiatives are underway in the area of nuclear education and training. Though, national surveys show that still more engineers and scientists having nuclear knowledge are required than are graduating. (author)

  1. Characterization of the snowy cotyledon 1 mutant of Arabidopsis thaliana: the impact of chloroplast elongation factor G on chloroplast development and plant vitality.

    Science.gov (United States)

    Albrecht, Verónica; Ingenfeld, Anke; Apel, Klaus

    2006-03-01

    During seedling development chloroplast formation marks the transition from heterotrophic to autotrophic growth. The development and activity of chloroplasts may differ in cotyledons that initially serve as a storage organ and true leaves whose primary function is photosynthesis. A genetic screen was used for the identification of genes that affect selectively chloroplast function in cotyledons of Arabidopsis thaliana. Several mutants exhibiting pale cotyledons and green true leaves were isolated and dubbed snowy cotyledon (sco). One of the mutants, sco1, was characterized in more detail. The mutated gene was identified using map-based cloning. The mutant contains a point mutation in a gene encoding the chloroplast elongation factor G, leading to an amino acid exchange within the predicted 70S ribosome-binding domain. The mutation results in a delay in the onset of germination. At this early developmental stage embryos still contain undifferentiated proplastids, whose proper function seems necessary for seed germination. In light-grown sco1 seedlings the greening of cotyledons is severely impaired, whereas the following true leaves develop normally as in wild-type plants. Despite this apparent similarity of chloroplast development in true leaves of mutant and wild-type plants various aspects of mature plant development are also affected by the sco1 mutation such as the onset of flowering, the growth rate, and seed production. The onset of senescence in the mutant and the wild-type plants occurs, however, at the same time, suggesting that in the mutant this particular developmental step does not seem to suffer from reduced protein translation efficiency in chloroplasts.

  2. Summary of site-characterization studies conducted from 1983 through 1987 at the Waste Isolation Pilot Plant (WIPP) site, southeastern New Mexico

    International Nuclear Information System (INIS)

    Lappin, A.R.

    1988-01-01

    The Waste Isolation Pilot Plant (WIPP) is being excavated at a depth of approximately 655 m in bedded halites. Site-characterization activities at the WIPP site began in 1976. Characterization activities since 1983 have had the objective of updating the conceptual model for the geologic and hydrologic behavior of the WIPP site and vicinity. This paper discusses aspects of the general conceptual model significant to both site characterization and performance assessment. The geological and hydrologic behavior of the WIPP site and vicinity is transient, and has been transient since at least deposition of the Permian Salado Formation containing the underground workings of the WIPP facility. The Salado Formation deforms regionally in response to gravity, but is very low in permeability, except within approximately two meters of the WIPP facility. The Culebra Dolomite Member of the Rustler Formation dominates the hydrology at the WIPP site. Hydrologic measurements, geologic studies, major-element and minor-element distributions in Culebra fluids, and the results of isotopic studies (stable-isotope, radiocarbon, uranium-disequilibrium, and 87 Sr/ 86 Sr) are consistent with the interpretations that, although the Culebra dominates flow within the Rustler at the WIPP site and Rustler karst is not present, there has been limited vertical fluid movement within the Rustler and between the Rustler and the overlying Dewey Lake Red Beds

  3. Design-Basis Flood Estimation for Site Characterization at Nuclear Power Plants in the United States of America

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, Rajiv; Hibler, Lyle F.; Coleman, Andre M.; Ward, Duane L.

    2011-11-01

    The purpose of this document is to describe approaches and methods for estimation of the design-basis flood at nuclear power plant sites. Chapter 1 defines the design-basis flood and lists the U.S. Nuclear Regulatory Commission's (NRC) regulations that require estimation of the design-basis flood. For comparison, the design-basis flood estimation methods used by other Federal agencies are also described. A brief discussion of the recommendations of the International Atomic Energy Agency for estimation of the design-basis floods in its member States is also included.

  4. Design-Basis Flood Estimation for Site Characterization at Nuclear Power Plants in the United States of America

    International Nuclear Information System (INIS)

    Prasad, Rajiv; Hibler, Lyle F.; Coleman, Andre M.; Ward, Duane L.

    2011-01-01

    The purpose of this document is to describe approaches and methods for estimation of the design-basis flood at nuclear power plant sites. Chapter 1 defines the design-basis flood and lists the U.S. Nuclear Regulatory Commission's (NRC) regulations that require estimation of the design-basis flood. For comparison, the design-basis flood estimation methods used by other Federal agencies are also described. A brief discussion of the recommendations of the International Atomic Energy Agency for estimation of the design-basis floods in its member States is also included.

