Directory of Open Access Journals (Sweden)
Michiro Susa
2010-05-01
Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.
Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng
2015-02-01
Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.
El-Ariss, Mohamad
ARN_2M are complementary to a sequence shifted slightly downstream in the same gene (583-607 nucleic acids). RNA duplexes siRNA_1 and siARN_2 consist exclusively of DNA while "modifed" siRNA_1M and si RNA_2M consist of RNA overhangs. siRNA duplexes (siRNA_1 and siRNA_2) were chosen from the work published by Hao Wu et al. (2003), Stege et al. (2004) and Miletti-Gonzalez et al. (2005) which showed that these siRNA sequences are effective to silence MDR1 gene in cancer cells (breast cancer cells MCF-7 / AdrR and MCF-7 / BC-19 and stomach cancer cells: EPG85-257RDB).[3-5] Moreover, Strapps et al. (2010) showed that the use of siRNA having overhangs formed of ribonucleotides leads to a similar silencing but lasting longer in vivo and in vitro compared to the use of siRNA containing deoxyribonucleotides overhangs.[6] Thus siARN_1M and siARN_2M sequences correspond to siARN_1 and siARN_2 sequences but whose overhangs are formed of ribonucleotides. These siRNA specific to the MDR1 gene (MDR1-siRNA) were combined to chitosan to form nanoparticles capable of protecting these MDR1-siRNA and delivering it into the MCF-7 MDR cells. Chitosan used here as a delivery system, is a natural and biodegradable polysaccharide whose biological properties are defined by its average molecular weight (MW) and by its degree of deacetylation (DD). When the positively charged chitosan is added with the negatively charged siRNA, there is formation of nanoparticles by electrostatic attraction. In this project, chitosan 92-10 (DDA- MW) was used as a delivery system with a N:P (ratio chitosan amino groups: RNA phosphate) of 5. Analysis by dynamic light scattering (DLS) demonstrated that the nanoparticles have a diameter between 62.56 and 82.72 nm and a zeta potential ranging from 17.4 to 23.5 mV. Analysis by confocal microscopy showed that chitosan (92-10-5)/labeled siRNA are internalized in MCF-7 MDR cells and that siRNAs are released in the cytoplasm. MCF-7 cells resistant MDR were transfected in
Directory of Open Access Journals (Sweden)
Kim Kyung-Jong
2008-08-01
Full Text Available Abstract Background The membrane transporters such as P-glycoprotein (Pgp, the MDR1 gene product, are one of causes of treatment failure in cancer patients. In this study, the epigenetic mechanisms involved in differential MDR1 mRNA expression were compared between 10 gastric and 9 colon cancer cell lines. Methods The MDR1 mRNA levels were determined using PCR and real-time PCR assays after reverse transcription. Cytotoxicity was performed using the MTT assay. Methylation status was explored by quantification PCR-based methylation and bisulfite DNA sequencing analyses. Results The MDR1 mRNA levels obtained by 35 cycles of RT-PCR in gastric cancer cells were just comparable to those obtained by 22 cycles of RT-PCR in colon cancer cells. Real-time RT-PCR analysis revealed that MDR1 mRNA was not detected in the 10 gastric cancer cell lines but variable MDR1 mRNA levels in 7 of 9 colon cancer cell lines except the SNU-C5 and HT-29 cells. MTT assay showed that Pgp inhibitors such as cyclosporine A, verapamil and PSC833 sensitized Colo320HSR (colon, highest MDR1 expression but not SNU-668 (gastric, highest and SNU-C5 (gastric, no expression to paclitaxel. Quantification PCR-based methylation analysis revealed that 90% of gastric cancer cells, and 33% of colon cancer cells were methylated, which were completely matched with the results obtained by bisulfite DNA sequencing analysis. 5-aza-2'-deoxcytidine (5AC, a DNA methyltransferase inhibitor increased the MDR1 mRNA levels in 60% of gastric cells, and in 11% of colon cancer cells. Trichostatin A (TSA, histone deacetylase inhibitor increased the MDR1 mRNA levels in 70% of gastric cancer cells and 55% of colon cancer cells. The combined treatment of 5AC with TSA increased the MDR1 mRNA levels additively in 20% of gastric cancer cells, but synergistically in 40% of gastric and 11% of colon cancer cells. Conclusion These results indicate that the MDR1 mRNA levels in gastric cancer cells are significantly
Directory of Open Access Journals (Sweden)
Ivan V. Chernikov
2017-03-01
Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.
In vitro detection of mdr1 mRNA in murine leukemia cells with 111In-labeled oligonucleotide
International Nuclear Information System (INIS)
Bai Jingming; Yokoyama, Kunihiko; Kinuya, Seigo; Michigishi, Takatoshi; Tonami, Norihisa; Shiba, Kazuhiro; Matsushita, Ryo; Nomura, Masaaki
2004-01-01
The feasibility of intracellular mdr1 mRNA expression detection with radiolabeled antisense oligonucleotide (ODN) was investigated in the murine leukemia cell line, P388/S, and its subclonal, adriamycin-resistant cell line, P388/R. The expression level of mdr1 mRNA was analyzed by reverse transcription-polymerase chain reaction (RT-PCR). Existence of the multidrug resistance (MDR) phenomenon was assessed via cellular uptake of 99m Tc-sestamibi (MIBI), a known substrate for P-glycoprotein. A 15-mer phosphorothioate antisense ODN complementary to the sequences located at -1 to 14 of mdr1 mRNA and its corresponding sense ODN were conjugated with the cyclic anhydride of diethylene triamine penta-acetic acid (cDTPA) via an amino group linked to the terminal phosphate at the 5' end at pH 8-9. The DTPA-ODN complexes at concentrations of 0.1-17.4 μMwere reacted with 111 InCl 3 at pH 5 for 1 h. The hybridization affinity of labeled ODN was evaluated with size-exclusion high-performance liquid chromatography following incubation with the complementary sequence. Cellular uptake of labeled ODN was examined in vitro. Furthermore, enhancing effects of synthetic lipid carriers (Transfast) on transmembrane delivery of ODN were assessed. P388/R cells displayed intense mdr1 mRNA expression in comparison with P388/S cells. 99m Tc-MIBI uptake in P388/S cells was higher than that in P388/R cells. Specific radioactivity up to 1,634 MBq/nmol was achieved via elevation of added radioactivity relative to ODN molar amount. The hybridization affinity of antisense 111 In-ODN was preserved at approximately 85% irrespective of specific activity. Cellular uptake of antisense 111 In-ODN did not differ from that of sense 111 In-ODN in either P388/S cells or P388/R cells. However, lipid carrier incorporation significantly increased transmembrane delivery of 111 In-ODN; moreover, specific uptake of antisense 111 In-ODN was demonstrated in P388/R cells. Radiolabeling of ODN at high specific
Nasilowska-Adamska, Barbara; Solarska, Iwona; Paluszewska, Monika; Malinowska, Iwona; Jedrzejczak, Wieslaw W; Warzocha, Krzysztof
2014-04-01
Fms-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) and mixed-lineage leukemia gene-partial tandem duplication (MLL-PTD) are aberrations associated with leukemia which indicate unsatisfactory prognosis. Downstream regulatory targets of FLT3-ITD and MLL-PTD are not well defined. We have analyzed the expression of MDR-1, multidrug resistant protein-1 (MRP-1), breast cancer resistance protein (BCRP), and lung resistance protein (LRP) messenger RNA (mRNA) in relation to the mutational status of FLT3-ITD and MLL-PTD in 185 acute myeloid leukemia (AML) adult patients. The real-time quantitative polymerase chain reaction method was performed to assess the expression of the MDR-1, MRP-1, BCRP, and LRP mRNA, and the results were presented as coefficients calculated using an intermediate method according to Pfaffl's rule. Significantly higher expressions of MDR-1 mRNA were found in patients who did not harbor FLT3-ITD (0.20 vs. 0.05; p = 0.0001) and MRP-1 mRNA in patients with this mutation (0.96 vs. 0.70; p = 0.002) and of BCRP mRNA in patients with MLL-PTD (0.61 vs. 0.38; p = 0.03). In univariate analysis, the high expression of MDR-1 mRNA (≥0.1317) negatively influenced the outcome of induction therapy (p = 0.05), whereas the high expression of BCRP mRNA (≥1.1487) was associated with a high relapse rate (RR) (p = 0.013). We found that the high expression of MDR-1 (≥0.1317), MRP-1 (≥0.8409), and BCRP mRNA (≥1.1487) significantly influenced disease-free survival (DFS; p = 0.059, 0.032, and 0.009, respectively) and overall survival (0.048, 0.014, and 0.059, respectively). Moreover, a high expression of BCRP mRNA (≥1.1487) proved to be an independent prognostic factor for RR (p = 0.01) and DFS (p = 0.002) in multivariate analysis. The significant correlation between the expression of MDR-1, MRP-1, and BCRP mRNA and FLT3-ITD or MLL-PTD in AML patients requires further investigation.
Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi
2009-07-01
This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.
[Expression and significance of P-gp/mdr1 mRNA, MRP and LRP in non-Hodgkin's lymphoma].
Li, Le; Su, Li-ping; Ma, Li; Zhao, Jin; Zhu, Lei; Zhou, Yong-an
2009-03-01
To explore the expression and clinical significance of P-glycoprotein (P-gp)/mdr1mRNA, multidrug resistance-associated protein (MRP) and lung resistance protein (LRP) in newly diagnosed non-Hodgkin's lymphoma. mdr1 mRNA of in 41 patients with non-Hodgkin's lymphoma was assayed by semi-quantitative RT-PCR. The expressions of P-gp, MRP and LRP proteins in lymph node viable blasts were identified by flow cytometry. The results were compared with those obtained from control cases, and the correlation of the changes with clinical outcomes was analyzed. (1) Among the 41 cases, the positive expression of P-gp protein was detected in 8 cases, MRP in 7 cases, LRP in 15 cases, and mdr 1 mRNA in 11 cases. (2) The P-gp and LRP levels in NHL were significantly higher than those in control group, but MRP wasn't. The P-gp over-expression was significantly associated with mdr1mRNA (r = 0.396, P = 0.01). No correlation was showed among the expressions of P-gp, MRP and LRP. (3) Patients with P-gp expression had a poorer outcome of chemotherapy than those with P-gp-negative (P = 0.005). P-gp expression was significantly associated with higher clinical stage (P = 0.046) and elevated serum lactate dehydrogenase level (P = 0.032), but not associated with malignant degree (P = 0.298). MRP had no impact on the outcome of chemotherapy (P = 0.212), and wasn't significantly associated with higher clinical stage (P = 0.369), elevated LDH (P = 0.762) and higher malignant degree (P = 0.451). Patients with LRP expression had a poorer outcome of chemotherapy than those LRP-negative (P = 0.012). LRP expression was significantly associated with higher clinical stage (P = 0.0019), elevated LDH (P = 0.02) and higher malignant degree (P = 0.01). The data of this study indicate that P-gp and LRP expressions but not MRP expression are important in the mechanism of drug resistance associated with a poor clinical outcome in previously untreated NHL.
International Nuclear Information System (INIS)
Kinuya, S.; Yokoyama, K; Fukuoka, M.; Michigishi, T.; Tonami, N.; Shiba, K.; Mori, H.; Watanabe, N.; Shuke, N.
2006-01-01
We examined the feasibility of Tc-99m sestamibi to monitor changes of mRNA expression of MDRl/P-glycoprotein (Pgp) following antisense oligodeoxynucleotide (AS-ODN) treatment in vivo. Three days after the intraperitoneal inoculation of murine leukaemia P388/R cells expressing MDR1/P-gp in CDFI mice, 15-mer phosphorothioate ASODN to the initiation codon of mouse mdr1 mRNA was administered intraperitoneally at 10 mg/kg daily for 3 or 4 days. Cells collected from ascites were suspended in medium for Tc-99m sestamibi uptake studies. To know the duration of antisense effects, cells were harvested 2 days later after the 3-day treatment. AS-ODN treatment increased Tc-99m sestamibi uptake. Effects of 3-day treatment and 4-day treatment were the same. Treatment effects were not detected when uptake was observed 2 days after 3-day treatment. Based on the results it was concluded that in vivo treatment with AS-ODN specific to the coding portion of mdr1 mRNA increased Tc-99m sestamibi uptake in leukaemia cells possessing MDR function. (author)
Directory of Open Access Journals (Sweden)
Rosa Gagliardi B.
2015-01-01
Full Text Available Objective. The objective of this study is to analyze the frequency of mdr1-1Δ mutation in German Shepherd, Doberman, Border Collie and Greyhound dog breeds in Uruguay. Materials and methods. A total of 95 animals from the four breeds mentioned above were studied. DNA was isolated from blood using potassium acetate with a subsequent degradation from RNA with RNAsaH. The concentration and quality of the DNA obtained was evaluated with a Nanodrop, ND-1000 spectrophotometer. To determine the presence or absence of the mdr1-1Δ mutation, DNA samples were sent to Gene Seek, Neogen Corporation of Chicago, United States, for genotyping. Results. In all 95 animals studied, the mdr1-1Δ mutation was not present. Conclusions. Based on the preliminary results obtained, other elements that may cause adverse drug reactions must be considered: unidentified mutations in other regions of the MDR1 gene; mutations in other genes involved in the transport of drugs from the same subfamily or another; mutations in enzymes involved in drug metabolism (e.g. Cytochrome P450. Moreover, especially with Border Collies and Greyhounds, it is advisable to increase the number of animals in the study.
Directory of Open Access Journals (Sweden)
Yu-Li Lo
Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity
Mo, Xianchao; Li, Weizhong
2014-05-01
To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.
Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko
2002-04-01
The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.
International Nuclear Information System (INIS)
Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.
1990-01-01
The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy
Dioscin enhances methotrexate absorption by down-regulating MDR1 in vitro and in vivo
Energy Technology Data Exchange (ETDEWEB)
Wang, Lijuan, E-mail: jlwang1979@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Huo, Xiaokui, E-mail: huoxiaokui@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); and others
2014-06-01
The purpose of this study was to investigate the enhancing effect of dioscin on the absorption of methotrexate (MTX) and clarify the molecular mechanism involved in vivo and in vitro. Dioscin increased MTX chemosensitivity and transepithelial flux in the absorptive direction, significantly inhibiting multidrug resistance 1 (MDR1) mRNA and protein expression and MDR1 promoter and nuclear factor κ-B (NF-κB) activities in Caco-2 cells. Moreover, inhibitor κB-α (IκB-α) degradation was inhibited by dioscin. Dioscin enhanced the intracellular concentration of MTX by down-regulating MDR1 expression through a mechanism that involves NF-κB signaling pathway inhibition in Caco-2 cells. Dioscin strengthened MTX absorption by inhibiting MDR1 expression in rat intestine. In addition, even though MTX is absorbed into the enterocytes, there was no increase in toxicity observed, and that, in fact, decreased toxicity was seen. - Highlights: • Dioscin raised MTX concentration by inhibiting MDR1 in Caco-2 cells. • Dioscin suppresses MDR1 by inhibiting NF-κB signaling pathway in Caco-2 cells. • Dioscin can enhance MTX absorption via inhibiting MDR1 in vivo and in vitro. • Dioscin did not increase MTX-induced gastrointestinal mucosal toxicity.
Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation
International Nuclear Information System (INIS)
Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook
2007-01-01
The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance
Directory of Open Access Journals (Sweden)
Jianfang Chen
Full Text Available Multidrug resistance (MDR is one of the major reasons chemotherapy-based treatments fail. Hypoxia is generally associated with tumor chemoresistance. However, the correlation between the heterodimeric hypoxia-inducible factor-1 (HIF-1 and the multidrug resistance (MDR1 gene/transporter P-glycoprotein (P-gp remains unclear. This study aims to explore the molecular mechanisms of reversing colon cancer MDR by focusing on the target gene HIF-1α.A chemotherapeutic sensitivity assay was used to observe the efficiency of MDR reversal in LoVo multicellular spheroids (MCS. The apoptotic level induced by different drugs was examined by flow cytometry (FCM. Binding of HIF-1α to the MDR1 gene promoter was evaluated by Chromatin immunoprecipitation (ChIP. The relationship between HIF-1α/P-gp expression and sensitivity to chemotherapy was analyzed.The sensitivity of LoVo MCS to all four chemotherapy drugs was decreased to varying degrees under hypoxic conditions. After silencing the HIF-1α gene, the sensitivities of LoVo MCS to all four chemotherapy drugs were restored. The apoptotic levels that all the drugs induced were all decreased to various extents in the hypoxic group. After silencing HIF-1α, the apoptosis level induced by all four chemotherapy drugs increased. The expression of HIF-1α and P-gp was significantly enhanced in LoVo MCS after treatment with hypoxia. Inhibiting HIF-1α significantly decreased the expression of MDR1/P-gp mRNA or protein in both the LoVo monolayers and LoVo MCS. The ChIP assay showed that HIF-1α was bound to the MDR1 gene promoter. Advanced colon carcinoma patients with expression of both HIF-1α and P-gp were more resistant to chemotherapy than that with non expression.HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-gp. The expression of HIF-1α and MDR1/P-gp can be used as a predictive marker for chemotherapy resistance in colon cancer.
Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog
Directory of Open Access Journals (Sweden)
Rosa Gagliardi B.
2013-08-01
Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.
Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter
2002-08-01
Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.
MDR1 P-glycoprotein transports endogenous opioid peptides
Oude Elferink, R. P.; Zadina, J.
2001-01-01
MDR1 P-glycoprotein is generally regarded as an efflux pump for amphipathic toxic compounds. The question remains, however, whether certain endogenous compounds are also substrates for this transporter. Certain peptides have been shown to interact with MDR1 Pgp as well and we have therefore
Multimodal transfer of MDR by exosomes in human osteosarcoma.
Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola
2016-07-01
Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.
Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J
1997-02-01
One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.
Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids
Directory of Open Access Journals (Sweden)
Buddhasukh Duang
2004-04-01
Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.
Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids
International Nuclear Information System (INIS)
Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang
2004-01-01
Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents
Ribera, Alba; Benavent, Eva; Lora-Tamayo, Jaime; Tubau, Fe; Pedrero, Salvador; Cabo, Xavier; Ariza, Javier; Murillo, Oscar
2015-12-01
In the era of emergence of MDR Pseudomonas aeruginosa, osteoarticular infections (OIs) add more difficulties to its treatment. The role of β-lactams (BLs) is questioned and older drugs need to be reconsidered. The objective of this study was to describe our experience in the management of OIs caused by MDR P. aeruginosa and evaluate different therapeutic options. This was a retrospective analysis of a prospectively collected cohort (2004-13) of patients with OI caused by MDR P. aeruginosa. We created two groups: (i) Group A (more difficult to treat), prosthetic joint infections (PJIs) and osteoarthritis (OA) managed with device retention; and (ii) Group B (less difficult to treat), OA managed without device retention. Antibiotic treatment was administered according to clinician criteria: monotherapy/combined therapy; and BL used by intermittent bolus (IB)/continuous infusion. Of 34 patients, 15 (44.1%) had PJI and 19 (55.9%) had OA (8 related to an orthopaedic device). Twenty-three cases (68%) were caused by XDR P. aeruginosa. The initial management included removal of an orthopaedic device in 14 cases, together with antibiotic [alone, 19 (55.9%; 4 colistin, 14 BL-IB and 1 BL continuous infusion); and in combination, 15 (44.1%; 5 BL-IB and 10 BL continuous infusion)]. The overall cure rate was 50% (39% and 63% in Groups A and B, respectively), ranging from 31.6% with monotherapy to 73.3% with combined therapy (P = 0.016), with special interest within Group A (cure rate with combined therapy 71.4%, P = 0.049). After rescue therapy, which included removal of remaining devices, the cure rate reached 85.3%. We suggest that the BL/colistin combination is an optimized therapy for OI caused by MDR P. aeruginosa, together with an appropriate surgical treatment. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Construction of retrovirus vector taking MDR1/ACBC1 and its ...
African Journals Online (AJOL)
We successfully observed the expression of the reporter gene-GFP by using the green light fluorescence microscope and the p-glycoprotein (P-gp) expressed by exogenous gene MDR1 by Western Blotting. All these facts indicated that the retroviral vector PMX-flag-MDR1-GFP had successfully been transfected into ...
Liu, Zhongle; Myers, Lawrence C
2017-11-01
Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.
Specificity of drug transport mediated by CaMDR1: a major facilitator ...
Indian Academy of Sciences (India)
Unknown
CaMDR1 encodes a major facilitator superfamily (MFS) protein in Candida albicans whose expression has been linked to .... by plaque assay and the integration of CaMDR1 at the ... with recombinant virus, vAcCaMDR1 and cells infected.
Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.
1997-01-01
The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes
International Nuclear Information System (INIS)
Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram
2010-01-01
Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors
Significance of MDR1 and multiple drug resistance in refractory human epileptic brain
Directory of Open Access Journals (Sweden)
Dini Gabriele
2004-10-01
Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.
Mechanisms of P-Glycoprotein Modulation by Semen Strychni Combined with Radix Paeoniae Alba
Directory of Open Access Journals (Sweden)
Li-Li Liu
2017-01-01
Full Text Available Semen Strychni has been extensively used as a Chinese herb, but its therapeutic window is narrowed by the strong toxicity of the compound, which limits its effectiveness. Radix Paeoniae Alba has been reported to reduce the toxic effects and increase the therapeutic effects of Semen Strychni, but the underlying mechanism remains unknown. This research aimed to explore the mechanism through which P-glycoprotein (P-gp is modulated by Semen Strychni combined with Radix Paeoniae Alba in vitro. An MTT assay was used to study cytotoxicity in an MDCK-MDR1 cell model. Rh123 efflux and accumulation were measured to assess P-gp function. The expression levels of MDR1 mRNA and P-gp protein in MDCK-MDR1 cells were investigated. A P-gp ATPase activity assay kit was applied to detect the effect on P-gp ATPase activity. Semen Strychni combined with Radix Paeoniae Alba could induce P-gp-mediated drug transport by inhibiting brucine and strychnine transport in MDCK-MDR1 cells, enhancing the P-gp efflux function, upregulating the P-gp expression and MDR1 mRNA levels, and stimulating P-gp ATPase activity.
LENUS (Irish Health Repository)
Walsh, Naomi
2009-01-01
BACKGROUND: Renal cell carcinoma patients respond poorly to conventional chemotherapy, this unresponsiveness may be attributable to multidrug resistance (MDR). The mechanisms of MDR in renal cancer are not fully understood and the specific contribution of ABC transporter proteins which have been implicated in the chemoresistance of various cancers has not been fully defined in this disease. METHODS: In this retrospective study the expression of two of these transporter efflux pumps, namely MDR-1 P-gp (ABCB1) and MRP-1 (ABCC1) were studied by immunohistochemistry in archival material from 95 renal cell carcinoma patients. RESULTS: In the first study investigating MDR-1 P-gp and MRP-1 protein expression patterns in renal cell carcinoma patients, high levels of expression of both efflux pumps are observed with 100% of tumours studied showing MDR-1 P-gp and MRP-1 positivity. CONCLUSION: Although these findings do not prove a causal role, the high frequency of tumours expressing these efflux pumps suggests that they may be important contributors to the chemoresistance of this tumour type.
HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein
Directory of Open Access Journals (Sweden)
Cara Andrea
2007-03-01
Full Text Available Abstract Background The discovery of diketoacid-containing derivatives as inhibitors of HIV-1 Integrase (IN (IN inhibitors, IINs has played a major role in validating this enzyme as an important target for antiretroviral therapy. Since the in vivo efficacy depends on access of these drugs to intracellular sites where HIV-1 replicates, we determined whether the IINs are recognized by the multidrug transporter MDR1-P-glycoprotein (P-gp thereby reducing their intracellular accumulation. To address the effect of IINs on drug transport, nine quinolonyl diketo acid (DKA derivatives active on the HIV-1 IN strand transfer (ST step and with EC50 ranging from 1.83 to >50 μm in cell-based assays were tested for their in vitro interaction with P-gp in the CEM-MDR cell system. IINs were investigated for the inhibition and induction of the P-gp function and expression as well as for multidrug resistance (MDR reversing ability. Results The HIV-1 IINs act as genuine P-gp substrates by inhibiting doxorubicin efflux and inducing P-gp functional conformation changes as evaluated by the modulation of UIC2 mAb epitope. Further, IINs chemosensitize MDR cells to vinblastine and induce P-gp expression in drug sensitive revertants of CEM-MDR cells. Conclusion To our knowledge, this is the first demonstration that HIV-1 IINs are P-gp substrates. This biological property may influence the absorption, distribution and elimination of these novels anti HIV-1 compounds.
Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi
2016-07-01
Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.
DEFF Research Database (Denmark)
Stein, Ulrike; Lage, Hermann; Jordan, Andreas
2002-01-01
The impact of the ABC transporters breast cancer resistance protein/mitoxantrone resistance associated transporter (BCRP/MXR), multidrug resistance-associated protein 1 (MRP1) and multidrug resistance gene-1/P-glycoprotein (MDR1/PGP) on the multidrug resistance (MDR) phenotype in chemoresistance...... expression of BCRP/MXR and of MRP1 were clearly enhanced (vs. parental and classical MDR lines). MDR1/PGP expression was distinctly elevated in the classical MDR subline EPG85-257RDB (vs. parental and atypical MDR sublines). In all thermoresistant counterparts basal expression of BCRP/MXR, MRP1 and MDR1/PGP...... was increased relative to thermosensitive sublines. Although it could be shown that the overexpressed ABC transporters were functionally active, however, no decreased drug accumulations of doxorubicin, mitoxantrone and rhodamine 123 were observed. Thus, expression of BCRP/MXR, MRP1 and MDR1/PGP was found...
International Nuclear Information System (INIS)
Schneider, José; Gonzalez-Roces, Severino; Pollán, Marina; Lucas, Raul; Tejerina, Armando; Martin, Miguel; Alba, Alfonso
2001-01-01
total clinical response rate of 75.0%. None achieved a complete pathological response. MDR1 mRNA expression detected by RT-PCR was associated with the presence of invaded axillary nodes at surgery in 18/22 cases (81.8%), compared with 13/24 (54.2%) in the group with undetectable MDR1 expression. This difference was statistically significant (P < 0.05). LRP expression in more than 20% of tumor cells before any treatment was associated with axillary nodal metastasis after chemotherapy and rescue mastectomy in 17/23 cases, compared with 3/8 in nonexpressors. Again, this difference was highly significant (P < 0.01). LRP expression before treatment and MDR1 mRNA expression after treatment were significantly interrelated (P < 0.001), which might reflect the presence of chemoresistant clones liable to metastasize to the regional nodes. Persistence of previously detected MDR1-positivity after treatment (7/9 compared with 0/2 cases) was significantly associated with axillary node metastasis (P < 0.05). Finally, in a logistic regression multivariate model, histology other than ductal, a Ki67 labeling index of at least 20% and the combination of LRP and MDR1 positivity emerged as independent predictors of axillary node invasion at the time of rescue mastectomy. The expression of different genes involved in resistance to chemotherapy, both before and after treatment with neoadjuvant, is associated with the presence of axillary node invasion at rescue surgery in locally advanced breast cancer. This might reflect the presence of intrinsically resistant clones before any form of therapy, which persist after it, and could be helpful both for prognosis and for the choice of individual treatment
Cheng, Qilai; Liao, Meixiang; Hu, Haibo; Li, Hongliang; Wu, Longhuo
2018-01-01
P-glycoprotein (P-gp, i.e., MDR1) is associated with the phenotype of multidrug resistance (MDR) and causes chemotherapy failure in the management of cancers. Searching for effective MDR modulators and combining them with anticancer drugs is a promising strategy against MDR. Asiatic acid (AA), a natural triterpene isolated from the plant Centella asiatica, may have an antitumor activity. The present study assessed the reversing effect of AA on MDR and possible molecular mechanisms of AA action in MDR1-overexpressing cisplatin (DDP)-resistant lung cancer cells, A549/DDP. Human lung adenocarcinoma A549/DDP cells were either exposed to different concentrations of AA or treated with DDP, and their viability was measured by the MTT assay. A Rhodamine 123 efflux assay, immunofluorescent staining, ATPase assay, reverse-transcription PCR (RT-PCR), and western blot analysis were conducted to elucidate the mechanisms of action of AA on MDR. Our results showed that AA significantly enhanced the cytotoxicity of DDP toward A549/DDP cells but not its parental A549 cells. Furthermore, AA strongly inhibited P-gp expression by blocking MDR1 gene transcription and increased the intracellular accumulation of the P-gp substrate Rhodamine 123 in A549/DDP cells. Nuclear factor (NF)-kB (p65) activity, IkB degradation, and NF-kB/p65 nuclear translocation were markedly inhibited by pretreatment with AA. Additionally, AA inhibited the MAPK-ERK pathway, as indicated by decreased phosphorylation of ERK1 and -2, AKT, p38, and JNK, thus resulting in reduced activity of the Y-box binding protein 1 (YB1) via blockage of its nuclear translocation. AA reversed P-gp-mediated MDR by inhibition of P-gp expression. This effect was likely related to downregulation of YB1, and this effect was mediated by the NF-kB and MAPK-ERK pathways. AA may be useful as an MDR reversal agent for combination therapy in clinical trials. © 2018 The Author(s). Published by S. Karger AG, Basel.
The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.
Hirose, Masao
2009-04-01
There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.
Breed distribution of the nt230(del4) MDR1 mutation in dogs.
Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim
2011-07-01
A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.
Role of MRP-1 and GST-Pi in MDR and their inhibition by ...
African Journals Online (AJOL)
Samia A. Ebeed
2016-08-16
Aug 16, 2016 ... Various mechanisms were proposed that underlie MDR in malignant cells. ... the gene that confers MDR in lung cancer cells. MRP1 acts in order to protect ... the many physiological and pathophysiological processes influ-.
Cao, Wei; Kayama, Hisako; Chen, Mei Lan; Delmas, Amber; Sun, Amy; Kim, Sang Yong; Rangarajan, Erumbi S; McKevitt, Kelly; Beck, Amanda P; Jackson, Cody B; Crynen, Gogce; Oikonomopoulos, Angelos; Lacey, Precious N; Martinez, Gustavo J; Izard, Tina; Lorenz, Robin G; Rodriguez-Palacios, Alex; Cominelli, Fabio; Abreu, Maria T; Hommes, Daniel W; Koralov, Sergei B; Takeda, Kiyoshi; Sundrud, Mark S
2017-12-19
CD4 + T cells are tightly regulated by microbiota in the intestine, but whether intestinal T cells interface with host-derived metabolites is less clear. Here, we show that CD4 + T effector (Teff) cells upregulated the xenobiotic transporter, Mdr1, in the ileum to maintain homeostasis in the presence of bile acids. Whereas wild-type Teff cells upregulated Mdr1 in the ileum, those lacking Mdr1 displayed mucosal dysfunction and induced Crohn's disease-like ileitis following transfer into Rag1 -/- hosts. Mdr1 mitigated oxidative stress and enforced homeostasis in Teff cells exposed to conjugated bile acids (CBAs), a class of liver-derived emulsifying agents that actively circulate through the ileal mucosa. Blocking ileal CBA reabsorption in transferred Rag1 -/- mice restored Mdr1-deficient Teff cell homeostasis and attenuated ileitis. Further, a subset of ileal Crohn's disease patients displayed MDR1 loss of function. Together, these results suggest that coordinated interaction between mucosal Teff cells and CBAs in the ileum regulate intestinal immune homeostasis. Copyright © 2017 Elsevier Inc. All rights reserved.
Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes
Energy Technology Data Exchange (ETDEWEB)
Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)
2012-12-19
Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Baum, C; Peinert, S; Carpinteiro, A; Eckert, H G; Fairbairn, L J
2000-05-01
Genetic transfer and expression of drug-resistance functions into haematopoietic stem and progenitor cells is a promising means to overcome both the acute and longterm side-effects of cytotoxic drugs in bone marrow. Here, we describe a functional analysis of a retroviral vector that co-expresses human cDNAs for multidrug resistance 1/P-glycoprotein (MDR1) and a double mutant of O(6)-alkylguanine-alkyltransferase (hATPA/GA) to high levels. The hATPA/GA protein contains two amino acid substitutions that render it resistant to compounds such as O(6)-benzylguanine that inhibit the wild-type protein which is often overexpressed in resistant tumour cells. Evidence for simultaneous drug resistance of genetically modified primary murine progenitor cells to colchicine or the podophyllotoxin etoposide, both covered by MDR1-mediated efflux activity, and the nitrosourea BCNU, which is counteracted by hATPA/GA, is presented using in vitro colony assays.
Directory of Open Access Journals (Sweden)
Lanying Pan
2015-02-01
Full Text Available Stellera chamaejasme L. (Thymelaeaceae is widely distributed in Mongolia, Tibet and the northern parts of China. Its roots are commonly used as “Langdu”, which is embodied in the Pharmacopoeia of the P.R. China (2010 as a toxic Traditional Chinese Medicine. It is claimed to have antivirus, antitumor and antibacterial properties in China and other Asian countries. Studies were carried out to characterize the inhibition of neochamaejasmin B (NCB on P-glycoprotein (P-gp, ABCB1, MDR1. Rhodamine-123 (R-123 transport and accumulation studies were performed in MDCK-hMDR1 cells. ABCB1 (MDR1 mRNA gene expression and P-gp protein expression were analyzed. Binding selectivity studies based on molecular docking were explored. R-123 transport and accumulation studies in MDCK-hMDR1 cells indicated that NCB inhibited the P-gp-mediated efflux in a concentration-dependent manner. RT-PCR and Western blot demonstrated that the P-gp expression was suppressed by NCB. To investigate the inhibition type of NCB on P-gp, Ki and Ki’ values were determined by double-reciprocal plots in R-123 accumulation studies. Since Ki was greater than Ki’, the inhibition of NCB on P-gp was likely a mixed type of competitive and non-competitive inhibition. The results were confirmed by molecular docking in our current work. The docking data indicated that NCB had higher affinity to P-gp than to Lig1 ((S-5,7-dihydroxy-2-(4-hydroxyphenylchroman-4-one.
Energy Technology Data Exchange (ETDEWEB)
Zhu, Lijun; Wu, Jinjun; Zhao, Min; Song, Wenjie; Qi, Xiaoxiao; Wang, Ying [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); Lu, Linlin [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China); Liu, Zhongqiu, E-mail: liuzq@gzucm.edu.cn [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China)
2017-04-01
Aconitine (AC) is the primary bioactive/toxic alkaloid in plants of the Aconitum species. Our previous study demonstrated that Mdr1 was involved in efflux of AC. However, the mechanism by which Mdr1 regulates the efficacy/toxicity of AC in vivo remains unclear. The present study aimed to determine the effects of Mdr1a on the efficacy/toxicity and pharmacokinetics of AC in wild-type and Mdr1a{sup −/−} FVB mice. After oral administration of AC, significantly higher analgesic effect was observed in Mdr1a{sup −/−} mice (49% to 105%) compared to wild-type mice (P < 0.05). The levels of s100-β protein and creatine kinase, which indicate cerebral and myocardial damage, respectively, were also significantly increased (P < 0.05) in Mdr1a{sup −/−} mice. Histopathological examination revealed that the Mdr1a{sup −/−} mice suffered from evident cerebral and myocardial damages, but the wild-type mice did not. These findings suggested that Mdr1a deficiency significantly promoted the analgesic effect of AC and exacerbated its toxicity. Pharmacokinetic experiments showed that T{sub 1/2} of AC in the Mdr1a{sup −/−} mice was significantly higher (from 87% to 300%) than that in wild-type mice (P < 0.05). The distribution of AC in the brain of Mdr1a{sup −/−} mice was 2- to 32-fold higher than that in the brains of wild-type mice (P < 0.05). Toxic reactions were more severe in Mdr1a{sup −/−} mice compared to wild-type mice. In conclusion, Mdr1a deficiency significantly enhanced the analgesic effect of AC and exacerbated its toxicity by upregulating its distribution to the brain and decreasing its plasma elimination rate. Thus, Mdr1a dysfunction may cause severe AC poisoning. - Highlights: • The efficacy and toxicity of aconitine were significantly enhanced in Mdr1a{sup −/−} mice. • The distribution of aconitine to the brain was remarkably increased in Mdr1a{sup −/−} mice. • The elimination rate of aconitine was significantly decreased in Mdr1a
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Wielandt, Ana María; Vollrath, Valeska; Chianale, José
2004-09-01
There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.
Valdez, Benigno C; Li, Yang; Murray, David; Brammer, Jonathan E; Liu, Yan; Hosing, Chitra; Nieto, Yago; Champlin, Richard E; Andersson, Borje S
2016-09-27
HDAC inhibitors, DNA alkylators and nucleoside analogs are effective components of combination chemotherapy. To determine a possible mechanism of their synergism, we analyzed the effects of HDAC inhibitors on the expression of drug transporters which export DNA alkylators. Exposure of PEER lymphoma T-cells to 15 nM romidepsin (Rom) resulted in 40%-50% reduction in mRNA for the drug transporter MRP1 and up to ~500-fold increase in the MDR1 mRNA within 32-48 hrs. MRP1 protein levels concomitantly decreased while MDR1 increased. Other HDAC inhibitors - panobinostat, belinostat and suberoylanilide hydroxamic acid (SAHA) - had similar effects on these transporters. The protein level of MRP1 correlated with cellular resistance to busulfan and chlorambucil, and Rom exposure sensitized cells to these DNA alkylators. The decrease in MRP1 correlated with decreased cellular drug export activity, and increased level of MDR1 correlated with increased export of daunorubicin. A similar decrease in the level of MRP1 protein, and increase in MDR1, were observed when mononuclear cells derived from patients with T-cell malignancies were exposed to Rom. Decreased MRP1 and increased MDR1 expressions were also observed in blood mononuclear cells from lymphoma patients who received SAHA-containing chemotherapy in a clinical trial. This inhibitory effect of HDAC inhibitors on the expression of MRP1 suggests that their synergism with DNA alkylating agents is partly due to decreased efflux of these alkylators. Our results further imply the possibility of antagonistic effects when HDAC inhibitors are combined with anthracyclines and other MDR1 drug ligands in chemotherapy.
MicroRNA signatures from multidrug-resistant Mycobacterium tuberculosis
REN, NA; GAO, GUIJU; SUN, YUE; ZHANG, LING; WANG, HUIZHU; HUA, WENHAO; WAN, KANGLIN; LI, XINGWANG
2015-01-01
Tuberculosis (TB) infections, caused by multi-drug-resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug-resistance in MTB. PMID:26324150
MicroRNA signatures from multidrug‑resistant Mycobacterium tuberculosis.
Ren, Na; Gao, Guiju; Sun, Yue; Zhang, Ling; Wang, Huizhu; Hua, Wenhao; Wan, Kanglin; Li, Xingwang
2015-11-01
Tuberculosis (TB) infections, caused by multidrug‑resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug‑resistance in MTB.
Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism
Directory of Open Access Journals (Sweden)
Em Sutrisna
2015-06-01
Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.
Directory of Open Access Journals (Sweden)
Ana Martins
2015-01-01
Full Text Available Ecdysteroids, analogs of the insect molting hormone, are known for their various mild, nonhormonal bioactivities in mammals. Previously, we reported that less-polar ecdysteroids can modulate the doxorubicin resistance of a multidrug resistant (MDR mouse lymphoma cell line expressing the human ABCB1 transporter. Here, we describe the ability of 20-hydroxyecdysone (1 and its mono- (2 and diacetonide (3 derivatives to sensitize various MDR and non-MDR cancer cell lines towards doxorubicin, paclitaxel, vincristine, or cisplatin. Drug IC50 values with or without ecdysteroid were determined by MTT assay. Compound 3 significantly sensitized all cell lines to each chemotherapeutic except for cisplatin, whose activity was decreased. In order to overcome solubility and stability issues for the future in vivo administration of compound 3, liposomal formulations were developed. By means of their combination index values obtained via checkerboard microplate method, a formulation showed superior activity to that of compound 3 alone. Because ecdysteroids act also on non-ABCB1 expressing (sensitive cell lines, our results demonstrate that they do not or not exclusively exert their adjuvant anticancer activity as ABCB1 inhibitors, but other mechanisms must be involved, and they opened the way towards their in vivo bioactivity testing against various cancer xenografts.
Importancia pronóstica de la expresión de MDR-1 en la leucemia mieloblástica aguda
Directory of Open Access Journals (Sweden)
J. Arbelbide
2003-08-01
Full Text Available Una proporción importante de pacientes con leucemia mieloblástica aguda (LMA presentan recaída o resistencia con el tratamiento. Uno de los mecanismos involucrados en la resistencia a drogas, es la presencia de la glicoproteína P 170 (gp-P 170 resultante de la expresión del gen MDR-1 sobre las células leucémicas. El objetivo de este trabajo es valorar el impacto pronóstico de la expresión de MDR-1 en una población de pacientes tratados por LMA. Se evaluó retrospectivamente la expresión de MDR-1 en una cohorte de 55 pacientes con LMA, mayores de 16 años, que recibieron tratamiento quimioterápico desde 1990 hasta el 2000. Se evaluó sobre biopsia de médula ósea, la expresión de MDR-1/gp-P 170 por inmunohistoquímica. Mediante una curva ROC, se estableció que una expresión de MDR-1 > 50% en células blásticas, resultó significativa para el logro de remisión completa. Esta expresión de MDR-1+ correlacionó con la presencia de leucocitosis: (p:0.002, expresion de células CD34+ (p:0.006, menor tasa de remisión completa (p:0.001, mayor tasa de recaída (p:0.02 y de estudios citogenéticos no favorables (p:0.02. La SLE fue de 21.2% ES:9.3 con un seguimiento de 22 meses para el grupo MDR-1+ versus 56.4% ES:12.5 con un seguimiento de 78 meses en los casos MDR-1- (p:0.007. Se puede concluir que la expresion de MDR-1 ha demostrado ser un factor pronóstico de resistencia a la quimioterapia. Estos pacientes presentan una menor tasa de remisión completa, una mayor tasa de recaída por persistencia de enfermedad residual post-tratamiento, lo que produce una menor sobrevida global.An important number of patients with Acute Myeloid Leukemia (AML experience relapse or resistance to chemotherapy. One of the mechanisms involved in this resistance is the presence of glycoprotein P170 (gp-P 170, which results of the MDR-1 gene in leukemic cells. The objective of this article is to assess the prognostic impact of the expression of MDR-1 in a
Directory of Open Access Journals (Sweden)
Strazzullo Viviana
2006-12-01
Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader
Frequency of the MDR1 mutant allele associated with multidrug sensitivity in dogs from Brazil
Directory of Open Access Journals (Sweden)
Monobe MM
2015-04-01
Full Text Available Marina M Monobe,1 João P Araujo Junior,2 Kari V Lunsford,3 Rodrigo C Silva,4 Camilo Bulla41Department of Veterinary Clinics, School of Veterinary Medicine and Animal Science, 2Department of Microbiology and Immunology, Biosciences Institute, Sao Paulo State University (UNESP, Botucatu, Brazil; 3Department of Clinical Sciences and Animal Health Center, 4Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Mississippi, MS, USAAbstract: To date, a 4-bp deletion in the MDR1 gene has been detected in more than ten dog breeds, as well as in mixed breed dogs, in several countries, however information regarding this mutation in dogs from Brazil is lacking. For this reason, 103 Collies, 77 Border Collies, 76 Shetland Sheepdogs, 20 Old English Sheepdogs, 55 German Shepherds, 16 Australian Shepherds, and 53 Whippets from Brazil were screened for the presence of the mutation. The heterozygous mutated genotype, MDR1 (+/−, frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 50.5% (95% CI =41.1%–59.9%, 31.3% (95% CI =8.6%–53.2%, and 15.8% (95% CI =7.7%–23.9%, respectively. Homozygous mutated genotype, MDR1 (−/−, was detected only in Collies 35.9%. The MDR1 allele mutant frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 61.2% (95% CI =54.8%–67.5%, 15.6% (95% CI =3.1%–28.2%, and 7.9% (95% CI =3.7%–12.1%, respectively. Additionally, even free of the mutant allele, the maximum mutant prevalence (MMP in that population, with 95% CI, was 3.8%, 5.2%, 5.4%, and 13.8% for Border Collies, German Shepherds, Whippets, and Old English Sheepdogs, respectively. In this way, this information is important, not only for MDR1 genotype-based breeding programs and international exchange of breeding animals of predisposed breeds, but also for modification of drug therapy for breeds at risk.Keywords: P-glycoprotein, MDR1 mutation, ivermectin, dog, drug
Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.
Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G
2017-10-01
ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Mary Dyszlewski
2002-01-01
Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.
Bouzidi, Amira; Mesbah-Amroun, Hamida; Boukercha, Aziza; Benhassine, Fadila; Belboueb, Réda; Berkouk, Karima; Messadi, Wassila; Touil-Boukoffa, Chafia
2016-12-01
The multi-drug resistance gene (MDR1) has raised increasing interest as a susceptibility gene for Crohn's disease (CD). The role of MDR1 single-nucleotide polymorphisms (SNPs) in the predisposition and behavior of CD in the pediatric population is still elusive. Here, we investigated whether SNPs in MDR1 are associated with CD in Algerian pediatric patients. A case-control study was conducted enrolling 47 pediatric CD patients and 100 controls. All subjects were genotyped for the most common MDR1 SNPs (C3434T, C1236T, and G2677A/T) using PCR-RFLP method. We also explored the association between polymorphisms and clinical sub-phenotypes. We have detected no significant association of C3435T SNP and pediatric CD. However, we observed a significantly higher frequency of the risk alleles, 1236T and 2677T/A among the CD patients compared to controls. Moreover, the risk allele 1236T was associated to a higher risk for resective surgery. Our data suggest that the C1236T and G2677A/T SNPs in the MDR1 gene are associated with CD and the C1236T risk allele with a more severe course of disease in Algerian pediatric patients. Further analysis using larger patients group and functional studies would be interesting to elucidate the role of MDR1 gene in pediatric CD.Pediatric Research (2016); doi:10.1038/pr.2016.163.
Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam
2015-08-01
The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.
Directory of Open Access Journals (Sweden)
Youn Kyung Choi
2013-01-01
Full Text Available Cancer cells acquire anticancer drug resistance during chemotherapy, which aggravates cancer disease. MDR1 encoded from multidrug resistance gene 1 mainly causes multidrug resistance phenotypes of different cancer cells. In this study, we demonstrate that JNK1/2 activation by an extract from the root of Morus alba L. (White mulberry reduces doxorubicin-resistant MCF-7/Dox cell viability by inhibiting YB-1 regulation of MDR1 gene expression. When MCF-7 or MCF-7/Dox cells, where MDR1 is highly expressed were treated with an extract from roots or leaves of Morus alba L., respectively, the root extract from the mulberry (REM but not the leaf extract (LEM reduced cell viabilities of both MCF-7 and MCF-7/Dox cells, which was enhanced by cotreatment with doxorubicin. REM but not LEM further inhibited YB-1 nuclear translocation and its regulation of MDR1 gene expression. Moreover, REM promoted phosphorylation of c-Jun NH2-terminal kinase 1/2 (JNK1/2 and JNK1/2 inhibitor, SP600125 and rescued REM inhibition of both MDR1 expression and viabilities in MCF-7/Dox cells. Consistently, overexpression of JNK1, c-Jun, or c-Fos inhibited YB-1-dependent MDR1 expression and reduced viabilities in MCF-7/Dox cells. In conclusion, our data indicate that REM-activated JNK-cJun/c-Fos pathway decreases the viability of MCF-7/Dox cells by inhibiting YB-1-dependent MDR1 gene expression. Thus, we suggest that REM may be useful for treating multidrug-resistant cancer cells.
ECG-triggered MDR-CT for the detection of pulmonary metastases
International Nuclear Information System (INIS)
Pauls, S.; Wahl, J.; Aschoff, A.J.; Brambs, H.J.; Fleiter, T.R.
2003-01-01
Purpose: Comparison of multidetector-row CT (MDR-CT) of the chest with and without ECG triggering for the detection of pulmonary metastases. Materials and Methods: Fifty patients with malignant tumors underwent CT of the chest. The unenhanced phase was performed with ECG-triggered MDR-CT and the contrast-enhanced phase with helical MDR-CT. The ECG-triggered and standard helical scans were interpreted in separate sessions, with the analysis determining the number and demarcation of the intrapulmonary nodules and the delineation of the mediastinal structure (rated 1 = excellent to 5 = poor). Results: ECG-MDR-CT images detected 38% more pulmonary nodules than MDR-CT. The detection rate for tumors [de
Directory of Open Access Journals (Sweden)
U D Gupta
2015-01-01
Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of
Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H
1987-11-01
We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.
Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines
NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho
2007-01-01
Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...
Exploration of Fungal Association From Hard Coral Against Pathogen MDR Staphylococcus haemolyticus
Cristianawati, O.; Radjasa, O. K.; Sabdono, A.; Trianto, A.; Sabdaningsih, A.; Sibero, M. T.; Nuryadi, H.
2017-02-01
Staphylococcus haemolyticus are opportunistic bacteria and as the second leading cause of nosocomial infections. It is a disease causing septicemia, peritonitis, otitis, and urinary tract infections and infections of the eye. It also a phenotype resistant to multiple antibiotics commercial. There is now an urgency to find an alternative antibiotics to combat this bacteria. It has been widely reported that many bioactive marine natural products from marine invertebrate have striking similarities to metabolites of their associated microorganisms including fungi. Hard coral associated microorganisms are among of the most interesting and promising marine natural product sources, which produce with various biological activities. The proposed work focused on the discovery of bioactive compounds and also estimated the phylogenetic diversity from fungal association of hard coral against pathogen MDR Staphylococcus haemolyticus. A total of 32 fungal association, FHP 7 which were isolated from Favia sp. capable of inhibiting the growth MDR. Molecular identification based on 18S rRNA gene sequences revealed that the active fungal association belonged 100% to the members from one of the genera Trichoderma longibrachiatum. Accession Number LC185084.1.
Experience with LDR and MDR brachytherapy for cervical cancer
International Nuclear Information System (INIS)
Okawa, Tomohiko; Okawa, Midori-Kita; Kaneyasu, Yuko; Karasawa, Kumiko; Fukuhara, Noboru
1996-01-01
As the brachytherapy dose-rate increases, it is necessary to reduce the total dose or to increase the fraction number with reducing the fraction dose in order not to increase the incidence of the late effect. With the introduction to the Tokyo Women's Medical College, Hospital of a remote afterloading system of Selectron - MDR, delivering dose-rate to point A became approximately twice of that with our classical cesium LDR manual afterloading technique. Material and Methods: Between 1987 to 1993 a total of, previously untreated 74 patients with cervical cancer received MDR brachytherapy using a Selection - MDR. This analysis is therefore of those patients series who underwent radical radioradiotherapy with MDR, 1987-1993, in comparison with the 347 cases who were treated with classical manual LDR afterloading machine, 1969-1986. The treatment was a brachytherapy during external radiotherapy and dos-rate at point A was 160-180 cGy/hour with MDR and 80-90 cGy/hour with LDR. The mean fraction dose was 800-1000 cGy by MDR and 1000-1200 cGy by LDR and fraction number was increased 1-2times in the MDR group with no change of a total dose at point A. Results: The mean age was 63.3 years in the MDR group and 60.2 in the LDR group. In the MDR group, 4 patients were at stage I, 16 stage II, 32 stage III, and 22 stage IV. In the LDR group, 32 were at stage I, 83 stage II, 183 stage III, and 49 stage IV. The medical rate was not significantly different between two groups. The tumor response by manual examination one month after radiotherapy showed no significant difference. The 5-year survival rate for the MDR and LDR groups were 100% : 78% at stage I, 61% : 71% at stage II and 52% : 53% at stage III, with no significant differences. Late complications by severity with grade II-III according to Kottureire's classification were not significantly different in the rectum or bladder. These results suggested that MDR brachytherapy was useful for the patients' QOL as it reduced the
Directory of Open Access Journals (Sweden)
Overvad Kim
2009-11-01
Full Text Available Abstract Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1 and Breast Cancer Resistance Protein (BCRP/ABCG2 may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA and polycyclic aromatic hydrocarbons (PAH. Cyclooxygenase-2 (COX-2 derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. Methods The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642 in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142, the two COX-2 A-1195G (rs689466 and G-765C (rs20417 in the promoter region, and the COX-2 T8473C (rs5275 polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR = 1.52, 95% Confidence Interval (CI: 1.12-2.06. Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00. There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16 whereas variant allele carriers were not at increased risk (p for interaction = 0.02. COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T
International Nuclear Information System (INIS)
Andersen, Vibeke; Østergaard, Mette; Christensen, Jane; Overvad, Kim; Tjønneland, Anne; Vogel, Ulla
2009-01-01
The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642) in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142), the two COX-2 A-1195G (rs689466) and G-765C (rs20417) in the promoter region, and the COX-2 T8473C (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR) = 1.52, 95% Confidence Interval (CI): 1.12-2.06). Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00)). There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16) whereas variant allele carriers were not at increased risk (p for interaction = 0.02). COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T8473C (p-values for interaction 0
Monoclonal antibody to an external epitope of the human mdr1 P-glycoprotein
Arceci, R. J.; Stieglitz, K.; Bras, J.; Schinkel, A.; Baas, F.; Croop, J.
1993-01-01
A membrane glycoprotein, termed P-glycoprotein, has been shown to be responsible for cross-resistance to a broad range of structurally and functionally distinct cytotoxic agents. P-glycoprotein, encoded in humans by the mdr1 gene, functions as an energy-dependent efflux pump to exclude these
Shao, Jing; Zhang, MengXiang; Wang, TianMing; Li, Yue; Wang, ChangZhong
2016-01-01
Fungal infections caused by fluconazole-resistant Candida albicans are an intractable clinical problem, calling for new efficient antifungal drugs. Kaempferol, an active flavonoid, has been considered a potential candidate against Candida species. This work investigates the resistance reversion of kaempferol in fluconazole-resistant C. albicans and the underlying mechanism. The antifungal activities of fluconazole and/or kaempferol were assessed by a series of standard procedures including broth microdilution method, checkerboard assay and time-kill (T-K) test in nine clinical strains as well as a standard reference isolate of C. albicans. Subsequently, the morphological changes, the efflux of rhodamine 6G, and the expressions of CDR 1, CDR 2, and MDR 1 were analysed by scanning electron microscope (SEM), inverted fluorescence microscope and quantitative reverse transcription polymerase chain reaction (qRT-PCR) in C. albicans z2003. For all the tested C. albicans strains, the minimum inhibitory concentrations (MICs) of fluconazole and kaempferol ranged 0.25-32 and 128-256 μg/mL with a range of fractional inhibitory concentration index of 0.257-0.531. In C. albicans z2003, the expression of both CDR 1 and CDR 2 were decreased after exposure to kaempferol alone with negligible rhodamine 6G accumulation, while the expression of CDR 1, CDR 2 and MDR 1 were all decreased when fluconazole and kaempferol were used concomitantly with notable fluorescence of rhodamine 6G observed. Kaempferol-induced reversion in fluconazole-resistant C. albicans might be likely due to the suppression of the expression of CDR1, CDR2 and MDR1.
Kengkla, Kirati; Kongpakwattana, Khachen; Saokaew, Surasak; Apisarnthanarak, Anucha; Chaiyakunapruk, Nathorn
2018-01-01
To comprehensively compare and rank the efficacy and safety of available treatment options for patients with MDR and XDR Acinetobacter baumannii (AB) infection. We searched PubMed, Embase and the Cochrane register of trials systematically for studies that examined treatment options for patients with MDR- and XDR-AB infections until April 2016. Network meta-analysis (NMA) was performed to estimate the risk ratio (RR) and 95% CI from both direct and indirect evidence. Primary outcomes were clinical cure and microbiological cure. Secondary outcomes were all-cause mortality and nephrotoxic and non-nephrotoxic adverse events. A total of 29 studies with 2529 patients (median age 60 years; 65% male; median APACHE II score 19.0) were included. Although there were no statistically significant differences between treatment options, triple therapy with colistin, sulbactam and tigecycline had the highest clinical cure rate. Colistin in combination with sulbactam was associated with a significantly higher microbiological cure rate compared with colistin in combination with tigecycline (RR 1.23; 95% CI 1.03-1.47) and colistin monotherapy (RR 1.21; 95% CI 1.06-1.38). No significant differences in all-cause mortality were noted between treatment options. Tigecycline-based therapy also appeared less effective for achieving a microbiological cure and is not appropriate for treating bloodstream MDR- and XDR-AB infections. Combination therapy of colistin with sulbactam demonstrates superiority in terms of microbiological cure with a safety profile similar to that of colistin monotherapy. Thus, our findings support the use of this combination as a treatment for MDR- and XDR-AB infections. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Tom Cattaert
Full Text Available We propose a novel multifactor dimensionality reduction method for epistasis detection in small or extended pedigrees, FAM-MDR. It combines features of the Genome-wide Rapid Association using Mixed Model And Regression approach (GRAMMAR with Model-Based MDR (MB-MDR. We focus on continuous traits, although the method is general and can be used for outcomes of any type, including binary and censored traits. When comparing FAM-MDR with Pedigree-based Generalized MDR (PGMDR, which is a generalization of Multifactor Dimensionality Reduction (MDR to continuous traits and related individuals, FAM-MDR was found to outperform PGMDR in terms of power, in most of the considered simulated scenarios. Additional simulations revealed that PGMDR does not appropriately deal with multiple testing and consequently gives rise to overly optimistic results. FAM-MDR adequately deals with multiple testing in epistasis screens and is in contrast rather conservative, by construction. Furthermore, simulations show that correcting for lower order (main effects is of utmost importance when claiming epistasis. As Type 2 Diabetes Mellitus (T2DM is a complex phenotype likely influenced by gene-gene interactions, we applied FAM-MDR to examine data on glucose area-under-the-curve (GAUC, an endophenotype of T2DM for which multiple independent genetic associations have been observed, in the Amish Family Diabetes Study (AFDS. This application reveals that FAM-MDR makes more efficient use of the available data than PGMDR and can deal with multi-generational pedigrees more easily. In conclusion, we have validated FAM-MDR and compared it to PGMDR, the current state-of-the-art MDR method for family data, using both simulations and a practical dataset. FAM-MDR is found to outperform PGMDR in that it handles the multiple testing issue more correctly, has increased power, and efficiently uses all available information.
vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.
Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej
2017-06-01
The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Transmission of MDR and XDR tuberculosis in Shanghai, China.
Directory of Open Access Journals (Sweden)
Ming Zhao
Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.
Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.
Directory of Open Access Journals (Sweden)
Kocfa Chung-Delgado
Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.
DEFF Research Database (Denmark)
Litman, Thomas; Druley, T E; Stein, W D
2001-01-01
The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....
International Nuclear Information System (INIS)
Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong; Gu, Yanhong; Shu, Yongqian; Sun, Yang; Shen, Yan; Xu, Qiang
2015-01-01
Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib
Energy Technology Data Exchange (ETDEWEB)
Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Gu, Yanhong; Shu, Yongqian [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Sun, Yang [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Shen, Yan, E-mail: shenyan@nju.edu.cn [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Xu, Qiang, E-mail: molpharm@163.com [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China)
2015-02-15
Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib.
Xiong, Yuqing; Yuan, Zhao; Yang, Jingzhi; Xia, Chunhua; Li, Xinhua; Huang, Shibo; Zhang, Hong; Liu, Mingyi
2016-04-01
Rupatadine (RUP) is an oral antihistamine and platelet-activating factor antagonist and is shown as the substrate of CYP3A5 and P-gp. The significant interindividual differences of CYP3A5 and P-gp often cause bioavailability differences of some clinical drugs. The present study is aimed to evaluate the effect of genetic polymorphisms of CYP3A5 and MDR1 on RUP pharmacokinetics in healthy male Chinese volunteer subjects. Blood samples were collected from 36 subjects before and after a single, oral RUP 10 mg dose. A PCR-RFLP assay was used to genotype CYP3A5*3 and assess MDR1 C3435T variation. A validated LC-MS/MS method quantified plasma RUP concentration. The relationship between RUP plasma concentration, pharmacokinetic parameters, and polymorphic alleles (CYP3A5 and MDR1) were assessed. Plasma RUP concentrations were lower for CYP3A5*1/*1 carriers than for CYP3A5*3/*3 and CYP3A5*1/*3 carriers. Mean C(max), AUC(0-t) and AUC(0-∞) were significantly lower, and the CLz and Vd were significantly higher in the CYP3A5 wild-type group, than in the CYP3A5 mutated group. MDR1 CT and MDR1 TT carriers had lower plasma RUP concentrations than MDR1 CC carriers. The mean C(max), AUC(0-t), AUC(0-∞) and T max were significantly lower in the TT group than in the CC and CT groups. The mean CLz was higher in the TT group than in the CC and CT groups, but not significantly. These results suggest that CYP3A5 and MDR1 may play a key role in the variability of RUP metabolism and transport, respectively. CYP3A5 and MDR1 polymorphisms may be the main explanation for the differences observed in RUP pharmacokinetics, and therefore may provide a rationale for safe and effective clinical use of RUP. Our research lays down a solid theory foundation to guide the safe and effective clinical use of RUP and a route to achieve individualized therapy.
Directory of Open Access Journals (Sweden)
Elvis Terci Valera
Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the
Czech Academy of Sciences Publication Activity Database
Campa, D.; Sainz, J.; Pardini, Barbara; Vodičková, Ludmila; Naccarati, Alessio; Rudolph, A.; Novotný, J.; Försti, A.; Buch, S.; von Schönfels, W.; Schafmayer, C.; Völzke, H.; Hoffmeister, M.; Frank, B.; Barale, R.; Hemminki, K.; Hampe, J.; Chang-Claude, J.; Brenner, H.; Vodička, Pavel; Canzian, F.
2012-01-01
Roč. 7, č. 3 (2012), e32784 E-ISSN 1932-6203 R&D Projects: GA ČR GA310/07/1430; GA ČR GAP304/10/1286 Institutional research plan: CEZ:AV0Z50390703 Keywords : single-nucleotide polymorphisms * resistance 1 mdr1 * p-glycoprotein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012
Chung, Janet; Zhang, Jane; Li, Haitang; Ouellet, Dominique L; DiGiusto, David L; Rossi, John J
2012-11-01
Combinational therapy with small RNA inhibitory agents against multiple viral targets allows efficient inhibition of viral production by controlling gene expression at critical time points. Here we explore combinations of different classes of therapeutic anti-HIV-1 RNAs expressed from within the context of an intronic MCM7 (minichromosome maintenance complex component-7) platform that naturally harbors 3 microRNAs (miRNAs). We replaced the endogenous miRNAs with anti-HIV small RNAs, including small interfering RNAs (siRNAs) targeting HIV-1 tat and rev messages that function to induce post-transcriptional gene silencing by the RNA interference pathway, a nucleolar-localizing RNA ribozyme that targets the conserved U5 region of HIV-1 transcripts for degradation, and finally nucleolar trans-activation response (TAR) and Rev-binding element (RBE) RNA decoys designed to sequester HIV-1 Tat and Rev proteins inside the nucleolus. We demonstrate the versatility of the MCM7 platform in expressing and efficiently processing the siRNAs as miRNA mimics along with nucleolar small RNAs. Furthermore, three of the combinatorial constructs tested potently suppressed viral replication during a 1-month HIV challenge, with greater than 5-log inhibition compared with untransduced, HIV-1-infected CEM T lymphocytes. One of the most effective constructs contains an anti-HIV siRNA combined with a nucleolar-localizing U5 ribozyme and TAR decoy. This represents the first efficacious example of combining Drosha-processed siRNAs with small nucleolar ribonucleoprotein (snoRNP)-processed nucleolar RNA chimeras from a single intron platform for effective inhibition of viral replication. Moreover, we demonstrated enrichment/selection for cells expressing levels of the antiviral RNAs that provide optimal inhibition under the selective pressure of HIV. The combinations of si/snoRNAs represent a new paradigm for combinatorial RNA-based gene therapy applications.
Wai, Pyae Phyo; Shewade, Hemant Deepak; Kyaw, Nang Thu Thu; Thein, Saw; Si Thu, Aung; Kyaw, Khine Wut Yee; Aye, Nyein Nyein; Phyo, Aye Mon; Maung, Htet Myet Win; Soe, Kyaw Thu; Aung, Si Thu
2018-01-01
The Union in collaboration with national TB programme (NTP) started the community-based MDR-TB care (CBMDR-TBC) project in 33 townships of upper Myanmar to improve treatment initiation and treatment adherence. Patients with MDR-TB diagnosed/registered under NTP received support through the project staff, in addition to the routine domiciliary care provided by NTP staff. Each township had a project nurse exclusively for MDR-TB and 30 USD per month (max. for 4 months) were provided to the patient as a pre-treatment support. To assess whether CBMDR-TBC project's support improved treatment initiation. In this cohort study (involving record review) of all diagnosed MDR-TB between January 2015 and June 2016 in project townships, CBMDR-TBC status was categorized as "receiving support" if date of project initiation in patient's township was before the date of diagnosis and "not receiving support", if otherwise. Cox proportional hazards regression (censored on 31 Dec 2016) was done to identify predictors of treatment initiation. Of 456 patients, 57% initiated treatment: 64% and 56% among patients "receiving support (n = 208)" and "not receiving support (n = 228)" respectively (CBMDR-TBC status was not known in 20 (4%) patients due to missing diagnosis dates). Among those initiated on treatment (n = 261), median (IQR) time to initiate treatment was 38 (20, 76) days: 31 (18, 50) among patients "receiving support" and 50 (26,101) among patients "not receiving support". After adjusting other potential confounders (age, sex, region, HIV, past history of TB treatment), patients "receiving support" had 80% higher chance of initiating treatment [aHR (0.95 CI): 1.8 (1.3, 2.3)] when compared to patients "not receiving support". In addition, age 15-54 years, previous history of TB and being HIV negative were independent predictors of treatment initiation. Receiving support under CBMDR-TBC project improved treatment initiation: it not only improved the proportion initiated but also
Stasiołek, Mariusz; Romanowicz, Hanna; Połatyńska, Katarzyna; Chamielec, Maciej; Skalski, Dominik; Makowska, Marianna; Smolarz, Beata
2016-07-08
Epilepsy is a disease of neurological character. Approximately one third of epileptic patients demonstrate a drug-resistant phenotype, which is associated with the development of drug-resistant epilepsy. The multidrug resistance protein 1 and glycoprotein P, encoded by MDR1, play a significant role in the transmembrane transport of anti-epileptic agents. Single nucleotide polymorphism C3435T (rs1045642) within MDR1 gene may be associated with an increased expression of P-gp which affects the levels of antiepileptic drugs in plasma. The presented studies analysed the association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children. C3435T polymorphism of MDR1 gene was analysed by the high resolution melting technique in a group of patients with drug-resistant (n = 106) and drug-responsive epilepsy (n = 67), as well as in non-epileptic children (n = 98) hospitalised at the Department of Neurology, Polish Mother's Memorial Hospital in Lodz. Genotype and allele distributions were evaluated and their compatibility with the Hardy-Weinberg distribution was assessed by means of the χ(2) test. Genotype and allele evaluation, regarding their relationship with a given feature, was supported by an analysis of odds ratio and 95 % confidence interval, calculated according to the logistic regression model. An association was observed between the incidence rate of DRE and the presence of C allele in C3435T polymorphism of MDR1 gene, which may enhance the risk of the disease. The T allele may then play a protective role. No differences were found in the studied groups, regarding either genotype or allele distribution in reference to patient's gender or concomitant diseases. Following the obtained results, C3435T polymorphism of MDR1 gene may be connected with the incidence of drug-resistant epilepsy in the population of Polish children. ISRCTN ISRCTN73824458. Registered 28th September 2014.
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind
2015-01-01
transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...
Gagliardi, Rosa; Llambí, Silvia; Arruga, M Victoria
2015-01-01
The fields of pharmacogenetics and pharmacogenomics have become increasingly promising regarding the clinical application of genetic data to aid in prevention of adverse reactions. Specific screening tests can predict which animals express modified proteins or genetic sequences responsible for adverse effects associated with a drug. Among the genetic variations that have been investigated in dogs, the multidrug resistance gene (MDR) is the best studied. However, other genes such as CYP1A2 and CYP2B11 control the protein syntheses involved in the metabolism of many drugs. In the present study, the MDR-1, CYP1A2 and CYP2B11 genes were examined to identify SNP polymorphisms associated with these genes in the following four canine breeds: Uruguayan Cimarron, Border Collie, Labrador Retriever and German Shepherd. The results revealed that several SNPs of the CYP1A2 and CYP2B11 genes are potential targets for drug sensitivity investigations.
Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad
2018-01-27
There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak
EXSPRESSION OF MDR-GENES AND MONORESISTANCE GENES IN NON-SMALL-CELL LUNG CANCER
Directory of Open Access Journals (Sweden)
E. L. Yumov
2014-01-01
Full Text Available We studied the expression of multidrug resistance genes (MDR and monoresistance genes in normal bronchial tissue and tumor tissue of the non-small cell lung cancer (NSCLC after neoadjuvant chemotherapy (NACT (vinorelbine-carboplatine. The study included 30 patients with NSCLC (Т2–4N0–3M0. Normal bronchial tissue, normal lung tissue and tumor tissue collected during surgery following neoadjuvant chemotherapy (NACT served as a material of the study. The expression levels of MDR genes (ABCB1, ABCB2, ABCC1, ABCC2, ABCС5, ABCG1, ABCG2, GSTP and MVP, and monoresistance genes (BRCA1, ERCC1, RRM1, TOP1, TOP2A, TUBB3 and TYMS were estimated by quantitative reverse transcriptase PCR (RT-qPCR. The expression levels of some MDR genes and monoresistance genes (АВСВ1, АВСВ2, ABCG1, ERCC1, GSTP1 and MVP were significantly higher in the bronchi than in tumor tissue. The expression of ABCG1, ABCG2 and ERCC1 genes was higher in patients with T1-2 cancer than in patients with T3-4 cancer. Patients with adenocarcinoma had higher expression of BRCA1, MVP and ABCB1 genes than patients with squamous cell lung cancer. A tendency towards reduction in the expression level of MDR-genes and monoresistance genes was observed in patients with partial tumor regression compared to that observed in patients with stable disease. These findings were consistent with the previous data on reduction in the MDR-gene expression after chemotherapy with a good response in breast cancer patients.
Heightened vulnerability to MDR-TB epidemics after controlling drug-susceptible TB.
Directory of Open Access Journals (Sweden)
Jason D Bishai
2010-09-01
Full Text Available Prior infection with one strain TB has been linked with diminished likelihood of re-infection by a new strain. This paper attempts to determine the role of declining prevalence of drug-susceptible TB in enabling future epidemics of MDR-TB.A computer simulation of MDR-TB epidemics was developed using an agent-based model platform programmed in NetLogo (See http://mdr.tbtools.org/. Eighty-one scenarios were created, varying levels of treatment quality, diagnostic accuracy, microbial fitness cost, and the degree of immunogenicity elicited by drug-susceptible TB. Outcome measures were the number of independent MDR-TB cases per trial and the proportion of trials resulting in MDR-TB epidemics for a 500 year period after drug therapy for TB is introduced.MDR-TB epidemics propagated more extensively after TB prevalence had fallen. At a case detection rate of 75%, improving therapeutic compliance from 50% to 75% can reduce the probability of an epidemic from 45% to 15%. Paradoxically, improving the case-detection rate from 50% to 75% when compliance with DOT is constant at 75% increases the probability of MDR-TB epidemics from 3% to 45%.The ability of MDR-TB to spread depends on the prevalence of drug-susceptible TB. Immunologic protection conferred by exposure to drug-susceptible TB can be a crucial factor that prevents MDR-TB epidemics when TB treatment is poor. Any single population that successfully reduces its burden of drug-susceptible TB will have reduced herd immunity to externally or internally introduced strains of MDR-TB and can experience heightened vulnerability to an epidemic. Since countries with good TB control may be more vulnerable, their self interest dictates greater promotion of case detection and DOTS implementation in countries with poor control to control their risk of MDR-TB.
