Rodríguez, M A; Del Rio Barquero, Luís M; Ortez, Carlos I; Jou, Cristina; Vigo, Meritxell; Medina, Julita; Febrer, Anna; Ramon-Krauel, Marta; Diaz-Manera, Jorge; Olive, Montse; González-Mera, Laura; Nascimento, Andres; Jimenez-Mallebrera, Cecilia
2017-01-01
Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM) characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD) and Bethlem Myopathy (BM). Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM). We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may be relevant to
Directory of Open Access Journals (Sweden)
M. A. Rodríguez
2017-08-01
Full Text Available Mutations in human collagen VI genes cause a spectrum of musculoskeletal conditions in children and adults collectively termed collagen VI-related myopathies (COL6-RM characterized by a varying degree of muscle weakness and joint contractures and which include Ullrich Congenital Muscular Dystrophy (UCMD and Bethlem Myopathy (BM. Given that collagen VI is one of the most abundant extracellular matrix proteins in adipose tissue and its emerging role in energy metabolism we hypothesized that collagen VI deficiency might be associated with alterations in adipose tissue distribution and adipokines serum profile. We analyzed body composition by means of dual-energy X-ray absorptiometry in 30 pediatric and adult COL6-RM myopathy patients representing a range of severities (UCMD, intermediate-COL6-RM, and BM. We found a distinctive pattern of regional adipose tissue accumulation which was more evident in children at the most severe end of the spectrum. In particular, the accumulation of fat in the android region was a distinguishing feature of UCMD patients. In parallel, there was a decrease in lean mass compatible with a state of sarcopenia, particularly in ambulant children with an intermediate phenotype. All children and adult patients that were sarcopenic were also obese. These changes were significantly more pronounced in children with collagen VI deficiency than in children with Duchenne Muscular Dystrophy of the same ambulatory status. High molecular weight adiponectin and leptin were significantly increased in sera from children in the intermediate and BM group. Correlation analysis showed that the parameters of fat mass were negatively associated with motor function according to several validated outcome measures. In contrast, lean mass parameters correlated positively with physical performance and quality of life. Leptin and adiponectin circulating levels correlated positively with fat mass parameters and negatively with lean mass and thus may
Pneumothoraces in collagen VI-related dystrophy: a case series and recommendations for management
Directory of Open Access Journals (Sweden)
Kristin L. Fraser
2017-06-01
Full Text Available Collagen VI-related dystrophy (collagen VI-RD is a rare neuromuscular condition caused by mutations in the COL6A1, COL6A2 or COL6A3 genes. The phenotypic spectrum includes early-onset Ullrich congenital muscular dystrophy, adult-onset Bethlem myopathy and an intermediate phenotype. The disorder is characterised by distal hyperlaxity and progressive muscle weakness, joint contractures and respiratory insufficiency. Respiratory insufficiency is attributed to chest wall contractures, scoliosis, impaired diaphragmatic function and intercostal muscle weakness. To date, intrinsic parenchymal lung disease has not been implicated in the inevitable respiratory decline of these patients. This series focuses on pneumothorax, an important but previously under-recognised disease manifestation of collagen VI-RD. We describe two distinct clinical presentations within collagen VI-RD patients with pneumothorax. The first cohort consists of neonates and children with a single pneumothorax in the setting of large intrathoracic pressure changes. The second group is made up of adult patients with recurrent pneumothoraces, associated with chest computed tomography scan evidence of parenchymal lung disease. We describe treatment challenges in this unique population with respect to expectant observation, tube thoracostomy and open pleurodesis. Based on this experience, we offer recommendations for early identification of lung disease in collagen VI-RD and definitive intervention.
Genetics Home Reference: collagen VI-related myopathy
... individuals have muscle weakness and joint deformities called contractures that restrict movement of the affected joints and ... muscle tone (hypotonia) in infancy, but they develop contractures during childhood, typically in their fingers, wrists, elbows, ...
Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts
DEFF Research Database (Denmark)
Witting, Nanna; Krag, Thomas; Werlauff, Ulla
2018-01-01
INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....
... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...
... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...
Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.
Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker
2014-05-01
Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.
Mitochondrial disorders in congenital myopathies
Directory of Open Access Journals (Sweden)
D. A. Kharlamov
2014-01-01
Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.
Dimachkie, Mazen M.; Barohn, Richard J.
2014-01-01
Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent
DEFF Research Database (Denmark)
Witting, Nanna; Andersen, Linda K; Vissing, John
2016-01-01
Classically, myopathies are categorized according to limb or cranial nerve muscle affection, but with the growing use of magnetic resonance imaging it has become evident that many well-known myopathies have significant involvement of the axial musculature. New disease entities with selective axial...
Tarnopolsky, Mark A
2016-12-01
Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.
Directory of Open Access Journals (Sweden)
Alessandra eZulian
2014-11-01
Full Text Available Ullrich congenital muscular dystrophy and Bethlem myopathy are caused by mutations in collagen VI genes, which encode an extracellular matrix protein; yet mitochondria play a major role in disease pathogenesis through a short circuit caused by inappropriate opening of the permeability transition pore, a high conductance channel which causes a shortage in ATP production. We find that melanocytes do not produce collagen VI yet they bind it at the cell surface, suggesting that this protein may play a trophic role and that its absence may cause lesions similar to those seen in skeletal muscle. We show that mitochondria in melanocytes of Ullrich congenital muscular dystrophy and Bethlem myooathy patients display increased size, reduced matrix density and disrupted cristae, findings that suggest a functional impairment. In keeping with this hypothesis, mitochondria (i underwent anomalous depolarization after inhibition of the F-ATP synthase with oligomycin, and (ii displayed decreased respiratory reserve capacity. The non-immunosuppressive cyclophilin inhibitor NIM811 prevented mitochondrial depolarization in response to oligomycin in melanocytes from both Ullrich congenital muscular dystrophy and Bethlem myopathy patients, and partially restored the respiratory reserve of melanocytes from one Bethlem myopathy patient. These results match our recent findings on melanocytes from patients affected by Duchenne muscular dystrophy (Pellegrini et al., 2013 Melanocytes--a novel tool to study mitochondrial dysfunction in Duchenne muscular dystrophy. J Cell Physiol 228, 1323-1331, and suggest that skin biopsies may represent a minimally invasive tool to investigate mitochondrial dysfunction and to evaluate drug efficacy in collagen VI-related myopathies and possibly in other muscle wasting conditions like aging sarcopenia.
DiMauro, Salvatore
2006-11-01
Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.
Papazian, Óscar; Rivas-Chacón, Rafael
2013-09-06
To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.
Jackson, Gail C.; Marcus-Soekarman, Dominique; Stolte-Dijkstra, Irene; Verrips, Aad; Taylor, Jacqueline A.; Briggs, Michael D.
Multiple epiphyseal dysplasia (MED) is a clinically variable and genetically heterogeneous disease that is characterized by mild short stature and early onset osteoarthritis. Autosomal dominant forms are caused by mutations in the genes that encode type IX collagen, cartilage oligomeric matrix
Jackson, G.C.; Marcus-Soekarman, D.; Stolte-Dijkstra, I.; Verrips, A.; Taylor, J.A.; Briggs, M.D.
2010-01-01
Multiple epiphyseal dysplasia (MED) is a clinically variable and genetically heterogeneous disease that is characterized by mild short stature and early onset osteoarthritis. Autosomal dominant forms are caused by mutations in the genes that encode type IX collagen, cartilage oligomeric matrix
Molecular and Genetic Studies of Congenital Myopathies
2018-03-21
Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy
Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa
2013-10-01
Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.
Directory of Open Access Journals (Sweden)
Aralikatte Onkarappa Saroja
2013-01-01
Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.
Myopathy in acute hypothyroidism
Ma, JTC; Yu, YL; Kung, AWC
1987-01-01
Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...
Myopathy in acute hypothyroidism.
Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.
1987-01-01
Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...
Genetics Home Reference: Miyoshi myopathy
... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...
de Freitas, M R; Nascimento, O J
1975-06-01
The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.
STATINS AND MYOPATHY: MOLECULAR MECHANISMS
Directory of Open Access Journals (Sweden)
O. M. Drapkina
2012-01-01
Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered.
International Nuclear Information System (INIS)
Edstroem, L.; Wroblewski, R.; Mair, W.G.
1982-01-01
Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation
Cerebrovascular Accidents In Myopathies
Directory of Open Access Journals (Sweden)
Farzad Fatehi
2017-02-01
Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.
Muscle regeneration in mitochondrial myopathies
DEFF Research Database (Denmark)
Krag, T O; Hauerslev, S; Jeppesen, T D
2013-01-01
Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...
Spectrum of metabolic myopathies.
Angelini, Corrado
2015-04-01
Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.
Inherited myopathies and muscular dystrophies
Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.
The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and
Mosaicism for dominant collagen 6 mutations as a cause for intrafamilial phenotypic variability
Donkervoort, S.; Hu, Y.; Stojkovic, T.; Voermans, N.C.; Foley, A.R.; Leach, M.E.; Dastgir, J.; Bolduc, V.; Cullup, T.; Becdelievre, A. de; Yang, L.; Su, H.; Meilleur, K.; Schindler, A.B.; Kamsteeg, E.J.; Richard, P.; Butterfield, R.J.; Winder, T.L.; Crawford, T.O.; Weiss, R.B.; Muntoni, F.; Allamand, V.; Bonnemann, C.G.
2015-01-01
Collagen 6-related dystrophies and myopathies (COL6-RD) are a group of disorders that form a wide phenotypic spectrum, ranging from severe Ullrich congenital muscular dystrophy, intermediate phenotypes, to the milder Bethlem myopathy. Both inter- and intrafamilial variable expressivity are commonly
Stepwise approach to myopathy in systemic disease.
Chawla, Jasvinder
2011-01-01
Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.
Exercise training in metabolic myopathies
DEFF Research Database (Denmark)
Vissing, J
2016-01-01
metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...
Genetics Home Reference: nemaline myopathy
... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...
Endocrine myopathy: Case-based review
Directory of Open Access Journals (Sweden)
Babul Reddy Hanmayyagari
2016-01-01
Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.
Bastin, Jean; Djouadi, Fatima
2016-01-01
Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581
Bruno, Claudio; Dimauro, Salvatore
2008-10-01
The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.
Amyloid myopathy: a diagnostic challenge
Directory of Open Access Journals (Sweden)
Heli Tuomaala
2009-08-01
Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.
Idiopathic Inflammatory Myopathies: An update
Directory of Open Access Journals (Sweden)
Bulent KURT
2016-06-01
Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45
Immune-mediated statin myopathy.
Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit
2016-01-01
Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.
Localized scleroderma and regional inflammatory myopathy.
Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A
2014-05-01
Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.
ColVI myopathies: where do we stand, where do we go?
Directory of Open Access Journals (Sweden)
Allamand Valérie
2011-09-01
Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.
Evidence-based treatment of metabolic myopathy
Directory of Open Access Journals (Sweden)
Yan LIN
2014-05-01
Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment. Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature. Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should
DEFF Research Database (Denmark)
Soendergaard, Christoffer; Riis, Lene Buhl; Nielsen, Ole Haagen
2014-01-01
Collagenous sprue is a rare clinicopathological condition of the small bowel. It is characterised by abnormal subepithelial collagen deposition and is typically associated with malabsorption, diarrhoea and weight loss. The clinical features of collagenous sprue often resemble those of coeliac...... disease and together with frequent histological findings like mucosal thinning and intraepithelial lymphocytosis the diagnosis may be hard to reach without awareness of this condition. While coeliac disease is treated using gluten restriction, collagenous sprue is, however, not improved...... by this intervention. In cases of diet-refractory 'coeliac disease' it is therefore essential to consider collagenous sprue to initiate treatment at an early stage to prevent the fibrotic progression. Here, we report a case of a 78-year-old man with collagenous sprue and present the clinical and histological...
A diagnostic algorithm for metabolic myopathies.
Berardo, Andres; DiMauro, Salvatore; Hirano, Michio
2010-03-01
Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.
Genetics Home Reference: idiopathic inflammatory myopathy
... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...
Lago, N R; Bulos, M J; Monserrat, A J
1997-01-01
Fibrillar collagen in the glomeruli is considered specific of the nail-patella syndrome. A new nephropathy with diffuse intraglomerular deposition of type III collagen without nail and skeletal abnormalities has been described. We report the case of a 26-year-old woman who presented persistent proteinuria, hematuria, deafness without nail and skeletal abnormalities. The renal biopsy showed focal and segmental glomerulosclerosis by light microscopy. The electron microscopy revealed the presence of massive fibrillar collagen within the mesangial matriz and the basement membrane. This is the first patient reported in our country. We emphasize the usefulness of electron microscopy in the study of glomerular diseases.
Understanding mitochondrial myopathies: a review
Directory of Open Access Journals (Sweden)
Abhimanyu S. Ahuja
2018-05-01
Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.
An integrated diagnosis strategy for congenital myopathies.
Directory of Open Access Journals (Sweden)
Johann Böhm
Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.
Systemic calciphylaxis presenting as a painful, proximal myopathy.
Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.
1992-01-01
A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.
Collagen VI glycine mutations : Perturbed assembly and a spectrum of clinical severity
Pace, Rishika A.; Peat, Rachel A.; Baker, Naomi L.; Zamurs, Laura; Moergelin, Matthias; Irving, Melita; Adams, Naomi E.; Bateman, John F.; Mowat, David; Smith, Nicholas J. C.; Lamont, Phillipa J.; Moore, Steven A.; Mathews, Katherine D.; North, Kathryn N.; Lamande, Shireen R.
Objective: The collagen VI muscular dystrophies, Bethlem myopathy and Ullrich congenital muscular dystrophy, form a continuum of clinical phenotypes. Glycine mutations in the triple helix have been identified in both Bethlem and Ullrich congenital muscular dystrophy, but it is not known why they
Adult-onset nemaline myopathy presenting as respiratory failure.
LENUS (Irish Health Repository)
Kelly, Emer
2008-11-01
Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.
Myopathies of endocrine disorders: A prospective clinical and biochemical study
Directory of Open Access Journals (Sweden)
Vikas Sharma
2014-01-01
Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.
Acute steroid myopathy: a highly overlooked entity.
Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev
2018-02-15
Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.
Centronuclear myopathy in a Border collie dog.
Eminaga, S; Cherubini, G B; Shelton, G D
2012-10-01
A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.
Aerobic Training in Patients with Congenital Myopathy
DEFF Research Database (Denmark)
Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen
2016-01-01
INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....
The expanding phenotype of mitochondrial myopathy.
DiMauro, Salvatore; Gurgel-Giannetti, Juliana
2005-10-01
Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.
Hereditary myopathies with early respiratory insufficiency in adults.
Naddaf, Elie; Milone, Margherita
2017-11-01
Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.
Meeting the challenges in the diagnosis of inflammatory myopathies ...
African Journals Online (AJOL)
Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...
Hypothyroid myopathy. A clinical and pathologaical study.
McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G
1980-09-01
Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature
[Cardiac myopathy due to overt hypothyroidism].
Harbeck, B; Berndt, M J; Lehnert, H
2014-03-01
A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.
Treatment Opportunities in Patients With Metabolic Myopathies
DEFF Research Database (Denmark)
Ørngreen, Mette Cathrine; Vissing, John
2017-01-01
the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...
Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo
2014-01-01
Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.
Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A
Energy Technology Data Exchange (ETDEWEB)
Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others
1995-08-28
The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.
[Biologic therapy in idiopathic inflammatory myopathy].
Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M
2014-09-15
The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.
Flaccid quadriplegia due to thyrotoxic myopathy.
Couillard, Philippe; Wijdicks, Eelco F M
2014-04-01
Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.
Proximal collagenous gastroenteritides:
DEFF Research Database (Denmark)
Nielsen, Ole Haagen; Riis, Lene Buhl; Danese, Silvio
2014-01-01
AIM: While collagenous colitis represents the most common form of the collagenous gastroenteritides, the collagenous entities affecting the proximal part of the gastrointestinal tract are much less recognized and possibly overlooked. The aim was to summarize the latest information through a syste...
Atypical presentation of GNE myopathy with asymmetric hand weakness
de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria
2014-01-01
GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749
Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy
... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...
Statin Induced Myopathy a Patient with Multiple Systemic Diseases
Directory of Open Access Journals (Sweden)
Özgül Uçar
2011-04-01
Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.
Congenital myopathy is caused by mutation of HACD1
Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti
2013-01-01
Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...
Skeletal muscle repair in a mouse model of nemaline myopathy
Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.
2006-01-01
Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...
Aerobic Training in Patients with Congenital Myopathy.
Directory of Open Access Journals (Sweden)
Gitte Hedermann
Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.
Association between statin-associated myopathy and skeletal muscle damage.
Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette
2009-07-07
Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.
Collagen VI disorders: Insights on form and function in the extracellular matrix and beyond.
Lamandé, Shireen R; Bateman, John F
2017-12-22
Mutations in the three canonical collagen VI genes, COL6A1, COL6A2 and COL6A3, cause a spectrum of muscle disease from Bethlem myopathy at the mild end to the severe Ullrich congenital muscular dystrophy. Mutations can be either dominant or recessive and the resulting clinical severity is influenced by the way mutations impact the complex collagen VI assembly process. Most mutations are found towards the N-terminus of the triple helical collagenous domain and compromise extracellular microfibril assembly. Outside the triple helix collagen VI is highly polymorphic and discriminating mutations from rare benign changes remains a major diagnostic challenge. Collagen VI deficiency alters extracellular matrix structure and biomechanical properties and leads to increased apoptosis and oxidative stress, decreased autophagy, and impaired muscle regeneration. Therapies that target these downstream consequences have been tested in a collagen VI null mouse and also in small human trials where they show modest clinical efficacy. An important role for collagen VI in obesity, cancer and diabetes is emerging. A major barrier to developing effective therapies is the paucity of information about how collagen VI deficiency in the extracellular matrix signals the final downstream consequences - the receptors involved and the intracellular messengers await further characterization. Copyright © 2017 International Society of Matrix Biology. Published by Elsevier B.V. All rights reserved.
Endocytic collagen degradation
DEFF Research Database (Denmark)
Madsen, Daniel H.; Jürgensen, Henrik J.; Ingvarsen, Signe Ziir
2012-01-01
it crucially important to understand both the collagen synthesis and turnover mechanisms in this condition. Here we show that the endocytic collagen receptor, uPARAP/Endo180, is a major determinant in governing the balance between collagen deposition and degradation. Cirrhotic human livers displayed a marked...... up-regulation of uPARAP/Endo180 in activated fibroblasts and hepatic stellate cells located close to the collagen deposits. In a hepatic stellate cell line, uPARAP/Endo180 was shown to be active in, and required for, the uptake and intracellular degradation of collagen. To evaluate the functional...... groups of mice clearly revealed a fibrosis protective role of uPARAP/Endo180. This effect appeared to directly reflect the activity of the collagen receptor, since no compensatory events were noted when comparing the mRNA expression profiles of the two groups of mice in an array system focused on matrix-degrading...
... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...
Acute liver failure after recommended doses of acetaminophen in patients with myopathies
I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)
2011-01-01
textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute
Acute liver failure after recommended doses of acetaminophen in patients with myopathies
Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.
2011-01-01
To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We
Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme
... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...
... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...
BAG3 myofibrillar myopathy presenting with cardiomyopathy.
Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P
2015-05-01
Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.
Myofibrillar myopathies: State of the art, present and future challenges.
Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B
2015-10-01
Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Mitochondrial myopathy presenting as fibromyalgia: a case report
Directory of Open Access Journals (Sweden)
Abdullah Mishal
2012-02-01
Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.
Autosomal dominant distal myopathy: Linkage to chromosome 14
Energy Technology Data Exchange (ETDEWEB)
Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.
1995-02-01
We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.
Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations
DEFF Research Database (Denmark)
Witting, Nanna; Werlauff, Ulla; Duno, Morten
2016-01-01
airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....
Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?
Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.
2013-01-01
Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy
A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome
Directory of Open Access Journals (Sweden)
Kang Won Lee
2015-12-01
Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.
A Case Report of Inflammatory Myopathy and Sideroblastic Anemia
Directory of Open Access Journals (Sweden)
F Binesh
2007-01-01
Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.
Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.
Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin
2015-08-01
Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.
Hoffmann's disease: MR imaging of hypothyroid myopathy
International Nuclear Information System (INIS)
Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun
2015-01-01
Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)
Hoffmann's disease: MR imaging of hypothyroid myopathy
Energy Technology Data Exchange (ETDEWEB)
Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)
2015-11-15
Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)
Glucocorticoid-induced myopathy in the intensive care unit
DEFF Research Database (Denmark)
Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner
2015-01-01
Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...
Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy
Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn
2014-01-01
Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570
DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies
Directory of Open Access Journals (Sweden)
Alessandra Ruggieri
2016-09-01
Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic
Genetics Home Reference: CAV3-related distal myopathy
... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...
Congenital myopathy is caused by mutation of HACD1.
Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti
2013-12-20
Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.
Eosinophilic fasciitis in a child mimicking a myopathy.
Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.
2006-01-01
A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,
GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation
Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip
2016-01-01
Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745
Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy
Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.
1998-01-01
OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared
Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.
Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J
1997-05-01
A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.
Collagen Quantification in Tissue Specimens.
Coentro, João Quintas; Capella-Monsonís, Héctor; Graceffa, Valeria; Wu, Zhuning; Mullen, Anne Maria; Raghunath, Michael; Zeugolis, Dimitrios I
2017-01-01
Collagen is the major extracellular protein in mammals. Accurate quantification of collagen is essential in the biomaterials (e.g., reproducible collagen scaffold fabrication), drug discovery (e.g., assessment of collagen in pathophysiologies, such as fibrosis), and tissue engineering (e.g., quantification of cell-synthesized collagen) fields. Although measuring hydroxyproline content is the most widely used method to quantify collagen in biological specimens, the process is very laborious. To this end, the Sircol™ Collagen Assay is widely used due to its inherent simplicity and convenience. However, this method leads to overestimation of collagen content due to the interaction of Sirius red with basic amino acids of non-collagenous proteins. Herein, we describe the addition of an ultrafiltration purification step in the process to accurately determine collagen content in tissues.
REV-ERB and ROR: therapeutic targets for treating myopathies
Welch, Ryan D.; Flaveny, Colin A.
2017-08-01
Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.
Collagen metabolism in obesity
DEFF Research Database (Denmark)
Rasmussen, M H; Jensen, L T; Andersen, T
1995-01-01
OBJECTIVE: To investigate the impact of obesity, fat distribution and weight loss on collagen turnover using serum concentrations of the carboxyterminal propeptide of type I procollagen (S-PICP) and the aminoterminal propeptide of type III pro-collagen (S-PIIINP) as markers for collagen turnover...... (r = 0.37; P = 0.004), height (r = 0.27; P = 0.04), waist circumference (r = 0.35; P = 0.007), as well as with WHR (r = 0.33; P = 0.01) and was inversely correlated to age (r = -0.40; P = 0.002). Compared with randomly selected controls from a large pool of healthy volunteers, the obese patients had...... restriction (P obesity and associated with body fat distribution, suggesting...
Collagen Homeostasis and Metabolism
DEFF Research Database (Denmark)
Magnusson, S Peter; Heinemeier, Katja M; Kjaer, Michael
2016-01-01
The musculoskeletal system and its collagen rich tissue is important for ensuring architecture of skeletal muscle, energy storage in tendon and ligaments, joint surface protection, and for ensuring the transfer of muscular forces into resulting limb movement. Structure of tendon is stable...... inactivity or immobilization of the human body will conversely result in a dramatic loss in tendon stiffness and collagen synthesis. This illustrates the importance of regular mechanical load in order to preserve the stabilizing role of the connective tissue for the overall function of the musculoskeletal...
The effect of coenzyme Q10 in statin myopathy.
Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard
2012-01-01
Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.
Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.
Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold
2016-12-01
Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.
Miopatia ocular descendente Descending ocular myopathy: a case report
Directory of Open Access Journals (Sweden)
Marcos R. G. de Freitas
1975-06-01
Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.
Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy
Directory of Open Access Journals (Sweden)
Şenol Kobak
2013-01-01
Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.
Analysis of lipid profile in lipid storage myopathy.
Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi
2016-09-01
Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct
Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy
Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.
2010-01-01
Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...
Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies
DEFF Research Database (Denmark)
Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.
2016-01-01
Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....
Diagnosis and treatment of the idiopathic inflammatory myopathies
Gazeley, David J.; Cronin, Mary E.
2011-01-01
The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...
Association between statin-associated myopathy and skeletal muscle damage.
Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette
2009-01-01
BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...
Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).
Yamini, B; Schillhorn van Veen, T W
1988-10-01
Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.
Search for Pompe disease among patients with undetermined myopathies.
Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A
2015-07-20
Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Katarzyna A Piróg
Full Text Available Pseudoachondroplasia (PSACH and multiple epiphyseal dysplasia (MED are skeletal disorders resulting from mutations in COMP, matrilin-3 or collagen IX and are characterised by short-limbed dwarfism and premature osteoarthritis. Interestingly, recent reports suggest patients can also manifest with muscle weakness. Here we present a detailed analysis of two mouse models of the PSACH/MED disease spectrum; ΔD469 T3-COMP (PSACH and V194D matrilin-3 (MED. In grip test experiments T3-COMP mice were weaker than wild-type littermates, whereas V194D mice behaved as controls, confirming that short-limbed dwarfism alone does not contribute to PSACH/MED-related muscle weakness. Muscles from T3-COMP mice showed an increase in centronuclear fibers at the myotendinous junction. T3-COMP tendons became more lax in cyclic testing and showed thicker collagen fibers when compared with wild-type tissue; matrilin-3 mutant tissues were indistinguishable from controls. This comprehensive study of the myopathy associated with PSACH/MED mutations enables a better understanding of the disease progression, confirms that it is genotype specific and that the limb weakness originates from muscle and tendon pathology rather than short-limbed dwarfism itself. Since some patients are primarily diagnosed with neuromuscular symptoms, this study will facilitate better awareness of the differential diagnoses that might be associated with the PSACH/MED spectrum and subsequent care of PSACH/MED patients.
Morphologic imaging in muscular dystrophies and inflammatory myopathies
International Nuclear Information System (INIS)
Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya
2010-01-01
To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)
Morphologic imaging in muscular dystrophies and inflammatory myopathies
Energy Technology Data Exchange (ETDEWEB)
Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)
2010-12-15
To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)
Zidovudine-induced myopathy: A study in Indian patients.
Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish
2010-07-01
Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.
[The genetics of collagen diseases].
Kaplan, J; Maroteaux, P; Frezal, J
1986-01-01
Heritable disorders of collagen include Ehler-Danlos syndromes (11 types are actually known), Larsen syndrome and osteogenesis imperfecta. Their clinical, genetic and biochemical features are reviewed. Marfan syndrome is closely related to heritable disorders of collagen.
Rheology of Heterotypic Collagen Networks
Piechocka, I.K.; van Oosten, A.S.G.; Breuls, R.G.M.; Koenderink, G.H.
2011-01-01
Collagen fibrils are the main structural element of connective tissues. In many tissues, these fibrils contain two fibrillar collagens (types I and V) in a ratio that changes during tissue development, regeneration, and various diseases. Here we investigate the influence of collagen composition on
Collagen turnover after tibial fractures
DEFF Research Database (Denmark)
Joerring, S; Krogsgaard, M; Wilbek, H
1994-01-01
Collagen turnover after tibial fractures was examined in 16 patients with fracture of the tibial diaphysis and in 8 patients with fracture in the tibial condyle area by measuring sequential changes in serological markers of turnover of types I and III collagen for up to 26 weeks after fracture....... The markers were the carboxy-terminal extension peptide of type I procollagen (PICP), the amino-terminal extension peptide of type III procollagen (PIIINP), and the pyridinoline cross-linked carboxy-terminal telopeptide of type I collagen (ICTP). The latter is a new serum marker of degradation of type I...... collagen. A group comparison showed characteristic sequential changes in the turnover of types I and III collagen in fractures of the tibial diaphysis and tibial condyles. The turnover of type III collagen reached a maximum after 2 weeks in both groups. The synthesis of type I collagen reached a maximum...
CT and the diagnosis of myopathies. Preliminary findings in 42 cases
Energy Technology Data Exchange (ETDEWEB)
Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M
1986-01-01
A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).
Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.
Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John
2004-03-01
A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.
Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency
Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John
2004-01-01
A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.
Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review
Directory of Open Access Journals (Sweden)
V. A. Erokhina
2013-08-01
Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.
Muscle structural changes in mitochondrial myopathy relate to genotype
DEFF Research Database (Denmark)
Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.
2003-01-01
It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...
Collagen macromolecular drug delivery systems
International Nuclear Information System (INIS)
Gilbert, D.L.
1988-01-01
The objective of this study was to examine collagen for use as a macromolecular drug delivery system by determining the mechanism of release through a matrix. Collagen membranes varying in porosity, crosslinking density, structure and crosslinker were fabricated. Collagen characterized by infrared spectroscopy and solution viscosity was determined to be pure and native. The collagen membranes were determined to possess native vs. non-native quaternary structure and porous vs. dense aggregate membranes by electron microscopy. Collagen monolithic devices containing a model macromolecule (inulin) were fabricated. In vitro release rates were found to be linear with respect to t 1/2 and were affected by crosslinking density, crosslinker and structure. The biodegradation of the collagen matrix was also examined. In vivo biocompatibility, degradation and 14 C-inulin release rates were evaluated subcutaneously in rats
Collagens - structure, function and biosynthesis.
Gelse, K; Poschl, E; Aigner, T
2003-01-01
The extracellular matrix represents a complex alloy of variable members of diverse protein families defining structural integrity and various physiological functions. The most abundant family is the collagens with more than 20 different collagen types identified so far. Collagens are centrally involved in the formation of fibrillar and microfibrillar networks of the extracellular matrix, basement membranes as well as other structures of the extracellular matrix. This review focuses on the dis...
[Insight into the training of patients with idiopathic inflammatory myopathy].
Váncsa, Andrea
2016-09-01
Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.
Statin-associated myopathy: from genetic predisposition to clinical management.
Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R
2014-01-01
Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.
Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.
Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B
2017-11-01
Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Skeletal muscle repair in a mouse model of nemaline myopathy.
Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H
2006-09-01
Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.
Statin-associated immune-mediated myopathy: biology and clinical implications.
Christopher-Stine, Lisa; Basharat, Pari
2017-04-01
In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.
Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features
Directory of Open Access Journals (Sweden)
Zhiyv Niu
2018-03-01
Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy
Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.
Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita
2018-01-01
The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the
Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache
Directory of Open Access Journals (Sweden)
R Burnham
2006-01-01
Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.
Collagen Conduit Versus Microsurgical Neurorrhaphy
DEFF Research Database (Denmark)
Boeckstyns, Michel; Sørensen, Allan Ibsen; Viñeta, Joaquin Fores
2013-01-01
To compare repair of acute lacerations of mixed sensory-motor nerves in humans using a collagen tube versus conventional repair.......To compare repair of acute lacerations of mixed sensory-motor nerves in humans using a collagen tube versus conventional repair....
The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.
Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W
2013-07-01
The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high
Directory of Open Access Journals (Sweden)
Ting Chen
2016-01-01
Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.
Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy
Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.
2015-01-01
To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide
Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.
Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian
2015-08-01
The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.
Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.
Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van
2004-01-01
BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on
Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.
Karalliedde, Lakshman; Baker, David; Marrs, Timothy C
2006-01-01
-15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in
Acylcarnitines profile best predicts survival in horses with atypical myopathy.
Directory of Open Access Journals (Sweden)
François Boemer
Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.
Acylcarnitines profile best predicts survival in horses with atypical myopathy
Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie
2017-01-01
Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683
Restrictive extraocular myopathy: A presenting feature of acromegaly
Directory of Open Access Journals (Sweden)
Steven Heireman
2011-01-01
Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.
A case of congenital myopathy masquerading as paroxysmal dyskinesia
Directory of Open Access Journals (Sweden)
Harsh Patel
2014-01-01
Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.
The genetic basis of pectoralis major myopathies in modern broiler chicken lines
Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago
2015-01-01
This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...
de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique
2005-03-01
Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.
Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan
2010-01-01
Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...
Dietary intervention rescues myopathy associated with neurofibromatosis type 1.
Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron
2018-02-15
Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For
White striping and woody breast myopathies in the modern poultry industry: a review.
Kuttappan, V A; Hargis, B M; Owens, C M
2016-11-01
Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.
Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome
International Nuclear Information System (INIS)
Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves
2014-01-01
Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)
Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome
Energy Technology Data Exchange (ETDEWEB)
Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)
2014-08-15
Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)
Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.
Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok
GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.
A collagen-binding EGFR antibody fragment targeting tumors with a collagen-rich extracellular matrix
Hui Liang; Xiaoran Li; Bin Wang; Bing Chen; Yannan Zhao; Jie Sun; Yan Zhuang; Jiajia Shi; He Shen; Zhijun Zhang; Jianwu Dai
2016-01-01
Many tumors over-express collagen, which constitutes the physical scaffold of tumor microenvironment. Collagen has been considered to be a target for cancer therapy. The collagen-binding domain (CBD) is a short peptide, which could bind to collagen and achieve the sustained release of CBD-fused proteins in collagen scaffold. Here, a collagen-binding EGFR antibody fragment was designed and expressed for targeting the collagen-rich extracellular matrix in tumors. The antibody fragment (Fab) of ...