  5. Characterization of the microbial community structure in ‘Candidatus Liberibacter asiaticus’-infected citrus plants treated with antibiotics

    OpenAIRE

    Zhang, M.; Powell, Charles A.; Chuan, Yu; Duan, Yongping

    2014-01-01

    The updated PhyloChip TM G3 were used to explore the differences in the relative abundance and phylogenetic diversity of the bacterial communities associated with HLB-affected citrus plants in the field over a growing season and those treated with antibiotic combinations of AG (Ampicillin at 1000 mg/L and Gentamicin at 100 mg/L) and PS (Penicillin at 1000 mg/L and Streptomycin at 100 mg/L). Both antibiotic treatments resulted in significantly lower Las bacterial ti...

  6. Characterization of the chlorophyll thermoluminescence afterglow in dark-adapted or far-red-illuminated plant leaves

    International Nuclear Information System (INIS)

    Miranda, T.; Ducruet, J.M.

    1995-01-01

    Far red illumination of photosynthetic material induces a delayed luminescence rise, or afterglow, which has been reported in plant leaves, protoplasts or intact chloroplasts and in algal cells. but does not occur in isolated thylakoids. The rise kinetics is accelerated by increasing temperature and we show, by slowly heating a leaf sample after a far-red illumination, that the afterglow emission can be optimally resolved as a sharp thermoluminescence band. Plant material was mainly pea (Pisum sativum L., cv Kazar and Merveille de Kelvedon) and cucumber (Cucumis sativus L., cv Marketer). Comparisons were done with rape, spinach, tobacco, avocado and maize. A 0.2 degree C-1s to 0.5 degree C-1s temperature gradient, started above 0 degree C after a far red illumination, revealed a new thermoluminescence AG band, peaking between 40 degree C and 50 degree C. It exhibited the characteristic properties of the luminescence afterglow recorded at a constant temperature. The AG band was very sensitive to short incubations at both freezing and moderately warm temperatures. Increasing duration of far red illumination caused two kinetically distinct effects on the AG band and on the B band (S-2S-3 Q-B- recombination), which can be ascribed to different behaviors of proton gradients in stroma and in grana lamellae, respectively. The induction of an afterglow by far red light lasted for several minutes in the dark, at 10 degree C. Flash sequences fired in these conditions confirmed the presence of S-2 and S-3 states stable in the dark, producing luminescence by recombination with back-transferred electrons. In some plant batches, an AG band could be induced by 2 or 3 flashes in the absence of far red light, which demonstrates that a metabolic state leading to AG emission may arise spontaneously in plant leaves. The strong temperature dependence of the AG emission is discussed in terms of heat-induced conformational changes in the thylakoid membrane. We conclude that

  7. Application of TXRF spectrometry and HPLC for the characterization of xylem saps of nickel contaminated cucumber plants grown in urea containing nutrient solutions

    International Nuclear Information System (INIS)

    Tatar, E.; Mihucz, V.G.; Varga, G.; Zaray, G.; Cseh, E.

    2000-01-01

    plants exposed to heavy metal contamination. In addition to the organic acid analysis, the characterization of other organic compounds of the transport routes would be important in order to elucidate their role in the either nutrient or toxic metal transport. (author)

  8. Documentation of Improvement Competences

    DEFF Research Database (Denmark)

    Johansen, Jørn; Back, Karsten Kristensen; Korsaa, Morten

    2017-01-01

    This paper demonstrates how a report used in a Master in Project management and Process improvement training at Roskilde University Denmark can be used to evaluate if a student can pass the ECQA SPI Manager exam. It also demonstrates how the structure of the report addresses all necessary...... Manager job role, which is based on the SPI Manifesto and the ImprovAbilityTM model (part of ISO/IEC 33014 Guideline for Process Improvement) among other types of knowledge and research....... competences, which should or could be brought into play during the project – and therefor also in one way or another addresses the quality of the activated competences in the improvement project – a kind of qualification. The clue is that the structure of the report follows the units and element in the SPI...

  9. Developing Creative Competencies

    DEFF Research Database (Denmark)

    Friis, Silje Alberthe Kamille

    2012-01-01

    This paper offers a theoretical framework for how to think about and understand creativity – and how to work with the development of creative competencies in design education. Most design students experience recurrent, individual challenges in design work, which have to do with their personal......, psychological configuration. The objective of the present research is to provide new insight into the dynamics underlying our individual strengths and challenges, and develop approaches to help design students come full circle in creative work processes. The paper builds on contemporary theory and techniques...... from the field of psychology, as well as research-in-practice with students at the Kolding School of Design and presents the outline of a model for how to work with and facilitate the development of creative competencies. While the research is still in its early phases, response from participants...