Harivenkatesh, Natarajan; Kumar, Lalit; Bakhshi, Sameer; Sharma, Atul; Kabra, Madhulika; Velpandian, Thirumurthy; Gogia, Ajay; Shastri, Shivaram S; Gupta, Yogendra Kumar
2017-09-01
Influence of polymorphisms in the genes coding for imatinib transporters and metabolizing enzymes on cytogenetic relapse in patients with chronic myeloid leukemia (CML) is not known. One hundred and four patients (52 cases with cytogenetic relapse and 52 controls without relapse) with chronic-phase CML on imatinib therapy and have completed 5 years of follow-up were enrolled. The following single nucleotide polymorphisms (SNPs) were genotyped; C1236T, C3435T, G2677T/A in MDR1 gene and A6986G in CYP3A5 gene, using PCR-RFLP method and validated by direct gene sequencing. Imatinib trough levels were measured using LC-MS/MS. Patients with CC genotype for MDR1-C1236T polymorphism were at significantly higher risk for cytogenetic relapse [OR =4.382, 95% CI (1.145, 16.774), p = .022], while those with TT genotype for MDR1-C3435T polymorphism had significantly lower risk of relapse [OR =0.309, 95% CI (0.134, 0.708), p = .005]. Imatinib trough levels were lower in patients with relapse compared to those without relapse (1551.4 ± 1324.1 vs. 2154.2 ± 1358.3 ng/mL; p = .041). MDR1-C3435T genotype [adjusted-OR: 0.266; 95% CI (0.111, 0.636); p = .003] and trough levels (p = .014) were independent predictors of relapse in multivariate analysis. To conclude, C1236T and C3435T polymorphisms in MDR1 gene and trough levels significantly influence the risk of cytogenetic relapse. MDR1-C3435T genotype might emerge as a potential biomarker to predict the risk of cytogenetic relapse in patients with CML.
Yang, Hong; Deng, Liwei; Li, Tingting; Shen, Xue; Yan, Jie; Zuo, Liangming; Wu, Chunhui; Liu, Yiyao
2015-12-01
Multidrug resistance (MDR) is a major impediment to the success of cancer chemotherapy. One of the effective approaches to overcome MDR is to use nanoparticle-mediated the gene silence of chemotherapeutic export proteins by RNA interference to increase drug accumulation in drug resistant cancer cells. In this work, a new co-delivery system, DOX-PLGA/PEI/P-gp shRNA nanobubbles (NBs) around 327 nm, to overcome doxorubicin (DOX) resistance in MCF-7 human breast cancer was designed and developed. Positively charged polyethylenimine (PEI) were modified onto the surface of DOX-PLGA NBs through DCC/NHS crosslinking, and could efficiently condense P-gp shRNA into DOX-PLGA/PEI NBs at vector/shRNA weight ratios of 70:1 and above. An in vitro release profile demonstrated an efficient DOX release (more than 80%) from DOX-PLGA/PEI NBs at pH 4.4, suggesting a pH-responsive drug release for the multifunctionalized NBs. Cellular experimental results further showed that DOX-PLGA/PEI/P-gp shRNA NBs could facilitate cellular uptake of DOX into cells and increase the cell proliferation suppression effect of DOX against MCF-7/ADR cells (a DOX-resistant and P-glycoprotein (P-gp) over-expression cancer cell line). The IC50 of DOX-PLGA NBs against MCF-7/ADR cells was 2-fold lower than that of free DOX. The increased cellular uptake and nuclear accumulation of DOX delivered by DOX-PLGA/PEI/P-gp shRNA NBs in MCF-7/ADR cells was confirmed by fluorescence microscopy and fluorescence spectrophotometry, and might be owning to the down-regulation of P-gp and reduced the efflux of DOX. The cellular uptake mechanism of DOX-PLGA/PEI/P-gp shRNA NBs indicated that the macropinocytosis was one of the pathways for the uptake of NBs by MCF-7/ADR cells, which was also an energy-dependent process. Furthermore, the in vitro cellular ultrasound imaging suggested that the employment of the DOX-PLGA/PEI/P-gp shRNA NBs could efficiently enhance ultrasound imaging of cancer cells. These results demonstrated
Shiokawa, Zenyu; Hashimoto, Kentaro; Saito, Bunnai; Oguro, Yuya; Sumi, Hiroyuki; Yabuki, Masato; Yoshimatsu, Mie; Kosugi, Yohei; Debori, Yasuyuki; Morishita, Nao; Dougan, Douglas R; Snell, Gyorgy P; Yoshida, Sei; Ishikawa, Tomoyasu
2013-12-15
We previously reported octahydropyrrolo[1,2-a]pyrazine derivative 2 (T-3256336) as a potent antagonist for inhibitors of apoptosis (IAP) proteins. Because compound 2 was susceptible to MDR1 mediated efflux, we developed another scaffold, hexahydropyrazino[1,2-a]indole, using structure-based drug design. The fused benzene ring of this scaffold was aimed at increasing the lipophilicity and decreasing the basicity of the scaffold to improve the membrane permeability across MDR1 expressing cells. We established a chiral pool synthetic route to yield the desired tricyclic chiral isomers. Chemical modification of the core scaffold led to a representative compound 50, which showed strong inhibition of IAP binding (X chromosome-linked IAP [XIAP]: IC50 23 nM and cellular IAP [cIAP]: IC50 1.1 nM) and cell growth inhibition (MDA-MB-231 cells: GI50 2.8 nM) with high permeability and low potential of MDR1 substrate. Copyright © 2013 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Andersen, Vibeke; Svenningsen, Katrine; Almind Knudsen, Lina
2015-01-01
AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette...... with glucocorticoids. The evidence for the involvement of ABCC2 and ABCG2 in colonic pathophysiology was weak. CONCLUSION: ABCB1, diet, and gut microbes mutually interact in colonic inflammation, a well-known risk factor for CRC. Further insight may be translated into preventive and treatment strategies....... transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1...
Zhang, Yu-Xin; Wei, Shi-Jie; Yang, Xiao-Ying; Zhang, Wen-Ping; Wang, Xin-Yu; Dang, Hong-Wan
2014-10-01
To evaluate the influence of CYP2C19*2/*3 and MDR1 C3435T polymorphisms on the pharmacokinetics of lansoprazole (LPZ) in healthy Chinese subjects. All 24 subjects were from a study of bioequivalence. Plasma concentrations of LPZ were determined by liquid chromatography/mass spectrometry. Cytochrome P450 (CYP) 2C19*2/*3 and multidrug resistance transporter gene 1 (MDR1) C3435T of the subjects were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Significant differences were found in the area under the concentration-time curve from predose to T (AUC(0-T)), area under the concentration-time curve from predose to infinity (AUC(0-∞), t(1/2)), and apparent oral clearance (CL/F) of LPZ between CYP2C19 extensive metabolizers and intermediate metabolizers (p < 0.05). The AUC(0-T), AUC(0-∞), maximum plasma concentration, and CL/F of LPZ were significantly different between subjects with the MDR1 C3435T C/C, C/T, and T/T polymorphisms (p < 0.05). CYP2C19*2/*3 and MDR1 C3435T polymorphisms are important determinants of LPZ pharmacokinetics.
Detekce polymorfismu v genu MDR1 u ovčáckých a honáckých psů
Staroveská, Marieta
2016-01-01
This thesis is focused on polymorphism of MDR1 gene and related drug resistance. Resistance is caused by deletion of four nucleotids, that resulting in a frame shift and synthesis of nonfunctional transport of P-glycoprotein. The text describes a polymorphism of MDR1 (ABCB1) gene, which results in reduced resistance to drugs belonging to the group of macrocyclic lactones. It also describes inheritance of this phenomenon and it deals with the detection of mutation using PCR (polymerase chain r...
International Nuclear Information System (INIS)
Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.
2017-01-01
Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)
Chen, Bryan Wei; Chen, Wei; Liang, Hui; Liu, Hao; Liang, Chao; Zhi, Xiao; Hu, Li-Qiang; Yu, Xia-Zhen; Wei, Tao; Ma, Tao; Xue, Fei; Zheng, Lei; Zhao, Bin; Feng, Xin-Hua; Bai, Xue-Li; Liang, Ting-Bo
2015-08-01
mTOR is aberrantly activated in hepatocellular carcinoma (HCC) and plays pivotal roles in tumorigenesis and chemoresistance. Rapamycin has been reported to exert antitumor activity in HCC and sensitizes HCC cells to cytotoxic agents. However, due to feedback activation of AKT after mTOR complex 1 (mTORC1) inhibition, simultaneous targeting of mTORC1/2 may be more effective. In this study, we examined the interaction between the dual mTORC1/2 inhibitor OSI-027 and doxorubicin in vitro and in vivo. OSI-027 was found to reduce phosphorylation of both mTORC1 and mTORC2 substrates, including 4E-BP1, p70S6K, and AKT (Ser473), and inhibit HCC cell proliferation. Similar to OSI-027 treatment, knockdown of mTORC2 induced G0-G1 phase cell-cycle arrest. In contrast, rapamycin or knockdown of mTORC1 increased phosphorylation of AKT (Ser473), yet had little antiproliferative effect. Notably, OSI-027 synergized with doxorubicin for the antiproliferative efficacy in a manner dependent of MDR1 expression in HCC cells. The synergistic antitumor effect of OSI-027 and doxorubicin was also observed in a HCC xenograft mouse model. Moreover, AKT was required for OSI-027-induced cell-cycle arrest and downregulation of MDR1. Our findings provide a rationale for dual mTORC1/mTORC2 inhibitors, such as OSI-027, as monotherapy or in combination with cytotoxic agents to treat HCC. Mol Cancer Ther; 14(8); 1805-15. ©2015 AACR. ©2015 American Association for Cancer Research.
Moiseeva, N I; Susova, O Yu; Mitrofanov, A A; Panteleev, D Yu; Pavlova, G V; Pustogarov, N A; Stavrovskaya, A A; Rybalkina, E Yu
2016-06-01
Glioblastomas (GBL) are the most common and aggressive brain tumors. They are distinguished by high resistance to radiation and chemotherapy. To find novel approaches for GBL classification, we obtained 16 primary GBL cell cultures and tested them with real-time PCR for mRNA expression of several genes (YB-1, MGMT, MELK, MVP, MDR1, BCRP) involved in controlling cell proliferation and drug resistance. The primary GBL cultures differed in terms of proliferation rate, wherein a group of GBL cell cultures with low proliferation rate demonstrated higher resistance to temozolomide. We found that GBL primary cell cultures characterized by high proliferation rate and lower resistance to temozolomide expressed higher mRNA level of the YB-1 and MDR1 genes, whereas upregulated expression of MVP/LRP mRNA was a marker in the group of GBL with low proliferation rate and high resistance. A moderate correlation between expression of YB-1 and MELK as well as YB-1 and MDR1 was found. In the case of YB-1 and MGMT expression, no correlation was found. A significant negative correlation was revealed between mRNA expression of MVP/LRP and MELK, MDR1, and BCRP. No correlation in expression of YB-1 and MVP/LRP genes was observed. It seems that mRNA expression of YB-1 and MVP/LRP may serve as a marker for GBL cell cultures belonging to distinct groups, each of which is characterized by a unique pattern of gene activity.
Directory of Open Access Journals (Sweden)
Linardi Renata Lehn
2006-01-01
Full Text Available (MDR1 gene expressed in tumor cells and also in several normal tissues, such as intestine, liver, kidney, blood-brain barrier, spinal cord, and placenta. P-gp has been identified in mice, rat, bovine, monkey, rodents, and human beings and has been receiving a particular clinical relevance because this protein expression limits brain access and intestinal absorption of many drugs. This protein plays a role as a protective barrier against a wide variety of substrates, avoiding drug entry into the central nervous system. P-glycoprotein also interferes with drug bioavailability and disposition, including absorption, distribution, metabolization, and excretion, influencing pharmacokinetic and pharmacodynamic of drugs. Modulation of P-gp may help the efficacy of treatment of several diseases and can explain some adverse central nervous system effects induced by drugs after intravenous administration and the poor response of oral administration in patients. Alteration in P-gp expression or function has been associated with several diseases susceptibility in humans and animals. Furthermore, additional studies relating MDR1 and P-gp expression has an important clinical implication also in terms of treatment efficacy.
Aleo, Michael D; Shah, Falgun; He, Kan; Bonin, Paul D; Rodrigues, A David
2017-05-15
The role of bile salt export protein (BSEP) inhibition in drug-induced liver injury (DILI) has been investigated widely, while inhibition of the canalicular multidrug resistant protein 3 (MDR3) has received less attention. This transporter plays a pivotal role in secretion of phospholipids into bile and functions coordinately with BSEP to mediate the formation of bile acid-containing biliary micelles. Therefore, inhibition of MDR3 in human hepatocytes was examined across 125 drugs (70 of Most-DILI-concern and 55 of No-DILI-concern). Of these tested, 41% of Most-DILI-concern and 47% of No-DILI-concern drugs had MDR3 IC 50 values of <50 μM. A better distinction across DILI classifications occurred when systemic exposure was considered where safety margins of 50-fold had low sensitivity (0.29), but high specificity (0.96). Analysis of physical chemical property space showed that basic compounds were twice as likely to be MDR3 inhibitors as acids, neutrals, and zwitterions and that inhibitors were more likely to have polar surface area (PSA) values of <100 Å 2 and cPFLogD values between 1.5 and 5. These descriptors, with different cutoffs, also highlighted a group of compounds that shared dual potency as MDR3 and BSEP inhibitors. Nine drugs classified as Most-DILI-concern compounds (four withdrawn, four boxed warning, and one liver injury warning in their approved label) had intrinsic potency features of <20 μM in both assays, thereby reinforcing the notion that multiple inhibitory mechanisms governing bile formation (bile acid and phospholipid efflux) may confer additional risk factors that play into more severe forms of DILI as shown by others for BSEP inhibitors combined with multidrug resistance-associated protein (MRP2, MRP3, MRP4) inhibitory properties. Avoiding physical property descriptors that highlight dual BSEP and MDR3 inhibition or testing drug candidates for inhibition of multiple efflux transporters (e.g., BSEP, MDR3, and MRPs) may be an effective
Evers, R.; Kool, M.; Smith, A. J.; van Deemter, L.; de Haas, M.; Borst, P.
2000-01-01
The human multidrug transporter MDR1 P-glycoprotein and the multidrug resistance proteins MRP1 and MRP2 transport a range of cytotoxic drugs, resulting in multidrug resistance in tumour cells. To overcome this form of drug resistance in patients, several inhibitors (reversal agents) of these
Directory of Open Access Journals (Sweden)
Delianis Pringgenies
2014-03-01
The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test, sensitivity test for antibacterial, DNA exctraction, DNA amplification based on PCR method, DNA sequencing. Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant
Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis
Directory of Open Access Journals (Sweden)
Mayara Lisboa Bastos
2017-11-01
Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational
Schelz, Zsuzsanna; Molnár, Joseph; Fogliano, Vincenzo; Ferracane, Rosalia; Pernice, Rita; Shirataki, Yoshiaki; Motohashi, Noboru
2006-01-01
In earlier experiments, the MDR (multidrug resistance)-reversal activities of Anastasia Black (Russian black sweet pepper) extracts had been analysed. Recently, the most effective MDR reversing extracts and fractions have been separated by HPLC (high-performance liquid chromatography, for carotenoids) and LC-MS-MS (HPLC combined with mass spectrometry, for phenolic compounds) methods. As a result of the analytical studies, the following flavonoids had been identified: feruloyl glucopyranoside, quercetin rhamnopyranoside glucopyranoside, luteolin glucopyranoside arabinopyranoside, apigenin glucopyranoside arabinopyranoside, quercetin rhamnopyranoside, luteolin arabinopyranoside diglucopy-ranoside, hesperidine and luteolin glucuronide. According to the literature, the aglycones of these phenolic compounds exhibit MDR-reversal activity in vitro, and the connection between the phenolic content of Anastasia Black and MDR-reversal action was therefore studied by different analytical methods. The results of this study revealed that the identified flavonoids of Anastasia Black may be only partially responsible for the modulation of the MDR of mouse lymphoma cells. Other lipophilic compounds, most probably carotenoids, present in Russian black sweet pepper may act as inhibitors of MDR reversal.
Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie
2017-02-01
This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.
Ménez, Cécile; Sutra, Jean-François; Prichard, Roger; Lespine, Anne
2012-01-01
The anthelmintics ivermectin (IVM) and moxidectin (MOX) display differences in toxicity in several host species. Entrance into the brain is restricted by the P-glycoprotein (P-gp) efflux transporter, while toxicity is mediated through the brain GABA(A) receptors. This study compared the toxicity of IVM and MOX in vivo and their interaction with GABA(A) receptors in vitro. Drug toxicity was assessed in Mdr1ab(−/−) mice P-gp-deficient after subcutaneous administration of increasing doses (0.11–2.0 and 0.23–12.9 µmol/kg for IVM and MOX in P-gp-deficient mice and half lethal doses (LD50) in wild-type mice). Survival was evaluated over 14-days. In Mdr1ab(−/−) mice, LD50 was 0.46 and 2.3 µmol/kg for IVM and MOX, respectively, demonstrating that MOX was less toxic than IVM. In P-gp-deficient mice, MOX had a lower brain-to-plasma concentration ratio and entered into the brain more slowly than IVM. The brain sublethal drug concentrations determined after administration of doses close to LD50 were, in Mdr1ab(−/−) and wild-type mice, respectively, 270 and 210 pmol/g for IVM and 830 and 740–1380 pmol/g for MOX, indicating that higher brain concentrations are required for MOX toxicity than IVM. In rat α1β2γ2 GABA channels expressed in Xenopus oocytes, IVM and MOX were both allosteric activators of the GABA-induced response. The Hill coefficient was 1.52±0.45 for IVM and 0.34±0.56 for MOX (p<0.001), while the maximum potentiation caused by IVM and MOX relative to GABA alone was 413.7±66.1 and 257.4±40.6%, respectively (p<0.05), showing that IVM causes a greater potentiation of GABA action on this receptor. Differences in the accumulation of IVM and MOX in the brain and in the interaction of IVM and MOX with GABA(A) receptors account for differences in neurotoxicity seen in intact and Mdr1-deficient animals. These differences in neurotoxicity of IVM and MOX are important in considering their use in humans. PMID:23133688
Larsson, R; Nygren, P
1990-07-15
A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).
Lai, Yong; Huang, Min; Li, Hui; Wang, Xue-Ding; Li, Jia-Li
2012-11-01
P-Glycoprotein (P-gp, encoded by MDR1 gene) plays an important role in determining bioavailability and pharmacologic effects of many drugs. There is increasing evidence that P-gp activity may be genetically determined. In this study, we investigated the genotype distribution and the haplotype profiles of MDR1 gene in Chinese Han, Bai, Wa and Tibetan subjects. Much lower frequencies of the 1236T allele and the 2677T allele were found in Wa subjects than those in other three ethnic groups, while the 2677A allele was found about 6-fold more frequently in Han subjects than in subjects of other three ethnic groups. The Han, Bai and Tibetan subjects share the same three predominant haplotypes (T-T-T, T-G-C and C-G-C), and T-T-T is the highest and accounts for more than one third of the number of haplotypes in the subjects from each ethnic group. However, T-T-T was less common than T-G-C, T-G-T and C-G-C and occurring at only 13.8% in Wa subjects, furthermore, higher frequencies of T-G-T, C-T-C, C-G-T and C-T-T were observed in Wa subjects compared to those in other three ethnic groups. Frequencies of C-A-C and T-A-C in Han subjects were higher than those in other three ethnic groups. The findings of this study will be of some relevance in predicting MDR1 phenotype and pharmacokinetics as well as pharmacodynamic effects of many commonly used drugs that are P-gp substrates in these four Chinese ethnic groups.
Dekel, Yaron; Machluf, Yossy; Stoler, Aviad; Aderet, Arava; Baumel, Daniel; Kellerman, Efrat; Plotsky, Yoram; Noked Partouche, Oshrat; Elhalal, Gal; Ben-Shlomo, Izhar; Bercovich, Dani
2017-11-13
Sensitivity to macrocyclic lactones, which are commonly used in veterinary clinics, was first found in Rough Collies, and was attributed in 2001 to a 4 bp deletion in the MDR1 gene. The list of affected breeds currently includes 13 breeds. Researchers from different countries and continents examined the allelic frequencies of the nt230(del4) MDR1 mutation, emphasizing the clinical importance of this test not only to mutation-prone dogs, but also to their crosses and mongrels, since treatment of a deletion carrier with these compounds may lead to its death. In this study, the allelic frequencies of nt230(del4) MDR1 mutation in affected breeds, their crosses, unrelated pure breeds and mongrels are reported for the state of Israel (n = 1416 dogs). The Israeli data were compared with reports from the US, Europe, UK, Australia and Japan. The allelic frequencies of nt230(del4) MDR1 mutation in Israel for Australian, Swiss and German Shepherds (31%, 17% and 2.4%, respectively) are similar to the corresponding frequencies worldwide, much higher for Border Collies (4.8%), twice lower for Rough Collies (28%, compared to 55% or more elsewhere), and ~1% for mongrels. The frequencies for crosses of Australian Shepherd and Border Collies in Israel are 4 and 1.6 times lower, respectively, compared to the frequencies for the respective pure breeds. This work, that for the first time presents the frequency of nt230(del4) MDR1 mutation in Israel, along with a worldwide survey, has implications for clinicians, owners and breeders of sheepdogs and their crosses and supports the need for extra care in treatment and in future breeding. Of note, the relative proportion of affected breeds, in the overall tested dogs, might be higher than their actual proportion in Israel due to directed samples collection by veterinarians for clinical purposes, as these are mainly limited to certain affected breeds or dogs that resemble them.
Directory of Open Access Journals (Sweden)
Roshan Mascarenhas
Full Text Available mRNA translation into proteins is highly regulated, but the role of mRNA isoforms, noncoding RNAs (ncRNAs, and genetic variants remains poorly understood. mRNA levels on polysomes have been shown to correlate well with expressed protein levels, pointing to polysomal loading as a critical factor. To study regulation and genetic factors of protein translation we measured levels and allelic ratios of mRNAs and ncRNAs (including microRNAs in lymphoblast cell lines (LCL and in polysomal fractions. We first used targeted assays to measure polysomal loading of mRNA alleles, confirming reported genetic effects on translation of OPRM1 and NAT1, and detecting no effect of rs1045642 (3435C>T in ABCB1 (MDR1 on polysomal loading while supporting previous results showing increased mRNA turnover of the 3435T allele. Use of high-throughput sequencing of complete transcript profiles (RNA-Seq in three LCLs revealed significant differences in polysomal loading of individual RNA classes and isoforms. Correlated polysomal distribution between protein-coding and non-coding RNAs suggests interactions between them. Allele-selective polysome recruitment revealed strong genetic influence for multiple RNAs, attributable either to differential expression of RNA isoforms or to differential loading onto polysomes, the latter defining a direct genetic effect on translation. Genes identified by different allelic RNA ratios between cytosol and polysomes were enriched with published expression quantitative trait loci (eQTLs affecting RNA functions, and associations with clinical phenotypes. Polysomal RNA-Seq combined with allelic ratio analysis provides a powerful approach to study polysomal RNA recruitment and regulatory variants affecting protein translation.
Woo, Ho-Hyung; Baker, Terri; Laszlo, Csaba; Chambers, Setsuko K.
2013-01-01
CSF-1 mRNA 3′UTR contains multiple unique motifs, including a common microRNA (miRNA) target in close proximity to a noncanonical G-quadruplex and AU-rich elements (AREs). Using a luciferase reporter system fused to CSF-1 mRNA 3′UTR, disruption of the miRNA target region, G-quadruplex, and AREs together dramatically increased reporter RNA levels, suggesting important roles for these cis-acting regulatory elements in the down-regulation of CSF-1 mRNA. We find that nucleolin, which binds both G-quadruplex and AREs, enhances deadenylation of CSF-1 mRNA, promoting CSF-1 mRNA decay, while having the capacity to increase translation of CSF-1 mRNA. Through interaction with the CSF-1 3′UTR miRNA common target, we find that miR-130a and miR-301a inhibit CSF-1 expression by enhancing mRNA decay. Silencing of nucleolin prevents the miRNA-directed mRNA decay, indicating a requirement for nucleolin in miRNA activity on CSF-1 mRNA. Downstream effects followed by miR-130a and miR-301a inhibition of directed cellular motility of ovarian cancer cells were found to be dependent on nucleolin. The paradoxical effects of nucleolin on miRNA-directed CSF-1 mRNA deadenylation and on translational activation were explored further. The nucleolin protein contains four acidic stretches, four RNA recognition motifs (RRMs), and nine RGG repeats. All three domains in nucleolin regulate CSF-1 mRNA and protein levels. RRMs increase CSF-1 mRNA, whereas the acidic and RGG domains decrease CSF-1 protein levels. This suggests that nucleolin has the capacity to differentially regulate both CSF-1 RNA and protein levels. Our finding that nucleolin interacts with Ago2 indirectly via RNA and with poly(A)-binding protein C (PABPC) directly suggests a nucleolin-Ago2-PABPC complex formation on mRNA. This complex is in keeping with our suggestion that nucleolin may work with PABPC as a double-edged sword on both mRNA deadenylation and translational activation. Our findings underscore the complexity of
Directory of Open Access Journals (Sweden)
Irwan Supriyanto
2017-08-01
Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.
Imaging and Targeted Therapy of Multidrug Resistance. Final Report
International Nuclear Information System (INIS)
Piwnica-Worms, David
2009-01-01
One focus area of DOE Office of Science was the Imaging of Gene Expression in Health and Disease in real time in tissue culture, whole animals and ultimately patients. Investigators of the Molecular Imaging Group, Washington University Medical School, ascribed to this objective and a major focus of this group directly tied into the DOE program through their efforts targeting the multidrug resistance gene (MDR1). Our plans for continuation of the program were to extend and build on this line of investigation, incorporating new molecular tools into our methodology to selectively inhibit MDR1 gene expression with novel modulation strategies. Two approaches were to be pursued: (1) high throughput screening of compounds that disrupted mutant p53 transactivation of the MDR1 promoter, and (2) knockdown of MDR1 messenger RNA with retroviral-mediated delivery of small interfering RNA constructs. These would be combined with our continuing effort to synthesize ligands and examine structure-activity relationships of bis-salicylaldehydes labeled with gallium-68 to generate PET agents for imaging MDR1 P-glycoprotein function. We would be uniquely positioned to correlate therapeutic modulation of MDR1 gene expression and protein function in the same systems in vivo using PET and bioluminescence reporters. Use of animal models such as the mdr1a/1b(-/-) gene deleted mice would also have enabled refined analysis of modulation and tracer pharmacokinetics in vivo. Overall, this DOE program and resultant tools would enable direct monitoring of novel therapeutic strategies and the MDR phenotype in relation to gene expression and protein function in vivo.
MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years.
Directory of Open Access Journals (Sweden)
Naira Dekhil
Full Text Available Multidrug-resistant tuberculosis (MDR-TB outbreaks that evolve, from the outset, in a context strictly negative for HIV infection deserve special consideration since they reflect the true intrinsic epidemic potential of the causative strain. To our knowledge, the long-term evolution of such exceptional outbreaks and the treatment outcomes for the involved patients has never been reported hitherto. Here we provide a thorough description, over an 11-year period, of an MDR-TB outbreak that emerged and expanded in an HIV-negative context, Northern Tunisia.From October 2001 to June 2011, the MDR-TB outbreak involved 48 HIV-negative individuals that are mainly young (mean age 31.09 yrs; 89.6% male and noninstitutionalized. Drug susceptibility testing coupled to mutational analysis revealed that initial transmission involved an isolate that was simultaneously resistant to isoniazid, rifampicin, ethambutol, and streptomycin. The causative Haarlem3-ST50 outbreak strain expanded mainly as an 11-banded IS6110 RFLP profile (77.1%, from which a 12-banded subclone evolved. After undergoing a 2-year treatment with second-line drugs, 22 (45.8% patients were cured and 3 (6.2% completed treatment, thus yielding an overall treatment success rate of 52.1%. Among the patients that experienced unfavorable treatment outcomes, 10 (20.8% failed treatment, 3 (6.2% were lost to follow-up, 5 (10.4% died, and 5 (10.4% could not be evaluated. Poor adherence to treatment was found to be the main independent predictor of unfavorable outcomes (HR: 9.15; 95% CI 1.72-48.73; P = 0.014. Intriguingly, the evolved 12-banded subclone proved significantly associated with unfavorable outcomes (HR: 4.90; 95% CI 1.04-23.04, P = 0.044. High rate of fatality and relapse was further demonstrated at the long-term, since 70% of those whose treatment failed have died, and 24% among those deemed successfully treated have relapsed.Taken together, the data obtained in this study indicate that MDR
Triandala Sibero, Mada; Sabdaningsih, Aninditia; Cristianawati, Olvi; Nuryadi, Handung; Karna Radjasa, Ocky; Sabdono, Agus; Trianto, Agus
2017-02-01
Irrational used of antibiotic in several decades ago causing resistant in bacteria and decreasing the cure rate of infectious diseases. Multidrug-resistant (MDR) Escherichia coli is known to cause various of infectious diseases such as urinary tract infection, nosocomial bloodstream infection, meningitis, bacteraemia, and gastrointestinal disease. Marine sponge-associated fungi have potential as source of new compound to combat MDR E. coli. The aims of this research were to isolate marine sponge-assosiated fungi, to screen potential fungi against MDR E. coli, to identify the potential fungi and its host sponge. There were 29 marine sponge-associated fungi successfully isolated from 9 sponges. Among 29 sponge-associated fungi screened, there were 7 isolates showed antibacterial activity against MDR E. coli. The best inhibition zone produced by MPS 14.1/MT 02 and MPS 14.3/MT 04 from sponge PP.SP.16.14. According to fungi identification result fungus MPS 14.1/MT 02 was identified as Trichoderma asperellum while MPS 14.3/MT 04 was identified as Trichoderma reesei. Sponge identification leaded the PP.SP.16.14 as Cinachyrella sp.
Morris, M D; Quezada, L; Bhat, P; Moser, K; Smith, J; Perez, H; Laniado-Laborin, R; Estrada-Guzman, J; Rodwell, T C
2013-07-01
The State of Baja California, Mexico, had the highest prevalence of multidrug-resistant tuberculosis (MDR-TB) in Mexico in 2009. To understand the socio-economic burden of MDR-TB disease and its treatment on patients in Tijuana and Mexicali, Mexico. From July to November 2009, qualitative interviews were conducted with 12 patients enrolled in a US-Mexico binational MDR-TB treatment program, Puentes de Esperanza (Bridges of Hope), which was designed to support MDR-TB patients. In-depth interviews were coded to identify major themes in patient experiences of MDR-TB diagnosis and care. While some patients were able to maintain their pre-MDR-TB lives to a limited extent, most patients reported losing their sense of identity due to their inability to work, social isolation, and stigmatization from family and friends. The majority of participants expressed appreciation for Puentes' role in 'saving their lives'. Being diagnosed with MDR-TB and undergoing treatment imposes significant psychological, social and economic stress on patients. Strong social support elements within Puentes helped alleviate these burdens. Improvements to the program might include peer-support groups for patients undergoing treatment and transitioning back into the community after treatment.
Dual regulation of P-glycoprotein expression by Trichostatin A in cancer cell lines
Directory of Open Access Journals (Sweden)
Balaguer Trinidad
2012-07-01
Full Text Available Abstract Background It has been reported that the histone deacetylase inhibitor (iHDAc trichostatin A (TSA induces an increase in MDR1 gene transcription (ABCB1. This result would compromise the use of iHDACs in combination with other cytotoxic agents that are substrates of P-glycoprotein (Pgp. It has also been reported the use of alternative promoters by the ABCB1 gene and the existence of a translational control of Pgp protein. Finally, the ABCB1 gene is located in a genetic locus with the nested gene RUNDC3B in the complementary DNA strand, raising the possibility that RUNDC3B expression could interfere with ABCB1 alternative promoter regulation. Methods A combination of RT-PCR, real time RT-PCR, Western blot and drug accumulation assays by flow cytometry has been used in this study. Results The iHDACs-induced increase in MDR1 mRNA levels is not followed by a subsequent increase in Pgp protein levels or activity in several pancreatic and colon carcinoma cell lines, suggesting a translational control of Pgp in these cell lines. In addition, the MDR1 mRNA produced in these cell lines is shorter in its 5′ end that the Pgp mRNA produced in cell lines expressing Pgp protein. The different size of the Pgp mRNA is due to the use of alternative promoters. We also demonstrate that these promoters are differentially regulated by TSA. The translational blockade of Pgp mRNA in the pancreatic carcinoma cell lines could be related to alterations in the 5′ end of the MDR1 mRNA in the Pgp protein expressing cell lines. In addition, we demonstrate that the ABCB1 nested gene RUNDC3B expression although upregulated by TSA is independent of the ABCB1 alternative promoter used. Conclusions The results show that the increase in MDR1 mRNA expression after iHDACs treatment is clinically irrelevant since this mRNA does not render an active Pgp protein, at least in colon and pancreatic cancer cell lines. Furthermore, we demonstrate that TSA in fact, regulates
Fuchs, Claudia Daniela; Paumgartner, Gustav; Mlitz, Veronika; Kunczer, Victoria; Halilbasic, Emina; Leditznig, Nadja; Wahlström, Annika; Ståhlman, Marcus; Thüringer, Andrea; Kashofer, Karl; Stojakovic, Tatjana; Marschall, Hanns-Ulrich; Trauner, Michael
2018-04-10
Interruption of the enterohepatic circulation of bile acids (BAs) may protect against BA-mediated cholestatic liver and bile duct injury. BA sequestrants are established to treat cholestatic pruritus, but their impact on the underlying cholestasis is still unclear. We aimed to explore the therapeutic effects and mechanisms of the BA sequestrant colesevelam in a mouse model of sclerosing cholangitis. Mdr2 -/- mice received colesevelam for 8 weeks. Gene expression profiles of BA homeostasis, inflammation and fibrosis were explored in liver, intestine and colon. Hepatic and faecal BA profiles and gut microbiome were analysed. Glucagon-like peptide 1 (GLP-1) levels in portal blood were measured by ELISA. Furthermore, Mdr2 -/- mice as well as wild-type 3,5-diethoxy-carbonyl-1,4-dihydrocollidine-fed mice were treated with GLP-1-receptor agonist exendin-4 for 2 weeks prior to analysis. Colesevelam reduced serum liver enzymes, BAs and expression of proinflammatory and profibrogenic markers. Faecal BA profiling revealed increased levels of secondary BAs after resin treatment, while hepatic and biliary BA composition showed a shift towards more hydrophilic BAs. Colonic GLP-1 secretion, portal venous GLP-1 levels and intestinal messenger RNA expression of gut hormone Proglucagon were increased, while ileal Fgf15 expression was abolished by colesevelam. Exendin-4 treatment increased bile duct mass without promoting a reactive cholangiocyte phenotype in mouse models of sclerosing cholangitis. Microbiota analysis showed an increase of the phylum δ-Proteobacteria after colesevelam treatment and a shift within the phyla Firmicutes from Clostridiales to Lactobacillus . Colesevelam increases faecal BA excretion and enhances BA conversion towards secondary BAs, thereby stimulating secretion of GLP-1 from enteroendocrine L-cells and attenuates liver and bile duct injury in Mdr2 -/- mice. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article
DEFF Research Database (Denmark)
Andersen, V.; Agerstjerne, L.; Jensen, D.
2009-01-01
Background: Smoking, dietary factors, and alcohol consumption are known life style factors contributing to gastrointestinal carcinogenesis. Genetic variations in carcinogen handling may affect cancer risk. The multidrug resistance 1(MDR1/ABCB1) gene encodes the transport protein P-glycoprotein (a...... in inflammation, and may thereby affect the risk of malignity. Hence, genetic variations that modify the function of P-glycoprotein may be associated with the risk of colorectal cancer (CRC). We have previously found an association between the MDR1 intron 3 G-rs3789243-A polymorphism and the risk of CRC...... of colorectal carcinomas and adenomas in the Norwegian population was assessed in 167 carcinomas, 990 adenomas, and 400 controls. Genotypes were determined by allelic discrimination. Odds ratio (OR) and 95 confidence interval (95% CI) were estimated by binary logistic regression. Results: No association...
Splice form variant and amino acid changes in MDR49 confers DDT resistance in transgenic Drosophila.
Seong, Keon Mook; Sun, Weilin; Clark, John M; Pittendrigh, Barry R
2016-03-22
The ATP-binding cassette (ABC) transporters represent a superfamily of proteins that have important physiological roles in both prokaryotes and eukaryotes. In insects, ABC transporters have previously been implicated in insecticide resistance. The 91-R strain of Drosophila melanogaster has been intensely selected with DDT over six decades. A recent selective sweeps analysis of 91-R implicated the potential role of MDR49, an ABC transporter, in DDT resistance, however, to date the details of how MDR49 may play a role in resistance have not been elucidated. In this study, we investigated the impact of structural changes and an alternative splicing event in MDR49 on DDT-resistance in 91-R, as compared to the DDT susceptible strain 91-C. We observed three amino acid differences in MDR49 when 91-R was compared with 91-C, and only one isoform (MDR49B) was implicated in DDT resistance. A transgenic Drosophila strain containing the 91-R-MDR49B isoform had a significantly higher LD50 value as compared to the 91-C-MDR49B isoform at the early time points (6 h to 12 h) during DDT exposure. Our data support the hypothesis that the MDR49B isoform, with three amino acid mutations, plays a role in the early aspects of DDT resistance in 91-R.
Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke
2018-05-31
Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of
RNA interactions in the 5' region of the HIV-1 genome
DEFF Research Database (Denmark)
Damgaard, Christian Kroun; Andersen, Ebbe Sloth; Knudsen, Bjarne
2004-01-01
The untranslated leader of the dimeric HIV-1 RNA genome is folded into a complex structure that plays multiple and essential roles in the viral replication cycle. Here, we have investigated secondary and tertiary structural elements within the 5' 744 nucleotides of the HIV-1 genome using...... a combination of bioinformatics, enzymatic probing, native gel electrophoresis, and UV-crosslinking experiments. We used a recently developed RNA folding algorithm (Pfold) to predict the common secondary structure of an alignment of 20 divergent HIV-1 sequences. Combining this analysis with biochemical data, we...
SmD1 Modulates the miRNA Pathway Independently of Its Pre-mRNA Splicing Function.
Directory of Open Access Journals (Sweden)
Xiao-Peng Xiong
2015-08-01
Full Text Available microRNAs (miRNAs are a class of endogenous regulatory RNAs that play a key role in myriad biological processes. Upon transcription, primary miRNA transcripts are sequentially processed by Drosha and Dicer ribonucleases into ~22-24 nt miRNAs. Subsequently, miRNAs are incorporated into the RNA-induced silencing complexes (RISCs that contain Argonaute (AGO family proteins and guide RISC to target RNAs via complementary base pairing, leading to post-transcriptional gene silencing by a combination of translation inhibition and mRNA destabilization. Select pre-mRNA splicing factors have been implicated in small RNA-mediated gene silencing pathways in fission yeast, worms, flies and mammals, but the underlying molecular mechanisms are not well understood. Here, we show that SmD1, a core component of the Drosophila small nuclear ribonucleoprotein particle (snRNP implicated in splicing, is required for miRNA biogenesis and function. SmD1 interacts with both the microprocessor component Pasha and pri-miRNAs, and is indispensable for optimal miRNA biogenesis. Depletion of SmD1 impairs the assembly and function of the miRISC without significantly affecting the expression of major canonical miRNA pathway components. Moreover, SmD1 physically and functionally associates with components of the miRISC, including AGO1 and GW182. Notably, miRNA defects resulting from SmD1 silencing can be uncoupled from defects in pre-mRNA splicing, and the miRNA and splicing machineries are physically and functionally distinct entities. Finally, photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP analysis identifies numerous SmD1-binding events across the transcriptome and reveals direct SmD1-miRNA interactions. Our study suggests that SmD1 plays a direct role in miRNA-mediated gene silencing independently of its pre-mRNA splicing activity and indicates that the dual roles of splicing factors in post-transcriptional gene regulation may be
Madera, Rachel F.; Wang, Jennifer P.; Libraty, Daniel H.
2011-01-01
There is a growing need for novel vaccine adjuvants that can provide safe and potent T-helper type 1 (Th1) activity. RNA-like immune response modifiers (IRMs) are candidate T-cell adjuvants that skew acquired immune responses towards a Th1 phenotype. We set out to delineate the essential signaling pathways by which the RNA-like IRMs, resiquimod (R-848) and polyinosinic:polycytidylic acid (poly I:C), augment CD4+ T-helper 1 (Th1) responses. Highly purified murine conventional dendritic cells (cDCs) and conventional CD4+ T-cells were co-cultured in allogeneic and MHC congenic mixed leukocyte reactions. The activation of CD4+ Th1 cells was examined utilizing cells from mice deficient in specific RNA-sensing pattern recognition receptors and signaling mediators. R-848 and poly I:C stimulation of Type I interferon production and signaling in cDCs was essential but not sufficient for driving CD4+ Th1 responses. The early and rapid production of IL-1α and IL-1β was equally critical for the optimal activation of Th1 CD4+ T-cells. R-848 activation of Toll-like receptor 7/MyD88-dependent signaling in cDCs led to a rapid upregulation of pro-IL-1α and pro-IL-1β production compared to poly I:C activation of MyD88-independent signaling pathways. The in vitro data show that CD4+ T-cell adjuvant activity of RNA-like IRMs is mediated by a critical combination of early and rapid Type I interferon, IL-1α and IL-1β production. These results provide important insights into the key signaling pathways responsible for RNA-like IRM CD4+ Th1 activation. A better understanding of the critical signaling pathways by which RNA-like IRMs stimulate CD4+ Th1 responses is relevant to the rational design of improved vaccine adjuvants. PMID:22206014
Directory of Open Access Journals (Sweden)
Rachel F Madera
Full Text Available There is a growing need for novel vaccine adjuvants that can provide safe and potent T-helper type 1 (Th1 activity. RNA-like immune response modifiers (IRMs are candidate T-cell adjuvants that skew acquired immune responses towards a Th1 phenotype. We set out to delineate the essential signaling pathways by which the RNA-like IRMs, resiquimod (R-848 and polyinosinic:polycytidylic acid (poly I:C, augment CD4+ T-helper 1 (Th1 responses. Highly purified murine conventional dendritic cells (cDCs and conventional CD4+ T-cells were co-cultured in allogeneic and MHC congenic mixed leukocyte reactions. The activation of CD4+ Th1 cells was examined utilizing cells from mice deficient in specific RNA-sensing pattern recognition receptors and signaling mediators. R-848 and poly I:C stimulation of Type I interferon production and signaling in cDCs was essential but not sufficient for driving CD4+ Th1 responses. The early and rapid production of IL-1α and IL-1β was equally critical for the optimal activation of Th1 CD4+ T-cells. R-848 activation of Toll-like receptor 7/MyD88-dependent signaling in cDCs led to a rapid upregulation of pro-IL-1α and pro-IL-1β production compared to poly I:C activation of MyD88-independent signaling pathways. The in vitro data show that CD4+ T-cell adjuvant activity of RNA-like IRMs is mediated by a critical combination of early and rapid Type I interferon, IL-1α and IL-1β production. These results provide important insights into the key signaling pathways responsible for RNA-like IRM CD4+ Th1 activation. A better understanding of the critical signaling pathways by which RNA-like IRMs stimulate CD4+ Th1 responses is relevant to the rational design of improved vaccine adjuvants.
Lelong-Rebel, Isabelle; Brisson, Christine; Fabre, Michel; Bergerat, Jean-Pierre; Rebel, Gérard
2008-01-01
Two chemosensitive cell lines, LoVo-fusoid (LoVo-f) and LoVo-small cells (LoVo-sc) were derived from the original LoVo cell line. These two variants and the multidrug-resistant (MDR) cell line LoVo-Dox were screened for various properties. In non-permeabilized cells, only LoVo-sc showed mucin-2 staining whereas labelling was positive in all permeabilized cell lines. As shown by electron microscopy screening and by relative resistance to trypsin detachment, only LoVo-sc cells showed strong mucus secretion. All three cell lines displayed strong staining for P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP) and lung-resistance-related protein (LRP) in different locations according to the drug resistance state. The three cell lines showed intracellular labelling of LRP and MRP. The sensitive cells showed P-gp in a large perinuclear ring and in the cytoplasm, but little (LoVo-sc cells) or no staining (LoVo-f cells) was shown at the plasma membrane level. For the Lovo-Dox cells, P-gp was located in the plasma membrane, in cellular anchorages and in the cytoplasm as well. Cell resistance against antineoplastic agents often results from mobilization of various factors, the modulation of which is linked to the culture conditions. As most of the protocols utilize cells growing in (air + 5-10% CO2) atmosphere e.g. 20% O2, balance of the respective participants in the MDR multi-modal mechanism may not be representative of the in vivo situation and may lead to erratic pharmacological response. Indeed, cells within solid tumours were exposed to low pO2, most of them being under hypoxic condition (0.1-5% O2). In the absence of anticancer drugs, all LoVo cell lines grew notably faster at 20% O2 than at 5% O2. Moreover, respective sensitivities of both non-MDR variants to doxorubicin were altered according the pO2. Whatever the pO2 was, virtually none of the antioxidants tested affected the cytotoxic activity of doxorubicin for the three cell lines. By contrast
Isolation, Characterization and Anti-Multiple Drug Resistant (MDR ...
African Journals Online (AJOL)
(MDR) Bacterial Activity of Endophytic Fungi Isolated from ... Institute of Protection & Development of Beibu Wan Ocean Resources, Qinzhou University, Qinzhou, Guangxi Province, ..... isolated from secondary metabolites of the mangrove.
DEFF Research Database (Denmark)
Bramow, S; Ott, P; Thomsen Nielsen, F
2001-01-01
then analysed as were hepatic mRNA levels of canalicular transport proteins (Mrp2, Bsep, Mdr1b and Mdr2), sinusoidal transport proteins (Ntcp, Oatp1 and Oatp2), GSH related enzymes (gamma-glutamylcysteine synthetase light (GCSlc) and heavy (GCShc) chain subunits and glutathione-S-transferase) and CYPs (CYP3A9...... secondary to cyclosporine A could be related to reduction in mRNA expression of GSH synthesising enzymes and Mrp2, leading to reduced protection against oxidative stress and reduced bile acid-independent bile flow. After sirolimus treatment, Mrp2 mRNA was also reduced together with reduced levels of most...... CYPs and increased Oatp2, possibly leading to accumulation of toxic metabolites in the hepatocytes. The enhanced cholestatic effect of the combination treatment could be related to reduced GSH synthesising enzymes and even more pronounced reduction in Mrp2 mRNA and increase of Oatp2 mRNA....
Radiation enhancement effect of RNA interference for HIF-1α on the transplant tumor
International Nuclear Information System (INIS)
Ren Ruimei; Sun Xindong; Zhao Hanxi; Yan Qingxia; Huang Guangwu
2008-01-01
Objective: To determine and explore the radiation enhancement of RNA interference for HIF-1α on the transplant tumor using polycationic polyethylenimine (PEI), as a new kind of gene vector. Methods: SPCA-1 nude mouse model was used. 160 nude mice bearing SPCA-1 were randomly divided into 4 treated groups and 1 control groups, each group had 32 mice. The expression of HIF-1α was studied by immunohistochemical method after RNA interference for HIF-1α. The differences of the volume, weight, survival time of the transplant tumor were studied among the simple radiation group, the simple RNA interference for HIF- 1α group and the combination of radiation and RNA interference for HIF-1α. Results: The expression of HIF-1α was decreased after RNA interference for HIF-1α. RNA interference for HIF-1α combined with radiation decreased the volume, weight of the transplant tumor, and prolonged its survival time period significantly than other methods. Conclusions: RNA interference targeting HIF-1α might enhance the radiosensitivity of the transplant tumor using PEI as a new kind of gene vector in vitro. (authors)
MicroRNA modulation combined with sunitinib as a novel therapeutic strategy for pancreatic cancer
Directory of Open Access Journals (Sweden)
Passadouro M
2014-07-01
Full Text Available Marta Passadouro,1,2 Maria C Pedroso de Lima,1,2 Henrique Faneca11Center for Neuroscience and Cell Biology, 2Department of Life Sciences, Faculty of Science and Technology, University of Coimbra, Coimbra, PortugalAbstract: Pancreatic ductal adenocarcinoma (PDAC is a highly aggressive and mortal cancer, characterized by a set of known mutations, invasive features, and aberrant microRNA expression that have been associated with hallmark malignant properties of PDAC. The lack of effective PDAC treatment options prompted us to investigate whether microRNAs would constitute promising therapeutic targets toward the generation of a gene therapy approach with clinical significance for this disease. In this work, we show that the developed human serum albumin–1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine:cholesterol/anti-microRNA oligonucleotides (+/– (4/1 nanosystem exhibits the ability to efficiently deliver anti-microRNA oligonucleotides targeting the overexpressed microRNAs miR-21, miR-221, miR-222, and miR-10 in PDCA cells, promoting an almost complete abolishment of microRNA expression. Silencing of these microRNAs resulted in a significant increase in the levels of their targets. Moreover, the combination of microRNA silencing, namely miR-21, with low amounts of the chemotherapeutic drug sunitinib resulted in a strong and synergistic antitumor effect, showing that this combined strategy could be of great importance for therapeutic application in PDAC. Keywords: pancreatic cancer gene therapy, anti-microRNAs oligonucleotides, delivery nanosystems, albumin-associated lipoplexes
Unique behavioral characteristics and microRNA signatures in a drug resistant epilepsy model.
Directory of Open Access Journals (Sweden)
Jangsup Moon
Full Text Available BACKGROUND: Pharmacoresistance is a major issue in the treatment of epilepsy. However, the mechanism underlying pharmacoresistance to antiepileptic drugs (AEDs is still unclear, and few animal models have been established for studying drug resistant epilepsy (DRE. In our study, spontaneous recurrent seizures (SRSs were investigated by video-EEG monitoring during the entire procedure. METHODS/PRINCIPAL FINDINGS: In the mouse pilocarpine-induced epilepsy model, we administered levetiracetam (LEV and valproate (VPA in sequence. AED-responsive and AED-resistant mice were naturally selected after 7-day treatment of LEV and VPA. Behavioral tests (open field, object exploration, elevated plus maze, and light-dark transition test and a microRNA microarray test were performed. Among the 37 epileptic mice with SRS, 23 showed significantly fewer SRSs during administration of LEV (n = 16, LEV sensitive (LS group or VPA (n = 7, LEV resistant/VPA sensitive (LRVS group, while 7 epileptic mice did not show any amelioration with either of the AEDs (n = 7, multidrug resistant (MDR group. On the behavioral assessment, MDR mice displayed distinctive behaviors in the object exploration and elevated plus maze tests, which were not observed in the LS group. Expression of miRNA was altered in LS and MDR groups, and we identified 4 miRNAs (miR-206, miR-374, miR-468, and miR-142-5p, which were differently modulated in the MDR group versus both control and LS groups. CONCLUSION: This is the first study to identify a pharmacoresistant subgroup, resistant to 2 AEDs, in the pilocarpine-induced epilepsy model. We hypothesize that modulation of the identified miRNAs may play a key role in developing pharmacoresistance and behavioral alterations in the MDR group.
African Journals Online (AJOL)
User
Among the MDR-TB cases rifampicin resistance was associated with rpoB WT gene and rpoB MUT gene in 100% and 62% of the ... diagnosis of TB patients, and proper treatment and management of the infected cases to minimize the spread and ..... in an amino acid change and concluded that this is one of the reasons ...
Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian
2017-09-09
Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Christian Diamant Mossoro-Kpinde
2016-01-01
Full Text Available Objectives. We evaluated the performances of Amplix real-time PCR platform developed by Biosynex (Strasbourg, France, combining automated station extraction (Amplix station 16 Dx and real-time PCR (Amplix NG, for quantifying plasma HIV-1 RNA by lyophilized HIV-1 RNA-based Amplix reagents targeting gag and LTR, using samples from HIV-1-infected adults from Central African Republic. Results. Amplix real-time PCR assay showed low limit of detection (28 copies/mL, across wide dynamic range (1.4–10 log copies/mL, 100% sensitivity and 99% specificity, high reproducibility, and accuracy with mean bias < 5%. The assay showed excellent correlations and concordance of 95.3% with the reference HIV-1 RNA load assay (Roche, with mean absolute bias of +0.097 log copies/mL by Bland-Altman analysis. The assay was able to detect and quantify the most prevalent HIV-1 subtype strains and the majority of non-B subtypes, CRFs of HIV-1 group M, and HIV-1 groups N and O circulating in Central Africa. The Amplix assay showed 100% sensitivity and 99.6% specificity to diagnose virological failure in clinical samples from antiretroviral drug-experienced patients. Conclusions. The HIV-1 RNA-based Amplix real-time PCR platform constitutes sensitive and reliable system for clinical monitoring of HIV-1 RNA load in HIV-1-infected children and adults, particularly adapted to intermediate laboratory facilities in sub-Saharan Africa.
Directory of Open Access Journals (Sweden)
Persson Bengt
2010-10-01
Full Text Available Abstract Background The Medium-chain Dehydrogenases/Reductases (MDR form a protein superfamily whose size and complexity defeats traditional means of subclassification; it currently has over 15000 members in the databases, the pairwise sequence identity is typically around 25%, there are members from all kingdoms of life, the chain-lengths vary as does the oligomericity, and the members are partaking in a multitude of biological processes. There are profile hidden Markov models (HMMs available for detecting MDR superfamily members, but none for determining which MDR family each protein belongs to. The current torrential influx of new sequence data enables elucidation of more and more protein families, and at an increasingly fine granularity. However, gathering good quality training data usually requires manual attention by experts and has therefore been the rate limiting step for expanding the number of available models. Results We have developed an automated algorithm for HMM refinement that produces stable and reliable models for protein families. This algorithm uses relationships found in data to generate confident seed sets. Using this algorithm we have produced HMMs for 86 distinct MDR families and 34 of their subfamilies which can be used in automated annotation of new sequences. We find that MDR forms with 2 Zn2+ ions in general are dehydrogenases, while MDR forms with no Zn2+ in general are reductases. Furthermore, in Bacteria MDRs without Zn2+ are more frequent than those with Zn2+, while the opposite is true for eukaryotic MDRs, indicating that Zn2+ has been recruited into the MDR superfamily after the initial life kingdom separations. We have also developed a web site http://mdr-enzymes.org that provides textual and numeric search against various characterised MDR family properties, as well as sequence scan functions for reliable classification of novel MDR sequences. Conclusions Our method of refinement can be readily applied to
Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)
International Nuclear Information System (INIS)
Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.
2002-01-01
PgP. This generic structure also offers the flexibility to prepare a wide range of molecules that are readily suitable for halogenation with either Iodine-123 or F-18 for radiopharmaceutical development. Finally these phenolic type of molecules based on Quercetin are relatively less toxic than equivalent drugs. In this proposal an extensive research program is required to develop specific drugs for the different efflux pumps present in the body, which represent multi drug resistance. A successful outcome is critically dependent on the initial synthesis of a large number of compounds for screening. The combined effort of the three institutions will boost resources significantly to a critical level required to competitively produce successful outcomes in the project. Optimisation studies on derivatives of these flavonols will be made in parallel with the assistance of in vitro studies by measuring the binding of compounds to the ATP sites of Pgp. An extensive in vitro screening program has been established in Paris, prior to radiolabelling and in vivo evaluation. Structural optimisation and attachment of radionuclides to promising molecular targets will be explored using molecular modelling. Initially computational chemistry using Sybyl will be undertaken to develop a pharmacophore and to assist with the incorporation of the radionuclide in the appropriate position. In vivo evaluation will be undertaken in specific animal models both at the University of Tours in France as well as at the Sydney Cancer Centre in Australia. PET functional imaging studies may be undertaken on successful candidates at the SHFJ in Orsay, France whilst SPECT imaging will be undertaken in both Tours and in Sydney. In addition to intellectual property and potential commercial product(s), specific PET or SPECT radiopharmaceuticals can provide valuable information on the assessment of MDR in cancer patients through functional, non-invasive, imaging and therefore make significant contributions to
Igolnikov, Alexander C; Green, Richard M
2006-03-01
The administration of a methionine and choline deficient (MCD) diet to mice serves as an animal model of NASH. The multidrug resistant 2 (Mdr2) P-glycoprotein encodes for the canalicular phospholipid transporter, and Mdr2 (+/-) mice secrete 40% less phosphatidylcholine than wild-type mice. We have hypothesized that phosphatidylethanolamine-N-methyl transferase (PEMT) up-regulation is a consequence of MCD diet administration, and is important for the pathogenesis of steatohepatitis in this model. However, the effect of decreased phosphatidylcholine secretion and modulation of PEMT on the development of diet-induced steatohepatitis in Mdr2 (+/-) mice has not been explored. Thus, the purpose of the study is to examine the effects of the MCD diet on Mdr2 (+/-) mice. Mdr2 (+/-) and Mdr2 (+/+) mice were treated with an MCD or control diet for up to 30 days, and the severity of steatohepatitis, PEMT activity and hepatic S-adenosylmethionine (SAM), and S-adenosylhomocysteine (SAH) levels were measured. Serum ALT levels, hepatic inflammation, and PEMT activity were significantly lower, and hepatic SAM:SAH ratios were significantly higher in Mdr2 (+/-) mice at 7 and 30 days on the MCD diet. Mdr2 (+/-) mice have diminished susceptibility to MCD diet-induced NASH, which is associated with a relative decrease in PEMT activity and increased SAM:SAH ratios.
Trezise, A E; Ratcliff, R; Hawkins, T E; Evans, M J; Freeman, T C; Romano, P R; Higgins, C F; Colledge, W H
1997-04-01
The cystic fibrosis (Cftr and multidrug resistance (Mdr1) genes encode structurally similar proteins which are members of the ABC transporter superfamily. These genes exhibit complementary patterns of expression in vivo, suggesting that the regulation of their expression may be co-ordinated. We have tested this hypothesis in vivo by examining Cftr and Mdr1 expression in cystic fibrosis knockout transgenic mice (Cftr(tm1CAM)). Cftr mRNA expression in Cftr(tm1CAM)/Cftr(tm1CAM) mice was 4-fold reduced in the intestine, as compared with littermate wild-type mice. All other Cftr(tm1CAM)/Cftr(tm1CAM) mouse tissues examined showed similar reductions in Cftr expression. In contrast, we observed a 4-fold increase in Mdr1 mRNA expression in the intestines of neonatal and 3- to 4-week-old Cftr(tm1CAM)/Cftr(tm1CAM) mice, as compared with age-matched +/+ mice, and an intermediate level of Mdr1 mRNA in heterozygous Cftr(tm1CAM) mice. In 10-week-old, Cftr(tm1CAM)/Cftr(tm1CAM) mice and in contrast to the younger mice, Mdr1 mRNA expression was reduced, by 3-fold. The expression of two control genes, Pgk-1 and Mdr2, was similar in all genotypes, suggesting that the changes in Mdr1 mRNA levels observed in the Cftr(tm1CAM)/Cftr(tm1CAM) mice are specific to the loss of Cftr expression and/or function. These data provide further evidence supporting the hypothesis that the regulation Cftr and Mdr1 expression is co-ordinated in vivo, and that this co-ordinate regulation is influenced by temporal factors.
miR-133b down-regulates ABCC1 and enhances the sensitivity of CRC to anti-tumor drugs.
Chen, Miao; Li, Daojiang; Gong, Ni; Wu, Hao; Su, Chen; Xie, Canbin; Xiang, Hong; Lin, Changwei; Li, Xiaorong
2017-08-08
Multidrug resistance (MDR) is the main cause of failed chemotherapy treatments. Therefore, preventing MDR is pivotal in treating colorectal cancer (CRC). In a previous study miR-133b was shown to be a tumor suppressor. Additionally, in CRC cells transfected with miR-133b, ATP-binding cassette (ABC) subfamily C member 1(ABCC1) was shown to be significantly down regulated. Whether miR-133b also enhances the chemosensitivity of drugs used to treat CRC by targeting ABCC1 is still unclear. Here, we utilized flow cytometry and high-performance liquid chromatography (HPLC) analysis to identify the ability of miR-133b to reserve MDR in CRC. We then used a dual-luciferase reporter assay to validate that miR-133b targets ABCC1. Further in vivo experiments were designed to validate the method in which miR-133b reversed MDR in CRC cells. The results demonstrated that the level of miR-133b was down-regulated and the expression of ABCC1 was up-regulated in drug-resistant CRC cells compared to non-drug-resistant CRC cells. The restoration of miR-133b expression in CRC drug-resistant cells in vitro resulted in reduced IC50s to chemotherapeutic drugs, significantly induced G1 accumulation, inhibited growth and promoted necrosis in combination with either 5-fluorouracil (5-FU) or vincristine (VCR), and decreased the expression of ABCC1. The dual-luciferase assay demonstrated that miR-133b directly targets ABCC1. The combination of agomiRNA-133b with chemotherapeutic drugs in vivo inhibited tumor growth induced by CRC drug-resistant cells. A xenograft from the in vivo model resulted in up-regulated levels of miR-133b and down-regulated levels of ABCC1. Therefore, miR-133b enhances the chemosensitivity of CRC cells to anti-tumor drugs by directly down-regulating ABCC1. This discovery provides a therapeutic strategy in which miR-133b is used as a potential sensitizer for drug-resistant CRC.
Antonissen, Gunther; Devreese, Mathias; De Baere, Siegrid; Martel, An; Van Immerseel, Filip; Croubels, Siska
2017-03-01
Cytochrome P450 (CYP450) drug biotransformation enzymes and multidrug resistance (MDR) proteins may influence drug disposition processes. The first part of the study aimed to evaluate the effect of mycotoxins deoxynivalenol (DON) and/or fumonisins (FBs), at contamination levels approaching European Union guidance levels, on intestinal and hepatic CYP450 enzymes and MDR proteins gene expression in broiler chickens. mRNA expression of genes encoding CYP450 enzymes (CYP3A37, CYP1A4 and CYP1A5) and drug transporters (MDR1/ABCB1 and MRP2/ABCC2) was determined using qRT-PCR. A significant up-regulation of CYP1A4 (P = 0.037) and MDR1 (P = 0.036) was observed in the jejunum of chickens fed a diet contaminated with FBs. The second part of this study aimed to investigate the impact of feeding a FBs contaminated diet on the oral absorption of enrofloxacin (10 mg/kg BW), a MDR1 substrate. A significant (P = 0.045), however small, decreased area under the plasma concentration-time curve (AUC 0-48 h, mean ± SD) was observed for enrofloxacin in chickens fed the FBs contaminated diet compared to the control group, 16.28 ± 1.82 h μg/mL versus 18.27 ± 1.79 h μg/mL. These findings suggest that concurrent administration of drugs with FBs contaminated feed might alter the pharmacokinetic characteristics of CYP1A4 substrate drugs and MDR1 substrates, such as enrofloxacin. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Mohd Zakihalani A. Halim
2016-03-01
Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary
Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.
Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok
2018-03-16
Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.
Commercial grade item (CGI) dedication of MDR relays for nuclear safety related applications
Das, Ranjit K.; Julka, Anil; Modi, Govind
1994-08-01
MDR relays manufactured by Potter & Brumfield (P&B) have been used in various safety related applications in commercial nuclear power plants. These include emergency safety features (ESF) actuation systems, emergency core cooling systems (ECCS) actuation, and reactor protection systems. The MDR relays manufactured prior to May 1990 showed signs of generic failure due to corrosion and outgassing of coil varnish. P&B has made design changes to correct these problems in relays manufactured after May 1990. However, P&B does not manufacture the relays under any 10CFR50 Appendix B quality assurance (QA) program. They manufacture the relays under their commercial QA program and supply these as commercial grade items. This necessitates CGI Dedication of these relays for use in nuclear-safety-related applications. This paper presents a CGI dedication program that has been used to dedicate the MDR relays manufactured after been used to dedicate the MDR relays manufactured after May 1990. The program is in compliance with current Nuclear Regulatory Commission (NRC) and Electric Power Research Institute (EPRI) guidelines and applicable industry standards; it specifies the critical characteristics of the relays, provides the tests and analysis required to verify the critical characteristics, the acceptance criteria for the test results, performs source verification to quality P&B for its control of the critical characteristics, and provides documentation. The program provides reasonable assurance that the new MDR relays will perform their intended safety functions.
Directory of Open Access Journals (Sweden)
Satoshi Iizuka
Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.
Remy, Estelle; Duque, Paula
2014-01-01
Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617
Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu
2012-01-01
P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.
Yuan, Wei-Qi; Zhang, Rong-Rong; Wang, Jun; Ma, Yan; Li, Wen-Xue; Jiang, Ren-Wang; Cai, Shao-Hui
2016-05-24
Multidrug resistance (MDR) mediated by P-glycoprotein (P-gp) is a major cause of cancer therapy failure. In this study, we identified a novel C21 steroidal glycoside, asclepiasterol, capable of reversing P-gp-mediated MDR. Asclepiasterol (2.5 and 5.0μM) enhanced the cytotoxity of P-gp substrate anticancer drugs in MCF-7/ADR and HepG-2/ADM cells. MDR cells were more responsive to paclitaxel in the presence of asclepiasterol, and colony formation of MDR cells was only reduced upon treatment with a combination of asclepiasterol and doxorubicin. Consistent with these findings, asclepiasterol treatment increased the intracellular accumulation of doxorubicin and rhodamine 123 (Rh123) in MDR cells. Asclepiasterol decreased expression of P-gp protein without stimulating or suppressing MDR1 mRNA levels. Asclepiasterol-mediated P-gp suppression caused inhibition of ERK1/2 phosphorylation in two MDR cell types, and EGF, an activator of the MAPK/ERK pathway, reversed the P-gp down-regulation, implicating the MAPK/ERK pathway in asclepiasterol-mediated P-gp down-regulation. These results suggest that asclepiasterol could be developed as a modulator for reversing P-gp-mediated MDR in P-gp-overexpressing cancer variants.
Chowbay, Balram; Cumaraswamy, Sivathasan; Cheung, Yin Bun; Zhou, Qingyu; Lee, Edmund J D
2003-02-01
Intestinal cytochrome P450 3A4 (CYP3A4) and P-glycoprotein (P-gp) both play a vital role in the metabolism of oral cyclosporine (CsA). We investigated the genetic polymorphisms in CYP3A4(promoter region and exons 5, 7 and 9) and MDR1 (exons 12, 21 and 26) genes and the impact of these polymorphisms on the pharmacokinetics of oral CsA in stable heart transplant patients (n = 14). CYP3A4 polymorphisms were rare in the Asian population and transplant patients. Haplotype analysis revealed 12 haplotypes in the Chinese, eight in the Malays and 10 in the Indians. T-T-T was the most common haplotype in all ethnic groups. The frequency of the homozygous mutant genotype at all three loci (TT-TT-TT) was highest in the Indians (31%) compared to 19% and 15% in the Chinese and Malays, respectively. In heart transplant patients, CsA exposure (AUC(0-4 h), AUC(0-12 h) and C(max)) was high in patients with the T-T-T haplotypes compared to those with C-G-C haplotypes. These findings suggest that haplotypes rather than genotypes influence CsA disposition in transplant patients.
Li, Wentao; Zhai, Baoping; Zhi, Hui; Li, Yuhong; Jia, Linjiao; Ding, Chao; Zhang, Bin; You, Wei
2014-09-01
Docetaxel is a first-line chemotherapeutic agent for treating advanced breast cancer. The development of chemoresistance or multidrug resistance (MDR), however, results in breast cancer chemotherapy failure. This study aims to explore the molecular mechanisms underlying docetaxel-resistance in treatment of breast cancer. The docetaxel-resistant subline MCF7/DOC, derived from the parental sensitive breast cancer cell line MCF7, was established by intermittent exposure to moderate concentrations of docetaxel, followed by examination of its phenotypes. The MCF7/DOC subline showed cross resistance against paclitaxel, doxorubicin, methotrexate, and 5-Fu. Compared to the parental MCF7, MCF7/DOC cells were enlarged with heterogeneous sizes and a cobblestone and polygonal appearance. They were arrested at G2/M phase and proliferated slowly. The colony formation potential of MCF7/DOC in soft agar was significantly increased. MCF7/DOC cells showed reduced intracellular accumulation and increased efflux of rhodamine 123. The mRNA expression level of adenosine triphosphate binding cassette (ABC) transporter family, i.e., ABCB1, ABCC1, ABCC2, ABCG2, and β tubulin isotypes were characterized by quantitative PCR. High-level expression of ABCB1, βI, and βIII tubulin mRNA in MCF7/DOC was detected. Downregulation of ABCB1, βI, and βIII tubulin mediated by three combined siRNAs resulted in stronger growth inhibition of MCF7/DOC than inhibition of the expression of individual genes. ABCB1, βI, and βIII tubulin might contribute to the MDR of MCF7/DOC and be potential therapeutic targets for overcoming MDR of breast cancer.
Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.
Directory of Open Access Journals (Sweden)
Adrien Molinas
Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation
Krawczenko, Agnieszka; Bielawska-Pohl, Aleksandra; Wojtowicz, Karolina; Jura, Roksana; Paprocka, Maria; Wojdat, Elżbieta; Kozłowska, Urszula; Klimczak, Aleksandra; Grillon, Catherine; Kieda, Claudine; Duś, Danuta
2017-01-01
Active cellular transporters of harmful agents-multidrug resistance (mdr) proteins-are present in tumor, stem and endothelial cells, among others. While mdr proteins are broadly studied in tumor cells, their role in non-tumor cells and the significance of their action not connected with removal of harmful xenobiotics is less extensively documented. Proper assessment of mdr proteins expression is difficult. Mdr mRNA presence is most often evaluated but that does not necessarily correlate with the protein level. The protein expression itself is difficult to determine; usually cells with mdr overexpression are studied, not cells under physiological conditions, in which a low expression level of mdr protein is often insufficient for detection in vitro. Various methods are used to identify mdr mRNA and protein expression, together with functional tests demonstrating their biological drug transporting activities. Data comparing different methods of investigating expression of mdr mRNAs and their corresponding proteins are still scarce. In this article we present the results of a study concerning mdr mRNA and protein expression. Our goal was to search for the best method to investigate the expression level and functional activity of five selected mdr proteins-MDR1, BCRP, MRP1, MRP4 and MRP5-in established in vitro cell lines of human endothelial cells (ECs) and their progenitors. Endothelial cells demonstrated mdr presence at the mRNA level, which was not always confirmed at the protein level or in functional tests. Therefore, several different assays had to be applied for evaluation of mdr proteins expression and functions in endothelial cells. Among them functional tests seemed to be the most conclusive, although not very specific.
Sabdaningsih, A.; Cristianawati, O.; Sibero, M. T.; Nuryadi, H.; Radjasa, O. K.; Sabdono, A.; Trianto, A.
2017-02-01
Multidrug resistant Staphylococcus haemolyticus is a Gram-positive bacteria and member of coagulase negative staphylococci (CoNS) which has the highest level of antimicrobial resistance. This nosocomial pathogen due to skin or soft tissue infections, bacteremia, septicemia, peritonitis, otitis media, meningitis and urinary tract infections. The ability to produce enterotoxins, hemolysins, biofilm, and cytotoxins could be an important characteristic for the successful of infection. Marine-derived fungi have potency as a continuous supply of bioactive compound. The aim of this research was screening antibacterial agent from crude extracts of marine-derived fungi associated with soft corals against MDR-S. haemolyticus. Among 23 isolates of marine-derived fungi isolated from 7 soft corals, there were 4 isolates active against MDR-S. haemolyticus. The screening was conducted by using agar plug diffusion method. Isolate PPSC-27-A4 had the highest antibacterial activity with diameter 23±9,6 mm. The crude extract from this isolate had been confirmed to antibacterial susceptibility test and it had the highest antibacterial activity in 12.2 mm with concentration of 300μg/ml from mycelia extract. PPSC-27-A4 had been characterized in molecular, based on the sequence analysis of 18S rRNA, PPSC-27-A4 isolate was identified as Trichoderma longibrachiatum.