Mosaicism for dominant collagen 6 mutations as a cause for intrafamilial phenotypic variability.
Donkervoort, Sandra; Hu, Ying; Stojkovic, Tanya; Voermans, Nicol C; Foley, A Reghan; Leach, Meganne E; Dastgir, Jahannaz; Bolduc, Véronique; Cullup, Thomas; de Becdelièvre, Alix; Yang, Lin; Su, Hai; Meilleur, Katherine; Schindler, Alice B; Kamsteeg, Erik-Jan; Richard, Pascale; Butterfield, Russell J; Winder, Thomas L; Crawford, Thomas O; Weiss, Robert B; Muntoni, Francesco; Allamand, Valérie; Bönnemann, Carsten G
2015-01-01
Collagen 6-related dystrophies and myopathies (COL6-RD) are a group of disorders that form a wide phenotypic spectrum, ranging from severe Ullrich congenital muscular dystrophy, intermediate phenotypes, to the milder Bethlem myopathy. Both inter- and intrafamilial variable expressivity are commonly observed. We present clinical, immunohistochemical, and genetic data on four COL6-RD families with marked intergenerational phenotypic heterogeneity. This variable expression seemingly masquerades as anticipation is due to parental mosaicism for a dominant mutation, with subsequent full inheritance and penetrance of the mutation in the heterozygous offspring. We also present an additional fifth simplex patient identified as a mosaic carrier. Parental mosaicism was confirmed in the four families through quantitative analysis of the ratio of mutant versus wild-type allele (COL6A1, COL6A2, and COL6A3) in genomic DNA from various tissues, including blood, dermal fibroblasts, and saliva. Consistent with somatic mosaicism, parental samples had lower ratios of mutant versus wild-type allele compared with the fully heterozygote offspring. However, there was notable variability of the mutant allele levels between tissues tested, ranging from 16% (saliva) to 43% (fibroblasts) in one mosaic father. This is the first report demonstrating mosaicism as a cause of intrafamilial/intergenerational variability of COL6-RD, and suggests that sporadic and parental mosaicism may be more common than previously suspected. © 2014 WILEY PERIODICALS, INC.
PHAGOCYTOSIS AND REMODELING OF COLLAGEN MATRICES
Abraham, Leah C.; Dice, J Fred.; Lee, Kyongbum; Kaplan, David L.
2007-01-01
The biodegradation of collagen and the deposition of new collagen-based extracellular matrices are of central importance in tissue remodeling and function. Similarly, for collagen-based biomaterials used in tissue engineering, the degradation of collagen scaffolds with accompanying cellular infiltration and generation of new extracellular matrix is critical for integration of in vitro grown tissues in vivo. In earlier studies we observed significant impact of collagen structure on primary lun...
Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization
Directory of Open Access Journals (Sweden)
O. A. Antelava
2014-01-01
Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by
Enhanced stabilization of collagen by furfural.
Lakra, Rachita; Kiran, Manikantan Syamala; Usha, Ramamoorthy; Mohan, Ranganathan; Sundaresan, Raja; Korrapati, Purna Sai
2014-04-01
Furfural (2-furancarboxaldehyde), a product derived from plant pentosans, has been investigated for its interaction with collagen. Introduction of furfural during fibril formation enhanced the thermal and mechanical stability of collagen. Collagen films treated with furfural exhibited higher denaturation temperature (Td) (pFurfural and furfural treated collagen films did not have any cytotoxic effect. Rheological characterization showed an increase in shear stress and shear viscosity with increasing shear rate for treated collagen. Circular dichroism (CD) studies indicated that the furfural did not have any impact on triple helical structure of collagen. Scanning electron microscopy (SEM) of furfural treated collagen exhibited small sized porous structure in comparison with untreated collagen. Thus this study provides an alternate ecologically safe crosslinking agent for improving the stability of collagen for biomedical and industrial applications. Copyright © 2014 Elsevier B.V. All rights reserved.
Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy.
Mercer, Louise K; Moore, Tonia L; Chinoy, Hector; Murray, Andrea K; Vail, Andy; Cooper, Robert G; Herrick, Ariane L
2010-09-01
To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Nailfold video microscopy (x300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width) were quantified. Patients were clinically assessed and disease activity recorded using the Myositis Disease Activity Assessment Tool. Disease severity and physical function were assessed using the myositis damage index and Stanford HAQ, respectively. Findings were analysed using linear and logistic regression, adjusted for age and sex. In a subgroup of 16 patients with IIM and 27 controls, the process was repeated 6-12 months later and the results were analysed using Student's t-test. Capillary density was lower and dimensions were higher in patients with IIM compared with healthy controls (P nailfold capillaroscopy, suggesting that nailfold capillaroscopy may be useful as an outcome measure of microvascular disease in studies of IIM.
Muscle sonography in six patients with hereditary inclusion body myopathy
International Nuclear Information System (INIS)
Adler, Ronald S.; Garolfalo, Giovanna; Paget, Stephen; Kagen, Lawrence
2008-01-01
To evaluate the morphological changes of muscle with sonography in six patients affected by hereditary inclusion body myopathy (HIBM). We studied a group of six Persian Jews diagnosed with HIBM. All were homozygous for the GNE mutation M712T. Ultrasonographic examinations of the quadriceps femoris and hamstring muscle groups were performed. A follow-up ultrasound examination was performed, after an interval of 3 years, in four of these patients. Muscles were assessed subjectively as to echogenicity, determined by gray-scale assessment, and loss of normal muscle morphology. Power Doppler sonography (PDS) was used to assess vascularity. A sonographic finding of central atrophy and peripheral sparing resulting in a target-like appearance was noted in the hamstring compartment of all six patients. The quadriceps compartment also showed involvement of the rectus femoris of all patients, which, in some cases, was the only muscle involved in the quadriceps. Vascularity was markedly reduced in the affected areas, with blood flow demonstrated in the peripherally spared areas. The severity of atrophy increased with disease duration. In this case series, we describe a new sonographic finding as well as document progression of HIBM disease, which has generally been described as quadriceps sparing. The myopathic target lesion, as well as isolated rectus femoris atrophy, may provide a useful adjunct to disease diagnosis. (orig.)
Myopathy in CRPS-I: disuse or neurogenic?
Hulsman, Natalie M; Geertzen, Jan H B; Dijkstra, Pieter U; van den Dungen, Jan J A M; den Dunnen, Wilfred F A
2009-08-01
The diagnosis Complex Regional Pain Syndrome type I (CRPS-I) is based on clinical symptoms, including motor symptoms. Histological changes in muscle tissue may be present in the chronic phase of CRPS-I. Aim of this study was to analyze skeletal muscle tissue from amputated limbs of patients with CRPS-I, in order to gain more insight in factors that may play a role in changes in muscles in CRPS-I. These changes may be helpful in clarifying the pathophysiology of CRPS-I. Fourteen patients with therapy resistant and longstanding CRPS-I, underwent an amputation of the affected limb. In all patients histological analysis showed extensive changes in muscle tissue, such as fatty degeneration, fibre atrophy and nuclear clumping, which was not related to duration of CRPS-I prior to amputation. In all muscles affected, both type 1 and type 2 fibre atrophy was found, without selective type 2 fibre atrophy. In four patients, type grouping was observed, indicating a sequence of denervation and reinnervation of muscle tissue. In two patients even large group atrophy was present, suggesting new denervation after reinnervation. Comparison between subgroups in arms and legs showed no difference in the number of changes in muscle tissue. Intrinsic and extrinsic muscles were affected equally. Our findings show that in the chronic phase of CRPS-I extensive changes can be seen in muscle tissue, not related to duration of CRPS-I symptoms. Signs of neurogenic myopathy were present in five patients.
OCULAR ASPECTS OF HYPERTHYROIDISM WITH SPECIAL REFERENCE TO OCULAR MYOPATHY
Directory of Open Access Journals (Sweden)
Mallika O. U
2017-04-01
Full Text Available BACKGROUND Hyperthyroidism can result in ocular manifestations even before systemic signs and symptoms develop. It is seen more in females and severe forms are more common in males. Early detection of ocular involvement can prevent vision threatening complications and troublesome discomforts affecting quality of vision. This clinical study highlights the importance of detailed ocular examination in hyperthyroidism. MATERIALS AND METHODS Fifty consecutive patients with ocular signs of hyperthyroidism were evaluated and followed up for an average period of 1 year. Detailed ocular examination included exophthalmometric measurements, ocular movements and Worth four-dot test. T3, T4, TSH, CT scan and antimicrosomal antibodies and antithyroglobulin antibodies were done along with routine investigations. Study Design- Prospective cohort study. RESULTS Statistical analysis did not reveal any correlation between the level of serum T3 and severity of ocular findings. Majority of the cases were euthyroid with moderate ocular myopathy having multiple muscle involvement. Inferior rectus was affected most. CONCLUSION The ocular signs of hyperthyroidism in the present study seem to be mild. The severe eye changes like corneal involvement and optic nerve changes were less common.
[Statin associated myopathy in clinical practice. Results of DAMA study].
Millán, Jesús; Pedro-Botet, Juan; Climent, Elisenda; Millán, Joaquín; Rius, Joan
Muscle symptoms, with or without elevation of creatin kinase are one of the main adverse effects of statin therapy, a fact that sometimes limits their use. The aim of this study was to evaluate the clinical characteristics of patients treated with statins who have complained muscle symptoms and to identify possible predictive factors. A cross-sectional one-visit, non-interventional, national multicenter study including patients of both sexes over 18 years of age referred for past or present muscle symptoms associated with statin therapy was conducted. 3,845 patients were recruited from a one-day record from 2,001 physicians. Myalgia was present in 78.2% of patients included in the study, myositis in 19.3%, and rhabdomyolysis in 2.5%. Patients reported muscle pain in 77.5% of statin-treated individuals, general weakness 42.7%, and cramps 28.1%. Kidney failure, intense physical exercise, alcohol consumption (>30g/d in men and 20g/d in women) and abdominal obesity were the clinical situations associated with statin myopathy. Myalgia followed by myositis are the most frequent statin-related side effects. It should be recommended control environmental factors such as intense exercise and alcohol intake as well as abdominal obesity and renal function of the patient treated with statins. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.
Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina
2014-01-01
Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously
Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.
2012-01-01
Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was
Fracture mechanics of collagen fibrils
DEFF Research Database (Denmark)
Svensson, Rene B; Mulder, Hindrik; Kovanen, Vuokko
2013-01-01
Tendons are important load-bearing structures, which are frequently injured in both sports and work. Type I collagen fibrils are the primary components of tendons and carry most of the mechanical loads experienced by the tissue, however, knowledge of how load is transmitted between and within...... fibrils is limited. The presence of covalent enzymatic cross-links between collagen molecules is an important factor that has been shown to influence mechanical behavior of the tendons. To improve our understanding of how molecular bonds translate into tendon mechanics, we used an atomic force microscopy...... technique to measure the mechanical behavior of individual collagen fibrils loaded to failure. Fibrils from human patellar tendons, rat-tail tendons (RTTs), NaBH₄ reduced RTTs, and tail tendons of Zucker diabetic fat rats were tested. We found a characteristic three-phase stress-strain behavior in the human...
Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A
2016-11-01
The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.
Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association
Directory of Open Access Journals (Sweden)
Subasree Ramakrishnan
2012-01-01
Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.
Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1
DEFF Research Database (Denmark)
Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro
2015-01-01
Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...
A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.
Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio
2012-09-01
Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.
Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.
Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu
2017-07-01
Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.
Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy
Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert
2013-01-01
Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594
Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone
Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu
2017-01-01
Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208
Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J
2014-03-01
It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.
Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.
Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z
2001-07-01
Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.
A study of acute muscle dysfunction with particular reference to dengue myopathy
Directory of Open Access Journals (Sweden)
Rajesh Verma
2017-01-01
Full Text Available Background: Acute myopathy is a common cause of acute motor quadriparesis which has various etiologies with different courses of illness and prognosis depending on the cause. Understanding this diversity helps us in proper approach toward diagnosis, predicting the prognosis, and possible complications and in improving the treatments that are being provided. This study was planned to study the clinical, electrophysiological, and etiological profile of patients presenting with acute myopathy. We also studied how dengue-related acute myopathy differs from other causes and also difference between myopathy due to myositis and hypokalemia in cases of dengue. Materials and Methods: This was a prospective, observational study involving all clinically suspected cases of acute myopathy of not more than 4 weeks duration with raised serum creatine kinase (CK level. They were subjected to detailed clinical evaluation along with hematological, biochemical, microbiological, and electrophysiological studies and followed-up for outcome at 1 and 3 months. Muscle biopsy and histopathological examination were done in selected patients after taking informed consent. Statistical analysis was performed by appropriate methods using SPSS version 16.0 (Chicago, IL, USA. Results: We evaluated thirty patients of acute myopathy with raised CK level. Seventeen patients had fever, 11 had myalgia, and 5 had skin lesions. All presented with symmetric weakness, 17 (56.7% patients having predominantly proximal weakness, neck or truncal weakness in 6 (20%, hyporeflexia in 12 (40%, with mean Medical Research Council (MRC sum score of 46.67 ± 6.0. Eight (mean modified Barthel index [MBI] at presentation - 15 ± 3.7 patients had poor functional status according to MBI and 15 according to modified Rankin scale (MRS (mean MRS score - 2.5 ± 1.2. Etiology was dengue viral infection in 14 patients; hypokalemia due to various causes other than dengue in 8; pyomyositis in 3
Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark
DEFF Research Database (Denmark)
Witting, Nanna; Werlauff, Ulla; Duno, Morten
2017-01-01
.3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...
Treatment of critical illness polyneuropathy and/or myopathy - a systematic review
DEFF Research Database (Denmark)
Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg
2012-01-01
The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....
Collagen crosslinks in chondromalacia of the patella.
Väätäinen, U; Kiviranta, I; Jaroma, H; Arokosi, J; Tammi, M; Kovanen, V
1998-02-01
The aim of the study was to determine collagen concentration and collagen crosslinks in cartilage samples from chondromalacia of the patella. To study the extracellular matrix alterations associated to chondromalacia, we determined the concentration of collagen (hydroxyproline) and its hydroxylysylpyridinoline and lysylpyridinoline crosslinks from chondromalacia foci of the patellae in 12 patients and 7 controls from apparently normal cadavers. The structure of the collagen network in 8 samples of grades II-IV chondromalacia was examined under polarized light microscopy. The full-thickness cartilage samples taken with a surgical knife from chondromalacia lesions did not show changes in collagen, hydroxylysylpyridinoline and lysylpyridinoline concentration as compared with the controls. Polarized light microscopy showed decreased birefringence in the superficial cartilage of chondromalacia lesions, indicating disorganization or disappearance of collagen fibers in this zone. It is concluded that the collagen network shows gradual disorganization with the severity of chondromalacia lesion of the patella without changes in the concentration or crosslinks of collagen.
Autophagy, inflammation and innate immunity in inflammatory myopathies.
Directory of Open Access Journals (Sweden)
Cristina Cappelletti
Full Text Available Autophagy has a large range of physiological functions and its dysregulation contributes to several human disorders, including autoinflammatory/autoimmune diseases such as inflammatory myopathies (IIMs. In order to better understand the pathogenetic mechanisms of these muscular disorders, we sought to define the role of autophagic processes and their relation with the innate immune system in the three main subtypes of IIM, specifically sporadic inclusion body myositis (sIBM, polymyositis (PM, dermatomyositis (DM and juvenile dermatomyositis (JDM. We found that although the mRNA transcript levels of the autophagy-related genes BECN1, ATG5 and FBXO32 were similar in IIM and controls, autophagy activation in all IIM subgroups was suggested by immunoblotting results and confirmed by immunofluorescence. TLR4 and TLR3, two potent inducers of autophagy, were highly increased in IIM, with TLR4 transcripts significantly more expressed in PM and DM than in JDM, sIBM and controls, and TLR3 transcripts highly up-regulated in all IIM subgroups compared to controls. Co-localization between autophagic marker, LC3, and TLR4 and TLR3 was observed not only in sIBM but also in PM, DM and JDM muscle tissues. Furthermore, a highly association with the autophagic processes was observed in all IIM subgroups also for some TLR4 ligands, endogenous and bacterial HSP60, other than the high-mobility group box 1 (HMGB1. These findings indicate that autophagic processes are active not only in sIBM but also in PM, DM and JDM, probably in response to an exogenous or endogenous 'danger signal'. However, autophagic activation and regulation, and also interaction with the innate immune system, differ in each type of IIM. Better understanding of these differences may lead to new therapies for the different IIM types.
Building blocks of Collagen based biomaterial devices
Indian Academy of Sciences (India)
First page Back Continue Last page Overview Graphics. Building blocks of Collagen based biomaterial devices. Collagen as a protein. Collagen in tissues and organs. Stabilizing and cross linking agents. Immunogenicity. Hosts (drugs). Controlled release mechanisms of hosts. Biodegradability, workability into devices ...
Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.
Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew
2016-06-01
Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.
The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy
de Visser, M.; de Voogt, W. G.; la Rivière, G. V.
1992-01-01
We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of
DEFF Research Database (Denmark)
van Galen Verwilghen, Gaby; Votion, D.-M.
2013-01-01
Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...
Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy
Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.
2008-01-01
The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,
Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R
2000-01-01
Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.
Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.
Vite, C H; Melniczek, J; Patterson, D; Giger, U
1999-01-01
Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.
Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.
Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J
2016-09-01
Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.
Atypical myopathy in Denmark confirmed with the aTRAQ assay
DEFF Research Database (Denmark)
Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie
2016-01-01
Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...
Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.
2015-01-01
Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085
Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.
Schaars, C.F.; Stalenhoef, A.F.H.
2008-01-01
PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.
Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?
International Nuclear Information System (INIS)
Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta
2015-01-01
To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)
Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?
Energy Technology Data Exchange (ETDEWEB)
Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)
2015-12-15
To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)
RYR1-related myopathies: a wide spectrum of phenotypes throughout life
Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.
2015-01-01
BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific
DEFF Research Database (Denmark)
van Galen Verwilghen, Gaby; Votion, D.-M.
2013-01-01
Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...
Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy
Directory of Open Access Journals (Sweden)
Lei Tian
2015-06-01
Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.
Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy
Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans
2016-01-01
The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)
Autosomal dominant distal myopathy due to a novel ACTA1 mutation.
Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita
2017-08-01
Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.
Fatigue in patients with spinal muscular atrophy type II and congenital myopathies
DEFF Research Database (Denmark)
Werlauff, Ulla; Højberg, A; Firla-Holme, R
2014-01-01
PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...
Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R
Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate
Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies
Energy Technology Data Exchange (ETDEWEB)
Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))
1990-07-01
The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.
The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy
Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.
2016-01-01
HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249
Collagens--structure, function, and biosynthesis.
Gelse, K; Pöschl, E; Aigner, T
2003-11-28
The extracellular matrix represents a complex alloy of variable members of diverse protein families defining structural integrity and various physiological functions. The most abundant family is the collagens with more than 20 different collagen types identified so far. Collagens are centrally involved in the formation of fibrillar and microfibrillar networks of the extracellular matrix, basement membranes as well as other structures of the extracellular matrix. This review focuses on the distribution and function of various collagen types in different tissues. It introduces their basic structural subunits and points out major steps in the biosynthesis and supramolecular processing of fibrillar collagens as prototypical members of this protein family. A final outlook indicates the importance of different collagen types not only for the understanding of collagen-related diseases, but also as a basis for the therapeutical use of members of this protein family discussed in other chapters of this issue.
International Nuclear Information System (INIS)
Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.
2004-01-01
As a class, hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors can potentially cause skeletal myopathy. One statin, cerivastatin, has recently been withdrawn from the market due to an unacceptably high incidence of rhabdomyolysis. The mechanism underlying statin-induced myopathy is unknown. This paper sought to investigate the relationship among statin-induced myopathy, mitochondrial function, and muscle ubiquinone levels. Rats were administered cerivastatin at 0.1, 0.5, and 1.0 (mg/kg)/day or dose vehicle (controls) by oral gavage for 15 days. Samples of type I-predominant skeletal muscle (soleus) and type II-predominant skeletal muscle [quadriceps and extensor digitorum longus (EDL)], and blood were collected on study days 5, 10, and 15 for morphological evaluation, clinical chemistry, mitochondrial function tests, and analysis of ubiquinone levels. No histological changes were observed in any of the animals on study days 5 or 10, but on study day 15, mid- and high-dose animals had necrosis and inflammation in type II skeletal muscle. Elevated creatine kinase (CK) levels in blood (a clinical marker of myopathy) correlated with the histopathological diagnosis of myopathy. Ultrastructural characterization of skeletal muscle revealed disruption of the sarcomere and altered mitochondria only in myofibers with degeneration, while adjacent myofibers were unaffected and had normal mitochondria. Thus, mitochondrial effects appeared not to precede myofiber degeneration. Mean coenzyme Q9 (CoQ9) levels in all dose groups were slightly decreased relative to controls in type II skeletal muscle, although the difference was not significantly different in most cases. Mitochondrial function in skeletal muscle was not affected by the changes in ubiquinone levels. The ubiquinone levels in high-dose-treated animals exhibiting myopathy were not significantly different from low-dose animals with no observable toxic effects. Furthermore, ubiquinone levels did not correlate
Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.
Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony
2017-04-01
Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and ClinicalTrials.gov databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies
Collagen cross linking: Current perspectives
Directory of Open Access Journals (Sweden)
Srinivas K Rao
2013-01-01
Full Text Available Keratoconus is a common ectatic disorder occurring in more than 1 in 1,000 individuals. The condition typically starts in adolescence and early adulthood. It is a disease with an uncertain cause and its progression is unpredictable, but in extreme cases, vision deteriorates and can require corneal transplant surgery. Corneal collagen cross-linking (CCL with riboflavin (C3R is a recent treatment option that can enhance the rigidity of the cornea and prevent disease progression. Since its inception, the procedure has evolved with newer instrumentation, surgical techniques, and is also now performed for expanded indications other than keratoconus. With increasing experience, newer guidelines regarding optimization of patient selection, the spectrum of complications and their management, and combination procedures are being described. This article in conjunction with the others in this issue, will try and explore the uses of collagen cross-linking (CXL in its current form.
Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J
2017-05-01
Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very
Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo
2012-04-01
Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in
Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.
El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S
2016-06-01
Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.
2004-01-01
Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,
Collagen fibrillogenesis: fibronectin, integrins, and minor collagens as organizers and nucleators.
Kadler, Karl E; Hill, Adele; Canty-Laird, Elizabeth G
2008-10-01
Collagens are triple helical proteins that occur in the extracellular matrix (ECM) and at the cell-ECM interface. There are more than 30 collagens and collagen-related proteins but the most abundant are collagens I and II that exist as D-periodic (where D = 67 nm) fibrils. The fibrils are of broad biomedical importance and have central roles in embryogenesis, arthritis, tissue repair, fibrosis, tumor invasion, and cardiovascular disease. Collagens I and II spontaneously form fibrils in vitro, which shows that collagen fibrillogenesis is a selfassembly process. However, the situation in vivo is not that simple; collagen I-containing fibrils do not form in the absence of fibronectin, fibronectin-binding and collagen-binding integrins, and collagen V. Likewise, the thin collagen II-containing fibrils in cartilage do not form in the absence of collagen XI. Thus, in vivo, cellular mechanisms are in place to control what is otherwise a protein self-assembly process. This review puts forward a working hypothesis for how fibronectin and integrins (the organizers) determine the site of fibril assembly, and collagens V and XI (the nucleators) initiate collagen fibrillogenesis.
Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease
International Nuclear Information System (INIS)
Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia
2008-01-01
Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)
Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease
Energy Technology Data Exchange (ETDEWEB)
Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)
2008-11-15
Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)
Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe
2015-02-03
Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.
Complete Histological Resolution of Collagenous Sprue
Directory of Open Access Journals (Sweden)
Hugh J Freeman
2004-01-01
Full Text Available A 65-year-old woman developed a watery diarrhea syndrome with collagenous colitis. Later, weight loss and hypoalbuminemia were documented. This prompted small bowel biopsies that showed pathological changes of collagenous sprue. An apparent treatment response to a gluten-free diet and prednisone resulted in reduced diarrhea, weight gain and normalization of serum albumin. Later repeated biopsies from multiple small and large bowel sites over a period of over three years, however, showed reversion to normal small intestinal mucosa but persistent collagenous colitis. These results indicate that collagenous inflammatory disease may be a far more extensive process in the gastrointestinal tract than is currently appreciated. Moreover, collagenous colitis may be a clinical signal that occult small intestinal disease is present. Finally, collagenous sprue may, in some instances, be a completely reversible small intestinal disorder.
A novel functional role of collagen glycosylation
DEFF Research Database (Denmark)
Jürgensen, Henrik J; Madsen, Daniel H; Ingvarsen, Signe
2011-01-01
Collagens make up the most abundant component of interstitial extracellular matrices and basement membranes. Collagen remodeling is a crucial process in many normal physiological events and in several pathological conditions. Some collagen subtypes contain specific carbohydrate side chains......, the function of which is poorly known. The endocytic collagen receptor urokinase plasminogen activator receptor-associated protein (uPARAP)/Endo180 plays an important role in matrix remodeling through its ability to internalize collagen for lysosomal degradation. uPARAP/Endo180 is a member of the mannose...... receptor protein family. These proteins all include a fibronectin type II domain and a series of C-type lectin-like domains, of which only a minor part possess carbohydrate recognition activity. At least two of the family members, uPARAP/Endo180 and the mannose receptor, interact with collagens...
Effect of radiation on rat skin collagen
International Nuclear Information System (INIS)
Nogami, Akira
1980-01-01
I. Albino male rats were exposed for 16 weeks to ultraviolet light (UVL) which has principle emission at 305 nm. There were no significant changes between control and UVL-exposed skins in the total hydroxyproline content. However, a little increase of citrate-soluble collagen, a little decrease of insoluble collagen and a decrease of aldehyde content in soluble collagen were observed with UVL exposure. Total acid glycosaminoglycan in skin increased 30% or more from control. These results show that the effect of UVL on rat skin in vivo was merely inflammation phenomenon and that the 'aging' process of skin was not caused in our experimental conditions. II. The effects of radiation on the solubility of rat skin collagen were examined under various conditions. 1) When intact rats were exposed to a single dose of radiation from 43 kVp X-ray source, the solubility in skin collagen did not change at 4,000 R dosage, while in irradiation of 40,000 R a decreased solubility in collagen was observed. When rats were given 400 R a week for 12 weeks, there was no changes in the solubility of collagen during experimental period. 2) In vitro exposure to skins, an irradiation of 40,000 R from 43 kVp X-ray source caused a decrease in the solubility of collagen. While an irradiation of 40,000 R of dosage from 200 kVp X-ray source resulted in the increase in soluble collagen and the decrease in insoluble collagen. 3) When intact rats were given a single dose of 40,000 R from 60 Co- gamma -ray, insoluble collagen decreased in both young and adult rats. Similar changes in collagen solubility were observed in vitro gamma -irradiation. (author)
Alginate-Collagen Fibril Composite Hydrogel
Directory of Open Access Journals (Sweden)
Mahmoud Baniasadi
2015-02-01
Full Text Available We report on the synthesis and the mechanical characterization of an alginate-collagen fibril composite hydrogel. Native type I collagen fibrils were used to synthesize the fibrous composite hydrogel. We characterized the mechanical properties of the fabricated fibrous hydrogel using tensile testing; rheometry and atomic force microscope (AFM-based nanoindentation experiments. The results show that addition of type I collagen fibrils improves the rheological and indentation properties of the hydrogel.
Routes towards Novel Collagen-Like Biomaterials
Directory of Open Access Journals (Sweden)
Adrian V. Golser
2018-04-01
Full Text Available Collagen plays a major role in providing mechanical support within the extracellular matrix and thus has long been used for various biomedical purposes. Exemplary, it is able to replace damaged tissues without causing adverse reactions in the receiving patient. Today’s collagen grafts mostly are made of decellularized and otherwise processed animal tissue and therefore carry the risk of unwanted side effects and limited mechanical strength, which makes them unsuitable for some applications e.g., within tissue engineering. In order to improve collagen-based biomaterials, recent advances have been made to process soluble collagen through nature-inspired silk-like spinning processes and to overcome the difficulties in providing adequate amounts of source material by manufacturing collagen-like proteins through biotechnological methods and peptide synthesis. Since these methods also open up possibilities to incorporate additional functional domains into the collagen, we discuss one of the best-performing collagen-like type of proteins, which already have additional functional domains in the natural blueprint, the marine mussel byssus collagens, providing inspiration for novel biomaterials based on collagen-silk hybrid proteins.
Boerboom, R.A.; Krahn - Nash, K.; Megens, R.T.A.; Zandvoort, van M.; Merkx, M.; Bouten, C.V.C.
2007-01-01
Collagen is the protein primarily responsible for the load-bearing properties of tissues and collagen architecture is one of the main determinants of the mechanical properties of tissues. Visualisation of changes in collagen three-dimensional structure is essential in order to improve our
Directory of Open Access Journals (Sweden)
Teet Seene
2012-01-01
Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.
Free radicals in alcoholic myopathy: indices of damage and preventive studies.
Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon
2002-04-15
Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.
Fatal hepatic hemorrhage by peliosis hepatis in X-linked myotubular myopathy: a case report.
Motoki, T; Fukuda, M; Nakano, T; Matsukage, S; Fukui, A; Akiyoshi, S; Hayashi, Y K; Ishii, E; Nishino, I
2013-11-01
We report a 5-year-old boy with X-linked myotubular myopathy complicated by peliosis hepatis. At birth, he was affected with marked generalized muscle hypotonia and weakness, which required permanent ventilatory support, and was bedridden for life. He died of acute fatal hepatic hemorrhage after using a mechanical in-exsufflator. Peliosis hepatis, defined as multiple, variable-sized, cystic blood-filled spaces through the liver parenchyma, was confirmed by autopsy. To avoid fatal hepatic hemorrhage by peliosis hepatis, routine hepatic function tests and abdominal imaging tests should be performed for patients with X-linked myotubular myopathy, especially at the time of using artificial respiration. Copyright © 2013 Elsevier B.V. All rights reserved.
Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.
Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello
2016-04-01
Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.
Laser welding and collagen crosslinks
Energy Technology Data Exchange (ETDEWEB)
Reiser, K.M.; Last, J.A. [California Univ., Davis, CA (United States). Dept. of Medicine; Small, W. IV; Maitland, D.J.; Heredia, N.J.; Da Silva, L.B.; Matthews, D.L. [Lawrence Livermore National Lab., CA (United States)
1997-02-20
Strength and stability of laser-welded tissue may be influenced, in part, by effects of laser exposure on collagen crosslinking. We therefore studied effects of diode laser exposure (805 nm, 1-8 watts, 30 seconds) + indocyanine green dye (ICG) on calf tail tendon collagen crosslinks. Effect of ICG dye alone on crosslink content prior to laser exposure was investigated; unexpectedly, we found that ICG-treated tissue had significantly increased DHLNL and OHP, but not HLNL. Laser exposure after ICG application reduced elevated DHLNL and OHP crosslink content down to their native levels. The monohydroxylated crosslink HLNL was inversely correlated with laser output (p<0.01 by linear regression analysis). DHLNL content was highly correlated with content of its maturational product, OHP, suggesting that precursor-product relations are maintained. We conclude that: (1)ICG alone induces DHLNL and OHP crosslink formation; (2)subsequent laser exposure reduces the ICG-induced crosslinks down to native levels; (3)excessive diode laser exposure destroys normally occurring HLNL crosslinks.
Modern collagen wound dressings: function and purpose.
Fleck, Cynthia Ann; Simman, Richard
2010-09-01
Collagen, which is produced by fibroblasts, is the most abundant protein in the human body. A natural structural protein, collagen is involved in all 3 phases of the wound-healing cascade. It stimulates cellular migration and contributes to new tissue development. Because of their chemotactic properties on wound fibroblasts, collagen dressings encourage the deposition and organization of newly formed collagen, creating an environment that fosters healing. Collagen-based biomaterials stimulate and recruit specific cells, such as macrophages and fibroblasts, along the healing cascade to enhance and influence wound healing. These biomaterials can provide moisture or absorption, depending on the delivery system. Collagen dressings are easy to apply and remove and are conformable. Collagen dressings are usually formulated with bovine, avian, or porcine collagen. Oxidized regenerated cellulose, a plant-based material, has been combined with collagen to produce a dressing capable of binding to and protecting growth factors by binding and inactivating matrix metalloproteinases in the wound environment. The increased understanding of the biochemical processes involved in chronic wound healing allows the design of wound care products aimed at correcting imbalances in the wound microenvironment. Traditional advanced wound care products tend to address the wound's macroenvironment, including moist wound environment control, fluid management, and controlled transpiration of wound fluids. The newer class of biomaterials and wound-healing agents, such as collagen and growth factors, targets specific defects in the chronic wound environment. In vitro laboratory data point to the possibility that these agents benefit the wound healing process at a biochemical level. Considerable evidence has indicated that collagen-based dressings may be capable of stimulating healing by manipulating wound biochemistry.
Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu
2016-01-01
Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...
DEFF Research Database (Denmark)
Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt
2015-01-01
inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...