  10. WHO NEEDS INTERCULTURAL COMPETENCES?

    Directory of Open Access Journals (Sweden)

    Carmen-Laura ZARZU

    2013-06-01

    Full Text Available The current essay focuses on the need for formal education in the area of intercultural communication and training of intercultural competences. It builds on cultural identity and diversity literature, on the experiment conducted in the Low Countries in introducing a new topic for students from social sciences referring to intercultural communication and on reports and papers of international companies, organizations and agencies. The argument of globalization which should give equal opportunities to each and every world’s citizen adds pressure on managers dealing with multicultural teams. Intercultural competences gain importance in recruiting, while turning cultural diversity in team performance requires skills, knowledge and experience. Managing cultural diversity presupposes that people are aware, recognize, understand and deal with differences. Thus intercultural communication should be studied as a stand-alone topic or imbedded in other subjects in different forms of education or training, so people are prepared for intercultural, social and professional relationships.

  11. Production competence revisited

    DEFF Research Database (Denmark)

    Szász, Levente; Demeter, Krisztina; Boer, Harry

    2015-01-01

    to measure production competence as the two-dimensional operational level construct it actually is, and to use Slack’s (1994) importance performance matrix to study its business level performance effects. The three hypotheses developed are tested using a subsample of the International Manufacturing Strategy...... Survey database, which includes 465 manufacturing companies from 21 countries. Findings – The study offers additional empirical support for production competence theory. Going beyond supporting existing theory, the results give more detailed insight by indicating that low operational performance on even...... one important competitive factor leads to lower business performance (order-losing effect); excessive investment in increasing operational performance on any less important competitive factor does not necessarily lead to higher business performance. Practical implications – Using a large empirical...

  12. FIRST robots compete

    Science.gov (United States)

    2000-01-01

    FIRST teams and their robots work to go through the right motions at the FIRST competition. Students from all over the country are at the KSC Visitor Complex for the FIRST (For Inspiration and Recognition of Science and Technology) Southeast Regional competition March 9-11 in the Rocket Garden. Teams of high school students are testing the limits of their imagination using robots they have designed, with the support of business and engineering professionals and corporate sponsors, to compete in a technological battle against other schools' robots. Of the 30 high school teams competing, 16 are Florida teams co-sponsored by NASA and KSC contractors. Local high schools participating are Astronaut, Bayside, Cocoa Beach, Eau Gallie, Melbourne, Melbourne Central Catholic, Palm Bay, Rockledge, Satellite, and Titusville.

  13. Competence, governance, and entrepreneurship

    DEFF Research Database (Denmark)

    Foss, Nicolai Juul; Mahnke, Volker

    This title illustrates modern economics. Because it informs strategic choices, it is relevant to business administration in general, and for strategic management in particular. Two dominant streams may be identified in the literature, namely the "competence" and "governance" perspectives...... on the firm. While there has been little direct discussion between the main proponents of these perspectives, both claim that they are reaching for a "strategic theory of the firm". Such a theory would not only shed light on the classical questions considered in the theory of the firm (e.g. why firms exist......, what determines their boundaries and internal organization), but would also be helpful for informing strategy issues, such as understanding strategic flexibility, strategic options, and the sources of competitive advantage. This volume brings together prominent voices on competence, governance...

  14. Spiritual Competency Scale: Further Analysis

    Science.gov (United States)

    Dailey, Stephanie F.; Robertson, Linda A.; Gill, Carman S.

    2015-01-01

    This article describes a follow-up analysis of the Spiritual Competency Scale, which initially validated ASERVIC's (Association for Spiritual, Ethical and Religious Values in Counseling) spiritual competencies. The study examined whether the factor structure of the Spiritual Competency Scale would be supported by participants (i.e., ASERVIC…

  15. Quality Assurance Plan for the Upper East Fork Poplar Creek Characterization Area, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    International Nuclear Information System (INIS)

    1996-12-01

    This quality assurance plan summarizes requirements for conducting work on the Upper East 9 Fork Poplar Creek (UEFPC) Characterization Area (CA). The reader is referred to the Expanded Task Work Agreement for Upper East Fork Poplar Creek Characterization Area, Remedial Investigation/Feasibility Study (RI/FS) for details regarding the activities, roles, and responsibilities summarized here. UEFPC is designated a Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) site and thus requires a remedial investigation (RI) and a feasibility study (FS). The RI objectives are to evaluate the nature and extent of known and suspected contaminates, to provide data to perform baseline ecological and human health risk assessments, and to support development and evaluation of remedial alternatives for the FS,. Existing data will be used as much as possible. Additional sampling may be required to fill data gaps. The goal of the RI is to prioritize the major sources of contaminants to exit pathways and to understand their characteristics for risk characterization and development of remedial alternatives. The FS objectives are to investigate technologies and develop and evaluate alternatives based on 2031 CERCLA guidance

  16. Dementia and Legal Competency

    OpenAIRE

    Filaković, Pavo; Petek Erić, Anamarija; Mihanović, Mate; Glavina, Trpimir; Molnar, Sven

    2011-01-01

    The legal competency or capability to exercise rights is level of judgment and decision-making ability needed to manage one's own affairs and to sign official documents. With some exceptions, the person entitles this right in age of majority. It is acquired without legal procedures, however the annulment of legal capacity requires a juristic process. This resolution may not be final and could be revoked thorough the procedure of reverting legal capacity – fully or partially. Given ...