Mayer, U; Wagenaar, E; Beijnen, J.H; Smit, J.W; Meijer, D.K F; van Asperen, J.; Borst, P; Schinkel, A.H
1 We have used mice with a disrupted mdrla P-glycoprotein gene (mdrIa (-/-) mice) to study the role of P-glycoprotein in the pharmacokinetics of digoxin, a model P-glycoprotein substrate. 2 [K-3]-digoxin at a dose of 0.2 mg kg(-1) was administered as a single i.v. or oral bolus injection. We
Determination of chromium combined with DNA, RNA and protein in chromium-rich brewer's yeast
International Nuclear Information System (INIS)
Ding Wenjun; Qian Qinfang; Hou Xiaolin; Feng Weiyue; Chai Zhifang
2000-01-01
The contents of chromium in the DNA, RNA and protein fractions separated from chromium-rich and normal brewer's yeast were determined with the neutron activation analysis in order to study the combination of Cr with DNA, RNA and protein in chromium-rich brewer's yeast. The results showed that the extracting rats and concentrations of DNA, RNA and protein had no significant difference in two types of yeast, but the chromium contents of DNA, RNA and protein in the chromium-rich yeast were significantly higher than those in the normal. In addition, the content of chromium in DNA was much higher than that in RNA and protein, which indicated that the inorganic chromium compounds entered into the yeast cell, during the yeast cultivation in the culture medium containing chromium were converted into organic chromium compounds combined with DNA, RNA and protein
Directory of Open Access Journals (Sweden)
Lei Xia
2013-01-01
Full Text Available The main goal of this work is to investigate the killing effects and molecular mechanism of photodynamic therapy (PDT mediated by the Ad5/F35-APE1 siRNA recombinant adenovirus in combination with a hematoporphrphyrin derivative (HpD in the A549 human lung adenocarcinoma cell line in vitro to provide a theoretical reference for treating lung cancer by HpD-PDT. By using the technologies of MTT, flow cytometry, ELISA, and western blot, we observed that the proliferation inhibition and apoptosis of the A549 cells were significantly higher than the control group ( after HpD-PDT was performed. The inhibitory efficiency is dependent on the HpD concentration and laser intensity dose. The inhibitory effect on the proliferation of A549 cells of Ad5/F35-APE1 siRNA is more significant after combining with PDT, as indicated by a significant elevation of the intracellular ROS level and the expression of inflammatory factors (. The HpD-PDT-induced expression of the APE1 protein reached the peak after 24 h in A549 cells. The inhibition of APE1 expression in A549 cells was most significant after 48 hours of infection by Ad5/F35-APE1 siRNA recombinant adenovirus (10 MOI. In conclusion, the Ad5/F35-APE1 siRNA recombinant adenovirus could efficiently inhibit the HpD-PDT-induced APE1 expression hence could significantly enhance the killing effect of HpD-PDT in lung cancer cells.
DBR1 siRNA inhibition of HIV-1 replication
Directory of Open Access Journals (Sweden)
Naidu Yathi
2005-10-01
Full Text Available Abstract Background HIV-1 and all retroviruses are related to retroelements of simpler organisms such as the yeast Ty elements. Recent work has suggested that the yeast retroelement Ty1 replicates via an unexpected RNA lariat intermediate in cDNA synthesis. The putative genomic RNA lariat intermediate is formed by a 2'-5' phosphodiester bond, like that found in pre-mRNA intron lariats and it facilitates the minus-strand template switch during cDNA synthesis. We hypothesized that HIV-1 might also form a genomic RNA lariat and therefore that siRNA-mediated inhibition of expression of the human RNA lariat de-branching enzyme (DBR1 expression would specifically inhibit HIV-1 replication. Results We designed three short interfering RNA (siRNA molecules targeting DBR1, which were capable of reducing DBR1 mRNA expression by 80% and did not significantly affect cell viability. We assessed HIV-1 replication in the presence of DBR1 siRNA and found that DBR1 knockdown led to decreases in viral cDNA and protein production. These effects could be reversed by cotransfection of a DBR1 cDNA indicating that the inhibition of HIV-1 replication was a specific effect of DBR1 underexpression. Conclusion These data suggest that DBR1 function may be needed to debranch a putative HIV-1 genomic RNA lariat prior to completion of reverse transcription.
Accurate placement of substrate RNA by Gar1 in H/ACA RNA-guided pseudouridylation.
Wang, Peng; Yang, Lijiang; Gao, Yi Qin; Zhao, Xin Sheng
2015-09-03
H/ACA RNA-guided ribonucleoprotein particle (RNP), the most complicated RNA pseudouridylase so far known, uses H/ACA guide RNA for substrate capture and four proteins (Cbf5, Nop10, L7Ae and Gar1) for pseudouridylation. Although it was shown that Gar1 not only facilitates the product release, but also enhances the catalytic activity, the chemical role that Gar1 plays in this complicated machinery is largely unknown. Kinetics measurement on Pyrococcus furiosus RNPs at different temperatures making use of fluorescence anisotropy showed that Gar1 reduces the catalytic barrier through affecting the activation entropy instead of enthalpy. Site-directed mutagenesis combined with molecular dynamics simulations demonstrated that V149 in the thumb loop of Cbf5 is critical in placing the target uridine to the right position toward catalytic D85 of Cbf5. The enzyme elegantly aligns the position of uridine in the catalytic site with the help of Gar1. In addition, conversion of uridine to pseudouridine results in a rigid syn configuration of the target nucleotide in the active site and causes Gar1 to pull out the thumb. Both factors guarantee the efficient release of the product. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Nicholas J Schurch
Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.
Directory of Open Access Journals (Sweden)
M. Muñoz-Torrico
2017-01-01
Full Text Available Diabetes mellitus (DM is a well-known risk factor for tuberculosis (TB. However, it is not known to what extent DM affects the outcome in patients with multidrug-resistant (MDR-TB and extensively drug-resistant TB (XDR-TB treated with second-line anti-TB drugs.The objective of this study was to compare the microbiological evolution (sputum smear and culture conversion and final outcomes of MDR/XDR-TB patients with and without DM, managed at the national TB reference centre in Mexico City. Results: Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%, 11 with pre-XDR-TB (e.g. MDR-TB with additional resistance to one injectable drug or a fluoroquinolone, 12.2% and 6 (6.7% with XDR-TB. Out of these, 49 (54.4% had DM and 42 (86% were undergoing insulin treatment.No statistically significant differences were found in treatment outcomes comparing DM vs. non-DM MDR-TB cases: 18/32 (56.3% of DM cases and 19/24 (79.2% non DM patients achieved treatment success (p = 0.07. The time to sputum smear and culture conversion was longer (although not statistically in patients without DM, as follows: the mean (±SD time to sputum smear conversion was 53.9 (±31.4 days in DM patients and 65.2 (±34.8 days in non-DM ones (p = 0.15, while the time to culture conversion was 66.2 (±27.6 days for DM and 81.4 (±37.7 days for non-DM MDR-TB cases (p = 0.06. Conclusions: The study results support the Mexican National TB programme to strengthen its collaboration with the DM programme, as an entry point for TB (and latent TB infection screening and management. Keywords: Diabetes mellitus, Delay, Sputum and culture conversion, MDR-TB, High treatment adherence
CLDN6 promotes chemoresistance through GSTP1 in human breast cancer
Directory of Open Access Journals (Sweden)
Minlan Yang
2017-11-01
Full Text Available Abstract Background Claudin-6 (CLDN6, a member of CLDN family and a key component of tight junction, has been reported to function as a tumor suppressor in breast cancer. However, whether CLDN6 plays any role in breast cancer chemoresistance remains unclear. In this study, we investigated the role of CLDN6 in the acquisition of chemoresistance in breast cancer cells. Methods We manipulated the expression of CLDN6 in MCF-7 and MCF-7/MDR cells with lv-CLDN6 and CLDN6-shRNA and investigated whether CLDN6 manipulation lead to different susceptibilities to several chemotherapeutic agents in these cells. The cytotoxicity of adriamycin (ADM, 5-fluorouracil (5-FU, and cisplatin (DDP was tested by cck-8 assay. Cell death was determined by DAPI nuclear staining. The enzyme activity of glutanthione S-transferase-p1 (GSTP1 was detected by a GST activity kit. Then lv-GSTP1 and GSTP1-shRNA plasmids were constructed to investigate the potential of GSTP1 in regulating chemoresistance of breast cancer. The TP53-shRNA was adopted to explore the regulation mechanism of GSTP1. Finally, immunohistochemistry was used to explore the relationship between CLDN6 and GSTP1 expression in breast cancer tissues. Results Silencing CLDN6 increased the cytotoxicity of ADM, 5-FU, and DDP in MCF-7/MDR cells. Whereas overexpression of CLDN6 in MCF-7, the parental cell line of MCF-7/MDR expressing low level of CLDN6, increased the resistance to the above drugs. GSTP1 was upregulated in CLDN6-overexpressed MCF-7 cells. RNAi –mediated silencing of CLDN6 downregulated both GSTP1 expression and GST enzyme activity in MCF-7/MDR cells. Overexpresssion of GSTP1 in CLDN6 silenced MCF-7/MDR cells restored chemoresistance, whereas silencing GSTP1 reduced the chemoresistance due to ectopic overexpressed of CLDN6 in MCF-7 cells. These observations were also repeated in TNBC cells Hs578t. We further confirmed that CLDN6 interacted with p53 and promoted translocation of p53 from nucleus to
Directory of Open Access Journals (Sweden)
Khoeruddin Wittriansyah
2016-12-01
Full Text Available Marine sponge-associated fungi are the sources of bioactive compounds with various pharmacologicals potency. This study aimed to isolate the sponge-associated fungi as the producer of the MDR anti-bacterial compounds. The associated fungi were isolated from the sponges collected from Riung water, Nusa Tenggara Timur. Five of the best isolates were cultured on MEA to obtain the methanolic extract for further studies. The antagonistic test was conducted using overlay method towards the MDR Staphylococcus aureus and Escherichia coli. A total of 33 fungi were isolated from 19 sponge specimens. The antagonistic test showed that 19 isolates were active against both S. aureus and E. coli, and 13 of them were merely active against one of the bacteria. However, only five isolates have strong activity against one or both of the bacteria. The KN-15-3 had the strongest activity against S. aureus (18.75±0.777mm and E. coli (15.10±0.141mm at the concentration of 400 μg.disc-1 so it can be developed further as a source of drug candicate. Keywords: Fungi symbiont, Sponges, MDR Antibacterial, Staphylococcus aureus, Escherichia coli.
microRNA-independent recruitment of Argonaute 1 to nanos mRNA through the Smaug RNA-binding protein.
Pinder, Benjamin D; Smibert, Craig A
2013-01-01
Argonaute (Ago) proteins are typically recruited to target messenger RNAs via an associated small RNA such as a microRNA (miRNA). Here, we describe a new mechanism of Ago recruitment through the Drosophila Smaug RNA-binding protein. We show that Smaug interacts with the Ago1 protein, and that Ago1 interacts with and is required for the translational repression of the Smaug target, nanos mRNA. The Ago1/nanos mRNA interaction does not require a miRNA, but it does require Smaug. Taken together, our data suggest a model whereby Smaug directly recruits Ago1 to nanos mRNA in a miRNA-independent manner, thereby repressing translation.
Morici, P; Florio, W; Rizzato, C; Ghelardi, E; Tavanti, A; Rossolini, G M; Lupetti, A
2017-10-01
The spread of multi-drug resistant (MDR) Klebsiella pneumoniae strains producing carbapenemases points to a pressing need for new antibacterial agents. To this end, the in-vitro antibacterial activity of a synthetic N-terminal peptide of human lactoferrin, further referred to as hLF1-11, was evaluated against K. pneumoniae strains harboring different carbapenemase genes (i.e. OXA-48, KPC-2, KPC-3, VIM-1), with different susceptibility to colistin and other antibiotics, alone or in combination with conventional antibiotics (gentamicin, tigecycline, rifampicin, clindamycin, and clarithromycin). An antimicrobial peptide susceptibility assay was used to assess the bactericidal activity of hLF1-11 against the different K. pneumoniae strains tested. The synergistic activity was evaluated by a checkerboard titration method, and the fractional inhibitory concentration (FIC) index was calculated for the various combinations. hLF1-11 was more efficient in killing a K. pneumoniae strain susceptible to most antimicrobials (including colistin) than a colistin-susceptible strain and a colistin-resistant MDR K. pneumoniae strain. In addition, hLF1-11 exhibited a synergistic effect with the tested antibiotics against MDR K. pneumoniae strains. The results of this study indicate that resistance to hLF1-11 and colistin are not strictly associated, and suggest an hLF1-11-induced sensitizing effect of K. pneumoniae to antibiotics, especially to hydrophobic antibiotics, which are normally not effective on Gram-negative bacteria. Altogether, these data indicate that hLF1-11 in combination with antibiotics is a promising candidate to treat infections caused by MDR-K. pneumoniae strains.
Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz
2015-02-20
The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification of CELF1 RNA targets by CLIP-seq in human HeLa cells
Directory of Open Access Journals (Sweden)
Olivier Le Tonquèze
2016-06-01
Full Text Available The specific interactions between RNA-binding proteins and their target RNAs are an essential level to control gene expression. By combining ultra-violet cross-linking and immunoprecipitation (CLIP and massive SoliD sequencing we identified the RNAs bound by the RNA-binding protein CELF1, in human HeLa cells. The CELF1 binding sites deduced from the sequence data allow characterizing specific features of CELF1-RNA association. We present therefore the first map of CELF1 binding sites in human cells.
An Epstein-Barr Virus MicroRNA Blocks Interleukin-1 (IL-1) Signaling by Targeting IL-1 Receptor 1.
Skinner, Camille M; Ivanov, Nikita S; Barr, Sarah A; Chen, Yan; Skalsky, Rebecca L
2017-11-01
Epstein-Barr virus (EBV) encodes >44 viral microRNAs (miRNAs) that are differentially expressed throughout infection, can be detected in Epstein-Barr virus (EBV)-positive tumors, and manipulate several biological processes, including cell proliferation, apoptosis, and immune responses. Here, we show that EBV BHRF1-2 miRNAs block NF-κB activation following treatment with proinflammatory cytokines, specifically interleukin-1β (IL-1β). Analysis of EBV PAR-CLIP miRNA targetome data sets combined with pathway analysis revealed multiple BHRF1-2 miRNA targets involved in interleukin signaling pathways. By further analyzing changes in cellular gene expression patterns, we identified the IL-1 receptor 1 (IL1R1) as a direct target of miR-BHRF1-2-5p. Targeting the IL1R1 3' untranslated region (UTR) by EBV miR-BHRF1-2-5p was confirmed using 3'-UTR luciferase reporter assays and Western blot assays. Manipulation of EBV BHRF1-2 miRNA activity in latently infected B cells altered steady-state cytokine levels and disrupted IL-1β responsiveness. These studies demonstrate functionally relevant BHRF1-2 miRNA interactions during EBV infection, which is an important step in understanding their roles in pathogenesis. IMPORTANCE IL-1 signaling plays an important role in inflammation and early activation of host innate immune responses following virus infection. Here, we demonstrate that a viral miRNA downregulates the IL-1 receptor 1 during EBV infection, which consequently alters the responsiveness of cells to IL-1 stimuli and changes the cytokine expression levels within infected cell populations. We postulate that this viral miRNA activity not only disrupts IL-1 autocrine and paracrine signaling loops that can alert effector cells to sites of infection but also provides a survival advantage by dampening excessive inflammation that may be detrimental to the infected cell. Copyright © 2017 American Society for Microbiology.
Lee, Jonghwan; Choi, Kyung-Ju; Moon, Sung Ung; Kim, Soonhag
2016-01-01
Recently, microRNA (miRNA or miR) has emerged as a new cancer biomarker because of its high expression level in various cancer types and its role in the control of tumor suppressor genes. In cancer studies, molecular imaging and treatment based on target cancer markers have been combined to facilitate simultaneous cancer diagnosis and therapy. In this study, for combined therapy with diagnosis of cancer, we developed a doxorubicin-conjugated miR-221 molecular beacon (miR-221 DOXO MB) in a single platform composed of three different nucleotides: miR-221 binding sequence, black hole quencher 1 (BHQ1), and doxorubicin binding site. Imaging of endogenous miR-221 was achieved by specific hybridization between miR-221 and the miR-221 binding site in miR-221 DOXO MB. The presence of miR-221 triggered detachment of the quencher oligo and subsequent activation of a fluorescent signal of miR-221 DOXO MB. Simultaneous cancer therapy in C6 astrocytoma cells and nude mice was achieved by inhibition of miRNA-221 function that downregulates tumor suppressor genes. The detection of miR-221 expression and inhibition of miR-221 function by miR-221 DOXO MB provide the feasibility as a cancer theragnostic probe. Furthermore, a cytotoxic effect was induced by unloading of doxorubicin intercalated into miR-221 DOXO MB inside cells. Loss of miR-221 function and cytotoxicity induced by the miR-221 DOXO MB provides combined therapeutic efficacy against cancers. This method could be used as a new theragnostic probe with enhanced therapy to detect and inhibit many cancer-related miRNAs. Copyright © 2015 Elsevier Ltd. All rights reserved.
Evf2 lncRNA/BRG1/DLX1 interactions reveal RNA-dependent inhibition of chromatin remodeling.
Cajigas, Ivelisse; Leib, David E; Cochrane, Jesse; Luo, Hao; Swyter, Kelsey R; Chen, Sean; Clark, Brian S; Thompson, James; Yates, John R; Kingston, Robert E; Kohtz, Jhumku D
2015-08-01
Transcription-regulating long non-coding RNAs (lncRNAs) have the potential to control the site-specific expression of thousands of target genes. Previously, we showed that Evf2, the first described ultraconserved lncRNA, increases the association of transcriptional activators (DLX homeodomain proteins) with key DNA enhancers but represses gene expression. In this report, mass spectrometry shows that the Evf2-DLX1 ribonucleoprotein (RNP) contains the SWI/SNF-related chromatin remodelers Brahma-related gene 1 (BRG1, SMARCA4) and Brahma-associated factor (BAF170, SMARCC2) in the developing mouse forebrain. Evf2 RNA colocalizes with BRG1 in nuclear clouds and increases BRG1 association with key DNA regulatory enhancers in the developing forebrain. While BRG1 directly interacts with DLX1 and Evf2 through distinct binding sites, Evf2 directly inhibits BRG1 ATPase and chromatin remodeling activities. In vitro studies show that both RNA-BRG1 binding and RNA inhibition of BRG1 ATPase/remodeling activity are promiscuous, suggesting that context is a crucial factor in RNA-dependent chromatin remodeling inhibition. Together, these experiments support a model in which RNAs convert an active enhancer to a repressed enhancer by directly inhibiting chromatin remodeling activity, and address the apparent paradox of RNA-mediated stabilization of transcriptional activators at enhancers with a repressive outcome. The importance of BRG1/RNA and BRG1/homeodomain interactions in neurodevelopmental disorders is underscored by the finding that mutations in Coffin-Siris syndrome, a human intellectual disability disorder, localize to the BRG1 RNA-binding and DLX1-binding domains. © 2015. Published by The Company of Biologists Ltd.
Management and treatment outcomes of patients enrolled in MDR-TB treatment in Viet Nam.
Phuong, N T M; Nhung, N V; Hoa, N B; Thuy, H T; Takarinda, K C; Tayler-Smith, K; Harries, A D
2016-03-21
The programmatic management of drug-resistant tuberculosis (TB) in Viet Nam has been rapidly scaled up since 2009. To document the annual numbers of patients enrolled for multidrug-resistant tuberculosis (MDR-TB) treatment during 2010-2014 and to determine characteristics and treatment outcomes of patients initiating treatment during 2010-2012. A retrospective cohort study using national reports and data from the national electronic data system for drug-resistant TB. The number of patients enrolled annually for MDR-TB treatment increased from 97 in 2010 to 1522 in 2014. The majority of patients were middle-aged men who had pulmonary disease and had failed a retreatment regimen; 77% had received ⩾2 courses of TB treatment. Favourable outcomes (cured and treatment completed) were attained in 73% of patients. Unfavourable outcomes included loss to follow-up (12.5%), death (8%) and failure (6.3%). Having had ⩾2 previous treatment courses and being human immunodeficiency virus-positive were associated with unfavourable outcomes. Increasing numbers of patients are being treated for MDR-TB each year with good treatment outcomes under national programme management in Viet Nam. However, there is a need to increase case detection-currently at 30% of the estimated 5100 MDR-TB cases per year, reduce adverse outcomes and improve monitoring and evaluation.
Zhu, Zhenni; Wang, Yu; Liu, Zhiqing; Wang, Fan; Zhao, Qiu
2012-05-01
The aim of this study was to verify the inhibitory effects of epigallocatechin-3-gallate (EGCG) on cell proliferation and the expression of hypoxia-inducible factor 1 (HIF-1α) and multidrug resistance protein 1 (MDR1/P-gp) in the human pancreatic carcinoma cell line PANC-1, thereby, reversing drug resistance of pancreatic carcinoma and improving its sensitivity to cancer chemotherapy. The human pancreatic carcinoma cell line PANC-1 was incubated under hypoxic conditions with different concentrations of epigallocatechin-3-gallate (EGCG) for indicated hours. The effects of EGCG on the mRNA or protein expression of HIF-1α and MDR1 were determined by RT-PCR or western blotting. Cellular proliferation and viability assays were measured using Cell Counting Kit-8. Western blotting revealed that EGCG inhibits the expression of the HIF-1α protein in a dose-dependent manner, while RT-PCR showed that it does not have any effects on HIF-1α mRNA. In addition, EGCG attenuated the mRNA and protein levels of P-gp in a dose-dependent manner, reaching a peak at the highest concentration. Furthermore, EGCG inhibited the proliferation of PANC-1 cells in a concentration- and time-dependent manner. The attenuation of HIF-1α and the consequently reduced P-gp could contribute to the inhibitory effects of EGCG on the proliferation of PANC-1 cells.
Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.
Directory of Open Access Journals (Sweden)
Richa Kumari
Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients
International Nuclear Information System (INIS)
Berger, W.
1993-08-01
The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance
Thapa, Rupak; Bhagat, Chintan; Shrestha, Pragya; Awal, Suvash; Dudhagara, Pravin
2017-05-16
Silver nanoparticles (AgNPs) are believed to be emerging tool against various infectious diseases including multi-drug resistant (MDR) bacteria. In the present study, in vitro synthesis of AgNPs was optimized using 1:50 ratio of macerozyme (25 μg/μl) and 1 mM AgNO 3 incubated at 80 °C for 8 h. AgNPs were characterized by UV-Visible spectroscopy, dynamic light scattering (DLS), scanning electron microscopy, energy-dispersive X-ray spectroscopy, transmission electron microscopy (TEM) and X-ray diffraction (XRD). Characterization studies suggest the synthesis of elliptical, stable and crystalline AgNPs with an average size of 38.26 ± 0.4 nm calculated using TEM. The XRD pattern revealed the face-centered-cubic (fcc) form of metallic silver. Good shape integrity and dispersion of AgNPs after 1 year of incubation confirmed their stability. AgNPs were exibited the antimicrobial property against ten pathogenic bacteria, three molds and one yeast. The AgNPs also revealed remarkable antimicrobial activity against three MDR strains i.e. Extended spectrum beta-lactamase positive Escherichia coli, Staphylococcus aureus (MRSA) and Teicoplanin resistant Streptococcus Pneumoniae. The AgNPs coated surgical threads (suture) were revealed the remarkble antibacterial activity against three MDR strains. This is the first report to synthesize antimicrobial elliptical AgNPs using enzymes. The results suggest the possibilities to develop the nanoparticles coated antimicrobial medical fabric to combat against MDR infection.
RNA-binding properties and RNA chaperone activity of human peroxiredoxin 1
International Nuclear Information System (INIS)
Kim, Ji-Hee; Lee, Jeong-Mi; Lee, Hae Na; Kim, Eun-Kyung; Ha, Bin; Ahn, Sung-Min; Jang, Ho Hee; Lee, Sang Yeol
2012-01-01
Highlights: ► hPrx1 has RNA-binding properties. ► hPrx1 exhibits helix-destabilizing activity. ► Cold stress increases hPrx1 level in the nuclear fraction. ► hPrx1 enhances the viability of cells exposed to cold stress. -- Abstract: Human peroxiredoxin 1 (hPrx1), a member of the peroxiredoxin family, detoxifies peroxide substrates and has been implicated in numerous biological processes, including cell growth, proliferation, differentiation, apoptosis, and redox signaling. To date, Prx1 has not been implicated in RNA metabolism. Here, we investigated the ability of hPrx1 to bind RNA and act as an RNA chaperone. In vitro, hPrx1 bound to RNA and DNA, and unwound nucleic acid duplexes. hPrx1 also acted as a transcription anti-terminator in an assay using an Escherichia coli strain containing a stem–loop structure upstream of the chloramphenicol resistance gene. The overall cellular level of hPrx1 expression was not increased at low temperatures, but the nuclear level of hPrx1 was increased. In addition, hPrx1 overexpression enhanced the survival of cells exposed to cold stress, whereas hPrx1 knockdown significantly reduced cell survival under the same conditions. These findings suggest that hPrx1 may perform biological functions as a RNA-binding protein, which are distinctive from known functions of hPrx1 as a reactive oxygen species scavenger.
Wang, Yong; Yang, Tao; Zhang, Zhen; Lu, Ming; Zhao, Wei; Zeng, Xiandong; Zhang, Weiguo
2017-05-01
Long non-coding RNA (lncRNA) have been the focus of increasing attention due to the role they play in many diseases, including osteosarcoma. The function of taurine upregulated gene 1 (TUG1) and its mechanism in osteosarcoma remain unclear. In our research, we found that TUG1 was elevated and correlated with a poor prognosis in osteosarcoma patients. In addition, the following functional experiment showed that decreased TUG1 could remarkably inhibit osteosarcoma cell migration and invasion, indicating that TUG1 functioned as an oncogene in osteosarcoma. Moreover, we revealed that TUG1 and Rho-associated coiled-coil-containing protein kinase 1 (ROCK1), a metastasis-related gene targeted by microRNA-335-5p (miR-335-5p), had the same miR-335-5p combining site. The subsequent luciferase assay verified TUG1 was a target of miR-335-5p. Furthermore, the results of a real-time quantitative PCR showed that TUG1 and miR-335-5p could affect each other's expression. respectively. Finally, we affirmed that TUG1 affected ROCK1 expression and ROCK1-mediated migration/invasion by working as a competitive endogenous RNA (ceRNA) via miR-335-5p. In summary, the findings of this study, based on ceRNA theory, combining the research foundation of miR-335-5p and ROCK1, and taking TUG1 as a new study point, provide new insight into molecular-level reversing migration and invasion of osteosarcoma. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Stalenhoef, Janneke E; Terveer, Elisabeth M; Knetsch, Cornelis W; Van't Hof, Peter J; Vlasveld, Imro N; Keller, Josbert J; Visser, Leo G; Kuijper, Eduard J
2017-01-01
Combined fecal microbiota transfer and antibiotic treatment prevented recurrences of urinary tract infections with multidrug-resistant (MDR) Pseudomonas aeruginosa , but it failed to eradicate intestinal colonization with MDR Escherichia coli . Based on microbiota analysis, failure was not associated with distinct diminished microbiota diversity.
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...
Peters, Philip J; Westheimer, Emily; Cohen, Stephanie; Hightow-Weidman, Lisa B; Moss, Nicholas; Tsoi, Benjamin; Hall, Laura; Fann, Charles; Daskalakis, Demetre C; Beagle, Steve; Patel, Pragna; Radix, Asa; Foust, Evelyn; Kohn, Robert P; Marmorino, Jenni; Pandori, Mark; Fu, Jie; Samandari, Taraz; Gay, Cynthia L
2016-02-16
Although acute HIV infection contributes disproportionately to onward HIV transmission, HIV testing has not routinely included screening for acute HIV infection. To evaluate the performance of an HIV antigen/antibody (Ag/Ab) combination assay to detect acute HIV infection compared with pooled HIV RNA testing. Multisite, prospective, within-individual comparison study conducted between September 2011 and October 2013 in 7 sexually transmitted infection clinics and 5 community-based programs in New York, California, and North Carolina. Participants were 12 years or older and seeking HIV testing, without known HIV infection. All participants with a negative rapid HIV test result were screened for acute HIV infection with an HIV Ag/Ab combination assay (index test) and pooled human immunodeficiency virus 1 (HIV-1) RNA testing. HIV RNA testing was the reference standard, with positive reference standard result defined as detectable HIV-1 RNA on an individual RNA test. Number and proportion with acute HIV infections detected. Among 86,836 participants with complete test results (median age, 29 years; 75.0% men; 51.8% men who have sex with men), established HIV infection was diagnosed in 1158 participants (1.33%) and acute HIV infection was diagnosed in 168 participants (0.19%). Acute HIV infection was detected in 134 participants with HIV Ag/Ab combination testing (0.15% [95% CI, 0.13%-0.18%]; sensitivity, 79.8% [95% CI, 72.9%-85.6%]; specificity, 99.9% [95% CI, 99.9%-99.9%]; positive predictive value, 59.0% [95% CI, 52.3%-65.5%]) and in 164 participants with pooled HIV RNA testing (0.19% [95% CI, 0.16%-0.22%]; sensitivity, 97.6% [95% CI, 94.0%-99.4%]; specificity, 100% [95% CI, 100%-100%]; positive predictive value, 96.5% [95% CI, 92.5%-98.7%]; sensitivity comparison, P testing detected 82% of acute HIV infections detectable by pooled HIV RNA testing. Compared with rapid HIV testing alone, HIV Ag/Ab combination testing increased the relative HIV diagnostic yield (both
Szaflarski, Witold; Sujka-Kordowska, Patrycja; Pula, Bartosz; Jaszczyńska-Nowinka, Karolina; Andrzejewska, Małgorzata; Zawierucha, Piotr; Dziegiel, Piotr; Nowicki, Michał; Ivanov, Pavel; Zabel, Maciej
2013-08-01
Vaults are cytoplasmic ribonucleoprotein particles composed of three proteins (MVP, TEP1, vPARP) and vault‑associated RNAs (vRNAs). Although the cellular functions of vaults remain unclear, vaults are strongly linked to the development of multidrug resistance (MDR), the major obstacle to the efficient treatment of cancers. Available published data suggest that vaults and their components are frequently upregulated in broad variety of multidrug-resistant cancer cell lines and tumors of different histological origin. Here, we provide detailed analysis of vault protein expression in post-surgery ovarian cancer samples from patients that were not exposed to chemotherapy. Our analysis suggests that vault proteins are expressed in the ovaries of healthy individuals but their expression in cancer patients is changed. Specifically, MVP, TEP1 and vPARP mRNA levels are significantly decreased in cancer samples with tendency of lower expression in higher-grade tumors. The pattern of vault protein mRNA expression is strongly correlated with the expression of other MDR-associated proteins such as MDR1, MRP1 and BCRP. Surprisingly, the protein levels of MVP, TEP1 and vPARP are actually increased in the higher‑grade tumors suggesting existence of post-transcriptional regulation of vault component production.
Hicks, R M; Padayatchi, N; Shah, N S; Wolf, A; Werner, L; Sunkari, V B; O'Donnell, M R
2014-09-01
Pediatric multidrug-resistant tuberculosis (MDR-TB) is complicated by difficult diagnosis, complex treatment, and high mortality. In South Africa, these challenges are amplified by human immunodeficiency virus (HIV) co-infection; however, evidence on treatment outcomes among co-infected children is limited. Using conventional and new pediatric definitions, to describe treatment outcomes and identify risk factors for unfavorable outcome and mortality in children aged children (median age 8 years, IQR 4-12) with MDR-TB (n = 78) or XDR-TB (n = 6) initiated treatment. Sixty-four (77%) were HIV-positive and 62 (97%) received antiretroviral therapy. Sixty-six (79%) achieved favorable treatment outcomes. Overall mortality was 11% (n = 9) at 18 months after initiation of treatment. Malnutrition (aOR 27.4, 95%CI 2.7-278.7) and severe radiographic findings (aOR 4.68, 95%CI 1.01-21.9) were associated with unfavorable outcome. New pediatric outcome definitions increased the proportion classified as cured. It is possible to successfully treat pediatric MDR-TB-HIV even in resource-poor settings. Malnutrition is a marker for severe TB-HIV disease, and is a potential target for future interventions in these patients.
Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries
Directory of Open Access Journals (Sweden)
Daniela Toro-Ascuy
2016-11-01
Full Text Available The human immunodeficiency virus type-1 (HIV-1 unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1, Staufen double-stranded RNA binding protein 1/2 (STAU1/2, or components of miRNA-induced silencing complex (miRISC and processing bodies (PBs. More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A, allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2, an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries.
Ex vivo analysis identifies effective HIV-1 latency–reversing drug combinations
Laird, Gregory M.; Bullen, C. Korin; Rosenbloom, Daniel I.S.; Martin, Alyssa R.; Hill, Alison L.; Durand, Christine M.; Siliciano, Janet D.; Siliciano, Robert F.
2015-01-01
Reversal of HIV-1 latency by small molecules is a potential cure strategy. This approach will likely require effective drug combinations to achieve high levels of latency reversal. Using resting CD4+ T cells (rCD4s) from infected individuals, we developed an experimental and theoretical framework to identify effective latency-reversing agent (LRA) combinations. Utilizing ex vivo assays for intracellular HIV-1 mRNA and virion production, we compared 2-drug combinations of leading candidate LRAs and identified multiple combinations that effectively reverse latency. We showed that protein kinase C agonists in combination with bromodomain inhibitor JQ1 or histone deacetylase inhibitors robustly induce HIV-1 transcription and virus production when directly compared with maximum reactivation by T cell activation. Using the Bliss independence model to quantitate combined drug effects, we demonstrated that these combinations synergize to induce HIV-1 transcription. This robust latency reversal occurred without release of proinflammatory cytokines by rCD4s. To extend the clinical utility of our findings, we applied a mathematical model that estimates in vivo changes in plasma HIV-1 RNA from ex vivo measurements of virus production. Our study reconciles diverse findings from previous studies, establishes a quantitative experimental approach to evaluate combinatorial LRA efficacy, and presents a model to predict in vivo responses to LRAs. PMID:25822022
Non-coding RNA detection methods combined to improve usability, reproducibility and precision
Directory of Open Access Journals (Sweden)
Kreikemeyer Bernd
2010-09-01
Full Text Available Abstract Background Non-coding RNAs gain more attention as their diverse roles in many cellular processes are discovered. At the same time, the need for efficient computational prediction of ncRNAs increases with the pace of sequencing technology. Existing tools are based on various approaches and techniques, but none of them provides a reliable ncRNA detector yet. Consequently, a natural approach is to combine existing tools. Due to a lack of standard input and output formats combination and comparison of existing tools is difficult. Also, for genomic scans they often need to be incorporated in detection workflows using custom scripts, which decreases transparency and reproducibility. Results We developed a Java-based framework to integrate existing tools and methods for ncRNA detection. This framework enables users to construct transparent detection workflows and to combine and compare different methods efficiently. We demonstrate the effectiveness of combining detection methods in case studies with the small genomes of Escherichia coli, Listeria monocytogenes and Streptococcus pyogenes. With the combined method, we gained 10% to 20% precision for sensitivities from 30% to 80%. Further, we investigated Streptococcus pyogenes for novel ncRNAs. Using multiple methods--integrated by our framework--we determined four highly probable candidates. We verified all four candidates experimentally using RT-PCR. Conclusions We have created an extensible framework for practical, transparent and reproducible combination and comparison of ncRNA detection methods. We have proven the effectiveness of this approach in tests and by guiding experiments to find new ncRNAs. The software is freely available under the GNU General Public License (GPL, version 3 at http://www.sbi.uni-rostock.de/moses along with source code, screen shots, examples and tutorial material.
Lo, Yu-Li; Tu, Wei-Chen
2015-12-05
Chrysophsin-1, an amphipathic alpha-helical antimicrobial peptide, is isolated from the gills of the red sea bream and possesses different structure and mechanism(s) in comparison with traditional multidrug resistance (MDR) modulators. For the purpose of reducing off-target normal cell toxicity, it is rational to incorporate chrysophsin-1 and epirubicin in a PEGylated liposomal formulation. In the present study, we report a multifunctional liposomes with epirubicin as an antineoplastic agent and an apoptosis inducer, as well as chrysophsin-1 as a MDR transporter inhibitor and an apoptosis modulator in human cervical cancer HeLa cells. Co-incubation of HeLa cells with PEGylated liposomal formulation of epirubicin and chrysophsin-1 resulted in a significant increase in the cytotoxicity of epirubicin. The liposomal formulations of epirubicin and/or chrysophsin-1 were shown to considerably improve the intracellular H2O2 and O2(-) levels of HeLa cells. Furthermore, these treatments were found to extensively reduce mRNA expression levels of MDR1, MRP1, and MRP2. The addition of chrysophsin-1 in liposomes was demonstrated to substantially enhance the intracellular accumulation of epirubicin in HeLa cells. Moreover, the PEGylated liposomes of epirubicin and chrysophsin-1 were also found to significantly increase the mRNA expressions of p53, Bax, and Bcl-2. The ratio of Bax to Bcl-2 was noticeably amplified in the presence of these formulations. Apoptosis induction was also validated by chromatin condensation, a reduction in mitochondrial membrane potential, the increased sub-G1 phase of cell cycle, and more populations of apoptosis using annexin V/PI assay. These formulations were verified to increase the activity and mRNA expression levels of caspase-9 and caspases-3. Collectively, our findings provide the first evidence that cotreatment with free or liposomal chrysophsin-1 and epirubicin leads to cell death in human cervical cancer cells through the ROS
Directory of Open Access Journals (Sweden)
Raj N Yadav
Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.
Ghodousi, Elaheh S; Rahgozar, Soheila
2018-04-06
Multidrug resistance (MDR) is considered as the major obstacle for treating pediatric acute lymphoblastic leukemia (ALL). MicroRNAs (miRNAs) are small non coding RNAs which may potentially regulate response to chemotherapy. In this study, total RNA was isolated from bone marrow samples of 46 children with de novo ALL and 16 controls. Quantitative reverse transcriptase polymerase chain reaction was used to investigate the expression profile of the predicted miRNAs; miR-326 and miR-200c, and their predicted targets ABCA2, and ABCA3 transporters. The presence of minimal residual disease was studied using PCR-SSCP (single-strand conformation polymorphism) 1 year after treatment. The association between the miRNA expression and drug resistance was analyzed statistically. Results showed a significant down-regulation of both miR-326 and miR-200c expressions in ALL patients compared with non-cancer controls (P = 0.0002, AUC = 0.813 and P = 0.035, AUC = 0.79, respectively). A considerable negative association between miR-326 expression and MDR was identified which could raise the risk of chemoresistance by 4.8- fold. The expression profiles of miR-326 and ABCA2 transporter were inversely correlated. Data revealed, a novel diagnostic role for miR-326 and miR-200c as potential biomarkers of pediatric ALL. Down-regulation of miR-326 was introduced, for the first time, as a prognostic factor for drug resistance in childhood ALL. To the best of our knowledge, this is the first time that ABCA2 transporter is proposed as a target gene for miR-326, through which it can exert its impact on drug resistance. These data may provide novel approaches to new therapeutics and diagnostics. © 2018 Wiley Periodicals, Inc.
Management of MDR-TB in HIV co-infected patients in Eastern Europe
DEFF Research Database (Denmark)
Efsen, A M W; Schultze, A; Miller, R F
2018-01-01
below the target of 90%, reflecting the challenging patient population and the environment in which health care is provided. Urgent improvement of management of patients with TB/HIV in EE, in particular for those with MDR-TB, is needed and includes widespread access to rapid TB diagnostics, better......OBJECTIVES: Mortality among HIV patients with tuberculosis (TB) remains high in Eastern Europe (EE), but details of TB and HIV management remain scarce. METHODS: In this prospective study, we describe the TB treatment regimens of patients with multi-drug resistant (MDR) TB and use of antiretroviral...... access to and use of second-line TB drugs, timely ART initiation with viral load monitoring, and integration of TB/HIV care....
Directory of Open Access Journals (Sweden)
Pham PV
2012-05-01
Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was
The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain.
Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene
2014-01-01
T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.
Komori, Yuki; Arisawa, Sakiko; Takai, Miho; Yokoyama, Kunihiro; Honda, Minako; Hayashi, Kazuhiko; Ishigami, Masatoshi; Katano, Yoshiaki; Goto, Hidemi; Ueyama, Jun; Ishikawa, Tetsuya; Wakusawa, Shinya
2014-02-05
The hepatoprotective action of ursodeoxycholic acid (UDCA) was previously suggested to be partially dependent on its antioxidative effect. Doxorubicin (DOX) and reactive oxygen species have also been implicated in the overexpression of P-glycoprotein (P-gp), which is encoded by the MDR1 gene and causes antitumor multidrug resistance. In the present study, we assessed the effects of UDCA on the expression of MDR1 mRNA, P-gp, and intracellular reactive oxygen species levels in DOX-treated HepG2 cells and compared them to those of other bile acids. DOX-induced increases in reactive oxygen species levels and the expression of MDR1 mRNA were inhibited by N-acetylcysteine, an antioxidant, and the DOX-induced increase in reactive oxygen species levels and DOX-induced overexpression of MDR1 mRNA and P-gp were inhibited by UDCA. Cells treated with UDCA showed improved rhodamine 123 uptake, which was decreased in cells treated with DOX alone. Moreover, cells exposed to DOX for 24h combined with UDCA accumulated more DOX than that of cells treated with DOX alone. Thus, UDCA may have inhibited the overexpression of P-gp by suppressing DOX-induced reactive oxygen species production. Chenodeoxycholic acid (CDCA) also exhibited these effects, whereas deoxycholic acid and litocholic acid were ineffective. In conclusion, UDCA and CDCA had an inhibitory effect on the induction of P-gp expression and reactive oxygen species by DOX in HepG2 cells. The administration of UDCA may be beneficial due to its ability to prevent the overexpression of reactive oxygen species and acquisition of multidrug resistance in hepatocellular carcinoma cells. Copyright © 2013 Elsevier B.V. All rights reserved.
Combining miRNA and mRNA Expression Profiles in Wilms Tumor Subtypes
Directory of Open Access Journals (Sweden)
Nicole Ludwig
2016-03-01
Full Text Available Wilms tumor (WT is the most common childhood renal cancer. Recent findings of mutations in microRNA (miRNA processing proteins suggest a pivotal role of miRNAs in WT genesis. We performed miRNA expression profiling of 36 WTs of different subtypes and four normal kidney tissues using microarrays. Additionally, we determined the gene expression profile of 28 of these tumors to identify potentially correlated target genes and affected pathways. We identified 85 miRNAs and 2107 messenger RNAs (mRNA differentially expressed in blastemal WT, and 266 miRNAs and 1267 mRNAs differentially expressed in regressive subtype. The hierarchical clustering of the samples, using either the miRNA or mRNA profile, showed the clear separation of WT from normal kidney samples, but the miRNA pattern yielded better separation of WT subtypes. A correlation analysis of the deregulated miRNA and mRNAs identified 13,026 miRNA/mRNA pairs with inversely correlated expression, of which 2844 are potential interactions of miRNA and their predicted mRNA targets. We found significant upregulation of miRNAs-183, -301a/b and -335 for the blastemal subtype, and miRNAs-181b, -223 and -630 for the regressive subtype. We found marked deregulation of miRNAs regulating epithelial to mesenchymal transition, especially in the blastemal subtype, and miRNAs influencing chemosensitivity, especially in regressive subtypes. Further research is needed to assess the influence of preoperative chemotherapy and tumor infiltrating lymphocytes on the miRNA and mRNA patterns in WT.
Lo, Yu-Li; Lee, Hsin-Pin; Tu, Wei-Chen
2015-01-01
This study aims to explore the effects and mechanisms of hepcidin, a potential antimicrobial peptide from Tilapia, and epirubicin (Epi), an antineoplastic agent, on the generation of reactive oxygen species (ROS) and link the ROS levels to the reversal mechanisms of multidrug resistance (MDR) by epirubicin and hepcidin in human squamous cell carcinoma SCC15 and human embryonal carcinoma NT2D1 cells. The cells, pretreated with hepcidin, epirubicin, or a combination of these compounds in PEGylated liposomes, were used to validate the molecular mechanisms involved in inhibiting efflux transporters and inducing apoptosis as evaluated by cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of this combination. We found that hepcidin significantly enhanced the cytotoxicity of epirubicin in liposomes. The co-incubation of epirubicin with hepcidin in liposomes intensified the ROS production, including hydrogen peroxide and superoxide free radicals. Hepcidin significantly increased epirubicin intracellular uptake into NT2D1 and SCC15 cells, as supported by the diminished mRNA expressions of MDR1, MDR-associated protein (MRP) 1, and MRP2. Hepcidin and/or epirubicin in liposomes triggered apoptosis, as verified by the reduced mitochondrial membrane potential, increased sub-G1 phase of cell cycle, incremental populations of apoptosis using annexin V/PI assay, and chromatin condensation. As far as we know, this is the first example showing that PEGylated liposomal TH1-5 and epirubicin gives rise to cell death in human squamous carcinoma and testicular embryonic carcinoma cells through the reduced epirubicin efflux via ROS-mediated suppression of P-gp and MRPs and concomitant initiation of mitochondrial apoptosis pathway. Hence, hepcidin in PEGylated liposomes may function as an adjuvant to anticancer drugs, thus demonstrating a novel strategy for reversing MDR. PMID:26393585
A preliminary characterisation of recovered uranium produced by MDR
International Nuclear Information System (INIS)
Kwon, Hyuk Il; Davison, J.; Marsh, G.
1997-10-01
The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO 2 powder and pellet produced by the MDR process were similar with those of NU UO 2 powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs
A preliminary characterisation of recovered uranium produced by MDR
Energy Technology Data Exchange (ETDEWEB)
Kwon, Hyuk Il [Korea Atomic Energy Research Inst., Daeduk (Korea, Republic of); Davison, J.; Marsh, G. [British Nuclear Forum, London (United Kingdom)
1997-10-01
The CANFLEX-RU fuel to be developed for the future should be verified if it has any major problems in RU handling techniques and related technology development. For this purpose, a preliminary R and D efforts on the RU handling characteristics were executed by joint effort with BNFL in following area. 1) preparation of RU powder by the MDR process 2) Compaction and sintering characteristics of RU powder 3) required special process for the production of CANFLEX-RU fuel 4) characterization of fission product residue composition in the RU powder 5) radiological characterization of RU powder and sintered pellets. Physical characterization of RU UO{sub 2} powder and pellet produced by the MDR process were similar with those of NU UO{sub 2} powder and pellet. The density of RU pellets, however, were higher than those of NU pellets and RU pellets showed little higher values in pore size distributions. RU contained only negligibly low concentrations of fission products and actinides. Especially, the Cs-137 content in the powder (before sintering) were undetectable and therefore would not contaminate the sintering furnace. RU pellet showed higher impurity levels, especially in the Ni content. Radioactivity on the RU powder showed about twice higher value at the surface than those of NU, but showed drastic reduction by distance and became similar at the 1 meter distance. RU pellets showed close coincidence between NU and RU at any distance. This result could be used close coincidence between NU and RU at any distance. This result could be used as a basis of the feasibility assessment on the development of CANFLEX-RU. Through basic research works on the improvement of CANFLEX-RU fabrication processes, compatibility with CANFLEX-NU fabrication process will be evaluated and analysed. (author). 4 refs.
Khoeruddin Wittriansyah; Agus Trianto; Sekar Widyaningsih; Ocky Karna Radjasa; Rudhi Pribadi
2016-01-01
Marine sponge-associated fungi are the sources of bioactive compounds with various pharmacologicals potency. This study aimed to isolate the sponge-associated fungi as the producer of the MDR anti-bacterial compounds. The associated fungi were isolated from the sponges collected from Riung water, Nusa Tenggara Timur. Five of the best isolates were cultured on MEA to obtain the methanolic extract for further studies. The antagonistic test was conducted using overlay method towards the MDR St...
75 FR 59176 - DoD Mandatory Declassification Review (MDR) Program
2010-09-27
..., VA 22060-6201. (13) Missile Defense Agency. Missile Defense Agency, Attention: MDA/DS, 7100 Defense... DEPARTMENT OF DEFENSE Office of the Secretary 32 CFR Part 222 [DoD-2010-OS-0043; RIN 0790-AI62] DoD Mandatory Declassification Review (MDR) Program AGENCY: Department of Defense. ACTION: Proposed...
Directory of Open Access Journals (Sweden)
Sudeepa Khanal
Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.
Directory of Open Access Journals (Sweden)
Shiv Kumar
2015-06-01
Full Text Available CONTEXT : Tuberculosis is a contagious disease with social stigma attached to it. Various problems which are social and economic in nature are faced by TB patient. Therefore , it is essential to explore the overall effect of MDR - TB/TB on health and patients perception of Well - being. AIMS : To Document the effect of MDR - TB/TB on social , functional and economic well - being of patients. SETTINGS AND DESIGN : A Cross - sectional study , Conveniently Recruited 68 MDR - TB Patients and 136 non - MDR - TB Patients (from Rural as well as urban Area of Surat District diagnosed by CBNAAT were interviewed for investigating the effect of Tuberculosis. METHODS AND MATERIAL : A pre - tested standardized semi - structured questionnaire was used. Data was collected about socio - demographic profile of patients and interpreted in table. Data about effect of MDR - TB/TB was collected on Likert Scale and Frequency was calculated and Data wa s plotted on multiple bar charts. RESULTS : As compared to healthy status in the past , 93% MDR - TB and 82% TB patients have decreased ability to do work , about half of MDR - TB Patients and TB Patients have detiorated relations with family members , 67% of stud y participants have developed disharmonious relations with neighbor’s , 55% of Study participants have decreased income , 88% of study participants have decreased performance in day to day activities and 78% of study participants have faced discordial and di srespectful behavior from co - workers. CONCLUSION : Working ability more detiorated in MDR - TB patients while rest of the effect on social , functional and economic well - being is same in both TB and Multi Drug Resistant TB patients. This study emphasizes very clearly that social stigma still persist in community about Tuberculosis which needs to be eliminated in community by behavior change communication by health workers at all levels of health care.
Zhang, Hui; Patel, Atish; Ma, Shao-Lin; Li, Xiao Jie; Zhang, Yun-Kai; Yang, Pei-Qi; Kathawala, Rishil J; Wang, Yi-Jun; Anreddy, Nagaraju; Fu, Li-Wu; Chen, Zhe-Sheng
2014-01-01
Background and Purpose The transporter, multidrug resistance protein 1 (MRP1, ABCC1), plays a critical role in the development of multidrug resistance (MDR). Ibrutinib is an inhibitor of Bruton's tyrosine kinase. Here we investigated the reversal effect of ibrutinib on MRP1-mediated MDR. Experimental Approach Cytotoxicity was determined by MTT assay. The expression of protein was detected by Western blot. RT-PCR and Q-PCR were performed to detect the expression of MRP1 mRNA. The intracellular accumulation and efflux of substrates for MRP1 were measured by scintillation counter and flow cytometry. HEK293/MRP1 cell xenografts in nude mice were established to study the effects of ibrutinib in vivo. Key Results Ibrutinib significantly enhanced the cytotoxicity of MRP1 substrates in HEK293/MRP1 and HL60/Adr cells overexpressing MRP1. Furthermore, ibrutinib increased the accumulation of substrates in these MRP1-overexpressing cells by inhibiting the drug efflux function of MRP1. However, mRNA and protein expression of MRP1 remained unaltered after treatment with ibrutinib in MRP1-overexpressing cells. In vivo, ibrutinib enhanced the efficacy of vincristine to inhibit the growth of HEK293/MRP1 tumour xenografts in nude mice. Importantly, ibrutinib also enhances the cytotoxicity of vincristine in primary cultures of leukaemia blasts, derived from patients. Conclusions and Implications Our results indicated that ibrutinib significantly increased the efficacy of the chemotherapeutic agents which were MRP1 substrates, in MRP1-overexpressing cells, in vitro, in vivo and ex vivo. These findings will lead to further studies on the effects of a combination of ibrutinib with chemotherapeutic agents in cancer patients overexpressing MRP1. PMID:25164592
2012-01-01
Background During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the protection and dispersal of sexual spores. Fruiting bodies contain a number of cell types not found in vegetative mycelium, and these morphological differences are thought to be mediated by changes in gene expression. However, little is known about the spatial distribution of gene expression in fungal development. Here, we used laser microdissection (LM) and RNA-seq to determine gene expression patterns in young fruiting bodies (protoperithecia) and non-reproductive mycelia of the ascomycete Sordaria macrospora. Results Quantitative analysis showed major differences in the gene expression patterns between protoperithecia and total mycelium. Among the genes strongly up-regulated in protoperithecia were the pheromone precursor genes ppg1 and ppg2. The up-regulation was confirmed by fluorescence microscopy of egfp expression under the control of ppg1 regulatory sequences. RNA-seq analysis of protoperithecia from the sterile mutant pro1 showed that many genes that are differentially regulated in these structures are under the genetic control of transcription factor PRO1. Conclusions We have generated transcriptional profiles of young fungal sexual structures using a combination of LM and RNA-seq. This allowed a high spatial resolution and sensitivity, and yielded a detailed picture of gene expression during development. Our data revealed significant differences in gene expression between protoperithecia and non-reproductive mycelia, and showed that the transcription factor PRO1 is involved in the regulation of many genes expressed specifically in sexual structures. The LM/RNA-seq approach will also be relevant to other eukaryotic systems in which multicellular development is investigated. PMID:23016559
Directory of Open Access Journals (Sweden)
Teichert Ines
2012-09-01
Full Text Available Abstract Background During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the protection and dispersal of sexual spores. Fruiting bodies contain a number of cell types not found in vegetative mycelium, and these morphological differences are thought to be mediated by changes in gene expression. However, little is known about the spatial distribution of gene expression in fungal development. Here, we used laser microdissection (LM and RNA-seq to determine gene expression patterns in young fruiting bodies (protoperithecia and non-reproductive mycelia of the ascomycete Sordaria macrospora. Results Quantitative analysis showed major differences in the gene expression patterns between protoperithecia and total mycelium. Among the genes strongly up-regulated in protoperithecia were the pheromone precursor genes ppg1 and ppg2. The up-regulation was confirmed by fluorescence microscopy of egfp expression under the control of ppg1 regulatory sequences. RNA-seq analysis of protoperithecia from the sterile mutant pro1 showed that many genes that are differentially regulated in these structures are under the genetic control of transcription factor PRO1. Conclusions We have generated transcriptional profiles of young fungal sexual structures using a combination of LM and RNA-seq. This allowed a high spatial resolution and sensitivity, and yielded a detailed picture of gene expression during development. Our data revealed significant differences in gene expression between protoperithecia and non-reproductive mycelia, and showed that the transcription factor PRO1 is involved in the regulation of many genes expressed specifically in sexual structures. The LM/RNA-seq approach will also be relevant to other eukaryotic systems in which multicellular development is investigated.
Zhang, Yun-Kai; Zhang, Guan-Nan; Wang, Yi-Jun; Patel, Bhargav A.; Talele, Tanaji T.; Yang, Dong-Hua; Chen, Zhe-Sheng
2016-05-01
ATP-Binding Cassette transporters are involved in the efflux of xenobiotic compounds and are responsible for decreasing drug accumulation in multidrug resistant (MDR) cells. Discovered by structure-based virtual screening algorithms, bafetinib, a Bcr-Abl/Lyn tyrosine kinase inhibitor, was found to have inhibitory effects on both ABCB1- and ABCG2-mediated MDR in this in-vitro investigation. Bafetinib significantly sensitized ABCB1 and ABCG2 overexpressing MDR cells to their anticancer substrates and increased the intracellular accumulation of anticancer drugs, particularly doxorubicin and [3H]-paclitaxel in ABCB1 overexpressing cells; mitoxantrone and [3H]-mitoxantrone in ABCG2 overexpressing cells, respectively. Bafetinib stimulated ABCB1 ATPase activities while inhibited ABCG2 ATPase activities. There were no significant changes in the expression level or the subcellular distribution of ABCB1 and ABCG2 in the cells exposed to 3 μM of bafetinib. Overall, our study indicated that bafetinib reversed ABCB1- and ABCG2-mediated MDR by blocking the drug efflux function of these transporters. These findings might be useful in developing combination therapy for MDR cancer treatment.
Genotype frequencies of polymorphic MDR1 variants in the Kazakhstani population
Directory of Open Access Journals (Sweden)
Samat Kozhakhmetov
2014-03-01
Full Text Available Introduction: Statins appear to be handled by an ATP-dependent membrane transporter and three SNPs (C1236T (rs1128503, G2677T (rs2032582, and C3435T (rs1045642, which capture the common genetic variation at this locus. Individuals, who carry the T allele at each SNP (i.e., the T-T-T haplotype, have higher systemic exposure to simvastatin. A triallelic thymine (T - guanine (G - adenine (A, which is a point mutation at nucleotide 2677 in exon 22, leads to ABCB1 in a non-synonymous codons (GCT alanine, TCT serine, threonine ACT at position 893 in a cytoplasmic loop of ATP-dependent membrane transporters. Methods: Blood samples from healthy individuals were collected in the Republican Diagnostic Center, Astana, Kazakhstan. The research samples included 461 healthy people. Genomic DNA was extracted from peripheral blood using the ‘salting out’ procedure. For the MDR1 exon 21, 2677G˃T/A (Ala893Ser/Thr polymorphism was genotyped by PCR sequencing by the use of dye-terminator (ABI 3730xl sequencer. Results: The GG allele appeared in 23% of samples, the GA in 6.7%, the GT in 44%, the non-G heterozygote in 4.5%, and the non-G homozygote in 18%. These results are consistent with previously published data. Importantly, the frequency of 2677T alleles in our group was 15.4%. This represents the lowest frequency of this allele compared to published data in different populations. The frequency of the 2677T allele in Asians and Caucasians varies from 38 to 62%, and is 15% for African Americans. On the other hand, the 2677A allele frequency in the Japanese varies from 15 to 22%, and in Caucasians from 2% and 4%. The 2677A allele frequency has been found in 4.6% of samples. Conclusions: Our study further emphasizes differences between various Asian populations and the importance of repeating this genetic study in different ethnic groups.
Yeh, H H; Tian, T; Rubio, L; Crawford, B; Falk, B W
2000-07-01
Time course and mutational analyses were used to examine the accumulation in protoplasts of progeny RNAs of the bipartite Crinivirus, Lettuce infectious yellow virus (LIYV; family Closteroviridae). Hybridization analyses showed that simultaneous inoculation of LIYV RNAs 1 and 2 resulted in asynchronous accumulation of progeny LIYV RNAs. LIYV RNA 1 progeny genomic and subgenomic RNAs could be detected in protoplasts as early as 12 h postinoculation (p.i.) and accumulated to high levels by 24 h p.i. The LIYV RNA 1 open reading frame 2 (ORF 2) subgenomic RNA was the most abundant of all LIYV RNAs detected. In contrast, RNA 2 progeny were not readily detected until ca. 36 h p.i. Mutational analyses showed that in-frame stop codons introduced into five of seven RNA 2 ORFs did not affect accumulation of progeny LIYV RNA 1 or RNA 2, confirming that RNA 2 does not encode proteins necessary for LIYV RNA replication. Mutational analyses also supported that LIYV RNA 1 encodes proteins necessary for replication of LIYV RNAs 1 and 2. A mutation introduced into the LIYV RNA 1 region encoding the overlapping ORF 1B and ORF 2 was lethal. However, mutations introduced into only LIYV RNA 1 ORF 2 resulted in accumulation of progeny RNA 1 near or equal to wild-type RNA 1. In contrast, the RNA 1 ORF 2 mutants did not efficiently support the trans accumulation of LIYV RNA 2. Three distinct RNA 1 ORF 2 mutants were analyzed and all exhibited a similar phenotype for progeny LIYV RNA accumulation. These data suggest that the LIYV RNA 1 ORF 2 encodes a trans enhancer for RNA 2 accumulation.
SiRNA-mediated IGF-1R inhibition sensitizes human colon cancer SW480 cells to radiation
International Nuclear Information System (INIS)
Yavari, Kamal; Taghikhani, Mohammad; Mesbah-Namin, Seyed A.; Maragheh, Mohammad Ghannadi; Babaei, Mohammad Hosein; Arfaee, Ali Jabbary; Madani, Hossein; Mirzaei, Hamid Reza
2010-01-01
Purpose. Insulin like growth factor receptor 1 (IGF-1R) is well-documented to play a key role in radiation response and tumor radiosensitivity, thus offering an attractive clinic drug target to enhance tumor sensitivity to anti-cancer radiotherapy. Material and methods. Human colon carcinoma SW480 cells were transfected with the specific small interference RNA (siRNA) expression vector (pkD-shRNA-IGF-1R-V2) designed to target IGF-1R mRNA. The expression of IGF-1R mRNA and its protein among the transfected and untransfected cells were detected by semi-quantitative RT-PCR and ELISA assay. The changes in cell radiosensitivity were examined by MTT assay. Results. Transfection of mammalian expression vector pkD containing IGF-1R siRNA was shown to reduce IGF-1R mRNA levels by up to 95%. ELISA assay detected a similar inhibition of IGF-1R protein levels in cells transfected with IGF-1R siRNA. SW480 cells transfected with the expression vector for siRNA significantly rendered cells more sensitive to radiation and the highest radiation enhancement ratio was 2.02 ± 0.08. Conclusion. These data provide the first evidence that specific siRNA fragment (pkD-shRNA-IGF-1R-V2) targeting human IGF-1R mRNA is able to enhance colon cancer radiosensitivity. Also results indicated that, combining IGF-1R siRNA and radiation significantly enhances antitumor efficacy compared with either modality alone
Yu, Zheng; Peng, Sun; Hong-Ming, Pan; Kai-Feng, Wang
2012-01-01
To investigate the expression of multi-drug resistance-related genes, MDR3 and MRP, in clinical specimens of primary liver cancer and their potential as prognostic factors in liver cancer patients. A total of 26 patients with primary liver cancer were enrolled. The expression of MDR3 and MRP genes was measured by real-time PCR and the association between gene expression and the prognosis of patients was analyzed by the Kaplan-Meier method and COX regression model. This study showed that increases in MDR3 gene expression were identified in cholangiocellular carcinoma, cirrhosis and HBsAg-positive patients, while MRP expression increased in hepatocellular carcinoma, non-cirrhosis and HBsAg-negative patients. Moreover, conjugated bilirubin and total bile acid in the serum were significantly reduced in patients with high MRP expression compared to patients with low expression. The overall survival tended to be longer in patients with high MDR3 and MRP expression compared to the control group. MRP might be an independent prognostic factor in patients with liver cancer by COX regression analysis. MDR3 and MRP may play important roles in liver cancer patients as prognostic factors and their underlying mechanisms in liver cancer are worthy of further investigation.
Regulatory BC1 RNA in Cognitive Control
Iacoangeli, Anna; Dosunmu, Aderemi; Eom, Taesun; Stefanov, Dimitre G.; Tiedge, Henri
2017-01-01
Dendritic regulatory BC1 RNA is a non-protein-coding (npc) RNA that operates in the translational control of gene expression. The absence of BC1 RNA in BC1 knockout (KO) animals causes translational dysregulation that entails neuronal phenotypic alterations including prolonged epileptiform discharges, audiogenic seizure activity in vivo, and…
DEFF Research Database (Denmark)
Saaby, Lasse; Tfelt-Hansen, Peer; Brodin, Birger
2015-01-01
monolayers with a permeability of 5.7 × 10−5 cm sec−1 compared to an apical to basolateral permeability of 1.3 × 10−5 cm sec-1. The efflux could be inhibited with the P-gp inhibitor zosuquidar. Zosuquidar (0.4 μmol/L) reduced the efflux ratio (PB-A/PA-B) for verapamil 4.6–1.6. The presence of telmisartan......Verapamil is used in high doses for the treatment of cluster headache. Verapamil has been described as a P-glycoprotein (P-gp, ABCB1) substrate. We wished to evaluate in vitro whether co administration of a P-gp inhibitor with verapamil could be a feasible strategy for increasing CNS uptake...... of verapamil. Fluxes of radiolabelled verapamil across MDCK II MDR1 monolayers were measured in the absence and presence of the putative P-gp inhibitor telmisartan (a clinically approved drug compound). Verapamil displayed a vectorial basolateral-to-apical transepithelial efflux across the MDCK II MDR1...
Ingemarsdotter, Carin K; Zeng, Jingwei; Long, Ziqi; Lever, Andrew M L; Kenyon, Julia C
2018-03-14
NSC260594, a quinolinium derivative from the NCI diversity set II compound library, was previously identified in a target-based assay as an inhibitor of the interaction between the HIV-1 (ψ) stem-loop 3 (SL3) RNA and Gag. This compound was shown to exhibit potent antiviral activity. Here, the effects of this compound on individual stages of the viral lifecycle were examined by qRT-PCR, ELISA and Western blot, to see if its actions were specific to the viral packaging stage. The structural effects of NSC260594 binding to the HIV-1 gRNA were also examined by SHAPE and dimerization assays. Treatment of cells with NSC260594 did not reduce the number of integration events of incoming virus, and treatment of virus producing cells did not affect the level of intracellular Gag protein or viral particle release as determined by immunoblot. However, NSC260594 reduced the incorporation of gRNA into virions by up to 82%, without affecting levels of gRNA inside the cell. This reduction in packaging correlated closely with the reduction in infectivity of the released viral particles. To establish the structural effects of NSC260594 on the HIV-1 gRNA, we performed SHAPE analyses to pinpoint RNA structural changes. NSC260594 had a stabilizing effect on the wild type RNA that was not confined to SL3, but that was propagated across the structure. A packaging mutant lacking SL3 did not show this effect. NSC260594 acts as a specific inhibitor of HIV-1 RNA packaging. No other viral functions are affected. Its action involves preventing the interaction of Gag with SL3 by stabilizing this small RNA stem-loop which then leads to stabilization of the global packaging signal region (psi or ψ). This confirms data, previously only shown in analyses of isolated SL3 oligonucleotides, that SL3 is structurally labile in the presence of Gag and that this is critical for the complete psi region to be able to adopt different conformations. Since replication is otherwise unaffected by NSC260594
Parkesh, Raman; Childs-Disney, Jessica L.; Nakamori, Masayuki; Kumar, Amit; Wang, Eric; Wang, Thomas; Hoskins, Jason; Tran, Tuan; Housman, David; Thornton, Charles A.; Disney, Matthew D.
2012-01-01
Myotonic dystrophy type 1 (DM1) is a triplet repeating disorder caused by expanded CTG repeats in the 3′ untranslated region of the dystrophia myotonica protein kinase (DMPK) gene. The transcribed repeats fold into an RNA hairpin with multiple copies of a 5′CUG/3′GUC motif that binds the RNA splicing regulator muscleblind-like 1 protein (MBNL1). Sequestration of MBNL1 by expanded r(CUG) repeats causes splicing defects in a subset of pre-mRNAs including the insulin receptor, the muscle-specific chloride ion channel, Sarco(endo)plasmic reticulum Ca2+ ATPase 1 (Serca1/Atp2a1), and cardiac troponin T (cTNT). Based on these observations, the development of small molecule ligands that target specifically expanded DM1 repeats could serve as therapeutics. In the present study, computational screening was employed to improve the efficacy of pentamidine and Hoechst 33258 ligands that have been shown previously to target the DM1 triplet repeat. A series of inhibitors of the RNA-protein complex with low micromolar IC50’s, which are >20-fold more potent than the query compounds, were identified. Importantly, a bis-benzimidazole identified from the Hoechst query improves DM1-associated pre-mRNA splicing defects in cell and mouse models of DM1 (when dosed with 1 mM and 100 mg/kg, respectively). Since Hoechst 33258 was identified as a DM1 binder through analysis of an RNA motif-ligand database, these studies suggest that lead ligands targeting RNA with improved biological activity can be identified by using a synergistic approach that combines analysis of known RNA-ligand interactions with virtual screening. PMID:22300544
BRAKER1: Unsupervised RNA-Seq-Based Genome Annotation with GeneMark-ET and AUGUSTUS.
Hoff, Katharina J; Lange, Simone; Lomsadze, Alexandre; Borodovsky, Mark; Stanke, Mario
2016-03-01
Gene finding in eukaryotic genomes is notoriously difficult to automate. The task is to design a work flow with a minimal set of tools that would reach state-of-the-art performance across a wide range of species. GeneMark-ET is a gene prediction tool that incorporates RNA-Seq data into unsupervised training and subsequently generates ab initio gene predictions. AUGUSTUS is a gene finder that usually requires supervised training and uses information from RNA-Seq reads in the prediction step. Complementary strengths of GeneMark-ET and AUGUSTUS provided motivation for designing a new combined tool for automatic gene prediction. We present BRAKER1, a pipeline for unsupervised RNA-Seq-based genome annotation that combines the advantages of GeneMark-ET and AUGUSTUS. As input, BRAKER1 requires a genome assembly file and a file in bam-format with spliced alignments of RNA-Seq reads to the genome. First, GeneMark-ET performs iterative training and generates initial gene structures. Second, AUGUSTUS uses predicted genes for training and then integrates RNA-Seq read information into final gene predictions. In our experiments, we observed that BRAKER1 was more accurate than MAKER2 when it is using RNA-Seq as sole source for training and prediction. BRAKER1 does not require pre-trained parameters or a separate expert-prepared training step. BRAKER1 is available for download at http://bioinf.uni-greifswald.de/bioinf/braker/ and http://exon.gatech.edu/GeneMark/ katharina.hoff@uni-greifswald.de or borodovsky@gatech.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
microRNA-independent recruitment of Argonaute 1 to nanos mRNA through the Smaug RNA-binding protein
Pinder, Benjamin D; Smibert, Craig A
2012-01-01
Argonaute 1 directly interacts with the RNA binding protein Smaug in Drosophila, is thereby recruited to the Smaug target nanos mRNA and is required for Smaug-mediated translational repression of the nanos mRNA.
International Nuclear Information System (INIS)
O'Grady, Michael; Raha, Debasish; Hanson, Bonnie J; Bunting, Michaeline; Hanson, George T
2005-01-01
The transcription factor activator protein-1 (AP-1) has been implicated in a large variety of biological processes including oncogenic transformation. The tyrosine kinases of the epidermal growth factor receptor (EGFR) constitute the beginning of one signal transduction cascade leading to AP-1 activation and are known to control cell proliferation and differentiation. Drug discovery efforts targeting this receptor and other pathway components have centred on monoclonal antibodies and small molecule inhibitors. Resistance to such inhibitors has already been observed, guiding the prediction of their use in combination therapies with other targeted agents such as RNA interference (RNAi). This study examines the use of RNAi and kinase inhibitors for qualification of components involved in the EGFR/AP-1 pathway of ME180 cells, and their inhibitory effects when evaluated individually or in tandem against multiple components of this important disease-related pathway. AP-1 activation was assessed using an ME180 cell line stably transfected with a beta-lactamase reporter gene under the control of AP-1 response element following epidermal growth factor (EGF) stimulation. Immunocytochemistry allowed for further quantification of small molecule inhibition on a cellular protein level. RNAi and RT-qPCR experiments were performed to assess the amount of knockdown on an mRNA level, and immunocytochemistry was used to reveal cellular protein levels for the targeted pathway components. Increased potency of kinase inhibitors was shown by combining RNAi directed towards EGFR and small molecule inhibitors acting at proximal or distal points in the pathway. After cellular stimulation with EGF and analysis at the level of AP-1 activation using a β-lactamase reporter gene, a 10–12 fold shift or 2.5–3 fold shift toward greater potency in the IC 50 was observed for EGFR and MEK-1 inhibitors, respectively, in the presence of RNAi targeting EGFR. EGFR pathway components were qualified as
Recovery, modernization and computerization of the monochromator MDR-23
International Nuclear Information System (INIS)
Miranda, L. J.