Directory of Open Access Journals (Sweden)
Hina N. Khan
2016-02-01
Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.
Toxic myopathy in a dog associated with the presence of monensin in dry food.
Wilson, J S
1980-01-01
This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.
Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food
Wilson, J. S.
1980-01-01
This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.
Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy
Directory of Open Access Journals (Sweden)
Saleh Saleh Elessawy
2016-09-01
Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.
Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey
2018-06-01
Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3 mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3 mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3 mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.
Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy
Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H
2015-01-01
Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...
Mutation-specific effects on thin filament length in thin filament myopathy.
Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C
2016-06-01
Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.
Unfolded protein response and activated degradative pathways regulation in GNE myopathy.
Directory of Open Access Journals (Sweden)
Honghao Li
Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.
International Nuclear Information System (INIS)
Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.
1987-01-01
Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)
Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone
Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu
2017-01-01
Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...
Radiological features of Paget disease of bone associated with VCP myopathy
Energy Technology Data Exchange (ETDEWEB)
Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)
2012-03-15
Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)
Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.
Rue, Nana; Vissing, John; Galbo, Henrik
2014-10-01
Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.
Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.
Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils
2016-03-01
Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).
The genetic basis of pectoralis major myopathies in modern broiler chicken lines.
Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago
2015-12-01
This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.
[Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].
Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra
2017-11-01
We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.
Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet
Directory of Open Access Journals (Sweden)
Brianne E. Phillips
2015-01-01
Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.
Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review
Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.
2015-01-01
Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685
Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings
International Nuclear Information System (INIS)
Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo
1998-01-01
We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients
[Value of MRI in the treatment of Grave's disease orbital myopathy].
Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H
2001-10-01
In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.
Recombinant gelatin and collagen from methylotrophic yeasts
Bruin, de E.C.
2002-01-01
Based on its structural role and compatibility within the human body, collagen is a commonly used biomaterial in medical applications, such as cosmetic surgery, wound treatment and tissue engineering. Gelatin is in essence denatured and partly degraded collagen and is,
Biomimetic soluble collagen purified from bones.
Ferreira, Ana Marina; Gentile, Piergiorgio; Sartori, Susanna; Pagliano, Cristina; Cabrele, Chiara; Chiono, Valeria; Ciardelli, Gianluca
2012-11-01
Type I collagen has been extensively exploited as a biomaterial for biomedical applications and drug delivery; however, small molecular alterations occurring during the isolation procedure and its interaction with residual bone extracellular matrix molecules or proteins might affect the overall material biocompatibility and performance. The aim of the current work is to study the potential alterations in collagen properties and organization associated with the absence of proteoglycans, which mimic pathological conditions associated with age-related diseases. A new approach for evaluating the effect of proteoglycans on the properties of isolated type I collagen from the bone matrix is described. Additional treatment with guanidine hydrochloride was introduced to remove residual proteoglycans from the collagen matrix. The properties of the isolated collagen with/without guanidine hydrochloride treatment were investigated and compared with a commercial rabbit collagen as control. We demonstrate that the absence of proteoglycans in the isolated type I collagen affects its thermal properties, the extraction into its native structure, and its ability to hydrate and self-assemble into fibers. The fine control and tuning of all these features, linked to the absence of non-collagenous proteins as proteoglycans, offer the possibility of designing new strategies and biomaterials with advanced biomimetic properties aimed at regenerating bone tissue in the case of fragility and/or defects. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chondroitin Sulfate Perlecan Enhances Collagen Fibril Formation
DEFF Research Database (Denmark)
Kvist, A. J.; Johnson, A. E.; Mörgelin, M.
2006-01-01
in collagen type II fibril assembly by perlecan-null chondrocytes. Cartilage perlecan is a heparin sulfate or a mixed heparan sulfate/chondroitin sulfate proteoglycan. The latter form binds collagen and accelerates fibril formation in vitro, with more defined fibril morphology and increased fibril diameters...... produced in the presence of perlecan. Interestingly, the enhancement of collagen fibril formation is independent on the core protein and is mimicked by chondroitin sulfate E but neither by chondroitin sulfate D nor dextran sulfate. Furthermore, perlecan chondroitin sulfate contains the 4,6-disulfated...... disaccharides typical for chondroitin sulfate E. Indeed, purified glycosaminoglycans from perlecan-enriched fractions of cartilage extracts contain elevated levels of 4,6-disulfated chondroitin sulfate disaccharides and enhance collagen fibril formation. The effect on collagen assembly is proportional...
Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.
2011-01-01
Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871
Energy Technology Data Exchange (ETDEWEB)
Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)
1992-03-01
Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.
Energy Technology Data Exchange (ETDEWEB)
Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))
1992-01-01
Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.
International Nuclear Information System (INIS)
Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.
1992-01-01
Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques
Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F
2014-09-01
Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.
Deniset-Besseau, A.; De Sa Peixoto, P.; Duboisset, J.; Loison, C.; Hache, F.; Benichou, E.; Brevet, P.-F.; Mosser, G.; Schanne-Klein, M.-C.
2010-02-01
Collagen is characterized by triple helical domains and plays a central role in the formation of fibrillar and microfibrillar networks, basement membranes, as well as other structures of the connective tissue. Remarkably, fibrillar collagen exhibits efficient Second Harmonic Generation (SHG) and SHG microscopy proved to be a sensitive tool to score fibrotic pathologies. However, the nonlinear optical response of fibrillar collagen is not fully characterized yet and quantitative data are required to further process SHG images. We therefore performed Hyper-Rayleigh Scattering (HRS) experiments and measured a second order hyperpolarisability of 1.25 10-27 esu for rat-tail type I collagen. This value is surprisingly large considering that collagen presents no strong harmonophore in its amino-acid sequence. In order to get insight into the physical origin of this nonlinear process, we performed HRS measurements after denaturation of the collagen triple helix and for a collagen-like short model peptide [(Pro-Pro-Gly)10]3. It showed that the collagen large nonlinear response originates in the tight alignment of a large number of weakly efficient harmonophores, presumably the peptide bonds, resulting in a coherent amplification of the nonlinear signal along the triple helix. To illustrate this mechanism, we successfully recorded SHG images in collagen liquid solutions by achieving liquid crystalline ordering of the collagen triple helices.
The Mineral–Collagen Interface in Bone
2015-01-01
The interface between collagen and the mineral reinforcement phase, carbonated hydroxyapatite (cAp), is essential for bone’s remarkable functionality as a biological composite material. The very small dimensions of the cAp phase and the disparate natures of the reinforcement and matrix are essential to the material’s performance but also complicate study of this interface. This article summarizes what is known about the cAp-collagen interface in bone and begins with descriptions of the matrix and reinforcement roles in composites, of the phases bounding the interface, of growth of cAp growing within the collagen matrix, and of the effect of intra- and extrafibrilar mineral on determinations of interfacial properties. Different observed interfacial interactions with cAp (collagen, water, non-collagenous proteins) are reviewed; experimental results on interface interactions during loading are reported as are their influence on macroscopic mechanical properties; conclusions of numerical modeling of interfacial interactions are also presented. The data suggest interfacial interlocking (bending of collagen molecules around cAp nanoplatelets) and water-mediated bonding between collagen and cAp are essential to load transfer. The review concludes with descriptions of areas where new research is needed to improve understanding of how the interface functions. PMID:25824581
Age Increases Monocyte Adhesion on Collagen
Khalaji, Samira; Zondler, Lisa; Kleinjan, Fenneke; Nolte, Ulla; Mulaw, Medhanie A.; Danzer, Karin M.; Weishaupt, Jochen H.; Gottschalk, Kay-E.
2017-05-01
Adhesion of monocytes to micro-injuries on arterial walls is an important early step in the occurrence and development of degenerative atherosclerotic lesions. At these injuries, collagen is exposed to the blood stream. We are interested whether age influences monocyte adhesion to collagen under flow, and hence influences the susceptibility to arteriosclerotic lesions. Therefore, we studied adhesion and rolling of human peripheral blood monocytes from old and young individuals on collagen type I coated surface under shear flow. We find that firm adhesion of monocytes to collagen type I is elevated in old individuals. Pre-stimulation by lipopolysaccharide increases the firm adhesion of monocytes homogeneously in older individuals, but heterogeneously in young individuals. Blocking integrin αx showed that adhesion of monocytes to collagen type I is specific to the main collagen binding integrin αxβ2. Surprisingly, we find no significant age-dependent difference in gene expression of integrin αx or integrin β2. However, if all integrins are activated from the outside, no differences exist between the age groups. Altered integrin activation therefore causes the increased adhesion. Our results show that the basal increase in integrin activation in monocytes from old individuals increases monocyte adhesion to collagen and therefore the risk for arteriosclerotic plaques.
Cosmetic Potential of Marine Fish Skin Collagen
Directory of Open Access Journals (Sweden)
Ana L. Alves
2017-10-01
Full Text Available Many cosmetic formulations have collagen as a major component because of its significant benefits as a natural humectant and moisturizer. This industry is constantly looking for innovative, sustainable, and truly efficacious products, so marine collagen based formulations are arising as promising alternatives. A solid description and characterization of this protein is fundamental to guarantee the highest quality of each batch. In the present study, we present an extensive characterization of marine-derived collagen extracted from salmon and codfish skins, targeting its inclusion as component in cosmetic formulations. Chemical and physical characterizations were performed using several techniques such as sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE, Fourier Transformation Infrared (FTIR spectroscopy rheology, circular dichroism, X-ray diffraction, humidity uptake, and a biological assessment of the extracts regarding their irritant potential. The results showed an isolation of type I collagen with high purity but with some structural and chemical differences between sources. Collagen demonstrated a good capacity to retain water, thus being suitable for dermal applications as a moisturizer. A topical exposure of collagen in a human reconstructed dermis, as well as the analysis of molecular markers for irritation and inflammation, exhibited no irritant potential. Thus, the isolation of collagen from fish skins for inclusion in dermocosmetic applications may constitute a sustainable and low-cost platform for the biotechnological valorization of fish by-products.
Association of collagen architecture with glioblastoma patient survival.
Pointer, Kelli B; Clark, Paul A; Schroeder, Alexandra B; Salamat, M Shahriar; Eliceiri, Kevin W; Kuo, John S
2017-06-01
OBJECTIVE Glioblastoma (GBM) is the most malignant primary brain tumor. Collagen is present in low amounts in normal brain, but in GBMs, collagen gene expression is reportedly upregulated. However, to the authors' knowledge, direct visualization of collagen architecture has not been reported. The authors sought to perform the first direct visualization of GBM collagen architecture, identify clinically relevant collagen signatures, and link them to differential patient survival. METHODS Second-harmonic generation microscopy was used to detect collagen in a GBM patient tissue microarray. Focal and invasive GBM mouse xenografts were stained with Picrosirius red. Quantitation of collagen fibers was performed using custom software. Multivariate survival analysis was done to determine if collagen is a survival marker for patients. RESULTS In focal xenografts, collagen was observed at tumor brain boundaries. For invasive xenografts, collagen was intercalated with tumor cells. Quantitative analysis showed significant differences in collagen fibers for focal and invasive xenografts. The authors also found that GBM patients with more organized collagen had a longer median survival than those with less organized collagen. CONCLUSIONS Collagen architecture can be directly visualized and is different in focal versus invasive GBMs. The authors also demonstrate that collagen signature is associated with patient survival. These findings suggest that there are collagen differences in focal versus invasive GBMs and that collagen is a survival marker for GBM.
Characterization of Genipin-Modified Dentin Collagen
Directory of Open Access Journals (Sweden)
Hiroko Nagaoka
2014-01-01
Full Text Available Application of biomodification techniques to dentin can improve its biochemical and biomechanical properties. Several collagen cross-linking agents have been reported to strengthen the mechanical properties of dentin. However, the characteristics of collagen that has undergone agent-induced biomodification are not well understood. The objective of this study was to analyze the effects of a natural cross-linking agent, genipin (GE, on dentin discoloration, collagen stability, and changes in amino acid composition and lysyl oxidase mediated natural collagen cross-links. Dentin collagen obtained from extracted bovine teeth was treated with three different concentrations of GE (0.01%, 0.1%, and 0.5% for several treatment times (0–24 h. Changes in biochemical properties of NaB3H4-reduced collagen were characterized by amino acid and cross-link analyses. The treatment of dentin collagen with GE resulted in a concentration- and time-dependent pigmentation and stability against bacterial collagenase. The lysyl oxidase-mediated trivalent mature cross-link, pyridinoline, showed no difference among all groups while the major divalent immature cross-link, dehydro-dihydroxylysinonorleucine/its ketoamine in collagen treated with 0.5% GE for 24 h, significantly decreased compared to control (P< 0.05. The newly formed GE-induced cross-links most likely involve lysine and hydroxylysine residues of collagen in a concentration-dependent manner. Some of these cross-links appear to be reducible and stabilized with NaB3H4.
Fibrous mini-collagens in hydra nematocysts.
Holstein, T W; Benoit, M; Herder, G V; David, C N; Wanner, G; Gaub, H E
1994-07-15
Nematocysts (cnidocysts) are exocytotic organelles found in all cnidarians. Here, atomic force microscopy and field emission scanning electron microscopy reveal the structure of the nematocyst capsule wall. The outer wall consists of globular proteins of unknown function. The inner wall consists of bundles of collagen-like fibrils having a spacing of 50 to 100 nanometers and cross-striations at intervals of 32 nanometers. The fibrils consist of polymers of "mini-collagens," which are abundant in the nematocysts of Hydra. The distinct pattern of mini-collagen fibers in the inner wall can provide the tensile strength necessary to withstand the high osmotic pressure (15 megapascals) in the capsules.
Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi
2015-10-23
HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.
A New Kind of Biomaterials-Bullfrog Skin Collagen
Institute of Scientific and Technical Information of China (English)
He LI; Bai Ling LIU; Hua Lin CHEN; Li Zhen GAO
2003-01-01
Pepsin-soluble collagen was prepared from bullfrog skin and partially characterized. This study revealed interesting differences, such as molecular weight, amino acid composition, denaturation temperature (Td), in the frog skin collagen when compared to the known vertebrate collagens. This study gives hints that bullfrog skin can be a potential, safe alternative source of collagen from cattle for use in various fields.
Protease-activatable collagen targeting based on protein cyclization
Breurken, M.; Lempens, E.H.M.; Merkx, M.
2010-01-01
Threading collagen through a protein needle: The collagen-binding protein CNA35 operates by wrapping itself around the collagen triple helix. By connecting the N and C termini through an MMP recognition sequence, a dual-specific MMP-sensitive collagen-targeting ligand is obtained that can be used
Collagen based Biomaterials from CLRI: An Inspiration from the ...
Indian Academy of Sciences (India)
Collagen-based Smart Biomaterials · Smart materials: As smart people see them · Some Biomaterials based on Collagen in Human Health care · Questions of Value to this presentation ... Collagen based biomaterials · COLLAGEN IN VISION CARE · Slide 57 · Bandage lens: A smart device · Work at CLRI: In summary.
Chitosan: collagen sponges. In vitro mineralization
International Nuclear Information System (INIS)
Martins, Virginia da C.A.; Silva, Gustavo M.; Plepis, Ana Maria G.
2011-01-01
The regeneration of bone tissue is a problem that affects many people and scaffolds for bone tissue growth has been widely studied. The aim of this study was the in vitro mineralization of chitosan, chitosan:native collagen and chitosan:anionic collagen sponges. The sponges were obtained by lyophilization and mineralization was made by soaking the sponges in alternating solutions containing Ca 2+ and PO 4 3- . The mineralization was confirmed by infrared spectroscopy, energy dispersive X-ray and X-ray diffraction observing the formation of phosphate salts, possibly a carbonated hydroxyapatite since Ca/P=1.80. The degree of mineralization was obtained by thermogravimetry calculating the amount of residue at 750 deg C. The chitosan:anionic collagen sponge showed the highest degree of mineralization probably due to the fact that anionic collagen provides additional sites for interaction with the inorganic phase. (author)
The minor collagens in articular cartilage
DEFF Research Database (Denmark)
Luo, Yunyun; Sinkeviciute, Dovile; He, Yi
2017-01-01
Articular cartilage is a connective tissue consisting of a specialized extracellular matrix (ECM) that dominates the bulk of its wet and dry weight. Type II collagen and aggrecan are the main ECM proteins in cartilage. However, little attention has been paid to less abundant molecular components......, especially minor collagens, including type IV, VI, IX, X, XI, XII, XIII, and XIV, etc. Although accounting for only a small fraction of the mature matrix, these minor collagens not only play essential structural roles in the mechanical properties, organization, and shape of articular cartilage, but also...... fulfil specific biological functions. Genetic studies of these minor collagens have revealed that they are associated with multiple connective tissue diseases, especially degenerative joint disease. The progressive destruction of cartilage involves the degradation of matrix constituents including...
Glycine functionalized alumina nanoparticles stabilize collagen in ...
Indian Academy of Sciences (India)
Al2O3 nanoparticles thereby suggesting ... 1. Introduction. Collagen is a naturally occurring skin protein in animal tis- ... easily adsorb on the surface of the nanoparticles and amino .... [19,23], agglomeration is prevented by the electrostatic.
Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R
2012-12-01
The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.
Properties of Chitosan-Laminated Collagen Film
Directory of Open Access Journals (Sweden)
Vera Lazić
2012-01-01
Full Text Available The objective of this study is to determine physical, mechanical and barrier properties of chitosan-laminated collagen film. Commercial collagen film, which is used for making collagen casings for dry fermented sausage production, was laminated with chitosan film layer in order to improve the collagen film barrier properties. Different volumes of oregano essential oil per 100 mL of filmogenic solution were added to chitosan film layer: 0, 0.2, 0.4, 0.6 and 0.8 mL to optimize water vapour barrier properties. Chitosan layer with 0.6 or 0.8 % of oregano essential oil lowered the water vapour transmission rate to (1.85±0.10·10–6 and (1.78±0.03·10–6 g/(m2·s·Pa respectively, compared to collagen film ((2.51±0.05·10–6 g/(m2·s·Pa. However, chitosan-laminated collagen film did not show improved mechanical properties compared to the collagen one. Tensile strength decreased from (54.0±3.8 MPa of the uncoated collagen film to (36.3±4.0 MPa when the film was laminated with 0.8 % oregano essential oil chitosan layer. Elongation at break values of laminated films did not differ from those of collagen film ((18.4±2.7 %. Oxygen barrier properties were considerably improved by lamination. Oxygen permeability of collagen film was (1806.8±628.0·10–14 cm3/(m·s·Pa and values of laminated films were below 35·10–14 cm3/(m·s·Pa. Regarding film appearance and colour, lamination with chitosan reduced lightness (L and yellowness (+b of collagen film, while film redness (+a increased. These changes were not visible to the naked eye.
Collagen Accumulation in Osteosarcoma Cells lacking GLT25D1 Collagen Galactosyltransferase.
Baumann, Stephan; Hennet, Thierry
2016-08-26
Collagen is post-translationally modified by prolyl and lysyl hydroxylation and subsequently by glycosylation of hydroxylysine. Despite the widespread occurrence of the glycan structure Glc(α1-2)Gal linked to hydroxylysine in animals, the functional significance of collagen glycosylation remains elusive. To address the role of glycosylation in collagen expression, folding, and secretion, we used the CRISPR/Cas9 system to inactivate the collagen galactosyltransferase GLT25D1 and GLT25D2 genes in osteosarcoma cells. Loss of GLT25D1 led to increased expression and intracellular accumulation of collagen type I, whereas loss of GLT25D2 had no effect on collagen secretion. Inactivation of the GLT25D1 gene resulted in a compensatory induction of GLT25D2 expression. Loss of GLT25D1 decreased collagen glycosylation by up to 60% but did not alter collagen folding and thermal stability. Whereas cells harboring individually inactivated GLT25D1 and GLT25D2 genes could be recovered and maintained in culture, cell clones with simultaneously inactive GLT25D1 and GLT25D2 genes could be not grown and studied, suggesting that a complete loss of collagen glycosylation impairs osteosarcoma cell proliferation and viability. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Imaging Prostate Cancer Microenvironment by Collagen Hybridization
2015-10-01
diagnosis, staging, and treatment of numerous connective tissue disorders and diseases. Standard antibody staining methods that rely on epitopes of a...CMP can be used to detect mechanical damage to collagen in tendon which could be used for diagnostic and therapeutics of musculoskeletal injury which...13. SUPPLEMENTARY NOTES 14. ABSTRACT The major goal of the proposed work is to develop new PCa imaging methods based on the collagen mimetic peptide
Oriented collagen fibers direct tumor cell intravasation
Han, Weijing
2016-09-24
In this work, we constructed a Collagen I-Matrigel composite extracellular matrix (ECM). The composite ECM was used to determine the influence of the local collagen fiber orientation on the collective intravasation ability of tumor cells. We found that the local fiber alignment enhanced cell-ECM interactions. Specifically, metastatic MDA-MB-231 breast cancer cells followed the local fiber alignment direction during the intravasation into rigid Matrigel (∼10 mg/mL protein concentration).
Directory of Open Access Journals (Sweden)
Massimo Vecchiato
2012-03-01
Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of
Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.
Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H
2008-05-01
The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.
Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.
Brown, Bradley D; Rais, Theodore
2015-01-01
The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).
Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T
2017-02-05
Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.
BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.
Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta
2015-12-01
BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.
Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R
2016-07-01
Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.
Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular
Directory of Open Access Journals (Sweden)
Rosana Herminia Scola
2007-03-01
Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.
Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun
2013-03-01
Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.
Collagen Fibrils: Nature's Highly Tunable Nonlinear Springs.
Andriotis, Orestis G; Desissaire, Sylvia; Thurner, Philipp J
2018-03-21
Tissue hydration is well known to influence tissue mechanics and can be tuned via osmotic pressure. Collagen fibrils are nature's nanoscale building blocks to achieve biomechanical function in a broad range of biological tissues and across many species. Intrafibrillar covalent cross-links have long been thought to play a pivotal role in collagen fibril elasticity, but predominantly at large, far from physiological, strains. Performing nanotensile experiments of collagen fibrils at varying hydration levels by adjusting osmotic pressure in situ during atomic force microscopy experiments, we show the power the intrafibrillar noncovalent interactions have for defining collagen fibril tensile elasticity at low fibril strains. Nanomechanical tensile tests reveal that osmotic pressure increases collagen fibril stiffness up to 24-fold in transverse (nanoindentation) and up to 6-fold in the longitudinal direction (tension), compared to physiological saline in a reversible fashion. We attribute the stiffening to the density and strength of weak intermolecular forces tuned by hydration and hence collagen packing density. This reversible mechanism may be employed by cells to alter their mechanical microenvironment in a reversible manner. The mechanism could also be translated to tissue engineering approaches for customizing scaffold mechanics in spatially resolved fashion, and it may help explain local mechanical changes during development of diseases and inflammation.
X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.
Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H
1990-01-01
We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...
Serum and tissue markers of myopathy in patients with colorectal cancer
Directory of Open Access Journals (Sweden)
Nicoletta Adami
2012-09-01
Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin
Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report
Directory of Open Access Journals (Sweden)
Rosana Hermínia Scola
2005-06-01
Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.
DEFF Research Database (Denmark)
Vestergaard, H; Klein, H H; Hansen, T
1995-01-01
Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...
Collagen as potential cell scaffolds for tissue engineering.
Annuar, N; Spier, R E
2004-05-01
Selections of collagen available commercially were tested for their biocompatibility as scaffold to promote cell growth in vitro via simple collagen fast test and cultivation of mammalian cells on the selected type of collagen. It was found that collagen type C9791 promotes the highest degree of aggregation as well as cells growth. This preliminary study also indicated potential use of collagen as scaffold in engineered tissue.
Directory of Open Access Journals (Sweden)
Kate Stuart
Full Text Available Scarring of the skin is a large unmet clinical problem that is of high patient concern and impact. Wound healing is complex and involves numerous pathways that are highly orchestrated, leaving the skin sealed, but with abnormal organization and composition of tissue components, namely collagen and proteoglycans, that are then remodeled over time. To improve healing and reduce or eliminate scarring, more rapid restoration of healthy tissue composition and organization offers a unique approach for development of new therapeutics. A synthetic collagen-binding peptidoglycan has been developed that inhibits matrix metalloproteinase-1 and 13 (MMP-1 and MMP-13 mediated collagen degradation. We investigated the synthetic peptidoglycan in a rat incisional model in which a single dose was delivered in a hyaluronic acid (HA vehicle at the time of surgery prior to wound closure. The peptidoglycan treatment resulted in a significant reduction in scar tissue at 21 days as measured by histology and visual analysis. Improved collagen architecture of the treated wounds was demonstrated by increased tensile strength and transmission electron microscopy (TEM analysis of collagen fibril diameters compared to untreated and HA controls. The peptidoglycan's mechanism of action includes masking existing collagen and inhibiting MMP-mediated collagen degradation while modulating collagen organization. The peptidoglycan can be synthesized at low cost with unique design control, and together with demonstrated preclinical efficacy in reducing scarring, warrants further investigation for dermal wound healing.
Liang, Hui; Li, Xiaoran; Wang, Bin; Chen, Bing; Zhao, Yannan; Sun, Jie; Zhuang, Yan; Shi, Jiajia; Shen, He; Zhang, Zhijun; Dai, Jianwu
2016-02-17
Many tumors over-express collagen, which constitutes the physical scaffold of tumor microenvironment. Collagen has been considered to be a target for cancer therapy. The collagen-binding domain (CBD) is a short peptide, which could bind to collagen and achieve the sustained release of CBD-fused proteins in collagen scaffold. Here, a collagen-binding EGFR antibody fragment was designed and expressed for targeting the collagen-rich extracellular matrix in tumors. The antibody fragment (Fab) of cetuximab was fused with CBD (CBD-Fab) and expressed in Pichia pastoris. CBD-Fab maintained antigen binding and anti-tumor activity of cetuximab and obtained a collagen-binding ability in vitro. The results also showed CBD-Fab was mainly enriched in tumors and had longer retention time in tumors in A431 s.c. xenografts. Furthermore, CBD-Fab showed a similar therapeutic efficacy as cetuximab in A431 xenografts. Although CBD-Fab hasn't showed better therapeutic effects than cetuximab, its smaller molecular and special target may be applicable as antibody-drug conjugates (ADC) or immunotoxins.
Middelkoop, E.; de Vries, H. J.; Ruuls, L.; Everts, V.; Wildevuur, C. H.; Westerhof, W.
1995-01-01
We describe an in vitro model that we have used to evaluate dermal substitutes and to obtain data on cell proliferation, the rate of degradation of the dermal equivalent, contractibility and de novo synthesis of collagen. We tested three classes of collagenous materials: (1) reconstituted
Krahn, K.B.N.; Bouten, C.V.C.; Tuijl, van S.; Zandvoort, van M.; Merkx, M.
2006-01-01
Visualization of the formation and orientation of collagen fibers in tissue engineering experiments is crucial for understanding the factors that determine the mechanical properties of tissues. In this study, collagen-specific fluorescent probes were developed using a new approach that takes
MIDDELKOOP, E; DEVRIES, HJC; RUULS, L; EVERTS, [No Value; WILDEVUUR, CHR; WESTERHOF, W
We describe an in vitro model that we have used to evaluate dermal substitutes and to obtain data on cell proliferation, the rate of degradation of the dermal equivalent, contractibility and de novo synthesis of collagen. We tested three classes of collagenous materials: (1) reconstituted
The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.
Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R
2018-03-01
The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.
Directory of Open Access Journals (Sweden)
Vincent Lepori
2018-05-01
Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.
Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu
2017-01-01
Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E
2006-01-01
Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.
Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.
Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore
2016-12-01
Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.
MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT
Directory of Open Access Journals (Sweden)
O. M. Drapkina
2015-01-01
Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.
Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.
Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J
2018-04-23
Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.
Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion
2018-05-04
Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Directory of Open Access Journals (Sweden)
Muhammad I. Ullah
2017-12-01
Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?
Directory of Open Access Journals (Sweden)
Antonia eKaltsatou
2015-03-01
Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.
Elevated risk of venous thromboembolic events in patients with inflammatory myopathies
Directory of Open Access Journals (Sweden)
Nowak M
2016-06-01
Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state
Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M
1991-03-01
A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.
MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT
Directory of Open Access Journals (Sweden)
O. M. Drapkina
2015-09-01
Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.
Directory of Open Access Journals (Sweden)
Pari Basharat
2016-07-01
Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.
Directory of Open Access Journals (Sweden)
Benech Philippe
2009-08-01
Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.
Santa, Kristin M
2010-11-01
Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.
Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.
Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo
2012-12-01
In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Zvaritch, Elena; MacLennan, David H.
2015-01-01
Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed
Bottai, Matteo; Tjärnlund, Anna; Santoni, Giola; Werth, Victoria P.; Pilkington, Clarissa; de Visser, Marianne; Alfredsson, Lars; Amato, Anthony A.; Barohn, Richard J.; Liang, Matthew H.; Singh, Jasvinder A.; Aggarwal, Rohit; Arnardottir, Snjolaug; Chinoy, Hector; Cooper, Robert G.; Danko, Katalin; Dimachkie, Mazen M.; Feldman, Brian M.; García-de la Torre, Ignacio; Gordon, Patrick; Hayashi, Taichi; Katz, James D.; Kohsaka, Hitoshi; Lachenbruch, Peter A.; Lang, Bianca A.; Li, Yuhui; Oddis, Chester V.; Olesinka, Marzena; Reed, Ann M.; Rutkowska-Sak, Lidia; Sanner, Helga; Selva-O'Callaghan, Albert; Wook Song, Yeong; Vencovsky, Jiri; Ytterberg, Steven R.; Miller, Frederick W.; Rider, Lisa G.; Lundberg, Ingrid E.; Amoruso, Maria; Andersson, Helena; Bayat, Nastaran; Bhansing, Kavish J.; Bucher, Sara; Champbell, Richard; Charles-Schoeman, Christina; Chaudhry, Vinay; Christopher-Stine, Lisa; Chung, Lorinda; Cronin, Mary; Curry, Theresa; Dahlbom, Kathe; Distler, Oliver; Efthimiou, Petros; van Engelen, Baziel G. M.; Faiq, Abdullah; Farhadi, Payam Noroozi; Fiorentino, David; Hengstman, Gerald; Hoogendijk, Jessica; Huber, Adam; Kataoka, Hiroshi; Katsumata, Yasuhiro; Kim, Susan; Kong-Rosario, Michelle; Kontzias, Apostolos; Krol, Petra; Kurita, Takashi; Li, Zhan-Guo; Lindvall, Björn; Linklater, Helen; Maillard, Sue; Mamyrova, Gulnara; Mantegazza, Renato; Marder, Galina S.; Nagahashi Marie, Suely Kazue; Mathiesen, Pernille; Mavragani, Clio P.; McHugh, Neil J.; Michaels, Mimi; Mohammed, Reem; Morgan, Gabrielle; Moser, David W.; Moutsopoulos, Haralampos M.
2017-01-01
To describe the methodology used to develop new classification criteria for adult and juvenile idiopathic inflammatory myopathies (IIMs) and their major subgroups. An international, multidisciplinary group of myositis experts produced a set of 93 potentially relevant variables to be tested for
DEFF Research Database (Denmark)
Klein, H H; Müller, R; Vestergaard, H
1999-01-01
We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...
DEFF Research Database (Denmark)
Andersen, Ditte C; Petersson, Stine J; Jørgensen, Louise H
2009-01-01
, DLK1 was upregulated in all human myopathies analyzed, including Duchenne- and Becker muscular dystrophies. Substantial numbers of DLK1(+) satellite cells were observed in normal neonatal and Duchenne muscle, and furthermore, myogenic DLK1(+) cells were identified during muscle regeneration in animal...
Guglielmi, V; Oosterhof, A; Voermans, N C; Cardani, R; Molenaar, J P; van Kuppevelt, T H; Meola, G; van Engelen, B G; Tomelleri, G; Vattemi, G
2016-06-01
Sarcoplasmic/endoplasmic reticulum Ca(2+) ATPase (SERCA) pumps play the major role in lowering cytoplasmic calcium concentration in skeletal muscle by catalyzing the ATP-dependent transport of Ca(2+) from the cytosol to the lumen of the sarcoplasmic reticulum (SR). Although SERCA abnormalities have been hypothesized to contribute to the dysregulation of intracellular Ca(2+) homeostasis and signaling in muscle of patients with myotonic dystrophy (DM) and hypothyroid myopathy, the characterization of SERCA pumps remains elusive and their impairment is still unclear. We assessed the activity of SR Ca(2+)-ATPase, expression levels and fiber distribution of SERCA1 and SERCA2, and oligomerization of SERCA1 protein in muscle of patients with DM type 1 and 2, and with hypothyroid myopathy. Our data provide evidence that SR Ca(2+) ATPase activity, protein levels and muscle fiber distribution of total SERCA1 and SERCA2, and SERCA1 oligomerization pattern are similar in patients with both DM1 and DM2, hypothyroid myopathy and in control subjects. We prove that SERCA1b, the neonatal isoform of SERCA1, is expressed at protein level in muscle of patients with DM2 and, in lower amount, of patients with DM1. Our present study demonstrates that SERCA function is not altered in muscle of patients with DM and with hypothyroid myopathy. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Zaharieva, Irina T; Thor, Michael G; Oates, Emily C
2016-01-01
Congenital myopathies are a clinically and genetically heterogeneous group of muscle disorders characterized by congenital or early-onset hypotonia and muscle weakness, and specific pathological features on muscle biopsy. The phenotype ranges from foetal akinesia resulting in in utero or neonatal...