  17. COMPETENCE IN MEDICINE

    OpenAIRE

    Hélio Teixeira MD.

    2005-01-01

    Medical competence is the result of a lifelong evolving process, based on the development of efficiency, experience and ethical principles. Efficiency in medical practice depends on scientific knowledge, technical abilities and communication skills. Experience is a process of personal refinement, breeding knowledge and wisdom. Finally, medical ethics is founded on the quest for justice, compassion and love. Didactically, we can distinguish three phases in the professional evolution of a physi...

  18. Dissociative State and Competence

    Directory of Open Access Journals (Sweden)

    Yu-Ju Lin

    2007-10-01

    Full Text Available This report presents the results of forensic evaluation of the civil competence of a case of alleged dissociative identity disorder (DID and discusses whether such dissociative states substantially jeopardize civil competence. A 40-year-old woman claimed that she had had many personalities since her college days. From the age of 37 to 40, she shopped excessively, which left her with millions of dollars of debt. She ascribed her shopping to a certain identity state, over which she had no control. (In this article, we use the term identity state to replace personality as an objective description of a mental state. She thus raised the petition of civil incompetence. During the forensic evaluation, it was found that the identity states were relatively stable and mutually aware of each other. The switch into another identity state was sometimes under voluntary control. The subject showed consistency and continuity in behavioral patterns across the different identity states, and no matter which identity state she was in, there was no evidence of impairment in her factual knowledge of social situations and her capacity for managing personal affairs. We hence concluded that she was civilly competent despite the claimed DID. Considering that the existence and diagnosis of DID are still under dispute and a diagnosis of DID alone is not sufficient to interdict a person's civil right, important clinical and forensic issues remain to be answered.

  19. [Competence based medical education].

    Science.gov (United States)

    Bernabó, Jorge G; Buraschi, Jorge; Olcese, Juan; Buraschi, María; Duro, Eduardo

    2007-01-01

    The strategy of curriculum planning in the majority of the Schools of Medicine has shifted, in the past years, from curriculum models based in contents to outcome oriented curricula. Coincidently the interest in defining and evaluating the clinical competences that a graduate must have has grown. In our country, and particularly in the Associated Hospitals belonging to the Unidad Regional de Enseñanza IV of the UBA School of Medicine, evidence has been gathered showing that the acquisition of clinical competences during the grade is in general insufficient. The foundations and characteristics of PREM (Programa de Requisitos Esenciales Mínimos) are described. PREM is a tool to promote the apprenticeship of abilities and necessary skills for the practice of medicine. The objective of the program is to promote the apprenticeship of a well defined list of core competences considered indispensable for a general practitioner. An outcome oriented curriculum with a clear definition of the expected knowledge, skills and attitudes of a graduate of the programme, the promotion of learning experiences centered in the practice and evaluation tools based in direct observation of the student's performance should contribute to close the gap between what the Medicine Schools traditionally teach and evaluate, and what the doctor needs to know and needs to do to perform correctly its profession.

  20. Isolation and characterization of novel plant growth promoting Micrococcus sp NII-0909 and its interaction with cowpea.

    Science.gov (United States)

    Dastager, Syed G; Deepa, C K; Pandey, Ashok

    2010-12-01

    A phosphate-solubilizing bacterial strain NII-0909 isolated from the Western ghat forest soil in India was identified as Micrococcus sp on the basis of phenotypic characteristics, carbon source utilization pattern, fatty acid methyl esters analysis, and 16S rRNA gene sequence. The strain exhibited the plant growth-promoting attributes of phosphate solubilization, auxin production, 1-aminocyclopropane-1-carboxylate deaminase activity, and siderophore production. It was able to solubilize (122.4μg of Ca(3)PO(4) ml(-1)), and produce IAA (109μgml(-1)) at 30°C. P-solubilizing activity of the strain NII-0909 was associated with the release of organic acids and a drop in the pH of the NBRIP medium. HPLC analysis detected two organic acids in the course of P-solubilization. A significant increase in the growth of cow pea was recorded for inoculations under controlled conditions. Scanning electron microscopic study revealed the root colonization of strain on cow pea seedlings. These results demonstrate that isolates NII-0909 has the promising PGPR attributes to be develop as a biofertilizer to enhance soil fertility and promote the plant growth. Copyright © 2010 Elsevier Masson SAS. All rights reserved.