2012-01-01
For use in the Optics Laboratory, newly created in the CEADEN, one of the necessary equipment is the Monochromator MDR-23, which was necessary for recovery, modernization (replacing the power supply and control) and computerization by designing a VI (virtual instrument) to control stepper motor through a PC using Lab VIEW 7.1 that allows users to select the address mode, the number of steps and the engine speed and give the initial value of the position and limits the range of the monochromator to start working with it. The principle of operation of the program is done in detail to facilitate understanding of how to operate and use the graphical programming designed and achieve efficient use of equipment. (Author)
Huang, Tsi-Shu; Kunin, Calvin M; Yan, Bo-Shiun; Chen, Yao-Shen; Lee, Susan Shin-Jung; Syu, Wan
2012-03-01
This study was designed to determine the susceptibility of clinical isolates of multidrug-resistant (MDR) and non-MDR Mycobacterium tuberculosis to sulfamethoxazole, trimethoprim and trimethoprim/sulfamethoxazole over a 12 year period in Taiwan. We examined a total of 117 clinical isolates of M. tuberculosis collected from Southern Taiwan, 116 from 1995 to 2006 and an extensively drug-resistant (XDR) isolate in 2009. These included 28 isolates susceptible to all four first-line agents, 52 MDR isolates and 36 isolates with a mixed combination of drug resistance patterns other than MDR and 1 XDR isolate. Sulfamethoxazole inhibited 80% growth of all 117 isolates regardless of their susceptibility to the first-line agents at an MIC(90) of 9.5 mg/L. The concentration required to inhibit 99% growth was 38 mg/L. There were no significant changes in the MIC(50) or MIC(90) of sulfamethoxazole over a 12 year period. All 117 isolates were resistant to trimethoprim at >8 mg/L. The combination of trimethoprim/sulfamethoxazole at a ratio of 1:19 had no additive or synergistic effects. Sulfamethoxazole inhibited the growth of clinical isolates of M. tuberculosis at achievable concentrations in plasma after oral administration. Susceptibility to sulfamethoxazole remained constant over a 12 year period. Trimethoprim was inactive against M. tuberculosis and trimethoprim/sulfamethoxazole provided no additional activity. Although the current and prior studies demonstrate that sulfamethoxazole is active against M. tuberculosis the search needs to continue for more active, lipid-soluble sulphonamides that are better absorbed into tissues and have improved therapeutic efficacy.
SR proteins are NXF1 adaptors that link alternative RNA processing to mRNA export.
Müller-McNicoll, Michaela; Botti, Valentina; de Jesus Domingues, Antonio M; Brandl, Holger; Schwich, Oliver D; Steiner, Michaela C; Curk, Tomaz; Poser, Ina; Zarnack, Kathi; Neugebauer, Karla M
2016-03-01
Nuclear export factor 1 (NXF1) exports mRNA to the cytoplasm after recruitment to mRNA by specific adaptor proteins. How and why cells use numerous different export adaptors is poorly understood. Here we critically evaluate members of the SR protein family (SRSF1-7) for their potential to act as NXF1 adaptors that couple pre-mRNA processing to mRNA export. Consistent with this proposal, >1000 endogenous mRNAs required individual SR proteins for nuclear export in vivo. To address the mechanism, transcriptome-wide RNA-binding profiles of NXF1 and SRSF1-7 were determined in parallel by individual-nucleotide-resolution UV cross-linking and immunoprecipitation (iCLIP). Quantitative comparisons of RNA-binding sites showed that NXF1 and SR proteins bind mRNA targets at adjacent sites, indicative of cobinding. SRSF3 emerged as the most potent NXF1 adaptor, conferring sequence specificity to RNA binding by NXF1 in last exons. Interestingly, SRSF3 and SRSF7 were shown to bind different sites in last exons and regulate 3' untranslated region length in an opposing manner. Both SRSF3 and SRSF7 promoted NXF1 recruitment to mRNA. Thus, SRSF3 and SRSF7 couple alternative splicing and polyadenylation to NXF1-mediated mRNA export, thereby controlling the cytoplasmic abundance of transcripts with alternative 3' ends. © 2016 Müller-McNicoll et al.; Published by Cold Spring Harbor Laboratory Press.
Hattori, Yoshiyuki; Kikuchi, Takuto; Nakamura, Mari; Ozaki, Kei-Ichi; Onishi, Hiraku
2017-01-01
It has been reported that suppression of protein kinase N3 (PKN3) expression in vascular and lymphatic endothelial cells results in the inhibition of tumor progression and lymph node metastasis formation. The present study investigated whether combination therapy of small interfering RNA (siRNA) against PKN3 and doxorubicin (DXR) could increase therapeutic efficacy against liver and lung metastases. In vitro transfection of PKN3 siRNA into PKN3-positive MDA-MB-231, LLC, and Colon 26 cells and PKN3-negative MCF-7 cells did not inhibit cell growth and did not increase sensitivity to DXR. However, following in vivo treatment, PKN3 siRNA suppressed the growth of liver MDA-MB-231 and lung LLC and MCF-7 metastases, although combination therapy with DXR did not increase the therapeutic efficacy. By contrast, in liver MCF-7 metastases, PKN3 siRNA or DXR alone did not exhibit significant inhibition of tumor growth, but their combination significantly improved therapeutic efficacy. Treatment of liver MDA-MB-231 metastases with PKN3 siRNA induced a change in vasculature structure via suppression of PKN3 mRNA expression. PKN3 siRNA may induce antitumor effects in lung and liver metastases by suppression of PKN3 expression in stroma cells, such as endothelial cells. From these findings, PKN3 siRNA alone or in combination with DXR may reduce the tumor growth of liver and lung metastases regardless of PKN3 expression in tumor cells. PMID:29098022
Cruz-Gallardo, Isabel; Aroca, Ángeles; Persson, Cecilia; Karlsson, B. Göran; Díaz-Moreno, Irene
2013-01-01
T-cell intracellular antigen-1 (TIA-1) is a DNA/RNA-binding protein that regulates critical events in cell physiology by the regulation of pre-mRNA splicing and mRNA translation. TIA-1 is composed of three RNA recognition motifs (RRMs) and a glutamine-rich domain and binds to uridine-rich RNA sequences through its C-terminal RRM2 and RRM3 domains. Here, we show that RNA binding mediated by either isolated RRM3 or the RRM23 construct is controlled by slight environmental pH changes due to the protonation/deprotonation of TIA-1 RRM3 histidine residues. The auxiliary role of the C-terminal RRM3 domain in TIA-1 RNA recognition is poorly understood, and this work provides insight into its binding mechanisms. PMID:23902765
Iwata, Yuji
2013-08-05
Efficient and precise microRNA (miRNA) biogenesis in Arabidopsis is mediated by the RNaseIII-family enzyme DICER-LIKE 1 (DCL1), double-stranded RNA-binding protein HYPONASTIC LEAVES 1 and the zinc-finger (ZnF) domain-containing protein SERRATE (SE). In the present study, we examined primary miRNA precursor (pri-miRNA) processing by highly purified recombinant DCL1 and SE proteins and found that SE is integral to pri-miRNA processing by DCL1. SE stimulates DCL1 cleavage of the pri-miRNA in an ionic strength-dependent manner. SE uses its N-terminal domain to bind to RNA and requires both N-terminal and ZnF domains to bind to DCL1. However, when DCL1 is bound to RNA, the interaction with the ZnF domain of SE becomes indispensible and stimulates the activity of DCL1 without requiring SE binding to RNA. Our results suggest that the interactions among SE, DCL1 and RNA are a potential point for regulating pri-miRNA processing. 2013 The Author(s) 2013.
Wnt/β-catenin pathway regulates ABCB1 transcription in chronic myeloid leukemia
International Nuclear Information System (INIS)
Corrêa, Stephany; Binato, Renata; Du Rocher, Bárbara; Castelo-Branco, Morgana TL; Pizzatti, Luciana; Abdelhay, Eliana
2012-01-01
The advanced phases of chronic myeloid leukemia (CML) are known to be more resistant to therapy. This resistance has been associated with the overexpression of ABCB1, which gives rise to the multidrug resistance (MDR) phenomenon. MDR is characterized by resistance to nonrelated drugs, and P-glycoprotein (encoded by ABCB1) has been implicated as the major cause of its emergence. Wnt signaling has been demonstrated to be important in several aspects of CML. Recently, Wnt signaling was linked to ABCB1 regulation through its canonical pathway, which is mediated by β-catenin, in other types of cancer. In this study, we investigated the involvement of the Wnt/β-catenin pathway in the regulation of ABCB1 transcription in CML, as the basal promoter of ABCB1 has several β-catenin binding sites. β-catenin is the mediator of canonical Wnt signaling, which is important for CML progression. In this work we used the K562 cell line and its derived MDR-resistant cell line Lucena (K562/VCR) as CML study models. Real time PCR (RT-qPCR), electrophoretic mobility shift assay (EMSA), chromatin immunoprecipitation (ChIP), flow cytometry (FACS), western blot, immunofluorescence, RNA knockdown (siRNA) and Luciferase reporter approaches were used. β-catenin was present in the protein complex on the basal promoter of ABCB1 in both cell lines in vitro, but its binding was more pronounced in the resistant cell line in vivo. Lucena cells also exhibited higher β-catenin levels compared to its parental cell line. Wnt1 and β-catenin depletion and overexpression of nuclear β-catenin, together with TCF binding sites activation demonstrated that ABCB1 is positively regulated by the canonical pathway of Wnt signaling. These results suggest, for the first time, that the Wnt/β-catenin pathway regulates ABCB1 in CML
Mukherjee, J S; Joseph, J K; Rich, M L; Shin, S S; Furin, J J; Seung, K J; Sloutsky, A; Socci, A R; Vanderwarker, C; Vasquez, L; Palacios, E; Guerra, D; Viru, F A; Farmer, P; Del Castillo, H E
2003-07-01
Since 2000, the directly observed treatment, short-course (DOTS) strategy has been expanded in several countries to include treatment of multidrug-resistant tuberculosis (MDR-TB). This strategy is known as DOTS-Plus. Tuberculosis is a common cause of morbidity and mortality for children throughout the developing world. Children may also be infected with MDR-TB, yet most developing countries do not specifically address pediatric MDR-TB. To present the intermediate outcomes of the first 16 children enrolled in the Peruvian DOTS-Plus program and to demonstrate the tolerability of second-line anti-tuberculosis drugs. Three children completed therapy and are cured, one child had bacteriologic and clinical failure after 12 months of therapy and died of respiratory insufficiency, and 12 have intermediate outcomes demonstrating favorable clinical, bacteriologic, and radiographic evidence of improvement after 9-19 months of therapy. Of the 16 pediatric DOTS-Plus patients, 15 have tolerated therapy well and have had favorable clinical evolution. However, the diagnosis of pediatric MDR-TB is often extremely delayed due to reliance on the adult case definition and should be changed to prevent progressive, chronic illness in such children. Programmatic changes could facilitate earlier diagnosis and treatment of pediatric MDR-TB in Peru and in other DOTS-Plus programs.
Hunter, Lydia J R; Brockington, Samuel F; Murphy, Alex M; Pate, Adrienne E; Gruden, Kristina; MacFarlane, Stuart A; Palukaitis, Peter; Carr, John P
2016-03-16
Cellular RNA-dependent RNA polymerases (RDRs) catalyze synthesis of double-stranded RNAs that can serve to initiate or amplify RNA silencing. Arabidopsis thaliana has six RDR genes; RDRs 1, 2 and 6 have roles in anti-viral RNA silencing. RDR6 is constitutively expressed but RDR1 expression is elevated following plant treatment with defensive phytohormones. RDR1 also contributes to basal virus resistance. RDR1 has been studied in several species including A. thaliana, tobacco (Nicotiana tabacum), N. benthamiana, N. attenuata and tomato (Solanum lycopersicum) but not to our knowledge in potato (S. tuberosum). StRDR1 was identified and shown to be salicylic acid-responsive. StRDR1 transcript accumulation decreased in transgenic potato plants constitutively expressing a hairpin construct and these plants were challenged with three viruses: potato virus Y, potato virus X, and tobacco mosaic virus. Suppression of StRDR1 gene expression did not increase the susceptibility of potato to these viruses. Phylogenetic analysis of RDR genes present in potato and in a range of other plant species identified a new RDR gene family, not present in potato and found only in Rosids (but apparently lost in the Rosid A. thaliana) for which we propose the name RDR7.
Directory of Open Access Journals (Sweden)
Ma Hong
2011-06-01
Full Text Available Abstract Background The process of HIV-1 genomic RNA (gRNA encapsidation is governed by a number of viral encoded components, most notably the Gag protein and gRNA cis elements in the canonical packaging signal (ψ. Also implicated in encapsidation are cis determinants in the R, U5, and PBS (primer binding site from the 5' untranslated region (UTR. Although conventionally associated with nuclear export of HIV-1 RNA, there is a burgeoning role for the Rev/RRE in the encapsidation process. Pleiotropic effects exhibited by these cis and trans viral components may confound the ability to examine their independent, and combined, impact on encapsidation of RNA into HIV-1 viral particles in their innate viral context. We systematically reconstructed the HIV-1 packaging system in the context of a heterologous murine leukemia virus (MLV vector RNA to elucidate a mechanism in which the Rev/RRE system is central to achieving efficient and specific encapsidation into HIV-1 viral particles. Results We show for the first time that the Rev/RRE system can augment RNA encapsidation independent of all cis elements from the 5' UTR (R, U5, PBS, and ψ. Incorporation of all the 5' UTR cis elements did not enhance RNA encapsidation in the absence of the Rev/RRE system. In fact, we demonstrate that the Rev/RRE system is required for specific and efficient encapsidation commonly associated with the canonical packaging signal. The mechanism of Rev/RRE-mediated encapsidation is not a general phenomenon, since the combination of the Rev/RRE system and 5' UTR cis elements did not enhance encapsidation into MLV-derived viral particles. Lastly, we show that heterologous MLV RNAs conform to transduction properties commonly associated with HIV-1 viral particles, including in vivo transduction of non-dividing cells (i.e. mouse neurons; however, the cDNA forms are episomes predominantly in the 1-LTR circle form. Conclusions Premised on encapsidation of a heterologous RNA into
Bahry, Muhammad Syaifudien; Pringgenies, Delianis; Trianto, Agus
2017-01-01
The resistance of pathogenic bacteria may occur to many types of antibiotics, especially in cases of non-compliance use of antibiotics, which likely to allow the evolution of Multi-Drug Resistant (MDR) bacteria. Gastropods seas are marine invertebrates informed capable of production of secondary metabolites as antibacterial MDR. The purpose of the study was the isolation and identification of gastropod symbiont bacteria found in the waters of Krakal, Gunung Kidul, Yogyakarta, which has the ability to produce antibacterial compounds against MDR(Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, MRSA (methicillin-Resistant Staphylococcus aureus), Staphylococcus aureus, and Staphylococcus homunis) molecular. Stages of this research began with the isolation of bacteria, bacteria screening for anti-MDR compound, mass culture, and extraction, antibacterial activity test, DNA extraction, amplification by PCR 16S rDNA and sequencing. The results of the study showed that 19 isolates of bacteria were isolated from three species of gastropods namely Littorina scabra, Cypraea moneta and Conus ebraeus. Among them, 4 isolates showed activity against MDR test bacteria (E. coli, E. cloacae, K. pneumoniae, S. aureus and S. homunis). The highest activity was displayed by code LS.G1.8 isolate with the largest inhibition zone 15.47±0.45mm on S. humonis at 250 µg/disk concentration. Isolate CM.G2.1 showed largest inhibition zone, with 21.5±0.07mm on MRSA at 1000 µg/disk concentration and isolate the largest inhibition zone CM.G2.5 14.37±0.81mm on MRSA 14.37±0.81mm at concentrations 1000 µg/disk. The molecular identification of isolates LS.G1.8 has 99% homology with Bacillus subtilis and isolates CM.G2.1 has 99% homology with Bacillus pumillus.
C to U RNA editing mediated by APOBEC1 requires RNA-binding protein RBM47.
Fossat, Nicolas; Tourle, Karin; Radziewic, Tania; Barratt, Kristen; Liebhold, Doreen; Studdert, Joshua B; Power, Melinda; Jones, Vanessa; Loebel, David A F; Tam, Patrick P L
2014-08-01
Cytidine (C) to Uridine (U) RNA editing is a post-transcriptional modification that is accomplished by the deaminase APOBEC1 and its partnership with the RNA-binding protein A1CF. We identify and characterise here a novel RNA-binding protein, RBM47, that interacts with APOBEC1 and A1CF and is expressed in tissues where C to U RNA editing occurs. RBM47 can substitute for A1CF and is necessary and sufficient for APOBEC1-mediated editing in vitro. Editing is further impaired in Rbm47-deficient mutant mice. These findings suggest that RBM47 and APOBEC1 constitute the basic machinery for C to U RNA editing. © 2014 The Authors.
Directory of Open Access Journals (Sweden)
Feng Cheng
2017-01-01
Full Text Available RNA-binding proteins (RBPs and miRNAs are capable of controlling processes in normal development and cancer. Both of them could determine RNA transcripts fate from synthesis to decay. One such RBP, Dead end (Dnd1, is essential for regulating germ-cell viability and suppresses the germ-cell tumors development, yet how it exerts its functions in breast cancer has remained unresolved. The level of Dnd1 was detected in 21 cancerous tissues paired with neighboring normal tissues by qRT-PCR. We further annotated TCGA (The Cancer Genome Atlas mRNA expression profiles and found that the expression of Dnd1 and Bim is positively correlated (p=0.04. Patients with higher Dnd1 expression level had longer overall survival (p=0.0014 by KM Plotter tool. Dnd1 knockdown in MCF-7 cells decreased Bim expression levels and inhibited apoptosis. While knockdown of Dnd1 promoted the decay of Bim mRNA 3′UTR, the stability of Bim-5′UTR was not affected. In addition, mutation of miR-221-binding site in Bim-3′UTR canceled the effect of Dnd1 on Bim mRNA. Knockdown of Dnd1 in MCF-7 cells confirmed that Dnd1 antagonized miR-221-inhibitory effects on Bim expression. Overall, our findings indicate that Dnd1 facilitates apoptosis by increasing the expression of Bim via its competitive combining with miR-221 in Bim-3′UTR. The new function of Dnd1 may contribute to a vital role in breast cancer development.
DEFF Research Database (Denmark)
Saaby, Lasse; Helms, Hans Christian Cederberg; Brodin, Birger
2016-01-01
The P-glycoprotein (P-gp) efflux pump has been shown to affect drug distribution and absorption in various organs and to cause drug resistance in cancer therapy. The aim of this work was to develop a cell line to serve as a screening system for potential substrates of P-gp. This requires a cell...... line with high paracellular tightness, low expression of nonhuman ABC transporters, and high expression of functional human P-gp (ABCB1). The porcine intestinal epithelial cell line, IPEC-J2, was selected as a transfection host, due to its ability to form extremely high-resistance monolayers (>10,000 Ω......·cm(2)) and its low endogenous expression of ABC-type efflux transporters. The IPEC-J2 cells were transfected with a plasmid that contained the sequence of the human MDR1 gene, which encodes P-gp, followed by a selection of successfully transfected cells with geneticin and puromycin. The resulting cell...
Directory of Open Access Journals (Sweden)
Dmitrii E. Polev
2014-01-01
Full Text Available Human gene LOC100505644 uncharacterized LOC100505644 [Homo sapiens] (Entrez Gene ID 100505644 is abundantly expressed in tumors but weakly expressed in few normal tissues. Till now the function of this gene remains unknown. Here we identified the chromosomal borders of the transcribed region and the major splice form of the LOC100505644-specific transcript. We characterised the major regulatory motifs of the gene and its splice sites. Analysis of the secondary structure of the major transcript variant revealed a hairpin-like structure characteristic for precursor microRNAs. Comparative genomic analysis of the locus showed that it originated in primates de novo. Taken together, our data indicate that human gene LOC100505644 encodes some non-protein coding RNA, likely a microRNA. It was assigned a gene symbol ELFN1-AS1 (ELFN1 antisense RNA 1 (non-protein coding. This gene combines features of evolutionary novelty and predominant expression in tumors.
Combined sequencing of mRNA and DNA from human embryonic stem cells
Directory of Open Access Journals (Sweden)
Florian Mertes
2016-06-01
Full Text Available Combined transcriptome and whole genome sequencing of the same ultra-low input sample down to single cells is a rapidly evolving approach for the analysis of rare cells. Besides stem cells, rare cells originating from tissues like tumor or biopsies, circulating tumor cells and cells from early embryonic development are under investigation. Herein we describe a universal method applicable for the analysis of minute amounts of sample material (150 to 200 cells derived from sub-colony structures from human embryonic stem cells. The protocol comprises the combined isolation and separate amplification of poly(A mRNA and whole genome DNA followed by next generation sequencing. Here we present a detailed description of the method developed and an overview of the results obtained for RNA and whole genome sequencing of human embryonic stem cells, sequencing data is available in the Gene Expression Omnibus (GEO database under accession number GSE69471.
Chimeric peptide-mediated siRNA transduction to inhibit HIV-1 infection.
Bivalkar-Mehla, Shalmali; Mehla, Rajeev; Chauhan, Ashok
2017-04-01
Persistent human immunodeficiency virus 1 (HIV-1) infection provokes immune activation and depletes CD4 + lymphocytes, leading to acquired immunodeficiency syndrome. Uninterrupted administration of combination antiretroviral therapy (cART) in HIV-infected patients suppresses viral replication to below the detectable level and partially restores the immune system. However, cART-unresponsive residual HIV-1 infection and elusive transcriptionally silent but reactivatable viral reservoirs maintain a permanent viral DNA blue print. The virus rebounds within a few weeks after interruption of suppressive therapy. Adjunct gene therapy to control viral replication by ribonucleic acid interference (RNAi) is a post-transcriptional gene silencing strategy that could suppress residual HIV-1 burden and overcome viral resistance. Small interfering ribonucleic acids (siRNAs) are efficient transcriptional inhibitors, but need delivery systems to reach inside target cells. We investigated the potential of chimeric peptide (FP-PTD) to deliver specific siRNAs to HIV-1-susceptible and permissive cells. Chimeric FP-PTD peptide was designed with an RNA binding domain (PTD) to bind siRNA and a cell fusion peptide domain (FP) to enter cells. FP-PTD-siRNA complex entered and inhibited HIV-1 replication in susceptible cells, and could be a candidate for in vivo testing.
The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections.
Busani, Stefano; Roat, Erika; Serafini, Giulia; Mantovani, Elena; Biagioni, Emanuela; Girardis, Massimo
2017-01-01
Patients with septic shock by multidrug resistant microorganisms (MDR) are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.
The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections
Directory of Open Access Journals (Sweden)
Stefano Busani
2017-01-01
Full Text Available Patients with septic shock by multidrug resistant microorganisms (MDR are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.
DEFF Research Database (Denmark)
Andersen, Vibeke; Østergaard, Mette; Christensen, Jane
2009-01-01
(rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant......Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived...... prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors...
Directory of Open Access Journals (Sweden)
Hironobu Yanagisawa
2016-03-01
Full Text Available The presence of high molecular weight double-stranded RNA (dsRNA within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV, a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.
Shrestha, Shovita; Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Ohara, Hiroshi; Shimada, Kayo; Satou, Kazuhito; Teruya, Kuniko; Nakano, Kazuma; Shiroma, Akino; Sherchand, Jeevan Bdr; Rijal, Basista Psd; Hirano, Takashi; Kirikae, Teruo; Pokhrel, Bharat Mani
2015-11-01
The emergence of multidrug-resistant (MDR) Acinetobacter baumannii has become a serious medical problem worldwide. To clarify the genetic and epidemiological properties of MDR A. baumannii strains isolated from a medical setting in Nepal, 246 Acinetobacter spp. isolates obtained from different patients were screened for MDR A. baumannii by antimicrobial disk susceptibility testing. Whole genomes of the MDR A. baumannii isolates were sequenced by MiSeq™ (Illumina), and the complete genome of one isolate (IOMTU433) was sequenced by PacBio RS II. Phylogenetic trees were constructed from single nucleotide polymorphism concatemers. Multilocus sequence types were deduced and drug resistance genes were identified. Of the 246 Acinetobacter spp. isolates, 122 (49.6%) were MDR A. baumannii, with the majority being resistant to aminoglycosides, carbapenems and fluoroquinolones but not to colistin and tigecycline. These isolates harboured the 16S rRNA methylase gene armA as well as bla(NDM-1), bla(OXA-23) or bla(OXA-58). MDR A. baumannii isolates belonging to clonal complex 1 (CC1) and CC2 as well as a novel clonal complex (CC149) have spread throughout a medical setting in Nepal. The MDR isolates harboured genes encoding carbapenemases (OXA and NDM-1) and a 16S rRNA methylase (ArmA). Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
International Nuclear Information System (INIS)
Yamada, Kiyoshi; Brink, I.; Engelhardt, R.
2005-01-01
In order to specify the influence of multidrug-resistance (MDR) on the accumulation of the PET tracer, F-18 FDG ([Fluorine-18]2-fluoro-2-deoxy-D-glucose, in melanoma cells, both the MDR function and expression of two human melanoma cell lines SK-MEL 23 and 24, were evaluated. The effects of MDR modulators on FDG accumulation and efflux were also investigated. A functional analysis using representative MDR fluorescent substrates and inhibitors clarified the following characteristics: SK-MEL 23 possesses a highly active function of multidrug resistance-associated protein (MRP), but not P-gp. SK-MEL 24 possesses weak functions of both MRP and P-gp. Western blot analysis using monoclonal antibodies for MDR expression demonstrated an exceedingly high MRP expression of SK-MEL 23 and only slight P-gp and MRP expression of SK-MEL 24, corresponding to the functional data. The efflux inhibition assay using F-18 FDG revealed a considerable retention of FDG in SK-MEL 23 in the presence of the MRP inhibitor probenecid. It was also found that the P-gp inhibitor verapamil depressed the FDG efflux of SK-MEL 24. Our present in vitro study suggests that FDG may be a substrate of MDR in some melanoma cells and further MDR may be one of the important factors affecting FDG-PET melanoma imaging. (author)
McDonagh, Phillip; Sheehy, Paul A; Norris, Jacqueline M
2015-03-23
Virulent biotypes of feline coronavirus (FCoV), commonly referred to as feline infectious peritonitis virus (FIPV), can result in the development of feline infectious peritonitis (FIP), a typically fatal immune mediated disease for which there is currently no effective antiviral treatment. We previously reported the successful in vitro inhibition of FIPV replication by synthetic siRNA mediated RNA interference (RNAi) in an immortalised cell line (McDonagh et al., 2011). A major challenge facing the development of any antiviral strategy is that of resistance, a problem which is particularly acute for RNAi based therapeutics due to the exquisite sequence specificity of the targeting mechanism. The development of resistance during treatment can be minimised using combination therapy to raise the genetic barrier or using highly potent compounds which result in a more rapid and pronounced reduction in the viral replication rate, thereby reducing the formation of mutant, and potentially resistant viruses. This study investigated the efficacy of combination siRNA therapy and its ability to delay or prevent viral escape. Virus serially passaged through cells treated with a single or dual siRNAs rapidly acquired resistance, with mutations identified in the siRNA target sites. Combination therapy with three siRNA prevented viral escape over the course of five passages. To identify more potent silencing molecules we also compared the efficacy, in terms of potency and duration of action, of canonical versus Dicer-substrate siRNAs for two previously identified effective viral motifs. Dicer-substrate siRNAs showed equivalent or better potency than canonical siRNAs for the target sites investigated, and may be a more appropriate molecule for in vivo use. Combined, these data inform the potential therapeutic application of antiviral RNAi against FIPV. Copyright © 2014 Elsevier B.V. All rights reserved.
Kalle, Arunasree M; Sachchidanand, Sachchidanand; Pallu, Reddanna
2010-09-01
Our previous studies have shown that overexpression of MDR1 and cyclooygenase-2 (COX-2) resulted in resistance development to imatinib in chronic myelogenous leukemia (CML) K562 (IR-K562) cells. In the present study, the regulatory mechanism of MDR1 induction by COX-2 was investigated. A gradual overexpression of MDR1 and COX-2 during the process of development was observed. Furthermore, down regulation of MDR1 upon COX-2 knockdown by siRNA showed a decrease in the PKC levels and activation of PKC by addition of PGE(2) to K562 cells, suggesting a role for PKC in the COX-2 mediated induction of MDR1. The present study demonstrates COX-2 induction by HDACs and MDR1 induction by COX-2 via PGE(2)-cAMP-PKC-mediated pathway. Copyright 2010 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Tachibana Taro
2011-10-01
Full Text Available Abstract Background Cellular function is regulated by the balance of stringently regulated amounts of mRNA. Previous reports revealed that RNA polymerase II (RNAPII, which transcribes mRNA, can be classified into the pausing state and the active transcription state according to the phosphorylation state of RPB1, the catalytic subunit of RNAPII. However, genome-wide association between mRNA expression level and the phosphorylation state of RNAPII is unclear. While the functional importance of pausing genes is clear, such as in mouse Embryonic Stem cells for differentiation, understanding this association is critical for distinguishing pausing genes from active transcribing genes in expression profiling data, such as microarrays and RNAseq. Therefore, we examined the correlation between the phosphorylation of RNAPII and mRNA expression levels using a combined analysis by ChIPseq and RNAseq. Results We first performed a precise quantitative measurement of mRNA by performing an optimized calculation in RNAseq. We then visualized the recruitment of various phosphorylated RNAPIIs, such as Ser2P and Ser5P. A combined analysis using optimized RNAseq and ChIPseq for phosphorylated RNAPII revealed that mRNA levels correlate with the various phosphorylation states of RNAPII. Conclusions We demonstrated that the amount of mRNA is precisely reflected by the phased phosphorylation of Ser2 and Ser5. In particular, even the most "pausing" genes, for which only Ser5 is phosphorylated, were detectable at a certain level of mRNA. Our analysis indicated that the complexity of quantitative regulation of mRNA levels could be classified into three categories according to the phosphorylation state of RNAPII.
Directory of Open Access Journals (Sweden)
Anne Louise Askou
Full Text Available Lentivirus-based gene delivery vectors carrying multiple gene cassettes are powerful tools in gene transfer studies and gene therapy, allowing coexpression of multiple therapeutic factors and, if desired, fluorescent reporters. Current strategies to express transgenes and microRNA (miRNA clusters from a single vector have certain limitations that affect transgene expression levels and/or vector titers. In this study, we describe a novel vector design that facilitates combined expression of therapeutic RNA- and protein-based antiangiogenic factors as well as a fluorescent reporter from back-to-back RNApolII-driven expression cassettes. This configuration allows effective production of intron-embedded miRNAs that are released upon transduction of target cells. Exploiting such multigenic lentiviral vectors, we demonstrate robust miRNA-directed downregulation of vascular endothelial growth factor (VEGF expression, leading to reduced angiogenesis, and parallel impairment of angiogenic pathways by codelivering the gene encoding pigment epithelium-derived factor (PEDF. Notably, subretinal injections of lentiviral vectors reveal efficient retinal pigment epithelium-specific gene expression driven by the VMD2 promoter, verifying that multigenic lentiviral vectors can be produced with high titers sufficient for in vivo applications. Altogether, our results suggest the potential applicability of combined miRNA- and protein-encoding lentiviral vectors in antiangiogenic gene therapy, including new combination therapies for amelioration of age-related macular degeneration.
Yuniati, Yuniati; Hasanah, Nurul; Ismail, Sjarif; Anitasari, Silvia; Paramita, Swandari
2018-01-01
Staphylococcus aureus , methicillin-resistant and Escherichia coli , multidrug-resistant included in the list of antibiotic-resistant priority pathogens from WHO. As multidrug-resistant bacteria problem is increasing, it is necessary to probe new sources for identifying antimicrobial compounds. Medicinal plants represent a rich source of antimicrobial agents. One of the potential plants for further examined as antibacterial is Dracontomelon dao (Blanco) Merr. & Rolfe. The present study designed to find the antibacterial activity of D. dao stem bark extracts on Methicillin-resistant S. aureus (MRSA) and E. coli Multiple Drug Resistance (MDR), followed by determined secondary metabolites with antibacterial activity and determined the value of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration). D. dao stem bark extracted using 60% ethanol. Disc diffusion test methods used to find the antibacterial activity, following by microdilution methods to find the value of MIC and MBC. Secondary metabolites with antibacterial activity determined by bioautography using TLC (thin layer chromatography) methods. D. dao stem bark extracts are sensitive to MSSA, MRSA and E.coli MDR bacteria. The inhibition zone is 16.0 mm in MSSA, 11.7 mm in MRSA and 10.7 mm in E. coli MDR. The entire MBC/MIC ratios for MSSA, MRSA and E.coli MDR is lower than 4. The ratio showed bactericidal effects of D. dao stem bark extracts. In TLC results, colorless bands found to be secondary metabolites with antibacterial activity. D. dao stem bark extracts are potential to develop as antibacterial agent especially against MRSA and E. coli MDR strain.
Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus
2010-01-01
Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651
Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.
Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C
2017-09-11
To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.
Vélez-Cruz, Renier; Zadorin, Anton S; Coin, Frédéric; Egly, Jean-Marc
2013-01-15
Specific mutations in the XPD subunit of transcription factor IIH result in combined xeroderma pigmentosum (XP)/Cockayne syndrome (CS), a severe DNA repair disorder characterized at the cellular level by a transcriptional arrest following UV irradiation. This transcriptional arrest has always been thought to be the result of faulty transcription-coupled repair. In the present study, we showed that, following UV irradiation, XP-D/CS cells displayed a gross transcriptional dysregulation compared with "pure" XP-D cells or WT cells. Furthermore, global RNA-sequencing analysis showed that XP-D/CS cells repressed the majority of genes after UV, whereas pure XP-D cells did not. By using housekeeping genes as a model, we demonstrated that XP-D/CS cells were unable to reassemble these gene promoters and thus to restart transcription after UV irradiation. Furthermore, we found that the repression of these promoters in XP-D/CS cells was not a simple consequence of deficient repair but rather an active heterochromatinization process mediated by the histone deacetylase Sirt1. Indeed, RNA-sequencing analysis showed that inhibition of and/or silencing of Sirt1 changed the chromatin environment at these promoters and restored the transcription of a large portion of the repressed genes in XP-D/CS cells after UV irradiation. Our work demonstrates that a significant part of the transcriptional arrest displayed by XP-D/CS cells arises as a result of an active repression process and not simply as a result of a DNA repair deficiency. This dysregulation of Sirt1 function that results in transcriptional repression may be the cause of various severe clinical features in patients with XP-D/CS that cannot be explained by a DNA repair defect.
Mizumoto, Hiroyuki; Iwakawa, Hiro-Oki; Kaido, Masanori; Mise, Kazuyuki; Okuno, Tetsuro
2006-04-01
The genome of Red clover necrotic mosaic virus (RCNMV) in the genus Dianthovirus is divided into two RNA molecules of RNA1 and RNA2, which have no cap structure at the 5' end and no poly(A) tail at the 3' end. The 3' untranslated region (3' UTR) of RCNMV RNA1 contains an essential RNA element (3'TE-DR1), which is required for cap-independent translation. In this study, we investigated a cap-independent translational mechanism of RNA2 using a firefly luciferase (Luc) gene expression assay system in cowpea protoplasts and a cell-free lysate (BYL) prepared from evacuolated tobacco BY2 protoplasts. We were unable to detect cis-acting RNA sequences in RNA2 that can replace the function of a cap structure, such as the 3'TE-DR1 of RNA1. However, the uncapped reporter RNA2, RNA2-Luc, in which the Luc open reading frame (ORF) was inserted between the 5' UTR and the movement protein ORF, was effectively translated in the presence of p27 and p88 in protoplasts in which RNA2-Luc was replicated. Time course experiments in protoplasts showed that the translational activity of RNA2-Luc did not reflect the amount of RNA2. Mutations in cis-acting RNA replication elements of RNA2 abolished the cap-independent translational activity of RNA2-Luc, suggesting that the translational activity of RNA2-Luc is coupled to RNA replication. Our results show that the translational mechanism differs between two segmented genomic RNAs of RCNMV. We present a model in which only RNA2 that is generated de novo through the viral RNA replication machinery functions as mRNA for translation.
Kim, Hak-Bong; Lee, Su-Hoon; Um, Jee-Hyun; Oh, Won Keun; Kim, Dong-Wan; Kang, Chi-Dug; Kim, Sun-Hee
2015-01-01
The effectiveness of Hsp90 inhibitors as anticancer agents was limited in multidrug-resistant (MDR) human cancer cells due to induction of heat shock proteins (Hsps) such as Hsp70/Hsp27 and P-glycoprotein (P-gp)-mediated efflux. In the present study, we showed that resistance to Hsp90 inhibitors of MDR human cancer cells could be overcome with SIRT1 inhibition. SIRT1 knock-down or SIRT1 inhibitors (amurensin G and EX527) effectively suppressed the resistance to Hsp90 inhibitors (17-AAG and AUY922) in several MDR variants of human lymphoblastic leukemia and human breast cancer cell lines. SIRT1 inhibition down-regulated the expression of heat shock factor 1 (HSF1) and subsequently Hsps and facilitated Hsp90 multichaperone complex disruption via hyperacetylation of Hsp90/Hsp70. These findings were followed by acceleration of ubiquitin ligase CHIP-mediated mutant p53 (mut p53) degradation and subsequent down-regulation of P-gp in 17-AAG-treated MDR cancer cells expressing P-gp and mut p53 after inhibition of SIRT1. Therefore, combined treatment with Hsp90 inhibitor and SIRT1 inhibitor could be a more effective therapeutic approach for Hsp90 inhibitor-resistant MDR cells via down-regulation of HSF1/Hsps, mut p53 and P-gp. PMID:26416354
Coumpounds affecting cell membrane functions and integrity: MDR pumps and theit exploration
Czech Academy of Sciences Publication Activity Database
Sigler, Karel; Gášková, D.
2002-01-01
Roč. 51, č. 24 (2002), s. 19-22 ISSN 0137-1398. [Uroczyste Seminarium z okazji urodzin Profesora Stanislawa Witka /70./. Wroclaw, 21.07.2002] R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Keywords : xenobioticexporting * multidrug resistance * mdr pumps Subject RIV: EE - Microbiology, Virology
Iwata, Yuji; Takahashi, Masateru; Fedoroff, Nina V.; Hamdan, Samir
2013-01-01
). In the present study, we examined primary miRNA precursor (pri-miRNA) processing by highly purified recombinant DCL1 and SE proteins and found that SE is integral to pri-miRNA processing by DCL1. SE stimulates DCL1 cleavage of the pri-miRNA in an ionic strength
Directory of Open Access Journals (Sweden)
Monali P. Mishra
2017-01-01
Full Text Available Urinary tract infection (UTI has become a more grievous problem today, due to multidrug resistance of infecting Gram-positive (GP and Gram-negative (GN bacteria, sometimes even with multiple infections. This study examines effectivity of 9 tropical flowering plants (Anogeissus acuminata, Azadirachta indica, Bauhinia variegata, Boerhaavia diffusa, Punica granatum, Soymida febrifuga, Terminalia chebula, Tinospora cordifolia and Tribulus terrestris for possible use as source of antimicrobials for multidrug resistant (MDR bacteria, along with main-stream antibiotics. Pathogenic bacteria were isolated from urine samples of patients attending and admitted in the hospital. Antibiograms of 11 isolated bacteria (GPs, Enterococcus faecalis and Staphylococcus aureus; and GNs, Acinetobacter baumannii, Citrobacter freundii, Enterobacter aerogenes, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumoniae, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were ascertained by the disc-diffusion method, and antibacterial effectivity of plant extracts was monitored by the agar-well diffusion method. Isolated bacteria were floridly MDR to most antibiotics of the day. Methanol extracts of 9 plants were used, and extracts of 3 plants, A. acuminata, P. granatum and S. febrifuga at least caused 25–29 mm as the maximum size of zone of inhibition on bacterial lawns. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values of methanol extracts of 9 plants were recorded. The methanol extract of A. acuminata had 0.29 mg/ml as the lowest MIC value and 0.67 mg/ml as the lowest MBC value, against MDR S. aureus, signifying effectivity; but, it had the highest MIC value of 3.41 mg/ml. and the highest MBC value of 4.27 mg/ml for most other MDR bacteria including E. coli. Qualitative phytochemical analysis was done for these 9 plants and information on leading phytochemicals was presented retrieved from PubChem database. Thus
Yi, Ying-Jie; Jia, Xiu-Hong; Wang, Jian-Yong; Li, You-Jie; Wang, Hong; Xie, Shu-Yang
2016-05-01
Multidrug resistance (MDR) of leukemia cells is a major obstacle in chemotherapeutic treatment. The high expression and constitutive activation of P-glycoprotein (P-gp) and multidrug resistance protein-1 (MRP-1) have been reported to play a vital role in enhancing cell resistance to anticancer drugs in many tumors. The present study aimed to investigate the reversal of MDR by silencing homeobox A10 (HOXA10) in adriamycin (ADR)-resistant human chronic myelogenous leukemia (CML) K562/ADM cells by modulating the expression of P-gp and MRP-1. K562/ADM cells were stably transfected with HOXA10-targeted short hairpin RNA (shRNA). The results of reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis showed that the mRNA and protein expression of HOXA10 was markedly suppressed following transfection with a shRNA-containing vector. The sensitivity of the K562/ADM cells to ADR was enhanced by the silencing of HOXA10, due to the increased intracellular accumulation of ADR. The accumulation of ADR induced by the silencing of HOXA10 may be due to the downregulation of P-gp and MRP-1. Western blot analysis revealed that downregulating HOXA10 inhibited the protein expression of P-gp and MRP-1. Taken together, these results suggest that knockdown of HOXA10 combats resistance and that HOXA10 is a potential target for resistant human CML.
PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR
Directory of Open Access Journals (Sweden)
Nagaraju Anreddy
2014-06-01
Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.
Determination of chromium combined with DNA, RNA and proteins in chromium-rich brewer's yeast by NAA
International Nuclear Information System (INIS)
Ding, W.J.; Qian, Q.F.; Hou, X.L.; Feng, W.Y.; Chai, Z.F.
2000-01-01
The content of chromium in the DNA, RNA and protein fractions separated from chromium-rich and normal brewer's yeast was determined by neutron activation analysis (NAA). Our results show that the extracted relative amounts and concentrations of DNA, RNA and proteins have no significant difference for two types of yeast, but the chromium content in DNA, RNA and proteins fractions extracted from the chromium-rich yeast are substantially higher than those from the normal. In addition, the concentration of chromium in DNA is much higher than that in RNA and proteins. It is evident that the inorganic chromium compounds can enter the yeast cell during the yeast cultivation in the chromium-containing culture medium and are converted into organic chromium species, which are combined with DNA, RNA and proteins. (author)
TM4SF1 Promotes Gemcitabine Resistance of Pancreatic Cancer In Vitro and In Vivo.
Directory of Open Access Journals (Sweden)
Jia Cao
Full Text Available TM4SF1 is overexpressed in pancreatic ductal adenocarcinoma (PDAC and affects the development of this cancer. Also, multidrug resistance (MDR is generally associated with tumor chemoresistance in pancreatic cancer. However, the correlation between TM4SF1 and MDR remains unknown. This research aims to investigate the effect of TM4SF1 on gemcitabine resistance in PDAC and explore the possible molecular mechanism between TM4SF1 and MDR.The expression of TM4SF1 was evaluated in pancreatic cancer cell lines and human pancreatic duct epithelial (HPDE cell lines by quantitative RT-PCR. TM4SF1 siRNA transfection was carried out using Hiperfect transfection reagent to knock down TM4SF1. The transcripts were analyzed by quantitative RT-PCR, RT-PCR and western blotting for further study. The cell proliferation and apoptosis were obtained to investigate the sensitivity to gemcitabine of pancreatic cancer cells after silencing TM4SF1 in vitro. We demonstrated that cell signaling of TM4SF1 mediated chemoresistance in cancer cells by assessing the expression of multidrug resistance (MDR genes using quantitative RT-PCR. In vivo, we used orthotopic pancreatic tumor models to investigate the effect of proliferation after silencing TM4SF1 by a lentivirus-mediated shRNA in MIA PaCa-2 cell lines.The mRNA expression of TM4SF1 was higher in seven pancreatic cancer cell lines than in HPDE cell lines. In three gemcitabine-sensitive cell lines (L3.6pl, BxPC-3, SU86.86, the expression of TM4SF1 was lower than that in four gemcitabine-resistant cell lines (MIA PaCa-2, PANC-1, Hs766T, AsPC-1. We evaluated that TM4SF1 was a putative target for gemcitabine resistance in pancreatic cancer cells. Using AsPC-1, MIA PaCa-2 and PANC-1, we investigated that TM4SF1 silencing affected cell proliferation and increased the percentages of cell apoptosis mediated by treatment with gemcitabine compared with cells which were treated with negative control. This resistance was associated
Editing of HIV-1 RNA by the double-stranded RNA deaminase ADAR1 stimulates viral infection
Doria, Margherita; Neri, Francesca; Gallo, Angela; Farace, Maria Giulia; Michienzi, Alessandro
2009-01-01
Adenosine deaminases that act on dsRNA (ADARs) are enzymes that target double-stranded regions of RNA converting adenosines into inosines (A-to-I editing) thus contributing to genome complexity and fine regulation of gene expression. It has been described that a member of the ADAR family, ADAR1, can target viruses and affect their replication process. Here we report evidence showing that ADAR1 stimulates human immuno deficiency virus type 1 (HIV-1) replication by using both editing-dependent and editing-independent mechanisms. We show that over-expression of ADAR1 in HIV-1 producer cells increases viral protein accumulation in an editing-independent manner. Moreover, HIV-1 virions generated in the presence of over-expressed ADAR1 but not an editing-inactive ADAR1 mutant are released more efficiently and display enhanced infectivity, as demonstrated by challenge assays performed with T cell lines and primary CD4+ T lymphocytes. Finally, we report that ADAR1 associates with HIV-1 RNAs and edits adenosines in the 5′ untranslated region (UTR) and the Rev and Tat coding sequence. Overall these results suggest that HIV-1 has evolved mechanisms to take advantage of specific RNA editing activity of the host cell and disclose a stimulatory function of ADAR1 in the spread of HIV-1. PMID:19651874
Directory of Open Access Journals (Sweden)
Marian Loveday
Full Text Available To improve the treatment of MDR-TB and HIV co-infected patients, we investigated the relationship between health system performance and patient treatment outcomes at 4 decentralised MDR-TB sites.In this mixed methods case study which included prospective comparative data, we measured health system performance using a framework of domains comprising key health service components. Using Pearson Product Moment Correlation coefficients we quantified the direction and magnitude of the association between health system performance and MDR-TB treatment outcomes. Qualitative data from participant observation and interviews analysed using systematic text condensation (STC complemented our quantitative findings.We found significant differences in treatment outcomes across the sites with successful outcomes varying from 72% at Site 1 to 52% at Site 4 (p<0.01. Health systems performance scores also varied considerably across the sites. Our findings suggest there is a correlation between treatment outcomes and overall health system performance which is significant (r = 0.99, p<0.01, with Site 1 having the highest number of successful treatment outcomes and the highest health system performance. Although the 'integration' domain, which measured integration of MDR-TB services into existing services appeared to have the strongest association with successful treatment outcomes (r = 0.99, p<0.01, qualitative data indicated that the 'context' domain influenced the other domains.We suggest that there is an association between treatment outcomes and health system performance. The chance of treatment success is greater if decentralised MDR-TB services are integrated into existing services. To optimise successful treatment outcomes, regular monitoring and support are needed at a district, facility and individual level to ensure the local context is supportive of new programmes and implementation is according to guidelines.
Jiang, Huijuan; Hu, Xigang; Zhang, Hongzhi; Li, Wenbo
2017-04-04
Long non-coding RNAs (lncRNAs) have been reported to regulate the sensitivity of different cancer cells to chemoradiotherapy. Aberrant expression of lncRNA Taurine-upregulated gene 1 (TUG1) has been found to be involved in the development of bladder cancer, however, its function and underlying mechanism in the radioresistance of bladder cancer remains unclear. Quantitative real-time PCR (qRT-PCR) was conducted to measure the expression of TUG1 and HMGB1 mRNA in bladder cancer tissues and cell lines. HMGB1 protein levels were tested by western blot assays. Different doses of X-ray were used for radiation treatment of bladder cancer cells. Colony survival and cell viability were detected by clonogenic assay and CCK-8 Kit, respectively. Cell apoptosis was determined by flow cytometry. A xenograft mouse model was constructed to observe the effect of TUG1 on tumor growth in vivo. The levels of TUG1 and HMGB1 were remarkably increased in bladder cancer tissues and cell lines. Radiation treatment markedly elevated the expression of TUG1 and HMGB1. TUG1 knockdown inhibited cell proliferation, promoted cell apoptosis and decreased colony survival in SW780 and BIU87 cells under radiation. Moreover, TUG1 depletion suppressed the HMGB1 mRNA and protein levels. Furthermore, overexpression of HMGB1 reversed TUG1 knockdown-induced effect in bladder cancer cells. Radiation treatment dramatically reduced the tumor volume and weight in xenograft model, and this effect was more obvious when combined with TUG1 silencing. LncRNA TUG1 knockdown enhances radiosensitivity of bladder cancer by suppressing HMGB1 expression. TUG1 acts as a potential regulator of radioresistance of bladder cancer, and it may represent a promising therapeutic target for bladder cancer patients.
Risk factors for MDR and XDR-TB in a tertiary referral hospital in India.
Directory of Open Access Journals (Sweden)
V Balaji
Full Text Available BACKGROUND: India has a high burden of drug resistant TB, although there are few data on XDR-TB. Although XDR-TB has existed previously in India, the definition has not been widely applied, and surveillance using second line drug susceptibility testing has not been performed. Our objective was to analyze clinical and demographic risk factors associated with isolation of MDR and XDR TB as compared to susceptible controls, at a tertiary center. METHODOLOGY/FINDINGS: Retrospective chart review based on positive cultures isolated in a high volume mycobacteriology laboratory between 2002 and 2007. 47 XDR, 30 MDR and 117 susceptible controls were examined. Drug resistant cases were less likely to be extrapulmonary, and had received more previous treatment regimens. Significant risk factors for XDR-TB included residence outside the local state (OR 7.43, 3.07-18.0 and care costs subsidized (OR 0.23, 0.097-0.54 in bivariate analysis and previous use of a fluoroquinolone and injectable agent (other than streptomycin (OR 7.00, 95% C.I. 1.14-43.03 and an initial treatment regimen which did not follow national guidelines (OR 5.68, 1.24-25.96 in multivariate analysis. Cavitation and HIV did not influence drug resistance. CONCLUSIONS/SIGNIFICANCE: There is significant selection bias in the sample available. Selection pressure from previous treatment and an inadequate initial regimen increases risk of drug resistance. Local patients and those requiring financial subsidies may be at lower risk of XDR-TB.
HIV-1 nef suppression by virally encoded microRNA
Directory of Open Access Journals (Sweden)
Brisibe Ebiamadon
2004-12-01
Full Text Available Abstract Background MicroRNAs (miRNAs are 21~25-nucleotides (nt long and interact with mRNAs to trigger either translational repression or RNA cleavage through RNA interference (RNAi, depending on the degree of complementarity with the target mRNAs. Our recent study has shown that HIV-1 nef dsRNA from AIDS patients who are long-term non-progressors (LTNPs inhibited the transcription of HIV-1. Results Here, we show the possibility that nef-derived miRNAs are produced in HIV-1 persistently infected cells. Furthermore, nef short hairpin RNA (shRNA that corresponded to a predicted nef miRNA (~25 nt, miR-N367 can block HIV-1 Nef expression in vitro and the suppression by shRNA/miR-N367 would be related with low viremia in an LTNP (15-2-2. In the 15-2-2 model mice, the weight loss, which may be rendered by nef was also inhibited by shRNA/miR-N367 corresponding to suppression of nef expression in vivo. Conclusions These data suggest that nef/U3 miRNAs produced in HIV-1-infected cells may suppress both Nef function and HIV-1 virulence through the RNAi pathway.
Directory of Open Access Journals (Sweden)
Debasish Kar
2016-10-01
Full Text Available Objective: To evaluate the antibacterial property of silver nanoparticles (AgNPs and capsaicin against multidrug resistant (MDR and extended spectrum beta-lactamase (ESBL producing Escherichia coli of bovine and poultry origin. Methods: Antibacterial efficacy of AgNPs and capsaicin was measured using broth dilution method. Five MDR-ESBL producing E. coli isolates of poultry (PEC4, PEC6, PEC15 and PEC16 and cattle mastitis origin (MEC2 were taken to evaluate the antibacterial effect of AgNPs and capsaicin. Results: At 50 mmol/L AgNPs, the viability of MDR of bacterial pathogens was reduced to almost 80%–90% and at 1000 mmol/L, the viability went down to 0%–3%. The minimum inhibitory concentration (MIC50 of AgNPs against these MDR-ESBL producing isolates was found to vary between 172–218 mmol/L whereas the MIC80 varied between 450–640 mmol/L. Capsaicin showed more prominent bactericidal effect and only at 2.5 mmol/L concentration, the viability was shown to be reduced by 20%–35% whereas at 7.5 mmol/L concentration, there was approximately 60% reduction in viability. Further at 25 mmol/L concentration, the viability was reduced to 0%–8%. The MIC50 and MIC80 of capsaicin against these MDRESBL producing isolates were found to vary between 4.6–7.5 mmol/L and 10.9–16.9 mmol/L, respectively. Conclusions: The results point out that capsaicin and AgNPs could be of use in treating ESBL infection.
Bauer, William J.; Heath, Jason; Jenkins, Jermaine L.; Kielkopf, Clara L.
2012-01-01
T-cell intracellular antigen-1 (TIA-1) regulates developmental and stress-responsive pathways through distinct activities at the levels of alternative pre-mRNA splicing and mRNA translation. The TIA-1 polypeptide contains three RNA recognition motifs (RRMs). The central RRM2 and C-terminal RRM3 associate with cellular mRNAs. The N-terminal RRM1 enhances interactions of a C-terminal Q-rich domain of TIA-1 with the U1-C splicing factor, despite linear separation of the domains in the TIA-1 sequence. Given the expanded functional repertoire of the RRM family, it was unknown whether TIA-1 RRM1 contributes to RNA binding as well as documented protein interactions. To address this question, we used isothermal titration calorimetry and small-angle X-ray scattering (SAXS) to dissect the roles of the TIA-1 RRMs in RNA recognition. Notably, the fas RNA exhibited two binding sites with indistinguishable affinities for TIA-1. Analyses of TIA-1 variants established that RRM1 was dispensable for binding AU-rich fas sites, yet all three RRMs were required to bind a polyU RNA with high affinity. SAXS analyses demonstrated a `V' shape for a TIA-1 construct comprising the three RRMs, and revealed that its dimensions became more compact in the RNA-bound state. The sequence-selective involvement of TIA-1 RRM1 in RNA recognition suggests a possible role for RNA sequences in regulating the distinct functions of TIA-1. Further implications for U1-C recruitment by the adjacent TIA-1 binding sites of the fas pre-mRNA and the bent TIA-1 shape, which organizes the N- and C-termini on the same side of the protein, are discussed. PMID:22154808
Directory of Open Access Journals (Sweden)
Steven Bhutra
Full Text Available Imatinib, a targeted tyrosine kinase inhibitor, is the gold standard for managing chronic myeloid leukemia (CML. Despite its wide application, imatinib resistance occurs in 20-30% of individuals with CML. Multiple potential biomarkers have been identified to predict imatinib response; however, the majority of them remain externally uncorroborated. In this study, we set out to systematically identify gene/microRNA (miRNA whose expression changes are related to imatinib response. Through a Gene Expression Omnibus search, we identified two genome-wide expression datasets that contain expression changes in response to imatinib treatment in a CML cell line (K562: one for mRNA and the other for miRNA. Significantly differentially expressed transcripts/miRNAs post imatinib treatment were identified from both datasets. Three additional filtering criteria were applied 1 miRbase/miRanda predictive algorithm; 2 opposite direction of imatinib effect for genes and miRNAs; and 3 literature support. These criteria narrowed our candidate gene-miRNA to a single pair: IL8 and miR-493-5p. Using PCR we confirmed the significant up-regulation and down-regulation of miR-493-5p and IL8 by imatinib treatment, respectively in K562 cells. In addition, IL8 expression was significantly down-regulated in K562 cells 24 hours after miR-493-5p mimic transfection (p = 0.002. Furthermore, we demonstrated significant cellular growth inhibition after IL8 inhibition through either gene silencing or by over-expression of miR-493-5p (p = 0.0005 and p = 0.001 respectively. The IL8 inhibition also further sensitized K562 cells to imatinib cytotoxicity (p < 0.0001. Our study combined expression changes in transcriptome and miRNA after imatinib exposure to identify a potential gene-miRNA pair that is a critical target in imatinib response. Experimental validation supports the relationships between IL8 and miR-493-5p and between this gene-miRNA pair and imatinib sensitivity in a CML cell
Decreases in Casz1 mRNA by an siRNA Complex Do not Alter Blood Pressure in Mice.
Ji, Su-Min; Shin, Young-Bin; Park, So-Yon; Lee, Hyeon-Ju; Oh, Bermseok
2012-03-01
Recent genomewide association studies of large samples have identified genes that are associated with blood pressure. The Global Blood Pressure Genetics (Global BPgen) and Cohorts for Heart and Aging Research in Genome Epidemiology (CHARGE) consortiums identified 14 loci that govern blood pressure on a genomewide significance level, one of which is CASZ1 confirmed in both Europeans and Asians. CASZ1 is a zinc finger transcription factor that controls apoptosis and cell fate and suppresses neuroblastoma tumor growth by reprogramming gene expression, like a tumor suppressor. To validate the function of CASZ1 in blood pressure, we decreased Casz1 mRNA levels in mice by siRNA. Casz1 siRNA reduced mRNA levels by 59% in a mouse cell line. A polyethylenimine-mixed siRNA complex was injected into mouse tail veins, reducing Casz1 mRNA expression to 45% in the kidney. However, blood pressure in the treated mice was unaffected, despite a 55% reduction in Casz1 mRNA levels in the kidney on multiple siRNA injections daily. Even though Casz1 siRNA-treated mice did not experience any significant change in blood pressure, our study demonstrates the value of in vivo siRNA injection in analyzing the function of candidate genes identified by genomewide association studies.
Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong
2014-02-01
The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.
Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En
2015-01-01
In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior
In vitro interactions with repeated grapefruit juice administration--to peel or not to peel?
Brill, Shlomo; Zimmermann, Christian; Berger, Karin; Drewe, Juergen; Gutmann, Heike
2009-03-01
Interactions of acutely administered grapefruit juice (GFJ) with cytochrome P450 isoform 3A4 (CYP3A4) and P-glycoprotein (Pgp) function are well established. In this study, we investigated in vitro the effect of repeated administration of GFJ and its major constituents (the flavonoid naringin, its aglycone naringenin and the furanocoumarin bergamottin) on mRNA expression of MDR1 and CYP3A4 in LS180 cells. Since the bergamottin content is higher in the peel than in the fruit, we compared GFJ containing peel (GFJP+) with juice without any peel extract (GFJP-). GFJP- (1%) showed no significant effect on MDR1 and CYP3A4 mRNA expression, whereas 1% GFJP+ increased expression of MDR1 3.7-fold (Pextract may have a lower potential for interactions with CYP3A4 or P-glycoprotein.
ABCE1 is a highly conserved RNA silencing suppressor.
Directory of Open Access Journals (Sweden)
Kairi Kärblane
Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.
Directory of Open Access Journals (Sweden)
Feng Zhi
Full Text Available Multidrug resistance (MDR is a major impediment to successful cancer chemotherapy. Co-delivery of novel MDR-reversing agents and anticancer drugs to cancer cells holds great promise for cancer treatment. MicroRNA-21 (miR-21 overexpression is associated with the development and progression of MDR in breast cancer, and it is emerging as a novel and promising MDR-reversing target. In this study, a multifunctional nanocomplex, composed of polyethylenimine (PEI/poly(sodium 4-styrenesulfonates (PSS/graphene oxide (GO and termed PPG, was prepared using the layer-by-layer assembly method to evaluate the reversal effects of PPG as a carrier for adriamycin (ADR along with miR-21 targeted siRNA (anti-miR-21 in cancer drug resistance. ADR was firstly loaded onto the PPG surface (PPGADR by physical mixing and anti-miR-21 was sequentially loaded onto PPGADR through electric absorption to form (anti-miR-21PPGADR. Cell experiments showed that PPG significantly enhanced the accumulation of ADR in MCF-7/ADR cells (an ADR resistant breast cancer cell line and exhibited much higher cytotoxicity than free ADR, suggesting that PPG could effectively reverse ADR resistance of MCF-7/ADR. Furthermore, the enhanced therapeutic efficacy of PPG could be correlated with effective silencing of miR-21 and with increased accumulation of ADR in drug-resistant tumor cells. The endocytosis study confirmed that PPG could effectively carry drug molecules into cells via the caveolae and clathrin-mediated endocytosis pathways. These results suggest that this PPG could be a potential and efficient non-viral vector for reversing MDR, and the strategy of combining anticancer drugs with miRNA therapy to overcome MDR could be an attractive approach in cancer treatment.
Energy Technology Data Exchange (ETDEWEB)
Wang, Yimeng; Zhou, Jianhong; Du, Yuchun, E-mail: ydu@uark.edu
2014-01-20
The NS1 protein of influenza viruses is a major virulence factor and exerts its function through interacting with viral/cellular RNAs and proteins. In this study, we identified heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNP A2/B1) as an interacting partner of NS1 proteins by a proteomic method. Knockdown of hnRNP A2/B1 by small interfering RNA (siRNA) resulted in higher levels of NS vRNA, NS1 mRNA, and NS1 protein in the virus-infected cells. In addition, we demonstrated that hnRNP A2/B1 proteins are associated with NS1 and NS2 mRNAs and that knockdown of hnRNP A2/B1 promotes transport of NS1 mRNA from the nucleus to the cytoplasm in the infected cells. Lastly, we showed that knockdown of hnRNP A2/B1 leads to enhanced virus replication. Our results suggest that hnRNP A2/B1 plays an inhibitory role in the replication of influenza A virus in host cells potentially through suppressing NS1 RNA/protein levels and NS1 mRNA nucleocytoplasmic translocation. - Highlights: • Cellular protein hnRNP A2/B1 interacts with influenza viral protein NS1. • hnRNP A2/B1 suppresses the levels of NS1 protein, vRNA and mRNA in infected cells. • hnRNP A2/B1 protein is associated with NS1 and NS2 mRNAs. • hnRNP A2/B1 inhibits the nuclear export of NS1 mRNAs. • hnRNP A2/B1 inhibits influenza virus replication.
Jatau, Bolajoko; Avong, Yohanna; Ogundahunsi, Olumide; Shah, Safieh; Tayler Smith, Katherine; Van den Bergh, Rafael; Zachariah, Rony; van Griensven, Johan; Ekong, Ernest; Dakum, Patrick
2015-01-01
The World Health Organisation (WHO) introduced the twelve early warning indicators for monitoring and evaluating drug Procurement and Supply management (PSM) systems, intended to prevent drug stock-outs and overstocking. Nigeria--one of the high Multi Drug Resistant Tuberculosis (MDR-TB) burden countries, scaled-up treatment in 2012 with the concurrent implementation of a PSM system. We evaluated how well this system functioned using the WHO indicators, including all seven MDR-TB treatment centres in the country that were functional throughout 2013. The quantity of MDR-TB drugs ordered for 2013 matched the annual forecast and all central orders placed during the year were delivered in full and on time. Drug consumption was 81%-106% of the quantity allocated for routine consumption. Timely submission of complete inventory reports ranged from 86-100%, late submissions being 5-15 days late. Forty to 71% of treatment centres placed a drug order when stock was below the minimum level of three months. The proportion of drug orders received at the treatment centres in full and on time ranged from 29-80%, late orders being 1-19 days late. The PSM was found to be performing well in terms of forecasting and procurement of MDR-TB drugs, but there were shortcomings in drug distribution, reporting at treatment centre level and in drug order placements. Despite these gaps, there were no stock outs. These findings indicate that where it matters most, namely ensuring that no drug stock outs affect patient management, the PSM system is effective. Addressing the observed shortcomings will help to strengthen the existing PSM system in anticipation of a growing MDR-TB case burden in the country.
Fraser, Hamish S F; Habib, Ali; Goodrich, Mark; Thomas, David; Blaya, Joaquin A; Fils-Aime, Joseph Reginald; Jazayeri, Darius; Seaton, Michael; Khan, Aamir J; Choi, Sharon S; Kerrison, Foster; Falzon, Dennis; Becerra, Mercedes C
2013-01-01
Multi-drug resistant TB (MDR-TB) is a complex infectious disease that is a growing threat to global health. It requires lengthy treatment with multiple drugs and specialized laboratory testing. To effectively scale up treatment to thousands of patients requires good information systems to support clinical care, reporting, drug forecasting, supply chain management and monitoring. Over the last decade we have developed the PIH-EMR electronic medical record system, and subsequently OpenMRS-TB, to support the treatment of MDR-TB in Peru, Haiti, Pakistan, and other resource-poor environments. We describe here the experience with implementing these systems and evaluating many aspects of their performance, and review other systems for MDR-TB management. We recommend a new approach to information systems to address the barriers to scale up MDR-TB treatment, particularly access to the appropriate drugs and lab data. We propose moving away from fragmented, vertical systems to focus on common platforms, addressing all stages of TB care, support for open data standards and interoperability, care for a wide range of diseases including HIV, integration with mHealth applications, and ability to function in resource-poor environments.
Abbink, Truus E. M.; Ooms, Marcel; Haasnoot, P. C. Joost; Berkhout, Ben
2005-01-01
The untranslated leader RNA is the most conserved part of the human immunodeficiency virus type I (HIV-1) genome. It contains many regulatory motifs that mediate a variety of steps in the viral life cycle. Previous work showed that the full-length leader RNA can adopt two alternative structures: a
Directory of Open Access Journals (Sweden)
Roja Rani Pallavali
Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence
Ham, Byung-Kook; Li, Gang; Jia, Weitao; Leary, Julie A; Lucas, William J
2014-11-01
In plants, the vascular system, specifically the phloem, functions in delivery of small RNA (sRNA) to exert epigenetic control over developmental and defense-related processes. Although the importance of systemic sRNA delivery has been established, information is currently lacking concerning the nature of the protein machinery involved in this process. Here, we show that a PHLOEM SMALL-RNA BINDING PROTEIN 1 (PSRP1) serves as the basis for formation of an sRNA ribonucleoprotein complex (sRNPC) that delivers sRNA (primarily 24 nt) to sink organs. Assembly of this complex is facilitated through PSRP1 phosphorylation by a phloem-localized protein kinase, PSRPK1. During long-distance transport, PSRP1-sRNPC is stable against phloem phosphatase activity. Within target tissues, phosphatase activity results in disassembly of PSRP1-sRNPC, a process that is probably required for unloading cargo sRNA into surrounding cells. These findings provide an insight into the mechanism involved in delivery of sRNA associated with systemic gene silencing in plants. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
tRNA modifying enzymes, NSUN2 and METTL1, determine sensitivity to 5-fluorouracil in HeLa cells.
Directory of Open Access Journals (Sweden)
Mayumi Okamoto
2014-09-01
Full Text Available Nonessential tRNA modifications by methyltransferases are evolutionarily conserved and have been reported to stabilize mature tRNA molecules and prevent rapid tRNA decay (RTD. The tRNA modifying enzymes, NSUN2 and METTL1, are mammalian orthologs of yeast Trm4 and Trm8, which are required for protecting tRNA against RTD. A simultaneous overexpression of NSUN2 and METTL1 is widely observed among human cancers suggesting that targeting of both proteins provides a novel powerful strategy for cancer chemotherapy. Here, we show that combined knockdown of NSUN2 and METTL1 in HeLa cells drastically potentiate sensitivity of cells to 5-fluorouracil (5-FU whereas heat stress of cells revealed no effects. Since NSUN2 and METTL1 are phosphorylated by Aurora-B and Akt, respectively, and their tRNA modifying activities are suppressed by phosphorylation, overexpression of constitutively dephosphorylated forms of both methyltransferases is able to suppress 5-FU sensitivity. Thus, NSUN2 and METTL1 are implicated in 5-FU sensitivity in HeLa cells. Interfering with methylation of tRNAs might provide a promising rationale to improve 5-FU chemotherapy of cancer.
Bergen, Phillip J.; Forrest, Alan; Bulitta, Jürgen B.; Tsuji, Brian T.; Sidjabat, Hanna E.; Paterson, David L.; Li, Jian; Nation, Roger L.
2011-01-01
The use of combination antibiotic therapy may be beneficial against rapidly emerging resistance in Pseudomonas aeruginosa. The aim of this study was to systematically investigate in vitro bacterial killing and resistance emergence with colistin alone and in combination with imipenem against multidrug-resistant (MDR) P. aeruginosa. Time-kill studies were conducted over 48 h using 5 clinical isolates and ATCC 27853 at two inocula (∼106 and ∼108 CFU/ml); MDR, non-MDR, and colistin-heteroresistant and -resistant strains were included. Nine colistin-imipenem combinations were investigated. Microbiological response was examined by log changes at 6, 24, and 48 h. Colistin combined with imipenem at clinically relevant concentrations increased the levels of killing of MDR and colistin-heteroresistant isolates at both inocula. Substantial improvements in activity with combinations were observed across 48 h with all colistin concentrations at the low inoculum and with colistin at 4× and 16× MIC (or 4 and 32 mg/liter) at the high inoculum. Combinations were additive or synergistic against imipenem-resistant isolates (MICs, 16 and 32 mg/liter) at the 106-CFU inoculum in 9, 11, and 12 of 18 cases (i.e., 9 combinations across 2 isolates) at 6, 24, and 48 h, respectively, and against the same isolates at the 108-CFU inoculum in 11, 7, and 8 cases, respectively. Against a colistin-resistant strain (MIC, 128 mg/liter), combinations were additive or synergistic in 9 and 8 of 9 cases at 24 h at the 106- and 108-CFU inocula, respectively, and in 5 and 7 cases at 48 h. This systematic study provides important information for optimization of colistin-imipenem combinations targeting both colistin-susceptible and colistin-resistant subpopulations. PMID:21876058
Enrofloxacin and Probiotic Lactobacilli Influence PepT1 and LEAP-2 mRNA Expression in Poultry.
Pavlova, Ivelina; Milanova, Aneliya; Danova, Svetla; Fink-Gremmels, Johanna
2016-12-01
Expression of peptide transporter 1 (PepT1) and liver-expressed antimicrobial peptide 2 (LEAP-2) in chickens can be influenced by food deprivation, pathological conditions and drug administration. Effect of three putative probiotic Lactobacillus strains and enrofloxacin on the expression of PepT1 and LEAP-2 mRNA was investigated in Ross 308 chickens. One-day-old chicks (n = 24) were allocated to following groups: control (without treatment); group treated with probiotics via feed; group treated with a combination of probiotics and enrofloxacin; and a group given enrofloxacin only. The drug was administered at a dose of 10 mg kg -1 , via drinking water for 5 days. Samples from liver, duodenum and jejunum were collected 126 h after the start of the treatment. Expression levels of PepT1 and LEAP-2 were determined by real-time polymerase chain reaction and were statistically evaluated by Mann-Whitney test. Enrofloxacin administered alone or in combination with probiotics provoked a statistically significant up-regulation of PepT1 mRNA levels in the measured organ sites. These changes can be attributed to a tendency of improvement in utilization of dietary peptide and in body weight gain. LEAP-2 mRNA expression levels did not change significantly in enrofloxacin-treated chickens in comparison with control group.