Roef, MJ; Kalhan, SC; Reijngoud, DJ; De Meer, K; Berger, Ruud
This study evaluated lactate disposal via gluconeogenesis as well as effects of FFA availability on gluconeogenesis via pyruvate (GNG(PYR)) in patients with mitochondrial myopathy due to complex I deficiency (CID). The rates of GNG(PYR) were measured in three CID patients and six healthy controls at
König, P; Ambrose, N S; Scott, N
2000-01-01
Hereditary internal anal sphincter myopathy is a very rare condition, only three families have so far been described in the literature. In this case report further clinical and histological findings of one affected member of one of the above families are presented.
Westermann, C.M.; Van Leeuwen, Robbert; Van Raamsdonk, L.W.D.; Mol, H.G.J.
BACKGROUND: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. HYPOTHESIS/OBJECTIVES: To measure
Westermann, C.M.; Leeuwen, van R.; Raamsdonk, van L.W.D.; Mol, H.G.J.
2016-01-01
Background: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. Hypothesis/Objectives: To
DEFF Research Database (Denmark)
Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T
2012-01-01
Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...
Huckriede, A; Heikema, A; Sjollema, K; Briones, P; Agsteribbe, E
1995-01-01
We have described two mitochondrial (mt) myopathy patients with reduced activities of various mt enzymes associated with significantly decreased amounts of heat shock protein 60 (hsp60). Experimental evidence suggested that the lack of hsp60 was the primary defect. Since hsp60 is essential for the
Nabben, M.; Schmitz, J.P.J.; Ciapaite, J.; le Clercq, C.M.P.; van Riel, N.A.; Haak, H.R.; Nicolay, K.; de Coo, I.F.M.; Smeets, H.; Praet, S.F.; van Loon, L.J.; Prompers, J.J.
2017-01-01
Muscle weakness and exercise intol erance negatively affect the quality of life of patients with mitochondrial myopathy. Short-term dietary nitrate supplementation has been shown to improve exercise performance and reduce oxygen cost of exercise in healthy humans and trained athletes. We
Akiyama, Masashi; Sakai, Kaori; Ogawa, Masaya; McMillan, James R; Sawamura, Daisuke; Shimizu, Hiroshi
2007-12-01
Recently, mutations in PNPLA2 encoding adipose triglyceride lipase (ATGL) were reported to underlie a neutral lipid storage disease (NLSD) subgroup characterized by mild myopathy and the absence of ichthyosis. In the present study a novel homozygous PNPLA2 mutation c.475_478dupCTCC (p.Gln160ProfsX19) in the patatin domain, the ATGL active site, was detected in a woman with NLSD and severe myopathy. The present results suggest that a premature truncation mutation in the patatin domain causes NLSD with severe myopathy.
Changes in guinea-pig dermal collagen during development
International Nuclear Information System (INIS)
Shuttleworth, C.A.; Forrest, L.
1975-01-01
Guinea-pig dermis was digested with pepsin and the solubilized collagen molecules separated by differential salt precipitation at pH 7.5. Differences in subunit composition and amino acid analysis were noted between type I and type III collagen. Incorporation of radioactive proline into the developing foetus enabled isolation of labelled type I and type III collagens. Comparison of the specific activity of the isolated collagen molecules showed that type III collagen had a high specific activity in the early stages of foetal development, which decreased dramatically during foetal development. The specific activity of pepsin-solubilized type I collagen remained fairly constant during foetal development. (orig.) [de
Biophysical behavior of Scomberoides commersonianus skin collagen.
Kolli, Nagamalleswari; Joseph, K Thomas; Ramasami, T
2002-06-01
Some biophysical characteristics of the skin collagen from Scomberoides commersonianus were measured and compared to those of rat tail tendon. Stress-strain data indicate that the strain at break as well as the tensile strength of the fish skin without scales increased significantly. The maximum tension in case of rat skin is at least a factor of two higher than that observed in fish skin. The much lower hydrothermal isometric tension measurements observed in fish skin are attributable to a lesser number of heat stable crosslinks. Stress relaxation measurements in the fish skin indicate that more than one relaxation process may be involved in the stabilization of collagenous matrix. The observed differences in the biophysical behavior of fish skin may well arise from combination of changes in extent of hydroxylation of proline in collagen synthesis, hydrogen bond network and fibril orientation as compared to rat tail tendon.
Collagenous gastritis in the pediatric age
Directory of Open Access Journals (Sweden)
Antonio Rosell-Camps
2015-05-01
Full Text Available Collagenous gastritis (CG is an uncommon condition known in the pediatric age. It is characterized by the presence of subepithelial collagen bands (> 10 μm associated with lymphoplasmacytic infiltration of the stomach's lamina propria. Symptoms manifested by patients with CG may be common with many other disorders. It typically manifests with epigastralgia, vomiting, and iron deficiency during pre-adolescence. This condition's pathophysiology remains unclear. In contrast to adults, where association with collagenous colitis and other autoimmune conditions is more common, pediatric involvement is usually confined to the stomach. Drugs of choice include proton pump inhibitors and corticoids. A case is reported of a 12-year-old girl with abdominal pain and ferritin deficiency who was diagnosed with CG based on gastric biopsy and experienced a favorable outcome.
Matsuura, Takashi; Tokutomi, Kentaro; Sasaki, Michiko; Katafuchi, Michitsuna; Mizumachi, Emiri; Sato, Hironobu
2014-01-01
Bone undergoes constant remodeling throughout life. The cellular and biochemical mechanisms of bone remodeling vary in a region-specific manner. There are a number of notable differences between the mandible and long bones, including developmental origin, osteogenic potential of mesenchymal stem cells, and the rate of bone turnover. Collagen, the most abundant matrix protein in bone, is responsible for determining the relative strength of particular bones. Posttranslational modifications of collagen, such as intermolecular crosslinking and lysine hydroxylation, are the most essential determinants of bone strength, although the amount of collagen is also important. In comparison to long bones, the mandible has greater collagen content, a lower amount of mature crosslinks, and a lower extent of lysine hydroxylation. The great abundance of immature crosslinks in mandibular collagen suggests that there is a lower rate of cross-link maturation. This means that mandibular collagen is relatively immature and thus more readily undergoes degradation and turnover. The greater rate of remodeling in mandibular collagen likely renders more flexibility to the bone and leaves it more suited to constant exercise. As reviewed here, it is important in clinical dentistry to understand the distinctive features of the bones of the jaw.
Directory of Open Access Journals (Sweden)
Takashi Matsuura
2014-01-01
Full Text Available Bone undergoes constant remodeling throughout life. The cellular and biochemical mechanisms of bone remodeling vary in a region-specific manner. There are a number of notable differences between the mandible and long bones, including developmental origin, osteogenic potential of mesenchymal stem cells, and the rate of bone turnover. Collagen, the most abundant matrix protein in bone, is responsible for determining the relative strength of particular bones. Posttranslational modifications of collagen, such as intermolecular crosslinking and lysine hydroxylation, are the most essential determinants of bone strength, although the amount of collagen is also important. In comparison to long bones, the mandible has greater collagen content, a lower amount of mature crosslinks, and a lower extent of lysine hydroxylation. The great abundance of immature crosslinks in mandibular collagen suggests that there is a lower rate of cross-link maturation. This means that mandibular collagen is relatively immature and thus more readily undergoes degradation and turnover. The greater rate of remodeling in mandibular collagen likely renders more flexibility to the bone and leaves it more suited to constant exercise. As reviewed here, it is important in clinical dentistry to understand the distinctive features of the bones of the jaw.
Immune responses to implanted human collagen graft in rats
International Nuclear Information System (INIS)
Quteish, D.; Dolby, A.E.
1991-01-01
Immunity to collagen implants may be mediated by cellular and humoral immune responses. To examine the possibility of such immunological reactivity and crossreactivity to collagen, 39 Sprague-Dawley rats (female, 10 weeks old, approximately 250 g wt) were implanted subcutaneously at thigh sites with crosslinked, freeze-dried human placental type I collagen grafts (4x4x2 mm) which had been irradiated (520 Gray) or left untreated. Blood was obtained by intracardiac sampling prior to implantation or from normal rats, and at various times afterwards when the animals were sacrificed. The sera from these animals were examined for circulating antibodies to human, bovine and rat tail (type I) collagens by enzyme-linked immunosorbent assay (ELISA). Also, the lymphoblastogenic responses of spleen lymphocytes from the irradiated collagen-implanted animals were assessed in culture by measuring thymidine uptake with autologous and normal rat sera in the presence of human bovine type I collagens. Implantation of the irradiated and non-irradiated collagen graft in rats led to a significant increase in the level of circulating antibodies to human collagen. Also antibody to bovine and rat tail collagens was detectable in the animals implanted with irradiated collagen grafts but at a lower level than the human collagen. There was a raised lymphoblastogenic response to both human and bovine collagens. The antibody level and lymphoblastogenesis to the tested collagens gradually decreased towards the end of the post-implantation period. (author)
Elevated Cardiac Troponin T in Patients With Skeletal Myopathies.
Schmid, Johannes; Liesinger, Laura; Birner-Gruenberger, Ruth; Stojakovic, Tatjana; Scharnagl, Hubert; Dieplinger, Benjamin; Asslaber, Martin; Radl, Roman; Beer, Meinrad; Polacin, Malgorzata; Mair, Johannes; Szolar, Dieter; Berghold, Andrea; Quasthoff, Stefan; Binder, Josepha S; Rainer, Peter P
2018-04-10
Cardiac troponins are often elevated in patients with skeletal muscle disease who have no evidence of cardiac disease. The goal of this study was to characterize cardiac troponin concentrations in patients with myopathies and derive insights regarding the source of elevated troponin T measurements. Cardiac troponin T (cTnT) and cardiac troponin I (cTnI) concentrations were determined by using high sensitivity assays in 74 patients with hereditary and acquired skeletal myopathies. Patients underwent comprehensive cardiac evaluation, including 12-lead electrocardiogram, 24-h electrocardiogram, cardiac magnetic resonance imaging, and coronary artery computed tomography. cTnT and cTnI protein expression was determined in skeletal muscle samples of 9 patients and in control tissues derived from autopsy using antibodies that are used in commercial assays. Relevant Western blot bands were subjected to liquid chromatography tandem mass spectrometry for protein identification. Levels of cTnT (median: 24 ng/l; interquartile range: 11 to 54 ng/l) were elevated (>14 ng/l) in 68.9% of patients; cTnI was elevated (>26 ng/l) in 4.1% of patients. Serum cTnT levels significantly correlated with creatine kinase and myoglobin (r = 0.679 and 0.786, respectively; both p < 0.001). Based on cTnT serial testing, 30.1% would have fulfilled current rule-in criteria for myocardial infarction. Noncoronary cardiac disease was present in 23%. Using cTnT antibodies, positive bands were found in both diseased and healthy skeletal muscle at molecular weights approximately 5 kDa below cTnT. Liquid chromatography tandem mass spectrometry identified the presence of skeletal troponin T isoforms in these bands. Measured cTnT concentrations were chronically elevated in the majority of patients with skeletal myopathies, whereas cTnI elevation was rare. Our data indicate that cross-reaction of the cTnT immunoassay with skeletal muscle troponin isoforms was the likely cause. Copyright © 2018 The
Satoh, Minoru; Tanaka, Shin; Ceribelli, Angela; Calise, S. John; Chan, Edward K. L.
2018-01-01
Autoantibodies specific for idiopathic inflammatory myopathy (myositis-specific autoantibodies (MSAs)) are clinically useful biomarkers to help the diagnosis of polymyositis/dermatomyositis (PM/DM). Many of these are also associated with a unique clinical subset of PM/DM, making them useful in predicting and monitoring certain clinical manifestations. Classic MSAs known for over 30 years include antibodies to Jo-1 (histidyl transfer RNA (tRNA) synthetase) and other aminoacyl tRNA synthetases (ARS), anti-Mi-2, and anti-signal recognition particle (SRP). Anti-Jo-1 is the first autoantibodies to ARS detected in 15–25 % of patients. In addition to anti-Jo-1, antibodies to seven other aminoacyl tRNA synthetases (ARS) have been reported with prevalence, usually 1–5 % or lower. Patients with any antiARS antibodies are associated with anti-synthetase syndrome characterized by myositis, interstitial lung disease (ILD), arthritis, Raynaud’s phenomenon, and others. Several recent studies suggested heterogeneity in clinical features among different anti-ARS antibody-positive patients and anti-ARS may also be found in idiopathic ILD without myositis. Anti-Mi-2 is a classic marker for DM and associated with good response to steroid treatment and good prognosis. Anti-SRP is specific for PM and associated with treatment-resistant myopathy histologically characterized as necrotizing myopathy. In addition to classic MSAs, several new autoantibodies with strong clinical significance have been described in DM. Antibodies to transcription intermediary factor 1γ/α (TIF1γ/α, p155/140) are frequently found in DM associated with malignancy while anti-melanoma differentiation-associated gene 5 (MDA5; CADM140) are associated with clinically amyopathic DM (CADM) complicated by rapidly progressive ILD. Also, anti-MJ/nuclear matrix protein 2 (NXP-2) and anti-small ubiquitin-like modifier-1 (SUMO-1) activating enzyme (SAE) are recognized as new DM-specific autoantibodies. Addition of
Energy Technology Data Exchange (ETDEWEB)
Wolf, M. [Universitaetsklinikum Heidelberg, Abteilung fuer Neuroradiologie, Heidelberg (Germany); Wolf, C. [Reha-Zentrum Gernsbach, Neurologie, Gernsbach (Germany); Weber, M.A. [Universitaetsklinikum Heidelberg, Abteilung fuer Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)
2017-12-15
Neurogenic myopathies are primary diseases of the nervous system, which secondarily result in denervation of the target musculature. The spectrum of potential causes is manifold ranging from acute traumatic injuries and chronic compression to neurodegenerative, inflammatory, metabolic and neoplastic processes. The medical history, clinical neurological examination, and electrophysiological tests including electromyography and nerve conduction studies are crucial in diagnosing neuropathic myopathies. Electromyography is the gold standard for diagnosing muscle denervation. Additional imaging methods and magnetic resonance imaging (MRI) in particular, are capable of contributing valuable information. The MRI examination of denervated musculature shows edema, an increase in the apparent diffusion coefficient (ADC) and hyperperfusion. Chronic denervation results in fatty degeneration and atrophy of affected muscles, which are also detectable by MRI. Although the MRI findings in muscle denervation are relatively unspecific, they show a high sensitivity, comparable to electromyography. Dedicated MR neurography may often visualize the underlying lesion(s) of the innervating nerve(s). Besides high sensitivity, comparable to electromyography, MRI is capable of evaluating muscles which are inaccessible for needle electromyography. Due to its non-invasive character, MRI is ideal for follow-up examinations. The use of MRI is often a meaningful addition to the diagnostics of neurogenic myopathies. The extent and distribution pattern of muscular alterations often provide information on the localization of the causative nerve damage. A correct diagnosis or at least a narrowing down of possible differential diagnoses can often be achieved using MRI. (orig.) [German] Neurogene Myopathien sind Erkrankungen des Nervensystems, die sekundaer zur Denervierung der Zielmuskulatur fuehren. Das Spektrum potenzieller Ursachen ist vielfaeltig und umfasst akute traumatische Verletzungen
[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].
Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong
2014-10-18
To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in
Directory of Open Access Journals (Sweden)
Andriy V. Shatillo
2014-12-01
Full Text Available Background: Limb girdle muscular dystrophies (LGMDs and several other disorders which share their specific phenotype are rare, predominantly hereditary conditions with no curative treatment. Differential diagnosis of these myopathies is quite challenging and expensive in many cases. Therefore, a significant proportion of patients remains undiagnosed and untreated for a long time. At the same time there is a huge amount of drugs and supplements potentially able to modify the course of some of these muscular dystrophies. That is why a simple empirical approach able to define a patient’s reaction to a specific compound seems rational. Because most common basic pathogenetic mechanisms for these quite different disorders increase the vulnerability of muscle cells (or decrease ability for reparation during mechanical stress, we propose a simple, noninvasive and inexpensive approach for individualized drug screening based on the drug’s influence on the mechanical vulnerability of peripheral blood mononuclear cells (PBMC. Methods: PBMC derived from 8 patients with Duchenne muscular dystrophy (DMD, 2 patients with LGMD2A, 1 patient with LGMD2B, 1 with MERRF syndrome, 1 with facioscapulohumeral muscular dystrophy (FSHD and 13 matched control subjects were irradiated by ultrasound in the presence of several compounds (lisinopril, vitamin D3, prednisolon, tocopherol, topiramate, glutargin, α-lipoic acid, essentiale, and physiological solution. Then viability indexes of the samples were detected by citotoxic assays based on vital dye (neutral red and resazurin metabolism. Results: In cytotoxicity tests with active transport of neutral red into PBMC derived from DMD patients, the cells showed signs of destruction at 1.06±0.52 minutes of ultrasounding compared to 1.75±0.6 minutes in control. PBMCs from patients with other myopathies have either normal or decreased resistance to ultrasound. The addition of tocopherol significantly changes the PBMC
Study of collagen metabolism after β radiation injury
International Nuclear Information System (INIS)
Zhou Yinghui; Xulan; Wu Shiliang; Zhang Xueguang; Chen Liesong
2000-01-01
Objective: To investigate the change of collagen metabolism and it's regulation after β radiation. Method: The animal model of β radiation injury was established by the β radiation produced by the linear accelerator; and irradiated NIH 3T3 cells were studied. In the experiment the contents of total collagen, collagen type I and type III were measured. The activity of MMPs-1 was tested. The contents of TGF-β 1 , IL-6 were also detected. Results: After exposure to β radiation, little change was found in the content of total collagen, but the content of collagen I decreased and the content of collagen III, MMPs-1 activity increased; the expression of TGF-β 1 , IL-6 increased. Conclusion: The changes in the metabolism of collagen play an important role in the irradiated injury of the skin; TGF-β 1 and IL-6 may be essential in the regulation of the collagen metabolism
Huber, AM; Feldman, BM; Rennebohm, RM; Hicks, JE; Lindsley, CB; Perez, MD; Zemel, LS; Wallace, CA; Ballinger, SH; Passo, MH; Reed, AM; Summers, RM; Katona, IM; Miller, FW; Lachenbruch, PA; Rider, LG; White, P.H.
Objective. To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. Methods. One hundred eight children with
Immunosuppression by fractionated total lymphoid irradiation in collagen arthritis
International Nuclear Information System (INIS)
McCune, W.J.; Buckley, J.A.; Belli, J.A.; Trentham, D.E.
1982-01-01
Treatments with fractionated total lymphoid irradiation (TLI) and cyclophosphamide were evaluated for rats injected with type II collagen. Preadministration of TLI and repeated injections of cyclophosphamide suppressed the severity of arthritis and lowered antibody titers to collagen significantly. TLI initiated at the onset of collagen arthritis decreased humoral and cellular responses to collagen but did not affect the severity of arthritis. These data demonstrate that both TLi and cyclophosphamide are immunosuppressive in an experimentally inducible autoimmune disease
Measurement of skeletal muscle collagen breakdown by microdialysis
DEFF Research Database (Denmark)
Miller, B F; Ellis, D; Robinson, M M
2011-01-01
Exercise increases the synthesis of collagen in the extracellular matrix of skeletal muscle. Breakdown of skeletal muscle collagen has not yet been determined because of technical limitations. The purpose of the present study was to use local sampling to determine skeletal muscle collagen breakdown...... collagen breakdown 17–21 h post-exercise, and our measurement of OHP using GC–MS was in agreement with traditional assays....
Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.
Momma, Kazunari; Noguchi, Satoru; Malicdan, May Christine V; Hayashi, Yukiko K; Minami, Narihiro; Kamakura, Keiko; Nonaka, Ikuya; Nishino, Ichizo
2012-01-01
Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.
Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.
Directory of Open Access Journals (Sweden)
Kazunari Momma
Full Text Available Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.
Insulin Resistance and Increased Muscle Cytokine Levels in Patients With Mitochondrial Myopathy
DEFF Research Database (Denmark)
Rue, Nana; Vissing, John; Galbo, Henrik
2014-01-01
CONTEXT: Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. OBJECTIVE: The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. DESIGN......: The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. MAIN OUTCOME MEASURES: Glucose infusion rate during 90-120 minutes of insulin infusion...... was measured. Cytokine concentrations in dialysate were also measured. RESULTS: Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P insulin, C-peptide, and glucagon were higher...
Exertional myopathy in a grizzly bear (Ursus arctos) captured by leghold snare.
Cattet, Marc; Stenhouse, Gordon; Bollinger, Trent
2008-10-01
We diagnosed exertional myopathy (EM) in a grizzly bear (Ursus arctos) that died approximately 10 days after capture by leghold snare in west-central Alberta, Canada, in June 2003. The diagnosis was based on history, post-capture movement data, gross necropsy, histopathology, and serum enzyme levels. We were unable to determine whether EM was the primary cause of death because autolysis precluded accurate evaluation of all tissues. Nevertheless, comparison of serum aspartate aminotransferase and creatine kinase concentrations and survival between the affected bear and other grizzly bears captured by leghold snare in the same research project suggests EM also occurred in other bears, but that it is not generally a cause of mortality. We propose, however, occurrence of nonfatal EM in grizzly bears after capture by leghold snare has potential implications for use of this capture method, including negative effects on wildlife welfare and research data.
X-linked Myotubular Myopathy with a Novel MTM1 Mutation in a Taiwanese Child
Directory of Open Access Journals (Sweden)
Chia-Ying Chang
2008-12-01
Full Text Available We report a male, preterm newborn infant with X-linked myotubular myopathy, the most severe type of the disease. He presented at birth with generalized hypotonia, difficulty in swallowing, and respiratory distress with frequent episodes of atelectasis. The infant had a long thin face, generalized hypotonia, and arachnodactyly. Diagnosis was based on fetal history, muscle histopathology, electron microscopy and a genetic study. A base pair change was detected in exon 11 of the MTM1 gene: c.1160C > A, which caused an amino acid change, p.S387Y. The father's gene was normal but the mother had the same mutation as her son and was thus a carrier.
Nakamura, R K; Russell, N J; Shelton, G D
2012-06-01
A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.
Directory of Open Access Journals (Sweden)
Rivkees ScottA
2010-08-01
Full Text Available We describe acute myopathy following I-131 treatment for hyperthyroidism due to Graves Disease (GD in an adolescent. A 15 year-old diagnosed with GD required treatment with radioactive iodine (I-131 therapy. Six weeks post I-131, he developed generalized muscle cramps. The CK was 19.800 U/L, the total thyroxine was 2.3 mcg/dL (29.6 nmol/L SI and the estimated free thyroxine (EFT was 0.5 ng/dL (6.4 pmol/L SI. The ALT was 112 U/L and AST was 364 U/L (normal
Two families with MYH7 distal myopathy associated with cardiomyopathy and core formations.
Naddaf, Elie; Waclawik, Andrew J
2015-03-01
Laing distal myopathy is caused by MYH7 gene mutations. Multiple families have been reported with varying patterns of skeletal and cardiac involvement as well as histopathological findings. We report 2 families with p.Glu1508del mutation with detailed electrophysiological and muscle pathology findings. All patients displayed the classic phenotype with weakness starting in the anterior compartment of the legs with a "hanging great toe." It was followed by finger extensors involvement, relatively sparing the extensor indicis proprius, giving the appearance of a "pointing index" finger. All the affected individuals had a dilated cardiomyopathy and core formations on muscle biopsy. Unexpectedly, neurogenic changes were also observed in some individuals. Both families were initially misdiagnosed with either central core disease or hereditary neuropathy. Recognizing the classic phenotype, screening for cardiac involvement that may be clinically silent, and determining the mode of inheritance help with selecting the appropriate genetic test.
X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.
Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H
1990-05-01
We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable to sublocalise the XLMTM locus further within the Xq28 region. This evidence for an Xq28 localisation may allow us to carry out useful genetic counselling within such families.
Lorenzoni, Paulo José; Werneck, Lineu Cesar; Kay, Cláudia Suemi Kamoi; Silvado, Carlos Eduardo Soares; Scola, Rosana Herminia
2015-11-01
Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) is a rare mitochondrial disorder. Diagnostic criteria for MELAS include typical manifestations of the disease: stroke-like episodes, encephalopathy, evidence of mitochondrial dysfunction (laboratorial or histological) and known mitochondrial DNA gene mutations. Clinical features of MELAS are not necessarily uniform in the early stages of the disease, and correlations between clinical manifestations and physiopathology have not been fully elucidated. It is estimated that point mutations in the tRNALeu(UUR) gene of the DNAmt, mainly A3243G, are responsible for more of 80% of MELAS cases. Morphological changes seen upon muscle biopsy in MELAS include a substantive proportion of ragged red fibers (RRF) and the presence of vessels with a strong reaction for succinate dehydrogenase. In this review, we discuss mainly diagnostic criterion, clinical and laboratory manifestations, brain images, histology and molecular findings as well as some differential diagnoses and current treatments.
Collagen gene interactions and endurance running performance
African Journals Online (AJOL)
to complete any of the individual components (3.8 km swim, 180 km bike or 42.2 km run) of the 226 km event. The major ... may affect normal collagen fibrillogenesis and alter the mechanical properties of ... using a XP Thermal Cycler (Block model XP-G, BIOER Technology Co.,. Japan). ..... New insights into the function of.
The collagenic architecture of human dura mater.
Protasoni, Marina; Sangiorgi, Simone; Cividini, Andrea; Culuvaris, Gloria Tiffany; Tomei, Giustino; Dell'Orbo, Carlo; Raspanti, Mario; Balbi, Sergio; Reguzzoni, Marcella
2011-06-01
Human dura mater is the most external meningeal sheet surrounding the CNS. It provides an efficient protection to intracranial structures and represents the most important site for CSF turnover. Its intrinsic architecture is made up of fibrous tissue including collagenic and elastic fibers that guarantee the maintenance of its biophysical features. The recent technical advances in the repair of dural defects have allowed for the creation of many synthetic and biological grafts. However, no detailed studies on the 3D microscopic disposition of collagenic fibers in dura mater are available. The authors report on the collagenic 3D architecture of normal dura mater highlighting the orientation, disposition in 3 dimensions, and shape of the collagen fibers with respect to the observed layer. Thirty-two dura mater specimens were collected during cranial decompressive surgical procedures, fixed in 2.5% Karnovsky solution, and digested in 1 N NaOH solution. After a routine procedure, the specimens were observed using a scanning electron microscope. The authors distinguished the following 5 layers in the fibrous dura mater of varying thicknesses, orientation, and structures: bone surface, external median, vascular, internal median, and arachnoid layers. The description of the ultrastructural 3D organization of the different layers of dura mater will give us more information for the creation of synthetic grafts that are as similar as possible to normal dura mater. This description will be also related to the study of the neoplastic invasion.
Edaravone suppresses degradation of type II collagen.
Huang, Chen; Liao, Guangjun; Han, Jian; Zhang, Guofeng; Zou, Benguo
2016-05-13
Osteoarthritis (OA) is a degenerative joint disease affecting millions of people. The degradation and loss of type II collagen induced by proinflammatory cytokines secreted by chondrocytes, such as factor-α (TNF-α) is an important pathological mechanism to the progression of OA. Edaravone is a potent free radical scavenger, which has been clinically used to treat the neuronal damage following acute ischemic stroke. However, whether Edaravone has a protective effect in articular cartilage hasn't been reported before. In this study, we investigated the chondrocyte protective effects of Edaravone on TNF-α induced degradation of type Ⅱ collagen. And our results indicated that TNF-α treatment resulted in degradation of type Ⅱ collagen, which can be ameliorated by treatment with Edaravone in a dose dependent manner. Notably, it was found that the inhibitory effects of Edaravone on TNF-α-induced reduction of type Ⅱ collagen were mediated by MMP-3 and MMP-13. Mechanistically, we found that Edaravone alleviated TNF-α induced activation of STAT1 and expression of IRF-1. These findings suggest a potential protective effect of Edaravone in OA. Copyright © 2016. Published by Elsevier Inc.
Multiscale structure and mechanics of collagen
Amuasi, H.E.
2012-01-01
While we are 70% water, in a very real sense collagen is the stuff we are made of. It is the most abundant protein in multicellular organisms, such as ourselves, making up roughly 25% of our total protein content. If you have ever wondered how the human body holds together all its different parts in
Peroxidase enzymes regulate collagen extracellular matrix biosynthesis.
DeNichilo, Mark O; Panagopoulos, Vasilios; Rayner, Timothy E; Borowicz, Romana A; Greenwood, John E; Evdokiou, Andreas
2015-05-01
Myeloperoxidase and eosinophil peroxidase are heme-containing enzymes often physically associated with fibrotic tissue and cancer in various organs, without any direct involvement in promoting fibroblast recruitment and extracellular matrix (ECM) biosynthesis at these sites. We report herein novel findings that show peroxidase enzymes possess a well-conserved profibrogenic capacity to stimulate the migration of fibroblastic cells and promote their ability to secrete collagenous proteins to generate a functional ECM both in vitro and in vivo. Mechanistic studies conducted using cultured fibroblasts show that these cells are capable of rapidly binding and internalizing both myeloperoxidase and eosinophil peroxidase. Peroxidase enzymes stimulate collagen biosynthesis at a post-translational level in a prolyl 4-hydroxylase-dependent manner that does not require ascorbic acid. This response was blocked by the irreversible myeloperoxidase inhibitor 4-amino-benzoic acid hydrazide, indicating peroxidase catalytic activity is essential for collagen biosynthesis. These results suggest that peroxidase enzymes, such as myeloperoxidase and eosinophil peroxidase, may play a fundamental role in regulating the recruitment of fibroblast and the biosynthesis of collagen ECM at sites of normal tissue repair and fibrosis, with enormous implications for many disease states where infiltrating inflammatory cells deposit peroxidases. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Reduced collagen accumulation after major surgery
DEFF Research Database (Denmark)
Jorgensen, L N; Kallehave, F; Karlsmark, T
1996-01-01
.01)). This decline was significantly higher in the six patients who had a postoperative infection (median 3.02 (range -0.06 to 6.14) versus 0.36 (range -1.56 to 12.60) micrograms/cm, P = 0.02). This study shows that major surgery is associated with impairment of subcutaneous collagen accumulation in a test wound...
Immunoadsorption for collagen and rheumatic diseases.
Yamaji, Ken
2017-10-01
The field of therapeutics has seen remarkable progress in the recent years, which has made mainstream drug treatment possible for collagen and rheumatic diseases. However, treatment of intractable cases where drug effectiveness is poor is a challenge. Furthermore, organ damage, concurrent illnesses or allergic reactions make adequate drug therapy impossible. For such cases, therapeutic apheresis is very significant, and it is important how this should be valued related to drug therapies. Therapeutic apheresis for collagen and rheumatic diseases involves the removal of factors that cause and exacerbate the disease; the aim of immunoadsorption, in particular, is to improve the clinical condition of patients with autoimmune disease by selectively removing pathogenic immune complexes and autoantibodies from their plasma. Immunoadsorption, in particular, unlike plasma exchange and DFPP, utilizes a high-affinity column that selectively removes autoantibodies and immune complexes, leaving other plasma components intact. There is no need to replenish fresh frozen plasma or blood products such as albumin and gamma globulin preparations. Immunoadsorption is thus superior in terms of safety, as the risk of infection or allergic reaction relating to these preparations can be avoided. We anticipate future investigations of application of synchronized therapy using drugs and therapeutic apheresis, most notably immunoadsorption, in combination to treat intractable clinical conditions such as collagen and rheumatic diseases. In this paper, our discussion includes the indications for immunoadsorption such as collagen and rheumatic diseases, the relevant conditions and types, as well as the latest understanding related to methods and clinical efficacy. Copyright © 2017 Elsevier Ltd. All rights reserved.
Controlled self assembly of collagen nanoparticle
Papi, Massimiliano; Palmieri, Valentina; Maulucci, Giuseppe; Arcovito, Giuseppe; Greco, Emanuela; Quintiliani, Gianluca; Fraziano, Maurizio; De Spirito, Marco
2011-11-01
In recent years carrier-mediated drug delivery has emerged as a powerful methodology for the treatment of various pathologies. The therapeutic index of traditional and novel drugs is enhanced via the increase of specificity due to targeting of drugs to a particular tissue, cell or intracellular compartment, the control over release kinetics, the protection of the active agent, or a combination of the above. Collagen is an important biomaterial in medical applications and ideal as protein-based drug delivery platform due to its special characteristics, such as biocompatibility, low toxicity, biodegradability, and weak antigenicity. While some many attempts have been made, further work is needed to produce fully biocompatible collagen hydrogels of desired size and able to release drugs on a specific target. In this article we propose a novel method to obtain spherical particles made of polymerized collagen surrounded by DMPC liposomes. The liposomes allow to control both the particles dimension and the gelling environment during the collagen polymerization. Furthermore, an optical based method to visualize and quantify each step of the proposed protocol is detailed and discussed.