Ginsberg, Stephen D; Che, Shaoli
2004-08-01
The use of five histochemical stains (cresyl violet, thionin, hematoxylin & eosin, silver stain, and acridine orange) was evaluated in combination with an expression profiling paradigm that included regional and single cell analyses within the hippocampus of post-mortem human brains and adult mice. Adjacent serial sections of human and mouse hippocampus were labeled by histochemistry or neurofilament immunocytochemistry. These tissue sections were used as starting material for regional and single cell microdissection followed by a newly developed RNA amplification procedure (terminal continuation (TC) RNA amplification) and subsequent hybridization to custom-designed cDNA arrays. Results indicated equivalent levels of global hybridization signal intensity and relative expression levels for individual genes for hippocampi stained by cresyl violet, thionin, and hematoxylin & eosin, and neurofilament immunocytochemistry. Moreover, no significant differences existed between the Nissl stains and neurofilament immunocytochemistry for individual CA1 neurons obtained via laser capture microdissection. In contrast, a marked decrement was observed in adjacent hippocampal sections stained for silver stain and acridine orange, both at the level of the regional dissection and at the CA1 neuron population level. Observations made on the cDNA array platform were validated by real-time qPCR using primers directed against beta-actin and glyceraldehyde-3 phosphate dehydrogenase. Thus, this report demonstrated the utility of using specific Nissl stains, but not stains that bind RNA species directly, in both human and mouse brain tissues at the regional and cellular level for state-of-the-art molecular fingerprinting studies.
Stein, Ulrike; Bergmann, Stephan; Scheffer, George L; Scheper, Rik J; Royer, Hans-Dieter; Schlag, Peter M; Walther, Wolfgang
2005-05-19
Vaults have been suggested to play a direct role in multidrug resistance (MDR) to anticancer drugs. The human major vault protein (MVP) also known as lung resistance-related protein (LRP) represents the predominant component of vaults that may be involved in the defense against xenobiotics. Here, we demonstrate that besides MDR-related cytostatics, also the non-MDR-related drug 5-fluorouracil (5-FU) was able to induce MVP mRNA and protein expression. Treatment with 5-FU amplified the binding activity and interaction of the transcription factor Y-box binding protein-1 (YB-1) with the Y-box of the human MVP gene promoter in a time-dependent manner. 5-FU also induced reporter expressions driven by a panel of newly generated MVP promoter deletion mutants. Interestingly, stably YB-1 overexpressing cell clones showed enhanced binding of YB-1 to the Y-box motif, associated with enhanced basal as well as 5-FU-inducible MVP promoter-driven reporter expressions. Moreover, transduction of YB-1 cDNA led to increased expression of endogenous MVP protein. Under physiological conditions, we observed a strong coexpression of MVP and YB-1 in human colon carcinoma specimen. In summary, our data demonstrate a direct involvement of YB-1 in controlling basal and 5-FU-induced MVP promoter activity. Therefore, YB-1 is directly linked to MVP-mediated drug resistance.
Directory of Open Access Journals (Sweden)
Masako Nomaguchi
2017-12-01
Full Text Available Genomic RNA of HIV-1 contains localized structures critical for viral replication. Its structural analysis has demonstrated a stem-loop structure, SLSA1, in a nearby region of HIV-1 genomic splicing acceptor 1 (SA1. We have previously shown that the expression level of vif mRNA is considerably altered by some natural single-nucleotide variations (nSNVs clustering in SLSA1 structure. In this study, besides eleven nSNVs previously identified by us, we totally found nine new nSNVs in the SLSA1-containing sequence from SA1, splicing donor 2, and through to the start codon of Vif that significantly affect the vif mRNA level, and designated the sequence SA1D2prox (142 nucleotides for HIV-1 NL4-3. We then examined by extensive variant and mutagenesis analyses how SA1D2prox sequence and SLSA1 secondary structure are related to vif mRNA level. While the secondary structure and stability of SLSA1 was largely changed by nSNVs and artificial mutations introduced to restore the original NL4-3 form from altered ones by nSNVs, no clear association of the two SLSA1 properties with vif mRNA level was observed. In contrast, when naturally occurring SA1D2prox sequences that contain multiple nSNVs were examined, we attained significant inverse correlation between the vif level and SLSA1 stability. These results may suggest that SA1D2prox sequence adapts over time, and also that the altered SA1D2prox sequence, SLSA1 stability, and vif level are mutually related. In total, we show here that the entire SA1D2prox sequence and SLSA1 stability critically contribute to the modulation of vif mRNA level.
Jones, Christopher P; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin
2013-02-01
The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNA(Lys3). Host cell tRNA(Lys) is selectively packaged into HIV-1 through a specific interaction between the major tRNA(Lys)-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNA(Lys3) is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNA(Lys) and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNA(Lys3) in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNA(Lys) to increase the efficiency of tRNA(Lys3) annealing to viral RNA.
International Nuclear Information System (INIS)
Sokova, O.I.; Siyanova, E.Yu.; Gudkov, A.V.; Kopnin, B.P.
1988-01-01
Using in situ hybridization, the mdr gene was mapped in chromosomes of Dzungarian hamster embryonic cells, amplification of which accompanies development of multidrug resistance (MDR). It was shown that the mdr gene is located in chromosome segment 4q15-21, in which, according to data obtained previously, amplified copes of open quotes MDR genes close quotes (mdr, et al.) are distributed, as a rule. Results obtained, as well as data of other investigators, attest to the fact that integration recombination of amplified copies of DNA occurs primarily at the site of disposition of homologous sequences
Directory of Open Access Journals (Sweden)
Lingyan Wang
Full Text Available RIG-I-like receptors (RLR are intracellular sensors utilized by nearly all cell types for recognition of viral RNA, initiation of antiviral defense, and induction of type I interferons (IFN. TBK1 is a critical kinase implicated in RLR-dependent IFN transcription. Posttranslational modification of TBK1 by K63-linked ubiquitin is required for RLR driven signaling. However, the TBK1 ubiquitin acceptor sites and the function of ubiquitinated TBK1 in the signaling cascade are unknown. We now show that TBK1 is ubiquitinated on residues K69, K154, and K372 in response to infection with RNA virus. The K69 and K154 residues are critical for innate antiviral responses and IFN production. Ubiquitinated TBK1 recruits the downstream adaptor NEMO through ubiquitin binding domains. The assembly of the NEMO/TBK1 complex on the mitochondrial protein MAVS leads to activation of TBK1 kinase activity and phosphorylation of the transcription factor, interferon response factor 3. The combined results refine current views of RLR signaling, define the role of TBK1 polyubiquitination, and detail the mechanisms involved in signalosome assembly.
Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1
Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.
2012-01-01
Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes
Liu, Lingzhi; Song, Chao; Zhang, Zhang; Yang, Juan; Zhou, Lili; Zhang, Xing; Xie, Guoming
2015-08-15
Measurement of microRNA (miRNA) levels in body fluids is a crucial tool for the early diagnosis and prognosis of cancers. In this study, we developed an electrochemical assay to detect miRNA-21 by fabricating the electrode with layer-by-layer assembly of oxidized single-walled carbon nanotubes and nanodiamonds. Tetrahedron-structured probes with free-standing probe on the top served as receptors to hybridize with target miRNA directly. The probes were immobilized on the deposited gold nanoparticles through a well-established strong Au-S bond. The electrochemical signal was mainly derived from an ultrasensitive pattern by combining hybridization chain reaction with DNA-functionalized AuNPs, which provided DNAzyme to catalyze H2O2 reduction. Differential pulse voltammetry was applied to record the electrochemical signals, which was increased linearly with the target miRNA-21, and the linear detection range was 10 fM to 1.0 nM. The limit of detection reached 1.95 fM (S/N=3), and the proposed biosensor exhibited good reproducibility and stability, as well as high sensitivity. Hence, this biosensor has a promising potential in clinical application. Copyright © 2015 Elsevier B.V. All rights reserved.
Hu, Guangzhen; Gupta, Shiv K.; Troska, Tammy P.; Nair, Asha; Gupta, Mamta
2017-01-01
Mantle cell lymphoma (MCL) is an aggressive B-cell lymphoma characterized by rapid disease progression. The needs for new therapeutic strategies for MCL patients call for further understanding on the molecular mechanisms of pathogenesis of MCL. Recently, long noncoding RNAs (lncRNAs) have been recognized as key regulators of gene expression and disease development, however, the role of lncRNAs in non-Hodgkin lymphoma and specifically in MCL is still unknown. Next generation RNA-sequencing was carried out on MCL patient samples along with normal controls and data was analyzed. As a result, several novel lncRNAs were found significantly overexpressed in the MCL samples with lncRNA ROR1-AS1 the most significant one. We cloned the ROR1-AS1 lncRNA in expression vector and ectopically transfected in MCL cell lines. Results showed that overexpression of ROR1-AS1 lncRNA promoted growth of MCL cells while decreased sensitivity to the treatment with drugs ibrutinib and dexamethasone. ROR-AS1 overexpression also decreased the mRNA expression of P16 (P = 0.21), and SOX11 (p = 0.017), without much effect on P53, ATM and P14 mRNA. RNA-immunoprecipitation assays demonstrated high affinity binding of lncRNA ROR1-AS1 with EZH2 and SUZ12 proteins of the polycomb repressive complex-2 (PRC2). Suppressing EZH2 activity with pharmacological inhibitor GSK343 abolished binding of ROR1-AS1 with EZH2. Taken together, this study identified a functional lncRNA ROR-AS1 involved with regulation of gene transcription via associating with PRC2 complex, and may serve as a novel biomarker in MCL patients. PMID:29113297
Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu
2013-01-01
A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.
Chemoresistance of CD133{sup +} colon cancer may be related with increased survivin expression
Energy Technology Data Exchange (ETDEWEB)
Lee, Mi-Ra; Ji, Sun-Young; Mia-Jan, Khalilullah [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Cho, Mee-Yon, E-mail: meeyon@yonsei.ac.kr [Department of Pathology, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of); Institute of Genomic Cohort, Yonsei University, Wonju College of Medicine, Wonju (Korea, Republic of)
2015-07-31
CD133, putative cancer stem cell marker, deemed to aid chemoresistance. However, this claim has been challenged recently and we previously reported that patients with CD133{sup +} colon cancer have benefit from 5-fluorouracil (5-FU) chemotherapy incontrast to no benefit in patients with CD133{sup −} cancer. To elucidate the role of CD133 expression in chemoresistance, we silenced the CD133 expression in a colon cancer cell line and determined its effect on the biological characteristics downstream. We comparatively analyzed the sequential changes of MDR1, ABCG2, AKT1 and survivin expression and the result of proliferation assay (WST-1 assay) with 5-FU treatment in CD133{sup +} and siRNA-induced CD133{sup −} cells, derived from Caco-2 colon cancer cell line. 5-FU treatment induced significantly increase of the mRNA expression of MDR1, ABCG2 and AKT1genes, but not protein level. CD133 had little to no effect on the mRNA and protein expression of these genes. However, survivin expression at mRNA and protein level were significantly increased in CD133{sup +} cells compared with siRNA-induced CD133-cells and Mock (not sorted CD133{sup +} cells) at 96 h after siRNA transfection. The cytotoxicity assay demonstrated notable increase of chemoresistance to 5-FU treatment (10 μM) in CD133{sup +} cells at 96 h after siRNA transfection. From this study, we conclude that CD133{sup +} cells may have chemoresistance to 5-FU through the mechanism which is related with survivin expression, instead of MDR1, ABCG2 and AKT1 expression. Therefore a survivin inhibitor can be a new target for effective treatment of CD133{sup +} colon cancer. - Highlights: • We evaluate the role of CD133 in chemoresistance of colon cancer. • We compared the chemoresistance of CD133{sup +} cells and siRNA-induced CD133{sup −} cells. • CD133 had little to no effect on MDR1, ABCG2 and AKT1 expression. • Survivin expression and chemoresistance were increased in CD133{sup +} colon cancer cells.
Structure of the central RNA recognition motif of human TIA-1 at 1.95 A resolution
International Nuclear Information System (INIS)
Kumar, Amit O.; Swenson, Matthew C.; Benning, Matthew M.; Kielkopf, Clara L.
2008-01-01
T-cell-restricted intracellular antigen-1 (TIA-1) regulates alternative pre-mRNA splicing in the nucleus, and mRNA translation in the cytoplasm, by recognizing uridine-rich sequences of RNAs. As a step towards understanding RNA recognition by this regulatory factor, the X-ray structure of the central RNA recognition motif (RRM2) of human TIA-1 is presented at 1.95 A resolution. Comparison with structurally homologous RRM-RNA complexes identifies residues at the RNA interfaces that are conserved in TIA-1-RRM2. The versatile capability of RNP motifs to interact with either proteins or RNA is reinforced by symmetry-related protein-protein interactions mediated by the RNP motifs of TIA-1-RRM2. Importantly, the TIA-1-RRM2 structure reveals the locations of mutations responsible for inhibiting nuclear import. In contrast with previous assumptions, the mutated residues are buried within the hydrophobic interior of the domain, where they would be likely to destabilize the RRM fold rather than directly inhibit RNA binding
Rutault, K; Hazzalin, C A; Mahadevan, L C
2001-03-02
Tumor necrosis factor-alpha (TNF-alpha) is a potent proinflammatory cytokine whose synthesis and secretion are implicated in diverse pathologies. Hence, inhibition of TNF-alpha transcription or translation and neutralization of its protein product represent major pharmaceutical strategies to control inflammation. We have studied the role of ERK and p38 mitogen-activated protein (MAP) kinase in controlling TNF-alpha mRNA levels in differentiated THP-1 cells and in freshly purified human monocytes. We show here that it is possible to produce virtually complete inhibition of lipopolysaccharide-stimulated TNF-alpha mRNA accumulation by using a combination of ERK and p38 MAP kinase inhibitors. Furthermore, substantial inhibition is achievable using combinations of 1 microm of each inhibitor, whereas inhibitors used individually are incapable of producing complete inhibition even at high concentrations. Finally, addressing mechanisms involved, we show that inhibition of p38 MAP kinase selectively destabilizes TNF-alpha transcripts but does not affect degradation of c-jun transcripts. These results impinge on the controversy in the literature surrounding the mode of action of MAP kinase inhibitors on TNF-alpha mRNA and suggest the use of combinations of MAP kinase inhibitors as an effective anti-inflammatory strategy.
Soliman, Ahmed M; Ahmed, Ashraf M; Shimamoto, Toshi; El-Domany, Ramadan A; Nariya, Hirofumi; Shimamoto, Tadashi
2017-07-01
Two Proteus mirabilis strains, designated PmTAN59 and PmKAF126, were isolated from two different Egyptian cities in 2014 and 2015, respectively. PmTAN59 was isolated from a sputum swab from a pneumonia patient in Tanta University Teaching Hospital. PmKAF126 was isolated from a patient with a diabetic foot infection in a hospital in the city of Kafr El-Sheikh. The two isolates were identified with bacterial small ribosomal RNA (16S rRNA) gene amplification and sequencing and tested for antimicrobial sensitivity with a Kirby-Bauer disk diffusion assay. The two strains were resistant to amoxicillin/clavulante, ampicillin, cefotaxime, cefoxitin, ceftriaxone, chloramphenicol, ciprofloxacin, colistin, gentamicin, kanamycin, nalidixic acid, spectinomycin, streptomycin, sulfamethoxazole/trimethoprime, and tetracycline, but sensitive to aztreonam, imipenem, and meropenem. Molecular characterization was used to map the entire backbone, including the multiple antibiotic resistance (MDR) region, of Salmonella genomic island 1 (SGI1). Both isolates carried a structure similar to SGI1, with two different MDR regions corresponding to SGI1-PmABB in PmTAN59 and SGI1-W in PmKAF126. SGI1-PmABB carried an integron of ~1.5kb with a two-gene cassette, aacCA5-aadA7, which confers resistance to gentamicin, streptomycin, and spectinomycin, whereas SGI1-W carried an integron of ~1.9kb containing aadA2-lnuF, which confers resistance to spectinomycin, streptomycin, and lincosamides. PmKAF126 carried the entire SGI1 sequence, however PmTAN59 carried a SGI1 structure with a deletion in the region from ORF S005 to ORF S009 and accompanied by insertion of IS1359 (1258bp). Furthermore, PmTAN59 carried class 2 integron of ~2.2kb containing dfrA1-sat2-aadA1. An ERIC-PCR analysis detected no clonal relationship between the two strains. Molecular screening for other antimicrobial resistance genes and a plasmid analysis indicated that PmTAN59 carried an IncFIB plasmid type. This strain also carried bla
A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.
Directory of Open Access Journals (Sweden)
Finn Grey
2010-06-01
Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.
Vondrusková, Eva; van den Burg, Janny; Zíková, Alena; Ernst, Nancy Lewis; Stuart, Kenneth; Benne, Rob; Lukes, Julius
2005-01-01
Mitochondrial RNA-binding proteins MRP1 and MRP2 occur in a heteromeric complex that appears to play a role in U-insertion/deletion editing in trypanosomes. Reduction in the levels of MRP1 (gBP21) and/or MRP2 (gBP25) mRNA by RNA interference in procyclic Trypanosoma brucei resulted in severe growth
Budworth, J; Gant, T W; Gescher, A
1997-01-01
The aim of this study was to investigate the link between protein kinase C (PKC) and multidrug resistance (mdr) phenotype. The expression of both was studied in doxorubicin-resistant MCF-7/Adr cells as they reverted to the wild-type phenotype when cultured in the absence of drug. The following parameters were measured in cells 4, 10, 15, 20 and 24 weeks after removal of doxorubicin; (1) sensitivity of the cells towards doxorubicin; (2) levels of P-glycoprotein (P-gp) and MDR1 mRNA; (3) levels and cellular localization of PKC isoenzyme proteins alpha, theta and epsilon; and (4) gene copy number of PKC-alpha and MDR1 genes. Cells lost their resistance gradually with time, so that by week 24 they had almost completely regained the drug sensitivity seen in wild-type MCF-7 cells. P-gp levels measured by Western blot mirrored the change in doxorubicin sensitivity. By week 20, P-gp had decreased to 18% of P-gp protein levels at the outset, and P-gp was not detectable at week 24. Similarly, MDR1 mRNA levels had disappeared by week 24. MCF-7/Adr cells expressed more PKCs-alpha and -theta than wild-type cells and possessed a different cellular localization of PKC-epsilon. The expression and distribution pattern of these PKCs did not change for up to 20 weeks, but reverted back to that seen in wild-type cells by week 24. MDR1 gene amplification remained unchanged until week 20, but then was lost precipitously between weeks 20 and 24. The PKC-alpha gene was not amplified in MCF-7/Adr cells. The results suggest that MCF-7/Adr cells lose MDR1 gene expression and PKC activity in a co-ordinate fashion, consistent with the existence of a mechanistic link between MDR1 and certain PKC isoenzymes.
Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt
2017-07-27
In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
David eEscalante-Santiago
2014-10-01
Full Text Available Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1 / ABCB1 and MRP2 / ABCC2 in patients with antiepileptic-drugs resistant epilepsy is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with antiepileptic-drugs resistant epilepsy (ADR and patients with good response to anti-epileptic drugs (CTR in a rigorously selected population. We analyzed 22 samples from drug-resistant patients with epilepsy and 7 samples from patients with good response to anti-epileptic drugs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA and rs2032582 (AT and AG were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT and 66744T>A (TG were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with AED-resistant epilepsy.
Glucose-induced MDR pump resynthesis in respiring yeast cells depends on nutrient level
Czech Academy of Sciences Publication Activity Database
Maláč, J.; Sigler, Karel; Gášková, D.
-, č. 337 (2005), s. 138-141 ISSN 0006-291X R&D Projects: GA ČR GD204/03/H066; GA ČR GP202/04/P110 Grant - others:GA FRVŠ FRVS 555/2005/G3 Institutional research plan: CEZ:AV0Z50200510 Keywords : MDR pumps * yeast * fluorimetric assay Subject RIV: EE - Microbiology, Virology Impact factor: 3.000, year: 2005
Directory of Open Access Journals (Sweden)
Yu-Jen Chen
Full Text Available Multi-drug resistance (MDR, an unfavorable factor compromising treatment efficacy of anticancer drugs, involves upregulated ATP binding cassette (ABC transporters and activated Sonic hedgehog (Shh signaling. By preparing human breast cancer MCF-7 cells resistant to doxorubicin (DOX, we examined the effect and mechanism of norcantharidin (NCTD, a small-molecule synthetic compound, on reversing multidrug resistance. The DOX-prepared MCF-7R cells also possessed resistance to vinorelbine, characteristic of MDR. At suboptimal concentration, NCTD significantly inhibited the viability of DOX-sensitive (MCF-7S and DOX-resistant (MCF-7R cells and reversed the resistance to DOX and vinorelbine. NCTD increased the intracellular accumulation of DOX in MCF-7R cells and suppressed the upregulated the mdr-1 mRNA, P-gp and BCRP protein expression, but not the MRP-1. The role of P-gp was strengthened by partial reversal of the DOX and vinorelbine resistance by cyclosporine A. NCTD treatment suppressed the upregulation of Shh expression and nuclear translocation of Gli-1, a hallmark of Shh signaling activation in the resistant clone. Furthermore, the Shh ligand upregulated the expression of P-gp and attenuated the growth inhibitory effect of NCTD. The knockdown of mdr-1 mRNA had not altered the expression of Shh and Smoothened in both MCF-7S and MCF-7R cells. This indicates that the role of Shh signaling in MDR might be upstream to mdr-1/P-gp, and similar effect was shown in breast cancer MDA-MB-231 and BT-474 cells. This study demonstrated that NCTD may overcome multidrug resistance through inhibiting Shh signaling and expression of its downstream mdr-1/P-gp expression in human breast cancer cells.
Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA.
Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila
2012-07-13
Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.
Isaakidis, Petros; Varghese, Bhanumati; Mansoor, Homa; Cox, Helen S.; Ladomirska, Joanna; Saranchuk, Peter; Da Silva, Esdras; Khan, Samsuddin; Paryani, Roma; Udwadia, Zarir; Migliori, Giovanni Battista; Sotgiu, Giovanni; Reid, Tony
2012-01-01
Background Significant adverse events (AE) have been reported in patients receiving medications for multidrug- and extensively-drug-resistant tuberculosis (MDR-TB & XDR-TB). However, there is little prospective data on AE in MDR- or XDR-TB/HIV co-infected patients on antituberculosis and antiretroviral therapy (ART) in programmatic settings. Methods Médecins Sans Frontières (MSF) is supporting a community-based treatment program for drug-resistant tuberculosis in HIV-infected patients in a slum setting in Mumbai, India since 2007. Patients are being treated for both diseases and the management of AE is done on an outpatient basis whenever possible. Prospective data were analysed to determine the occurrence and nature of AE. Results Between May 2007 and September 2011, 67 HIV/MDR-TB co-infected patients were being treated with anti-TB treatment and ART; 43.3% were female, median age was 35.5 years (Interquartile Range: 30.5–42) and the median duration of anti-TB treatment was 10 months (range 0.5–30). Overall, AE were common in this cohort: 71%, 63% and 40% of patients experienced one or more mild, moderate or severe AE, respectively. However, they were rarely life-threatening or debilitating. AE occurring most frequently included gastrointestinal symptoms (45% of patients), peripheral neuropathy (38%), hypothyroidism (32%), psychiatric symptoms (29%) and hypokalaemia (23%). Eleven patients were hospitalized for AE and one or more suspect drugs had to be permanently discontinued in 27 (40%). No AE led to indefinite suspension of an entire MDR-TB or ART regimen. Conclusions AE occurred frequently in this Mumbai HIV/MDR-TB cohort but not more frequently than in non-HIV patients on similar anti-TB treatment. Most AE can be successfully managed on an outpatient basis through a community-based treatment program, even in a resource-limited setting. Concerns about severe AE in the management of co-infected patients are justified, however, they should not cause delays
Semen Bacterial Concentrations and HIV-1 RNA Shedding Among HIV-1-Seropositive Kenyan Men.
Korhonen, Christine J; Srinivasan, Sujatha; Huang, Dandi; Ko, Daisy L; Sanders, Eduard J; Peshu, Norbert M; Krieger, John N; Muller, Charles H; Coombs, Robert W; Fredricks, David N; Graham, Susan M
2017-03-01
HIV-1 is transmitted through semen from men to their sexual partners. Genital infections can increase HIV-1 RNA shedding in semen, but shedding also occurs in the absence of typical pathogens. We hypothesized that higher bacterial concentrations in semen would be associated with higher HIV-1 RNA levels. We analyzed semen samples from 42 HIV-1-seropositive Kenyan men using quantitative polymerase chain reaction (PCR) to assess bacterial concentrations and real-time PCR to measure HIV-1 RNA levels. Generalized estimation equations were used to evaluate associations between these 2 measures. Broad-range 16S rRNA gene PCR with pyrosequencing was performed on a subset of 13 samples to assess bacterial community composition. Bacteria were detected in 96.6% of 88 samples by quantitative PCR. Semen bacterial concentration and HIV-1 RNA levels were correlated 0.30 (P = 0.01). The association between bacterial concentration and HIV-1 RNA detection was not significant after adjustment for antiretroviral therapy (ART) (adjusted odds ratio: 1.27, 95% CI: 0.84 to 1.91). Factors associated with semen bacterial concentration included insertive anal sex (adjusted beta 0.92, 95% CI: 0.12 to 1.73) and ART use (adjusted beta: -0.77, 95% CI: -1.50 to 0.04). Among 13 samples with pyrosequencing data, Corynebacterium spp., Staphylococcus spp., and Streptococcus spp. were most frequently detected. Most of these HIV-1-infected men had bacteria in their semen. ART use was associated with undetectable semen HIV-1 RNA and lower semen bacterial concentrations, whereas insertive anal sex was associated with higher bacterial concentrations. Additional studies evaluating the relationship between semen bacteria, inflammation, mucosal immunity, and HIV-1 shedding are needed to understand implications for HIV-1 transmission.
International Nuclear Information System (INIS)
Hennig, Janosch; Wang, Iren; Sonntag, Miriam; Gabel, Frank; Sattler, Michael
2013-01-01
Many processes in the regulation of gene expression and signaling involve the formation of protein complexes involving multi-domain proteins. Individual domains that mediate protein-protein and protein-nucleic acid interactions are typically connected by flexible linkers, which contribute to conformational dynamics and enable the formation of complexes with distinct binding partners. Solution techniques are therefore required for structural analysis and to characterize potential conformational dynamics. Nuclear magnetic resonance spectroscopy (NMR) provides such information but often only sparse data are obtained with increasing molecular weight of the complexes. It is therefore beneficial to combine NMR data with additional structural restraints from complementary solution techniques. Small angle X-ray/neutron scattering (SAXS/SANS) data can be efficiently combined with NMR-derived information, either for validation or by providing additional restraints for structural analysis. Here, we show that the combination of SAXS and SANS data can help to refine structural models obtained from data-driven docking using HADDOCK based on sparse NMR data. The approach is demonstrated with the ternary protein-protein-RNA complex involving two RNA recognition motif (RRM) domains of Sex-lethal, the N-terminal cold shock domain of Upstream-to-N-Ras, and msl-2 mRNA. Based on chemical shift perturbations we have mapped protein-protein and protein-RNA interfaces and complemented this NMR-derived information with SAXS data, as well as SANS measurements on subunit-selectively deuterated samples of the ternary complex. Our results show that, while the use of SAXS data is beneficial, the additional combination with contrast variation in SANS data resolves remaining ambiguities and improves the docking based on chemical shift perturbations of the ternary protein-RNA complex.
Energy Technology Data Exchange (ETDEWEB)
Hennig, Janosch; Wang, Iren; Sonntag, Miriam [Institute of Structural Biology, Helmholtz Zentrum Muenchen (Germany); Gabel, Frank [Extremophiles and Large Molecular Assemblies Group (ELMA), Institut de Biologie Structurale (IBS) CEA-CNRS-UJF (France); Sattler, Michael, E-mail: sattler@helmholtz-muenchen.de [Institute of Structural Biology, Helmholtz Zentrum Muenchen (Germany)
2013-05-15
Many processes in the regulation of gene expression and signaling involve the formation of protein complexes involving multi-domain proteins. Individual domains that mediate protein-protein and protein-nucleic acid interactions are typically connected by flexible linkers, which contribute to conformational dynamics and enable the formation of complexes with distinct binding partners. Solution techniques are therefore required for structural analysis and to characterize potential conformational dynamics. Nuclear magnetic resonance spectroscopy (NMR) provides such information but often only sparse data are obtained with increasing molecular weight of the complexes. It is therefore beneficial to combine NMR data with additional structural restraints from complementary solution techniques. Small angle X-ray/neutron scattering (SAXS/SANS) data can be efficiently combined with NMR-derived information, either for validation or by providing additional restraints for structural analysis. Here, we show that the combination of SAXS and SANS data can help to refine structural models obtained from data-driven docking using HADDOCK based on sparse NMR data. The approach is demonstrated with the ternary protein-protein-RNA complex involving two RNA recognition motif (RRM) domains of Sex-lethal, the N-terminal cold shock domain of Upstream-to-N-Ras, and msl-2 mRNA. Based on chemical shift perturbations we have mapped protein-protein and protein-RNA interfaces and complemented this NMR-derived information with SAXS data, as well as SANS measurements on subunit-selectively deuterated samples of the ternary complex. Our results show that, while the use of SAXS data is beneficial, the additional combination with contrast variation in SANS data resolves remaining ambiguities and improves the docking based on chemical shift perturbations of the ternary protein-RNA complex.
Directory of Open Access Journals (Sweden)
Tomoaki Takai
2017-01-01
Full Text Available Bladder cancer is one of the most difficult malignancies to control. We explored the use of a novel RNA-interference method for a driver oncogene regulating cancer specific energy metabolism by the combination treatment with a small interfering RNA (siRNA and a microRNA. After transfection of T24 and 253JB-V cells with miR-145 and/or siR-PTBP1, we examined the effects of cell growth and gene expression by performing the trypan blue dye exclusion test, Western blot, Hoechst 33342 staining, reverse transcription polymerase chain reaction (RT-PCR, and electron microscopy. The anti-cancer effects of xenograft model mice with miR-145 and/or siR-PTBP1 were then assessed. The combination treatment induced the deeper and longer growth inhibition and reduced the levels of both mRNA and protein expression of c-Myc and polypyrimidine tract-binding protein 1 (PTBP1 more than each single treatment. Notably, the combination treatment not only impaired the cancer specific energy metabolism by inhibiting c-Myc/PTBP1/PKMs axis but also inactivated MAPK/ERK and PI3K/AKT pathways examined in vitro and in vivo. Furthermore, the combination treatment induced apoptosis or autophagy; but, in some cells, apoptotic cell death was accompanied by autophagy, because the condensation of chromatin and many autophagosomes were coexistent. This combination treatment could be a novel RNA-interference strategy through the systemic silencing of the Warburg effect-promoting driver oncogene PTBP1 in bladder cancer cells.
Directory of Open Access Journals (Sweden)
Gene-Errol E Ringpis
Full Text Available Down-regulation of the HIV-1 coreceptor CCR5 holds significant potential for long-term protection against HIV-1 in patients. Using the humanized bone marrow/liver/thymus (hu-BLT mouse model which allows investigation of human hematopoietic stem/progenitor cell (HSPC transplant and immune system reconstitution as well as HIV-1 infection, we previously demonstrated stable inhibition of CCR5 expression in systemic lymphoid tissues via transplantation of HSPCs genetically modified by lentiviral vector transduction to express short hairpin RNA (shRNA. However, CCR5 down-regulation will not be effective against existing CXCR4-tropic HIV-1 and emergence of resistant viral strains. As such, combination approaches targeting additional steps in the virus lifecycle are required. We screened a panel of previously published shRNAs targeting highly conserved regions and identified a potent shRNA targeting the R-region of the HIV-1 long terminal repeat (LTR. Here, we report that human CD4(+ T-cells derived from transplanted HSPC engineered to co-express shRNAs targeting CCR5 and HIV-1 LTR are resistant to CCR5- and CXCR4- tropic HIV-1-mediated depletion in vivo. Transduction with the combination vector suppressed CXCR4- and CCR5- tropic viral replication in cell lines and peripheral blood mononuclear cells in vitro. No obvious cytotoxicity or interferon response was observed. Transplantation of combination vector-transduced HSPC into hu-BLT mice resulted in efficient engraftment and subsequent stable gene marking and CCR5 down-regulation in human CD4(+ T-cells within peripheral blood and systemic lymphoid tissues, including gut-associated lymphoid tissue, a major site of robust viral replication, for over twelve weeks. CXCR4- and CCR5- tropic HIV-1 infection was effectively inhibited in hu-BLT mouse spleen-derived human CD4(+ T-cells ex vivo. Furthermore, levels of gene-marked CD4(+ T-cells in peripheral blood increased despite systemic infection with either
MDV-1 variant of Qβ RNA. Final report
International Nuclear Information System (INIS)
Gordon, M.P.
1981-01-01
MDV-1 is a variant of Qβ RNA which consists of complementary plus (+) and minus (-) strands. The sequences of these strands are well established. MDV-1 is an active template in replication reactions. High-resolution polyacrylamide gel electrophoresis was used to locate sites of replication inhibition in the molecule induced by irradiation of (+) and (-) MDV-1 RNA templates with 254 nanometer (uv) light at a dose of 2500 Jm -2 . Presumably, this inhibition was caused by uridine hydrates and pyrimidine cyclobutane dimers. Each of the ten inhibition sites identified corresponds to regions in the template which contain two or more pyrimidines. Dose-response studies showed that the uv-induced inactivation of the template activity of MDV-1 RNA closely paralleled the formation of uridine hydrates when replication occurred at 12 0 C. At higher temperatures, the template activity of MDV-1 appeared to be less sensitive to uv light. Since pre-incubation of irradiated MDV-1 at 37 0 for 35 min did not affect replication inhibition at 12 0 C, inhibition of replication at 37 0 C does not appear to be due to dehydration of uridine hydrate at the higher temperature. Pauses in nucleic acid synthesis, attributed to kinetic modulators, were observed in a number of systems and were proposed to play a role in the regulation of nucleic acid synthesis. The results reported here suggest that some photolesions might mimic such modulators. The replication of (+) MDV-1 RNA was also inhibited at specific sites by kethoxal, semicarbazide, and methoxyamine. These sites were near some of the sites at which uv-induced replication inhibition occurred. These results suggested that some regions of the (+) MDV-1 molecule are structurally exposed to modification by uv and base-specific chemicals, and were consistent with some features of a computer-generated model of the secondary structure of (+) MDV-1 RNA
Directory of Open Access Journals (Sweden)
Keijiro Mizukami
2013-01-01
Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.
Directory of Open Access Journals (Sweden)
A R. Hadizadeh Tasbiti
2015-01-01
Conclusion: Such information could be helpful for the development of newer therapeutic agents or of diagnostic markers for better treatment or diagnosis of TB. This study extends the list of the potential determinants of differences in virulence between the two isolates (MDR and susceptible TB and adds to the current understanding of MTB pathogenesis.
Wang, Yi-Jun; Zhang, Yun-Kai; Zhang, Guan-Nan; Al Rihani, Sweilem B; Wei, Meng-Ning; Gupta, Pranav; Zhang, Xiao-Yu; Shukla, Suneet; Ambudkar, Suresh V; Kaddoumi, Amal; Shi, Zhi; Chen, Zhe-Sheng
2017-06-28
Chemotherapeutic multidrug resistance (MDR) is a significant challenge to overcome in clinic practice. Several mechanisms contribute to MDR, one of which is the augmented drug efflux induced by the upregulation of ABCB1 in cancer cells. Regorafenib, a multikinase inhibitor targeting the RAS/RAF/MEK/ERK pathway, was approved by the FDA to treat metastatic colorectal cancer and gastrointestinal stromal tumors. We investigated whether and how regorafenib overcame MDR mediated by ABCB1. The results showed that regorafenib reversed the ABCB1-mediated MDR and increased the accumulation of [ 3 H]-paclitaxel in ABCB1-overexpressing cells by suppressing efflux activity of ABCB1, but not altering expression level and localization of ABCB1. Regorafenib inhibited ATPase activity of ABCB1. In mice bearing resistant colorectal tumors, regorafenib raised the intratumoral concentration of paclitaxel and suppressed the growth of resistant colorectal tumors. But regorafenib did not induce cardiotoxicity/myelosuppression of paclitaxel in mice. Strategy to reposition one FDA-approved anticancer drug regorafenib to overcome the resistance of another FDA-approved, widely used chemotherapeutic paclitaxel, may be a promising direction for the field of adjuvant chemotherapy. This study provides clinical rationale for combination of conventional chemotherapy and targeted anticancer agents. Copyright © 2017 Elsevier B.V. All rights reserved.
Effect of moxifloxacin on oxidative stress, paraoxonase-1 (PON1 ...
African Journals Online (AJOL)
Purpose: To investigate the effect of moxifloxacin on paraoxonase-1 (PON1) activity, and serum oxidative stress in patients with multiple drug-resistant tuberculosis (MDR-TB). Methods: A total ofof 130 MDR-TB patients who were treated with moxifloxacin from October 2014 to October 2010 in Eastern Medical District of Linyi ...
Directory of Open Access Journals (Sweden)
Thibaut Josse
2007-09-01
Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.
Reduction of bilirubin by targeting human heme oxygenase-1 through siRNA.
Xia, Zhen-Wei; Li, Chun-E; Jin, You-Xin; Shi, Yi; Xu, Li-Qing; Zhong, Wen-Wei; Li, Yun-Zhu; Yu, Shan-Chang; Zhang, Zi-Li
2007-04-01
Neonatal hyperbilirubinemia is a common clinical condition caused mainly by the increased production and decreased excretion of bilirubin. Current treatment is aimed at reducing the serum levels of bilirubin. Heme oxygenase-1 (HO-1) is a rate-limiting enzyme that generates bilirubin. In this study we intended to suppress HO-1 using the RNA interference technique. Small interfering RNA (siRNA)-A, -B, and -C were designed based on human HO-1 (hHO-1) mRNA sequences. siRNA was transfected into a human hepatic cell line (HL-7702). hHO-1 transcription and protein levels were then determined. In addition, the inhibitory effect of siRNA on hHO-1 was assessed in cells treated with hemin or transfected with an hHO-1 plasmid. siRNA-C showed the most potent suppressive effect on hHO-1. This inhibition is dose and time dependent. Compared with control, both hemin and hHO-1 plasmids up-regulated hHO-1 expression in HL-7702 cells. However, the up-regulation was significantly attenuated by siRNA-C. Furthermore, the decrease in hHO-1 activity was coincident with the suppression of its transcription. Finally, siRNA-C was shown to reduce hHO-1 enzymatic activity and bilirubin levels. Thus, this study provides a novel therapeutic rationale by blocking bilirubin formation via siRNA for preventing and treating neonatal hyperbilirubinemia and bilirubin encephalopathy at an early clinical stage.
Chen, Zihao; Ju, Hongping; Yu, Shan; Zhao, Ting; Jing, Xiaojie; Li, Ping; Jia, Jing; Li, Nan; Tan, Bibo; Li, Yong
2018-03-13
Gastric cancer (GC) is one of a major global health problem especially in Asia. Nowadays, long non-coding RNA has gained significantly attention in the current research climate such as carcinogenesis. This research desired to explore the mechanism of Prader-Willi region non-protein coding RNA 1 (PWRN1) on regulating GC process. Differentially expressed lncRNAs in GC tissues were screened out through microarray analysis. The RNA and protein expression level was detected by qRT-PCR and western blot. Cell proliferation, apoptosis rate, metastasis abilities were respectively determined by CCK8, flow cytometry, wound healing and transwell assay. The luciferase reporter system was used to verify the targeting relationships between PWRN1, miR-425-5p and PTEN RIP assay was performed to prove whether PWRN1 acted as a competitive endogenous RNA (ceRNA) of miR-425-5p. Tumor xenograft model and immunohistochemistry were developed to study the influence of PWRN1 on tumor growth in vivo Microarray analysis determined that PWRN1 was different expressed between GC tissues and adjacent tissues. QRT-PCR revealed PWRN1 low expression in GC tissues and cells. PWRN1 up-regulated could reduce proliferation and metastasis and increased apoptosis in GC cells, while miR-425-5p had reverse effects. The RIP assay indicated that PWRN1 may target an oncogene miR-425-5p. The tumor xenograft assay found that up-regulated PWRN1 suppressed the tumor growth. The bioinformatic analysis, luciferase assay and western blot indicated that PWRN1 affected PTEN/Akt/MDM2/p53 axis via suppressing miR-425-5p. Our findings suggested that PWRN1 functioned as a ceRNA targeting to miR-425-5p and suppressed GC development via p53 signaling pathway. ©2018 The Author(s).
New preclinical antimalarial drugs potently inhibit hepatitis C virus genotype 1b RNA replication.
Directory of Open Access Journals (Sweden)
Youki Ueda
Full Text Available BACKGROUND: Persistent hepatitis C virus (HCV infection causes chronic liver diseases and is a global health problem. Although new triple therapy (pegylated-interferon, ribavirin, and telaprevir/boceprevir has recently been started and is expected to achieve a sustained virologic response of more than 70% in HCV genotype 1 patients, there are several problems to be resolved, including skin rash/ageusia and advanced anemia. Thus a new type of anti-HCV drug is still needed. METHODOLOGY/PRINCIPAL FINDINGS: Recently developed HCV drug assay systems using HCV-RNA-replicating cells (e.g., HuH-7-derived OR6 and Li23-derived ORL8 were used to evaluate the anti-HCV activity of drug candidates. During the course of the evaluation of anti-HCV candidates, we unexpectedly found that two preclinical antimalarial drugs (N-89 and its derivative N-251 showed potent anti-HCV activities at tens of nanomolar concentrations irrespective of the cell lines and HCV strains of genotype 1b. We confirmed that replication of authentic HCV-RNA was inhibited by these drugs. Interestingly, however, this anti-HCV activity did not work for JFH-1 strain of genotype 2a. We demonstrated that HCV-RNA-replicating cells were cured by treatment with only N-89. A comparative time course assay using N-89 and interferon-α demonstrated that N-89-treated ORL8 cells had more rapid anti-HCV kinetics than did interferon-α-treated cells. This anti-HCV activity was largely canceled by vitamin E. In combination with interferon-α and/or ribavirin, N-89 or N-251 exhibited a synergistic inhibitory effect. CONCLUSIONS/SIGNIFICANCE: We found that the preclinical antimalarial drugs N-89 and N-251 exhibited very fast and potent anti-HCV activities using cell-based HCV-RNA-replication assay systems. N-89 and N-251 may be useful as a new type of anti-HCV reagents when used singly or in combination with interferon and/or ribavirin.
1.Evaluation of the quality of fixed dose combination anti ...
African Journals Online (AJOL)
46987.2
serious implications on treatment outcomes for TB hence the moderately high rate of multi drug resistance (MDR) cases that were recorded in the. 9 country. Another study was done in Botswana in 1999 that involved quantitative analysis of 13 FDC anti TB samples and the results obtained showed that 31%. (4/13) of the ...
LR1: a candidate RNA virus of Leishmania.
Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K
1988-01-01
Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...
Directory of Open Access Journals (Sweden)
Vadim Shchepachev
2012-10-01
Full Text Available Clericuzio-type poikiloderma with neutropenia (PN is a rare genodermatosis associated with mutations in the C16orf57 gene, which codes for the uncharacterized protein hMpn1. We show here that, in both fission yeasts and humans, Mpn1 processes the spliceosomal U6 small nuclear RNA (snRNA posttranscriptionally. In Mpn1-deficient cells, U6 molecules carry 3′ end polyuridine tails that are longer than those in normal cells and lack a terminal 2′,3′ cyclic phosphate group. In mpn1Δ yeast cells, U6 snRNA and U4/U6 di-small nuclear RNA protein complex levels are diminished, leading to precursor messenger RNA splicing defects, which are reverted by expression of either yeast or human Mpn1 and by overexpression of U6. Recombinant hMpn1 is a 3′-to-5′ RNA exonuclease that removes uridines from U6 3′ ends, generating terminal 2′,3′ cyclic phosphates in vitro. Finally, U6 degradation rates increase in mpn1Δ yeasts and in lymphoblasts established from individuals affected by PN. Our data indicate that Mpn1 promotes U6 stability through 3′ end posttranscriptional processing and implicate altered U6 metabolism as a potential mechanism for PN pathogenesis.
Duan, Li-Jun; Ding, Min; Hou, Li-Jun; Cui, Yuan-Tao; Li, Chun-Jun; Yu, De-Min
2017-03-11
Long noncoding RNA taurine-upregulated gene 1 (lncRNA TUG1) has been reported to play a key role in the progression of diabetic nephropathy (DN). However, the role of lncRNA TUG1 in the regulation of diabetic nephropathy remains largely unknown. The aim of the present study is to identify the regulation of lncRNA TUG1 on extracellular matrix accumulation via mediating microRNA-377 targeting of PPARγ, and investigate the underlying mechanisms in progression of DN. Microarray was performed to screen differentially expressed miRNAs in db/db DN mice. Afterwards, computational prediction programs (TargetScan, miRanda, PicTar and miRGen) was applied to predict the target gene of miRNAs. The complementary binding of miRNA and lncRNA was assessed by luciferase assays. Protein and mRNA expression were detected by western blot and real time quantitate PCR. MiRNA-377 was screened by miRNA microarray and differentially up-regulated in db/db DN mice. PPARγ was predicted to be the target of miR-377 and the prediction was verified by luciferase assays. Expression of miR-377 was up-regulated in mesangial cell treated with high glucose (25 mM), and overexpression of miR-377 inhibited PPARγ expression and promoted PAI-1 and TGF-β1 expression. The expression of TUG1 antagonized the effect of miR-377 on the downregulation of its target PPARγ and inhibited extracellular matrix accumulation, including PAI-1, TGF-β1, fibronectin (FN) and collagen IV (Col IV), induced by high glucose. LncRNA TUG1 acts as an endogenous sponge of miR-377 and downregulates miR-377 expression levels, and thereby relieving the inhibition of its target gene PPARγ and alleviates extracellular matrix accumulation of mesangial cells, which provides a novel insight of diabetic nephropathy pathogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Dynamics of HIV-1 RNA Near the Plasma Membrane during Virus Assembly.
Sardo, Luca; Hatch, Steven C; Chen, Jianbo; Nikolaitchik, Olga; Burdick, Ryan C; Chen, De; Westlake, Christopher J; Lockett, Stephen; Pathak, Vinay K; Hu, Wei-Shau
2015-11-01
To increase our understanding of the events that lead to HIV-1 genome packaging, we examined the dynamics of viral RNA and Gag-RNA interactions near the plasma membrane by using total internal reflection fluorescence microscopy. We labeled HIV-1 RNA with a photoconvertible Eos protein via an RNA-binding protein that recognizes stem-loop sequences engineered into the viral genome. Near-UV light exposure causes an irreversible structural change in Eos and alters its emitted fluorescence from green to red. We studied the dynamics of HIV-1 RNA by photoconverting Eos near the plasma membrane, and we monitored the population of photoconverted red-Eos-labeled RNA signals over time. We found that in the absence of Gag, most of the HIV-1 RNAs stayed near the plasma membrane transiently, for a few minutes. The presence of Gag significantly increased the time that RNAs stayed near the plasma membrane: most of the RNAs were still detected after 30 min. We then quantified the proportion of HIV-1 RNAs near the plasma membrane that were packaged into assembling viral complexes. By tagging Gag with blue fluorescent protein, we observed that only a portion, ∼13 to 34%, of the HIV-1 RNAs that reached the membrane were recruited into assembling particles in an hour, and the frequency of HIV-1 RNA packaging varied with the Gag expression level. Our studies reveal the HIV-1 RNA dynamics on the plasma membrane and the efficiency of RNA recruitment and provide insights into the events leading to the generation of infectious HIV-1 virions. Nascent HIV-1 particles assemble on plasma membranes. During the assembly process, HIV-1 RNA genomes must be encapsidated into viral complexes to generate infectious particles. To gain insights into the RNA packaging and virus assembly mechanisms, we labeled and monitored the HIV-1 RNA signals near the plasma membrane. Our results showed that most of the HIV-1 RNAs stayed near the plasma membrane for only a few minutes in the absence of Gag, whereas
International Nuclear Information System (INIS)
Nielsen, Dorte; Maare, Christian; Eriksen, Jens; Litman, Thomas; Skovsgaard, Torben
2001-01-01
Purpose: To characterize irradiated murine tumor cells with respect to drug resistance, drug kinetics, and ATPase activity, and to evaluate the possible role of P-glycoprotein (PGP) and murine multidrug resistance associated protein (Mrp1) in the drug-resistant phenotype of these cells. Methods and Materials: Sensitive Ehrlich ascites tumor cells (EHR2) were in vitro exposed to fractionated irradiation (60 Gy). Western blot analysis was performed for determination of PGP and Mrp1, reverse transcriptase-polymerase chain reaction (RT-PCR) for determination of mdr1a + b mRNA, and semiquantitative RT-PCR for Mrp1 mRNA. The clonogenic assay was applied to investigate sensitivity, whereas the steady-state drug accumulation of daunorubicin (DNR), 3 H-vincristine (VCR), and 3 H-etoposide (VP16) was measured by spectrofluorometry and scintillation counting, respectively. For determining of ATPase activity, the release of inorganic phosphate from ATP was quantified using a colorimetric method. Results: Compared with EHR2, the irradiated cell line EHR2/irr showed increased expression of PGP (threefold), Mrp1 (eightfold), and Mrp1 mRNA (sixfold), and a slight reduction of mdr1b mRNA, whereas mdr1a was present in EHR2 but could not be detected in EHR2/irr. EHR2/irr developed sixfold resistance to VP16, twofold resistance to vincristine, but remained sensitive to DNR. Addition of the PGP inhibitor, verapamil (VER) or depletion of glutathione by buthionine sulfoximine (BSO) partly reversed the resistance in EHR2/irr. In EHR2/irr, the steady-state accumulation of 3 H-VCR and 3 H-VP16 was significantly decreased as compared with EHR2, whereas the accumulation of DNR was unchanged. The ATPase activity of plasma membrane vesicles prepared from EHR2/irr cells was similar to that of wild-type EHR2 cells. The ATPase activity was neither stimulated by vinblastine nor VER. Conclusion: Irradiation induced a multidrug-resistant phenotype in sensitive tumor cells. This phenotype was
Complete sequence of RNA1 of grapevine Anatolian ringspot virus.
Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic
2012-10-01
The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.
Reversal of cisplatin resistance in non-small cell lung cancer stem cells by Taxus chinensis var.
Jiang, Y Q; Xu, X P; Guo, Q M; Xu, X C; Liu, Q Y; An, S H; Xu, J L; Su, F; Tai, J B
2016-09-02
Drug resistance in cells is a major impedance to successful treatment of lung cancer. Taxus chinensis var. inhibits the growth of tumor cells and promotes the synthesis of interleukins 1 and 2 and tumor necrosis factor, enhancing immune function. In this study, T. chinensis var.-induced cell death was analyzed in lung cancer cells (H460) enriched for stem cell growth in a defined serum-free medium. Taxus-treated stem cells were also analyzed for Rhodamine 123 (Rh-123) expression by flow cytometry, and used as a standard functional indicator of MDR. The molecular basis of T. chinensis var.-mediated drug resistance was established by real-time PCR analysis of ABCC1, ABCB1, and lung resistance-related protein (LRP) mRNA, and western blot analysis of MRP1, MDR1, and LRP. Our results revealed that stem cells treated with higher doses of T. chinensis var. showed significantly lower growth inhibition rates than did H460 cells (P var. and cisplatin was also significantly inhibited (P var. (P var.-treated stem cells showed significant downregulation of the ABCC1, ABCB1, and LRP mRNA and MRP1, MDR1, and LRP (P var.-mediated downregulation of MRP1, MDR1, and LRP might contribute to the reversal of drug resistance in non-small cell lung cancer stem cells.
Endoplasmic reticulum stress increases AT1R mRNA expression via TIA-1-dependent mechanism.
Backlund, Michael; Paukku, Kirsi; Kontula, Kimmo K; Lehtonen, Jukka Y A
2016-04-20
As the formation of ribonucleoprotein complexes is a major mechanism of angiotensin II type 1 receptor (AT1R) regulation, we sought to identify novel AT1R mRNA binding proteins. By affinity purification and mass spectroscopy, we identified TIA-1. This interaction was confirmed by colocalization of AT1R mRNA and TIA-1 by FISH and immunofluorescence microscopy. In immunoprecipitates of endogenous TIA- 1, reverse transcription-PCR amplified AT1R mRNA. TIA-1 has two binding sites within AT1R 3'-UTR. The binding site proximal to the coding region is glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-dependent whereas the distal binding site is not. TIA-1 functions as a part of endoplasmic reticulum (ER) stress response leading to stress granule (SG) formation and translational silencing. We and others have shown that AT1R expression is increased by ER stress-inducing factors. In unstressed cells, TIA-1 binds to AT1R mRNA and decreases AT1R protein expression. Fluorescence microscopy shows that ER stress induced by thapsigargin leads to the transfer of TIA-1 to SGs. In FISH analysis AT1R mRNA remains in the cytoplasm and no longer colocalizes with TIA-1. Thus, release of TIA-1-mediated suppression by ER stress increases AT1R protein expression. In conclusion, AT1R mRNA is regulated by TIA-1 in a ER stress-dependent manner. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
TruSeq Stranded mRNA and Total RNA Sample Preparation Kits
Total RNA-Seq enabled by ribosomal RNA (rRNA) reduction is compatible with formalin-fixed paraffin embedded (FFPE) samples, which contain potentially critical biological information. The family of TruSeq Stranded Total RNA sample preparation kits provides a unique combination of unmatched data quality for both mRNA and whole-transcriptome analyses, robust interrogation of both standard and low-quality samples and workflows compatible with a wide range of study designs.
Directory of Open Access Journals (Sweden)
Chen Tingfu
2010-07-01
Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR
Interactions Between HIV-1 Gag and Viral RNA Genome Enhance Virion Assembly
DEFF Research Database (Denmark)
Dilley, Kari A; Nikolaitchik, Olga A; Galli, Andrea
2017-01-01
between Gag and viral RNA are required for the enhancement of particle production. Taken together, these studies are consistent with our previous hypothesis that specific dimeric viral RNA:Gag interactions are the nucleation event of infectious virion assembly, ensuring that one RNA dimer is packaged......Most HIV-1 virions contain two copies of full-length viral RNA, indicating that genome packaging is efficient and tightly regulated. However, the structural protein Gag is the only component required for the assembly of noninfectious virus-like particles and the viral RNA is dispensable...... in this process. The mechanism that allows HIV-1 to achieve such high efficiency of genome packaging when a packageable viral RNA is not required for virus assembly is currently unknown. In this report, we examined the role of HIV-1 RNA in virus assembly and found that packageable HIV-1 RNA enhances particle...
Directory of Open Access Journals (Sweden)
Dong Xi
Full Text Available Hepatitis B virus (HBV-related acute-on-chronic liver failure (ACLF has a poor prognosis with high in-hospital mortality. Hepatic and circulating inflammatory cytokines, such as fibrinogen like protein 2 (fgl2, FasL/Fas, and TNFα/TNFR1, play a significant role in the pathophysiology of ACLF. This study aimed to investigate the therapeutic effect of recombinant adenoviral vectors carrying constructed DNA code for non-native microRNA (miRNA targeting mouse fgl2 (mfgl2 or both mFas and mTNFR1 on murine hepatitis virus (MHV-3-induced fulminant hepatitis in BALB/cJ mice. Artificial miRNA eukaryotic expression plasmids against mfgl2, mFas, and mTNFR1 were constructed, and their inhibitory effects on the target genes were confirmed in vitro. pcDNA6.2-mFas-mTNFR1- miRNA,which expresses miRNA against both mFas and mTNFR1 simultaneously,was constructed. To construct a miRNA adenovirus expression vector against mfgl2, pcDNA6.2-mfgl2-miRNA was cloned using Gateway technology. Ad-mFas-mTNFR1- miRNA was also constructed by the same procedure. Adenovirus vectors were delivered by tail-vein injection into MHV-3-infected BALB/cJ mice to evaluate the therapeutic effect. 8 of 18 (44.4% mice recovered from fulminant viral hepatitis in the combined interference group treated with Ad-mfgl2-miRNA and Ad-mFas-mTNFR1-miRNA. But only 4 of 18 (22.2% mice receiving Ad-mfgl2-miRNA and 3 of 18 (16.7% mice receiving Ad-mFas-mTNFR1- miRNA survived. These adenovirus vectors significantly ameliorated inflammatory infiltration, fibrin deposition, hepatocyte necrosis and apoptosis, and prolonged survival time. Our data illustrated that combined interference using adenovirus-mediated artificial miRNAs targeting mfgl2, mFas, and mTNFR1 might have significant therapeutic potential for the treatment of fulminant hepatitis.
Semen Bacterial Concentrations and HIV-1 RNA Shedding Among HIV-1–Seropositive Kenyan Men
Srinivasan, Sujatha; Huang, Dandi; Ko, Daisy L.; Sanders, Eduard J.; Peshu, Norbert M.; Krieger, John N.; Muller, Charles H.; Coombs, Robert W.; Fredricks, David N.; Graham, Susan M.
2017-01-01
Introduction: HIV-1 is transmitted through semen from men to their sexual partners. Genital infections can increase HIV-1 RNA shedding in semen, but shedding also occurs in the absence of typical pathogens. We hypothesized that higher bacterial concentrations in semen would be associated with higher HIV-1 RNA levels. Methods: We analyzed semen samples from 42 HIV-1–seropositive Kenyan men using quantitative polymerase chain reaction (PCR) to assess bacterial concentrations and real-time PCR to measure HIV-1 RNA levels. Generalized estimation equations were used to evaluate associations between these 2 measures. Broad-range 16S rRNA gene PCR with pyrosequencing was performed on a subset of 13 samples to assess bacterial community composition. Results: Bacteria were detected in 96.6% of 88 samples by quantitative PCR. Semen bacterial concentration and HIV-1 RNA levels were correlated 0.30 (P = 0.01). The association between bacterial concentration and HIV-1 RNA detection was not significant after adjustment for antiretroviral therapy (ART) (adjusted odds ratio: 1.27, 95% CI: 0.84 to 1.91). Factors associated with semen bacterial concentration included insertive anal sex (adjusted beta 0.92, 95% CI: 0.12 to 1.73) and ART use (adjusted beta: −0.77, 95% CI: −1.50 to 0.04). Among 13 samples with pyrosequencing data, Corynebacterium spp., Staphylococcus spp., and Streptococcus spp. were most frequently detected. Conclusion: Most of these HIV-1–infected men had bacteria in their semen. ART use was associated with undetectable semen HIV-1 RNA and lower semen bacterial concentrations, whereas insertive anal sex was associated with higher bacterial concentrations. Additional studies evaluating the relationship between semen bacteria, inflammation, mucosal immunity, and HIV-1 shedding are needed to understand implications for HIV-1 transmission. PMID:27861240
Pu, Wenchen; Li, Jiao; Zheng, Yuanyuan; Shen, Xianyan; Fan, Xin; Zhou, Jian-Kang; He, Juan; Deng, Yulan; Liu, Xuesha; Wang, Chun; Yang, Shengyong; Chen, Qiang; Liu, Lunxu; Zhang, Guolin; Wei, Yu-Quan; Peng, Yong
2018-01-30
Hepatocellular carcinoma (HCC) is a leading cause of cancer death worldwide, but there are few effective treatments. Aberrant microRNA (miRNA) biogenesis is correlated with HCC development. We previously demonstrated that peptidyl-prolyl cis-trans isomerase NIMA-interacting 1 (Pin1) participates in miRNA biogenesis and is a potential HCC treatment target. However, how Pin1 modulates miRNA biogenesis remains obscure. Here, we present in vivo evidence that Pin1 overexpression is directly linked to the development of HCC. Administration with the Pin1 inhibitor (API-1), a specific small molecule targeting Pin1 peptidyl-prolyl isomerase domain and inhibiting Pin1 cis-trans isomerizing activity, suppresses in vitro cell proliferation and migration of HCC cells. But API-1-induced Pin1 inhibition is insensitive to HCC cells with low Pin1 expression and/or low exportin-5 (XPO5) phosphorylation. Mechanistically, Pin1 recognizes and isomerizes the phosphorylated serine-proline motif of phosphorylated XPO5 and passivates phosphorylated XPO5. Pin1 inhibition by API-1 maintains the active conformation of phosphorylated XPO5 and restores XPO5-driven precursor miRNA nuclear-to-cytoplasm export, activating anticancer miRNA biogenesis and leading to both in vitro HCC suppression and HCC suppression in xenograft mice. Experimental evidence suggests that Pin1 inhibition by API-1 up-regulates miRNA biogenesis by retaining active XPO5 conformation and suppresses HCC development, revealing the mechanism of Pin1-mediated miRNA biogenesis and unequivocally supporting API-1 as a drug candidate for HCC therapy, especially for Pin1-overexpressing, extracellular signal-regulated kinase-activated HCC. (Hepatology 2018). © 2018 by the American Association for the Study of Liver Diseases.
Chemoresistance of CD133(+) colon cancer may be related with increased survivin expression.
Lee, Mi-Ra; Ji, Sun-Young; Mia-Jan, Khalilullah; Cho, Mee-Yon
2015-07-31
CD133, putative cancer stem cell marker, deemed to aid chemoresistance. However, this claim has been challenged recently and we previously reported that patients with CD133(+) colon cancer have benefit from 5-fluorouracil (5-FU) chemotherapy incontrast to no benefit in patients with CD133(-) cancer. To elucidate the role of CD133 expression in chemoresistance, we silenced the CD133 expression in a colon cancer cell line and determined its effect on the biological characteristics downstream. We comparatively analyzed the sequential changes of MDR1, ABCG2, AKT1 and survivin expression and the result of proliferation assay (WST-1 assay) with 5-FU treatment in CD133(+) and siRNA-induced CD133(-) cells, derived from Caco-2 colon cancer cell line. 5-FU treatment induced significantly increase of the mRNA expression of MDR1, ABCG2 and AKT1genes, but not protein level. CD133 had little to no effect on the mRNA and protein expression of these genes. However, survivin expression at mRNA and protein level were significantly increased in CD133(+) cells compared with siRNA-induced CD133-cells and Mock (not sorted CD133(+) cells) at 96 h after siRNA transfection. The cytotoxicity assay demonstrated notable increase of chemoresistance to 5-FU treatment (10 μM) in CD133(+) cells at 96 h after siRNA transfection. From this study, we conclude that CD133(+) cells may have chemoresistance to 5-FU through the mechanism which is related with survivin expression, instead of MDR1, ABCG2 and AKT1 expression. Therefore a survivin inhibitor can be a new target for effective treatment of CD133(+) colon cancer. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Chen Yun-Ru
2012-09-01
Full Text Available Abstract Background Deep sequencing is a powerful tool for novel small RNA discovery. Illumina small RNA sequencing library preparation requires a pre-adenylated 3’ end adapter containing a 5’,5’-adenyl pyrophosphoryl moiety. In the absence of ATP, this adapter can be ligated to the 3’ hydroxyl group of small RNA, while RNA self-ligation and concatenation are repressed. Pre-adenylated adapters are one of the most essential and costly components required for library preparation, and few are commercially available. Results We demonstrate that DNA oligo with 5’ phosphate and 3’ amine groups can be enzymatically adenylated by T4 RNA ligase 1 to generate customized pre-adenylated adapters. We have constructed and sequenced a small RNA library for tomato (Solanum lycopersicum using the T4 RNA ligase 1 adenylated adapter. Conclusion We provide an efficient and low-cost method for small RNA sequencing library preparation, which takes two days to complete and costs around $20 per library. This protocol has been tested in several plant species for small RNA sequencing including sweet potato, pepper, watermelon, and cowpea, and could be readily applied to any RNA samples.
Chatterjee, Debashree; Sanchez, Ana M; Goldgur, Yehuda; Shuman, Stewart; Schwer, Beate
2016-07-01
Expression of fission yeast Pho1 acid phosphatase is repressed during growth in phosphate-rich medium. Repression is mediated by transcription of the prt locus upstream of pho1 to produce a long noncoding (lnc) prt RNA. Repression is also governed by RNA polymerase II CTD phosphorylation status, whereby inability to place a Ser7-PO4 mark (as in S7A) derepresses Pho1 expression, and inability to place a Thr4-PO4 mark (as in T4A) hyper-represses Pho1 in phosphate replete cells. Here we find that basal pho1 expression from the prt-pho1 locus is inversely correlated with the activity of the prt promoter, which resides in a 110-nucleotide DNA segment preceding the prt transcription start site. CTD mutations S7A and T4A had no effect on the activity of the prt promoter or the pho1 promoter, suggesting that S7A and T4A affect post-initiation events in prt lncRNA synthesis that make it less and more repressive of pho1, respectively. prt lncRNA contains clusters of DSR (determinant of selective removal) sequences recognized by the YTH-domain-containing protein Mmi1. Altering the nucleobase sequence of two DSR clusters in the prt lncRNA caused hyper-repression of pho1 in phosphate replete cells, concomitant with increased levels of the prt transcript. The isolated Mmi1 YTH domain binds to RNAs with single or tandem DSR elements, to the latter in a noncooperative fashion. We report the 1.75 Å crystal structure of the Mmi1 YTH domain and provide evidence that Mmi1 recognizes DSR RNA via a binding mode distinct from that of structurally homologous YTH proteins that recognize m(6)A-modified RNA. © 2016 Chatterjee et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
International Nuclear Information System (INIS)
Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.
1999-01-01
The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)
Zhang, Zhiting; Guo, Qianqian; Zhang, Shufang; Xiang, Chenxi; Guo, Xinwei; Zhang, Feng; Gao, Lanlan; Ni, Haiwei; Xi, Tao; Zheng, Lufeng
2018-05-07
RNA binding proteins (RBPs) are pivotal post-transcriptional regulators. RNPC1, an RBP, acts as a tumor suppressor through binding and regulating the expression of target genes in cancer cells. This study disclosed that RNPC1 expression was positively correlated with breast cancer patients' relapse free and overall survival, and RNPC1suppressed breast cancer cells metastasis. Mechanistically, RNPC1 promoting a competing endogenous network (ceRNA) crosstalk between STARD13, CDH5, HOXD10, and HOXD1 (STARD13-correlated ceRNA network) that we previously confirmed in breast cancer cells through stabilizing the transcripts and thus facilitating the expression of these four genes in breast cancer cells. Furthermore, RNPC1 overexpression restrained the promotion of STARD13, CDH5, HOXD10, and HOXD1 knockdown on cell metastasis. Notably, RNPC1 expression was positively correlated with CDH5, HOXD1 and HOXD10 expression in breast cancer tissues, and attenuated adriamycin resistance. Taken together, these results identified that RNPC1 could inhibit breast cancer cells metastasis via promoting STARD13-correlated ceRNA network.
Directory of Open Access Journals (Sweden)
N. AZARPIRA
2006-11-01
Full Text Available Background:It is well recognized that different patients respond in different ways to medications. The inter-individual variations are greater than the intera- individual variations,a finding consistent with the notion that inheritance is a determinant of drug responses. The recent identification of genetic polymorphisms in drug-metabolizing enzymes and drug transporters led to the hypothesis that genetic factors may be implicated in this interindividual variation. Single nucleotide polymorphism in common metabolic pathway,cytochrome P450 and common transporter,multidrug resistance-1 gene are two important sites that might involve clinically significant genetic variations. Ethnicity greatly influences these genetic polymorphism distributions. Methods: We studied the inheritance patterns of polymorphisms for MDR1 and CYP3A5 genes in the Iranian population and compared its genotype and allele frequencies with 3 different ethnic groups: Caucasian (United Kingdom, Chinese and Japanese. Results: We found striking differences in the distribution of MDR allelic variants between Iranian,Japanese and Chinese (p<0.02 and similar between the Iranian and Caucasian population.(p=0.06.Almost 50% of Iranian and Caucasian individuals were homozygous carriers of the variant T allele compared with 32% of the Japanese and 43% of the Chinese (p<0.02.More than half of Iranian subjects have at least one T allele,with lower P-gp level in small intestine.We also noted dramatic differences in the CYP3A5 alleles and genotypes distribution between Iranian subjects with other compared populations.99% of Iranian individuals were homozygous carriers of the variant G allele compared with about 70% of the Chinese and Japanese and 19% of the Caucasian population. The G/G genotype has a very low level of active cytochrome P450 enzyme.Conclusion:Our results emphasize the role of ethnicity in interindividual variability of the pharmacokinetic and pharmacodynamic characteristics
Induction of long noncoding RNA MALAT1 in hypoxic mice
Directory of Open Access Journals (Sweden)
Lelli A
2015-10-01
Full Text Available Aurelia Lelli,1,2,* Karen A Nolan,1,2,* Sara Santambrogio,1,2 Ana Filipa Gonçalves,1,2 Miriam J Schönenberger,1,2 Anna Guinot,1,2 Ian J Frew,1,2 Hugo H Marti,3 David Hoogewijs,1,2,4 Roland H Wenger1,2 1Institute of Physiology and Zurich Center for Human Physiology (ZIHP, University of Zurich, Zurich, Switzerland; 2National Center of Competence in Research "Kidney.CH", Zurich, Switzerland; 3Institute of Physiology and Pathophysiology, University of Heidelberg, Heidelberg, Germany; 4Institute of Physiology, University of Duisburg-Essen, Essen, Germany *These authors contributed equally to this work Abstract: Long thought to be “junk DNA”, in recent years it has become clear that a substantial fraction of intergenic genomic DNA is actually transcribed, forming long noncoding RNA (lncRNA. Like mRNA, lncRNA can also be spliced, capped, and polyadenylated, affecting a multitude of biological processes. While the molecular mechanisms underlying the function of lncRNAs have just begun to be elucidated, the conditional regulation of lncRNAs remains largely unexplored. In genome-wide studies our group and others recently found hypoxic transcriptional induction of a subset of lncRNAs, whereof nuclear-enriched abundant/autosomal transcript 1 (NEAT1 and metastasis-associated lung adenocarcinoma transcript 1 (MALAT1 appear to be the lncRNAs most ubiquitously and most strongly induced by hypoxia in cultured cells. Hypoxia-inducible factor (HIF-2 rather than HIF-1 seems to be the preferred transcriptional activator of these lncRNAs. For the first time, we also found strong induction primarily of MALAT1 in organs of mice exposed to inspiratory hypoxia. Most abundant hypoxic levels of MALAT1 lncRNA were found in kidney and testis. In situ hybridization revealed that the hypoxic induction in the kidney was confined to proximal rather than distal tubular epithelial cells. Direct oxygen-dependent regulation of MALAT1 lncRNA was confirmed using isolated primary
Structure, dynamics and RNA binding of the multi-domain splicing factor TIA-1
Wang, Iren; Hennig, Janosch; Jagtap, Pravin Kumar Ankush; Sonntag, Miriam; Valcárcel, Juan; Sattler, Michael
2014-01-01
Alternative pre-messenger ribonucleic acid (pre-mRNA) splicing is an essential process in eukaryotic gene regulation. The T-cell intracellular antigen-1 (TIA-1) is an apoptosis-promoting factor that modulates alternative splicing of transcripts, including the pre-mRNA encoding the membrane receptor Fas. TIA-1 is a multi-domain ribonucleic acid (RNA) binding protein that recognizes poly-uridine tract RNA sequences to facilitate 5′ splice site recognition by the U1 small nuclear ribonucleoprotein (snRNP). Here, we characterize the RNA interaction and conformational dynamics of TIA-1 by nuclear magnetic resonance (NMR), isothermal titration calorimetry (ITC) and small angle X-ray scattering (SAXS). Our NMR-derived solution structure of TIA-1 RRM2–RRM3 (RRM2,3) reveals that RRM2 adopts a canonical RNA recognition motif (RRM) fold, while RRM3 is preceded by an non-canonical helix α0. NMR and SAXS data show that all three RRMs are largely independent structural modules in the absence of RNA, while RNA binding induces a compact arrangement. RRM2,3 binds to pyrimidine-rich FAS pre-mRNA or poly-uridine (U9) RNA with nanomolar affinities. RRM1 has little intrinsic RNA binding affinity and does not strongly contribute to RNA binding in the context of RRM1,2,3. Our data unravel the role of binding avidity and the contributions of the TIA-1 RRMs for recognition of pyrimidine-rich RNAs. PMID:24682828
Dodge, Matthew A; Waller, Ross F; Chow, Larry M C; Zaman, Muhammad M; Cotton, Leanne M; McConville, Malcolm J; Wirth, Dyann F
2004-03-01
Upregulation of the multidrug resistance protein 1 (LeMDR1) in the protozoan parasite, Leishmania enriettii, confers resistance to hydrophobic drugs such as vinblastine, but increases the sensitivity of these parasites to the mitochondrial drug, rhodamine 123. In order to investigate the mechanism of action of LeMDR1, the subcellular localization of green fluorescent protein (GFP)-tagged versions of LeMDR1 and the fate of the traceable-fluorescent LeMDR1 substrate calcein AM were examined in both Leishmania mexicana and L. enriettii LeMDR1 -/- and overexpressing cell lines. The LeMDR1-GFP chimera was localized by fluorescence microscopy to a number of secretory and endocytic compartments, including the Golgi apparatus, endoplasmic reticulum (ER) and a multivesicular tubule (MVT)-lysosome. Pulse-chase labelling experiments with calcein AM suggested that the Golgi and ER pools, but not the MVT-lysosome pool, of LeMDR1 were active in pumping calcein AM out of the cell. Cells labelled with calcein AM under conditions that slow vesicular transport (low temperature and stationary growth) inhibited export and resulted in the accumulation of fluorescent calcein in both the Golgi and the mitochondria. We propose that LeMDR1 substrates are pumped into secretory compartments and exported from the parasite by exocytosis. Accumulation of MDR substrates in the ER can result in alternative transport to the mitochondrion, explaining the reciprocal sensitivity of drug-resistant Leishmania to vinblastine and rhodamine 123.
antaRNA: ant colony-based RNA sequence design.
Kleinkauf, Robert; Mann, Martin; Backofen, Rolf
2015-10-01
RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. http://www.bioinf.uni-freiburg.de/Software/antaRNA CONTACT: backofen@informatik.uni-freiburg.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
International Nuclear Information System (INIS)
Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.
2004-01-01
Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS
Juang, Vivian; Lee, Hsin-Pin; Lin, Anya Maan-Yuh; Lo, Yu-Li
Antimicrobial peptides (AMPs) have been recently evaluated as a new generation of adjuvants in cancer chemotherapy. In this study, we designed PEGylated liposomes encapsulating epirubicin as an antineoplastic agent and tilapia hepcidin 2-3, an AMP, as a multidrug resistance (MDR) transporter suppressor and an apoptosis/autophagy modulator in human cervical cancer HeLa cells. Cotreatment of HeLa cells with PEGylated liposomal formulation of epirubicin and hepcidin 2-3 significantly increased the cytotoxicity of epirubicin. The liposomal formulations of epirubicin and/or hepcidin 2-3 were found to noticeably escalate the intracellular H 2 O 2 and O 2 - levels of cancer cells. Furthermore, these treatments considerably reduced the mRNA expressions of MDR protein 1, MDR-associated protein (MRP) 1, and MRP2. The addition of hepcidin 2-3 in liposomes was shown to markedly enhance the intracellular epirubicin uptake and mainly localized into the nucleus. Moreover, this formulation was also found to trigger apoptosis and autophagy in HeLa cells, as validated by significant increases in the expressions of cleaved poly ADP ribose polymerase, caspase-3, caspase-9, and light chain 3 (LC3)-II, as well as a decrease in mitochondrial membrane potential. The apoptosis induction was also confirmed by the rise in sub-G1 phase of cell cycle assay and apoptosis percentage of annexin V/propidium iodide assay. We found that liposomal epirubicin and hepcidin 2-3 augmented the accumulation of GFP-LC3 puncta as amplified by chloroquine, implying the involvement of autophagy. Interestingly, the partial inhibition of necroptosis and the epithelial-mesenchymal transition by this combination was also verified. Altogether, our results provide evidence that coincubation with PEGylated liposomes of hepcidin 2-3 and epirubicin caused programmed cell death in cervical cancer cells through modulation of multiple signaling pathways, including MDR transporters, apoptosis, autophagy, and/or necroptosis
Xiong, Wan-Cheng; Han, Na; Wu, Nan; Zhao, Ke-Lei; Han, Chen; Wang, Hui-Xin; Ping, Guan-Fang; Zheng, Peng-Fei; Feng, Hailong; Qin, Lei; He, Peng
2018-01-01
Long noncoding RNAs (lncRNAs) are dysregulated in many diseases. MicroRNA-101 (miR-101) functions as a tumor suppressor by directly targeting ZEB1 in various cancers. However, the potential mechanism of lncRNA ZEB1-AS1 and miR-101/ZEB1 axis in CRC remains unknown. In this study, we further investigated the potential interplay between miR-101/ZEB1 axis and lncRNA ZEB1-AS1 in colorectal cancer (CRC). Results showed that ZEB1-AS1 was upregulated in CRC tissues and cells. MiR-101 was downregulated in CRC tissues and negatively correlated with ZEB1-AS1 and ZEB1 expression levels in CRC. Functional experiments showed that, consistent with ZEB1-AS1 depletion, miR-101 overexpression and ZEB1 depletion inhibited the proliferation and migration of CRC cells. Overexpression of miR-101 partially abolished the effects of ZEB1-AS1 on the proliferation and migration of these cells. Moreover, combined ZEB1-AS1 depletion and miR-101 overexpression significantly inhibited cell proliferation and migration of the CRC cells. Hence, ZEB1-AS1 functioned as a molecular sponge for miR-101 and relieved the inhibition of ZEB1 caused by miR-101. This study revealed a novel regulatory mechanism between ZEB1-AS1 and miR-101/ZEB1 axis. The interplay between ZEB1-AS1 and miR-101/ZEB1 axis contributed to the proliferation and migration of CRC cells, and targeting this interplay could be a promising strategy for CRC treatment.
Ms1, a novel sRNA interacting with the RNA polymerase core in mycobacteria
Czech Academy of Sciences Publication Activity Database
Hnilicová, Jarmila; Jirát-Matějčková, Jitka; Šiková, Michaela; Pospíšil, Jiří; Halada, Petr; Pánek, Josef; Krásný, Libor
2014-01-01
Roč. 42, č. 18 (2014), s. 11763-11776 ISSN 0305-1048 R&D Projects: GA ČR(CZ) GBP305/12/G034; GA ČR GP13-27150P Grant - others:Magistrát hl. m. P.(CZ) CZ.2.16/3.1.00/24023 Institutional support: RVO:61388971 Keywords : ESCHERICHIA-COLI * 6S RNA * NONCODING RNA Subject RIV: EE - Microbiology, Virology Impact factor: 9.112, year: 2014
Elferink, Ronald P. J. Oude; Ottenhoff, Roelof; Fricker, Gert; Seward, David J.; Ballatori, Nazzareno; Boyer, James
2004-01-01
The ABC transporters bile salt export pump ( BSEP; encoded by the ABCB11 gene), MDR3 P-glycoprotein (ABCB4), and sterolin 1 and 2 (ABCG5 and ABCG8) are crucial for the excretion of bile salt, phospholipid, and cholesterol, respectively, into the bile of mammals. The current paradigm is that
You, Chun-Xiang; Zhao, Qiang; Wang, Xiao-Fei; Xie, Xing-Bin; Feng, Xiao-Ming; Zhao, Ling-Ling; Shu, Huai-Rui; Hao, Yu-Jin
2014-02-01
Although numerous miRNAs have been already isolated from fruit trees, knowledge about miRNA biogenesis is largely unknown in fruit trees. Double-strand RNA-binding (DRB) protein plays an important role in miRNA processing and maturation; however, its role in the regulation of economically important traits is not clear yet in fruit trees. EST blast and RACE amplification were performed to isolate apple MdDRB1 gene. Following expression analysis, RNA binding and protein interaction assays, MdDRB1 was transformed into apple callus and in vitro tissue cultures to characterize the functions of MdDRB1 in miRNA biogenesis, adventitious rooting, leaf development and tree growth habit. MdDRB1 contained two highly conserved DRB domains. Its transcripts existed in all tissues tested and are induced by hormones. It bound to double-strand RNAs and interacted with AtDCL1 (Dicer-Like 1) and MdDCL1. Chip assay indicated its role in miRNA biogenesis. Transgenic analysis showed that MdDRB1 controls adventitious rooting, leaf curvature and tree architecture by modulating the accumulation of miRNAs and the transcript levels of miRNA target genes. Our results demonstrated that MdDRB1 functions in the miRNA biogenesis in a conserved way and that it is a master regulator in the formation of economically important traits in fruit trees. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
MicroRNA related polymorphisms and breast cancer risk.
Khan, Sofia; Greco, Dario; Michailidou, Kyriaki; Milne, Roger L; Muranen, Taru A; Heikkinen, Tuomas; Aaltonen, Kirsimari; Dennis, Joe; Bolla, Manjeet K; Liu, Jianjun; Hall, Per; Irwanto, Astrid; Humphreys, Keith; Li, Jingmei; Czene, Kamila; Chang-Claude, Jenny; Hein, Rebecca; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Fletcher, Olivia; Peto, Julian; dos Santos Silva, Isabel; Johnson, Nichola; Gibson, Lorna; Aitken, Zoe; Hopper, John L; Tsimiklis, Helen; Bui, Minh; Makalic, Enes; Schmidt, Daniel F; Southey, Melissa C; Apicella, Carmel; Stone, Jennifer; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel A; van der Luijt, Rob B; Meindl, Alfons; Schmutzler, Rita K; Müller-Myhsok, Bertram; Lichtner, Peter; Turnbull, Clare; Rahman, Nazneen; Chanock, Stephen J; Hunter, David J; Cox, Angela; Cross, Simon S; Reed, Malcolm W R; Schmidt, Marjanka K; Broeks, Annegien; Van't Veer, Laura J; Hogervorst, Frans B; Fasching, Peter A; Schrauder, Michael G; Ekici, Arif B; Beckmann, Matthias W; Bojesen, Stig E; Nordestgaard, Børge G; Nielsen, Sune F; Flyger, Henrik; Benitez, Javier; Zamora, Pilar M; Perez, Jose I A; Haiman, Christopher A; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Pharoah, Paul D P; Dunning, Alison M; Shah, Mitul; Luben, Robert; Brown, Judith; Couch, Fergus J; Wang, Xianshu; Vachon, Celine; Olson, Janet E; Lambrechts, Diether; Moisse, Matthieu; Paridaens, Robert; Christiaens, Marie-Rose; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Mulot, Claire; Marme, Frederick; Burwinkel, Barbara; Schneeweiss, Andreas; Sohn, Christof; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Andrulis, Irene L; Knight, Julia A; Tchatchou, Sandrine; Mulligan, Anna Marie; Dörk, Thilo; Bogdanova, Natalia V; Antonenkova, Natalia N; Anton-Culver, Hoda; Darabi, Hatef; Eriksson, Mikael; Garcia-Closas, Montserrat; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; van Asperen, Christi J; Kristensen, Vessela N; Slager, Susan; Toland, Amanda E; Ambrosone, Christine B; Yannoukakos, Drakoulis; Lindblom, Annika; Margolin, Sara; Radice, Paolo; Peterlongo, Paolo; Barile, Monica; Mariani, Paolo; Hooning, Maartje J; Martens, John W M; Collée, J Margriet; Jager, Agnes; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Giles, Graham G; McLean, Catriona; Brauch, Hiltrud; Brüning, Thomas; Ko, Yon-Dschun; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Simard, Jacques; Goldberg, Mark S; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Mannermaa, Arto; Hamann, Ute; Chenevix-Trench, Georgia; Blomqvist, Carl; Aittomäki, Kristiina; Easton, Douglas F; Nevanlinna, Heli
2014-01-01
Genetic variations, such as single nucleotide polymorphisms (SNPs) in microRNAs (miRNA) or in the miRNA binding sites may affect the miRNA dependent gene expression regulation, which has been implicated in various cancers, including breast cancer, and may alter individual susceptibility to cancer. We investigated associations between miRNA related SNPs and breast cancer risk. First we evaluated 2,196 SNPs in a case-control study combining nine genome wide association studies (GWAS). Second, we further investigated 42 SNPs with suggestive evidence for association using 41,785 cases and 41,880 controls from 41 studies included in the Breast Cancer Association Consortium (BCAC). Combining the GWAS and BCAC data within a meta-analysis, we estimated main effects on breast cancer risk as well as risks for estrogen receptor (ER) and age defined subgroups. Five miRNA binding site SNPs associated significantly with breast cancer risk: rs1045494 (odds ratio (OR) 0.92; 95% confidence interval (CI): 0.88-0.96), rs1052532 (OR 0.97; 95% CI: 0.95-0.99), rs10719 (OR 0.97; 95% CI: 0.94-0.99), rs4687554 (OR 0.97; 95% CI: 0.95-0.99, and rs3134615 (OR 1.03; 95% CI: 1.01-1.05) located in the 3' UTR of CASP8, HDDC3, DROSHA, MUSTN1, and MYCL1, respectively. DROSHA belongs to miRNA machinery genes and has a central role in initial miRNA processing. The remaining genes are involved in different molecular functions, including apoptosis and gene expression regulation. Further studies are warranted to elucidate whether the miRNA binding site SNPs are the causative variants for the observed risk effects.
International Nuclear Information System (INIS)
Prakash, R.K.; Netrawali, M.S.; Pradhan, D.S.
1976-01-01
UV-irradiation prevents rifampicin inhibition of the initiation of RNA synthesis by E.coli cells, but such rifampicin insensitivity is not exhibited by the residual RNA synthesis in γ-irradiated cells. Studies of the rate of [ 3 H]-uridine incorporation by E.coli cells at various times of incubation have been used to show that when γ-irradiation was given either before or after UV-irradiation of cells, the observed rifampicin insensitivity of residual RNA synthesis in the UV-irradiated cells was obliterated. RNA synthesis in cells subjected to combined exposures of UV- and γ-radiations was lowered to a lesser extent than that in the cells exposed to UV-irradiation alone. Possible mechanisms are discussed. (U.K.)
Energy Technology Data Exchange (ETDEWEB)
Prakash, R K; Netrawali, M S; Pradhan, D S [Bhabha Atomic Research Centre, Bombay (India). Biochemistry and Food Technology Div.
1976-09-01
UV-irradiation prevents rifampicin inhibition of the initiation of RNA synthesis by E.coli cells, but such rifampicin insensitivity is not exhibited by the residual RNA synthesis in ..gamma..-irradiated cells. Studies of the rate of (/sup 3/H)-uridine incorporation by E.coli cells at various times of incubation have been used to show that when ..gamma.. irradiation was given either before or after uv-irradiation of cells, the observed rifampicin insensitivity of residual RNA synthesis in the uv-irradiated cells was obliterated. RNA synthesis in cells subjected to combined exposures of uv- and ..gamma..-radiations was lowered to a lesser extent than that in the cells exposed to uv-irradiation alone. Possible mechanisms are discussed.
Structural and functional basis for RNA cleavage by Ire1
Directory of Open Access Journals (Sweden)
Stroud Robert M
2011-07-01
Full Text Available Abstract Background The unfolded protein response (UPR controls the protein folding capacity of the endoplasmic reticulum (ER. Central to this signaling pathway is the ER-resident bifunctional transmembrane kinase/endoribonuclease Ire1. The endoribonuclease (RNase domain of Ire1 initiates a non-conventional mRNA splicing reaction, leading to the production of a transcription factor that controls UPR target genes. The mRNA splicing reaction is an obligatory step of Ire1 signaling, yet its mechanism has remained poorly understood due to the absence of substrate-bound crystal structures of Ire1, the lack of structural similarity between Ire1 and other RNases, and a scarcity of quantitative enzymological data. Here, we experimentally define the active site of Ire1 RNase and quantitatively evaluate the contribution of the key active site residues to catalysis. Results This analysis and two new crystal structures suggest that Ire1 RNase uses histidine H1061 and tyrosine Y1043 as the general acid-general base pair contributing ≥ 7.6 kcal/mol and 1.4 kcal/mol to transition state stabilization, respectively, and asparagine N1057 and arginine R1056 for coordination of the scissile phosphate. Investigation of the stem-loop recognition revealed that additionally to the stem-loops derived from the classic Ire1 substrates HAC1 and Xbp1 mRNA, Ire1 can site-specifically and rapidly cleave anticodon stem-loop (ASL of unmodified tRNAPhe, extending known substrate specificity of Ire1 RNase. Conclusions Our data define the catalytic center of Ire1 RNase and suggest a mechanism of RNA cleavage: each RNase monomer apparently contains a separate catalytic apparatus for RNA cleavage, whereas two RNase subunits contribute to RNA stem-loop docking. Conservation of the key residues among Ire1 homologues suggests that the mechanism elucidated here for yeast Ire1 applies to Ire1 in metazoan cells, and to the only known Ire1 homologue RNase L.
Influenza A Virus NS1 Protein Promotes Efficient Nuclear Export of Unspliced Viral M1 mRNA.
Pereira, Carina F; Read, Eliot K C; Wise, Helen M; Amorim, Maria J; Digard, Paul
2017-08-01
Influenza A virus mRNAs are transcribed by the viral RNA-dependent RNA polymerase in the cell nucleus before being exported to the cytoplasm for translation. Segment 7 produces two major transcripts: an unspliced mRNA that encodes the M1 matrix protein and a spliced transcript that encodes the M2 ion channel. Export of both mRNAs is dependent on the cellular NXF1/TAP pathway, but it is unclear how they are recruited to the export machinery or how the intron-containing but unspliced M1 mRNA bypasses the normal quality-control checkpoints. Using fluorescent in situ hybridization to monitor segment 7 mRNA localization, we found that cytoplasmic accumulation of unspliced M1 mRNA was inefficient in the absence of NS1, both in the context of segment 7 RNPs reconstituted by plasmid transfection and in mutant virus-infected cells. This effect was independent of any major effect on steady-state levels of segment 7 mRNA or splicing but corresponded to a ∼5-fold reduction in the accumulation of M1. A similar defect in intronless hemagglutinin (HA) mRNA nuclear export was seen with an NS1 mutant virus. Efficient export of M1 mRNA required both an intact NS1 RNA-binding domain and effector domain. Furthermore, while wild-type NS1 interacted with cellular NXF1 and also increased the interaction of segment 7 mRNA with NXF1, mutant NS1 polypeptides unable to promote mRNA export did neither. Thus, we propose that NS1 facilitates late viral gene expression by acting as an adaptor between viral mRNAs and the cellular nuclear export machinery to promote their nuclear export. IMPORTANCE Influenza A virus is a major pathogen of a wide variety of mammalian and avian species that threatens public health and food security. A fuller understanding of the virus life cycle is important to aid control strategies. The virus has a small genome that encodes relatively few proteins that are often multifunctional. Here, we characterize a new function for the NS1 protein, showing that, as well as
Yang, Di; Li, Ren; Qiu, Li-Hong; Li, Chen
2009-04-01
To quantify the IL-1 beta mRNA and IL-6 mRNA expression induced by lipopolysaccharides (LPS)extracted from Porphyromonas endodontalis(P.e) in osteoblasts, and to relate P.e-LPS to bone absorption pathogenesis in lesions of chronical apical periodontitis. MG63 was treated with different concentrations of P.e-LPS(0-50 microg/mL) for different hours(0-24h). The expression of IL-1 beta mRNA and IL-6 mRNA was detected by reverse transcription polymerase chain reaction (RT-PCR).Statistical analysis was performed using one- way ANOVA and Dunnett t test with SPSS11.0 software package. The level of IL-1 beta mRNA and IL-6 mRNA increased significantly after treatment with P.e-LPS at more than 5 microg/mL (P<0.01)and for more than 1 hour (P<0.01), which indicated that P.e-LPS induced osteoblasts to express IL-1 beta mRNA and IL-6 mRNA in dose and time dependent manners. P.e-LPS may promote bone resorption in lesions of chronical apical periodontitis by inducing IL-1 beta mRNA and IL-6 mRNA expression in osteoblasts.
Structural insights into mechanisms of the small RNA methyltransferase HEN1
Energy Technology Data Exchange (ETDEWEB)
Huang, Ying; Ji, Lijuan; Huang, Qichen; Vassylyev, Dmitry G.; Chen, Xuemei; Ma, Jin-Biao; (UAB); (UCR)
2010-02-22
RNA silencing is a conserved regulatory mechanism in fungi, plants and animals that regulates gene expression and defence against viruses and transgenes. Small silencing RNAs of {approx}20-30 nucleotides and their associated effector proteins, the Argonaute family proteins, are the central components in RNA silencing. A subset of small RNAs, such as microRNAs and small interfering RNAs (siRNAs) in plants, Piwi-interacting RNAs in animals and siRNAs in Drosophila, requires an additional crucial step for their maturation; that is, 2'-O-methylation on the 3' terminal nucleotide. A conserved S-adenosyl-L-methionine-dependent RNA methyltransferase, HUA ENHANCER 1 (HEN1), and its homologues are responsible for this specific modification. Here we report the 3.1 {angstrom} crystal structure of full-length HEN1 from Arabidopsis in complex with a 22-nucleotide small RNA duplex and cofactor product S-adenosyl-L-homocysteine. Highly cooperative recognition of the small RNA substrate by multiple RNA binding domains and the methyltransferase domain in HEN1 measures the length of the RNA duplex and determines the substrate specificity. Metal ion coordination by both 2' and 3' hydroxyls on the 3'-terminal nucleotide and four invariant residues in the active site of the methyltransferase domain suggests a novel Mg{sup 2+}-dependent 2'-O-methylation mechanism.
Viljoen, Johannes; Gampini, Sandrine; Danaviah, Sivapragashini; Valéa, Diane; Pillay, Sureshnee; Kania, Dramane; Méda, Nicolas; Newell, Marie-Louise; Van de Perre, Philippe; Rouet, François
2010-11-01
There is an urgent need to assess the accuracy/feasibility of using dried blood spots (DBS) for monitoring of HIV-1 viral load in resource-limited settings. A total of 892 DBS from HIV-1-positive pregnant women and their neonates enrolled in the Kesho Bora prevention of mother-to-child transmission trial conducted in Durban (South Africa) and Bobo-Dioulasso (Burkina Faso) between May 2005 and July 2008 were tested for HIV-1 RNA. The combination Nuclisens extraction method (BioMérieux)/Generic HIV Viral Load assay (Biocentric) was performed using one DBS (in Durban) versus 2 DBS (in Bobo-Dioulasso) on 2 distinct open real-time polymerase chain reaction instruments. DBS HIV-1 RNA results were compared with plasma HIV-1 RNA and HIV serology results used as the gold standards. The limits of detection of assays on DBS were 3100 and 1550 copies per milliliter in Durban and Bobo-Dioulasso, respectively. DBS HIV-1 RNA values correlated significantly with plasma levels (n = 327; R = 0.7351) and were uniformly distributed according to duration of DBS storage at -20°C (median duration, 280 days). For early infant diagnosis, the sensitivity and specificity were 100% (95% confidence interval: 97.2 to 100.0 and 96.5 to 100.0, respectively). HIV-1 viral load kinetics in DNase-pretreated DBS were similar to those obtained in plasma specimens among 13 patients receiving antiretroviral treatment. HIV-1 RNA findings from serial infant DBS collected prospectively (n = 164) showed 100% concordance with HIV serology at 18 months of life. Our findings strongly advocate the implementation of DBS HIV-1 RNA testing in remote areas from low-income and middle-income countries.
MicroRNA, SND1, and alterations in translational regulation in colon carcinogenesis
International Nuclear Information System (INIS)
Tsuchiya, Naoto; Nakagama, Hitoshi
2010-01-01
Post-transcriptional regulation of gene expression by microRNA (miRNA) has recently attracted major interest in relation to its involvement in cancer development. miRNA is a member of small non-coding RNA, consists of 22-24 nucleotides and regulates expression of target mRNA species in a post-transcriptional manner by being incorporated with RNA-induced silencing complex (RISC). Staphylococcal nuclease homology domain containing 1 (SND1), a component of RISC, is frequently up-regulated in human colon cancers and also chemically induced colon cancers in animals. We here showed that SDN1 is involved in miRNA-mediated gene suppression and overexpression of SND1 in colon cancer cells causes down-regulation of APC without altering APC mRNA levels. As for the miRNA expression profile in human colon cancer, miR-34a was among the list of down-regulated miRNA. Expression of miR-34a is tightly regulated by p53, and ectopic expression of miR-34a in colon cancer cells causes remarkable reduction of cell proliferation and induces senescence-like phenotypes. MiR-34a also participates in the positive feedback loop of the p53 tumor suppressor network. This circuitry mechanism for p53 activation is of interest in understanding the tumor suppressive function of miR-34a in colon carcinogenesis. miRNA should also be considered as novel anti-cancer agents in tumor suppressive therapeutic applications.
International Nuclear Information System (INIS)
Kimura, Akihiko; Ishida, Yuko; Wada, Takashi; Yokoyama, Hitoshi; Mukaida, Naofumi; Kondo, Toshikazu
2005-01-01
To clarify the pathophysiological mechanism underlying acute renal injury caused by acute exposure to arsenic, we subcutaneously injected both BALB/c and C57BL/6 mice with sodium arsenite (NaAs; 13.5 mg/kg). BALB/c mice exhibited exaggerated elevation of serum blood urea nitrogen (BUN) and creatinine (CRE) levels, compared with C57BL/6 mice. Moreover, half of BALB/c mice died by 24 h, whereas all C57BL/6 mice survived. Histopathological examination on kidney revealed severe hemorrhages, acute tubular necrosis, neutrophil infiltration, cast formation, and disappearance of PAS-positive brush borders in BALB/c mice, later than 10 h. These pathological changes were remarkably attenuated in C57BL/6 mice, accompanied with lower intrarenal arsenic concentrations, compared with BALB/c mice. Among heavy metal inducible proteins including multidrug resistance-associated protein (MRP)-1, multidrug resistance gene (MDR)-1, metallothionein (MT)-1, and arsenite inducible, cysteine- and histidine-rich RNA-associated protein (AIRAP), intrarenal MDR-1, MT-1, and AIRAP gene expression was enhanced to a similar extent in both strains, whereas NaAs challenge augmented intrarenal MRP-1 mRNA and protein expression levels in C57BL/6 but not BALB/c mice. Moreover, the administration of a specific inhibitor of MRP-1, MK-571, significantly exaggerated acute renal injury in C57BL/6 mice. Thus, MRP-1 is crucially involved in arsenic efflux and eventually prevention of acute renal injury upon acute exposure to NaAs
Up-regulation of P-glycoprotein expression by catalase via JNK activation in HepG2 cells.
Li, Lin; Xu, Jianfeng; Min, Taishan; Huang, Weida
2006-01-01
Overexpression of the MDR1 gene is one of the reasons for multidrug resistance (MDR). Some studies suggested that antioxidants could down-regulate MDR1 expression as a possible cancer treatment. In this report, we try to determine the effects of antioxidants (catalase or N-acetylcysteine [NAC]) on the regulation of intrinsic MDR1 overexpression in HepG2 cells. Adding catalase or N-acetylcysteine to the HepG2 culture led to a significant increase of MDR1 mRNA and P-glycoprotein drug transporter activity. After catalase or NAC treatment, a reduced intracellular reactive oxygen species (ROS) was observed. The JNK inhibitor SP600125 abolished the positive effects of catalase on drug transporter activity in a dose-dependent manner. Furthermore, the up-regulation of P-glycoprotein functions by catalase was only observed in HepG2 cells but not in other cell lines tested (MCF-7, A549, A431). These data suggested that catalase can up-regulate P-glycoprotein expression in HepG2 cells via reducing intracellular ROS, and JNK may mediate this process.
The oestrogen receptor alpha-regulated lncRNA NEAT1 is a critical modulator of prostate cancer
Chakravarty, Dimple; Sboner, Andrea; Nair, Sujit S.; Giannopoulou, Eugenia; Li, Ruohan; Hennig, Sven; Mosquera, Juan Miguel; Pauwels, Jonathan; Park, Kyung; Kossai, Myriam; MacDonald, Theresa Y.; Fontugne, Jacqueline; Erho, Nicholas; Vergara, Ismael A.; Ghadessi, Mercedeh; Davicioni, Elai; Jenkins, Robert B.; Palanisamy, Nallasivam; Chen, Zhengming; Nakagawa, Shinichi; Hirose, Tetsuro; Bander, Neil H.; Beltran, Himisha; Fox, Archa H.; Elemento, Olivier; Rubin, Mark A.
2014-01-01
The androgen receptor (AR) plays a central role in establishing an oncogenic cascade that drives prostate cancer progression. Some prostate cancers escape androgen dependence and are often associated with an aggressive phenotype. The oestrogen receptor alpha (ERα) is expressed in prostate cancers, independent of AR status. However, the role of ERα remains elusive. Using a combination of chromatin immunoprecipitation (ChIP) and RNA-sequencing data, we identified an ERα-specific non-coding transcriptome signature. Among putatively ERα-regulated intergenic long non-coding RNAs (lncRNAs), we identified nuclear enriched abundant transcript 1 (NEAT1) as the most significantly overexpressed lncRNA in prostate cancer. Analysis of two large clinical cohorts also revealed that NEAT1 expression is associated with prostate cancer progression. Prostate cancer cells expressing high levels of NEAT1 were recalcitrant to androgen or AR antagonists. Finally, we provide evidence that NEAT1 drives oncogenic growth by altering the epigenetic landscape of target gene promoters to favour transcription. PMID:25415230
Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.
Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide
2017-10-13
Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Beta-Amyloid Downregulates MDR1-P-Glycoprotein (Abcb1 Expression at the Blood-Brain Barrier in Mice
Directory of Open Access Journals (Sweden)
Anja Brenn
2011-01-01
Full Text Available Neurovascular dysfunction is an important component of Alzheimer's disease, leading to reduced clearance across the blood-brain barrier and accumulation of neurotoxic β-amyloid (Aβ peptides in the brain. It has been shown that the ABC transport protein P-glycoprotein (P-gp, ABCB1 is involved in the export of Aβ from the brain into the blood. To determine whether Aβ influences the expression of key Aβ transporters, we studied the effects of 1-day subcutaneous Aβ1-40 and Aβ1-42 administration via Alzet mini-osmotic pumps on P-gp, BCRP, LRP1, and RAGE expression in the brain of 90-day-old male FVB mice. Our results demonstrate significantly reduced P-gp, LRP1, and RAGE mRNA expression in mice treated with Aβ1-42 compared to controls, while BCRP expression was not affected. The expression of the four proteins was unchanged in mice treated with Aβ1-40 or reverse-sequence peptides. These findings indicate that, in addition to the age-related decrease of P-gp expression, Aβ1-42 itself downregulates the expression of P-gp and other Aβ-transporters, which could exacerbate the intracerebral accumulation of Aβ and thereby accelerate neurodegeneration in Alzheimer's disease and cerebral β-amyloid angiopathy.
Directory of Open Access Journals (Sweden)
Chen Gang
2012-03-01
Full Text Available Abstract Background The epidermal growth factor receptor (EGFR is a validated therapeutic target in non-small cell lung cancer (NSCLC. However, current single agent receptor targeting does not achieve a maximal therapeutic effect, and some mutations confer resistance to current available agents. In the current study we have examined, in different NSCLC cell lines, the combined effect of RNA interference targeting the EGFR mRNA, and inactivation of EGFR signaling using different receptor tyrosine kinase inhibitors (TKIs or a monoclonal antibody cetuximab. Methods NSCLC cells (cell lines HCC827, H292, H358, H1650, and H1975 were transfected with EGFR siRNA and/or treated with the TKIs gefitinib, erlotinib, and afatinib, and/or with the monoclonal antibody cetuximab. The reduction of EGFR mRNA expression was measured by real-time quantitative RT-PCR. The down-regulation of EGFR protein expression was measured by western blot, and the proliferation, viability, caspase3/7 activity, and apoptotic morphology were monitored by spectrophotometry, fluorimetry, and fluorescence microscopy. The combined effect of EGFR siRNA and different drugs was evaluated using a combination index. Results EGFR-specific siRNA strongly inhibited EGFR protein expression almost equally in all cell lines and inhibited cell growth and induced cell apoptosis in all NSCLC cell lines studied, albeit with a different magnitude. The effects on growth obtained with siRNA was strikingly different from the effects obtained with TKIs. The effects of siRNA probably correlate with the overall oncogenic significance of the receptor, which is only partly inhibited by the TKIs. The cells which showed weak response to TKIs, such as the H1975 cell line containing the T790M resistance mutation, were found to be responsive to siRNA knockdown of EGFR, as were cell lines with downstream TKI resistance mutations. The cell line HCC827, harboring an exon 19 deletion mutation, was more than 10-fold
Modular arrangement of regulatory RNA elements.
Roßmanith, Johanna; Narberhaus, Franz
2017-03-04
Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed.
Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.
Ahuja, Richa; Kumar, Vijay
2017-07-01
RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.
mRNA/microRNA gene expression profile in microsatellite unstable colorectal cancer
Directory of Open Access Journals (Sweden)
Calin George A
2007-08-01
Full Text Available Abstract Background Colorectal cancer develops through two main genetic instability pathways characterized by distinct pathologic features and clinical outcome. Results We investigated colon cancer samples (23 characterized by microsatellite stability, MSS, and 16 by high microsatellite instability, MSI-H for genome-wide expression of microRNA (miRNA and mRNA. Based on combined miRNA and mRNA gene expression, a molecular signature consisting of twenty seven differentially expressed genes, inclusive of 8 miRNAs, could correctly distinguish MSI-H versus MSS colon cancer samples. Among the differentially expressed miRNAs, various members of the oncogenic miR-17-92 family were significantly up-regulated in MSS cancers. The majority of protein coding genes were also up-regulated in MSS cancers. Their functional classification revealed that they were most frequently associated with cell cycle, DNA replication, recombination, repair, gastrointestinal disease and immune response. Conclusion This is the first report that indicates the existence of differences in miRNA expression between MSS versus MSI-H colorectal cancers. In addition, the work suggests that the combination of mRNA/miRNA expression signatures may represent a general approach for improving bio-molecular classification of human cancer.
International Nuclear Information System (INIS)
Pan Yaozhen; Sun Chengyi; Wang Yuzhi
2004-01-01
Objective: To study the growth inhibition of human pancreatic cancer cells (PC-3) by lipofection-mediated and ionizing radiation improving transfection of IGF-1R antisense oligodeoxynucletides (ASON) in vitro. Methods: Colonigenicity of PC-3 cells in vitro after 60 Co γ-radiation was observed for ascertaining their radiosensitivity and optimal radiation dose was selected according to the radiation sensitivity. PC-3 cells were transfected by two ways: 1) by lipofection-mediated IGF-1R ASON combined with ionizing radiation. 2) by lipo-ASON alone without ionizing radiation. Cell growth was assessed by MTT method. The expression of IGF-1R at mRNA level was examined by RT-PCR. Flow cytometry was used to demonstrate apoptotic changes in lipo-ASON-treated cells. Results: The inhibitory efficiency of lipo-ASON combined with ionizing radiation was higher than that without ionizing radiation (P < 0.05). The apoptotic efficiency and the decreased level of IGF-1R at mRNA were significantly improved (P < 0.05). Conclusion: Lipofection-mediated and ionizing radiation-promoted transfection of IGF-1R antisense oligodeoxynucletides (ASON) significantly decreases IGF-1R at mRNA level and induces apoptosis of human pancreatic cancer cells in vitro
Directory of Open Access Journals (Sweden)
Hagedorn Peter H
2011-02-01
Full Text Available Abstract Background Several approaches have been developed for miRNA target prediction, including methods that incorporate expression profiling. However the methods are still in need of improvements due to a high false discovery rate. So far, none of the methods have used independent component analysis (ICA. Here, we developed a novel target prediction method based on ICA that incorporates both seed matching and expression profiling of miRNA and mRNA expressions. The method was applied on a cellular model of type 1 diabetes. Results Microrray profiling identified eight miRNAs (miR-124/128/192/194/204/375/672/708 with differential expression. Applying ICA on the mRNA profiling data revealed five significant independent components (ICs correlating to the experimental conditions. The five ICs also captured the miRNA expressions by explaining >97% of their variance. By using ICA, seven of the eight miRNAs showed significant enrichment of sequence predicted targets, compared to only four miRNAs when using simple negative correlation. The ICs were enriched for miRNA targets that function in diabetes-relevant pathways e.g. type 1 and type 2 diabetes and maturity onset diabetes of the young (MODY. Conclusions In this study, ICA was applied as an attempt to separate the various factors that influence the mRNA expression in order to identify miRNA targets. The results suggest that ICA is better at identifying miRNA targets than negative correlation. Additionally, combining ICA and pathway analysis constitutes a means for prioritizing between the predicted miRNA targets. Applying the method on a model of type 1 diabetes resulted in identification of eight miRNAs that appear to affect pathways of relevance to disease mechanisms in diabetes.
2013-01-01
Background In vitro evidence indicates that tetrandrine (TT) can potentiate the action of chloroquine 40-fold against choloquine-resistant Plasmodium falciparum. The key question emanating from that study is “would tetrandine and chloroquine be highly effective in a live Aotus monkey model with chloroquine-resistant parasites”. This study was designed to closely mimic the pharmacological/anti-malarial activity in man. Methods The Vietnam Smith/RE strain of P. falciparum, which is chloroquine-resistant was used in this study. Previous experimental procedures were followed. Panamanian owl monkeys (Aotus) were inoculated with 5×106 erythrocytes parasitized with the CQ-resistant strain of P. falciparum. Oral drug treatment was with CQ (20 mg/kg) and/or tetrandrine at 15 mg/Kg, 30 mg/Kg or 60 mg/Kg or 25 mg/Kg depending on experimental conditions. Results and Discussion Parasitaemia was cleared rapidly with CQ and TT while CQ treatment alone was ineffective. Recrudescence of malaria occurred after seven days post-infection. However, four animals were treated orally with TT and CQ parasites were cleared. It is likely that monkeys were cured via a combination of both drug and host immune responses. A single Aotus monkey infected with P. falciparum and untreated with drugs, died. No side effects were observed with these drug treatments. Conclusions This combination of chloroquine and tetrandrine forms the basis of a new attack on chloroquine-resistant malaria - one based upon inhibition of the basis of chloroquine resistance, the multiple drug resistance pump. Previous studies demonstrated that the parasite MDR pump was found on parasite membranes using 3H azidopine photoaffinity labelling. Since MDR-based choloroquine resistance is induced by chloroquine, the basis of the action of tetrandrine is the following: 1) tetrandrine inhibits the MDR pump by stimulating MDR ATPase which limits the energy of the pump by depletion of parasite ATP, 2) tetrandrine blocks the
Effects of combined mesenchymal stem cells and heme oxygenase-1 therapy on cardiac performance.
Zeng, Bin; Chen, Honglei; Zhu, Chengang; Ren, Xiaofeng; Lin, Guosheng; Cao, Feng
2008-10-01
Bone marrow mesenchymal stem cells (MSCs) have the potential to repair the infarcted myocardium and improve cardiac function. However, this approach is limited by its poor viability after transplantation, and controversy still exists over the mechanism by which MSCs contribute to the tissue repair. The human heme oxygenase-1 (hHO-1) was transfected into cultured MSCs using an adenoviral vector. 1 x 10(6) Ad-hHO-1-transfected MSCs (HO-1-MSCs) or Ad-Null-transfected MSCs (Null-MSCs) or PBS only (PBS group) were injected intramyocardially into rat hearts 1h after myocardial infarction. HO-1-MSCs survived in the infarcted myocardium, and expressed hHO-1 mRNA. The expression of basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF) was significantly enhanced in HO-1-MSCs-treated hearts. At the same time, there were significant reduction of TNF-alpha, IL-1-beta and IL-6 mRNA, and marked increase of IL-10 mRNA in HO-1-MSCs-treated hearts. Moreover, a further downregulation of proapoptotic protein, Bax, and a marked increase in microvessel density were observed in HO-1-MSCs-treated hearts. The infarct size and cardiac performance were also significantly improved in HO-1-MSCs-treated hearts. The combined approach improves MSCs survival and is superior to MSCs injection alone.
MicroRNA related polymorphisms and breast cancer risk.
Directory of Open Access Journals (Sweden)
Sofia Khan
Full Text Available Genetic variations, such as single nucleotide polymorphisms (SNPs in microRNAs (miRNA or in the miRNA binding sites may affect the miRNA dependent gene expression regulation, which has been implicated in various cancers, including breast cancer, and may alter individual susceptibility to cancer. We investigated associations between miRNA related SNPs and breast cancer risk. First we evaluated 2,196 SNPs in a case-control study combining nine genome wide association studies (GWAS. Second, we further investigated 42 SNPs with suggestive evidence for association using 41,785 cases and 41,880 controls from 41 studies included in the Breast Cancer Association Consortium (BCAC. Combining the GWAS and BCAC data within a meta-analysis, we estimated main effects on breast cancer risk as well as risks for estrogen receptor (ER and age defined subgroups. Five miRNA binding site SNPs associated significantly with breast cancer risk: rs1045494 (odds ratio (OR 0.92; 95% confidence interval (CI: 0.88-0.96, rs1052532 (OR 0.97; 95% CI: 0.95-0.99, rs10719 (OR 0.97; 95% CI: 0.94-0.99, rs4687554 (OR 0.97; 95% CI: 0.95-0.99, and rs3134615 (OR 1.03; 95% CI: 1.01-1.05 located in the 3' UTR of CASP8, HDDC3, DROSHA, MUSTN1, and MYCL1, respectively. DROSHA belongs to miRNA machinery genes and has a central role in initial miRNA processing. The remaining genes are involved in different molecular functions, including apoptosis and gene expression regulation. Further studies are warranted to elucidate whether the miRNA binding site SNPs are the causative variants for the observed risk effects.
MicroRNA Related Polymorphisms and Breast Cancer Risk
Khan, Sofia; Greco, Dario; Michailidou, Kyriaki; Milne, Roger L.; Muranen, Taru A.; Heikkinen, Tuomas; Aaltonen, Kirsimari; Dennis, Joe; Bolla, Manjeet K.; Liu, Jianjun; Hall, Per; Irwanto, Astrid; Humphreys, Keith; Li, Jingmei; Czene, Kamila; Chang-Claude, Jenny; Hein, Rebecca; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Fletcher, Olivia; Peto, Julian; dos Santos Silva, Isabel; Johnson, Nichola; Gibson, Lorna; Aitken, Zoe; Hopper, John L.; Tsimiklis, Helen; Bui, Minh; Makalic, Enes; Schmidt, Daniel F.; Southey, Melissa C.; Apicella, Carmel; Stone, Jennifer; Waisfisz, Quinten; Meijers-Heijboer, Hanne; Adank, Muriel A.; van der Luijt, Rob B.; Meindl, Alfons; Schmutzler, Rita K.; Müller-Myhsok, Bertram; Lichtner, Peter; Turnbull, Clare; Rahman, Nazneen; Chanock, Stephen J.; Hunter, David J.; Cox, Angela; Cross, Simon S.; Reed, Malcolm W. R.; Schmidt, Marjanka K.; Broeks, Annegien; Veer, Laura J. V. a. n't.; Hogervorst, Frans B.; Fasching, Peter A.; Schrauder, Michael G.; Ekici, Arif B.; Beckmann, Matthias W.; Bojesen, Stig E.; Nordestgaard, Børge G.; Nielsen, Sune F.; Flyger, Henrik; Benitez, Javier; Zamora, Pilar M.; Perez, Jose I. A.; Haiman, Christopher A.; Henderson, Brian E.; Schumacher, Fredrick; Le Marchand, Loic; Pharoah, Paul D. P.; Dunning, Alison M.; Shah, Mitul; Luben, Robert; Brown, Judith; Couch, Fergus J.; Wang, Xianshu; Vachon, Celine; Olson, Janet E.; Lambrechts, Diether; Moisse, Matthieu; Paridaens, Robert; Christiaens, Marie-Rose; Guénel, Pascal; Truong, Thérèse; Laurent-Puig, Pierre; Mulot, Claire; Marme, Frederick; Burwinkel, Barbara; Schneeweiss, Andreas; Sohn, Christof; Sawyer, Elinor J.; Tomlinson, Ian; Kerin, Michael J.; Miller, Nicola; Andrulis, Irene L.; Knight, Julia A.; Tchatchou, Sandrine; Mulligan, Anna Marie; Dörk, Thilo; Bogdanova, Natalia V.; Antonenkova, Natalia N.; Anton-Culver, Hoda; Darabi, Hatef; Eriksson, Mikael; Garcia-Closas, Montserrat; Figueroa, Jonine; Lissowska, Jolanta; Brinton, Louise; Devilee, Peter; Tollenaar, Robert A. E. M.; Seynaeve, Caroline; van Asperen, Christi J.; Kristensen, Vessela N.; Slager, Susan; Toland, Amanda E.; Ambrosone, Christine B.; Yannoukakos, Drakoulis; Lindblom, Annika; Margolin, Sara; Radice, Paolo; Peterlongo, Paolo; Barile, Monica; Mariani, Paolo; Hooning, Maartje J.; Martens, John W. M.; Collée, J. Margriet; Jager, Agnes; Jakubowska, Anna; Lubinski, Jan; Jaworska-Bieniek, Katarzyna; Durda, Katarzyna; Giles, Graham G.; McLean, Catriona; Brauch, Hiltrud; Brüning, Thomas; Ko, Yon-Dschun; Brenner, Hermann; Dieffenbach, Aida Karina; Arndt, Volker; Stegmaier, Christa; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; Simard, Jacques; Goldberg, Mark S.; Labrèche, France; Dumont, Martine; Winqvist, Robert; Pylkäs, Katri; Jukkola-Vuorinen, Arja; Grip, Mervi; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M.; Mannermaa, Arto; Hamann, Ute; Chenevix-Trench, Georgia; Blomqvist, Carl; Aittomäki, Kristiina; Easton, Douglas F.; Nevanlinna, Heli
2014-01-01
Genetic variations, such as single nucleotide polymorphisms (SNPs) in microRNAs (miRNA) or in the miRNA binding sites may affect the miRNA dependent gene expression regulation, which has been implicated in various cancers, including breast cancer, and may alter individual susceptibility to cancer. We investigated associations between miRNA related SNPs and breast cancer risk. First we evaluated 2,196 SNPs in a case-control study combining nine genome wide association studies (GWAS). Second, we further investigated 42 SNPs with suggestive evidence for association using 41,785 cases and 41,880 controls from 41 studies included in the Breast Cancer Association Consortium (BCAC). Combining the GWAS and BCAC data within a meta-analysis, we estimated main effects on breast cancer risk as well as risks for estrogen receptor (ER) and age defined subgroups. Five miRNA binding site SNPs associated significantly with breast cancer risk: rs1045494 (odds ratio (OR) 0.92; 95% confidence interval (CI): 0.88–0.96), rs1052532 (OR 0.97; 95% CI: 0.95–0.99), rs10719 (OR 0.97; 95% CI: 0.94–0.99), rs4687554 (OR 0.97; 95% CI: 0.95–0.99, and rs3134615 (OR 1.03; 95% CI: 1.01–1.05) located in the 3′ UTR of CASP8, HDDC3, DROSHA, MUSTN1, and MYCL1, respectively. DROSHA belongs to miRNA machinery genes and has a central role in initial miRNA processing. The remaining genes are involved in different molecular functions, including apoptosis and gene expression regulation. Further studies are warranted to elucidate whether the miRNA binding site SNPs are the causative variants for the observed risk effects. PMID:25390939
Cui, Peng; Chen, Tao; Qin, Tao; Ding, Feng; Wang, Zhenyu; Chen, Hao; Xiong, Liming
2016-01-01
© 2016 American Society of Plant Biologists. All rights reserved. Nonsense-mediated decay (NMD) is a posttranscriptional surveillance mechanism in eukaryotes that recognizes and degrades transcripts with premature translation-termination codons. The RNA polymerase II C-terminal domain phosphatase-like protein FIERY2 (FRY2; also known as C-TERMINAL DOMAIN PHOSPHATASE-LIKE1 [CPL1]) plays multiple roles in RNA processing in Arabidopsis thaliana. Here, we found that FRY2/CPL1 interacts with two NMD factors, eIF4AIII and UPF3, and is involved in the dephosphorylation of eIF4AIII. This dephosphorylation retains eIF4AIII in the nucleus and limits its accumulation in the cytoplasm. By analyzing RNA-seq data combined with quantitative RT-PCR validation, we found that a subset of alternatively spliced transcripts and 59-extended mRNAs with NMD-eliciting features accumulated in the fry2-1 mutant, cycloheximidetreated wild type, and upf3 mutant plants, indicating that FRY2 is essential for the degradation of these NMD transcripts.
Cui, Peng
2016-02-18
© 2016 American Society of Plant Biologists. All rights reserved. Nonsense-mediated decay (NMD) is a posttranscriptional surveillance mechanism in eukaryotes that recognizes and degrades transcripts with premature translation-termination codons. The RNA polymerase II C-terminal domain phosphatase-like protein FIERY2 (FRY2; also known as C-TERMINAL DOMAIN PHOSPHATASE-LIKE1 [CPL1]) plays multiple roles in RNA processing in Arabidopsis thaliana. Here, we found that FRY2/CPL1 interacts with two NMD factors, eIF4AIII and UPF3, and is involved in the dephosphorylation of eIF4AIII. This dephosphorylation retains eIF4AIII in the nucleus and limits its accumulation in the cytoplasm. By analyzing RNA-seq data combined with quantitative RT-PCR validation, we found that a subset of alternatively spliced transcripts and 59-extended mRNAs with NMD-eliciting features accumulated in the fry2-1 mutant, cycloheximidetreated wild type, and upf3 mutant plants, indicating that FRY2 is essential for the degradation of these NMD transcripts.
Ire1 mediated mRNA splicing in a C-terminus deletion mutant of Drosophila Xbp1.
Directory of Open Access Journals (Sweden)
Dina S Coelho
Full Text Available The Unfolded Protein Response is a homeostatic mechanism that permits eukaryotic cells to cope with Endoplasmic Reticulum (ER stress caused by excessive accumulation of misfolded proteins in the ER lumen. The more conserved branch of the UPR relies on an ER transmembrane enzyme, Ire1, which, upon ER stress, promotes the unconventional splicing of a small intron from the mRNA encoding the transcription factor Xbp1. In mammals, two specific regions (the hydrophobic region 2--HR2--and the C-terminal translational pausing site present in the Xbp1unspliced protein mediate the recruitment of the Xbp1 mRNA-ribosome-nascent chain complex to the ER membrane, so that Xbp1 mRNA can be spliced by Ire1. Here, we generated a Drosophila Xbp1 deletion mutant (Excision101 lacking both HR2 and C-terminal region, but not the Ire1 splicing site. We show that Ire1-dependent splicing of Xbp1 mRNA is reduced, but not abolished in Excision101. Our results suggest the existence of additional mechanisms for ER membrane targeting of Xbp1 mRNA that are independent of the C-terminal domain of Drosophila Xbp1unspliced.
Receptor-targeted aptamer-siRNA conjugate-directed transcriptional regulation of HIV-1
Zhou, Jiehua; Lazar, Daniel; Li, Haitang; Xia, Xin; Satheesan, Sangeetha; Charlins, Paige; O'Mealy, Denis; Akkina, Ramesh; Saayman, Sheena; Weinberg, Marc S.; Rossi, John J.; Morris, Kevin V.
2018-01-01
Gene-based therapies represent a promising therapeutic paradigm for the treatment of HIV-1, as they have the potential to maintain sustained viral inhibition with reduced treatment interventions. Such an option may represent a long-term treatment alternative to highly active antiretroviral therapy. Methods: We previously described a therapeutic approach, referred to as transcriptional gene silencing (TGS), whereby small noncoding RNAs directly inhibit the transcriptional activity of HIV-1 by targeting sites within the viral promoter, specifically the 5' long terminal repeat (LTR). TGS differs from traditional RNA interference (RNAi) in that it is characterized by concomitant silent-state epigenetic marks on histones and DNA. To deliver TGS-inducing RNAs, we developed functional RNA conjugates based on the previously reported dual function of the gp120 (A-1) aptamer conjugated to 27-mer Dicer-substrate anti-HIV-1 siRNA (dsiRNA), LTR-362. Results: We demonstrate here that high levels of processed guide RNAs localize to the nucleus in infected T lymphoblastoid CEM cell line and primary human CD4+ T-cells. Treatment of the aptamer-siRNA conjugates induced TGS with an ~10-fold suppression of viral p24 levels as measured at day 12 post infection. To explore the silencing efficacy of aptamer-siRNA conjugates in vivo, HIV-1-infected humanized NOD/SCID/IL2 rγnull mice (hu-NSG) were treated with the aptamer-siRNA conjugates. Systemic delivery of the A-1-stick-LTR-362 27-mer siRNA conjugates suppressed HIV-1 infection and protected CD4+ T cell levels in viremia hu-NSG mice. Principle conclusions: Collectively these data suggest that the gp120 aptamer-dsiRNA conjugate design is suitable for systemic delivery of small RNAs that can be used to suppress HIV-1. PMID:29556342
DEFF Research Database (Denmark)
Skovgaard, Casper; Brandt, Nina; Pilegaard, Henriette
2016-01-01
The aim of this study was to investigate the mRNA response related to mitochondrial biogenesis, metabolism, angiogenesis, and myogenesis in trained human skeletal muscle to speed endurance exercise (S), endurance exercise (E), and speed endurance followed by endurance exercise (S + E). Seventeen...... trained male subjects (maximum oxygen uptake (VO2-max): 57.2 ± 3.7 (mean ± SD) mL·min(-1)·kg(-1)) performed S (6 × 30 sec all-out), E (60 min ~60% VO2-max), and S + E on a cycle ergometer on separate occasions. Muscle biopsies were obtained at rest and 1, 2, and 3 h after the speed endurance exercise (S...... and S + E) and at rest, 0, 1, and 2 h after exercise in E In S and S + E, muscle peroxisome proliferator-activated receptor-γ coactivator-1 (PGC-1α) and pyruvate dehydrogenase kinase-4 (PDK4) mRNA were higher (P endurance exercise than at rest. Muscle PGC-1α and PDK4 m...
1,25 dihydroxyvitamin D3 (1,25) regulation of c-myc mRNA in HL-60 leukemia cells
International Nuclear Information System (INIS)
Simpson, R.U.; Bresnick, E.H.; Begley, D.A.
1986-01-01
Recently, 1,25 was shown to induce differentiation and decrease c-myc levels in HL-60 cells. The authors have confirmed these observations by RNA dot blot analysis. Cells treated with 50 nM 1,25 for 4, 24 and 48 hr showed c-myc mRNA levels of 26, 17 and 15% of control respectively. β-Actin mRNA levels were not altered. To ascertain whether 1, 25 regulated c-myc transcriptionally, an HL-60 nuclear RNA runoff assay was developed. Assay of total nuclei transcriptional activity revealed that 50% of RNA elongation was α-amanitin (0.8 μg/ml) sensitive and was linear with nuclei concentration (0.1-1 x 10 7 nuclei). 1,25 (50 nM) treated (45-96 hr) cells had decreased (approx.40%) total transcription rate relative to control. Decreased total RNA synthesis occurred concomitant with NBT reducing activity. 32 P-RNA runoff transcripts from HL-60 nuclei were hybridized to excess (5 μg DNA was excess) Pst I linearized c-myc and β-actin clones (in pBR322) immobilized on nitrocellulose filter. 32 P-RNA input from 2 x 10 6 to 2 x 10 7 cpm yielded linear hybridization signal. Analysis of blot dot intensity revealed no difference in transcription of c-myc in nuclei from 1,25 dosed or control cells. (myc/actin ratios: 1,25 (50 nM, 72 hr) =1.1 +/- 0.3 and control (72 hr) = 1.0, N=3 or 2 or 3 dots ea). These preliminary data suggest 1,25 does not affect c-myc transcription in HL-60 nuclei and may regulate c-myc mRNA post-transcriptionally
Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H
2004-04-01
Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.
Marquet, R; Baudin, F; Gabus, C; Darlix, J L; Mougel, M; Ehresmann, C; Ehresmann, B
1991-05-11
The retroviral genome consists of two identical RNA molecules joined close to their 5' ends by the dimer linkage structure. Recent findings indicated that retroviral RNA dimerization and encapsidation are probably related events during virion assembly. We studied the cation-induced dimerization of HIV-1 RNA and results indicate that all in vitro generated HIV-1 RNAs containing a 100 nucleotide domain downstream from the 5' splice site are able to dimerize. RNA dimerization depends on the concentration of RNA, mono- and multivalent cations, the size of the monovalent cation, temperature, and pH. Up to 75% of HIV-1 RNA is dimeric in the presence of spermidine. HIV-1 RNA dimer is fairly resistant to denaturing agents and unaffected by intercalating drugs. Antisense HIV-1 RNA does not dimerize but heterodimers can be formed between HIV-1 RNA and either MoMuLV or RSV RNA. Therefore retroviral RNA dimerization probably does not simply proceed through mechanisms involving Watson-Crick base-pairing. Neither adenine and cytosine protonation, nor quartets containing only guanines appear to determine the stability of the HIV-1 RNA dimer, while quartets involving both adenine(s) and guanine(s) could account for our results. A consensus sequence PuGGAPuA found in the putative dimerization-encapsidation region of all retroviral genomes examined may participate in the dimerization process.
Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Abdo Arbex, Marcos; Alarcon Arrascue, Edith; Alffenaar, Jan Willem; Caminero, Jose A; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmín; Scardigli, Anna; Akkerman, Onno W; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marín, Félix Antonio; Collahuazo López, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista
2016-06-01
No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug- and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution of imipenem/clavulanate versus meropenem/clavulanate added to background regimens to treat MDR- and XDR-TB cases.84 patients treated with imipenem/clavulanate-containing regimens showed a similar median number of antibiotic resistances (8 versus 8) but more fluoroquinolone resistance (79.0% versus 48.9%, pimipenem/clavulanate- and meropenem/clavulanate-containing regimens for a median (interquartile range) of 187 (60-428) versus 85 (49-156) days, respectively.Statistically significant differences were observed on sputum smear and culture conversion rates (79.7% versus 94.8%, p=0.02 and 71.9% versus 94.8%, pimipenem/clavulanate and meropenem/clavulanate were reported in 5.4% and 6.5% of cases only.Our study suggests that meropenem/clavulanate is more effective than imipenem/clavulanate in treating MDR/XDR-TB patients. Copyright ©ERS 2016.
Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA
Directory of Open Access Journals (Sweden)
Eric R. Gamache
2017-04-01
Full Text Available The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT. To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1, a 1-nucleotide interhelical loop and an 8-bp stem (S2 that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging.
International Nuclear Information System (INIS)
Asai, Kengo; Platt, Craig; Cochrane, Alan
2003-01-01
The control of HIV-1 viral RNA splicing and transport plays an important role in the successful replication of the virus. Previous studies have identified both an exon splicing enhancer (ESE) and a bipartite exon splicing silencer (ESS3a and ESS3b) within the terminal exon of HIV-1 that are involved in modulating both splicing and Rev-mediated export of viral RNA. To define the mechanism of ESS3a function, experiments were carried out to better define the cis and trans components required for ESS3a activity. Mutations throughout the 30-nt element resulted in partial loss of ESS function. Combining mutations was found to have an additive effect, suggesting the presence of multiple binding sites. Analysis of interacting factors identified hnRNP A1 as one component of the complex that modulates ESS3a activity. However, subsequent binding analyses determined that hnRNP A1 interacts with only one portion of ESS3a, suggesting the involvement of another host factor. Parallel analysis of the effect of the mutations on Rev-mediated export determined that there is not a direct correlation between the effect of the mutations on splicing and RNA transport. Consistent with this hypothesis, replacement of ESS3a with consensus hnRNP A1 binding sites was found to be insufficient to block Rev-mediated RNA export
Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hua; Li, Hau; Florens, Laurence; Mak, Ho Yi
2012-04-15
The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans.
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
International Nuclear Information System (INIS)
Del Vecchio, S.; Ciarmiello, A.; Potena, M.I.; Carriero, M.V.; Mainolfi, C.; Botti, G.; Thomas, R.; Cerra, M.; D'Aiuto, G.; Tsuruo, T.; Salvatore, M.
1997-01-01
Technetium-99m sestamibi is a transport substrate recognised by the multidrug-resistant P-glycoprotein (Pgp). To test whether 99m Tc-sestamibi efflux is enhanced in breast carcinomas overexpressing Pgp, we determined the efflux rates of 99m Tc-sestamibi and Pgp levels in tumours from 30 patients with untreated breast carcinoma. Patients were intravenously injected with 740 MBq of 99m Tc-sestamibi and underwent a 15-min dynamic study followed by the acquisition of static planar images at 0.5, 1, 2 and 4 h. Tumour specimens were obtained from each patient 24 h after 99m Tc-sestamibi scan and Pgp levels were determined using 125 I-MRK16 monoclonal antibody and in vitro quantitative autoradiography. All breast carcinomas showed high uptake of 99m Tc-sestamibi and data from region of interest analysis on sequential images were fitted with a monoexponential function. The efflux rates of 99m Tc-sestamibi, calculated from decay-corrected time-activity curves, ranged between 0.00121 and 0.01690 min -1 and were directly correlated with Pgp levels measured in the same tumours (r=0.62; P 99m Tc-sestamibi efflux from tumours of group A was 2.7 times higher than that observed in tumours of group B (0.00686 ±0.00390 min -1 vs 0.00250 ±0.00090 min -1 , P 99m Tc-sestamibi showed a sensitivity and a specificity of 80% and 95%, respectively. In conclusion, the efflux rate of 99m Tc-sestamibi may be used for the in vivo identification of the multidrug resistant (MDR1) phenotype in untreated breast cancer patients. (orig.). With 7 figs., 3 tabs
MicroRNA-1 overexpression blunts cardiomyocyte hypertrophy elicited by thyroid hormone.
Diniz, Gabriela Placoná; Lino, Caroline Antunes; Moreno, Camila Rodrigues; Senger, Nathalia; Barreto-Chaves, Maria Luiza Morais
2017-12-01
It is well-known that increased thyroid hormone (TH) levels induce cardiomyocyte growth. MicroRNAs (miRNAs) have been identified as key players in cardiomyocyte hypertrophy, which is associated with increased risk of heart failure. In this study, we evaluated the miR-1 expression in TH-induced cardiac hypertrophy, as well as the potential involvement of miR-1 in cardiomyocyte hypertrophy elicited by TH in vitro. The possible role of type 1 angiotensin II receptor (AT1R) in the effect promoted by TH in miR-1 expression was also evaluated. Neonatal rat cardiac myocytes (NRCMs) were treated with T 3 for 24 hr and Wistar rats were subjected to hyperthyroidism for 14 days combined or not with AT1R blocker. Real Time RT-PCR analysis indicated that miR-1 expression was decreased in cardiac hypertrophy in response to TH in vitro and in vivo, and this effect was unchanged by AT1R blocker. In addition, HDAC4, which is target of miR-1, was increased in NRCMs after T 3 treatment. A gain-of-function study revealed that overexpression of miR-1 prevented T 3 -induced cardiomyocyte hypertrophy and reduced HADC4 mRNA levels in NRCMs. In vivo experiments confirmed the downregulation of miR-1 in cardiac tissue from hyperthyroid animals, which was accompanied by increased HDAC4 mRNA levels. In addition, HDAC inhibitor prevented T 3 -induced cardiomyocyte hypertrophy. Our data reveal a new mechanistic insight into cardiomyocyte growth in response to TH, suggesting that miR-1 plays a role in cardiomyocyte hypertrophy induced by TH potentially via targeting HADC4. © 2017 Wiley Periodicals, Inc.
RNA content in the nucleolus alters p53 acetylation via MYBBP1A
Kuroda, Takao; Murayama, Akiko; Katagiri, Naohiro; Ohta, Yu-mi; Fujita, Etsuko; Masumoto, Hiroshi; Ema, Masatsugu; Takahashi, Satoru; Kimura, Keiji; Yanagisawa, Junn
2011-01-01
A number of external and internal insults disrupt nucleolar structure, and the resulting nucleolar stress stabilizes and activates p53. We show here that nucleolar disruption induces acetylation and accumulation of p53 without phosphorylation. We identified three nucleolar proteins, MYBBP1A, RPL5, and RPL11, involved in p53 acetylation and accumulation. MYBBP1A was tethered to the nucleolus through nucleolar RNA. When rRNA transcription was suppressed by nucleolar stress, MYBBP1A translocated to the nucleoplasm and facilitated p53–p300 interaction to enhance p53 acetylation. We also found that RPL5 and RPL11 were required for rRNA export from the nucleolus. Depletion of RPL5 or RPL11 blocked rRNA export and counteracted reduction of nucleolar RNA levels caused by inhibition of rRNA transcription. As a result, RPL5 or RPL11 depletion inhibited MYBBP1A translocation and p53 activation. Our observations indicated that a dynamic equilibrium between RNA generation and export regulated nucleolar RNA content. Perturbation of this balance by nucleolar stress altered the nucleolar RNA content and modulated p53 activity. PMID:21297583
Directory of Open Access Journals (Sweden)
Hoorig Nassanian
2007-08-01
Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.
LncRNA TUG1 sponges microRNA-9 to promote neurons apoptosis by up-regulated Bcl2l11 under ischemia.
Chen, Shengcai; Wang, Mengdie; Yang, Hang; Mao, Ling; He, Quanwei; Jin, Huijuan; Ye, Zi-Ming; Luo, Xue-Ying; Xia, Yuan-Peng; Hu, Bo
2017-03-25
Emerging studies have illustrated that LncRNAs TUG1 play critical roles in multiple biologic processes. However, the LncRNA TUG1 expression and function in ischemic stroke have not been reported yet. In this study, we found that LncRNA TUG1 expression was significantly up-regulated in brain ischemic penumbra from rat middle carotid artery occlusion (MCAO) model, while similar results were also observed in cultured neurons under oxygen-glucose deprivation (OGD) insult. Knockdown of TUG1 decreased the ratio of apoptotic cells and promoted cells survival in vitro, which may be regulated by the elevated miRNA-9 expression and decreased Bcl2l11 protein. Furthermore, TUG1 could directly interact with miR-9 and down-regulating miR-9 could efficiently reverse the function of TUG1 on the Bcl2l11 expression. In summary, our result sheds light on the role of LncRNA TUG1 as a miRNA sponge for ischemic stroke, possibly providing a new therapeutic target in stroke. Copyright © 2017 Elsevier Inc. All rights reserved.
Structural Insights into RNA Recognition by the Alternate-Splicing Regulator CUG-Binding Protein 1
Energy Technology Data Exchange (ETDEWEB)
M Teplova; J Song; H Gaw; A Teplov; D Patel
2011-12-31
CUG-binding protein 1 (CUGBP1) regulates multiple aspects of nuclear and cytoplasmic mRNA processing, with implications for onset of myotonic dystrophy. CUGBP1 harbors three RRM domains and preferentially targets UGU-rich mRNA elements. We describe crystal structures of CUGBP1 RRM1 and tandem RRM1/2 domains bound to RNAs containing tandem UGU(U/G) elements. Both RRM1 in RRM1-RNA and RRM2 in RRM1/2-RNA complexes use similar principles to target UGU(U/G) elements, with recognition mediated by face-to-edge stacking and water-mediated hydrogen-bonding networks. The UG step adopts a left-handed Z-RNA conformation, with the syn guanine recognized through Hoogsteen edge-protein backbone hydrogen-bonding interactions. NMR studies on the RRM1/2-RNA complex establish that both RRM domains target tandem UGUU motifs in solution, whereas filter-binding assays identify a preference for recognition of GU over AU or GC steps. We discuss the implications of CUGBP1-mediated targeting and sequestration of UGU(U/G) elements on pre-mRNA alternative-splicing regulation, translational regulation, and mRNA decay.
Mechanism for Coordinated RNA Packaging and Genome Replication by Rotavirus Polymerase VP1
Energy Technology Data Exchange (ETDEWEB)
Lu, Xiaohui; McDonald, Sarah M.; Tortorici, M. Alejandra; Tao, Yizhi Jane; Vasquez-Del Carpio, Rodrigo; Nibert, Max L.; Patton, John T.; Harrison, Stephen C. (Harvard-Med); (NIH); (CH-Boston)
2009-04-08
Rotavirus RNA-dependent RNA polymerase VP1 catalyzes RNA synthesis within a subviral particle. This activity depends on core shell protein VP2. A conserved sequence at the 3' end of plus-strand RNA templates is important for polymerase association and genome replication. We have determined the structure of VP1 at 2.9 {angstrom} resolution, as apoenzyme and in complex with RNA. The cage-like enzyme is similar to reovirus {lambda}3, with four tunnels leading to or from a central, catalytic cavity. A distinguishing characteristic of VP1 is specific recognition, by conserved features of the template-entry channel, of four bases, UGUG, in the conserved 3' sequence. Well-defined interactions with these bases position the RNA so that its 3' end overshoots the initiating register, producing a stable but catalytically inactive complex. We propose that specific 3' end recognition selects rotavirus RNA for packaging and that VP2 activates the autoinhibited VP1/RNA complex to coordinate packaging and genome replication.
Directory of Open Access Journals (Sweden)
Shirley Lam
Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these
Increased p38-MAPK is responsible for chemotherapy resistance in human gastric cancer cells
International Nuclear Information System (INIS)
Guo, Xianling; Zhang, Baihe; Wu, Mengchao; Wei, Lixin; Ma, Nannan; Wang, Jin; Song, Jianrui; Bu, Xinxin; Cheng, Yue; Sun, Kai; Xiong, Haiyan; Jiang, Guocheng
2008-01-01
Chemoresistance is one of the main obstacles to successful cancer therapy and is frequently associated with Multidrug resistance (MDR). Many different mechanisms have been suggested to explain the development of an MDR phenotype in cancer cells. One of the most studied mechanisms is the overexpression of P-glycoprotein (P-gp), which is a product of the MDR1 gene. Tumor cells often acquire the drug-resistance phenotype due to upregulation of the MDR1 gene. Overexpression of MDR1 gene has often been reported in primary gastric adenocarcinoma. This study investigated the role of p38-MAPK signal pathway in vincristine-resistant SGC7901/VCR cells. P-gp and MDR1 RNA were detected by Western blot analysis and RT-PCR amplification. Mitgen-activated protein kinases and function of P-gp were demonstrated by Western blot and FACS Aria cytometer analysis. Ap-1 activity and cell apoptosis were detected by Dual-Luciferase Reporter Assay and annexin V-PI dual staining. The vincristine-resistant SGC7901/VCR cells with increased expression of the multidrug-resistance 1 (MDR1) gene were resistant to P-gp-related drug and P-gp-unrelated drugs. Constitutive increases of phosphorylated p38-MAPK and AP-1 activities were also found in the drug-resistant cells. Inhibition of p38-MAPK by SB202190 reduced activator protein-1 (AP-1) activity and MDR1 expression levels and increased the sensitivity of SGC7901/VCR cells to chemotherapy. Activation of the p38-MAPK pathway might be responsible for the modulation of P-glycoprotein-mediated and P-glycoprotein-unmediated multidrug resistance in the SGC7901/VCR cell line
Olson, Erik D; Musier-Forsyth, Karin
2018-03-31
Retroviral Gag proteins are responsible for coordinating many aspects of virion assembly. Gag possesses two distinct nucleic acid binding domains, matrix (MA) and nucleocapsid (NC). One of the critical functions of Gag is to specifically recognize, bind, and package the retroviral genomic RNA (gRNA) into assembling virions. Gag interactions with cellular RNAs have also been shown to regulate aspects of assembly. Recent results have shed light on the role of MA and NC domain interactions with nucleic acids, and how they jointly function to ensure packaging of the retroviral gRNA. Here, we will review the literature regarding RNA interactions with NC, MA, as well as overall mechanisms employed by Gag to interact with RNA. The discussion focuses on human immunodeficiency virus type-1, but other retroviruses will also be discussed. A model is presented combining all of the available data summarizing the various factors and layers of selection Gag employs to ensure specific gRNA packaging and correct virion assembly. Copyright © 2018 Elsevier Ltd. All rights reserved.
Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes.