Collagen-induced arthritis in mice
Bevaart, Lisette; Vervoordeldonk, Margriet J.; Tak, Paul P.
2010-01-01
Collagen-induced arthritis (CIA) in mice is an animal model for rheumatoid arthritis (RA) and can be induced in DBA/1 and C57BL/6 mice using different protocols. The CIA model can be used to unravel mechanisms involved in the development of arthritis and is frequently used to study the effect of new
The degree of collagen crosslinks in medical collagen membranes determined by water absorption
International Nuclear Information System (INIS)
Braczko, M.; Tederko, A.; Grzybowski, J.
1994-01-01
Collagen membranes were crosslinked by using three agents: glutaraldehyde, hexametylenediisocyanate, and UV irradiation. The increasing concentrations of above chemical agents or longer time of UV exposition resulted in the higher cross-links degree and in the decrease of collagen membranes swelling (measured as water absorption), their elasticity and mechanical resistance. According to American standards, the degree of collagen biomaterial cross-links is determined by measuring of the digestion time by pepsin. However, that method is very time-consuming. In our study, we have that a simple, linear regression between logarithm of digestion time by pepsin exists and it was identical for all three cross-linking agents used. We have concluded that determination of water absorption can be an alternative, simple and fast method for examination of collagen membrane cross-links degree. (author). 16 refs, 7 figs, 1 tab
Corneal collagen crosslinking for keratoconus. A review
Directory of Open Access Journals (Sweden)
M. M. Bikbov
2014-10-01
Full Text Available Photochemical crosslinking is widely applied in ophthalmology. Its biochemical effect is due to the release of singlet oxygen that promotes anaerobic photochemical reaction. Keratoconus is one of the most common corneal ectasia affecting 1 in 250 to 250 000 persons. Currently, the rate of iatrogenic ectasia following eximer laser refractive surgery increases due to biomechanical weakening of the cornea. Morphologically and biochemically, ectasia is characterized by corneal layers thinning, contact between the stroma and epithelium resulting from Bowman’s membrane rupture, chromatin fragmentation in keratocyte nuclei, phagocytosis, abnormal staining and arrangement of collagen fibers, enzyme system disorders, and keratocyte apoptosis. In corneal ectasia, altered enzymatic processes result in the synthesis of abnormal collagen. Collagen packing is determined by the activity of various extracellular matrix enzymes which bind amines and aldehydes of collagen fiber amino acids. In the late stage, morphological changes of Descemet’s membrane (i.e., rupture and detachment develop. Abnormal hexagonal-shaped keratocytes and their apoptosis are the signs of endothelial dystrophy. The lack of analogs in domestic ophthalmology encouraged the scientists of Ufa Eye Research Institute to develop a device for corneal collagen crosslinking. The parameters of ultraviolet (i.e., wavelength, exposure time, power to achieve the desired effect were identified. The specifics of some photosensitizers in the course of the procedure were studied. UFalink, a device for UV irradiation of cornea, and photosensitizer Dextralink were developed and adopted. Due to the high risk of endothelial damage, this treatment is contraindicated in severe keratoconus (CCT less than 400 microns. Major effects of corneal collagen crosslinking are the following: Young’s modulus (modulus of elasticity increase by 328.9 % (on average, temperature tolerance increase by 5
Directory of Open Access Journals (Sweden)
Teet Seene
2016-05-01
Full Text Available Muscle weakness in corticosteroid myopathy is mainly the result of the destruction and atrophy of the myofibrillar compartment of fast-twitch muscle fibers. Decrease of titin and myosin, and the ratio of nebulin and MyHC in myopathic muscle, shows that these changes of contractile and elastic proteins are the result of increased catabolism of the abovementioned proteins in skeletal muscle. Slow regeneration of skeletal muscle is in good correlation with a decreased number of satellite cells under the basal lamina of muscle fibers. Aging causes a reduction of AMP-activated protein kinase (AMPK activity as the result of the reduced function of the mitochondrial compartment. AMPK activity increases as a result of increased functional activity. Resistance exercise causes anabolic and anticatabolic effects in skeletal muscle: muscle fibers experience hypertrophy while higher myofibrillar proteins turn over. These changes are leading to the qualitative remodeling of muscle fibers. As a result of these changes, possible maximal muscle strength is increasing. Endurance exercise improves capillary blood supply, increases mitochondrial biogenesis and muscle oxidative capacity, and causes a faster turnover rate of sarcoplasmic proteins as well as qualitative remodeling of type I and IIA muscle fibers. The combination of resistance and endurance exercise may be the fastest way to prevent or decelerate muscle atrophy due to the anabolic and anticatabolic effects of exercise combined with an increase in oxidative capacity. The aim of the present short review is to assess the role of myofibrillar protein catabolism in the development of glucocorticoid-caused myopathy from aging and physical activity aspects.
Directory of Open Access Journals (Sweden)
Hazem Akkad
Full Text Available Critical illness myopathy (CIM is a debilitating common consequence of modern intensive care, characterized by severe muscle wasting, weakness and a decreased myosin/actin (M/A ratio. Limb/trunk muscles are primarily affected by this myopathy while cranial nerve innervated muscles are spared or less affected, but the mechanisms underlying these muscle-specific differences remain unknown. In this time-resolved study, the cranial nerve innervated masseter muscle was studied in a unique experimental rat intensive care unit (ICU model, where animals were exposed to sedation, neuromuscular blockade (NMB, mechanical ventilation, and immobilization for durations varying between 6 h and 14d. Gel electrophoresis, immunoblotting, RT-PCR and morphological staining techniques were used to analyze M/A ratios, myofiber size, synthesis and degradation of myofibrillar proteins, and levels of heat shock proteins (HSPs. Results obtained in the masseter muscle were compared with previous observations in experimental and clinical studies of limb muscles. Significant muscle-specific differences were observed, i.e., in the masseter, the decline in M/A ratio and muscle fiber size was small and delayed. Furthermore, transcriptional regulation of myosin and actin synthesis was maintained, and Akt phosphorylation was only briefly reduced. In studied degradation pathways, only mRNA, but not protein levels of MuRF1, atrogin-1 and the autophagy marker LC3b were activated by the ICU condition. The matrix metalloproteinase MMP-2 was inhibited and protective HSPs were up-regulated early. These results confirm that the cranial nerve innervated masticatory muscles is less affected by the ICU-stress response than limb muscles, in accordance with clinical observation in ICU patients with CIM, supporting the model' credibility as a valid CIM model.
Mutations in the satellite cell gene MEGF10 cause a recessive congenital myopathy with minicores.
Boyden, Steven E; Mahoney, Lane J; Kawahara, Genri; Myers, Jennifer A; Mitsuhashi, Satomi; Estrella, Elicia A; Duncan, Anna R; Dey, Friederike; DeChene, Elizabeth T; Blasko-Goehringer, Jessica M; Bönnemann, Carsten G; Darras, Basil T; Mendell, Jerry R; Lidov, Hart G W; Nishino, Ichizo; Beggs, Alan H; Kunkel, Louis M; Kang, Peter B
2012-05-01
We ascertained a nuclear family in which three of four siblings were affected with an unclassified autosomal recessive myopathy characterized by severe weakness, respiratory impairment, scoliosis, joint contractures, and an unusual combination of dystrophic and myopathic features on muscle biopsy. Whole genome sequence from one affected subject was filtered using linkage data and variant databases. A single gene, MEGF10, contained nonsynonymous mutations that co-segregated with the phenotype. Affected subjects were compound heterozygous for missense mutations c.976T > C (p.C326R) and c.2320T > C (p.C774R). Screening the MEGF10 open reading frame in 190 patients with genetically unexplained myopathies revealed a heterozygous mutation, c.211C > T (p.R71W), in one additional subject with a similar clinical and histological presentation as the discovery family. All three mutations were absent from at least 645 genotyped unaffected control subjects. MEGF10 contains 17 atypical epidermal growth factor-like domains, each of which contains eight cysteine residues that likely form disulfide bonds. Both the p.C326R and p.C774R mutations alter one of these residues, which are completely conserved in vertebrates. Previous work showed that murine Megf10 is required for preserving the undifferentiated, proliferative potential of satellite cells, myogenic precursors that regenerate skeletal muscle in response to injury or disease. Here, knockdown of megf10 in zebrafish by four different morpholinos resulted in abnormal phenotypes including unhatched eggs, curved tails, impaired motility, and disorganized muscle tissue, corroborating the pathogenicity of the human mutations. Our data establish the importance of MEGF10 in human skeletal muscle and suggest satellite cell dysfunction as a novel myopathic mechanism.
... OII) Timed Up & Go (TUG) Western Ontario & McMaster Universities Osteoarthritis Index (WOMAC) Young Investigators Resources for Doctoral Students/Post-Doctoral Fellows Evidence-Based Practice for Academic Researchers Responsible Data Management in Research Career Planning Treatments Patient ...
... these disorders and to find ways to effectively treat, prevent, or potentially cure them. Information from the National Library of Medicine’s MedlinePlus ... neuromuscular diseases caused by damage to the mitochondria—small, energy-producing structures that serve as the cells' "power plants." Nerve cells in the brain and muscles ...
... National Institutes of Health, the leading supporter of biomedical research in the world. The NINDS, along with other ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research
... Institutes of Health (NIH), the leading supporter of biomedical research in the world. In conjunction with other NIH ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research
... noting “soft signs” in unaffected relatives. These include deaf- ness, short stature, migraine headaches and PEO. Muscle ... mitochondrial defects and provide valuable information for family planning. Perhaps most important, knowing the genetic defects that ...
... potassium levels (known as periodic paralysis). View Full Definition Treatment Treatment involves restoring normal levels of thyroid hormone and may include thyroid drugs, radioactive iodine, and sometimes partial or complete surgical ...
Collagen derived serum markers in carcinoma of the prostate
DEFF Research Database (Denmark)
Rudnicki, M; Jensen, L T; Iversen, P
1995-01-01
Three new collagen markers deriving from the collagenous matrix, e.g. carboxyterminal propeptide of type I procollagen (PICP), carboxy-terminal pyridinoline cross-linked telopeptide of type I collagen (ICTP), and aminoterminal propeptide of type III procollagen (PIIINP) were used for the diagnose...
Collagen targeting using multivalent protein-functionalized dendrimers
Breurken, M.; Lempens, E.H.M.; Temming, R.P.; Helms, B.A.; Meijer, E.W.; Merkx, M.
2011-01-01
Collagen is an attractive marker for tissue remodeling in a variety of common disease processes. Here we report the preparation of protein dendrimers as multivalent collagen targeting ligands by native chemical ligation of the collagen binding protein CNA35 to cysteine-functionalized dendritic
Molecular crowding of collagen: a pathway to produce highly-organized collagenous structures.
Saeidi, Nima; Karmelek, Kathryn P; Paten, Jeffrey A; Zareian, Ramin; DiMasi, Elaine; Ruberti, Jeffrey W
2012-10-01
Collagen in vertebrate animals is often arranged in alternating lamellae or in bundles of aligned fibrils which are designed to withstand in vivo mechanical loads. The formation of these organized structures is thought to result from a complex, large-area integration of individual cell motion and locally-controlled synthesis of fibrillar arrays via cell-surface fibripositors (direct matrix printing). The difficulty of reproducing such a process in vitro has prevented tissue engineers from constructing clinically useful load-bearing connective tissue directly from collagen. However, we and others have taken the view that long-range organizational information is potentially encoded into the structure of the collagen molecule itself, allowing the control of fibril organization to extend far from cell (or bounding) surfaces. We here demonstrate a simple, fast, cell-free method capable of producing highly-organized, anistropic collagen fibrillar lamellae de novo which persist over relatively long-distances (tens to hundreds of microns). Our approach to nanoscale organizational control takes advantage of the intrinsic physiochemical properties of collagen molecules by inducing collagen association through molecular crowding and geometric confinement. To mimic biological tissues which comprise planar, aligned collagen lamellae (e.g. cornea, lamellar bone or annulus fibrosus), type I collagen was confined to a thin, planar geometry, concentrated through molecular crowding and polymerized. The resulting fibrillar lamellae show a striking resemblance to native load-bearing lamellae in that the fibrils are small, generally aligned in the plane of the confining space and change direction en masse throughout the thickness of the construct. The process of organizational control is consistent with embryonic development where the bounded planar cell sheets produced by fibroblasts suggest a similar confinement/concentration strategy. Such a simple approach to nanoscale
DEFF Research Database (Denmark)
Engelholm, Lars H; List, Karin; Netzel-Arnett, Sarah
2003-01-01
The uptake and lysosomal degradation of collagen by fibroblasts constitute a major pathway in the turnover of connective tissue. However, the molecular mechanisms governing this pathway are poorly understood. Here, we show that the urokinase plasminogen activator receptor-associated protein (u......, these cells had diminished initial adhesion to a range of different collagens, as well as impaired migration on fibrillar collagen. These studies identify a central function of uPARAP/Endo180 in cellular collagen interactions....
1986-01-01
The tissue distribution of type II and type IX collagen in 17-d-old chicken embryo was studied by immunofluorescence using polyclonal antibodies against type II collagen and a peptic fragment of type IX collagen (HMW), respectively. Both proteins were found only in cartilage where they were co-distributed. They occurred uniformly throughout the extracellular matrix, i.e., without distinction between pericellular, territorial, and interterritorial matrices. Tissues that undergo endochondral bo...
Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana
2016-02-01
TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.
Guy, R J; Kamm, M A; Martin, J E
1997-02-01
We report a case of a distinctive familial internal anal sphincter myopathy with unique histological and radiological features. A 67-year-old woman presented with a 20-year history of proctalgia fugax and outlet obstruction; other family members were similarly affected. Computed tomograpy and magnetic resonance imaging demonstrated a grossly hypertrophied internal anal sphincter. Strip myectomy of the sphincter was carried out with improvement in evacuation but little relief of proctalgia. Further relief of symptoms was obtained using oral and transdermal nitrates and a calcium antagonist. Histological examination of the excised muscle revealed hypertrophy and an abnormal arrangement of fibres in whorls; many fibres contained vacuoles with inclusion bodies positive for periodic acid-Schiff. This description of a specific anal sphincter myopathy illustrates the potential importance of histopathological studies of smooth muscle in functional disorders of the gut.
Yatabe, K; Kawai, M
1997-08-01
Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.
Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.
Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun
2015-06-01
We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.
Horstick, Eric J.; Linsley, Jeremy W.; Dowling, James J.; Hauser, Michael A.; McDonald, Kristin K.; Ashley-Koch, Allison; Saint-Amant, Louis; Satish, Akhila; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Stamm, Demetra S.; Powell, Cynthia M.; Speer, Marcy C.; Franzini-Armstrong, Clara; Hirata, Hiromi; Kuwada, John Y.
2013-01-01
Excitation-contraction coupling, the process that regulates contractions by skeletal muscles, transduces changes in membrane voltage by activating release of Ca2+ from internal stores to initiate muscle contraction. Defects in EC coupling are associated with muscle diseases. Here we identify Stac3 as a novel component of the EC coupling machinery. Using a zebrafish genetic screen, we generate a locomotor mutation that is mapped to stac3. We provide electrophysiological, Ca2+ imaging, immunocytochemical and biochemical evidence that Stac3 participates in excitation-contraction coupling in muscles. Furthermore, we reveal that a mutation in human STAC3 as the genetic basis of the debilitating Native American myopathy (NAM). Analysis of NAM stac3 in zebrafish shows that the NAM mutation decreases excitation-contraction coupling. These findings enhance our understanding of both excitation-contraction coupling and the pathology of myopathies. PMID:23736855
Study of collagen metabolism and regulation after β radiation injury
International Nuclear Information System (INIS)
Zhou Yinghui; Xu Lan; Wu Shiliang; Qiu Hao; Jiang Zhi; Tu Youbin; Zhang Xueguang
2001-01-01
The animal model of β radiation injury was established by the β radiation produced by the linear accelerator; and irradiated NIH 3T3 cells were studied. In the experiment the contents of total collagen, collagen type I and type III were measured. The activity of MMPs-1 were tested. The contents of TGF-β 1 , IL-6 were also detected. The results showed that after exposure to β radiation, little change was found in the content of total collagen, but the content of collagen I decreased and the content of collagen III, MMPs-1 activity increased; the expression of TGF-β 1 , IL-6 increased. The results suggest that changes in the metabolism of collagen play an important role in the irradiated injury of the skin; TGF-β 1 , IL-6 may be essential in the regulation of the collagen metabolism
Type V Collagen is Persistently Altered after Inguinal Hernia Repair
DEFF Research Database (Denmark)
Lorentzen, L; Henriksen, N A; Juhl, P
2018-01-01
BACKGROUND AND AIMS: Hernia formation is associated with alterations of collagen metabolism. Collagen synthesis and degradation cause a systemic release of products, which are measurable in serum. Recently, we reported changes in type V and IV collagen metabolisms in patients with inguinal...... elective cholecystectomy served as controls (n = 10). Whole venous blood was collected 35-55 months after operation. Biomarkers for type V collagen synthesis (Pro-C5) and degradation (C5M) and those for type IV collagen synthesis (P4NP) and degradation (C4M2) were measured by a solid-phase competitive...... assay. RESULTS: The turnover of type V collagen (Pro-C5/C5M) was slightly higher postoperatively when compared to preoperatively in the inguinal hernia group (P = 0.034). In addition, the results revealed a postoperatively lower type V collagen turnover level in the inguinal hernia group compared...
Demineralized dentin matrix composite collagen material for bone tissue regeneration.
Li, Jianan; Yang, Juan; Zhong, Xiaozhong; He, Fengrong; Wu, Xiongwen; Shen, Guanxin
2013-01-01
Demineralized dentin matrix (DDM) had been successfully used in clinics as bone repair biomaterial for many years. However, particle morphology of DDM limited it further applications. In this study, DDM and collagen were prepared to DDM composite collagen material. The surface morphology of the material was studied by scanning electron microscope (SEM). MC3T3-E1 cells responses in vitro and tissue responses in vivo by implantation of DDM composite collagen material in bone defect of rabbits were also investigated. SEM analysis showed that DDM composite collagen material evenly distributed and formed a porous scaffold. Cell culture and animal models results indicated that DDM composite collagen material was biocompatible and could support cell proliferation and differentiation. Histological evaluation showed that DDM composite collagen material exhibited good biocompatibility, biodegradability and osteoconductivity with host bone in vivo. The results suggested that DDM composite collagen material might have a significant clinical advantage and potential to be applied in bone and orthopedic surgery.
Study of collagen metabolism and regulation after {beta} radiation injury
Energy Technology Data Exchange (ETDEWEB)
Yinghui, Zhou; Lan, Xu; Shiliang, Wu; Hao, Qiu; Zhi, Jiang; Youbin, Tu; Xueguang, Zhang [Suzhou Medical College (China)
2001-04-01
The animal model of {beta} radiation injury was established by the {beta} radiation produced by the linear accelerator; and irradiated NIH 3T3 cells were studied. In the experiment the contents of total collagen, collagen type I and type III were measured. The activity of MMPs-1 were tested. The contents of TGF-{beta}{sub 1}, IL-6 were also detected. The results showed that after exposure to {beta} radiation, little change was found in the content of total collagen, but the content of collagen I decreased and the content of collagen III, MMPs-1 activity increased; the expression of TGF-{beta}{sub 1}, IL-6 increased. The results suggest that changes in the metabolism of collagen play an important role in the irradiated injury of the skin; TGF-{beta}{sub 1}, IL-6 may be essential in the regulation of the collagen metabolism.
Directory of Open Access Journals (Sweden)
Sara De Palma
Full Text Available This study identifies metabolic and protein phenotypic alterations in gastrocnemius, tibialis anterior and diaphragm muscles of Col6a1(-/- mice, a model of human collagen VI myopathies. All three muscles of Col6a1(-/- mice show some common changes in proteins involved in metabolism, resulting in decreased glycolysis and in changes of the TCA cycle fluxes. These changes lead to a different fate of α-ketoglutarate, with production of anabolic substrates in gastrocnemius and tibialis anterior, and with lipotoxicity in diaphragm. The metabolic changes are associated with changes of proteins involved in mechanotransduction at the myotendineous junction/costameric/sarcomeric level (TN-C, FAK, ROCK1, troponin I fast and in energy metabolism (aldolase, enolase 3, triose phosphate isomerase, creatine kinase, adenylate kinase 1, parvalbumin, IDH1 and FASN. Together, these change may explain Ca(2+ deregulation, impaired force development, increased muscle-relaxation-time and fiber damage found in the mouse model as well as in patients. The severity of these changes differs in the three muscles (gastrocnemius
LARP6 Meets Collagen mRNA: Specific Regulation of Type I Collagen Expression
Directory of Open Access Journals (Sweden)
Yujie Zhang
2016-03-01
Full Text Available Type I collagen is the most abundant structural protein in all vertebrates, but its constitutive rate of synthesis is low due to long half-life of the protein (60–70 days. However, several hundred fold increased production of type I collagen is often seen in reparative or reactive fibrosis. The mechanism which is responsible for this dramatic upregulation is complex, including multiple levels of regulation. However, posttranscriptional regulation evidently plays a predominant role. Posttranscriptional regulation comprises processing, transport, stabilization and translation of mRNAs and is executed by RNA binding proteins. There are about 800 RNA binding proteins, but only one, La ribonucleoprotein domain family member 6 (LARP6, is specifically involved in type I collagen regulation. In the 5′untranslated region (5’UTR of mRNAs encoding for type I and type III collagens there is an evolutionally conserved stem-loop (SL structure; this structure is not found in any other mRNA, including any other collagen mRNA. LARP6 binds to the 5′SL in sequence specific manner to regulate stability of collagen mRNAs and their translatability. Here, we will review current understanding of how is LARP6 involved in posttranscriptional regulation of collagen mRNAs. We will also discuss how other proteins recruited by LARP6, including nonmuscle myosin, vimentin, serine threonine kinase receptor associated protein (STRAP, 25 kD FK506 binding protein (FKBP25 and RNA helicase A (RHA, contribute to this process.
Ibdah, J A; Tein, I; Dionisi-Vici, C; Bennett, M J; IJlst, L; Gibson, B; Wanders, R J; Strauss, A W
1998-01-01
Human mitochondrial trifunctional protein (TFP) is a heterooctamer of four alpha- and four beta-subunits that catalyzes three steps in the beta-oxidation spiral of long-chain fatty acids. TFP deficiency causes a Reye-like syndrome, cardiomyopathy, or sudden, unexpected death. We delineated the molecular basis for TFP deficiency in two patients with a unique phenotype characterized by chronic progressive polyneuropathy and myopathy without hepatic or cardiac involvement. Single-stranded confor...
Córdova-Noboa, H A; Oviedo-Rondón, E O; Sarsour, A H; Barnes, J; Ferzola, P; Rademacher-Heilshorn, M; Braun, U
2018-04-13
One experiment was conducted to evaluate the effects of guanidinoacetic acid (GAA) supplementation in broilers fed corn or sorghum-based diets on live performance, carcass and cut up yields, meat quality, and pectoral myopathies. The treatments consisted of corn or sorghum-based diets with or without the addition of GAA (600 g/ton). A total of 800 one-d-old male Ross 708 broiler chicks were randomly placed in 40 floor pens with 10 replicates (20 birds per pen) per each of the four treatments. At hatch, 14, 35, and 50 d, BW and feed intake were recorded. BW gain and FCR were calculated at the end of each phase. Four broilers per pen were selected and slaughtered at 51d and 55d of age to determine carcass and cut up yields, meat quality and myopathies (spaghetti muscle, white striping, and wooden breast) severity in the Pectoralis major. Data were analyzed as a randomized complete block design in a 2 × 2 factorial arrangement with grain type and GAA supplementation as main effects. At 50 d, diets containing GAA improved (P broilers fed corn diets with GAA had higher breast meat yield (P 0.05) by GAA supplementation at any slaughter ages. However, GAA decreased (P broilers supplemented with GAA had double (P broilers fed non-supplemented diets, therefore reducing the severity of this myopathy. In conclusion, GAA supplementation improved broiler live performance in broilers raised up to 50 d independently of grain source, increased breast meat yield in corn-based diets and reduced the severity of wooden breast myopathy.
Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu
2015-01-01
Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.
Imaging collagen type I fibrillogenesis with high spatiotemporal resolution
International Nuclear Information System (INIS)
Stamov, Dimitar R; Stock, Erik; Franz, Clemens M; Jähnke, Torsten; Haschke, Heiko
2015-01-01
Fibrillar collagens, such as collagen type I, belong to the most abundant extracellular matrix proteins and they have received much attention over the last five decades due to their large interactome, complex hierarchical structure and high mechanical stability. Nevertheless, the collagen self-assembly process is still incompletely understood. Determining the real-time kinetics of collagen type I formation is therefore pivotal for better understanding of collagen type I structure and function, but visualising the dynamic self-assembly process of collagen I on the molecular scale requires imaging techniques offering high spatiotemporal resolution. Fast and high-speed scanning atomic force microscopes (AFM) provide the means to study such processes on the timescale of seconds under near-physiological conditions. In this study we have applied fast AFM tip scanning to study the assembly kinetics of fibrillar collagen type I nanomatrices with a temporal resolution reaching eight seconds for a frame size of 500 nm. By modifying the buffer composition and pH value, the kinetics of collagen fibrillogenesis can be adjusted for optimal analysis by fast AFM scanning. We furthermore show that amplitude-modulation imaging can be successfully applied to extract additional structural information from collagen samples even at high scan rates. Fast AFM scanning with controlled amplitude modulation therefore provides a versatile platform for studying dynamic collagen self-assembly processes at high resolution. - Highlights: • Continuous non-invasive time-lapse investigation of collagen I fibrillogenesis in situ. • Imaging of collagen I self-assembly with high spatiotemporal resolution. • Application of setpoint modulation to study the hierarchical structure of collagen I. • Observing real-time formation of the D-banding pattern in collagen I
Imaging collagen type I fibrillogenesis with high spatiotemporal resolution
Energy Technology Data Exchange (ETDEWEB)
Stamov, Dimitar R, E-mail: stamov@jpk.com [JPK Instruments AG, Bouchéstrasse 12, 12435 Berlin (Germany); Stock, Erik [JPK Instruments AG, Bouchéstrasse 12, 12435 Berlin (Germany); Franz, Clemens M [DFG-Center for Functional Nanostructures (CFN), Karlsruhe Institute of Technology (KIT), Wolfgang-Gaede-Strasse 1a, 76131 Karlsruhe (Germany); Jähnke, Torsten; Haschke, Heiko [JPK Instruments AG, Bouchéstrasse 12, 12435 Berlin (Germany)
2015-02-15
Fibrillar collagens, such as collagen type I, belong to the most abundant extracellular matrix proteins and they have received much attention over the last five decades due to their large interactome, complex hierarchical structure and high mechanical stability. Nevertheless, the collagen self-assembly process is still incompletely understood. Determining the real-time kinetics of collagen type I formation is therefore pivotal for better understanding of collagen type I structure and function, but visualising the dynamic self-assembly process of collagen I on the molecular scale requires imaging techniques offering high spatiotemporal resolution. Fast and high-speed scanning atomic force microscopes (AFM) provide the means to study such processes on the timescale of seconds under near-physiological conditions. In this study we have applied fast AFM tip scanning to study the assembly kinetics of fibrillar collagen type I nanomatrices with a temporal resolution reaching eight seconds for a frame size of 500 nm. By modifying the buffer composition and pH value, the kinetics of collagen fibrillogenesis can be adjusted for optimal analysis by fast AFM scanning. We furthermore show that amplitude-modulation imaging can be successfully applied to extract additional structural information from collagen samples even at high scan rates. Fast AFM scanning with controlled amplitude modulation therefore provides a versatile platform for studying dynamic collagen self-assembly processes at high resolution. - Highlights: • Continuous non-invasive time-lapse investigation of collagen I fibrillogenesis in situ. • Imaging of collagen I self-assembly with high spatiotemporal resolution. • Application of setpoint modulation to study the hierarchical structure of collagen I. • Observing real-time formation of the D-banding pattern in collagen I.
Collagen markers in peritoneal dialysis patients
DEFF Research Database (Denmark)
Graff, J; Joffe, P; Fugleberg, S
1995-01-01
Possible relationships between the dialysate-to-plasma creatinine equilibration ratio (D/Pcreatinine 4 hour), duration of peritoneal dialysis treatment, number of peritonitis episodes, and mass appearance rates of three connective tissue markers [carboxyterminal propeptide of type I procollagen...... (PICP), aminoterminal propeptide of type III procollagen (PIIINP), and carboxyterminal telopeptide of type I collagen (ICTP)] were studied in 19 nondiabetic peritoneal dialysis patients. The absence of correlation between the mass appearance rates of the markers and the duration of dialysis treatment...... as well as the number of peritonitis episodes supports the concept that peritoneal dialysis does not cause persistent changes in the deposition and degradation rates of collagen. A correlation between the D/Pcreatinine 4 hr and the PICP mass appearance rates was found. Since it is unlikely...
Lukjanowicz, Małgorzata; Trzcińska-Butkiewicz, Beata; Brzosko, Marek
2006-01-01
Hypothyroidism is one of the common causes of the secondary hypercholesterolemia. The prevalence of hypothyroidism in the general population is estimated to be as high as about 1.5%. Frequency of the hypothyroidism in patients with hyperlipidemia is high, and can be observed in 4.2-10% in different populations. Most commonly, there is no need to treat the hypothyroid patients with the hypolipidemic drugs. Substitution treatment with the thyroid hormones usually results in either normalization or significant decreasing of the lipid levels. Hypothyroidism with symptoms of involvement of skeletal muscles is referred as to hypothyroid myopathy in English literature, and can be present in 30-80% patients with deficiency of the thyroid hormones. Hypothyroidism is a risk factor of developing of toxic injury of muscles, what is thought to be related to hypolipidemic drug intake. We report a case of a patient with undiagnosed hypothyroidism with muscle involvement manifestation, who was treated with fenofibrate due to accidentally diagnosed hypercholesterolemia. Hypolipidemic management resulted in rapid exacerbation of previously moderate myopathy. High concentrations of muscle enzymes and moderate increasing of creatinine concentration were detected. Improvement was observed after discontinuation of fenofibrate administration, but muscle symptoms and elevation of muscle enzymes and creatinine persisted. After administration of levothyroxin, muscle weakness and laboratory abnormalities were observed no longer. After several months of follow-up we believe that treatment with fenofibrate in our patient was complicated with muscle tissue damage and exacerbated symptoms of myopathy originally related to decompensated hypothyroidism.
Imaging Prostate Cancer Microenvironment by Collagen Hybridization
2016-12-01
of collagen II remodeling in Rheumatoid arthritis and other cartilage-related diseases or wound repair. We did observe trends in the CMP...proteins in vitro and in vivo has been prepared and submitted to Molecular Pharmaceutics . What do you plan to do during the next reporting period to...or care of human subjects, vertebrate animals, biohazards, and/or select agents Nothing to report. PRODUCTS Journal publications: Lucas L
Collagen Fiber Orientation in Primate Long Bones.
Warshaw, Johanna; Bromage, Timothy G; Terranova, Carl J; Enlow, Donald H
2017-07-01
Studies of variation in orientation of collagen fibers within bone have lead to the proposition that these are preferentially aligned to accommodate different kinds of load, with tension best resisted by fibers aligned longitudinally relative to the load, and compression best resisted by transversely aligned fibers. However, previous studies have often neglected to consider the effect of developmental processes, including constraints on collagen fiber orientation (CFO), particularly in primary bone. Here we use circularly polarized light microscopy to examine patterns of CFO in cross-sections from the midshaft femur, humerus, tibia, radius, and ulna in a range of living primate taxa with varied body sizes, phylogenetic relationships and positional behaviors. We find that a preponderance of longitudinally oriented collagen is characteristic of both periosteal primary and intracortically remodeled bone. Where variation does occur among groups, it is not simply understood via interpretations of mechanical loads, although prioritized adaptations to tension and/or shear are considered. While there is some suggestion that CFO may correlate with body size, this relationship is neither consistent nor easily explicable through consideration of size-related changes in mechanical adaptation. The results of our study indicate that there is no clear relationship between CFO and phylogenetic status. One of the principle factors accounting for the range of variation that does exist is primary tissue type, where slower depositing bone is more likely to comprise a larger proportion of oblique to transverse collagen fibers. Anat Rec, 300:1189-1207, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Calcaneal Tendon Collagen Fiber Morphometry and Aging
Czech Academy of Sciences Publication Activity Database
Hadraba, Daniel; Janáček, Jiří; Filová, Eva; Lopot, F.; Paesen, R.; Fanta, O.; Jarman, A.; Nečas, A.; Ameloot, M.; Jelen, K.
2017-01-01
Roč. 23, č. 5 (2017), s. 1040-1047 ISSN 1431-9276 R&D Projects: GA ČR(CZ) GA16-14758S; GA MŠk(CZ) LO1309; GA MŠk(CZ) LM2015062 Institutional support: RVO:67985823 ; RVO:68378041 Keywords : collagen * aging * crimp * fiber orientation * tendon Subject RIV: EB - Genetics ; Molecular Biology; BO - Biophysics (UEM-P) OBOR OECD: Developmental biology; Biophysics (UEM-P) Impact factor: 1.891, year: 2016
Chemical Stabilisation of Collagen as a Biomimetic
Directory of Open Access Journals (Sweden)
R. Gordon Paul
2003-01-01
Full Text Available Collagen is the most abundant protein in animals and because of its high mechanical strength and good resistance to degradation has been utilized in a wide range of products in industry whilst its low antigenicity has resulted in its widespread use in medicine. Collagen products can be purified from fibres, molecules reconstituted as fibres or from specific recombinant polypeptides with preferred properties. A common feature of all these biomaterials is the need for stable chemical cross-linking to control the mechanical properties and the residence time in the body, and to some extent the immunogenicity of the device. This can be achieved by a number of different cross-linking agents that react with specific amino acid residues on the collagen molecule imparting individual biochemical, thermal and mechanical characteristics to the biomaterial. In this review we have summarised the major techniques for testing these characteristics and the mechanisms involved in the variety of cross-linking reactions to achieve particular properties..
Nemaline myopathy and heart failure: role of ivabradine; a case report.
Sarullo, Filippo M; Vitale, Giuseppe; Di Franco, Antonino; Sarullo, Silvia; Salerno, Ylenia; Vassallo, Laura; Baviera, Emanuela Petrona; Marazia, Stefania; Mandalà, Giorgio; Lanza, Gaetano A
2015-01-19
Nemaline myopathy (NM) is a rare congenital myopathy characterized by muscle weakness, hypotonia and the presence in muscle fibers of inclusions known as nemaline bodies and a wide spectrum of clinical phenotypes, ranging from severe forms with neonatal onset to asymptomatic forms. The adult-onset form is heterogeneous in terms of clinical presentation and disease progression. Cardiac involvement occurs in the minority of cases and little is known about medical management in this subgroup of NM patients. We report a rare case of heart failure (HF) in a patient with adult-onset NM in whom ivabradine proved to be able to dramatically improve the clinical picture. We report a case of a 37-year-old man with adult-onset NM, presenting with weakness and hypotonia of the proximal limb muscles and shoulder girdle, severely limiting daily activities. He developed progressive HF over a period of 6 months while attending a rehabilitation program, with reduced left ventricular ejection fraction (LVEF = 20%), manifested by dyspnea and signs of systemic congestion. The patient was started HF therapy with enalapril, carvedilol, spironolactone and loop diuretics. Target HF doses of these drugs (including carvedilol) were not reached because of symptomatic hypotension causing a high resting heart rate (HR) ≥70 beats per minute (bpm). Further deterioration of the clinical picture occurred with several life-threatening arrhythmic episodes requiring external defibrillation. An implantable cardioverter defibrillator (ICD) was then implanted. Persistent high resting HR was successfully treated with ivabradine with HR lowering from 90 bpm to 55 bpm at 1 month follow up, LVEF rising to 50% at 3 month follow up and to 54% at 2,5 year follow up. To date no more hospitalizations for heart failure occurred. A single hospitalization due to aspiration pneumonia required insertion of a tracheostomy tube to protect airways from further aspiration. At present, the patient is attending
In vivo determination of arterial collagen synthesis in atherosclerotic rabbits
International Nuclear Information System (INIS)
Opsahl, W.P.; DeLuca, D.J.; Ehrhart, L.A.
1986-01-01
Collagen and non-collagen protein synthesis rates were determined in vivo in tissues from rabbits fed a control or atherogenic diet supplemented with 2% peanut oil and 0.25% cholesterol for 4 months. Rabbits received a bolus intravenous injection of L-[ 3 H]-proline (1.0 mCi/kg) and unlabeled L-proline (7 mmoles/kg) in 0.9% NaCl. Plasma proline specific activity decreased only 20% over 5 hr and was similar to the specific activity of free proline in tissues. Thoracic aortas from atherosclerotic rabbits exhibited raised plaques covering at least 75% of the surface. Thoracic intima plus a portion of the media (TIM) was separated from the remaining media plus adventitia (TMA). Dry delipidated weight, total collagen content, and collagen as a percent of dry weight were increased significantly in the TIM of atherosclerotic rabbits. Collagen synthesis rates and collagen synthesis as a percent of total protein synthesis were likewise increased both in the TIM and in the abdominal aortas. No differences from controls either in collagen content or collagen synthesis rates were observed in the TMA, lung or skin. These results demonstrate for the first time in vivo that formation of atherosclerotic plaques is associated with increased rates of collagen synthesis. Furthermore, as previously observed with incubations in vitro, collagen synthesis was elevated to a greater extent than noncollagen protein synthesis in atherosclerotic aortas from rabbits fed cholesterol plus peanut oil
Hyaluronan in aged collagen matrix increases prostate epithelial cell proliferation
Damodarasamy, Mamatha; Vernon, Robert B.; Chan, Christina K.; Plymate, Stephen R.; Wight, Thomas N.
2015-01-01
The extracellular matrix (ECM) of the prostate, which is comprised primarily of collagen, becomes increasingly disorganized with age, a property that may influence the development of hyperplasia and cancer. Collageous ECM extracted from the tails of aged mice exhibits many characteristics of collagen in aged tissues, including the prostate. When polymerized into a 3-dimensional (3D) gel, these collagen extracts can serve as models for the study of specific cell-ECM interactions. In the present study, we examined the behaviors of human prostatic epithelial cell lines representing normal prostate epithelial cells (PEC), benign prostatic hyperplasia (BPH-1), and adenocarcinoma (LNCaP) cultured in contact with 3D gels made from collagen extracts of young and aged mice. We found that proliferation of PEC, BPH-1, and LNCaP cells were all increased by culture on aged collagen gels relative to young collagen gels. In examining age-associated differences in the composition of the collagen extracts, we found that aged and young collagen had a similar amount of several collagen-associated ECM components, but aged collagen had a much greater content of the glycosaminoglycan hyaluronan (HA) than young collagen. The addition of HA (of similar size and concentration to that found in aged collagen extracts) to cells placed in young collagen elicited significantly increased proliferation in BPH-1 cells, but not in PEC or LNCaP cells, relative to controls not exposed to HA. Of note, histochemical analyses of human prostatic tissues showed significantly higher expression of HA in BPH and prostate cancer stroma relative to stroma of normal prostate. Collectively, these results suggest that changes in ECM involving increased levels of HA contribute to the growth of prostatic epithelium with aging. PMID:25124870
Collagen Structural Hierarchy and Susceptibility to Degradation by Ultraviolet Radiation.
Rabotyagova, Olena S; Cebe, Peggy; Kaplan, David L
2008-12-01
Collagen type I is the most abundant extracellular matrix protein in the human body, providing the basis for tissue structure and directing cellular functions. Collagen has complex structural hierarchy, organized at different length scales, including the characteristic triple helical feature. In the present study, the relationship between collagen structure (native vs. denatured) and sensitivity to UV radiation was assessed, with a focus on changes in primary structure, changes in conformation, microstructure and material properties. A brief review of free radical reactions involved in collagen degradation is also provided as a mechanistic basis for the changes observed in the study. Structural and functional changes in the collagens were related to the initial conformation (native vs. denatured) and the energy of irradiation. These changes were tracked using SDS-PAGE to assess molecular weight, Fourier transform infrared (FTIR) spectroscopy to study changes in the secondary structure, and atomic force microscopy (AFM) to characterize changes in mechanical properties. The results correlate differences in sensitivity to irradiation with initial collagen structural state: collagen in native conformation vs. heat-treated (denatured) collagen. Changes in collagen were found at all levels of the hierarchical structural organization. In general, the native collagen triple helix is most sensitive to UV-254nm radiation. The triple helix delays single chain degradation. The loss of the triple helix in collagen is accompanied by hydrogen abstraction through free radical mechanisms. The results received suggest that the effects of electromagnetic radiation on biologically relevant extracellular matrices (collagen in the present study) are important to assess in the context of the state of collagen structure. The results have implications in tissue remodeling, wound repair and disease progression.
Binding of collagens to an enterotoxigenic strain of Escherichia coli
International Nuclear Information System (INIS)
Visai, L.; Speziale, P.; Bozzini, S.
1990-01-01
An enterotoxigenic strain of Escherichia coli, B34289c, has been shown to bind the N-terminal region of fibronectin with high affinity. We now report that this strain also binds collagen. The binding of 125I-labeled type II collagen to bacteria was time dependent and reversible. Bacteria expressed a limited number of collagen receptors (2.2 x 10(4) per cell) and bound collagen with a Kd of 20 nM. All collagen types tested (I to V) as well as all tested cyanogen bromide-generated peptides [alpha 1(I)CB2, alpha 1(I)CB3, alpha 1(I)CB7, alpha 1(I)CB8, and alpha 2(I)CB4] were recognized by bacterial receptors, as demonstrated by the ability of these proteins to inhibit the binding of 125I-labeled collagen to bacteria. Of several unlabeled proteins tested in competition experiments, fibronectin and its N-terminal region strongly inhibited binding of the radiolabeled collagen to E. coli cells. Conversely, collagen competed with an 125I-labeled 28-kilodalton fibronectin fragment for bacterial binding. Collagen bound to bacteria could be displaced by excess amounts of either unlabeled fibronectin or its N-terminal fragment. Similarly, collagen could displace 125I-labeled N-terminal peptide of fibronectin bound to the bacterial cell surface. Bacteria grown at 41 degrees C or in the presence of glucose did not express collagen or fibronectin receptors. These results indicate the presence of specific binding sites for collagen on the surface of E. coli cells and furthermore that the collagen and fibronectin binding sites are located in close proximity, possibly on the same structure
Collagenous colitis: histopathology and clinical course.
Goff, J S; Barnett, J L; Pelke, T; Appelman, H D
1997-01-01
Collagenous colitis is a chronic diarrheal disease characterized by a normal or near-normal mucosa endoscopically and microscopic inflammation in the lamina propria, surface epithelial injury and a thick subepithelial collagen layer. The symptoms of collagenous colitis vary in duration and intensity, and long periods of remission have been described, but long-term follow-up data are limited. Our goal was to determine the natural clinical history of collagenous colitis and to determine whether there was a relationship between histopathologic changes and course of disease. Cases were identified at the University of Michigan Hospitals using surgical pathology records before 1992. All charts, including medical records from other hospitals, were reviewed, and a telephone interview was conducted with each locatable patient (pt). Biopsy specimens were reviewed by two pathologists for degree of collagen layer thickness, epithelial damage, and inflammation. There were 31 patients (26 F, 5 M) with a mean age of 66 yr (range 33-83) and a mean duration of symptoms of 5.4 yr at the time of diagnosis. Of the 31 patients, 18 (56%) had some form of arthritis, and 22 (71%) were using NSAIDS regularly at the time of diagnosis. Follow-up interviews were conducted at least 2 yr after diagnosis (mean 3.5 yr, range 2-5 yr) with 27 of 31 patients (3 could not be located, 1 died). Two definable groups of patients were identified: (1) those with either spontaneous or treatment-related symptom resolution (63%), and (2) those with ongoing or intermittent symptoms requiring at least intermittent therapy (37%). There was no significant difference between the two groups with regard to sex, age, associated diseases, and use of medications. Patients with symptom resolution (mean duration 3.1 yr) had been treated with antidiarrheals (6), sulfasalazine (3), discontinuation of NSAIDS (3), reversal of jejunoilial bypass (1), or nothing (4). Those with ongoing symptoms experienced a wide range of
ISOCT study of collagen crosslinking of collagen in cancer models (Conference Presentation)
Spicer, Graham; Young, Scott T.; Yi, Ji; Shea, Lonnie D.; Backman, Vadim
2016-03-01
The role of extracellular matrix modification and signaling in cancer progression is an increasingly recognized avenue for the progression of the disease. Previous study of field effect carcinogenesis with Inverse Spectroscopic Optical Coherence Tomography (ISOCT) has revealed pronounced changes in the nanoscale-sensitive mass fractal dimension D measured from field effect tissue when compared to healthy tissue. However, the origin of this difference in tissue ultrastructure in field effect carcinogenesis has remained poorly understood. Here, we present findings supporting the idea that enzymatic crosslinking of the extracellular matrix is an effect that presents at the earliest stages of carcinogenesis. We use a model of collagen gel with crosslinking induced by lysyl oxidase (LOXL4) to recapitulate the difference in D previously reported from healthy and cancerous tissue biopsies. Furthermore, STORM imaging of this collagen gel model verifies the morphologic effects of enzymatic crosslinking at length scales as small as 40 nm, close to the previously reported lower length scale sensitivity threshold of 35 nm for ISOCT. Analysis of the autocorrelation function from STORM images of collagen gels and subsequent fitting to the Whittle-Matérn correlation function shows a similar effect of LOXL4 on D from collagen measured with ISOCT and STORM. We extend this to mass spectrometric study of tissue to directly measure concentrations of collagen crosslink residues. The validation of ISOCT as a viable tool for non-invasive rapid quantification of collagen ultrastructure lends it to study other physiological phenomena involving ECM restructuring such as atherosclerotic plaque screening or cervical ripening during pregnancy.
DEFF Research Database (Denmark)
Kalamajski, Sebastian; Aspberg, Anders; Lindblom, Karin
2009-01-01
, but not by biglycan. We demonstrate that the polyaspartate domain binds calcium and regulates hydroxyapatite formation in vitro. In the presence of asporin, the number of collagen nodules, and mRNA of osteoblastic markers Osterix and Runx2, were increased. Moreover, decorin or the collagen-binding asporin fragment...... biomineralization activity. We also show that asporin can be expressed in Escherichia coli (Rosetta-gami) with correctly positioned cysteine bridges, and a similar system can possibly be used for the expression of other SLRPs (small LRR proteoglycans/proteins)....
Nishiyama, T; McDonough, A M; Bruns, R R; Burgeson, R E
1994-11-11
Type XII and XIV collagens are very large molecules containing three extended globular domains derived from the amino terminus of each alpha chain and an interrupted triple helix. Both collagens are genetically and immunologically unique and have distinct distributions in many tissues. These collagens localize near the surface of banded collagen fibrils. The function of the molecules is unknown. We have prepared a mixture of native type XII and XIV collagens that is free of contaminating proteins by electrophoretic criteria. In addition, we have purified the collagenase-resistant globular domains of type XII or XIV collagens (XII-NC-3 or XIV-NC-3). In this study, we have investigated the effect of intact type XII and XIV and XII-NC-3 or XIV-NC-3 on the interactions between fibroblasts and type I collagen fibrils. We find that both type XII and XIV collagens promote collagen gel contraction mediated by fibroblasts, even in the absence of serum. The activity is present in the NC-3 domains. The effect is dose-dependent and is inhibited by denaturation. The effect of type XII NC-3 is inhibited by the addition of anti-XII antiserum. To elucidate the mechanism underlying this phenomenon, we examined the effect of XII-NC-3 or XIV-NC-3 on deformability of collagen gels by centrifugal force. XII-NC-3 or XIV-NC-3 markedly promotes gel compression after centrifugation. The effect is also inhibited by denaturation, and the activity of type XII-NC3 is inhibited by the addition of anti-XII antiserum. The results indicate that the effect of XII-NC-3 or XIV-NC-3 on collagen gel contraction by fibroblasts is not due to activation of cellular events but rather results from the increase in mobility of hydrated collagen fibrils within the gel. These studies suggest that collagen types XII and XIV may modulate the biomechanical properties of tissues.
Mineralized Collagen: Rationale, Current Status, and Clinical Applications
Directory of Open Access Journals (Sweden)
Zhi-Ye Qiu
2015-07-01
Full Text Available This paper presents a review of the rationale for the in vitro mineralization process, preparation methods, and clinical applications of mineralized collagen. The rationale for natural mineralized collagen and the related mineralization process has been investigated for decades. Based on the understanding of natural mineralized collagen and its formation process, many attempts have been made to prepare biomimetic materials that resemble natural mineralized collagen in both composition and structure. To date, a number of bone substitute materials have been developed based on the principles of mineralized collagen, and some of them have been commercialized and approved by regulatory agencies. The clinical outcomes of mineralized collagen are of significance to advance the evaluation and improvement of related medical device products. Some representative clinical cases have been reported, and there are more clinical applications and long-term follow-ups that currently being performed by many research groups.
The non-phagocytic route of collagen uptake
DEFF Research Database (Denmark)
Madsen, Daniel H; Ingvarsen, Signe; Jürgensen, Henrik J
2011-01-01
The degradation of collagens, the most abundant proteins of the extracellular matrix, is involved in numerous physiological and pathological conditions including cancer invasion. An important turnover pathway involves cellular internalization and degradation of large, soluble collagen fragments......, generated by initial cleavage of the insoluble collagen fibers. We have previously observed that in primary mouse fibroblasts, this endocytosis of collagen fragments is dependent on the receptor urokinase plasminogen activator receptor-associated protein (uPARAP)/Endo180. Others have identified additional...... mechanisms of collagen uptake, with different associated receptors, in other cell types. These receptors include β1-integrins, being responsible for collagen phagocytosis, and the mannose receptor. We have now utilized a newly developed monoclonal antibody against uPARAP/Endo180, which down...
Collagen synthesis in human musculoskeletal tissues and skin
DEFF Research Database (Denmark)
Babraj, J A; Cuthbertson, D J R; Smith, K
2005-01-01
We have developed a direct method for the measurement of human musculoskeletal collagen synthesis on the basis of the incorporation of stable isotope-labeled proline or leucine into protein and have used it to measure the rate of synthesis of collagen in tendon, ligament, muscle, and skin....... In postabsorptive, healthy young men (28 +/- 6 yr) synthetic rates for tendon, ligament, muscle, and skin collagen were 0.046 +/- 0.005, 0.040 +/- 0.006, 0.016 +/- 0.002, and 0.037 +/- 0.003%/h, respectively (means +/- SD). In postabsorptive, healthy elderly men (70 +/- 6 yr) the rate of skeletal muscle collagen...... synthesis is greater than in the young (0.023 +/- 0.002%/h, P collagen are similar to those of mixed skeletal muscle protein in the postabsorptive state, whereas the rate for muscle collagen synthesis is much lower in both young and elderly men...
The decorin sequence SYIRIADTNIT binds collagen type I
DEFF Research Database (Denmark)
Kalamajski, Sebastian; Aspberg, Anders; Oldberg, Ake
2007-01-01
Decorin belongs to the small leucine-rich repeat proteoglycan family, interacts with fibrillar collagens, and regulates the assembly, structure, and biomechanical properties of connective tissues. The decorin-collagen type I-binding region is located in leucine-rich repeats 5-6. Site......-directed mutagenesis of this 54-residue-long collagen-binding sequence identifies Arg-207 and Asp-210 in leucine-rich repeat 6 as crucial for the binding to collagen. The synthetic peptide SYIRIADTNIT, which includes Arg-207 and Asp-210, inhibits the binding of full-length recombinant decorin to collagen in vitro....... These collagen-binding amino acids are exposed on the exterior of the beta-sheet-loop structure of the leucine-rich repeat. This resembles the location of interacting residues in other leucine-rich repeat proteins....
Flex Sensor Based Biofeedback Monitoring for Post-Stroke Fingers Myopathy Patients
Garda, Y. R.; Caesarendra, W.; Tjahjowidodo, T.; Turnip, A.; Wahyudati, S.; Nurhasanah, L.; Sutopo, D.
2018-04-01
Hands are one of the crucial parts of the human body in carrying out daily activities. Accidents on the hands decreasing in motor skills of the hand so that therapy is necessary to restore motor function of the hand. In addition to accidents, hand disabilities can be caused by certain diseases, e.g. stroke. Stroke is a partial destruction of the brain. It occurs if the arteries that drain blood to the brain are blocked, or if torn or leak. The purpose of this study to make biofeedback monitoring equipment for post-stroke hands myopathy patients. Biofeedback is an alternative method of treatment that involves measuring body functions measured subjects such as skin temperature, sweat activity, blood pressure, heart rate and hand paralysis due to stroke. In this study, the sensor used for biofeedback monitoring tool is flex sensor. Flex sensor is a passive resistive device that changes its resistance as the sensor is bent. Flex sensor converts the magnitude of the bend into electrical resistance, the greater the bend the greater the resistance value. The monitoring used in this biofeedback monitoring tool uses Graphical User Interface (GUI) in C# programming language. The motivation of the study is to monitor and record the progressive improvement of the hand therapy. Patients who experienced post-stroke can see the therapy progress quantitatively.
Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study
International Nuclear Information System (INIS)
Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno; Bassez, Guillaume; Carlier, Pierre G.; Clement, Karine; Petit, Francois M.; Carlier, Robert-Yves
2013-01-01
Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)
Myotubular myopathy and the neuromuscular junction: a novel therapeutic approach from mouse models
Directory of Open Access Journals (Sweden)
James J. Dowling
2012-11-01
Myotubular myopathy (MTM is a severe congenital muscle disease characterized by profound weakness, early respiratory failure and premature lethality. MTM is defined by muscle biopsy findings that include centralized nuclei and disorganization of perinuclear organelles. No treatments currently exist for MTM. We hypothesized that aberrant neuromuscular junction (NMJ transmission is an important and potentially treatable aspect of the disease pathogenesis. We tested this hypothesis in two murine models of MTM. In both models we uncovered evidence of a disorder of NMJ transmission: fatigable weakness, improved strength with neostigmine, and electrodecrement with repetitive nerve stimulation. Histopathological analysis revealed abnormalities in the organization, appearance and size of individual NMJs, abnormalities that correlated with changes in acetylcholine receptor gene expression and subcellular localization. We additionally determined the ability of pyridostigmine, an acetylcholinesterase inhibitor, to ameliorate aspects of the behavioral phenotype related to NMJ dysfunction. Pyridostigmine treatment resulted in significant improvement in fatigable weakness and treadmill endurance. In all, these results describe a newly identified pathological abnormality in MTM, and uncover a potential disease-modifying therapy for this devastating disorder.
Role of TGF-β signaling in inherited and acquired myopathies
Directory of Open Access Journals (Sweden)
Burks Tyesha N
2011-05-01
Full Text Available Abstract The transforming growth factor-beta (TGF-β superfamily consists of a variety of cytokines expressed in many different cell types including skeletal muscle. Members of this superfamily that are of particular importance in skeletal muscle are TGF-β1, mitogen-activated protein kinases (MAPKs, and myostatin. These signaling molecules play important roles in skeletal muscle homeostasis and in a variety of inherited and acquired neuromuscular disorders. Expression of these molecules is linked to normal processes in skeletal muscle such as growth, differentiation, regeneration, and stress response. However, chronic elevation of TGF-β1, MAPKs, and myostatin is linked to various features of muscle pathology, including impaired regeneration and atrophy. In this review, we focus on the aberrant signaling of TGF-β in various disorders such as Marfan syndrome, muscular dystrophies, sarcopenia, and critical illness myopathy. We also discuss how the inhibition of several members of the TGF-β signaling pathway has been implicated in ameliorating disease phenotypes, opening up novel therapeutic avenues for a large group of neuromuscular disorders.
Impaired Insulin/IGF Signaling in Experimental Alcohol-Related Myopathy
Directory of Open Access Journals (Sweden)
Elizabeth Silbermann
2012-08-01
Full Text Available Alcohol-related myopathy (Alc-M is highly prevalent among heavy drinkers, although its pathogenesis is not well understood. We hypothesize that Alc-M is mediated by combined effects of insulin/IGF resistance and oxidative stress, similar to the effects of ethanol on liver and brain. We tested this hypothesis using an established model in which adult rats were pair-fed for 8 weeks with isocaloric diets containing 0% (N = 8 or 35.5% (N = 13 ethanol by caloric content. Gastrocnemius muscles were examined by histology, morphometrics, qRT-PCR analysis, and ELISAs. Chronic ethanol feeding reduced myofiber size and mRNA expression of IGF-1 polypeptide, insulin, IGF-1, and IGF-2 receptors, IRS-1, and IRS-2. Multiplex ELISAs demonstrated ethanol-associated inhibition of insulin, IRS-1, Akt, and p70S6K signaling, and increased activation of GSK-3β. In addition, ethanol-exposed muscles had increased 4-hydroxy-2-nonenal immunoreactivity, reflecting lipid peroxidation, and reduced levels of mitochondrial Complex IV, Complex V, and acetylcholinesterase. These results demonstrate that experimental Alc-M is associated with inhibition of insulin/IGF/IRS and downstream signaling that mediates metabolism and cell survival, similar to findings in alcoholic liver and brain degeneration. Moreover, the increased oxidative stress, which could be mediated by mitochondrial dysfunction, may have led to inhibition of acetylcholinesterase, which itself is sufficient to cause myofiber atrophy and degeneration.
Directory of Open Access Journals (Sweden)
Levente Bodoki
2015-01-01
Full Text Available Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females and 93 controls (52 females. We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes.
Energy Technology Data Exchange (ETDEWEB)
Nishikai, Masahiko; Akiya, Kumiko [National Tokyo Medical Center (Japan)
2000-12-01
The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)
Bodoki, L; Nagy-Vincze, M; Griger, Z; Betteridge, Z; Szöllősi, L; Jobanputra, R; Dankó, K
2015-01-01
Idiopathic inflammatory myopathies are systemic, chronic autoimmune diseases characterized by symmetrical, proximal muscle weakness. Homogeneous groups present with similar symptoms. The response to therapy and prognosis could be facilitated by myositis-specific autoantibodies, and in this way, give rise to immunoserological classification. The myositis-specific autoantibodies are directed against specific proteins found in the cytoplasm or in the nucleus of the cells. To date, literature suggests the rarity of the co-existence of two myositis-specific autoantibodies. In this study the authors highlight rare associations of myositis-specific autoantibodies. Three hundred and thirty-seven Hungarian patients with polymyositis or dermatomyositis were studied. Their clinical findings were noted retrospectively. Specific blood tests identified six patients with the rare co-existence of myositis-specific autoantibodies, anti-Jo-1 and anti-SRP, anti-Jo-1 and anti-Mi-2, anti-Mi-2 and anti-PL-12, anti-Mi-2 and anti-SRP, and anti-SRP and anti-PL-7, respectively. This case review aims to identify the clinical importance of these rare associations and their place within the immunoserological classification.
International Nuclear Information System (INIS)
Nishikai, Masahiko; Akiya, Kumiko
2000-01-01
The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)
Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study
Energy Technology Data Exchange (ETDEWEB)
Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno [AP-HP, Centre de Reference de pathologie neuromusculaire Paris-Est, Groupe Hospitalier Pitie-Salpetriere, Assistance Publique-Hopitaux de Paris, Paris, (France); Bassez, Guillaume [AP-HP, Centre de Reference de Pathologie Neuromusculaire Paris-Ouest, CHU Henri Mondor, Creteil, (France); Carlier, Pierre G. [CEA, I2BM, MIRCen, IdM NMR Laboratory, T-75651 Paris, (France); Clement, Karine [AP-HP, Institute of Cardiometabolism and Nutrition, ICAN, Pitie-Salpetriere Hospital, University Pierre et Marie-Curie Paris6, Paris, INSERM, U872 team 7, Paris, (France); Petit, Francois M. [AP-HP, Molecular Genetics and Metabolic Diseases Laboratory, Antoine Beclere Hospital, Clamart, (France); Carlier, Robert-Yves [AP-HP, Departement d' imagerie Medicale et Centre d' innovation Technologique, CHU Raymond-Poincare, Garches, (France)
2013-07-01
Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)
Gerber, Karen; Harvey, John W.; D'Agorne, Sara; Wood, Jonathan; Giger, Urs
2009-01-01
Two male castrated Whippet littermates were presented at 1 year of age for pallor, tachycardia, systolic heart murmur, dark yellow to orange feces, intermittent lethargy, pigmenturia, and muscle shivering or cramping after exercise. Persistent macrocytic hypochromic anemia with marked reticulocytosis and metarubricytosis was found when CBC results were compared with reference values for Whippets. Increased serum creatine kinase activity and hyperkalemia also were sometimes present over the 4-year period of evaluation. Progressively increasing serum concentrations of N-terminal prohormone brain natriuretic peptide suggested cardiac disease. Erythrocytes from the whippets were less osmotically fragile but more alkaline fragile than those from control dogs. Erythrocyte phosphofructokinase (PFK) activities and 2,3-diphosphoglycerate concentrations were decreased. Restriction enzyme-based DNA test screening and DNA sequencing revealed the same mutation in the muscle-PFK gene of the Whippets as seen in English Springer Spaniel dogs with PFK deficiency. This is the first report of PFK deficiency in Whippet dogs. In addition to causing hemolysis and exertional myopathy, heart disease may be a prominent clinical component of PFK deficiency in this breed and has not been previously recognized in PFK-deficient English Springer Spaniels. PMID:19228357
Two desmin gene mutations associated with myofibrillar myopathies in Polish families.
Directory of Open Access Journals (Sweden)
Jakub Piotr Fichna
Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.
Directory of Open Access Journals (Sweden)
Petrović Igor N.
2012-01-01
Full Text Available Introduction. Mitochondrial encephalopathy, lactacidosis and stroke-like episodes (MELAS represent a multisystemic dysfunction due to various mutations in mitochondrial DNA. Here we report a patient with genetically confirmed MELAS. Case Outline. A patient is presented whose clinical features involved short stature, easy tendency to fatigue, recurrent seizures, progressive cognitive decline, myopathy, sensorineural deafness, diabetes mellitus as well as stroke-like episodes. The major clinical feature of migraine type headache was not present. Neuroimaging studies revealed signs of ischemic infarctions localized in the posterior regions of the brain cortex. Electron microscopy of the skeletal muscle biopsy showed subsarcolemmal accumulation of a large number of mitochondria with paracristal inclusions in the skeletal muscle cells. The diagnosis of MELAS was definitively confirmed by the detection of a specific point mutation A to G at nucleotide position 3243 of mitochondrial DNA. Conclusion. When a relatively young patient without common risk factors for ischemic stroke presents with signs of occipitally localized brain infarctions accompanied with multisystemic dysfunction, MELAS syndrome, it is necessary to conduct investigations in order to diagnose the disease.
Diabetic Myopathy: Impact of Diabetes Mellitus on Skeletal Muscle Progenitor Cells
Directory of Open Access Journals (Sweden)
Donna M D'Souza
2013-12-01
Full Text Available Diabetes mellitus is defined as a group of metabolic diseases that are associated with the presence of a hyperglycemic state due to impairments in insulin function. While the development of each form of diabetes (Type 1 or Type 2 drastically differs, resultant pathologies often overlap. In each diabetic condition a failure to maintain healthy muscle is often observed, and is termed diabetic myopathy. This significant, but often overlooked, complication is believed to contribute to the progression of additional diabetic pathologies due to the vital importance of skeletal muscle for our physical and metabolic well-being. While studies have investigated the link between changes to skeletal muscle metabolic health following diabetes mellitus onset (particularly Type 2 diabetes mellitus, few have examined the negative impact of diabetes mellitus on the growth and reparative capacities of skeletal muscle that often coincides with disease development. Importantly, evidence is accumulating that the muscle progenitor cell population (particularly the muscle satellite cell population is also negatively affected by the diabetic environment, and as such, likely contributes to the declining skeletal muscle health observed in diabetes mellitus. In this review, we summarize the current knowledge surrounding the influence of diabetes mellitus on skeletal muscle growth and repair, with a particular emphasis on the impact of diabetes mellitus on the progenitor cell population of skeletal muscle.
MiR-320a as a Potential Novel Circulating Biomarker of Arrhythmogenic CardioMyopathy.
Sommariva, Elena; D'Alessandra, Yuri; Farina, Floriana Maria; Casella, Michela; Cattaneo, Fabio; Catto, Valentina; Chiesa, Mattia; Stadiotti, Ilaria; Brambilla, Silvia; Dello Russo, Antonio; Carbucicchio, Corrado; Vettor, Giulia; Riggio, Daniela; Sandri, Maria Teresa; Barbuti, Andrea; Vernillo, Gianluca; Muratori, Manuela; Dal Ferro, Matteo; Sinagra, Gianfranco; Moimas, Silvia; Giacca, Mauro; Colombo, Gualtiero Ivanoe; Pompilio, Giulio; Tondo, Claudio
2017-07-06
Diagnosis of Arrhythmogenic CardioMyopathy (ACM) is challenging and often late after disease onset. No circulating biomarkers are available to date. Given their involvement in several cardiovascular diseases, plasma microRNAs warranted investigation as potential non-invasive diagnostic tools in ACM. We sought to identify circulating microRNAs differentially expressed in ACM with respect to Healthy Controls (HC) and Idiopathic Ventricular Tachycardia patients (IVT), often in differential diagnosis. ACM and HC subjects were screened for plasmatic expression of 377 microRNAs and validation was performed in 36 ACM, 53 HC, 21 IVT. Variable importance in data partition was estimated through Random Forest analysis and accuracy by Receiver Operating Curves. Plasmatic miR-320a showed 0.53 ± 0.04 fold expression difference in ACM vs. HC (p ACM (n = 13) and HC (n = 17) with athletic lifestyle, a ACM precipitating factor. Importantly, ACM patients miR-320a showed 0.78 ± 0.05 fold expression change vs. IVT (p = 0.03). When compared to non-invasive ACM diagnostic parameters, miR-320a ranked highly in discriminating ACM vs. IVT and it increased their accuracy. Finally, miR-320a expression did not correlate with ACM severity. Our data suggest that miR-320a may be considered a novel potential biomarker of ACM, specifically useful in ACM vs. IVT differentiation.