Directory of Open Access Journals (Sweden)
Thomas Birkballe Hansen
Full Text Available BACKGROUND: miRNAs are key players in gene expression regulation. To fully understand the complex nature of cellular differentiation or initiation and progression of disease, it is important to assess the expression patterns of as many miRNAs as possible. Thereby, identifying novel miRNAs is an essential prerequisite to make possible a comprehensive and coherent understanding of cellular biology. METHODOLOGY/PRINCIPAL FINDINGS: Based on two extensive, but previously published, small RNA sequence datasets from human embryonic stem cells and human embroid bodies, respectively [1], we identified 112 novel miRNA-like structures and were able to validate miRNA processing in 12 out of 17 investigated cases. Several miRNA candidates were furthermore substantiated by including additional available small RNA datasets, thereby demonstrating the power of combining datasets to identify miRNAs that otherwise may be assigned as experimental noise. CONCLUSIONS/SIGNIFICANCE: Our analysis highlights that existing datasets are not yet exhaustedly studied and continuous re-analysis of the available data is important to uncover all features of small RNA sequencing.
A comprehensive evaluation of the sl1p pipeline for 16S rRNA gene sequencing analysis.
Whelan, Fiona J; Surette, Michael G
2017-08-14
Advances in next-generation sequencing technologies have allowed for detailed, molecular-based studies of microbial communities such as the human gut, soil, and ocean waters. Sequencing of the 16S rRNA gene, specific to prokaryotes, using universal PCR primers has become a common approach to studying the composition of these microbiota. However, the bioinformatic processing of the resulting millions of DNA sequences can be challenging, and a standardized protocol would aid in reproducible analyses. The short-read library 16S rRNA gene sequencing pipeline (sl1p, pronounced "slip") was designed with the purpose of mitigating this lack of reproducibility by combining pre-existing tools into a computational pipeline. This pipeline automates the processing of raw 16S rRNA gene sequencing data to create human-readable tables, graphs, and figures to make the collected data more readily accessible. Data generated from mock communities were compared using eight OTU clustering algorithms, two taxon assignment approaches, and three 16S rRNA gene reference databases. While all of these algorithms and options are available to sl1p users, through testing with human-associated mock communities, AbundantOTU+, the RDP Classifier, and the Greengenes 2011 reference database were chosen as sl1p's defaults based on their ability to best represent the known input communities. sl1p promotes reproducible research by providing a comprehensive log file, and reduces the computational knowledge needed by the user to process next-generation sequencing data. sl1p is freely available at https://bitbucket.org/fwhelan/sl1p .
Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R
2016-08-01
To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (PNT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (PNT1 cells, which may provide a new therapeutic target for atypical chronic myelogenous leukemia.
Promising therapy of XDR-TB/MDR-TB with thioridazine an inhibitor of bacterial efflux pumps
DEFF Research Database (Denmark)
Amaral, L; Martins, M; Viveiros, M
2008-01-01
-TB) - a M. tuberculosis organism that is resistant to the most effective second line drugs available for the treatment of TB. This review provides detailed, significant evidence that supports the use of an old neuroleptic compound, thioridazine (TZ), for the management of MDR-TB and XDR-TB infections...... therapy predictably ineffective and death is inevitable, compassionate therapy with TZ should be contemplated. The risks are small and the rewards great....
Wei, Wenjuan; Yang, Haifei; Hu, Lifen; Ye, Ying; Li, Jiabin
2017-12-01
Treatment of Acinetobacter baumannii infections is challenging owing to widespread multidrug-resistant A. baumannii (MDR-AB) and the lack of novel agents. Although recent data suggest that levofloxacin (LVX) may have unique activity against MDR-AB in combination with colistin (CST), further preclinical work is needed. We used a A. baumannii type strain ATCC19606, a CST-resistant strain AB19606R, and two clinical isolates (GN0624 and GN1115) of MDR-AB to investigate the in vitro and in vivo efficacy of LVX-CST combination. Synergy studies were performed using the microtiter plate chequerboard assay and time-kill methodology. Inhibitory activity of antibiotics against biofilms and the mutant prevention concentrations were also studied in vitro. A simple invertebrate model (Galleria mellonella) has been used to assess the in vivo activity of antimicrobial therapies. The LVX-CST combination was bactericidal against the CST-susceptible clinical isolate (GN0624). In checkerboard assays, synergy (defined as a fractional inhibitory concentration index of baumanni. Treatment of G. mellonella larvae infected with lethal doses of A. baumannii resulted in significantly enhanced survival rates when LVX was given with CST compared with CST treatment alone (p < 0.05). In summary, a synergistic or additive effect between CST and LVX was observed in vitro and in vivo against CST-susceptible A. baumannii strains, although not against CST-resistant ones. Copyright © 2015. Published by Elsevier B.V.
Wang, Xiuli; Cui, Fuai; Madhu, Vedavathi; Dighe, Abhijit S; Balian, Gary; Cui, Quanjun
2011-02-01
A novel strategy to enhance bone repair is to combine angiogenic factors and osteogenic factors. We combined vascular endothelial growth factor (VEGF) and LIM mineralization protein-1 (LMP-1) by using an internal ribosome entry site to link the genes within a single plasmid. We then evaluated the effects on osteoblastic differentiation in vitro and ectopic bone formation in vivo with a subcutaneously placed PLAGA scaffold loaded with a cloned mouse osteoprogenitor cell line, D1, transfected with plasmids containing VEGF and LMP-1 genes. The cells expressing both genes elevated mRNA expression of RunX2 and β-catenin and alkaline phosphatase activity compared to cells from other groups. In vivo, X-ray and micro-CT analysis of the retrieved implants revealed more ectopic bone formation at 2 and 3 weeks but not at 4 weeks compared to other groups. The results indicate that the combination of the therapeutic growth factors potentiates cell differentiation and may promote osteogenesis.
Khan, Mateen A; Ma, Jia; Walden, William E; Merrick, William C; Theil, Elizabeth C; Goss, Dixie J
2014-06-01
Metal ion binding was previously shown to destabilize IRE-RNA/IRP1 equilibria and enhanced IRE-RNA/eIF4F equilibria. In order to understand the relative importance of kinetics and stability, we now report rapid rates of protein/RNA complex assembly and dissociation for two IRE-RNAs with IRP1, and quantitatively different metal ion response kinetics that coincide with the different iron responses in vivo. kon, for FRT IRE-RNA binding to IRP1 was eight times faster than ACO2 IRE-RNA. Mn(2+) decreased kon and increased koff for IRP1 binding to both FRT and ACO2 IRE-RNA, with a larger effect for FRT IRE-RNA. In order to further understand IRE-mRNA regulation in terms of kinetics and stability, eIF4F kinetics with FRT IRE-RNA were determined. kon for eIF4F binding to FRT IRE-RNA in the absence of metal ions was 5-times slower than the IRP1 binding to FRT IRE-RNA. Mn(2+) increased the association rate for eIF4F binding to FRT IRE-RNA, so that at 50 µM Mn(2+) eIF4F bound more than 3-times faster than IRP1. IRP1/IRE-RNA complex has a much shorter life-time than the eIF4F/IRE-RNA complex, which suggests that both rate of assembly and stability of the complexes are important, and that allows this regulatory system to respond rapidly to change in cellular iron. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Energy Technology Data Exchange (ETDEWEB)
Kobayashi, Ayaho; Kanaba, Teppei [Graduate School of Science and Engineering, Tokyo Metropolitan University, Minamiosawa 1-1, Hachioji 192-0397 (Japan); Satoh, Ryosuke [Institute of Microbial Chemistry, 3-14-23 Kamiosaki, Shinagawa-ku 141-0021, Tokyo (Japan); Fujiwara, Toshinobu [Institute of Microbial Chemistry, 3-14-23 Kamiosaki, Shinagawa-ku 141-0021, Tokyo (Japan); Graduate School of Pharmaceutical Sciences, Nagoya City University, 3-1 Tanabe-dori, Mizuho-ku,Nagoya 467-8603 (Japan); Ito, Yutaka [Graduate School of Science and Engineering, Tokyo Metropolitan University, Minamiosawa 1-1, Hachioji 192-0397 (Japan); Sugiura, Reiko [Laboratory of Molecular Pharmacogenomics, School of Pharmaceutical Sciences, Kinki University, 3-4-1 Kowakae, Higashi-Osaka 577-8502 (Japan); Mishima, Masaki, E-mail: mishima-masaki@tmu.ac.jp [Graduate School of Science and Engineering, Tokyo Metropolitan University, Minamiosawa 1-1, Hachioji 192-0397 (Japan)
2013-07-19
Highlights: •Solution structure of the second RRM of Nrd1 was determined. •RNA binding site of the second RRM was estimated. •Regulatory mechanism of RNA binding by phosphorylation is discussed. -- Abstract: Negative regulator of differentiation 1 (Nrd1) is known as a negative regulator of sexual differentiation in fission yeast. Recently, it has been revealed that Nrd1 also regulates cytokinesis, in which physical separation of the cell is achieved by a contractile ring comprising many proteins including actin and myosin. Cdc4, a myosin II light chain, is known to be required for cytokinesis. Nrd1 binds and stabilizes Cdc4 mRNA, and thereby suppressing the cytokinesis defects of the cdc4 mutants. Interestingly, Pmk1 MAPK phosphorylates Nrd1, resulting in markedly reduced RNA binding activity. Furthermore, Nrd1 localizes to stress granules in response to various stresses, and Pmk1 phosphorylation enhances the localization. Nrd1 consists of four RRM domains, although the mechanism by which Pmk1 regulates the RNA binding activity of Nrd1 is unknown. In an effort to delineate the relationship between Nrd1 structure and function, we prepared each RNA binding domain of Nrd1 and examined RNA binding to chemically synthesized oligo RNA using NMR. The structure of the second RRM domain of Nrd1 was determined and the RNA binding site on the second RRM domain was mapped by NMR. A plausible mechanism pertaining to the regulation of RNA binding activity by phosphorylation is also discussed.
International Nuclear Information System (INIS)
Kobayashi, Ayaho; Kanaba, Teppei; Satoh, Ryosuke; Fujiwara, Toshinobu; Ito, Yutaka; Sugiura, Reiko; Mishima, Masaki
2013-01-01
Highlights: •Solution structure of the second RRM of Nrd1 was determined. •RNA binding site of the second RRM was estimated. •Regulatory mechanism of RNA binding by phosphorylation is discussed. -- Abstract: Negative regulator of differentiation 1 (Nrd1) is known as a negative regulator of sexual differentiation in fission yeast. Recently, it has been revealed that Nrd1 also regulates cytokinesis, in which physical separation of the cell is achieved by a contractile ring comprising many proteins including actin and myosin. Cdc4, a myosin II light chain, is known to be required for cytokinesis. Nrd1 binds and stabilizes Cdc4 mRNA, and thereby suppressing the cytokinesis defects of the cdc4 mutants. Interestingly, Pmk1 MAPK phosphorylates Nrd1, resulting in markedly reduced RNA binding activity. Furthermore, Nrd1 localizes to stress granules in response to various stresses, and Pmk1 phosphorylation enhances the localization. Nrd1 consists of four RRM domains, although the mechanism by which Pmk1 regulates the RNA binding activity of Nrd1 is unknown. In an effort to delineate the relationship between Nrd1 structure and function, we prepared each RNA binding domain of Nrd1 and examined RNA binding to chemically synthesized oligo RNA using NMR. The structure of the second RRM domain of Nrd1 was determined and the RNA binding site on the second RRM domain was mapped by NMR. A plausible mechanism pertaining to the regulation of RNA binding activity by phosphorylation is also discussed
Structural Basis for dsRNA Recognition by NS1 Protein of Influenza A Virus
Energy Technology Data Exchange (ETDEWEB)
Cheng, A.; Wong, S; Yuan, Y
2009-01-01
Influenza A viruses are important human pathogens causing periodic pandemic threats. Nonstructural protein 1 (NS1) protein of influenza A virus (NS1A) shields the virus against host defense. Here, we report the crystal structure of NS1A RNA-binding domain (RBD) bound to a double-stranded RNA (dsRNA) at 1.7A. NS1A RBD forms a homodimer to recognize the major groove of A-form dsRNA in a length-independent mode by its conserved concave surface formed by dimeric anti-parallel alpha-helices. dsRNA is anchored by a pair of invariable arginines (Arg38) from both monomers by extensive hydrogen bonds. In accordance with the structural observation, isothermal titration calorimetry assay shows that the unique Arg38-Arg38 pair and two Arg35-Arg46 pairs are crucial for dsRNA binding, and that Ser42 and Thr49 are also important for dsRNA binding. Agrobacterium co-infiltration assay further supports that the unique Arg38 pair plays important roles in dsRNA binding in vivo.
The Long Non-Coding RNA RHPN1-AS1 Promotes Uveal Melanoma Progression
Directory of Open Access Journals (Sweden)
Linna Lu
2017-01-01
Full Text Available Increasing evidence suggests that aberrant long non-coding RNAs (lncRNAs are significantly correlated with the pathogenesis, development and metastasis of cancers. RHPN1 antisense RNA 1 (RHPN1-AS1 is a 2030-bp transcript originating from human chromosome 8q24. However, the role of RHPN1-AS1 in uveal melanoma (UM remains to be clarified. In this study, we aimed to elucidate the molecular function of RHPN1-AS1 in UM. The RNA levels of RHPN1-AS1 in UM cell lines were examined using the quantitative real-time polymerase chain reaction (qRT-PCR. Short interfering RNAs (siRNAs were designed to quench RHPN1-AS1 expression, and UM cells stably expressing short hairpin (sh RHPN1-AS1 were established. Next, the cell proliferation and migration abilities were determined using a colony formation assay and a transwell migration/invasion assay. A tumor xenograft model in nude mice was established to confirm the function of RHPN1-AS1 in vivo. RHPN1-AS1 was significantly upregulated in a number of UM cell lines compared with the normal human retinal pigment epithelium (RPE cell line. RHPN1-AS1 knockdown significantly inhibited UM cell proliferation and migration in vitro and in vivo. Our data suggest that RHPN1-AS1 could be an oncoRNA in UM, which may serve as a candidate prognostic biomarker and target for new therapies in malignant UM.
Dual RNA Processing Roles of Pat1b via Cytoplasmic Lsm1-7 and Nuclear Lsm2-8 Complexes
Directory of Open Access Journals (Sweden)
Caroline Vindry
2017-08-01
Full Text Available Pat1 RNA-binding proteins, enriched in processing bodies (P bodies, are key players in cytoplasmic 5′ to 3′ mRNA decay, activating decapping of mRNA in complex with the Lsm1-7 heptamer. Using co-immunoprecipitation and immunofluorescence approaches coupled with RNAi, we provide evidence for a nuclear complex of Pat1b with the Lsm2-8 heptamer, which binds to the spliceosomal U6 small nuclear RNA (snRNA. Furthermore, we establish the set of interactions connecting Pat1b/Lsm2-8/U6 snRNA/SART3 and additional U4/U6.U5 tri-small nuclear ribonucleoprotein particle (tri-snRNP components in Cajal bodies, the site of snRNP biogenesis. RNA sequencing following Pat1b depletion revealed the preferential upregulation of mRNAs normally found in P bodies and enriched in 3′ UTR AU-rich elements. Changes in >180 alternative splicing events were also observed, characterized by skipping of regulated exons with weak donor sites. Our data demonstrate the dual role of a decapping enhancer in pre-mRNA processing as well as in mRNA decay via distinct nuclear and cytoplasmic Lsm complexes.
Directory of Open Access Journals (Sweden)
Llopis Ana
2010-03-01
Full Text Available Abstract Background Gene expression is achieved by the coordinated action of multiple factors to ensure a perfect synchrony from chromatin epigenetic regulation through to mRNA export. Sus1 is a conserved mRNA export/transcription factor and is a key player in coupling transcription initiation, elongation and mRNA export. In the nucleus, Sus1 is associated to the transcriptional co-activator SAGA and to the NPC associated complex termed TREX2/THSC. Through these associations, Sus1 mediates the nuclear dynamics of different gene loci and facilitate the export of the new transcripts. Results In this study, we have investigated whether the yeast Sus1 protein is linked to factors involved in mRNA degradation pathways. We provide evidence for genetic interactions between SUS1 and genes coding for components of P-bodies such as PAT1, LSM1, LSM6 and DHH1. We demonstrate that SUS1 deletion is synthetic lethal with 5'→3' decay machinery components LSM1 and PAT1 and has a strong genetic interaction with LSM6 and DHH1. Interestingly, Sus1 overexpression led to an accumulation of Sus1 in cytoplasmic granules, which can co-localise with components of P-bodies and stress granules. In addition, we have identified novel physical interactions between Sus1 and factors associated to P-bodies/stress granules. Finally, absence of LSM1 and PAT1 slightly promotes the Sus1-TREX2 association. Conclusions In this study, we found genetic and biochemical association between Sus1 and components responsible for cytoplasmic mRNA metabolism. Moreover, Sus1 accumulates in discrete cytoplasmic granules, which partially co-localise with P-bodies and stress granules under specific conditions. These interactions suggest a role for Sus1 in gene expression during cytoplasmic mRNA metabolism in addition to its nuclear function.
Assessing the miRNA sponge potential of RUNX1T1 in t(8;21) acute myeloid leukemia
DEFF Research Database (Denmark)
Junge, Alexander; Zandi, Roza; Havgaard, Jakob Hull
2017-01-01
available t(8;21) AML RNA-Seq and miRNA-Seq data available from The Cancer Genome Atlas (TCGA) project, we obtained a network consisting of 605 genes that may act as ceRNAs competing for miRNAs with the suggested RUNX1T1 miRNA sponge. Among the 605 ceRNA candidates, 121 have previously been implied...... in cancer development. Players in the integrin, cadherin, and Wnt signaling pathways affected by the RUNX1T1 sponge were overrepresented. Finally, among a set of 21 high interest RUNX1T1 ceRNAs we found multiple genes that have previously been linked to AML formation. In conclusion, our study offers a novel...
Assignment methodology for larger RNA oligonucleotides: Application to an ATP-binding RNA aptamer
International Nuclear Information System (INIS)
Dieckmann, Thorsten; Feigon, Juli
1997-01-01
The use of uniform 13C, 15N labeling in the NMR spectroscopic study of RNA structures has greatly facilitated the assignment process in small RNA oligonucleotides. For ribose spinsystem assignments, exploitation of these labels has followed previously developed methods for the study of proteins. However, for sequential assignment of the exchangeable and nonexchangeable protons of the nucleotides, it has been necessary to develop a variety of new NMR experiments. Even these are of limited utility in the unambiguous assignment of larger RNAs due to the short carbon relaxation times and extensive spectral overlap for all nuclei.These problems can largely be overcome by the additional use of base-type selectively 13C, 15N-labeled RNA in combination with a judicious use of related RNAs with base substitutions. We report the application of this approach to a 36-nucleotide ATP-binding RNA aptamer in complex with AMP. Complete sequential 1H assignments, as well as the majority of 13C and 15N assignments, were obtained
The clinical significance and biological function of lncRNA RGMB-AS1 in hepatocellular carcinoma.
Sheng, Nan; Li, Yannan; Qian, Ruikun; Li, Yichun
2018-02-01
LncRNA RGMB-AS1 has been suggested to play significant roles in lung cancer progression. However, it remains unknown whether lncRNA RGMB-AS1 is involved in the development and progression of hepatocellular carcinoma. In our results, lncRNA RGMB-AS1 was low-expressed in hepatocellular carcinoma tissues and cell lines, and associated with clinical stage, tumor size and metastasis. Survival analysis indicated that lncRNA RGMB-AS1 high was an independent favorable prognostic factor for hepatocellular carcinoma patients. Gain-of-function studies showed up-regulated lncRNA RGMB-AS1 expression suppressed hepatocellular carcinoma cells proliferation, migration and invasion, and promoted cells apoptosis. There was a positively association between lncRNA RGMB-AS1 and RGMB in hepatocellular carcinoma tissues, and up-regulated lncRNA RGMB-AS1 expression increased RGMB mRNA and protein expressions in hepatocellular carcinoma cells. In conclusion, lncRNA RGMB-AS1 serves an anti-oncogenic role in hepatocellular carcinoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Yedidi, Ravikiran S. [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Muhuhi, Joseck M. [Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); Liu, Zhigang [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Bencze, Krisztina Z. [Department of Chemistry, Fort Hays State University, Hays, KS 67601 (United States); Koupparis, Kyriacos [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); O’Connor, Carrie E.; Kovari, Iulia A. [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Spaller, Mark R. [Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); Kovari, Ladislau C., E-mail: kovari@med.wayne.edu [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States)
2013-09-06
Highlights: •Inhibitors against MDR HIV-1 protease were designed, synthesized and evaluated. •Lead peptide (6a) showed potent inhibition (IC{sub 50}: 4.4 nM) of MDR HIV-1 protease. •(6a) Showed favorable binding isotherms against NL4-3 and MDR proteases. •(6a) Induced perturbations in the {sup 15}N-HSQC spectrum of MDR HIV-1 protease. •Molecular modeling suggested that (6a) may induce total flap closure inMDR protease. -- Abstract: Multidrug-resistant (MDR) clinical isolate-769, human immunodeficiency virus type-1 (HIV-1) protease (PDB ID: (1TW7)), was shown to exhibit wide-open flaps and an expanded active site cavity, causing loss of contacts with protease inhibitors. In the current study, the expanded active site cavity of MDR769 HIV-1 protease was screened with a series of peptide-inhibitors that were designed to mimic the natural substrate cleavage site, capsid/p2. Scanning Ala/Phe chemical mutagenesis approach was incorporated into the design of the peptide series to mimic the substrate co-evolution. Among the peptides synthesized and evaluated, a lead peptide (6a) with potent activity (IC{sub 50}: 4.4 nM) was identified against the MDR769 HIV-1 protease. Isothermal titration calorimetry data showed favorable binding profile for 6aagainst both wild type and MDR769 HIV-1 protease variants. Nuclear magnetic resonance spectrum of {sup 15}N-labeled MDR769 HIV-1 protease in complex with 6a showed some major perturbations in chemical shift, supporting the peptide induced conformational changes in protease. Modeling analysis revealed multiple contacts between 6a and MDR769 HIV-1 protease. The lead peptide-inhibitor, 6a, with high potency and good binding profile can be used as the basis for developing potent small molecule inhibitors against MDR variants of HIV.
International Nuclear Information System (INIS)
Yedidi, Ravikiran S.; Muhuhi, Joseck M.; Liu, Zhigang; Bencze, Krisztina Z.; Koupparis, Kyriacos; O’Connor, Carrie E.; Kovari, Iulia A.; Spaller, Mark R.; Kovari, Ladislau C.
2013-01-01
Highlights: •Inhibitors against MDR HIV-1 protease were designed, synthesized and evaluated. •Lead peptide (6a) showed potent inhibition (IC 50 : 4.4 nM) of MDR HIV-1 protease. •(6a) Showed favorable binding isotherms against NL4-3 and MDR proteases. •(6a) Induced perturbations in the 15 N-HSQC spectrum of MDR HIV-1 protease. •Molecular modeling suggested that (6a) may induce total flap closure inMDR protease. -- Abstract: Multidrug-resistant (MDR) clinical isolate-769, human immunodeficiency virus type-1 (HIV-1) protease (PDB ID: (1TW7)), was shown to exhibit wide-open flaps and an expanded active site cavity, causing loss of contacts with protease inhibitors. In the current study, the expanded active site cavity of MDR769 HIV-1 protease was screened with a series of peptide-inhibitors that were designed to mimic the natural substrate cleavage site, capsid/p2. Scanning Ala/Phe chemical mutagenesis approach was incorporated into the design of the peptide series to mimic the substrate co-evolution. Among the peptides synthesized and evaluated, a lead peptide (6a) with potent activity (IC 50 : 4.4 nM) was identified against the MDR769 HIV-1 protease. Isothermal titration calorimetry data showed favorable binding profile for 6aagainst both wild type and MDR769 HIV-1 protease variants. Nuclear magnetic resonance spectrum of 15 N-labeled MDR769 HIV-1 protease in complex with 6a showed some major perturbations in chemical shift, supporting the peptide induced conformational changes in protease. Modeling analysis revealed multiple contacts between 6a and MDR769 HIV-1 protease. The lead peptide-inhibitor, 6a, with high potency and good binding profile can be used as the basis for developing potent small molecule inhibitors against MDR variants of HIV
Characterization of a major late herpes simplex virus type 1 mRNA.
Costa, R H; Devi, B G; Anderson, K P; Gaylord, B H; Wagner, E K
1981-05-01
A major, late 6-kilobase (6-kb) mRNa mapping in the large unique region of herpes simplex virus type 1 (HSV-1) was characterized by using two recombinant DNA clones, one containing EcoRI fragment G (0.190 to 0.30 map units) in lambda. WES.B (L. Enquist, M. Madden, P. Schiop-Stansly, and G. Vandl Woude, Science 203:541-544, 1979) and one containing HindIII fragment J (0.181 to 0.259 map units) in pBR322. This 6-kb mRNA had its 3' end to the left of 0.231 on the prototypical arrangement of the HSV-1 genome and was transcribed from right to left. It was bounded on both sides by regions containing a large number of distinct mRNA species, and its 3' end was partially colinear with a 1.5-kb mRNA which encoded a 35,000-dalton polypeptide. The 6-kb mRNA encoded a 155,000-dalton polypeptide which was shown to be the only one of this size detectable by hybrid-arrested translation encoded by late polyadenylated polyribosomal RNA. The S1 nuclease mapping experiments indicated that there were no introns in the coding sequence for this mRNA and that its 3' end mapped approximately 800 nucleotides to the left of the BglII site at 0.231, whereas its 5' end extended very close to the BamHI site at 0.266.
Schultz, Eliette; Haenni, Marisa; Mereghetti, Laurent; Siebor, Eliane; Neuwirth, Catherine; Madec, Jean-Yves; Cloeckaert, Axel; Doublet, Benoît
2015-09-01
To characterize MDR genomic islands related to Salmonella genomic island 1 (SGI1) and Proteus genomic island 1 (PGI1) in Proteus mirabilis from human and animal sources in France in light of the previously reported cases. A total of 52 and 46 P. mirabilis clinical strains from human and animal sources, respectively, were studied for the period 2010-13. MDR was assessed by antimicrobial susceptibility testing, PCR detection of SGI1 and PGI1 and PCR mapping of the MDR regions. The diversity of the SGI1/PGI1-positive P. mirabilis strains was assessed by PFGE. Twelve P. mirabilis strains (5 humans and 7 dogs) were found to harbour an MDR island related to SGI1 or PGI1. Among them, several SGI1 variants were identified in diverse P. mirabilis genetic backgrounds. The variant SGI1-V, which harbours the ESBL bla VEB-6 gene, was found in closely genetically related human and dog P. mirabilis strains. The recently described PGI1 element was also identified in human and dog strains. Finally, one strain harboured a novel SGI genomic island closely related to SGI1 and SGI2 without an insertion of the MDR region. This study reports for the first time, to our knowledge, SGI1-positive and PGI1-positive P. mirabilis strains from dogs in France. The genetic diversity of the strains suggests several independent horizontal acquisitions of these MDR elements. The potential transmission of SGI1/PGI1-positive P. mirabilis strains between animals and humans is of public health concern, notably with regard to the spread of ESBL and carbapenemase genes, i.e. bla VEB-6 and bla NDM-1. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Aliyev, Altay; Patel, Jinesh; Brainard, Jennifer; Gupta, Manjula; Nasr, Christian; Hatipoglu, Betul; Siperstein, Allan; Berber, Eren
2016-01-01
The aim of this study was to analyze the usefulness of thyrotropin receptor messenger RNA (TSHR-mRNA) combined with neck ultrasonography (US) in the management of thyroid nodules with Bethesda III-V cytology. Cytology slides of patients with a preoperative fine needle aspiration (FNA) and TSHR-mRNA who underwent thyroidectomy between 2002 and 2011 were recategorized based on the Bethesda classification. Results of thyroid FNA, TSHR-mRNA, and US were compared with the final pathology. Sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were calculated. There were 12 patients with Bethesda III, 112 with Bethesda IV, and 58 with Bethesda V cytology. The sensitivity of TSHR-mRNA in predicting cancer was 33%, 65%, and 79 %, and specificity was 67%, 66%, and 71%, for Bethesda III, IV, and V categories, respectively. For the same categories, the PPV of TSHR-mRNA was 25%, 33%, and 79%, respectively; whereas the NPV was 75%, 88%, and 71%, respectively. The addition of neck US to TSHR-mRNA increased the NPV to 100% for Bethesda III, and 86%, for Bethesda IV, and 82% for Bethesda V disease. This study documents the potential usefulness of TSHR-mRNA for thyroid nodules with Bethesda III-V FNA categories. TSHR-mRNA may be used to exclude Bethesda IV disease. A large sample analysis is needed to determine its accuracy for Bethesda category III nodules. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Bodo C. Melnik
2017-09-01
Full Text Available Background: The perception of milk has changed from a “simple food” to a more sophisticated bioactive functional signaling system that promotes mTORC1-driven postnatal anabolism, growth, and development of the newborn infant. Accumulating evidence supports the view that milk´s miRNAs significantly contribute to these processes. The most abundant miRNA of milk found in milk fat and milk exosomes is miRNA-148a, which targets DNA methyltransferase 1 (DNMT1, a pivotal epigenetic regulator that suppresses transcription. Furthermore, milk-derived miRNA-125b, miRNA-30d, and miRNA-25 target TP53, the guardian of the genome that interacts with DNMT1 and regulates metabolism, cell kinetics, and apoptosis. Thus, the question arose whether cow´s milk-derived miRNAs may modify epigenetic regulation of the human milk consumer. Methods: To understand the potential impact of dairy milk consumption on human epigenetics, we have analyzed all relevant research-based bioinformatics data related to milk, milk miRNAs, epigenetic regulation, and lactation performance with special attention to bovine miRNAs that modify gene expression of DNA methyltransferase 1 (DNMT1 and p53 (TP53, the two guardians of the mammalian genome. By means of translational research and comparative functional genomics, we investigated the potential impact of cow´s milk miRNAs on epigenetic regulation of human DNMT1, TP53, FOXP3, and FTO, which are critically involved in immunologic and metabolic programming respectively. miRNA sequences have been obtained from mirbase.org. miRNA-target site prediction has been performed using TargetScan release 7.0. Results: The most abundant miRNA of cow´s milk is miRNA-148a, which represents more than 10% of all miRNAs of cow´s milk, survives pasteurization and refrigerated storage. The seed sequence of human and bovine miRNA-148a-3p is identical. Furthermore, human and bovine DNMT1 mRNA share 88% identity. The miRNA-148a 7mer seed is conserved in
Directory of Open Access Journals (Sweden)
Laura Espana-Serrano
2016-01-01
Full Text Available Lung cancer is the leading cause of cancer deaths in both men and women in the United States accounting for about 27% of all cancer deceases. In our effort to develop newer therapy for lung cancer, we evaluated the combinatory antitumor effect of siRNA targeting VEGF and the PI3K/mTOR dual inhibitor PF-04691502. We analyzed the anticancer effect of siRNA VEGF and PF-04691502 combination on proliferation, colony formation and migration of A549 and H460 lung cancer cells. Additionally, we assessed the combination treatment antiangiogenic effect on human umbilical vein endothelial cells. Here, we show for the first time that the antiangiogenic siRNA VEGF potentiates the PF-04691502 anticancer activity against non–small-cell lung cancer. We observed a significant (P < 0.05 decrease in cell viability, colony formation, and migration for the combination comparing with the single drug treatment. We also showed a significant (P < 0.05 enhanced effect of the combination treatment inhibiting angiogenesis progression and tube formation organization compared to the single drug treatment groups. Our findings demonstrated an enhanced synergistic anticancer effect of siRNA VEGF and PF-04691502 combination therapy by targeting two main pathways involved in lung cancer cell survival and angiogenesis which will be useful for future preclinical studies and potentially for lung cancer patient management.
Directory of Open Access Journals (Sweden)
Arthur C. Oliveira
2017-05-01
Full Text Available Target prediction is generally the first step toward recognition of bona fide microRNA (miRNA-target interactions in living cells. Several target prediction tools are now available, which use distinct criteria and stringency to provide the best set of candidate targets for a single miRNA or a subset of miRNAs. However, there are many false-negative predictions, and consensus about the optimum strategy to select and use the output information provided by the target prediction tools is lacking. We compared the performance of four tools cited in literature—TargetScan (TS, miRanda-mirSVR (MR, Pita, and RNA22 (R22, and we determined the most effective approach for analyzing target prediction data (individual, union, or intersection. For this purpose, we calculated the sensitivity, specificity, precision, and correlation of these approaches using 10 miRNAs (miR-1-3p, miR-17-5p, miR-21-5p, miR-24-3p, miR-29a-3p, miR-34a-5p, miR-124-3p, miR-125b-5p, miR-145-5p, and miR-155-5p and 1,400 genes (700 validated and 700 non-validated as targets of these miRNAs. The four tools provided a subset of high-quality predictions and returned few false-positive predictions; however, they could not identify several known true targets. We demonstrate that union of TS/MR and TS/MR/R22 enhanced the quality of in silico prediction analysis of miRNA targets. We conclude that the union rather than the intersection of the aforementioned tools is the best strategy for maximizing performance while minimizing the loss of time and resources in subsequent in vivo and in vitro experiments for functional validation of miRNA-target interactions.
Directory of Open Access Journals (Sweden)
Mohamed E. M. Saeed
2018-05-01
Full Text Available Betulinic acid (BetA is a naturally occurring pentacyclic triterpene isolated from the outer bark of white-barked birch trees and many other medicinal plants. Here, we studied betulinic acid's cytotoxic activity against drug-resistant tumor cell lines. P-glycoprotein (MDR1/ABCB1 and BCRP (ABCG2 are known ATP-binding cassette (ABC drug transporters that mediating MDR. ABCB5 is a close relative to ABCB1, which also mediates MDR. Constitutive activation of the EGF receptor is tightly linked to the development of chemotherapeutic resistance. BetA inhibited P-gp, BCRP, ABCB5 and mutation activated EGFR overexpressing cells with similar efficacy as their drug-sensitive parental counterparts. Furthermore, the mRNA expressions of ABCB1, BCRP, ABCB5 and EGFR were not related to the 50% inhibition concentrations (IC50 for BetA in a panel of 60 cell lines of the National Cancer Institute (NCI, USA. In addition to well-established MDR mechanisms, we attempted to identify other molecular mechanisms that play a role in mediating BetA's cytotoxic activity. For this reason, we performed COMPARE and hierarchical cluster analyses of the transcriptome-wide microarray-based mRNA expression of the NCI cell lines panel. Various genes significantly correlating to BetA's activity were involved in different biological processes, e.g., cell cycle regulation, microtubule formation, signal transduction, transcriptional regulation, chromatin remodeling, cell adhesion, tumor suppression, ubiquitination and proteasome degradation. Immunoblotting and in silico analyses revealed that the inhibition of AMFR activity might be one of the mechanisms for BetA to overcome MDR phenotypes. In conclusion, BetA may have therapeutic potential for the treatment of refractory tumors.
DEFF Research Database (Denmark)
Olivarius, Signe
of the transcriptome, 5’ end capture of RNA is combined with next-generation sequencing for high-throughput quantitative assessment of transcription start sites by two different methods. The methods presented here allow for functional investigation of coding as well as noncoding RNA and contribute to future...... RNAs rely on interactions with proteins, the establishment of protein-binding profiles is essential for the characterization of RNAs. Aiming to facilitate RNA analysis, this thesis introduces proteomics- as well as transcriptomics-based methods for the functional characterization of RNA. First, RNA...
MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells.
Chen, Dan; Chen, Zujian; Jin, Yi; Dragas, Dragan; Zhang, Leitao; Adjei, Barima S; Wang, Anxun; Dai, Yang; Zhou, Xiaofeng
2013-01-01
The miR-99 family is one of the evolutionarily most ancient microRNA families, and it plays a critical role in developmental timing and the maintenance of tissue identity. Recent studies, including reports from our group, suggested that the miR-99 family regulates various physiological processes in adult tissues, such as dermal wound healing, and a number of disease processes, including cancer. By combining 5 independent genome-wide expression profiling experiments, we identified a panel of 266 unique transcripts that were down-regulated in epithelial cells transfected with miR-99 family members. A comprehensive bioinformatics analysis using 12 different sequence-based microRNA target prediction algorithms revealed that 81 out of these 266 down-regulated transcripts are potential direct targets for the miR-99 family. Confirmation experiments and functional analyses were performed to further assess 6 selected miR-99 target genes, including mammalian Target of rapamycin (mTOR), Homeobox A1 (HOXA1), CTD small phosphatase-like (CTDSPL), N-myristoyltransferase 1 (NMT1), Transmembrane protein 30A (TMEM30A), and SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (SMARCA5). HOXA1 is a known proto-oncogene, and it also plays an important role in embryonic development. The direct targeting of the miR-99 family to two candidate binding sequences located in the HOXA1 mRNA was confirmed using a luciferase reporter gene assay and a ribonucleoprotein-immunoprecipitation (RIP-IP) assay. Ectopic transfection of miR-99 family reduced the expression of HOXA1, which, in consequence, down-regulated the expression of its downstream gene (i.e., Bcl-2) and led to reduced proliferation and cell migration, as well as enhanced apoptosis. In summary, we identified a number of high-confidence miR-99 family target genes, including proto-oncogene HOXA1, which may play an important role in regulating epithelial cell proliferation and migration during
MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells.
Directory of Open Access Journals (Sweden)
Dan Chen
Full Text Available The miR-99 family is one of the evolutionarily most ancient microRNA families, and it plays a critical role in developmental timing and the maintenance of tissue identity. Recent studies, including reports from our group, suggested that the miR-99 family regulates various physiological processes in adult tissues, such as dermal wound healing, and a number of disease processes, including cancer. By combining 5 independent genome-wide expression profiling experiments, we identified a panel of 266 unique transcripts that were down-regulated in epithelial cells transfected with miR-99 family members. A comprehensive bioinformatics analysis using 12 different sequence-based microRNA target prediction algorithms revealed that 81 out of these 266 down-regulated transcripts are potential direct targets for the miR-99 family. Confirmation experiments and functional analyses were performed to further assess 6 selected miR-99 target genes, including mammalian Target of rapamycin (mTOR, Homeobox A1 (HOXA1, CTD small phosphatase-like (CTDSPL, N-myristoyltransferase 1 (NMT1, Transmembrane protein 30A (TMEM30A, and SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (SMARCA5. HOXA1 is a known proto-oncogene, and it also plays an important role in embryonic development. The direct targeting of the miR-99 family to two candidate binding sequences located in the HOXA1 mRNA was confirmed using a luciferase reporter gene assay and a ribonucleoprotein-immunoprecipitation (RIP-IP assay. Ectopic transfection of miR-99 family reduced the expression of HOXA1, which, in consequence, down-regulated the expression of its downstream gene (i.e., Bcl-2 and led to reduced proliferation and cell migration, as well as enhanced apoptosis. In summary, we identified a number of high-confidence miR-99 family target genes, including proto-oncogene HOXA1, which may play an important role in regulating epithelial cell proliferation and
Energy Technology Data Exchange (ETDEWEB)
Chung, Eric; Jakinovich, Paul; Bae, Aekyung [Department of Anesthesiology, Health Sciences Center L4 Rm 081, Stony Brook University, Stony Brook, NY 11794 (United States); Rebecchi, Mario, E-mail: Mario.rebecchi@SBUmed.org [Department of Anesthesiology, Health Sciences Center L4 Rm 081, Stony Brook University, Stony Brook, NY 11794 (United States)
2012-10-01
Phospholipase C-{delta}{sub 1} (PLC{delta}{sub 1}) is a widely expressed highly active PLC isoform, modulated by Ca{sup 2+} that appears to operate downstream from receptor signaling and has been linked to regulation of cytokine production. Here we investigated whether PLC{delta}{sub 1} modulated expression of the pro-inflammatory cytokines interleukin-1{beta} (IL-1{beta}), tumor necrosis factor-{alpha} (TNF-{alpha}) and interleukin-6 (IL-6) in rat C6 glioma cells. Expression of PLC{delta}{sub 1} was specifically suppressed by small interfering RNA (siRNA) and the effects on cytokine mRNA expression, stimulated by the Toll-like receptor (TLR) agonist, lipopolysaccharide (LPS), were examined. Real-time polymerase chain reaction (RT-PCR) results showed that PLC{delta}{sub 1} knockdown enhanced expression IL-1{beta} and tumor necrosis factor-{alpha} (TNF-{alpha}) mRNA by at least 100 fold after 4 h of LPS stimulation compared to control siRNA treatment. PLC{delta}{sub 1} knock down caused persistently high Nf{kappa}b levels at 4 h of LPS stimulation compared to control siRNA-treated cells. PLC{delta}{sub 1} knockdown was also associated with elevated nuclear levels of c-Jun after 30 min of LPS stimulation, but did not affect LPS-stimulated p38 or p42/44 MAPK phosphorylation, normally associated with TLR activation of cytokine gene expression; rather, enhanced protein kinase C (PKC) phosphorylation of cellular proteins was observed in the absence of LPS stimulation. An inhibitor of PKC, bisindolylmaleimide II (BIM), reversed phosphorylation, prevented elevation of nuclear c-Jun levels, and inhibited LPS-induced increases of IL-1{beta} and TNF-{alpha} mRNA's induced by PLC{delta}{sub 1} knockdown. Our results show that loss of PLC{delta}{sub 1} enhances PKC/c-Jun signaling and up-modulates pro-inflammatory cytokine gene transcription in concert with the TLR-stimulated p38MAPK/Nf{kappa}b pathway. Our findings are consistent with the idea that PLC{delta}{sub 1} is a
Directory of Open Access Journals (Sweden)
Samantha J Hyde
Full Text Available All nucleotide polymerases and transferases catalyze nucleotide addition in a 5' to 3' direction. In contrast, tRNA(His guanylyltransferase (Thg1 enzymes catalyze the unusual reverse addition (3' to 5' of nucleotides to polynucleotide substrates. In eukaryotes, Thg1 enzymes use the 3'-5' addition activity to add G-1 to the 5'-end of tRNA(His, a modification required for efficient aminoacylation of the tRNA by the histidyl-tRNA synthetase. Thg1-like proteins (TLPs are found in Archaea, Bacteria, and mitochondria and are biochemically distinct from their eukaryotic Thg1 counterparts TLPs catalyze 5'-end repair of truncated tRNAs and act on a broad range of tRNA substrates instead of exhibiting strict specificity for tRNA(His. Taken together, these data suggest that TLPs function in distinct biological pathways from the tRNA(His maturation pathway, perhaps in tRNA quality control. Here we present the first crystal structure of a TLP, from the gram-positive soil bacterium Bacillus thuringiensis (BtTLP. The enzyme is a tetramer like human THG1, with which it shares substantial structural similarity. Catalysis of the 3'-5' reaction with 5'-monophosphorylated tRNA necessitates first an activation step, generating a 5'-adenylylated intermediate prior to a second nucleotidyl transfer step, in which a nucleotide is transferred to the tRNA 5'-end. Consistent with earlier characterization of human THG1, we observed distinct binding sites for the nucleotides involved in these two steps of activation and nucleotidyl transfer. A BtTLP complex with GTP reveals new interactions with the GTP nucleotide in the activation site that were not evident from the previously solved structure. Moreover, the BtTLP-ATP structure allows direct observation of ATP in the activation site for the first time. The BtTLP structural data, combined with kinetic analysis of selected variants, provide new insight into the role of key residues in the activation step.
MicroRNA-218 inhibits cell invasion and migration of pancreatic cancer via regulating ROBO1.
He, Hang; Hao, Si-Jie; Yao, Lie; Yang, Feng; Di, Yang; Li, Ji; Jiang, Yong-Jian; Jin, Chen; Fu, De-Liang
2014-10-01
miRNA-218 is a highlighted tumor suppressor and its underlying role in tumor progression is still unknown. Here, we restored the expression of miRNA-218 in pancreatic cancer to clarify the function and potent downstream pathway of miRNA-218. The expressions of both miRNA-218 and its potent target gene ROBO1 were revealed by RT-PCR and western blotting analysis. Transfection of miRNA-218 precursor mimics and luciferase assay were performed to elucidate the regulation mechanism between miRNA-218 and ROBO1. Cells, stably expressing miRNA-218 followed by forced expression of mutant ROBO1, were established through co-transfections of both lentivirus vector and plasmid vector. The cell migration and invasion abilities were evaluated by migration assay and invasion assay respectively. An increased expression of ROBO1 was revealed in cell BxPC-3-LN compared with cell BxPC-3. Elevated expression of miRNA-218 would suppress the expression of ROBO1 via complementary binding to a specific region within 3'UTR of ROBO1 mRNA (sites 971-978) in pancreatic cancer cells. Stably restoring the expression of miRNA-218 in pancreatic cancer significantly downregulated the expression of ROBO1 and effectively inhibited cell migration and invasion. Forced expression of mutant ROBO1 could reverse the repression effects of miRNA-218 on cell migration and invasion. Consequently, miRNA-218 acted as a tumor suppressor in pancreatic cancer by inhibiting cell invasion and migration. ROBO1 was a functional target of miRNA-218's downstream pathway involving in cell invasion and migration of pancreatic cancer.
Therapeutic Effects of Myeloid Cell Leukemia-1 siRNA on Human Acute Myeloid Leukemia Cells
Directory of Open Access Journals (Sweden)
Hadi Karami
2014-05-01
Full Text Available Purpose: Up-regulation of Mcl-1, a known anti-apoptotic protein, is associated with the survival and progression of various malignancies including leukemia. The aim of this study was to explore the effect of Mcl-1 small interference RNA (siRNA on the proliferation and apoptosis of HL-60 acute myeloid leukemia (AML cells. Methods: siRNA transfection was performed using Lipofectamine™2000 reagent. Relative mRNA and protein expressions were quantified by quantitative real-time PCR and Western blotting, respectively. Trypan blue assay was performed to assess tumor cell proliferation after siRNA transfection. The cytotoxic effect of Mcl-1 siRNA on leukemic cells was measured using MTT assay. Apoptosis was detected using ELISA cell death assay. Results: Mcl-1 siRNA clearly lowered both Mcl-1 mRNA and protein levels in a time-dependent manner, leading to marked inhibition of cell survival and proliferation. Furthermore, Mcl-1 down-regulation significantly enhanced the extent of HL-60 apoptotic cells. Conclusion: Our results suggest that the down-regulation of Mcl-1 by siRNA can effectively trigger apoptosis and inhibit the proliferation of leukemic cells. Therefore, Mcl-1 siRNA may be a potent adjuvant in AML therapy.
PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.
Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N
2016-05-01
To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.
Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun
2012-01-01
To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.
Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang
2017-02-06
Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. 'MAPK cascade'), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway'), reactive oxygen species (ROS) metabolic process (e.g. 'hydrogen peroxide catabolic process') and transcription factors (e.g., 'MYB, ZFP and bZIP') were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment.
Directory of Open Access Journals (Sweden)
Huei-Mei Chen
Full Text Available The polyA tails of mRNAs are monitored by the exosome as a quality control mechanism. We find that fission yeast, Schizosaccharomyces pombe, adopts this RNA quality control mechanism to regulate a group of 30 or more meiotic genes at the level of both splicing and RNA turnover. In vegetative cells the RNA binding protein Mmi1 binds to the primary transcripts of these genes. We find the novel motif U(U/C/GAAAC highly over-represented in targets of Mmi1. Mmi1 can specifically regulate the splicing of particular introns in a transcript: it inhibits the splicing of introns that are in the vicinity of putative Mmi1 binding sites, while allowing the splicing of other introns that are far from such sites. In addition, binding of Mmi1, particularly near the 3' end, alters 3' processing to promote extremely long polyA tails of up to a kilobase. The hyperadenylated transcripts are then targeted for degradation by the nuclear exonuclease Rrp6. The nuclear polyA binding protein Pab2 assists this hyperadenylation-mediated RNA decay. Rrp6 also targets other hyperadenylated transcripts, which become hyperadenylated in an unknown, but Mmi1-independent way. Thus, hyperadenylation may be a general signal for RNA degradation. In addition, binding of Mmi1 can affect the efficiency of 3' cleavage. Inactivation of Mmi1 in meiosis allows meiotic expression, through splicing and RNA stabilization, of at least 29 target genes, which are apparently constitutively transcribed.
An Exploration of Molecular Correlates Relevant to Radiation Combined Skin-Burn Trauma.
Directory of Open Access Journals (Sweden)
Aminul Islam
Full Text Available Exposure to high dose radiation in combination with physical injuries such as burn or wound trauma can produce a more harmful set of medical complications requiring specialist interventions. Currently these interventions are unavailable as are the precise biomarkers needed to help both accurately assess and treat such conditions. In the present study, we tried to identify and explore the possible role of serum exosome microRNA (miRNA signatures as potential biomarkers for radiation combined burn injury (RCBI.Female B6D2F1/J mice were assigned to four experimental groups (n = 6: sham control (SHAM, burn injury (BURN, radiation injury (RI and combined radiation skin burn injury (CI. We performed serum multiplex cytokine analysis and serum exosome miRNA expression profiling to determine novel miRNA signatures and important biological pathways associated with radiation combined skin-burn trauma.Serum cytokines, IL-5 and MCP-1, were significantly induced only in CI mice (p<0.05. From 890 differentially expressed miRNAs identified, microarray analysis showed 47 distinct miRNA seed sequences significantly associated with CI mice compared to SHAM control mice (fold change ≥ 1.2, p<0.05. Furthermore, only two major miRNA seed sequences (miR-690 and miR-223 were validated to be differentially expressed for CI mice specifically (fold change ≥ 1.5, p<0.05.Serum exosome miRNA signature data of adult mice, following RCBI, provides new insights into the molecular and biochemical pathways associated with radiation combined skin-burn trauma in vivo.
The antifibrotic effects of TGF-β1 siRNA on hepatic fibrosis in rats
International Nuclear Information System (INIS)
Lang, Qing; Liu, Qi; Xu, Ning; Qian, Ke-Li; Qi, Jing-Hu; Sun, Yin-Chun; Xiao, Lang; Shi, Xiao-Feng
2011-01-01
Highlights: → We constructed CCL4 induced liver fibrosis model successfully. → We proofed that the TGF-β1 siRNA had a definite therapy effect to CCL4 induced liver fibrosis. → The therapy effect of TGF-β1 siRNA had dose-dependent. -- Abstract: Background/aims: Hepatic fibrosis results from the excessive secretion of matrix proteins by hepatic stellate cells (HSCs), which proliferate during fibrotic liver injury. Transforming growth factor (TGF)-β1 is the dominant stimulus for extracellular matrix (ECM) production by stellate cells. Our study was designed to investigate the antifibrotic effects of using short interference RNA (siRNA) to target TGF-β1 in hepatic fibrosis and its mechanism in rats exposed to a high-fat diet and carbon tetrachloride (CCL4). Methods: A total of 40 healthy, male SD (Sprague-Dawley) rats were randomly divided into five even groups containing of eight rats each: normal group, model group, TGF-β1 siRNA 0.125 mg/kg treatment group, TGF-β1 siRNA 0.25 mg/kg treatment group and TGF-β1 siRNA negative control group (0.25 mg/kg). CCL4 and a high-fat diet were used for 8 weeks to induce hepatic fibrosis. All the rats were then sacrificed to collect liver tissue samples. A portion of the liver samples were soaked in formalin for Hematoxylin-Eosin staining, classifying the degree of liver fibrosis, and detecting the expression of type I and III collagen and TGF-β1; the remaining liver samples were stored in liquid nitrogen to be used for detecting TGF-β1 by Western blotting and for measuring the mRNA expression of type I and III collagen and TGF-β1 by quantitative real-time polymerase chain reaction. Results: Comparing the TGF-β1 siRNA 0.25 mg/kg treatment group to the model group, the TGF-β1 siRNA negative control group and the TGF-β1 siRNA 0.125 mg/kg treatment group showed significantly reduced levels of pathological changes, protein expression and the mRNA expression of TGF-β1, type I collagen and type III collagen (P < 0
The antifibrotic effects of TGF-{beta}1 siRNA on hepatic fibrosis in rats
Energy Technology Data Exchange (ETDEWEB)
Lang, Qing; Liu, Qi [Key Laboratory of Molecular Biology for Infectious Diseases, Ministry of Education, Instituted for Virus Hepatitis and Department of Infectious Diseases, The Second Affiliated Hospital, Chongqing Medical University, Chongqing (China); Xu, Ning [The Second Hospital of YuLin, Shanxi Province (China); Qian, Ke-Li; Qi, Jing-Hu; Sun, Yin-Chun; Xiao, Lang [Key Laboratory of Molecular Biology for Infectious Diseases, Ministry of Education, Instituted for Virus Hepatitis and Department of Infectious Diseases, The Second Affiliated Hospital, Chongqing Medical University, Chongqing (China); Shi, Xiao-Feng, E-mail: sxff2003@yahoo.com.cn [Key Laboratory of Molecular Biology for Infectious Diseases, Ministry of Education, Instituted for Virus Hepatitis and Department of Infectious Diseases, The Second Affiliated Hospital, Chongqing Medical University, Chongqing (China)
2011-06-10
Highlights: {yields} We constructed CCL4 induced liver fibrosis model successfully. {yields} We proofed that the TGF-{beta}1 siRNA had a definite therapy effect to CCL4 induced liver fibrosis. {yields} The therapy effect of TGF-{beta}1 siRNA had dose-dependent. -- Abstract: Background/aims: Hepatic fibrosis results from the excessive secretion of matrix proteins by hepatic stellate cells (HSCs), which proliferate during fibrotic liver injury. Transforming growth factor (TGF)-{beta}1 is the dominant stimulus for extracellular matrix (ECM) production by stellate cells. Our study was designed to investigate the antifibrotic effects of using short interference RNA (siRNA) to target TGF-{beta}1 in hepatic fibrosis and its mechanism in rats exposed to a high-fat diet and carbon tetrachloride (CCL4). Methods: A total of 40 healthy, male SD (Sprague-Dawley) rats were randomly divided into five even groups containing of eight rats each: normal group, model group, TGF-{beta}1 siRNA 0.125 mg/kg treatment group, TGF-{beta}1 siRNA 0.25 mg/kg treatment group and TGF-{beta}1 siRNA negative control group (0.25 mg/kg). CCL4 and a high-fat diet were used for 8 weeks to induce hepatic fibrosis. All the rats were then sacrificed to collect liver tissue samples. A portion of the liver samples were soaked in formalin for Hematoxylin-Eosin staining, classifying the degree of liver fibrosis, and detecting the expression of type I and III collagen and TGF-{beta}1; the remaining liver samples were stored in liquid nitrogen to be used for detecting TGF-{beta}1 by Western blotting and for measuring the mRNA expression of type I and III collagen and TGF-{beta}1 by quantitative real-time polymerase chain reaction. Results: Comparing the TGF-{beta}1 siRNA 0.25 mg/kg treatment group to the model group, the TGF-{beta}1 siRNA negative control group and the TGF-{beta}1 siRNA 0.125 mg/kg treatment group showed significantly reduced levels of pathological changes, protein expression and the mRNA
MicroRNA profile changes in human immunodeficiency virus type 1 (HIV-1 seropositive individuals
Directory of Open Access Journals (Sweden)
Smith Stephen M
2008-12-01
Full Text Available Abstract MicroRNAs (miRNAs play diverse roles in regulating cellular and developmental functions. We have profiled the miRNA expression in peripheral blood mononuclear cells from 36 HIV-1 seropositive individuals and 12 normal controls. The HIV-1-positive individuals were categorized operationally into four classes based on their CD4+ T-cell counts and their viral loads. We report that specific miRNA signatures can be observed for each of the four classes.
Directory of Open Access Journals (Sweden)
Oksana Dogorova
2016-03-01
Full Text Available With the growing incidence of Multi-Drug-Resistant Tuberculosis (MDR-TB in newly identified patients, novel multimodality treatment methods are needed, aimed at reducing the time to sputum conversion and cavity healing, which would be applicable in MDR cases. Our experimental treatment consisted of the following: 1 chemotherapy based on the drug sensitivity profile, 2 local laser irradiation therapy for 25 days, and lymphotropic administration of isoniazid (to subcutaneous tissue in alternating locations: underarm area; fifth intercostal space along the sterna border; subclavian area where the first rib meets the sternum in a daily dose of 10mg/kg 5 times a week. This treatment was significantly more effective in newly detected destructive MDR-TB versus the standard Category IV regimen for MDR-TB in terms of reduced time for sputum culture conversion and cavity healing, estimated to be 6 months after initiation of treatment.
Dahl, Viktor; Peterson, Julia; Fuchs, Dietmar; Gisslen, Magnus; Palmer, Sarah; Price, Richard W
2014-09-24
Though combination antiretroviral therapy reduces the concentration of HIV-1 RNA in both plasma and cerebrospinal fluid (CSF) below the detection limit of clinical assays, low levels of HIV-1 RNA are frequently detectable in plasma using more sensitive assays. We examined the frequency and magnitude of persistent low-level HIV-1 RNA in CSF and its relation to the central nervous system (CNS) immune activation. CSF and plasma HIV-1 RNA were measured using the single-copy assay with a detection limit of 0.3 copies/ml in 70 CSF and 68 plasma samples from 45 treated HIV-1-infected patients with less than 40 copies/ml of HIV-1 RNA in both fluids by standard clinical assays. We also measured CSF neopterin to assess intrathecal immune activation. Theoretical drug exposure was estimated using the CNS penetration-efficacy score of treatment regimens. CSF HIV-1 RNA was detected in 12 of the 70 CSF samples (17%) taken after up to 10 years of suppressive therapy, compared to 39 of the 68 plasma samples (57%) with a median concentration of less than 0.3 copies/ml in CSF compared to 0.3 copies/ml in plasma (P < 0.0001). CSF samples with detectable HIV-1 RNA had higher CSF neopterin levels (mean 8.2 compared to 5.7 nmol/l; P = 0.0085). Patients with detectable HIV-1 RNA in CSF did not differ in pretreatment plasma HIV-1 RNA levels, nadir CD4 cell count or CNS penetration-efficacy score. Low-level CSF HIV-1 RNA and its association with elevated CSF neopterin highlight the potential for the CNS to serve as a viral reservoir and for persistent infection to cause subclinical CNS injury.
AZIN1 RNA editing confers cancer stemness and enhances oncogenic potential in colorectal cancer.
Shigeyasu, Kunitoshi; Okugawa, Yoshinaga; Toden, Shusuke; Miyoshi, Jinsei; Toiyama, Yuji; Nagasaka, Takeshi; Takahashi, Naoki; Kusunoki, Masato; Takayama, Tetsuji; Yamada, Yasuhide; Fujiwara, Toshiyoshi; Chen, Leilei; Goel, Ajay
2018-06-21
Adenosine-to-inosine (A-to-I) RNA editing, a process mediated by adenosine deaminases that act on the RNA (ADAR) gene family, is a recently discovered epigenetic modification dysregulated in human cancers. However, the clinical significance and the functional role of RNA editing in colorectal cancer (CRC) remain unclear. We have systematically and comprehensively investigated the significance of the expression status of ADAR1 and of the RNA editing levels of antizyme inhibitor 1 (AZIN1), one of the most frequently edited genes in cancers, in 392 colorectal tissues from multiple independent CRC patient cohorts. Both ADAR1 expression and AZIN1 RNA editing levels were significantly elevated in CRC tissues when compared with corresponding normal mucosa. High levels of AZIN1 RNA editing emerged as a prognostic factor for overall survival and disease-free survival and were an independent risk factor for lymph node and distant metastasis. Furthermore, elevated AZIN1 editing identified high-risk stage II CRC patients. Mechanistically, edited AZIN1 enhances stemness and appears to drive the metastatic processes. We have demonstrated that edited AZIN1 functions as an oncogene and a potential therapeutic target in CRC. Moreover, AZIN1 RNA editing status could be used as a clinically relevant prognostic indicator in CRC patients.
Ko, Jina; Bhagwat, Neha; Yee, Stephanie S; Black, Taylor; Redlinger, Colleen; Romeo, Janae; O'Hara, Mark; Raj, Arjun; Carpenter, Erica L; Stanger, Ben Z; Issadore, David
2017-09-12
The use of microtechnology for the highly selective isolation and sensitive detection of circulating tumor cells has shown enormous promise. One challenge for this technology is that the small feature sizes - which are the key to this technology's performance - can result in low sample throughput and susceptibility to clogging. Additionally, conventional molecular analysis of CTCs often requires cells to be taken off-chip for sample preparation and purification before analysis, leading to the loss of rare cells. To address these challenges, we have developed a microchip platform that combines fast, magnetic micropore based negative immunomagnetic selection (>10 mL h -1 ) with rapid on-chip in situ RNA profiling (>100× faster than conventional RNA labeling). This integrated chip can isolate both rare circulating cells and cell clusters directly from whole blood and allow individual cells to be profiled for multiple RNA cancer biomarkers, achieving sample-to-answer in less than 1 hour for 10 mL of whole blood. To demonstrate the power of this approach, we applied our device to the circulating tumor cell based diagnosis of pancreatic cancer. We used a genetically engineered lineage-labeled mouse model of pancreatic cancer (KPCY) to validate the performance of our chip. We show that in a cohort of patient samples (N = 25) that this device can detect and perform in situ RNA analysis on circulating tumor cells in patients with pancreatic cancer, even in those with extremely sparse CTCs (<1 CTC mL -1 of whole blood).
Long noncoding RNA Tug1 regulates mitochondrial bioenergetics in diabetic nephropathy.
Long, Jianyin; Badal, Shawn S; Ye, Zengchun; Wang, Yin; Ayanga, Bernard A; Galvan, Daniel L; Green, Nathanael H; Chang, Benny H; Overbeek, Paul A; Danesh, Farhad R
2016-11-01
The regulatory roles of long noncoding RNAs (lncRNAs) in transcriptional coactivators are still largely unknown. Here, we have shown that the peroxisome proliferator-activated receptor γ (PPARγ) coactivator α (PGC-1α, encoded by Ppargc1a) is functionally regulated by the lncRNA taurine-upregulated gene 1 (Tug1). Further, we have described a role for Tug1 in the regulation of mitochondrial function in podocytes. Using a murine model of diabetic nephropathy (DN), we performed an unbiased RNA-sequencing (RNA-seq) analysis of kidney glomeruli and identified Tug1 as a differentially expressed lncRNA in the diabetic milieu. Podocyte-specific overexpression (OE) of Tug1 in diabetic mice improved the biochemical and histological features associated with DN. Unexpectedly, we found that Tug1 OE rescued the expression of PGC-1α and its transcriptional targets. Tug1 OE was also associated with improvements in mitochondrial bioenergetics in the podocytes of diabetic mice. Mechanistically, we found that the interaction between Tug1 and PGC-1α promotes the binding of PGC-1α to its own promoter. We identified a Tug1-binding element (TBE) upstream of the Ppargc1a gene and showed that Tug1 binds with the TBE to enhance Ppargc1a promoter activity. These findings indicate that a direct interaction between PGC-1α and Tug1 modulates mitochondrial bioenergetics in podocytes in the diabetic milieu.
A Phenotypic Screen for Functional Mutants of Human Adenosine Deaminase Acting on RNA 1.
Wang, Yuru; Havel, Jocelyn; Beal, Peter A
2015-11-20
Adenosine deaminases acting on RNA (ADARs) are RNA-editing enzymes responsible for the conversion of adenosine to inosine at specific locations in cellular RNAs. ADAR1 and ADAR2 are two members of the family that have been shown to be catalytically active. Earlier, we reported a phenotypic screen for the study of human ADAR2 using budding yeast S. cerevisiae as the host system. While this screen has been successfully applied to the study of ADAR2, it failed with ADAR1. Here, we report a new reporter that uses a novel editing substrate and is suitable for the study of ADAR1. We screened plasmid libraries with randomized codons for two important residues in human ADAR1 (G1007 and E1008). The screening results combined with in vitro deamination assays led to the identification of mutants that are more active than the wild type protein. Furthermore, a screen of the ADAR1 E1008X library with a reporter construct bearing an A•G mismatch at the editing site suggests one role for the residue at position 1008 is to sense the identity of the base pairing partner for the editing site adenosine. This work has provided a starting point for future in vitro evolution studies of ADAR1 and led to new insight into ADAR's editing site selectivity.
Preclinical Justification of pbi-shRNA EWS/FLI1 Lipoplex (LPX) Treatment for Ewing's Sarcoma.
Rao, Donald D; Jay, Christopher; Wang, Zhaohui; Luo, Xiuquan; Kumar, Padmasini; Eysenbach, Hilary; Ghisoli, Maurizio; Senzer, Neil; Nemunaitis, John
2016-08-01
The EWS/FLI1 fusion gene is well characterized as a driver of Ewing's sarcoma. Bi-shRNA EWS/FLI1 is a functional plasmid DNA construct that transcribes both siRNA and miRNA-like effectors each of which targets the identical type 1 translocation junction region of the EWS/FLI1 transcribed mRNA sequence. Previous preclinical and clinical studies confirm the safety of this RNA interference platform technology and consistently demonstrate designated mRNA and protein target knockdown at greater than 90% efficiency. We initiated development of pbi-shRNA EWS/FLI1 lipoplex (LPX) for the treatment of type 1 Ewing's sarcoma. Clinical-grade plasmid was manufactured and both sequence and activity verified. Target protein and RNA knockdown of 85-92% was demonstrated in vitro in type 1 human Ewing's sarcoma tumor cell lines with the optimal bi-shRNA EWS/FLI1 plasmid. This functional plasmid was placed in a clinically tested, liposomal (LP) delivery vehicle followed by in vivo verification of activity. Type 1 Ewing's sarcoma xenograft modeling confirmed dose related safety and tumor response to pbi-shRNA EWS/FLI1 LPX. Toxicology studies in mini-pigs with doses comparable to the demonstrated in vivo efficacy dose resulted in transient fever, occasional limited hypertension at low- and high-dose assessment and transient liver enzyme elevation at high dose. These results provide the justification to initiate clinical testing.
Zhang, Qianjun; Meng, Xiuhua; Li, Delin; Chen, Shaoyin; Luo, Jianmin; Zhu, Linjie; Singer, Robert H; Gu, Wei
2017-06-09
Local translation of specific mRNAs is regulated by dynamic changes in their subcellular localization, and these changes are due to complex mechanisms controlling cytoplasmic mRNA transport. The budding yeast Saccharomyces cerevisiae is well suited to studying these mechanisms because many of its transcripts are transported from the mother cell to the budding daughter cell. Here, we investigated the translational control of ASH1 mRNA after transport and localization. We show that although ASH1 transcripts were translated after they reached the bud tip, some mRNAs were bound by the RNA-binding protein Puf6 and were non-polysomal. We also found that the DEAD-box helicase Dhh1 complexed with the untranslated ASH1 mRNA and Puf6. Loss of Dhh1 affected local translation of ASH1 mRNA and resulted in delocalization of ASH1 transcript in the bud. Forcibly shifting the non-polysomal ASH1 mRNA into polysomes was associated with Dhh1 dissociation. We further demonstrated that Dhh1 is not recruited to ASH1 mRNA co-transcriptionally, suggesting that it could bind to ASH1 mRNA within the cytoplasm. Of note, Dhh1 bound to the 5'-UTR of ASH1 mRNA and inhibited its translation in vitro These results suggest that after localization to the bud tip, a portion of the localized ASH1 mRNA becomes translationally inactive because of binding of Dhh1 and Puf6 to the 5'- and 3'-UTRs of ASH1 mRNA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
6S-1 RNA function leads to a delay in sporulation in Bacillus subtilis.
Cavanagh, Amy T; Wassarman, Karen M
2013-05-01
We have discovered that 6S-1 RNA (encoded by bsrA) is important for appropriate timing of sporulation in Bacillus subtilis in that cells lacking 6S-1 RNA sporulate earlier than wild-type cells. The time to generate a mature spore once the decision to sporulate has been made is unaffected by 6S-1 RNA, and, therefore, we propose that it is the timing of onset of sporulation that is altered. Interestingly, the presence of cells lacking 6S-1 RNA in coculture leads to all cell types exhibiting an early-sporulation phenotype. We propose that cells lacking 6S-1 RNA modify their environment in a manner that promotes early sporulation. In support of this model, resuspension of wild-type cells in conditioned medium from ΔbsrA cultures also resulted in early sporulation. Use of Escherichia coli growth as a reporter of the nutritional status of conditioned media suggested that B. subtilis cells lacking 6S-1 RNA reduce the nutrient content of their environment earlier than wild-type cells. Several pathways known to impact the timing of sporulation, such as the skf- and sdp-dependent cannibalism pathways, were eliminated as potential targets of 6S-1 RNA-mediated changes, suggesting that 6S-1 RNA activity defines a novel mechanism for altering the timing of onset of sporulation. In addition, 6S-2 RNA does not influence the timing of sporulation, providing further evidence of the independent influences of these two related RNAs on cell physiology.
Kwok, Hoi-Hin
2017-05-18
MicroRNAs (miRNAs) are a family of non-coding RNAs that play crucial roles in regulating various normal cellular responses. Recent studies revealed that the canonical miRNA biogenesis pathway is subject to sophisticated regulation. Hormonal control of miRNA biogenesis by androgen and estrogen has been demonstrated, but the direct effects of the glucocorticoid receptor (GR) on miRNA biogenesis are unknown. This study revealed the role of GR in miRNA maturation. We showed that two GR agonists, dexamethasone and ginsenoside-Rg1 rapidly suppressed the expression of mature miR-15b, miR-23a, and miR-214 in human endothelial cells. RNA pulldown coupled with proteomic analysis identified GTPase-activating protein (SH3 domain) binding protein 1 (G3BP1) as one of the RNA-binding proteins mediating GR-regulated miRNA maturation. Activated GR induced phosphorylation of v-AKT Murine Thymoma Viral Oncogene Homologue (AKT) kinase, which in turn phosphorylated and promoted nuclear translocation of G3BP1. The nuclear G3BP1 bound to the G3BP1 consensus sequence located on primary miR-15b~16-2 and miR-23a~27a~24-2 to inhibit their maturation. The findings from this study have advanced our understanding of the non-genomic effects of GR in the vascular system.
Long noncoding RNA LISPR1 is required for S1P signaling and endothelial cell function.