García-Reynoso, Marco Julio; Veramendi-Espinoza, Liz Eliana; Ruiz-Garcia, Henry Jeison
2014-01-01
A 45 year-old man went to the emergency room due to disease duration of 15 days of insidious onset and progressive course. It began with symmetrical weakness and pain in feet and ankles that extends upward to the knees. Later, this progressed to paraparesis with Creatine phosphokinase levels of 44,270 U/L and respiratory failure that required mechanical ventilation. Electromyography and muscle biopsy of quadriceps were made. The patient responded to corticotherapy in pulses and supporting management. The presentation of ascending paresis suggested the diagnosis of Guillain-Barré syndrome. However, the degree of muscle involvement with rhabdomyolysis explains the neurological damage by itself. The biopsy revealed pathological criteria for necrotizing autoimmune myopathy (NAM), as well as other clinical and laboratory evidence. Patient disease continued and reached criteria for systemic lupus erythematosus (SLE). To our best knowledge, this is the first report of the NAM and SLE association. Copyright © 2012 Elsevier España, S.L. All rights reserved.
Directory of Open Access Journals (Sweden)
Roberto E. P. Sica
1975-06-01
Full Text Available Un estudio electrofisiológico detallado fué hecho en los músculos extensor corto de los dedos, de la eminencia tenar, de la eminencia hipotenar y soleo en un paciente con el diagnóstico de miopatía miotubular o centronuclear. El hallazgo principal fué una notoria reducción en el número de unidades motoras activas en todos los músculos investigados, en tanto que las unidades remanentes mostraron tamaño conservado. Las observaciones hechas se han interpretado como favoreciéndo la génesis neurógena en el desarrollo de este proceso.A detailed electrophysiological study has been made of the extensor digitorum brevis, thenar, hypothenar and soleus muscles in one patient with myotubular or centronuclear myopathy. The main finding was a noticeable reduction in the population of active motor units in all the investigated muscles. The remainer units showed normal sizes. The experimental observations have been interpreted in terms of a neuropathic process.
The spectrum of myopathies in the city of São Paulo
Directory of Open Access Journals (Sweden)
José A. Levy
1976-12-01
Full Text Available A review of all myopathic patients treated at the Neurologic Clinic of the Medical School of the University of São Paulo during the past 15 years is reported. A total of 466 cases were examined and distributed as follows: 56% of progressive muscular dystrophy; 31% of myasthenia gravis; 6% of polymyositis; 4% of myotonic dystrophy; and the remainder of several different diseases (central core disease, Kearns-syndrome, myotonia congenita, adynamia episodica hereditaria, diabetic myopathy and Eaton-Lambert syndrome. Enzymatic dosages, electromyography, muscle biopsy, electrocardiography and genetic counselling are also reported.Os autores fazem uma revisão de todos os casos de miopatias tratados na Clínica Neurológica da F.M.U.S.P. durante os últimos 15 anos. Foram examinados 466 casos, assim distribuídos: 56% de distrofia muscular progressiva; 31% de miastenia grave; 6% de polimiosite; 4% de distrofia miotônica e, o restante, de várias outras moléstias (Central core disease, síndrome de Kearns, miotonia congênita, adinamia episódica hereditária, miopatia diabética e síndrome de Eaton-Lambert. São relatadas também as dosagens enzimáticas, eletromiografia, biópsia muscular, eletrocardiografia e aconselhamento genético.
Directory of Open Access Journals (Sweden)
Sudhakar Veeranki
2015-01-01
Full Text Available Although hyperhomocysteinemia (HHcy elicits lower than normal body weights and skeletal muscle weakness, the mechanisms remain unclear. Despite the fact that HHcy-mediated enhancement in ROS and consequent damage to regulators of different cellular processes is relatively well established in other organs, the nature of such events is unknown in skeletal muscles. Previously, we reported that HHcy attenuation of PGC-1α and HIF-1α levels enhanced the likelihood of muscle atrophy and declined function after ischemia. In the current study, we examined muscle levels of homocysteine (Hcy metabolizing enzymes, anti-oxidant capacity and focused on protein modifications that might compromise PGC-1α function during ischemic angiogenesis. Although skeletal muscles express the key enzyme (MTHFR that participates in re-methylation of Hcy into methionine, lack of trans-sulfuration enzymes (CBS and CSE make skeletal muscles more susceptible to the HHcy-induced myopathy. Our study indicates that elevated Hcy levels in the CBS−/+ mouse skeletal muscles caused diminished anti-oxidant capacity and contributed to enhanced total protein as well as PGC-1α specific nitrotyrosylation after ischemia. Furthermore, in the presence of NO donor SNP, either homocysteine (Hcy or its cyclized version, Hcy thiolactone, not only increased PGC-1α specific protein nitrotyrosylation but also reduced its association with PPARγ in C2C12 cells. Altogether these results suggest that HHcy exerts its myopathic effects via reduction of the PGC-1/PPARγ axis after ischemia.
Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families
Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary
2014-01-01
Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946
Collagen derived serum markers in carcinoma of the prostate
DEFF Research Database (Denmark)
Rudnicki, M; Jensen, L T; Iversen, P
1995-01-01
Three new collagen markers deriving from the collagenous matrix, e.g. carboxyterminal propeptide of type I procollagen (PICP), carboxy-terminal pyridinoline cross-linked telopeptide of type I collagen (ICTP), and aminoterminal propeptide of type III procollagen (PIIINP) were used for the diagnose......, ICTP, and PICP did not differ between these two groups. In patients with metastatic prostatic cancer all five markers were increased compared to the level measured in patients with localized cancer (p
Metal stabilization of collagen and de novo designed mimetic peptides
Parmar, Avanish S.; Xu, Fei; Pike, Douglas H.; Belure, Sandeep V.; Hasan, Nida F.; Drzewiecki, Kathryn E.; Shreiber, David I.; Nanda, Vikas
2015-01-01
We explore the design of metal binding sites to modulate triple-helix stability of collagen and collagen-mimetic peptides. Globular proteins commonly utilize metals to connect tertiary structural elements that are well separated in sequence, constraining structure and enhancing stability. It is more challenging to engineer structural metals into fibrous protein scaffolds, which lack the extensive tertiary contacts seen in globular proteins. In the collagen triple helix, the structural adjacen...
Von Willebrand protein binds to extracellular matrices independently of collagen.
Wagner, D D; Urban-Pickering, M; Marder, V J
1984-01-01
Von Willebrand protein is present in the extracellular matrix of endothelial cells where it codistributes with fibronectin and types IV and V collagen. Bacterial collagenase digestion of endothelial cells removed fibrillar collagen, but the pattern of fibronectin and of von Willebrand protein remained undisturbed. Exogenous von Willebrand protein bound to matrices of different cells, whether rich or poor in collagen. von Willebrand protein also decorated the matrix of cells grown in the prese...
Collagenous gastritis: a morphologic and immunohistochemical study of 40 patients.
Arnason, Thomas; Brown, Ian S; Goldsmith, Jeffrey D; Anderson, William; O'Brien, Blake H; Wilson, Claire; Winter, Harland; Lauwers, Gregory Y
2015-04-01
Collagenous gastritis is a rare condition defined histologically by a superficial subepithelial collagen layer. This study further characterizes the morphologic spectrum of collagenous gastritis by evaluating a multi-institutional series of 40 patients (26 female and 14 male). The median age at onset was 16 years (range 3-89 years), including 24 patients (60%) under age 18. Twelve patients (30%) had associated celiac disease, collagenous sprue, or collagenous colitis. Hematoxylin and eosin slides were reviewed in biopsies from all patients and tenascin, gastrin, eotaxin, and IgG4/IgG immunohistochemical stains were applied to a subset. The distribution of subepithelial collagen favored the body/fundus in pediatric patients and the antrum in adults. There were increased surface intraepithelial lymphocytes (>25 lymphocytes/100 epithelial cells) in five patients. Three of these patients had associated celiac and/or collagenous sprue/colitis, while the remaining two had increased duodenal lymphocytosis without specific etiology. An eosinophil-rich pattern (>30 eosinophils/high power field) was seen in 21/40 (52%) patients. Seven patients' biopsies demonstrated atrophy of the gastric corpus mucosa. Tenascin immunohistochemistry highlighted the subepithelial collagen in all 21 specimens evaluated and was a more sensitive method of collagen detection in biopsies from two patients with subtle subepithelial collagen. No increased eotaxin expression was identified in 16 specimens evaluated. One of the twenty-three biopsies tested had increased IgG4-positive cells (100/high power field) with an IgG4/IgG ratio of 55%. In summary, collagenous gastritis presents three distinct histologic patterns including a lymphocytic gastritis-like pattern, an eosinophil-rich pattern, and an atrophic pattern. Eotaxin and IgG4 were not elevated enough to implicate these pathways in the pathogenesis. Tenascin immunohistochemistry can be used as a sensitive method of collagen detection.
Variation in the Helical Structure of Native Collagen
2014-02-24
notochord were obtained in previous studies [4,10,20–22]. The scaled amplitudes of the central, meridional section of each data set were used to...including helical, structure) from rat tail tendon (collagen type I) and lamprey notochord (collagen type II) show several common features (Figure 5). Of...also a possible consequence of the type II collagen notochord samples being stretched, perhaps to a greater extant then the type I tendon samples to aid
Collagen type IV at the fetal-maternal interface
Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A
2015-01-01
Introduction Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Methods Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle ...
[Biophysical principles of collagen cross-linking].
Spörl, E; Raiskup-Wolf, F; Pillunat, L E
2008-02-01
The reduced mechanical stability of the cornea in keratoconus or in keratectasia after Lasik may be increased by photooxidative cross-linking of corneal collagen. The biophysical principles are compiled for the safe and effective application of this new treatment method. The setting of the therapy parameters should be elucidated from the absorption behaviour of the cornea. The safety of the method for the endothelium cells and the lens will be discussed. The induced cross-links are shown to be the result of changes in the physico-chemical properties of the cornea. To reach a high absorption of the irradiation energy in the cornea, riboflavin of a concentration of 0.1% and UV light of a wavelength of 370 nm, corresponding to the relative maximum of absorption of riboflavin, were used. An irradiance of 3 mW/cm(2) and an irradiation time of 30 min lead to an increase of the mechanical stiffness. The endothelium cells will be protected due to the high absorption within the cornea, that means the damaging threshold of the endothelium cells will not be reached in a 400 microm thick stroma. As evidence for cross-links we can consider the increase of the biomechanical stiffness, the increased resistance against enzymatic degradation, a higher shrinkage temperature, a lower swelling rate and an increased diameter of collagen fibres. The therapy parameters were tested experimentally and have been proven clinically in the corneal collagen cross-linking. These parameters should be respected to reach a safe cross-linking effect without damage of the adjacent tissues.
Release of antibiotics from collagen dressing.
Grzybowski, J; Antos-Bielska, M; Ołdak, E; Trafny, E A
1997-01-01
Our new collagen dressing has been developed recently. Three types (A, B, and C) of the dressing were prepared in this study. Each type contained bacitracin, neomycin or colistin. The antibiotic was input into: i. collagen sponge (CS)--type A, ii. layer of limited hydrophobicity (LLH)--type B, and iii. into both CS and LLH layers--type C. The final concentration of the antibiotic that resulted from the loading level was 2 mg/cm2 for the dressings of type A and B and 4 mg/cm2 for the dressing of type C. The antibiotics were then extracted from the pieces of dressings for two days through dialysis membrane. Susceptibility of 54 bacterial strains (S. aureus, P. aeruginosa, and Acinetobacter) isolated from burn wounds were tested to the three antibiotics used for preparation of the dressings. The results of the study evidenced that efficiency of released of antibiotics into the extracts depended on the kind of antibiotic and on the type of dressing. The concentration of the antibiotics proved to be much higher than MIC90 values of the bacterial isolates tested in respect to their susceptibility. The dressing containing mixture of the three antibiotics in two layers--CS and LLH is now considered as potentially effective for care of infected wounds. It may be useful for the treatment of infected wounds or for profilaxis of contaminated wounds, ensuring: i. sufficient antimicrobial activity in wound, and ii. optimal wound environment for the presence of collagenic biomaterial on the damaged tissue.
Bednarz, M.; Stunnenberg, B.C.; Kusters, B.; Kamsteeg, E.J.; Saris, C.G.J.; Groome, J.; Winston, V.; Meola, G.; Jurkat-Rott, K.; Voermans, N.C.
2017-01-01
In sodium channelopathies, a severe fixed myopathy caused by a dominant mutation is rare. We describe two unrelated patients with a novel variant, p.Ile1455Thr, with phenotypes of paramyotonia in one case and fixed proximal myopathy with latent myotonia in another. In-vitro whole cell patch-clamp
ELECTRICAL AND THERMODYNAMIC PROPERTIES OF A COLLAGEN SOLUTION
Directory of Open Access Journals (Sweden)
Jaromír Štancl
2017-06-01
Full Text Available This paper focuses on measurements of the electrical properties, the specific heat capacity and the thermal conductivity of a collagen solution (7.19% mass fraction of native bovine collagen in water. The results of our experiments show that specific electrical conductivity of collagen solution is strongly dependent on temperature. The transition region of collagen to gelatin has been observed from the measured temperature dependence of specific electrical conductivity, and has been confirmed by specific heat capacity measurements by a differential scanning calorimetry.
Marine-derived collagen biomaterials from echinoderm connective tissues
Ferrario, Cinzia; Leggio, Livio; Leone, Roberta; Di Benedetto, Cristiano; Guidetti, Luca; Coccè , Valentina; Ascagni, Miriam; Bonasoro, Francesco; La Porta, Caterina A.M.; Candia Carnevali, M. Daniela; Sugni, Michela
2016-01-01
The use of marine collagens is a hot topic in the field of tissue engineering. Echinoderms possess unique connective tissues (Mutable Collagenous Tissues, MCTs) which can represent an innovative source of collagen to develop collagen barrier-membranes for Guided Tissue Regeneration (GTR). In the present work we used MCTs from different echinoderm models (sea urchin, starfish and sea cucumber) to produce echinoderm-derived collagen membranes (EDCMs). Commercial membranes for GTR or soluble/reassembled (fibrillar) bovine collagen substrates were used as controls. The three EDCMs were similar among each other in terms of structure and mechanical performances and were much thinner and mechanically more resistant than the commercial membranes. Number of fibroblasts seeded on sea-urchin membranes were comparable to the bovine collagen substrates. Cell morphology on all EDCMs was similar to that of structurally comparable (reassembled) bovine collagen substrates. Overall, echinoderms, and sea urchins particularly, are alternative collagen sources to produce efficient GTR membranes. Sea urchins display a further advantage in terms of eco-sustainability by recycling tissues from food wastes.
Collagen-Induced Arthritis: A model for Murine Autoimmune Arthritis.
Pietrosimone, K M; Jin, M; Poston, B; Liu, P
2015-10-20
Collagen-induced arthritis (CIA) is a common autoimmune animal model used to study rheumatoid arthritis (RA). The development of CIA involves infiltration of macrophages and neutrophils into the joint, as well as T and B cell responses to type II collagen. In murine CIA, genetically susceptible mice (DBA/1J) are immunized with a type II bovine collagen emulsion in complete Freund's adjuvant (CFA), and receive a boost of type II bovine collagen in incomplete Freund's adjuvant (IFA) 21 days after the first injection. These mice typically develop disease 26 to 35 days after the initial injection. C57BL/6J mice are resistant to arthritis induced by type II bovine collagen, but can develop arthritis when immunized with type II chicken collagen in CFA, and receive a boost of type II chicken collagen in IFA 21 days after the first injection. The concentration of heat-killed Mycobacterium tuberculosis H37RA (MT) in CFA also differs for each strain. DBA/1J mice develop arthritis with 1 mg/ml MT, while C57BL/6J mice require and 3-4 mg/ml MT in order to develop arthritis. CIA develops slowly in C57BL/6J mice and cases of arthritis are mild when compared to DBA/1J mice. This protocol describes immunization of DBA/1J mice with type II bovine collagen and the immunization of C57BL/6J mice with type II chicken collagen.
Collagen-Induced Arthritis: A model for Murine Autoimmune Arthritis
Pietrosimone, K. M.; Jin, M.; Poston, B.; Liu, P.
2015-01-01
Collagen-induced arthritis (CIA) is a common autoimmune animal model used to study rheumatoid arthritis (RA). The development of CIA involves infiltration of macrophages and neutrophils into the joint, as well as T and B cell responses to type II collagen. In murine CIA, genetically susceptible mice (DBA/1J) are immunized with a type II bovine collagen emulsion in complete Freund’s adjuvant (CFA), and receive a boost of type II bovine collagen in incomplete Freund’s adjuvant (IFA) 21 days aft...
Degradation of type IV collagen by neoplastic human skin fibroblasts
International Nuclear Information System (INIS)
Sheela, S.; Barrett, J.C.
1985-01-01
An assay for the degradation of type IV (basement membrane) collagen was developed as a biochemical marker for neoplastic cells from chemically transformed human skin fibroblasts. Type IV collagen was isolated from basement membrane of Syrian hamster lung and type I collagen was isolated from rat tails; the collagens were radioactively labelled by reductive alkylation. The abilities of normal (KD) and chemically transformed (Hut-11A) human skin fibroblasts to degrade the collagens were studied. A cell-associated assay was performed by growing either normal or transformed cells in the presence of radioactively labelled type IV collagen and measuring the released soluble peptides in the medium. This assay also demonstrated that KD cells failed to synthesize an activity capable of degrading type IV collagen whereas Hut-11A cells degraded type IV collagen in a linear manner for up to 4 h. Human serum at very low concentrations, EDTA and L-cysteine inhibited the enzyme activity, whereas protease inhibitors like phenylmethyl sulfonyl fluoride, N-ethyl maleimide or soybean trypsin inhibitor did not inhibit the enzyme from Hut-11A cells. These results suggest that the ability to degrade specifically type IV collagen may be an important marker for neoplastic human fibroblasts and supports a role for this collagenase in tumor cell invasion
Stabilization and anomalous hydration of collagen fibril under heating.
Directory of Open Access Journals (Sweden)
Sasun G Gevorkian
Full Text Available BACKGROUND: Type I collagen is the most common protein among higher vertebrates. It forms the basis of fibrous connective tissues (tendon, chord, skin, bones and ensures mechanical stability and strength of these tissues. It is known, however, that separate triple-helical collagen macromolecules are unstable at physiological temperatures. We want to understand the mechanism of collagen stability at the intermolecular level. To this end, we study the collagen fibril, an intermediate level in the collagen hierarchy between triple-helical macromolecule and tendon. METHODOLOGY/PRINCIPAL FINDING: When heating a native fibril sample, its Young's modulus decreases in temperature range 20-58°C due to partial denaturation of triple-helices, but it is approximately constant at 58-75°C, because of stabilization by inter-molecular interactions. The stabilization temperature range 58-75°C has two further important features: here the fibril absorbs water under heating and the internal friction displays a peak. We relate these experimental findings to restructuring of collagen triple-helices in fibril. A theoretical description of the experimental results is provided via a generalization of the standard Zimm-Bragg model for the helix-coil transition. It takes into account intermolecular interactions of collagen triple-helices in fibril and describes water adsorption via the Langmuir mechanism. CONCLUSION/SIGNIFICANCE: We uncovered an inter-molecular mechanism that stabilizes the fibril made of unstable collagen macromolecules. This mechanism can be relevant for explaining stability of collagen.
Discoidin Domain Receptor 1 Mediates Myosin-Dependent Collagen Contraction
Directory of Open Access Journals (Sweden)
Nuno M. Coelho
2017-02-01
Full Text Available Discoidin domain receptor 1 (DDR1 is a tyrosine kinase collagen adhesion receptor that mediates cell migration through association with non-muscle myosin IIA (NMIIA. Because DDR1 is implicated in cancer fibrosis, we hypothesized that DDR1 interacts with NMIIA to enable collagen compaction by traction forces. Mechanical splinting of rat dermal wounds increased DDR1 expression and collagen alignment. In periodontal ligament of DDR1 knockout mice, collagen mechanical reorganization was reduced >30%. Similarly, cultured cells with DDR1 knockdown or expressing kinase-deficient DDR1d showed 50% reduction of aligned collagen. Tractional remodeling of collagen was dependent on DDR1 clustering, activation, and interaction of the DDR1 C-terminal kinase domain with NMIIA filaments. Collagen remodeling by traction forces, DDR1 tyrosine phosphorylation, and myosin light chain phosphorylation were increased on stiff versus soft substrates. Thus, DDR1 clustering, activation, and interaction with NMIIA filaments enhance the collagen tractional remodeling that is important for collagen compaction in fibrosis.
Thrombolytic therapy of acute myocardial infarction alters collagen metabolism
DEFF Research Database (Denmark)
Høst, N B; Hansen, S S; Jensen, L T
1994-01-01
The objective of the study was to monitor collagen metabolism after thrombolytic therapy. Sequential measurements of serum aminoterminal type-III procollagen propeptide (S-PIIINP) and carboxyterminal type-I procollagen propeptide (S-PICP) were made in 62 patients suspected of acute myocardial.......05). A less pronounced S-PIIINP increase was noted with tissue-plasminogen activator than with streptokinase. Thrombolytic therapy induces collagen breakdown regardless of whether acute myocardial infarction is confirmed or not. With confirmed acute myocardial infarction collagen metabolism is altered...... for at least 6 months. Furthermore, fibrin-specific and nonspecific thrombolytic agents appear to affect collagen metabolism differently....
Tendon collagen synthesis declines with immobilization in elderly humans
DEFF Research Database (Denmark)
Dideriksen, Kasper; Boesen, Anders P; Reitelseder, Søren
2017-01-01
-80 yr) were randomly assigned to NSAIDs (ibuprofen 1,200 mg/day; Ibu) or placebo (Plc). One lower limb was immobilized in a cast for 2 wk and retrained for 6 wk. Tendon collagen protein synthesis, mechanical properties, size, expression of genes related to collagen turnover and remodeling, and signal...... intensity (from magnetic resonance imaging) were investigated. Tendon collagen synthesis decreased (P ... immobilization in both groups, whereas scleraxis mRNA decreased with inactivity in the Plc group only (P collagen protein synthesis decreased after 2 wk of immobilization, whereas tendon stiffness and modulus were only marginally reduced, and NSAIDs had no influence upon this...
Collagen metabolism in obesity: the effect of weight loss
DEFF Research Database (Denmark)
Rasmussen, M H; Jensen, L T; Andersen, T
1995-01-01
OBJECTIVE: To investigate the impact of obesity, fat distribution and weight loss on collagen turnover using serum concentrations of the carboxyterminal propeptide of type I procollagen (S-PICP) and the aminoterminal propeptide of type III pro-collagen (S-PIIINP) as markers for collagen turnover...... an increased turnover of type III collagen related to obesity in general and to abdominal obesity in particular. S-PIIINP levels decreases during weight loss in obese subjects, whereas S-PICP levels seems un-related to obesity and weight loss....
The collagen receptor uPARAP/Endo180
DEFF Research Database (Denmark)
Engelholm, Lars H; Ingvarsen, Signe; Jürgensen, Henrik J
2009-01-01
The uPAR-associated protein (uPARAP/Endo180), a type-1 membrane protein belonging to the mannose receptor family, is an endocytic receptor for collagen. Through this endocytic function, the protein takes part in a previously unrecognized mechanism of collagen turnover. uPARAP/Endo180 can bind...... and internalize both intact and partially degraded collagens. In some turnover pathways, the function of the receptor probably involves an interplay with certain matrix-degrading proteases whereas, in other physiological processes, redundant mechanisms involving both endocytic and pericellular collagenolysis seem...... in collagen breakdown seems to be involved in invasive tumor growth Udgivelsesdato: 2009...
Marine-derived collagen biomaterials from echinoderm connective tissues
Ferrario, Cinzia
2016-03-31
The use of marine collagens is a hot topic in the field of tissue engineering. Echinoderms possess unique connective tissues (Mutable Collagenous Tissues, MCTs) which can represent an innovative source of collagen to develop collagen barrier-membranes for Guided Tissue Regeneration (GTR). In the present work we used MCTs from different echinoderm models (sea urchin, starfish and sea cucumber) to produce echinoderm-derived collagen membranes (EDCMs). Commercial membranes for GTR or soluble/reassembled (fibrillar) bovine collagen substrates were used as controls. The three EDCMs were similar among each other in terms of structure and mechanical performances and were much thinner and mechanically more resistant than the commercial membranes. Number of fibroblasts seeded on sea-urchin membranes were comparable to the bovine collagen substrates. Cell morphology on all EDCMs was similar to that of structurally comparable (reassembled) bovine collagen substrates. Overall, echinoderms, and sea urchins particularly, are alternative collagen sources to produce efficient GTR membranes. Sea urchins display a further advantage in terms of eco-sustainability by recycling tissues from food wastes.
Fabrication of homobifunctional crosslinker stabilized collagen for biomedical application
International Nuclear Information System (INIS)
Lakra, Rachita; Kiran, Manikantan Syamala; Sai, Korrapati Purna
2015-01-01
Collagen biopolymer has found widespread application in the field of tissue engineering owing to its excellent tissue compatibility and negligible immunogenicity. Mechanical strength and enzymatic degradation of the collagen necessitates the physical and chemical strength enhancement. One such attempt deals with the understanding of crosslinking behaviour of EGS (ethylene glycol-bis (succinic acid N-hydroxysuccinimide ester)) with collagen to improve the physico-chemical properties. The incorporation of a crosslinker during fibril formation enhanced the thermal and mechanical stability of collagen. EGS crosslinked collagen films exhibited higher denaturation temperature (T d ) and the residue left after thermogravimetric analysis was about 16 ± 5.2%. Mechanical properties determined by uniaxial tensile tests showed a threefold increase in tensile strength and Young’s modulus at higher concentration (100 μM). Water uptake capacity reduced up to a moderate extent upon crosslinking which is essential for the transport of nutrients to the cells. Cell viability was found to be 100% upon treatment with 100 μM EGS whereas only 30% viability could be observed with glutaraldehyde. Rheological studies of crosslinked collagen showed an increase in shear stress and shear viscosity at 37 °C. Crosslinking with EGS resulted in the formation of a uniform fibrillar network. Trinitrobenzene sulfonate (TNBS) assay confirmed that EGS crosslinked collagen by forming a covalent interaction with ε-amino acids of collagen. The homobifunctional crosslinker used in this study enhanced the effectiveness of collagen as a biomaterial for biomedical application. (paper)
Small-bowel permeability in collagenous colitis
DEFF Research Database (Denmark)
Wildt, Signe; Madsen, Jan L; Rumessen, Jüri J
2006-01-01
Collagenous colitis (CC) is a chronic inflammatory bowel disease that affects the colon. However, some patients with CC present with accompanying pathologic small-bowel manifestations such as coeliac disease, defects in bile acid absorption and histopathologic changes in small-intestinal biopsies......, indicating that CC is a pan-intestinal disease. In small-intestinal disease, the intestinal barrier function may be impaired, and the permeability of the small intestine altered. The purpose of this research was to study small-bowel function in patients with CC as expressed by intestinal permeability....
Prediction of collagen orientation in articular cartilage by a collagen remodeling algorithm
Wilson, W.; Driessen, N.J.B.; Donkelaar, van C.C.; Ito, K.
2006-01-01
Tissue engineering is a promising method to treat damaged cartilage. So far it has not been possible to create tissue-engineered cartilage with an appropriate structural organization. It is envisaged that cartilage tissue engineering will significantly benefit from knowledge of how the collagen
Gauza-Włodarczyk, Marlena; Kubisz, Leszek; Mielcarek, Sławomir; Włodarczyk, Dariusz
2017-11-01
The increased interest in fish collagen is a consequence of the risk of exposure to Creutzfeld-Jacob disease (CJD) and the bovine spongiform encephalopathy (BSE), whose occurrence is associated with prions carried by bovine collagen. Collagen is the main biopolymer in living organisms and the main component of the skin and bones. Until the discovery of the BSE, bovine collagen had been widely used. The BSE epidemic increased the interest in new sources of collagen such as fish skin collagen (FSC) and its properties. Although the thermal properties of collagen originating from mammals have been well described, less attention has been paid to the thermal properties of FSC. Denaturation temperature is a particularly important parameter, depending on the collagen origin and hydration level. In the reported experiment, the free water and bound water release processes along with thermal denaturation process were studied by means of the differential scanning calorimetry (DSC). Measurements were carried out using a DSC 7 instrument (Elmer-Perkin), in the temperature range 298-670K. The study material was FSC derived by acidic hydration method. The bovine Achilles tendon (BAT) collagen type I was used as the control material. The thermograms recorded revealed both, exothermic and endothermic peaks. For both materials, the peaks in the temperature range of 330-360K were assigned to the release of free water and bound water. The denaturation temperatures of FSC and BAT collagen were determined as 420K and 493K, respectively. Thermal decomposition process was observed at about 500K for FSC and at about 510K for BAT collagen. These results show that FSC is less resistant to high temperature than BAT collagen. Copyright © 2017 Elsevier B.V. All rights reserved.
Ameloblasts express type I collagen during amelogenesis.
Assaraf-Weill, N; Gasse, B; Silvent, J; Bardet, C; Sire, J Y; Davit-Béal, T
2014-05-01
Enamel and enameloid, the highly mineralized tooth-covering tissues in living vertebrates, are different in their matrix composition. Enamel, a unique product of ameloblasts, principally contains enamel matrix proteins (EMPs), while enameloid possesses collagen fibrils and probably receives contributions from both odontoblasts and ameloblasts. Here we focused on type I collagen (COL1A1) and amelogenin (AMEL) gene expression during enameloid and enamel formation throughout ontogeny in the caudate amphibian, Pleurodeles waltl. In this model, pre-metamorphic teeth possess enameloid and enamel, while post-metamorphic teeth possess enamel only. In first-generation teeth, qPCR and in situ hybridization (ISH) on sections revealed that ameloblasts weakly expressed AMEL during late-stage enameloid formation, while expression strongly increased during enamel deposition. Using ISH, we identified COL1A1 transcripts in ameloblasts and odontoblasts during enameloid formation. COL1A1 expression in ameloblasts gradually decreased and was no longer detected after metamorphosis. The transition from enameloid-rich to enamel-rich teeth could be related to a switch in ameloblast activity from COL1A1 to AMEL synthesis. P. waltl therefore appears to be an appropriate animal model for the study of the processes involved during enameloid-to-enamel transition, especially because similar events probably occurred in various lineages during vertebrate evolution.
Postnatal development of collagen structure in ovine articular cartilage
Directory of Open Access Journals (Sweden)
Kranenbarg Sander
2010-06-01
Full Text Available Abstract Background Articular cartilage (AC is the layer of tissue that covers the articulating ends of the bones in diarthrodial joints. Across species, adult AC shows an arcade-like structure with collagen predominantly perpendicular to the subchondral bone near the bone, and collagen predominantly parallel to the articular surface near the articular surface. Recent studies into collagen fibre orientation in stillborn and juvenile animals showed that this structure is absent at birth. Since the collagen structure is an important factor for AC mechanics, the absence of the adult Benninghoff structure has implications for perinatal AC mechanobiology. The current objective is to quantify the dynamics of collagen network development in a model animal from birth to maturity. We further aim to show the presence or absence of zonal differentiation at birth, and to assess differences in collagen network development between different anatomical sites of a single joint surface. We use quantitative polarised light microscopy to investigate properties of the collagen network and we use the sheep (Ovis aries as our model animal. Results Predominant collagen orientation is parallel to the articular surface throughout the tissue depth for perinatal cartilage. This remodels to the Benninghoff structure before the sheep reach sexual maturity. Remodelling of predominant collagen orientation starts at a depth just below the future transitional zone. Tissue retardance shows a minimum near the articular surface at all ages, which indicates the presence of zonal differentiation at all ages. The absolute position of this minimum does change between birth and maturity. Between different anatomical sites, we find differences in the dynamics of collagen remodelling, but no differences in adult collagen structure. Conclusions The collagen network in articular cartilage remodels between birth and sexual maturity from a network with predominant orientation parallel to the
Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S
2016-08-12
Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.
Saada, Ann; Shaag, Avraham; Elpeleg, Orly
2003-05-01
Decreased mitochondrial thymidine kinase (TK2) activity is associated with mitochondrial DNA (mtDNA) depletion and respiratory chain dysfunction and is manifested by isolated, fatal skeletal myopathy. Other tissues such as liver, brain, heart, and skin remain unaffected throughout the patients' life. In order to elucidate the mechanism of tissue specificity in the disease we have investigated the expression of the mitochondrial deoxynucleotide carrier, the mtDNA content and the activity of TK2 in mitochondria of various tissues. Our results suggest that low basal TK2 activity combined with a high requirement for mitochondrial encoded proteins in muscle predispose this tissue to the devastating effect of TK2 deficiency.