Josipovic, Ivana; Pflüger, Beatrice; Fork, Christian; Vasconez, Andrea E; Oo, James A; Hitzel, Juliane; Seredinski, Sandra; Gamen, Elisabetta; Heringdorf, Dagmar Meyer Zu; Chen, Wei; Looso, Mario; Pullamsetti, Soni Savai; Brandes, Ralf P; Leisegang, Matthias S
2018-03-01
Sphingosine-1-Phosphate (S1P) is a potent signaling lipid. The effects of S1P are mediated by the five S1P receptors (S1PR). In the endothelium S1PR1 is the predominant receptor and thus S1PR1 abundance limits S1P signaling. Recently, lncRNAs were identified as a novel class of molecules regulating gene expression. Interestingly, the lncRNA NONHSAT004848 (LISPR1, Long intergenic noncoding RNA antisense to S1PR1), is closely positioned to the S1P1 receptors gene and in part shares its promoter region. We hypothesize that LISPR1 controls endothelial S1PR1 expression and thus S1P-induced signaling in endothelial cells. In vitro transcription and translation as well as coding potential assessment showed that LISPR1 is indeed noncoding. LISPR1 was localized in both cytoplasm and nucleus and harbored a PolyA tail at the 3'end. In human umbilical vein endothelial cells, as well as human lung tissue, qRT-PCR and RNA-Seq revealed high expression of LISPR1. S1PR1 and LISPR1 were downregulated in human pulmonary diseases such as COPD. LISPR1 but also S1PR1 were induced by inflammation, shear stress and statins. Knockdown of LISPR1 attenuated endothelial S1P-induced migration and spheroid outgrowth of endothelial cells. LISPR1 knockdown decreased S1PR1 expression, which was paralleled by an increase of the binding of the transcriptional repressor ZNF354C to the S1PR1 promoter and a reduction of the recruitment of RNA Polymerase II to the S1PR1 5'end. This resulted in attenuated S1PR1 expression and attenuated S1P downstream signaling. Collectively, the disease relevant lncRNA LISPR1 acts as a novel regulatory unit important for S1PR1 expression and endothelial cell function. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Olfat Gamil Shaker
2018-05-01
Full Text Available Background/Aims: Rheumatoid arthritis (RA is a systemic autoimmune disease affecting up to 1% of the population worldwide. The aim of the present study was to investigate whether miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 polymorphisms are associated with susceptibility to RA in Egyptians and whether they influence disease severity and activity. Methods: The study was performed on 104 unrelated RA patients and 112 healthy subjects. RA patients were further subdivided into active and inactive RA groups. Polymorphisms were genotyped by using real-time polymerase chain reaction with TaqMan allelic discrimination assay. Results: Significant differences in the frequency of miRNA-146a rs2910164, miRNA-499 rs3746444, IRAK1 rs3027898 and PADI4 rs1748033 alleles and genotypes were observed between RA patients and controls. Only CA and AA genotypes of IRAK1 rs3027898 shows a significant difference between active and inactive subgroups. MiRNA-146a rs2910164 and IRAK1 rs3027898 polymorphisms were a risk factor for predisposition to RA in codominant and dominant tested inheritance models, while, the miRNA-499 rs3746444 and PADI4 rs1748033 polymorphisms were a risk factor in codominant and recessive one. CG and GG genotypes of miRNA-146a rs2910164 were associated with positive erosions. CA genotype of IRAK1 rs3027898 was associated with low disease activity and negative erosions, while, the AA genotype was associated with high disease activity. CC genotype of PADI4 rs1748033 was associated with negative rheumatoid factor. Conclusion: The 4 studied SNPs were likely to play an important role in the susceptibility to RA and can influence disease severity and activity in Egyptian population.
Directory of Open Access Journals (Sweden)
Yung-Kuo Lee
Full Text Available Multidrug resistance (MDR, an unfavorable factor compromising the treatment efficacy of anticancer drugs, involves the upregulation of ATP binding cassette (ABC transporters and induction of galectin-3 signaling. Galectin-3 plays an anti-apoptotic role in many cancer cells and regulates various pathways to activate MDR. Thus, the inhibition of galectin-3 has the potential to enhance the efficacy of the anticancer drug epirubicin. In this study, we examined the effects and mechanisms of silencing galectin-3 via RNA interference (RNAi on the β-catenin/GSK-3β pathway in human colon adenocarcinoma Caco-2 cells. Galectin-3 knockdown increased the intracellular accumulation of epirubicin in Caco-2 cells; suppressed the mRNA expression of galectin-3, β-catenin, cyclin D1, c-myc, P-glycoprotein (P-gp, MDR-associated protein (MRP 1, and MRP2; and downregulated the protein expression of P-gp, cyclin D1, galectin-3, β-catenin, c-Myc, and Bcl-2. Moreover, galectin-3 RNAi treatment significantly increased the mRNA level of GSK-3β, Bax, caspase-3, and caspase-9; remarkably increased the Bax-to-Bcl-2 ratio; and upregulated the GSK-3β and Bax protein expressions. Apoptosis was induced by galectin-3 RNAi and/or epirubicin as demonstrated by chromatin condensation, a higher sub-G1 phase proportion, and increased caspase-3 and caspase-9 activity, indicating an intrinsic/mitochondrial apoptosis pathway. Epirubicin-mediated resistance was effectively inhibited via galectin-3 RNAi treatment. However, these phenomena could be rescued after galectin-3 overexpression. We show for the first time that the silencing of galectin-3 sensitizes MDR cells to epirubicin by inhibiting ABC transporters and activating the mitochondrial pathway of apoptosis through modulation of the β-catenin/GSK-3β pathway in human colon cancer cells.
Atomistic mechanism of microRNA translation upregulation via molecular dynamics simulations.
Directory of Open Access Journals (Sweden)
Wei Ye
Full Text Available MicroRNAs are endogenous 23-25 nt RNAs that play important gene-regulatory roles in animals and plants. Recently, miR369-3 was found to upregulate translation of TNFα mRNA in quiescent (G0 mammalian cell lines. Knock down and immunofluorescence experiments suggest that microRNA-protein complexes (with FXR1 and AGO2 are necessary for the translation upregulation. However the molecular mechanism of microRNA translation activation is poorly understood. In this study we constructed the microRNA-mRNA-AGO2-FXR1 quadruple complex by bioinformatics and molecular modeling, followed with all atom molecular dynamics simulations in explicit solvent to investigate the interaction mechanisms for the complex. A combined analysis of experimental and computational data suggests that AGO2-FXR1 complex relocalize microRNA:mRNA duplex to polysomes in G0. The two strands of dsRNA are then separated upon binding of AGO2 and FXR1. Finally, polysomes may improve the translation efficiency of mRNA. The mutation research confirms the stability of microRNA-mRNA-FXR1 and illustrates importance of key residue of Ile304. This possible mechanism can shed more light on the microRNA-dependent upregulation of translation.
Directory of Open Access Journals (Sweden)
Guang-Bing Li
Full Text Available Protein phosphatase magnesium-dependent 1δ (PPM1D is an oncogene, overexpressed in many solid tumors, including ovarian cancer and breast cancer. The current study examined the expression and the prognostic value of PPM1D mRNA in human hepatocellular carcinoma (HCC.Total RNA was extracted from 86 HCC and paired non-cancerous liver tissues. PPM1D mRNA expression was determined by real-time quantitative reverse transcriptase-polymerase chain reaction (qPCR. Immunohistochemistry assay was used to verify the expression of ppm1d protein in the HCC and non-cancerous liver tissues. HCC patients were grouped according to PPM1D mRNA expression with the average PPM1D mRNA level in non-cancerous liver tissue samples as the cut-off. Correlations between clinicopathologic variables, overall survival and PPM1D mRNA expression were analyzed.PPM1D mRNA was significantly higher in HCC than in the paired non-cancerous tissue (p<0.01. This was confirmed by ppm1d staining. 56 patients were classified as high expression group and the other 30 patients were categorized as low expression group. There were significant differences between the two groups in term of alpha-fetoprotein (α-FP level (p<0.01, tumor size (p<0.01, TNM stage (p<0.01, recurrence incidence (p<0.01 and family history of liver cancer (p<0.01. The current study failed to find significant differences between the two groups in the following clinical characteristics: age, gender, portal vein invasion, lymphnode metastasis, hepatitis B virus (HBV infection and alcohol intake. Survival time of high expression group was significantly shorter than that of low expression group (median survival, 13 months and 32 months, respectively, p<0.01.Up-regulation of PPM1D mRNA was associated with progressive pathological feature and poor prognosis in HCC patients. PPM1D mRNA may serve as a prognostic marker in HCC.
Directory of Open Access Journals (Sweden)
Head Steven R
2011-06-01
Full Text Available Abstract Background Cyanobacteria are potential sources of renewable chemicals and biofuels and serve as model organisms for bacterial photosynthesis, nitrogen fixation, and responses to environmental changes. Anabaena (Nostoc sp. strain PCC 7120 (hereafter Anabaena is a multicellular filamentous cyanobacterium that can "fix" atmospheric nitrogen into ammonia when grown in the absence of a source of combined nitrogen. Because the nitrogenase enzyme is oxygen sensitive, Anabaena forms specialized cells called heterocysts that create a microoxic environment for nitrogen fixation. We have employed directional RNA-seq to map the Anabaena transcriptome during vegetative cell growth and in response to combined-nitrogen deprivation, which induces filaments to undergo heterocyst development. Our data provide an unprecedented view of transcriptional changes in Anabaena filaments during the induction of heterocyst development and transition to diazotrophic growth. Results Using the Illumina short read platform and a directional RNA-seq protocol, we obtained deep sequencing data for RNA extracted from filaments at 0, 6, 12, and 21 hours after the removal of combined nitrogen. The RNA-seq data provided information on transcript abundance and boundaries for the entire transcriptome. From these data, we detected novel antisense transcripts within the UTRs (untranslated regions and coding regions of key genes involved in heterocyst development, suggesting that antisense RNAs may be important regulators of the nitrogen response. In addition, many 5' UTRs were longer than anticipated, sometimes extending into upstream open reading frames (ORFs, and operons often showed complex structure and regulation. Finally, many genes that had not been previously identified as being involved in heterocyst development showed regulation, providing new candidates for future studies in this model organism. Conclusions Directional RNA-seq data were obtained that provide
Interferon status at the women with recurrent genital herpes in combined liposomal RNA treatment
Directory of Open Access Journals (Sweden)
A. Sh. Makhmutkhodzhayev
2012-01-01
Full Text Available The aim of this study was the estimation of the influence of liposomal ribonucleic acid (RNA medicine «Liprina» on interferon status of women with recurrent genital herpes. In this study 60 women were included, who combined (acyclovir and Liprina, n = 40 or monoterapy with acyclovir (n = 20 were received. The levels of serum interferon alpha and gamma along with cervical virus elimination were estimated. The medicine «Liprina» increased the therapy efficiency of the women with genital herpes, that perhaps related with endogen interferon production amplification.
Promiscuous RNA binding ensures effective encapsidation of APOBEC3 proteins by HIV-1.
Directory of Open Access Journals (Sweden)
Luis Apolonia
2015-01-01
Full Text Available The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3 (APOBEC3 proteins are cell-encoded cytidine deaminases, some of which, such as APOBEC3G (A3G and APOBEC3F (A3F, act as potent human immunodeficiency virus type-1 (HIV-1 restriction factors. These proteins require packaging into HIV-1 particles to exert their antiviral activities, but the molecular mechanism by which this occurs is incompletely understood. The nucleocapsid (NC region of HIV-1 Gag is required for efficient incorporation of A3G and A3F, and the interaction between A3G and NC has previously been shown to be RNA-dependent. Here, we address this issue in detail by first determining which RNAs are able to bind to A3G and A3F in HV-1 infected cells, as well as in cell-free virions, using the unbiased individual-nucleotide resolution UV cross-linking and immunoprecipitation (iCLIP method. We show that A3G and A3F bind many different types of RNA, including HIV-1 RNA, cellular mRNAs and small non-coding RNAs such as the Y or 7SL RNAs. Interestingly, A3G/F incorporation is unaffected when the levels of packaged HIV-1 genomic RNA (gRNA and 7SL RNA are reduced, implying that these RNAs are not essential for efficient A3G/F packaging. Confirming earlier work, HIV-1 particles formed with Gag lacking the NC domain (Gag ΔNC fail to encapsidate A3G/F. Here, we exploit this system by demonstrating that the addition of an assortment of heterologous RNA-binding proteins and domains to Gag ΔNC efficiently restored A3G/F packaging, indicating that A3G and A3F have the ability to engage multiple RNAs to ensure viral encapsidation. We propose that the rather indiscriminate RNA binding characteristics of A3G and A3F promote functionality by enabling recruitment into a wide range of retroviral particles whose packaged RNA genomes comprise divergent sequences.
Agyeman, Akosua Adom; Ofori-Asenso, Richard
2016-06-22
Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and
Directory of Open Access Journals (Sweden)
Juang V
2016-11-01
Full Text Available Vivian Juang,1 Hsin-Pin Lee,2 Anya Maan-Yuh Lin,1,3 Yu-Li Lo1 1Department and Institute of Pharmacology, National Yang-Ming University, 2Department of Biological Sciences and Technology, National University of Tainan, 3Department of Medical Research, Taipei Veterans General Hospital, Taipei, Taiwan, Republic of China Abstract: Antimicrobial peptides (AMPs have been recently evaluated as a new generation of adjuvants in cancer chemotherapy. In this study, we designed PEGylated liposomes encapsulating epirubicin as an antineoplastic agent and tilapia hepcidin 2–3, an AMP, as a multidrug resistance (MDR transporter suppressor and an apoptosis/autophagy modulator in human cervical cancer HeLa cells. Cotreatment of HeLa cells with PEGylated liposomal formulation of epirubicin and hepcidin 2–3 significantly increased the cytotoxicity of epirubicin. The liposomal formulations of epirubicin and/or hepcidin 2–3 were found to noticeably escalate the intracellular H2O2 and O2- levels of cancer cells. Furthermore, these treatments considerably reduced the mRNA expressions of MDR protein 1, MDR-associated protein (MRP 1, and MRP2. The addition of hepcidin 2–3 in liposomes was shown to markedly enhance the intracellular epirubicin uptake and mainly localized into the nucleus. Moreover, this formulation was also found to trigger apoptosis and autophagy in HeLa cells, as validated by significant increases in the expressions of cleaved poly ADP ribose polymerase, caspase-3, caspase-9, and light chain 3 (LC3-II, as well as a decrease in mitochondrial membrane potential. The apoptosis induction was also confirmed by the rise in sub-G1 phase of cell cycle assay and apoptosis percentage of annexin V/propidium iodide assay. We found that liposomal epirubicin and hepcidin 2–3 augmented the accumulation of GFP-LC3 puncta as amplified by chloroquine, implying the involvement of autophagy. Interestingly, the partial inhibition of necroptosis and the epithelial
Bian, Zehua; Zhang, Jiwei; Li, Min; Feng, Yuyang; Wang, Xue; Zhang, Jia; Yao, Surui; Jin, Guoying; Du, Jun; Han, Weifeng; Yin, Yuan; Huang, Shenglin; Fei, Bojian; Zou, Jian; Huang, Zhaohui
2018-06-18
Long non-coding RNAs (lncRNAs) play key roles in human cancers. Here, FEZF1-AS1, a highly overexpressed lncRNA in colorectal cancer (CRC), was identified by lncRNA microarrays. We aimed to explore the roles and possible molecular mechanisms of FEZF1-AS1 in CRC. LncRNA expression in CRC tissues was measured by lncRNA microarray and qRT-PCR. The functional roles of FEZF1-AS1 in CRC were demonstrated by a series of in vitro and in vivo experiments. RNA pull-down, RNA immunoprecipitation and luciferase analyses were used to demonstrate the potential mechanisms of FEZF1-AS1. We identified a series of differentially expressed lncRNAs in CRC using lncRNA microarrays, and revealed that FEZF1-AS1 is one of the most overexpressed. Further validation in two expanded CRC cohorts confirmed the upregulation of FEZF1-AS1 in CRC, and revealed that increased FEZF1-AS1 expression is associated with poor survival. Functional assays revealed that FEZF1-AS1 promotes CRC cell proliferation and metastasis. Mechanistically, FEZF1-AS1 could bind and increase the stability of the pyruvate kinase 2 (PKM2) protein, resulting in increased cytoplasmic and nuclear PKM2 levels. Increased cytoplasmic PKM2 promoted pyruvate kinase activity and lactate production (aerobic glycolysis), whereas FEZF1-AS1-induced nuclear PKM2 upregulation further activated STAT3 signaling. In addition, PKM2 was upregulated in CRC tissues and correlated with FEZF1-AS1 expression and patient survival. Together, these data provide mechanistic insights into the regulation of FEZF1-AS1 on both STAT3 signaling and glycolysis by binding PKM2 and increasing its stability. Copyright ©2018, American Association for Cancer Research.
Energy Technology Data Exchange (ETDEWEB)
Iida, Tetsushi, E-mail: tiida@nig.ac.jp [Division of Cytogenetics, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); The Graduate University for Advanced Studies, Sokendai, Mishima, 1111 Yata, Mishima 411-8540 (Japan); Precursory Research for Embryonic Science and Technology (PRESTO), Japan Science and Technology Agency (JST), 4-1-8, Honcho, Kawaguchi-shi, Saitama 332-0012 (Japan); Iida, Naoko [Division of Mutagenesis, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); Tsutsui, Yasuhiro [Department of Life Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsuda-cho, Midori-ku, Yokohama 226-8501 (Japan); Yamao, Fumiaki [Division of Mutagenesis, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); The Graduate University for Advanced Studies, Sokendai, Mishima, 1111 Yata, Mishima 411-8540 (Japan); Kobayashi, Takehiko [Division of Cytogenetics, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); The Graduate University for Advanced Studies, Sokendai, Mishima, 1111 Yata, Mishima 411-8540 (Japan)
2012-10-12
Highlights: Black-Right-Pointing-Pointer RNAi is linked to the cell cycle checkpoint in fission yeast. Black-Right-Pointing-Pointer Ptr1 co-purifies with Ago1. Black-Right-Pointing-Pointer The ptr1-1 mutation impairs the checkpoint but does not affect gene silencing. Black-Right-Pointing-Pointer ago1{sup +} and ptr1{sup +} regulate the cell cycle checkpoint via the same pathway. Black-Right-Pointing-Pointer Mutations in ago1{sup +} and ptr1{sup +} lead to the nuclear accumulation of poly(A){sup +} RNAs. -- Abstract: Ago1, an effector protein of RNA interference (RNAi), regulates heterochromatin silencing and cell cycle arrest in fission yeast. However, the mechanism by which Ago1 controls cell cycle checkpoint following hydroxyurea (HU) treatment has not been elucidated. In this study, we show that Ago1 and other RNAi factors control cell cycle checkpoint following HU treatment via a mechanism independent of silencing. While silencing requires dcr1{sup +}, the overexpression of ago1{sup +} alleviated the cell cycle defect in dcr1{Delta}. Ago1 interacted with the mRNA export factor, Ptr1. The ptr1-1 mutation impaired cell cycle checkpoint but gene silencing was unaffected. Genetic analysis revealed that the regulation of cell cycle checkpoint by ago1{sup +} is dependent on ptr1{sup +}. Nuclear accumulation of poly(A){sup +} RNAs was detected in mutants of ago1{sup +} and ptr1{sup +}, suggesting there is a functional link between the cell cycle checkpoint and RNAi-mediated RNA quality control.
Directory of Open Access Journals (Sweden)
Freddie Bwanga
Full Text Available The most common method for detection of drug resistant (DR TB in resource-limited settings (RLSs is indirect susceptibility testing on Lowenstein-Jensen medium (LJ which is very time consuming with results available only after 2-3 months. Effective therapy of DR TB is therefore markedly delayed and patients can transmit resistant strains. Rapid and accurate tests suitable for RLSs in the diagnosis of DR TB are thus highly needed. In this study we compared two direct techniques--Nitrate Reductase Assay (NRA and Microscopic Observation Drug Susceptibility (MODS for rapid detection of MDR-TB in a high burden RLS. The sensitivity, specificity, and proportion of interpretable results were studied. Smear positive sputum was collected from 245 consecutive re-treatment TB patients attending a TB clinic in Kampala, Uganda. Samples were processed at the national reference laboratory and tested for susceptibility to rifampicin and isoniazid with direct NRA, direct MODS and the indirect LJ proportion method as reference. A total of 229 specimens were confirmed as M. tuberculosis, of these interpretable results were obtained in 217 (95% with either the NRA or MODS. Sensitivity, specificity and kappa agreement for MDR-TB diagnosis was 97%, 98% and 0.93 with the NRA; and 87%, 95% and 0.78 with the MODS, respectively. The median time to results was 10, 7 and 64 days with NRA, MODS and the reference technique, respectively. The cost of laboratory supplies per sample was low, around 5 USD, for the rapid tests. The direct NRA and MODS offered rapid detection of resistance almost eight weeks earlier than with the reference method. In the study settings, the direct NRA was highly sensitive and specific. We consider it to have a strong potential for timely detection of MDR-TB in RLS.
Directory of Open Access Journals (Sweden)
Krisda H Chaiyachati
Full Text Available As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs, trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones.We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period.All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment.Mobile HCWs submitted nine of 33 (27% expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care.This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations
Chaiyachati, Krisda H; Loveday, Marian; Lorenz, Stephen; Lesh, Neal; Larkan, Lee-Megan; Cinti, Sandro; Friedland, Gerald H; Haberer, Jessica E
2013-01-01
As the South African province of KwaZulu-Natal addresses a growing multidrug-resistant tuberculosis (MDR-TB) epidemic by shifting care and treatment from trained specialty centers to community hospitals, delivering and monitoring MDR-TB therapy has presented new challenges. In particular, tracking and reporting adverse clinical events have been difficult for mobile healthcare workers (HCWs), trained health professionals who travel daily to patient homes to administer and monitor therapy. We designed and piloted a mobile phone application (Mobilize) for mobile HCWs that electronically standardized the recording and tracking of MDR-TB patients on low-cost, functional phones. We assess the acceptability and feasibility of using Mobilize to record and submit adverse events forms weekly during the intensive phase of MDR-TB therapy and evaluate mobile HCW perceptions throughout the pilot period. All five mobile HCWs at one site were trained and provided with phones. Utilizing a mixed-methods evaluation, mobile HCWs' usage patterns were tracked electronically for seven months and analyzed. Qualitative focus groups and questionnaires were designed to understand the impact of mobile phone technology on the work environment. Mobile HCWs submitted nine of 33 (27%) expected adverse events forms, conflicting with qualitative results in which mobile HCWs stated that Mobilize improved adverse events communication, helped their daily workflow, and could be successfully expanded to other health interventions. When presented with the conflict between their expressed views and actual practice, mobile HCWs cited forgetfulness and believed patients should take more responsibility for their own care. This pilot experience demonstrated poor uptake by HCWs despite positive responses to using mHealth. Though our results should be interpreted cautiously because of the small number of mobile HCWs and MDR-TB patients in this study, we recommend carefully exploring the motivations of HCWs and
Brügger, D; Herbart, H; Gekeler, V; Seitz, G; Liu, C; Klingebiel, T; Orlikowsky, T; Einsele, H; Denzlinger, C; Bader, P; Niethammer, D; Beck, J F
1999-05-01
Despite the high effectiveness of various P-glycoprotein (P-gp) modulating substances in vitro their clinical value e.g. for combination treatment of acute myelogenous leukemias (AML) remains still unclear. This might be explainable by recent findings that other factors than P-gp (e.g. the multidrug resistance associated protein (MRP)) may also be involved in clinical occurring drug resistance. To study P-gp and MRP mediated MDR in AML blasts from patients with relapses at the functional level we measured rhodamine 123 (RHO) efflux in combination with a P-gp specific (SDZ PSC 833) or a MRP specific (MK571) modulator, respectively. Furthermore, direct antineoplastic drug action was monitored by determination of damaged cell fraction of a blast population using flow cytometry. We generally found strongly modulated RHO efflux by SDZ PSC 833 but slight RHO-efflux modulation by MK571 in blasts from relapsed states of AML expressing MDR1 or MRP mRNA at various levels. We could not demonstrate, though, significant PSC 833 or MK571 mediated modulation of the cytotoxic effects of etoposide. The results point to the possibility that combination of etoposide and a modulator might not improve responses to chemotherapy by targeting P-gp or MRP exclusively.
High SINE RNA Expression Correlates with Post-Transcriptional Downregulation of BRCA1
Directory of Open Access Journals (Sweden)
Giovanni Bosco
2013-04-01
Full Text Available Short Interspersed Nuclear Elements (SINEs are non-autonomous retrotransposons that comprise a large fraction of the human genome. SINEs are demethylated in human disease, but whether SINEs become transcriptionally induced and how the resulting transcripts may affect the expression of protein coding genes is unknown. Here, we show that downregulation of the mRNA of the tumor suppressor gene BRCA1 is associated with increased transcription of SINEs and production of sense and antisense SINE small RNAs. We find that BRCA1 mRNA is post-transcriptionally down-regulated in a Dicer and Drosha dependent manner and that expression of a SINE inverted repeat with sequence identity to a BRCA1 intron is sufficient for downregulation of BRCA1 mRNA. These observations suggest that transcriptional activation of SINEs could contribute to a novel mechanism of RNA mediated post-transcriptional silencing of human genes.
Directory of Open Access Journals (Sweden)
Wang Tingting
2008-04-01
Full Text Available Abstract Background One of the major challenges in currently chemotherapeutic theme is lacking effective biomarkers for drug response and sensitivity. Our current study focus on two promising biomarkers, ERCC1 (excision repair cross-complementing group 1 and BRCA1 (breast cancer susceptibility gene 1. To investigate their potential role in serving as biomarkers for drug sensitivity in cancer patients with metastases, we statistically measure the mRNA expression level of ERCC1 and BRCA1 in tumor cells isolated from malignant effusions and correlate them with cisplatin and/or docetaxel chemosensitivity. Methods Real-time quantitative PCR is used to analysis related genes expression in forty-six malignant effusions prospectively collected from non-small cell lung cancer (NSCLC, gastric and gynecology cancer patients. Viable tumor cells obtained from malignant effusions are tested for their sensitivity to cisplatin and docetaxel using ATP-TCA assay. Results ERCC1 expression level is negatively correlated with the sensitivity to cisplatin in NSCLC patients (P = 0.001. In NSCLC and gastric group, BRCA1 expression level is negatively correlated with the sensitivity to cisplatin (NSCLC: P = 0.014; gastric: P = 0.002 while positively correlated with sensitivity to docetaxel (NSCLC: P = 0.008; gastric: P = 0.032. A significant interaction is found between ERCC1 and BRCA1 mRNA expressions on sensitivity to cisplatin (P = 0.010, n = 45. Conclusion Our results demonstrate that ERCC1 and BRCA1 mRNA expression levels are correlated with in vitro chemosensitivity to cisplatin and/or docetaxel in malignant effusions of NSCLC and gastric cancer patients. And combination of ERCC1 and BRCA1 may have a better role on predicting the sensitivity to cisplatin than the single one is considered.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
Corduan, Aurélie; Plé, Hélène; Laffont, Benoit; Wallon, Thérèse; Plante, Isabelle; Landry, Patricia; Provost, Patrick
2015-05-01
Platelets play an important role in haemostasis, as well as in thrombosis and coagulation processes. They harbour a wide variety of messenger RNAs (mRNAs), that can template de novo protein synthesis, and an abundant array of microRNAs, which are known to mediate mRNA translational repression through proteins of the Argonaute (Ago) family. The relationship between platelet microRNAs and proteins capable of mediating translational repression, however, remains unclear. Here, we report that half of platelet microRNAs is associated to mRNA-regulatory Ago2 protein complexes, in various proportions. Associated to these Ago2 complexes are platelet mRNAs known to support de novo protein synthesis. Reporter gene activity assays confirmed the capacity of the platelet microRNAs, found to be associated to Ago2 complexes, to regulate translation of these platelet mRNAs through their 3'UTR. Neither the microRNA repertoire nor the microRNA composition of Ago2 complexes of human platelets changed upon activation with thrombin. However, under conditions favoring de novo synthesis of Plasminogen Activator Inhibitor-1 (PAI-1) protein, we documented a rapid dissociation of the encoding platelet SERPINE1 mRNA from Ago2 protein complexes as well as from the translational repressor protein T-cell-restricted intracellular antigen-1 (TIA-1). These findings are consistent with a scenario by which lifting of the repressive effects of Ago2 and TIA-1 protein complexes, involving a rearrangement of proteinmRNA complexes rather than disassembly of Ago2microRNA complexes, would allow translation of SERPINE1 mRNA into PAI-1 in response to platelet activation.
Wagh, Vishal; Urhekar, Anant; Modi, Deepak
2017-01-01
Identification of blood biomarkers that can be useful for predicting Mycobacterium tuberculosis (M.TB) infection, effect of therapy and Multi Drug Resistant (MDR) TB infected individuals is clinically useful for combating tuberculosis epidemic. In this study, we have evaluated the levels of selected miRNAs in serum of TB and MDR TB patients. In addition, we have studied their levels in serum of patients post-therapy. The levels of 4-miRNAs (miR-16, miR-29a, miR-125b and miR-155) were measured in 30 newly diagnosed TB patients, 19 Multi Drug Resistant (MDR) TB patients, 10 patients who completed TB therapy and were TB negative. 30 healthy individuals were recruited as controls. The levels of the miRNAs were estimated by qRT-PCR. Of the four miRNAs studied, the levels of miR-16 were significantly elevated and miR-155 were significantly reduced in serum of TB patients as compared to uninfected controls. The Receiver Operating Characteristic (ROC) curve of miR-16 and miR-155 exhibited a significant distinguishing efficiency with an AUC value of 1 (95% CI, 1 to 1) and 0.967 (95% CI, 0.92-1.04) respectively. Following the therapy, the levels of miR-16 and miR-155 returned to those observed in healthy subjects. In patients with MDR TB, miR-155 was lower as compared to healthy controls and TB treated group but higher as compared to TB naïve patients. miR-16 levels were lowest in serum of MDR TB patients compared to TB naïve, TB treated group and healthy controls. In conclusion, miR-16 and miR-155 in serum may act as surrogate biomarker for studying TB infection, progression of therapy and MDR TB. Copyright © 2016 Elsevier Ltd. All rights reserved.
Karabulut, S; Duranyıldız, D; Tas, F; Gezer, U; Akyüz, F; Serilmez, M; Ozgür, E; Yasasever, C T; Vatansever, S; Aykan, N F
2014-03-01
The principal aim of our study was to investigate the usefulness of serum protein and circulating mRNA of insulin-like growth factor-1 (IGF-1) as a diagnostic and prognostic tool in hepatocellular carcinoma (HCC). Fifty-four HCC patients and age- and sex-matched 20 healthy controls were enrolled into this study. Pretreatment serum IGF-1 and IGF-1 mRNA were determined by the solid-phase sandwich ELISA and quantitative RT-PCR method, respectively. The median age at diagnosis was 60 years, range 36-77 years; where majority of group were male (n = 48, 88.8%). All patients had cirrhotic history. Forty-six percent (n = 25) of patients had Child-Pugh score A, 30% (n = 16) had score B or C. All of the patients were treated with local therapies and none of them received sorafenib. The baseline serum IGF-1 mRNA levels were significantly higher in HCC patients than in the control group (p = 0.04), whereas no significant difference was observed for IGF-1 protein levels between the two group (p = 0.18). Patients with history of HBV infection, who were not treated, and who received multiple palliative treatment for HCC had higher serum IGF-1 mRNA levels (p = 0.03, 0.03, and 0.05, respectively). Poor performance status (p IGF-1 nor serum IGF-1 mRNA had significantly adverse effect on survival (p = 0.53 and 0.42, respectively).
Bi-objective integer programming for RNA secondary structure prediction with pseudoknots.
Legendre, Audrey; Angel, Eric; Tahi, Fariza
2018-01-15
RNA structure prediction is an important field in bioinformatics, and numerous methods and tools have been proposed. Pseudoknots are specific motifs of RNA secondary structures that are difficult to predict. Almost all existing methods are based on a single model and return one solution, often missing the real structure. An alternative approach would be to combine different models and return a (small) set of solutions, maximizing its quality and diversity in order to increase the probability that it contains the real structure. We propose here an original method for predicting RNA secondary structures with pseudoknots, based on integer programming. We developed a generic bi-objective integer programming algorithm allowing to return optimal and sub-optimal solutions optimizing simultaneously two models. This algorithm was then applied to the combination of two known models of RNA secondary structure prediction, namely MEA and MFE. The resulting tool, called BiokoP, is compared with the other methods in the literature. The results show that the best solution (structure with the highest F 1 -score) is, in most cases, given by BiokoP. Moreover, the results of BiokoP are homogeneous, regardless of the pseudoknot type or the presence or not of pseudoknots. Indeed, the F 1 -scores are always higher than 70% for any number of solutions returned. The results obtained by BiokoP show that combining the MEA and the MFE models, as well as returning several optimal and several sub-optimal solutions, allow to improve the prediction of secondary structures. One perspective of our work is to combine better mono-criterion models, in particular to combine a model based on the comparative approach with the MEA and the MFE models. This leads to develop in the future a new multi-objective algorithm to combine more than two models. BiokoP is available on the EvryRNA platform: https://EvryRNA.ibisc.univ-evry.fr .
Directory of Open Access Journals (Sweden)
Daniel Lepe-Soltero
2017-12-01
Full Text Available The genome annotation for the model plant Arabidopsis thaliana does not include the primary transcripts from which MIRNAs are processed. Here we present and analyze the raw mRNA sequencing data from wild type and serrate-1 globular stage embryos of A. thaliana, ecotype Columbia. Because SERRATE is required for pri-miRNA processing, these precursors accumulate in serrate-1 mutants, facilitating their detection using standard RNA-Seq protocols. We first use the mapping of the RNA-Seq reads to the reference genome to annotate the potential primary transcripts of MIRNAs expressed in the embryo. We then quantify these pri-miRNAs in wild type and serrate-1 mutants. Finally, we use differential expression analysis to determine which are up-regulated in serrate-1 compared to wild type, to select the best candidates for bona fide pri-miRNAs expressed in the globular stage embryos. In addition, we analyze a previously published RNA-Seq dataset of wild type and dicer-like 1 mutant embryos at the globular stage [1]. Our data are interpreted and discussed in a separate article [2].
Lepe-Soltero, Daniel; Armenta-Medina, Alma; Xiang, Daoquan; Datla, Raju; Gillmor, C Stewart; Abreu-Goodger, Cei
2017-12-01
The genome annotation for the model plant Arabidopsis thaliana does not include the primary transcripts from which MIRNAs are processed. Here we present and analyze the raw mRNA sequencing data from wild type and serrate-1 globular stage embryos of A. thaliana , ecotype Columbia. Because SERRATE is required for pri-miRNA processing, these precursors accumulate in serrate-1 mutants, facilitating their detection using standard RNA-Seq protocols. We first use the mapping of the RNA-Seq reads to the reference genome to annotate the potential primary transcripts of MIRNAs expressed in the embryo. We then quantify these pri-miRNAs in wild type and serrate-1 mutants. Finally, we use differential expression analysis to determine which are up-regulated in serrate-1 compared to wild type, to select the best candidates for bona fide pri-miRNAs expressed in the globular stage embryos. In addition, we analyze a previously published RNA-Seq dataset of wild type and dicer-like 1 mutant embryos at the globular stage [1]. Our data are interpreted and discussed in a separate article [2].
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
Corrêa, Régis L; Steiner, Florian A; Berezikov, Eugene; Ketting, René F
2010-04-08
RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.
Small catalytic RNA: Structure, function and application
Energy Technology Data Exchange (ETDEWEB)
Monforte, J.A.
1991-04-01
We have utilized a combination of photochemical cross-linking techniques and site-directed mutagenesis to obtain secondary and tertiary structure information for the self-cleaving, self-ligating subsequence of RNA from the negative strand of Satellite Tobacco Ringspot Virus. We have found that the helical regions fold about a hinge to promoting four different possible tertiary interactions, creating a molecular of similar shape to a paperclip. A model suggesting that the paperclip'' and hammerhead'' RNAs share a similar three dimensional structure is proposed. We have used a self-cleaving RNA molecule related to a subsequence of plant viroids, a hammerhead,'' to study the length-dependent folding of RNA produced during transcription by RNA polymerase. We have used this method to determine the length of RNA sequestered within elongating E. coli and T7 RNA polymerase complexes. The data show that for E. coli RNA polymerase 12{plus minus}1 nucleotides are sequestered within the ternary complex, which is consistent with the presence of an RNA-DNA hybrid within the transcription bubble, as proposed by others. The result for T7 RNA polymerase differs from E. coli RNA polymerase, with only 10{plus minus}1 nucleotides sequestered within the ternary complex, setting a new upper limit for the minimum RNA-DNA required for a stable elongating complex. Comparisons between E. coli and T7 RNA polymerase are made. The relevance of the results to models or transcription termination, abortive initiation, and initiation to elongation mode transitions are discussed.
Toczyski, D P; Steitz, J A
1993-01-01
EAP (EBER-associated protein) is an abundant, 15-kDa cellular RNA-binding protein which associates with certain herpesvirus small RNAs. We have raised polyclonal anti-EAP antibodies against a glutathione S-transferase-EAP fusion protein. Analysis of the RNA precipitated by these antibodies from Epstein-Barr virus (EBV)- or herpesvirus papio (HVP)-infected cells shows that > 95% of EBER 1 (EBV-encoded RNA 1) and the majority of HVP 1 (an HVP small RNA homologous to EBER 1) are associated with EAP. RNase protection experiments performed on native EBER 1 particles with affinity-purified anti-EAP antibodies demonstrate that EAP binds a stem-loop structure (stem-loop 3) of EBER 1. Since bacterially expressed glutathione S-transferase-EAP fusion protein binds EBER 1, we conclude that EAP binding is independent of any other cellular or viral protein. Detailed mutational analyses of stem-loop 3 suggest that EAP recognizes the majority of the nucleotides in this hairpin, interacting with both single-stranded and double-stranded regions in a sequence-specific manner. Binding studies utilizing EBER 1 deletion mutants suggest that there may also be a second, weaker EAP-binding site on stem-loop 4 of EBER 1. These data and the fact that stem-loop 3 represents the most highly conserved region between EBER 1 and HVP 1 suggest that EAP binding is a critical aspect of EBER 1 and HVP 1 function. Images PMID:8380232
Sotgiu, Giovanni; Centis, Rosella; D'Ambrosio, Lia; Alffenaar, Jan-William C.; Anger, Holly A.; Caminero, Jose A.; Castiglia, Paolo; De Lorenzo, Saverio; Ferrara, Giovanni; Koh, Won-Jung; Schecter, Giesela F.; Shim, Tae S.; Singla, Rupak; Skrahina, Alena; Spanevello, Antonio; Udwadia, Zarir F.; Villar, Miquel; Zampogna, Elisabetta; Zellweger, Jean-Pierre; Zumla, Alimuddin; Migliori, Giovanni Battista
2012-01-01
Linezolid is used off-label to treat multidrug-resistant tuberculosis (MDR-TB) in absence of systematic evidence. We performed a systematic review and meta-analysis on efficacy, safety and tolerability of linezolid-containing regimes based on individual data analysis. 12 studies (11 countries from
Perivascular delivery of Notch 1 siRNA inhibits injury-induced arterial remodeling.
Directory of Open Access Journals (Sweden)
Eileen M Redmond
Full Text Available To determine the efficacy of perivascular delivery of Notch 1 siRNA in preventing injury-induced arterial remodeling.Carotid artery ligation was performed to induce arterial remodeling. After 14 days, morphometric analysis confirmed increased vSMC growth and subsequent media thickening and neointimal formation. Laser capture microdissection, quantitative qRT-PCR and immunoblot analysis of medial tissue revealed a significant increase in Notch1 receptor and notch target gene, Hrt 1 and 2 expression in the injured vessels. Perivascular delivery of Notch 1 siRNA by pluronic gel inhibited the injury-induced increase in Notch 1 receptor and target gene expression when compared to scrambled siRNA controls while concomitantly reducing media thickening and neointimal formation to pre-injury, sham-operated levels. Selective Notch 1 knockdown also reversed the injury-induced inhibition of pro-apoptotic Bax expression while decreasing injury-induced anti-apoptotic Bcl-XL expression to sham-operated control levels. In parallel experiments, proliferative cyclin levels, as measured by PCNA expression, were reversed to sham-operated control levels following selective Notch 1 knockdown.These results suggest that injury-induced arterial remodeling can be successfully inhibited by localized perivascular delivery of Notch 1 siRNA.
U1 small nuclear RNA variants differentially form ribonucleoprotein particles in vitro.
Somarelli, Jason A; Mesa, Annia; Rodriguez, Carol E; Sharma, Shalini; Herrera, Rene J
2014-04-25
The U1 small nuclear (sn)RNA participates in splicing of pre-mRNAs by recognizing and binding to 5' splice sites at exon/intron boundaries. U1 snRNAs associate with 5' splice sites in the form of ribonucleoprotein particles (snRNPs) that are comprised of the U1 snRNA and 10 core components, including U1A, U1-70K, U1C and the 'Smith antigen', or Sm, heptamer. The U1 snRNA is highly conserved across a wide range of taxa; however, a number of reports have identified the presence of expressed U1-like snRNAs in multiple species, including humans. While numerous U1-like molecules have been shown to be expressed, it is unclear whether these variant snRNAs have the capacity to form snRNPs and participate in splicing. The purpose of the present study was to further characterize biochemically the ability of previously identified human U1-like variants to form snRNPs and bind to U1 snRNP proteins. A bioinformatics analysis provided support for the existence of multiple expressed variants. In vitro gel shift assays, competition assays, and immunoprecipitations (IPs) revealed that the variants formed high molecular weight assemblies to varying degrees and associated with core U1 snRNP proteins to a lesser extent than the canonical U1 snRNA. Together, these data suggest that the human U1 snRNA variants analyzed here are unable to efficiently bind U1 snRNP proteins. The current work provides additional biochemical insights into the ability of the variants to assemble into snRNPs. Copyright © 2014 Elsevier B.V. All rights reserved.
Dissection of protein interactomics highlights microRNA synergy.
Zhu, Wenliang; Zhao, Yilei; Xu, Yingqi; Sun, Yong; Wang, Zhe; Yuan, Wei; Du, Zhimin
2013-01-01
Despite a large amount of microRNAs (miRNAs) have been validated to play crucial roles in human biology and disease, there is little systematic insight into the nature and scale of the potential synergistic interactions executed by miRNAs themselves. Here we established an integrated parameter synergy score to determine miRNA synergy, by combining the two mechanisms for miRNA-miRNA interactions, miRNA-mediated gene co-regulation and functional association between target gene products, into one single parameter. Receiver operating characteristic (ROC) analysis indicated that synergy score accurately identified the gene ontology-defined miRNA synergy (AUC = 0.9415, psynergy, implying poor expectancy of widespread synergy. However, targeting more key genes made two miRNAs more likely to act synergistically. Compared to other miRNAs, miR-21 was a highly exceptional case due to frequent appearance in the top synergistic miRNA pairs. This result highlighted its essential role in coordinating or strengthening physiological and pathological functions of other miRNAs. The synergistic effect of miR-21 and miR-1 were functionally validated for their significant influences on myocardial apoptosis, cardiac hypertrophy and fibrosis. The novel approach established in this study enables easy and effective identification of condition-restricted potent miRNA synergy simply by concentrating the available protein interactomics and miRNA-target interaction data into a single parameter synergy score. Our results may be important for understanding synergistic gene regulation by miRNAs and may have significant implications for miRNA combination therapy of cardiovascular disease.
Naum-Onganía, Gabriela; Gago-Zachert, Selma; Peña, Eduardo; Grau, Oscar; Garcia, Maria Laura
2003-10-01
Citrus psorosis virus (CPsV), the type member of genus Ophiovirus, has three genomic RNAs. Complete sequencing of CPsV RNA 1 revealed a size of 8184 nucleotides and Northern blot hybridization with chain specific probes showed that its non-coding strand is preferentially encapsidated. The complementary strand of RNA 1 contains two open reading frames (ORFs) separated by a 109-nt intergenic region, one located near the 5'-end potentially encoding a 24K protein of unknown function, and another of 280K containing the core polymerase motifs characteristic of viral RNA-dependent RNA polymerases (RdRp). Comparison of the core RdRp motifs of negative-stranded RNA viruses, supports grouping CPsV, Ranunculus white mottle virus (RWMV) and Mirafiori lettuce virus (MiLV) within the same genus (Ophiovirus), constituting a monophyletic group separated from all other negative-stranded RNA viruses. Furthermore, RNAs 1 of MiLV, CPsV and RWMV are similar in size and those of MiLV and CPsV also in genomic organization and sequence.
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
Soge, Olusegun O; No, David; Michael, Karen E; Dankoff, Jennifer; Lane, Jennifer; Vogel, Keith; Smedley, Jeremy; Roberts, Marilyn C
2016-10-01
MDR MRSA isolates cultured from primates, their facility and primate personnel from the Washington National Primate Research Center were characterized to determine whether they were epidemiologically related to each other and if they represented common local human-associated MRSA strains. Human and primate nasal and composite environmental samples were collected, enriched and selected on medium supplemented with oxacillin and polymyxin B. Isolates were biochemically verified as Staphylococcus aureus and screened for the mecA gene. Selected isolates were characterized using SCCmec typing, MLST and WGS. Nasal cultures were performed on 596 primates and 105 (17.6%) were MRSA positive. Two of 79 (2.5%) personnel and two of 56 (3.6%) composite primate environmental facility samples were MRSA positive. Three MRSA isolates from primates, one MRSA from personnel, two environmental MRSA and one primate MSSA were ST188 and were the same strain type by conventional typing methods. ST188 isolates were related to a 2007 ST188 human isolate from Hong Kong. Both MRSA isolates from out-of-state primates had a novel MLST type, ST3268, and an unrelated group. All isolates carried ≥1 other antibiotic resistance gene(s), including tet(38), the only tet gene identified. ST188 is very rare in North America and has almost exclusively been identified in people from Pan-Asia, while ST3268 is a newly reported MRSA type. The data suggest that the primate MDR MRSA was unlikely to come from primate centre employees. Captive primates are likely to be an unappreciated source of MRSA. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Oestradiol reduces Liver Receptor Homolog-1 mRNA transcript stability in breast cancer cell lines
International Nuclear Information System (INIS)
Lazarus, Kyren A.; Zhao, Zhe; Knower, Kevin C.; To, Sarah Q.; Chand, Ashwini L.; Clyne, Colin D.
2013-01-01
Highlights: •LRH-1 is an orphan nuclear receptor that regulates tumor proliferation. •In breast cancer, high mRNA expression is associated with ER+ status. •In ER−ve cells, despite very low mRNA, we found abundant LRH-1 protein. •Our data show distinctly different LRH-1 protein isoforms in ER− and ER+ breast cancer cells. •This is due to differences in LRH-1 mRNA and protein stability rates. -- Abstract: The expression of orphan nuclear receptor Liver Receptor Homolog-1 (LRH-1) is elevated in breast cancer and promotes proliferation, migration and invasion in vitro. LRH-1 expression is regulated by oestrogen (E 2 ), with LRH-1 mRNA transcript levels higher in oestrogen receptor α (ERα) positive (ER+) breast cancer cells compared to ER− cells. However, the presence of LRH-1 protein in ER− cells suggests discordance between mRNA transcript levels and protein expression. To understand this, we investigated the impact of mRNA and protein stability in determining LRH-1 protein levels in breast cancer cells. LRH-1 transcript levels were significantly higher in ER+ versus ER− breast cancer cells lines; however LRH-1 protein was expressed at similar levels. We found LRH-1 mRNA and protein was more stable in ER− compared to ER+ cell lines. The tumor-specific LRH-1 variant isoform, LRH-1v4, which is highly responsive to E 2 , showed increased mRNA stability in ER− versus ER+ cells. In addition, in MCF-7 and T47-D cell lines, LRH-1 total mRNA stability was reduced with E 2 treatment, this effect mediated by ERα. Our data demonstrates that in ER− cells, increased mRNA and protein stability contribute to the abundant protein expression levels. Expression and immunolocalisation of LRH-1 in ER− cells as well as ER− tumors suggests a possible role in the development of ER− tumors. The modulation of LRH-1 bioactivity may therefore be beneficial as a treatment option in both ER− and ER+ breast cancer
Oestradiol reduces Liver Receptor Homolog-1 mRNA transcript stability in breast cancer cell lines
Energy Technology Data Exchange (ETDEWEB)
Lazarus, Kyren A. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Environmental and Biotechnology Centre, Swinburne University, Hawthorn, Victoria 3122 (Australia); Zhao, Zhe; Knower, Kevin C. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); To, Sarah Q. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3168 (Australia); Chand, Ashwini L. [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Clyne, Colin D., E-mail: Colin.clyne@princehenrys.org [Cancer Drug Discovery Laboratory, Prince Henry’s Institute of Medical Research, Clayton, Victoria 3168 (Australia); Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3168 (Australia)
2013-08-30
Highlights: •LRH-1 is an orphan nuclear receptor that regulates tumor proliferation. •In breast cancer, high mRNA expression is associated with ER+ status. •In ER−ve cells, despite very low mRNA, we found abundant LRH-1 protein. •Our data show distinctly different LRH-1 protein isoforms in ER− and ER+ breast cancer cells. •This is due to differences in LRH-1 mRNA and protein stability rates. -- Abstract: The expression of orphan nuclear receptor Liver Receptor Homolog-1 (LRH-1) is elevated in breast cancer and promotes proliferation, migration and invasion in vitro. LRH-1 expression is regulated by oestrogen (E{sub 2}), with LRH-1 mRNA transcript levels higher in oestrogen receptor α (ERα) positive (ER+) breast cancer cells compared to ER− cells. However, the presence of LRH-1 protein in ER− cells suggests discordance between mRNA transcript levels and protein expression. To understand this, we investigated the impact of mRNA and protein stability in determining LRH-1 protein levels in breast cancer cells. LRH-1 transcript levels were significantly higher in ER+ versus ER− breast cancer cells lines; however LRH-1 protein was expressed at similar levels. We found LRH-1 mRNA and protein was more stable in ER− compared to ER+ cell lines. The tumor-specific LRH-1 variant isoform, LRH-1v4, which is highly responsive to E{sub 2}, showed increased mRNA stability in ER− versus ER+ cells. In addition, in MCF-7 and T47-D cell lines, LRH-1 total mRNA stability was reduced with E{sub 2} treatment, this effect mediated by ERα. Our data demonstrates that in ER− cells, increased mRNA and protein stability contribute to the abundant protein expression levels. Expression and immunolocalisation of LRH-1 in ER− cells as well as ER− tumors suggests a possible role in the development of ER− tumors. The modulation of LRH-1 bioactivity may therefore be beneficial as a treatment option in both ER− and ER+ breast cancer.
Directory of Open Access Journals (Sweden)
Luk Ketut Budi Maitriani
2015-10-01
Full Text Available ABSTRAK : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb. ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is
Zhang, Gang; Li, Shuwei; Lu, Jiafei; Ge, Yuqiu; Wang, Qiaoyan; Ma, Gaoxiang; Zhao, Qinghong; Wu, Dongdong; Gong, Weida; Du, Mulong; Chu, Haiyan; Wang, Meilin; Zhang, Aihua; Zhang, Zhengdong
2018-05-02
Emerging evidence has shown that dysregulation function of long non-coding RNAs (lncRNAs) implicated in gastric cancer (GC). However, the role of the differentially expressed lncRNAs in GC has not fully explained. LncRNA expression profiles were determined by lncRNA microarray in five pairs of normal and GC tissues, further validated in another 75 paired tissues by quantitative real-time PCR (qRT-PCR). Overexpression of lncRNA MT1JP was conducted to assess the effect of MT1JP in vitro and in vivo. The biological functions were demonstrated by luciferase reporter assay, western blotting and rescue experiments. LncRNA MT1JP was significantly lower in GC tissues than adjacent normal tissues, and higher MT1JP was remarkably related to lymph node metastasis and advance stage. Besides, GC patients with higher MT1JP expression had a well survival. Functionally, overexpression of lncRNA MT1JP inhibited cell proliferation, migration, invasion and promoted cell apoptosis in vitro, and inhibited tumor growth and metastasis in vivo. Functional analysis showed that lncRNA MT1JP regulated FBXW7 expression by competitively binding to miR-92a-3p. MiR-92a-3p and down-regulated FBXW7 reversed cell phenotypes caused by lncRNA MT1JP by rescue analysis. MT1JP, a down-regulated lncRNA in GC, was associated with malignant tumor phenotypes and survival of GC. MT1JP regulated the progression of GC by functioning as a competing endogenous RNA (ceRNA) to competitively bind to miR-92a-3p and regulate FBXW7 expression. Our study provided new insight into the post-transcriptional regulation mechanism of lncRNA MT1JP, and suggested that MT1JP may act as a potential therapeutic target and prognosis biomarker for GC.
Relative workload determines exercise-induced increases in PGC-1alpha mRNA
DEFF Research Database (Denmark)
Nordsborg, Nikolai Baastrup; Lundby, Carsten; Leick, Lotte
2010-01-01
INTRODUCTION:: The hypothesis that brief intermittent exercise induced increases in human skeletal muscle metabolic mRNA is dependent on relative workload was investigated. METHODS:: Trained (n=10) and untrained (n=8) subjects performed exhaustive intermittent cycling exercise (4x4 min @ 85% of VO2...... peak, interspersed by 3 min). Trained subjects also performed the intermittent exercise at the same absolute workload as untrained, corresponding to 70% of VO2 peak (n=6). RESULTS:: Exercise at 85% of VO2 peak elevated (P... and untrained, respectively. PGC-1alpha mRNA expression was increased (Pelevated (3.1+/-0.7 mM) and PGC-1alpha mRNA content was less (P
Directory of Open Access Journals (Sweden)
Mrozikiewicz Przemyslaw M.
2014-06-01
Full Text Available There are a number of compounds that can modify the activity of ABC (ATP-binding cassette and SLC (solute carrier transporters in the blood-brain barrier (BBB. The aim of this study was to investigate the effect of natural and synthetic substances on the expression level of genes encoding transporters present in the BBB (mdr1a, mdr1b, mrp1, mrp2, oatp1a4, oatp1a5 and oatp1c1. Our results showed that verapamil caused the greatest reduction in the mRNA level while other synthetic (piracetam, phenobarbital and natural (codeine, cyclosporine A, quercetin substances showed a selective inhibitory effect. Further, the extract from the roots of Panax ginseng C. A. Meyer exhibited a decrease of transcription against selected transporters whereas the extract from Ginkgo biloba L. leaves resulted in an increase of the expression level of tested genes, except for mrp2. Extract from the aerial parts of Hypericum perforatum L. was the only one to cause an increased mRNA level for mdr1 and oatp1c1. These findings suggest that herbs can play an important role in overcoming the BBB and multidrug resistance to pharmacotherapy of brain cancer and mental disorders, based on the activity of selected drug-metabolizing enzymes and transporters located in the BBB
de Azeredo, Lucas Araújo; Wearick-Silva, Luis Eduardo; Viola, Thiago Wendt; Tractenberg, Saulo Gantes; Centeno-Silva, Anderson; Orso, Rodrigo; Schröder, Nadja; Bredy, Timothy William; Grassi-Oliveira, Rodrigo
2017-05-01
In rodents, disruption of mother-infant attachment induced by maternal separation (MS) is associated with recognition memory impairment and long-term neurobiological consequences. Particularly stress-induced modifications have been associated to disruption of cadherin (CDH) adhesion function, which plays an important role in remodeling of neuronal connection and synaptic plasticity. This study investigated the sex-dependent effect of MS on recognition memory and mRNA levels of classical type I and type II CDH and the related β -catenin (β -Cat) in the hippocampus and prefrontal cortex of late adolescent mice. We provided evidence that the BALB/c mice exposed to MS present deficit in recognition memory, especially females. Postnatal MS induced higher hippocampal CDH-2 and CDH-8 mRNA levels, as well as an upregulation of CDH-1 in the prefrontal cortex in both males and females. MS-reared female mice presented lower CDH-1 mRNA levels in the hippocampus. In addition, hippocampal CDH-1 mRNA levels were positively correlated with recognition memory performance in females. MS-reared male mice exhibited higher β -Cat mRNA levels in the hippocampus. Considering sex-specific effects on CDH mRNA levels, it has been demonstrated mRNA changes in CDH-1, β -Cat, and CDH-6 in the hippocampus, as well as CDH-1, CDH-8 and CDH-11 in the prefrontal cortex. Overall, these findings suggest a complex interplay among MS, CDH mRNA expression, and sex differences in the PFC and hippocampus of adolescent mice. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Shuai Wang
2016-05-01
Full Text Available Plants have varying abilities to tolerate chilling (low but not freezing temperatures, and it is largely unknown how plants such as Arabidopsis thaliana achieve chilling tolerance. Here, we describe a genome-wide screen for genes important for chilling tolerance by their putative knockout mutants in Arabidopsis thaliana. Out of 11,000 T-DNA insertion mutant lines representing half of the genome, 54 lines associated with disruption of 49 genes had a drastic chilling sensitive phenotype. Sixteen of these genes encode proteins with chloroplast localization, suggesting a critical role of chloroplast function in chilling tolerance. Study of one of these proteins RBD1 with an RNA binding domain further reveals the importance of chloroplast translation in chilling tolerance. RBD1 is expressed in the green tissues and is localized in the chloroplast nucleoid. It binds directly to 23S rRNA and the binding is stronger under chilling than at normal growth temperatures. The rbd1 mutants are defective in generating mature 23S rRNAs and deficient in chloroplast protein synthesis especially under chilling conditions. Together, our study identifies RBD1 as a regulator of 23S rRNA processing and reveals the importance of chloroplast function especially protein translation in chilling tolerance.
Directory of Open Access Journals (Sweden)
Yotam Blech-Hermoni
2015-12-01
Full Text Available CUG-BP, Elav-like family member 1 (CELF1 is a multi-functional RNA binding protein that regulates pre-mRNA alternative splicing in the nucleus, as well as polyadenylation status, mRNA stability, and translation in the cytoplasm [1]. Dysregulation of CELF1 has been implicated in cardiomyopathies in myotonic dystrophy type 1 and diabetes [2–5], but the targets of CELF1 regulation in the heart have not been systematically investigated. We previously demonstrated that in the developing heart CELF1 expression is restricted to the myocardium and peaks during embryogenesis [6–8]. To identify transcripts regulated by CELF1 in the embryonic myocardium, RNA-seq was used to compare the transcriptome of primary embryonic cardiomyocytes following siRNA-mediated knockdown of CELF1 to that of controls. Raw data files of the RNA-seq reads have been deposited in NCBI's Gene Expression Omnibus [9] under the GEO Series accession number GSE67360. These data can be used to identify transcripts whose levels or alternative processing (i.e., alternative splicing or polyadenylation site usage are regulated by CELF1, and should provide insight into the pathways and processes modulated by this important RNA binding protein during normal heart development and during cardiac pathogenesis.
HTLV-1 Tax plugs and freezes UPF1 helicase leading to nonsense-mediated mRNA decay inhibition.
Fiorini, Francesca; Robin, Jean-Philippe; Kanaan, Joanne; Borowiak, Malgorzata; Croquette, Vincent; Le Hir, Hervé; Jalinot, Pierre; Mocquet, Vincent
2018-01-30
Up-Frameshift Suppressor 1 Homolog (UPF1) is a key factor for nonsense-mediated mRNA decay (NMD), a cellular process that can actively degrade mRNAs. Here, we study NMD inhibition during infection by human T-cell lymphotropic virus type I (HTLV-1) and characterise the influence of the retroviral Tax factor on UPF1 activity. Tax interacts with the central helicase core domain of UPF1 and might plug the RNA channel of UPF1, reducing its affinity for nucleic acids. Furthermore, using a single-molecule approach, we show that the sequential interaction of Tax with a RNA-bound UPF1 freezes UPF1: this latter is less sensitive to the presence of ATP and shows translocation defects, highlighting the importance of this feature for NMD. These mechanistic insights reveal how HTLV-1 hijacks the central component of NMD to ensure expression of its own genome.
Javadi, Hamidreza; Lotfi, Abbas Sahebghadam; Hosseinkhani, Saman; Mehrani, Hossein; Amani, Jafar; Soheili, Zahra Soheila; Hojati, Zahra; Kamali, Mehdi
2018-06-06
In the present research, we assumed that reducing the amounts of E6 and E7 oncoproteins by a specific siRNA sequence and recovering p53 and RB proteins, along with the recovery of the FOXO1 protein by applying anti-miR-182, would increase apoptosis and reduce proliferation rate in cancer cells. The HPV16-positive CaSki cervical cancer cell line was used. 48 hours after transfection of siRNA for targeting E6 and E7 oncoproteins and anti-miR-182, expression of its cellular targets p53, p21 and FOXO1 was assessed by real-time PCR, western blot analysis and immunocytofluorescence staining. In all treatments, apoptosis rate and viability were evaluated using Annexin-V-FITC apoptosis detection kits and MTT assays, respectively. Among the designed siRNAs, E6-1 and E7-2 proved the most effective in reducing E6 and E7 expressions by increasing the apoptotic rates to 12.4% and 16%, respectively, after 48 hours. Also, using anti-miR-182 increased apoptotic rate to 12.7% 48 hours after transfection of cervical cancer cells. The combinational use of either E6-1 or E7-2 siRNAs with anti-miR-182 resulted in a rise in apoptosis to 19.3% and 26%, respectively, higher than those obtained from the individual application of either without anti-miR-182. The simultaneous use of siRNA E6-1 and siRNA E7-2 with cisplatin increased sensitivity to cisplatin and reduced the viability of the cancer cells as compared to the use of cisplatin alone. The simultaneous use of cisplatin and anti-miR-182 had no considerable effect on viability or apoptosis rate compared to cisplatin alone.
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Stress induction of Bm1 RNA in silkworm larvae: SINEs, an unusual class of stress genes
Kimura, Richard H.; Choudary, Prabhakara V.; Stone, Koni K.; Schmid, Carl W.
2001-01-01
This study surveys the induction of RNA polymerase III (Pol III)–directed expression of short interspersed element (SINE) transcripts by various stresses in an animal model, silkworm larvae. Sublethal heat shock and exposure to several toxic compounds increase the level of Bm1 RNA, the silkworm SINE transcript, while also transiently increasing expression of a well-characterized stress-induced transcript, Hsp70 messenger RNA (mRNA). In certain cases, the Bm1 RNA response coincides with that of Hsp70 mRNA, but more often Bm1 RNA responds later in recovery. Baculovirus infection and exposure to certain toxic compounds increase Bm1 RNA but not Hsp70 mRNA, showing that SINE induction is not necessarily coupled to transcription of this particular heat shock gene. SINEs behave as an additional class of stress-inducible genes in living animals but are unusual as stress genes because of their high copy number, genomic dispersion, and Pol III–directed transcription. PMID:11599568
Yan, Wang; Chen, Zhao-Ying; Chen, Jia-Qi; Chen, Hui-Min
2018-02-19
Long non-coding RNA nuclear paraspeckle assembly transcript 1 (lncRNA NEAT1) was found to be closely related to the pathological changes in brain and nervous system. However, the role of NEAT1 and its potential mechanism in Parkinson's disease (PD) largely remain uncharacterized. In this study, PD mouse model was established by intraperitoneal injection of MPTP. The numbers of TH + neurons, NEAT1 expression and the level of PINK1, LC3-II, LC3-I protein were assessed in PD mice. SH-SY5Y cells were treated with MPP + as PD cell model. RNA pull-down assay was used to identify the interaction between NEAT1 and PINK1 in vitro. The endogenous expression of NEAT1 was modified by lentiviral vector carrying interference sequence for NEAT1 in vivo. The numbers of TH + neurons significantly decreased in PD mice compared with the control. The expressions of NEAT1, PINK1 protein and LC3-II/LC3-I level were increased by MPTP in vitro and in vivo. Moreover, NEAT1 positively regulated the protein level of PINK1 through inhibition of PINK1 protein degradation. And NEAT1 mediated the effects of MPP + on SH-SY5Y cells through stabilization of PINK1 protein. The results of in vivo experiments revealed that NEAT1 knockdown could effectively suppress MPTP-induced autophagy in vivo that alleviated dopaminergic neuronal injury. LncRNA NEAT1 promoted the MPTP-induced autophagy in PD through stabilization of PINK1 protein. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Shuai Yang
Full Text Available To study the role of long non-coding RNA (lncRNA MALAT1 in transforming growth factor beta 1 (TGF-β1-induced epithelial-mesenchymal transition (EMT of retinal pigment epithelial (RPE cells.ARPE-19 cells were cultured and exposed to TGF-β1. The EMT of APRE-19 cells is confirmed by morphological change, as well as the increased expression of alpha-smooth muscle actin (αSMA and fibronectin, and the down-regulation of E-cadherin and Zona occludin-1(ZO-1 at both mRNA and protein levels. The expression of lncRNA MALAT1 in RPE cells were detected by quantitative real-time PCR. Knockdown of MALAT1 was achieved by transfecting a small interfering RNA (SiRNA. The effect of inhibition of MALAT1 on EMT, migration, proliferation, and TGFβ signalings were observed. MALAT1 expression was also detected in primary RPE cells incubated with proliferative vitreoretinopathy (PVR vitreous samples.The expression of MALAT1 is significantly increased in RPE cells incubated with TGFβ1. MALAT1 silencing attenuates TGFβ1-induced EMT, migration, and proliferation of RPE cells, at least partially through activating Smad2/3 signaling. MALAT1 is also significantly increased in primary RPE cells incubated with PVR vitreous samples.LncRNA MALAT1 is involved in TGFβ1-induced EMT of human RPE cells and provides new understandings for the pathogenesis of PVR.
Recoding aminoacyl-tRNA synthetases for synthetic biology by rational protein-RNA engineering.
Hadd, Andrew; Perona, John J
2014-12-19
We have taken a rational approach to redesigning the amino acid binding and aminoacyl-tRNA pairing specificities of bacterial glutaminyl-tRNA synthetase. The four-stage engineering incorporates generalizable design principles and improves the pairing efficiency of noncognate glutamate with tRNA(Gln) by over 10(5)-fold compared to the wild-type enzyme. Better optimized designs of the protein-RNA complex include substantial reengineering of the globular core region of the tRNA, demonstrating a role for specific tRNA nucleotides in specifying the identity of the genetically encoded amino acid. Principles emerging from this engineering effort open new prospects for combining rational and genetic selection approaches to design novel aminoacyl-tRNA synthetases that ligate noncanonical amino acids onto tRNAs. This will facilitate reconstruction of the cellular translation apparatus for applications in synthetic biology.
Analysis of miRNA expression profiles in melatonin-exposed GC-1 spg cell line.
Zhu, Xiaoling; Chen, Shuxiong; Jiang, Yanwen; Xu, Ying; Zhao, Yun; Chen, Lu; Li, Chunjin; Zhou, Xu
2018-02-05
Melatonin is an endocrine neurohormone secreted by pinealocytes in the pineal gland. It exerts diverse physiological effects, such as circadian rhythm regulator and antioxidant. However, the functional importance of melatonin in spermatogenesis regulation remains unclear. The objectives of this study are to: (1) detect melatonin affection on miRNA expression profiles in GC-1 spg cells by miRNA deep sequencing (DeepSeq) and (2) define melatonin affected miRNA-mRNA interactions and associated biological processes using bioinformatics analysis. GC-1 spg cells were cultured with melatonin (10 -7 M) for 24h. DeepSeq data were validated using quantitative real-time reverse transcription polymerase chain reaction analysis (qRT-PCR). A total of 176 miRNA expressions were found to be significantly different between two groups (fold change of >2 or melatonin could regulate the expression of miRNA to perform its physiological effects in GC-1 spg cells. These results should be useful to investigate the biological function of miRNAs regulated by melatonin in spermatogenesis and testicular germ cell tumor. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Golam Mahmudunnabi
2018-06-01
Full Text Available Klebsiella pneumoniae is the second leading causative agent of UTI. In this study, a rapid combined polymerase chain reaction and restriction fragment length polymorphism analysis was developed to identify K. pneumoniae in women, infected with urinary tract infection in the Sylhet city of Bangladesh. Analysis of 11 isolates from women at the age range of 20–55 from three different hospitals were done firstly by amplification with K. pneumoniae specific ITS primers. All of the 11 collected isolates were amplified in PCR and showed the expected 136 bp products. Then, restriction fragment length polymorphism analysis of 11 isolates were conducted after PCR amplification by 16s rRNA universal primers, followed by subsequent digestion and incubation with two restriction enzymes, Pst1 and Alu1. Seven out of 11 isolates were digested by Pst1 restriction enzymes, six isolates digested by Alu1, and while others were negative for both enzymes. Data results reveal that, women at age between 25 and 50 were digested by both enzymes. A woman aged over than 50 was negative while bellow 20 was digested by only Pst1. The results could pave the tactic for further research in the detection of K. pneumoniae from UTI infected women. Keywords: Klebsiella pneumoniae, ITS-primer, MDR isolates, PCR-RFLP analysis
Zhan, Yuefu; Liang, Xianwen; Han, Xiangjun; Chen, Jianqiang; Zhang, Shufang; Tan, Shun; Li, Qun; Wang, Xiong; Liu, Fan
2017-02-28
To explore the correlation between the apparent diffusion coefficient (ADC) and mRNA expression of tissue inhibitor of metalloproteinase-1 (TIMP-1) in different stages of liver fibrosis in rats. Methods: A model of liver fibrosis in rats was established by intraperitoneal injection of high-fat diet combined with porcine serum. After drug administration for 4 weeks, 48 rats served as a model group and 12 rats served as a control group, then they underwent diffusion weighted imaging (DWI) scanning. The value of ADC was calculated at b value=800 s/mm2. The rats were sacrificed and carried out pathologic examination after DWI scanning immediately. The mRNA expression of TIMP-1 was detected by real time-polymerase chain reaction (RT-PCR). The rats of hepatic fibrosis were also divided into a S0 group (n=4), a S1 group (n=11), a S2 group (n=12), a S3 group (n=10), and a S4 group (n=9) according to their pathological stage. The value of ADC and the expression of TIMP-1 mRNA among the different stage groups of liver fibrosis were compared, and the correlation between ADC and the TIMP-1 mRNA were analyzed. Results: The ADC value and the TIMP-1 mRNA expression were significantly different between the control group and the liver fibrosis group (F=46.54 and 53.87, P0.05). For the comparison of TIMP-1 mRNA, there was no significant difference between the S1 group and the S2 group, the S3 group and the S4 group (both P>0.05). There were significant differences among the rest of the groups (all Pcorrelation analysis showed that there was a negative correlation between the ADC value and the TIMP-1 mRNA expression (r=-0.76, Pcorrelation between them.
Charley, Phillida A; Wilusz, Carol J; Wilusz, Jeffrey
2018-01-05
Regulated mRNA decay plays a vital role in determining both the level and quality of cellular gene expression. Viral RNAs must successfully evade this host RNA decay machinery to establish a productive infection. One way for RNA viruses to accomplish this is to target the cellular exoribonuclease XRN1, because this enzyme is accessible in the cytoplasm and plays a major role in mRNA decay. Members of the Flaviviridae use RNA structures in their 5'- or 3'-untranslated regions to stall and repress XRN1, effectively stabilizing viral RNAs while also causing significant dysregulation of host cell mRNA stability. Here, we use a series of biochemical assays to demonstrate that the 3'-terminal portion of the nucleocapsid (N) mRNA of Rift Valley fever virus, a phlebovirus of the Bunyaviridae family, also can effectively stall and repress XRN1. The region responsible for impeding XRN1 includes a G-rich portion that likely forms a G-quadruplex structure. The 3'-terminal portions of ambisense-derived transcripts of multiple arenaviruses also stalled XRN1. Therefore, we conclude that RNAs from two additional families of mammalian RNA viruses stall and repress XRN1. This observation. emphasizes the importance and commonality of this viral strategy to interfere with the 5'-to-3'-exoribonuclease component of the cytoplasmic RNA decay machinery. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Wenjuan Wei
2017-12-01
Full Text Available Background/Purpose: Treatment of Acinetobacter baumannii infections is challenging owing to widespread multidrug-resistant A. baumannii (MDR-AB and the lack of novel agents. Although recent data suggest that levofloxacin (LVX may have unique activity against MDR-AB in combination with colistin (CST, further preclinical work is needed. Methods: We used a A. baumannii type strain ATCC19606, a CST-resistant strain AB19606R, and two clinical isolates (GN0624 and GN1115 of MDR-AB to investigate the in vitro and in vivo efficacy of LVXâCST combination. Synergy studies were performed using the microtiter plate chequerboard assay and timeâkill methodology. Inhibitory activity of antibiotics against biofilms and the mutant prevention concentrations were also studied in vitro. A simple invertebrate model (Galleria mellonella has been used to assess the in vivo activity of antimicrobial therapies. Results: The LVXâCST combination was bactericidal against the CST-susceptible clinical isolate (GN0624. In checkerboard assays, synergy (defined as a fractional inhibitory concentration index of < 0.5 was observed between CST and LVX in GN0624. The combination had antibiofilm properties on the preformed biofilms of four tested strains and could prevent the emergence of CST-resistant A. baumanni. Treatment of G. mellonella larvae infected with lethal doses of A. baumannii resulted in significantly enhanced survival rates when LVX was given with CST compared with CST treatment alone (p < 0.05. Conclusion: In summary, a synergistic or additive effect between CST and LVX was observed in vitro and in vivo against CST-susceptible A. baumannii strains, although not against CST-resistant ones. Keywords: Acinetobacter baumannii, antimicrobial synergy, invertebrate model, levofloxacin, polymyxins