Directory of Open Access Journals (Sweden)
Surekha Bangal
2012-12-01
Full Text Available AbstractGyrate atrophy is a rare metabolic disease with autosomal recessive inheritance pattern characterised by hyperornithinemia and typical ocular findings. This report presents a 17-year-old intellectually challenged girl consulting for a progressive fall of visual acuity with night blindness. Fundus examination showed patches of chorioretinal atrophy with typical scalloped borders and peri vascular pigmentation in the equatorial region. Fundus fluroscein angiography revealed characteristic staining pattern. Other ocular associations included myopia and posterior sub capsular cataract. Progressive systemic proximal myopathy was one of the associated features. Dietary supplementation of vitamin B6 was advised.
Pieper, J.S.; Oosterhof, A.; Dijkstra, Pieter J.; Veerkamp, J.H.; van Kuppevelt, T.H.
1999-01-01
Porous collagen matrices with defined physical, chemical and biological characteristics are interesting materials for tissue engineering. Attachment of glycosaminoglycans (GAGs) may add to these characteristics and valorize collagen. In this study, porous type I collagen matrices were crosslinked
Directory of Open Access Journals (Sweden)
Joshua J. Todd
2018-03-01
Full Text Available The ryanodine receptor 1-related congenital myopathies (RYR1-RM comprise a spectrum of slow, rare neuromuscular diseases. Affected individuals present with a mild-to-severe symptomatology ranging from proximal muscle weakness, hypotonia and joint contractures to scoliosis, ophthalmoplegia, and respiratory involvement. Although there is currently no FDA-approved treatment for RYR1-RM, our group recently conducted the first clinical trial in this patient population (NCT02362425. This study aimed to characterize novel RYR1 variants with regard to genetic, laboratory, muscle magnetic resonance imaging (MRI, and clinical findings. Genetic and histopathology reports were obtained from participant’s medical records. Alamut Visual Software was used to determine if participant’s variants had been previously reported and to assess predicted pathogenicity. Physical exams, pulmonary function tests, T1-weighted muscle MRI scans, and blood measures were completed during the abovementioned clinical trial. Six novel variants (two de novo, three dominant, and one recessive were identified in individuals with RYR1-RM. Consistent with established RYR1-RM histopathology, cores were observed in all biopsies, except Case 6 who exhibited fiber-type disproportion. Muscle atrophy and impaired mobility with Trendelenburg gait were the most common clinical symptoms and were identified in all cases. Muscle MRI revealed substantial inter-individual variation in fatty infiltration corroborating the heterogeneity of the disease. Two individuals with dominant RYR1 variants exhibited respiratory insufficiency: a clinical symptom more commonly associated with recessive RYR1-RM cases. This study demonstrates that a genetics-led approach is suitable for the diagnosis of suspected RYR1-RM which can be corroborated through histopathology, muscle MRI and clinical examination.
The occurrence of deep pectoral myopathy in broilers and associated changes in breast meat quality.
Yalcin, S; Ozkan, S; Acar, M Comert; Meral, O
2018-02-01
1. Two experiments were conducted to determine the effect of slaughter weight on the incidence and intensity of deep pectoral myopathy (DPM) of M. pectoralis minor (p. minor muscle) in commercial conditions in Turkey and to evaluate the impact of DPM on meat quality traits of pectoralis major (p. major) muscle in broilers. 2. In Experiment 1, a total of 116 250 carcasses from 59 Ross-308 broiler flocks, classified according to slaughter weight as 2.0-2.2, 2.2-2.4, 2.4-2.6 and >2.6 kg, were evaluated for occurrence of DPM. In Experiment 2, p. major samples from unaffected broilers and each DPM stage were evaluated for meat quality, oxidant and antioxidant properties, nutritional value and fatty acid profile. DPM was characterised as 1: muscles with coagulative necrosis, 2: muscles with fibrous tissue texture and pink to plumb and 3: muscles with green necrotic area. 3. The average incidence of DPM was found to be 0.73% in Experiment 1 and independent of slaughter weight. 4. In Experiment 2, p. major muscle of broilers with DPM 1 and 2 had higher pH values with higher redness and drip loss. All DPM stages resulted in an increase in lipid content and malondialdehyde activity and lowered ash content of p. major muscle compared with unaffected birds. DPM 2 increased superoxide dismutase and glutathione peroxidase activities in M. p. major. The p. major of broilers with DPM had lower content of C18:2 conjugated linoleic and C20:3n-6 fatty acids than those of unaffected broilers. Lower Δ6 desaturase and thiosterase activities and 18:2n-6 to 18:3n-3 ratio were observed for all DPM stages compared to unaffected. 5. It was concluded that these changes obtained in p. major muscle of broilers with DPM might indicate biochemical characteristics of muscle degenerations.
Williams, R B; Grehan, M J; Hersch, M; Andre, J; Cook, I J
2003-01-01
Aims: In patients with inflammatory myopathy and dysphagia, our aims were to determine: (1) the diagnostic utility of clinical and laboratory indicators; (2) the biomechanical properties of the pharyngo-oesophageal segment; (3) the usefulness of pharyngeal videomanometry in distinguishing neuropathic from myopathic dysphagia; and (4) clinical outcome. Methods: Clinical, laboratory, and videomanometric assessment was performed in 13 patients with myositis and dysphagia, in 17 disease controls with dysphagia (due to proven CNS disease), and in 22 healthy age matched controls. The diagnostic accuracy of creatine kinase (CPK), erythrocyte sedimentation rate, antinuclear antibody, and electromyography (EMG) were compared with the gold standard muscle biopsy. The biomechanical properties of the pharyngo-oesophageal segment were assessed by videomanometry. Results: Mean time from dysphagia onset to the diagnosis of myositis was 55 months (range 1–180). One third had no extrapharyngeal muscle weakness; 25% had normal CPK, and EMG was unhelpful in 28%. Compared with neurogenic controls, myositis patients had more prevalent cricopharyngeal restrictive disorders (69% v 14%; p=0.0003), reduced upper oesophageal sphincter (UOS) opening (p=0.01), and elevated hypopharyngeal intrabolus pressures (p=0.001). Videomanometric features favouring a myopathic over a neuropathic aetiology were: preserved pharyngeal swallow response, complete UOS relaxation, and normal swallow coordination. The 12 month mortality was 31%. Conclusions: The notable lack of supportive clinical signs and significant false negative rates for laboratory tests contribute to the marked delay in diagnosis. The myopathic process is strongly associated with restricted sphincter opening suggesting that cricopharyngeal disruption is a useful adjunct to immunosuppressive therapy. The condition has a poor prognosis. PMID:12631653
Intravenous immune globulin in hereditary inclusion body myopathy: a pilot study
Directory of Open Access Journals (Sweden)
Dorward Heidi
2007-01-01
Full Text Available Abstract Background Hereditary Inclusion Body Myopathy (HIBM is an autosomal recessive, adult onset, non-inflammatory neuromuscular disorder with no effective treatment. The causative gene, GNE, codes for UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, which catalyzes the first two reactions in the synthesis of sialic acid. Reduced sialylation of muscle glycoproteins, such as α-dystroglycan and neural cell adhesion molecule (NCAM, has been reported in HIBM. Methods We treated 4 HIBM patients with intravenous immune globulin (IVIG, in order to provide sialic acid, because IgG contains 8 μmol of sialic acid/g. IVIG was infused as a loading dose of 1 g/kg on two consecutive days followed by 3 doses of 400 mg/kg at weekly intervals. Results For all four patients, mean quadriceps strength improved from 19.0 kg at baseline to 23.2 kg (+22% directly after IVIG loading to 25.6 kg (+35% at the end of the study. Mean shoulder strength improved from 4.1 kg at baseline to 5.9 kg (+44% directly after IVIG loading to 6.0 kg (+46% at the end of the study. The composite improvement for 8 other muscle groups was 5% after the initial loading and 19% by the end of the study. Esophageal motility and lingual strength improved in the patients with abnormal barium swallows. Objective measures of functional improvement gave variable results, but the patients experienced improvements in daily activities that they considered clinically significant. Immunohistochemical staining and immunoblotting of muscle biopsies for α-dystroglycan and NCAM did not provide consistent evidence for increased sialylation after IVIG treatment. Side effects were limited to transient headaches and vomiting. Conclusion The mild benefits in muscle strength experienced by HIBM patients after IVIG treatment may be related to the provision of sialic acid supplied by IVIG. Other sources of sialic acid are being explored as treatment options for HIBM.
Directory of Open Access Journals (Sweden)
A.C. Gimenes
2011-04-01
Full Text Available We determined the response characteristics and functional correlates of the dynamic relationship between the rate (Δ of oxygen consumption ( O2 and the applied power output (work rate = WR during ramp-incremental exercise in patients with mitochondrial myopathy (MM. Fourteen patients (7 males, age 35.4 ± 10.8 years with biopsy-proven MM and 10 sedentary controls (6 males, age 29.0 ± 7.8 years took a ramp-incremental cycle ergometer test for the determination of the O2 on-exercise mean response time (MRT and the gas exchange threshold (GET. The ΔO2/ΔWR slope was calculated up to GET (S1, above GET (S2 and over the entire linear portion of the response (S T. Knee muscle endurance was measured by isokinetic dynamometry. As expected, peak O2 and muscle performance were lower in patients than controls (P O2/ΔWR than controls, especially the S2 component (6.8 ± 1.5 vs 10.3 ± 0.6 mL·min-1·W-1, respectively; P O2/ΔWR (S T and muscle endurance, MRT-O2, GET and peak O2 in MM patients (P O2/ΔWR below 8 mL·min-1·W-1 had severely reduced peak O2 values (O2 had lower ΔO2/ΔWR (P O2/ΔWR is typically reduced in patients with MM, being related to increased functional impairment and higher cardiopulmonary stress.
Effect of Mechanical Stretching of the Skin on Collagen Fibril ...
African Journals Online (AJOL)
Stabilization of collagen fibres during development and through growth to maturation has now become fairly documented. In vitro effect of mechanical stretching of ratsf skin on oxidative deamination of ε-NH2-groups of lysine and hydroxylysine, and functional properties of its type . collagen were studied. Experiments were ...
Electrophoretic mobility patterns of collagen following laser welding
Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.
1991-06-01
Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.
Effects of recombinant human collagen VI from Escherichia coli on ...
African Journals Online (AJOL)
Jane
2011-07-20
Jul 20, 2011 ... In this study, we reported the cloning and over expression of a gene coding for human collagen peptide. (CP6) in Escherichia coli and investigated the protective effects of CP6 on UVA-irradiated human skin fibroblasts cells. The collagen peptide (CP6) was highly soluble and the expression level was.
Changes in collagen synthesis and degradation during skeletal muscle growth
International Nuclear Information System (INIS)
Laurent, G.J.; McAnulty, R.J.; Gibson, J.
1985-01-01
The changes in collagen metabolism during skeletal muscle growth were investigated by measuring rates of synthesis and degradation during stretch-induced hypertrophy of the anterior latissimus dorsi muscle of the adult chicken (Gallus domesticus). Synthesis rates were obtained from the uptake of tritiated proline injected intravenously with a flooding dose of unlabeled proline. Degradation of newly synthesized and ''mature'' collagen was estimated from the amount of hydroxyproline in the free pool as small molecular weight moieties. In normal muscle, the synthesis rate was 1.1 +/- 0.3%/day, with 49 +/- 7% of the newly produced collagen degraded rapidly after synthesis. During hypertrophy there was an increase of about fivefold in the rate of synthesis (P less than 0.01), a 60% decrease in the rate of degradation of newly synthesized collagen (P less than 0.02), and an increase of about fourfold in the amount of degradation of mature collagen (P less than 0.01). These results suggest an important role for degradative as well as synthetic processes in the regulation of collagen mass. They indicate that enhanced degradation of mature collagen is required for muscle growth and suggest a physiological role for the pathway whereby in normal muscle, a large proportion of newly produced collagen is rapidly degraded
Chitosan Cross-linked Reconstituted Amniotic Collagen Membrane ...
Indian Academy of Sciences (India)
First page Back Continue Last page Overview Graphics. Chitosan Cross-linked Reconstituted Amniotic Collagen Membrane – An Excellent Cell Substratum. The KERATINOCYTE proliferation and Differentiation into multiple layers is due to the presence of type - IV collagen in the amnion. Cultured FIBROBLASTS had good ...
The collagen microfibril model, a tool for biomaterials scientists
Animal hides, a major byproduct of the meat industry, are a rich source of collagen, a structural protein of the extracellular matrix that gives strength and form to the skin, tendons and bones of mammals. The structure of fibrous collagen, a long triple helix that self-associates in a staggered arr...
Postnatal development of collagen structure in ovine articular cartilage
Turnhout, van M.C.; Schipper, H.; Engel, B.; Buist, W.; Kranenbarg, S.; Leeuwen, van J.L.
2010-01-01
Background Articular cartilage (AC) is the layer of tissue that covers the articulating ends of the bones in diarthrodial joints. Across species, adult AC shows an arcade-like structure with collagen predominantly perpendicular to the subchondral bone near the bone, and collagen predominantly
Postnatal development of collagen structure in ovine articular cartilage
Turnhout, van M.C.; Schipper, H.; Engel, B.; Buist, W.; Kranenbarg, S.; Leeuwen, van J.L.
2010-01-01
BACKGROUND:Articular cartilage (AC) is the layer of tissue that covers the articulating ends of the bones in diarthrodial joints. Across species, adult AC shows an arcade-like structure with collagen predominantly perpendicular to the subchondral bone near the bone, and collagen predominantly
Collagen levels are normalized after decompression of experimentally obstructed colon
DEFF Research Database (Denmark)
Rehn, Martin; Ågren, Sven Per Magnus; Syk, I
2011-01-01
Our aim was to define the dynamics in collagen concentrations in the large bowel wall following decompression of experimental obstruction.......Our aim was to define the dynamics in collagen concentrations in the large bowel wall following decompression of experimental obstruction....
Fish collagen is an important panallergen in the Japanese population.
Kobayashi, Y; Akiyama, H; Huge, J; Kubota, H; Chikazawa, S; Satoh, T; Miyake, T; Uhara, H; Okuyama, R; Nakagawara, R; Aihara, M; Hamada-Sato, N
2016-05-01
Collagen was identified as a fish allergen in early 2000s. Although its allergenic potential has been suggested to be low, risks associated with collagen as a fish allergen have not been evaluated to a greater extent. In this study, we aimed to clarify the importance of collagen as a fish allergen. Our results showed that 50% of Japanese patients with fish allergy had immunoglobulin E (IgE) against mackerel collagen, whereas 44% had IgE against mackerel parvalbumin. IgE inhibition assay revealed high cross-reactivity of mackerel collagen to 22 fish species (inhibition rates: 87-98%). Furthermore, a recently developed allergy test demonstrated that collagen triggered IgE cross-linking on mast cells. These data indicate that fish collagen is an important and very common panallergen in fish consumed in Japan. The high rate of individuals' collagen allergy may be attributable to the traditional Japanese custom of raw fish consumption. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Preparation and structure characterization of soluble bone collagen ...
African Journals Online (AJOL)
In this study, G-25 gel chromatography, X-diffraction, scanning electron microscopy (SEM), UV and Fourier transform infrared spectroscopy (FTIR) were used to analyze soluble collagen peptides chelating calcium. Collagen peptide hydrolysis can be divided into four components using G-25 gel chromatography.
Penta-fibrillar assembly: A Building block collagen based materials
Indian Academy of Sciences (India)
There is a smartness in the way the penta-fibrils behave in collagen based biomaterials. It is one of the intriguing nano material with a size of about 4 nano meter diagonal size. There are several intermolecular forces that participate in the penta fibrillar assembly, which derive importance in smart behavior of collagen.
Collagenous colitis as a possible cause of toxic megacolon.
LENUS (Irish Health Repository)
Fitzgerald, S C
2009-03-01
Collagenous colitis is a microscopic colitis characterized by normal appearing colonic mucosa on endoscopy. It is regarded as a clinically benign disease which rarely results in serious complications. We report a case of toxic megacolon occurring in a patient with collagenous colitis. This is the first reported case of toxic megacolon occurring in this subset of patients.
Collagen synthesis in CBA mouse heart after total thoracic irradiation
International Nuclear Information System (INIS)
Murray, J.C.; Parkins, C.S.; Institute of Cancer Research, Sutton
1988-01-01
CBA mice were irradiated to the whole thorax with single doses of 240 kVp X-rays in the dose range 8-16 Gy. Collagen and total protein synthesis rates in the heart were measured at 2-monthly intervals using a radio-isotope incorporation techniques. Doses of 10 Gy or greater caused a slight increase in collagen synthesis, followed by significantly reduced collagen synthesis by 16 weeks or longer after treatment. The depression in synthesis appeared correspondingly earlier with increasing dose. Total protein synthesis in heart followed similar patterns although changes were not statistically significant, indicating that the changes reflected alterations to collagen synthesis specifally, and not protein synthesis in geneal. Total hydroxyproline measurements showed no significant changes in heart collagen at any time as a result of X-irradiation. 18 refs.; 7 figs
Second-harmonic generation imaging of collagen in ancient bone.
Thomas, B; McIntosh, D; Fildes, T; Smith, L; Hargrave, F; Islam, M; Thompson, T; Layfield, R; Scott, D; Shaw, B; Burrell, C L; Gonzalez, S; Taylor, S
2017-12-01
Second-harmonic generation imaging (SHG) captures triple helical collagen molecules near tissue surfaces. Biomedical research routinely utilizes various imaging software packages to quantify SHG signals for collagen content and distribution estimates in modern tissue samples including bone. For the first time using SHG, samples of modern, medieval, and ice age bones were imaged to test the applicability of SHG to ancient bone from a variety of ages, settings, and taxa. Four independent techniques including Raman spectroscopy, FTIR spectroscopy, radiocarbon dating protocols, and mass spectrometry-based protein sequencing, confirm the presence of protein, consistent with the hypothesis that SHG imaging detects ancient bone collagen. These results suggest that future studies have the potential to use SHG imaging to provide new insights into the composition of ancient bone, to characterize ancient bone disorders, to investigate collagen preservation within and between various taxa, and to monitor collagen decay regimes in different depositional environments.
Second-harmonic generation imaging of collagen in ancient bone
Directory of Open Access Journals (Sweden)
B. Thomas
2017-12-01
Full Text Available Second-harmonic generation imaging (SHG captures triple helical collagen molecules near tissue surfaces. Biomedical research routinely utilizes various imaging software packages to quantify SHG signals for collagen content and distribution estimates in modern tissue samples including bone. For the first time using SHG, samples of modern, medieval, and ice age bones were imaged to test the applicability of SHG to ancient bone from a variety of ages, settings, and taxa. Four independent techniques including Raman spectroscopy, FTIR spectroscopy, radiocarbon dating protocols, and mass spectrometry-based protein sequencing, confirm the presence of protein, consistent with the hypothesis that SHG imaging detects ancient bone collagen. These results suggest that future studies have the potential to use SHG imaging to provide new insights into the composition of ancient bone, to characterize ancient bone disorders, to investigate collagen preservation within and between various taxa, and to monitor collagen decay regimes in different depositional environments.
Collagen matrix as a tool in studying fibroblastic cell behavior.
Kanta, Jiří
2015-01-01
Type I collagen is a fibrillar protein, a member of a large family of collagen proteins. It is present in most body tissues, usually in combination with other collagens and other components of extracellular matrix. Its synthesis is increased in various pathological situations, in healing wounds, in fibrotic tissues and in many tumors. After extraction from collagen-rich tissues it is widely used in studies of cell behavior, especially those of fibroblasts and myofibroblasts. Cells cultured in a classical way, on planar plastic dishes, lack the third dimension that is characteristic of body tissues. Collagen I forms gel at neutral pH and may become a basis of a 3D matrix that better mimics conditions in tissue than plastic dishes.
Stability and cellular responses to fluorapatite-collagen composites.
Yoon, Byung-Ho; Kim, Hae-Won; Lee, Su-Hee; Bae, Chang-Jun; Koh, Young-Hag; Kong, Young-Min; Kim, Hyoun-Ee
2005-06-01
Fluorapatite (FA)-collagen composites were synthesized via a biomimetic coprecipitation method in order to improve the structural stability and cellular responses. Different amounts of ammonium fluoride (NH4F), acting as a fluorine source for FA, were added to the precipitation of the composites. The precipitated composites were freeze-dried and isostatically pressed in a dense body. The added fluorine was incorporated nearly fully into the apatite structure (fluoridation), and a near stoichiometric FA-collagen composite was obtained with complete fluoridation. The freeze-dried composites had a typical biomimetic network, consisting of collagen fibers and precipitates of nano-sized apatite crystals. The human osteoblast-like cells on the FA-collagen composites exhibited significantly higher proliferation and differentiation (according to alkaline phosphatase activity) than those on the hydroxyapatite-collagen composite. These enhanced osteoblastic cell responses were attributed to the fluorine release and the reduced dissolution rate.
Cervical Collagen Concentration within Fifteen Months after Delivery
DEFF Research Database (Denmark)
Sundtoft, Iben; Uldbjerg, Niels; Sommer, Steffe
2011-01-01
OBJECTIVE: Cervical collagen concentration decreases during pregnancy. The increased risk of preterm birth following a short interpregnancy interval may be explained by an incomplete remodeling of the cervix. The objective of this study was to describe the changes in cervical collagen concentration...... over 15 months following delivery. METHODS: The collagen concentrations were determined in cervical biopsies obtained from 15 women at 3, 6, 9, 12, and 15 months after delivery. RESULTS: The mean cervical collagen concentrations were 50, 59, 63, 65, and 65 % of dry weight (SD 4.2 – 6.5). This increase...... was statistically significant until month 9, but not between months 9 and 12. CONCLUSIONS: Low collagen concentrations in the uterine cervix may contribute to the association between a short interpregnancy interval and preterm birth....
Mechanical response of collagen molecule under hydrostatic compression
International Nuclear Information System (INIS)
Saini, Karanvir; Kumar, Navin
2015-01-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.
Mechanisms of lamellar collagen formation in connective tissues.
Ghazanfari, Samaneh; Khademhosseini, Ali; Smit, Theodoor H
2016-08-01
The objective of tissue engineering is to regenerate functional tissues. Engineering functional tissues requires an understanding of the mechanisms that guide the formation and evolution of structure in the extracellular matrix (ECM). In particular, the three-dimensional (3D) collagen fiber arrangement is important as it is the key structural determinant that provides mechanical integrity and biological function. In this review, we survey the current knowledge on collagen organization mechanisms that can be applied to create well-structured functional lamellar tissues and in particular intervertebral disc and cornea. Thus far, the mechanisms behind the formation of cross-aligned collagen fibers in the lamellar structures is not fully understood. We start with cell-induced collagen alignment and strain-stabilization behavior mechanisms which can explain a single anisotropically aligned collagen fiber layer. These mechanisms may explain why there is anisotropy in a single layer in the first place. However, they cannot explain why a consecutive collagen layer is laid down with an alternating alignment. Therefore, we explored another mechanism, called liquid crystal phasing. While dense concentrations of collagen show such behavior, there is little evidence that the conditions for liquid crystal phasing are actually met in vivo. Instead, lysyl aldehyde-derived collagen cross-links have been found essential for correct lamellar matrix deposition. Furthermore, we suggest that supra-cellular (tissue-level) shear stress may be instrumental in the alignment of collagen fibers. Understanding the potential mechanisms behind the lamellar collagen structure in connective tissues will lead to further improvement of the regeneration strategies of functional complex lamellar tissues. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mechanical response of collagen molecule under hydrostatic compression.
Saini, Karanvir; Kumar, Navin
2015-04-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials. Copyright © 2015 Elsevier B.V. All rights
Mechanical response of collagen molecule under hydrostatic compression
Energy Technology Data Exchange (ETDEWEB)
Saini, Karanvir, E-mail: karans@iitrpr.ac.in; Kumar, Navin
2015-04-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.
Rutenberg, Andrew D.; Brown, Aidan I.; Kreplak, Laurent
2016-08-01
Collagen fibril cross-sectional radii show no systematic variation between the interior and the periphery of fibril bundles, indicating an effectively constant rate of collagen incorporation into fibrils throughout the bundle. Such spatially homogeneous incorporation constrains the extracellular diffusion of collagen precursors from sources at the bundle boundary to sinks at the growing fibrils. With a coarse-grained diffusion equation we determine stringent bounds, using parameters extracted from published experimental measurements of tendon development. From the lack of new fibril formation after birth, we further require that the concentration of diffusing precursors stays below the critical concentration for fibril nucleation. We find that the combination of the diffusive bound, which requires larger concentrations to ensure homogeneous fibril radii, and lack of nucleation, which requires lower concentrations, is only marginally consistent with fully processed collagen using conservative bounds. More realistic bounds may leave no consistent concentrations. Therefore, we propose that unprocessed pC-collagen diffuses from the bundle periphery followed by local C-proteinase activity and subsequent collagen incorporation at each fibril. We suggest that C-proteinase is localized within bundles, at fibril surfaces, during radial fibrillar growth. The much greater critical concentration of pC-collagen, as compared to fully processed collagen, then provides broad consistency between homogeneous fibril radii and the lack of fibril nucleation during fibril growth.
Goodpasture's autoimmune disease - A collagen IV disorder.
Pedchenko, Vadim; Richard Kitching, A; Hudson, Billy G
2018-05-12
Goodpasture's (GP) disease is an autoimmune disorder characterized by the deposition of pathogenic autoantibodies in basement membranes of kidney and lung eliciting rapidly progressive glomerulonephritis and pulmonary hemorrhage. The principal autoantigen is the α345 network of collagen IV, which expression is restricted to target tissues. Recent discoveries include a key role of chloride and bromide for network assembly, a novel posttranslational modification of the antigen, a sulfilimine bond that crosslinks the antigen, and the mechanistic role of HLA in genetic susceptibility and resistance to GP disease. These advances provide further insights into molecular mechanisms of initiation and progression of GP disease and serve as a basis for developing of novel diagnostic tools and therapies for treatment of Goodpasture's disease. Copyright © 2017. Published by Elsevier B.V.
Subclinical pulmonary involvement in collagen vascular diseases
International Nuclear Information System (INIS)
Dansin, E.; Wallaert, B.; Jardin, M.R.; Remy, J.; Hatron, P.Y.; Tonnel, A.B.
1990-01-01
A recruitment of immune and inflammatory cells into alveolar spaces has been reported in patients with collagen vascular diseases (CVD) and a normal chest radiograph. These findings defined the concept of subclinical alveolitis (SCA). To determine whether SCA may be associated with CT signs of interstitial lung disease (ILD), the authors of this paper compared bronchoalveolar lavage (BAL) findings and high-resolution (HRCT) scans in 36 patients with CVD and normal chest radiographs (systemic sclerosis [SS, n = 21], rheumatoid arthritis [RA, n = 9], primary Sjogren's syndrome [PS, n = 6]). HRCT scans were obtained in supine and prone positions. Results of BAL revealed SCA in 17/36 patients (47%); lymphocyte SCA in 4/36 (24%); neutrophil SCA in 7/36 (41%); and mixed SCA in 6/36 (35%)
Cutaneous collagenous vasculopathy: A rare case report
Directory of Open Access Journals (Sweden)
Kinjal Deepak Rambhia
2016-01-01
Full Text Available Cutaneous collagenous vasculopathy (CCV is a distinct, rare, and underdiagnosed condition. We report a case of CCV in a 50-year-old woman presenting as asymptomatic, erythematous to hyperpigmented nonblanchable macules over both the lower extremities. The clinical differential diagnosis of the lesions was pigmented purpuric dermatoses (Schamberg's purpura and cutaneous small vessel vasculitis. Histology of the lesions revealed dilated superficial dermal vessels with abundant pink hyaline material in the vessel wall, which stained with periodic acid Schiff stain. The patient was diagnosed as CCV. This condition remains largely underdiagnosed and is commonly mistaken for pigmented purpuric dermatosis or generalized essential telangiectasia. Emphasis on the differentiation of CCV from its clinical and histological mimicks is made.
Corneal collagen crosslinking and pigment dispersion syndrome.
LaHood, Benjamin R; Moore, Sacha
2017-03-01
We describe the case of a keratoconus patient with pigment dispersion syndrome (PDS) who was treated for progressive corneal ectasia with corneal collagen crosslinking (CXL). Pigment dispersion syndrome has been shown to have associated morphologic changes of the corneal endothelium. Corneal CXL has the potential to cause toxicity to the corneal endothelium, and adjacent pigment might increase the likelihood of damage. In this case, the presence of PDS had no detrimental effect on the outcome of treatment, and no complications were observed at 12 months follow-up, indicating that it may be safe to perform corneal CXL in the setting of PDS. This is an important observation as the number of indications for corneal CXL grows. Copyright © 2017 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.
High-strength mineralized collagen artificial bone
Qiu, Zhi-Ye; Tao, Chun-Sheng; Cui, Helen; Wang, Chang-Ming; Cui, Fu-Zhai
2014-03-01
Mineralized collagen (MC) is a biomimetic material that mimics natural bone matrix in terms of both chemical composition and microstructure. The biomimetic MC possesses good biocompatibility and osteogenic activity, and is capable of guiding bone regeneration as being used for bone defect repair. However, mechanical strength of existing MC artificial bone is too low to provide effective support at human load-bearing sites, so it can only be used for the repair at non-load-bearing sites, such as bone defect filling, bone graft augmentation, and so on. In the present study, a high strength MC artificial bone material was developed by using collagen as the template for the biomimetic mineralization of the calcium phosphate, and then followed by a cold compression molding process with a certain pressure. The appearance and density of the dense MC were similar to those of natural cortical bone, and the phase composition was in conformity with that of animal's cortical bone demonstrated by XRD. Mechanical properties were tested and results showed that the compressive strength was comparable to human cortical bone, while the compressive modulus was as low as human cancellous bone. Such high strength was able to provide effective mechanical support for bone defect repair at human load-bearing sites, and the low compressive modulus can help avoid stress shielding in the application of bone regeneration. Both in vitro cell experiments and in vivo implantation assay demonstrated good biocompatibility of the material, and in vivo stability evaluation indicated that this high-strength MC artificial bone could provide long-term effective mechanical support at human load-bearing sites.
Directory of Open Access Journals (Sweden)
Bin Wang
2013-11-01
Full Text Available Acid soluble collagen (ASC from scales of croceine croaker (ASC-C was successfully isolated with the yield of 0.37% ± 0.08% (dry weight basis, and characterized as type I collagen on the basis of amino acid analysis and electrophoretic pattern. The antioxidant hydrolysate of ASC-C (ACH was prepared through a two-stage in vitro digestion (4-h trypsin followed by 4-h pepsin, and three antioxidant peptides (ACH-P1, ACH-P2, and ACH-P3 were further isolated from ACH using ultrafiltration, gel chromatography, and RP-HPLC, and their amino acid sequences were identified as GFRGTIGLVG (ACH-P1, GPAGPAG (ACH-P2, and GFPSG (ACH-P3. ACH-P1, ACH-P2, and ACH-P3 showed good scavenging activities on hydroxyl radical (IC50 0.293, 0.240, and 0.107 mg/mL, respectively, DPPH radical (IC50 1.271, 0.675, and 0.283 mg/mL, respectively, superoxide radical (IC50 0.463, 0.099, and 0.151 mg/mL, respectively, and ABTS radical (IC50 0.421, 0.309, and 0.210 mg/mL, respectively. ACH-P3 was also effectively against lipid peroxidation in the model system. The antioxidant activities of three collagen peptides were due to the presence of hydrophobic amino acid residues within the peptide sequences. The collagen peptides might be used as antioxidant for the therapy of diseases associated with oxidative stress, or reducing oxidative changes during storage.
International Nuclear Information System (INIS)
Dumitrascu, M.; Sima, E.; Minea, R.; Vancea, C.; Meltze, V.; Albu, M.G.
2011-01-01
Complete text of publication follows. The aim of the present study was to investigate the influence of electron beam irradiation on some blends of collagen-polyvinylpyrrolidone (PVP) and collagen-dextran (DEX). The blends were prepared by mixing different quantities of collagen, PVP and DEX in distilled water. After irradiation the obtained hydrogels were processed by controlled drying and freeze-drying. Both types of materials were characterized by FT-IR, FT-Raman, TG, DSC, water uptake and SEM. The intensity of the characteristic bands, in the range 2800-3600 cm -1 from FT-IR spectra, varied considerably as function of absorbed radiation dose. Raman spectra revealed the absence of the characteristic peak at 2700 cm -1 for irradiated blends at 30 kGy. Kinetic parameters were calculated from the TG, DTG and DSC data by means of isoconversion methods at different heating rates. Thereby a relation between absorbed radiation dose and activation energy was established. Water uptake studies were carried out in PBS solution (phosphate buffer saline) at 37 deg C and pH = 7.4 and the results revealed a decrease of the water uptake with increasing of absorbed radiation dose.