Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

Science.gov (United States)

de Oliveira, Rafael R; Nicholson, Wayne L

2016-01-01

To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

International Nuclear Information System (INIS)

Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

1993-01-01

Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

Directory of Open Access Journals (Sweden)

Sun Yuan

2006-02-01

Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

The Life-cycle of Operons

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

2005-11-18

Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

DEFF Research Database (Denmark)

Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

2008-01-01

The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

Science.gov (United States)

Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

2011-11-01

HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

A Coarse-Grained Biophysical Model of E. coli and Its Application to Perturbation of the rRNA Operon Copy Number

Science.gov (United States)

Tadmor, Arbel

2009-03-01

In this work a biophysical model of Escherichia coli is presented that predicts growth rate and an effective cellular composition from an effective, coarse-grained representation of its genome. We assume that E. coli is in a state of balanced exponential steady-state growth, growing in a temporally and spatially constant environment, rich in resources. We apply this model to a series of past measurements, where the growth rate and rRNA-to-protein ratio have been measured for seven E. coli strains with an rRNA operon copy number ranging from one to seven (the wild-type copy number). These experiments show that growth rate markedly decreases for strains with fewer than six copies. Using the model, we were able to reproduce these measurements. We show that the model that best fits these data suggests that the volume fraction of macromolecules inside E. coli is not fixed when the rRNA operon copy number is varied. Moreover, the model predicts that increasing the copy number beyond seven results in a cytoplasm densely packed with ribosomes and proteins. Assuming that under such overcrowded conditions prolonged diffusion times tend to weaken binding affinities, the model predicts that growth rate will not increase substantially beyond the wild-type growth rate, as indicated by other experiments. Our model therefore suggests that changing the rRNA operon copy number of wild-type E. coli cells growing in a constant rich environment does not substantially increase their growth rate. Other observations regarding strains with an altered rRNA operon copy number, such as nucleoid compaction and the rRNA operon feedback response, appear to be qualitatively consistent with this model. In addition, we discuss possible design principles suggested by the model and propose further experiments to test its validity.

Process strategies to improve heterologous protein production in Escherichia coli under lactose or IPTG induction

DEFF Research Database (Denmark)

Kilikian, B. V.; Surarez, I. D.; Liria, C. W.

2000-01-01

Cells of Escherichia coli BL21 bearing the chicken muscle Troponin C (TnC) gene under the control of the lacUV5 promoter were induced under different cultivation conditions and the consequences on growth and cell protein content were investigated. The type of inducer molecule (lactose or IPTG...... per gram dry cell weight (DCW), was achieved when isopropyl-beta-D-thiogalactoside (IPTG) was the inducer. Under lactose induction, a value of 96 mg per gram DCW was attained. However, the high metabolic load imposed by IPTG, when compared with lactose induction, as assessed by the cell protein...... content and stability, indicates that lactose is probably the most appropriate inducer for the synthesis of this heterologous protein. (C) 2000 Elsevier Science Ltd. All rights reserved....

Expression of the N2 fixation gene operon of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21.

Science.gov (United States)

Zhang, Lihong; Liu, Xiaomeng; Li, Xinxin; Chen, Sanfeng

2015-10-01

To investigate the transcription and translation and nitrogenase activity of the nine N2-fixing-gene (nif) operon (nifBHDKENXhesAnifX) of Paenibacillus sp. WLY78 under the control of the T7 promoter in Escherichia coli BL21 under different conditions. The Paenibacillus nif operon under the control of the T7 promoter is significantly transcribed and effectively translated in E. coli BL21 when grown in medium containing organic N compounds (yeast extract and Tryptone) or NH4+ by using RT-PCR and Western blot analysis. Transcription and translation of foreign nif genes in E. coli are not inhibited by environmental organic or inorganic N compounds or O2. However, contrary to transcription and translation, nitrogenase activity is 4% lower in the recombinant E. coli 78-32 compared to the native Paenibacillus sp. WLY78. The Paenibacillus nif operon under the control of T7 promoter enables E. coli BL21 to synthesize active nitrogenase. This study shows how the nif gene operon can be transferred to non-N2-fixing bacteria or to eukaryotic organelles.

Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Galas, D J; Branscomb, E W

1976-08-12

The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

Problem-Solving Test: Tryptophan Operon Mutants

Science.gov (United States)

Szeberenyi, Jozsef

2010-01-01

This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

Science.gov (United States)

Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

2014-09-01

Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

DEFF Research Database (Denmark)

Brøndsted, Lone; Atlung, Tove

1996-01-01

The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

Science.gov (United States)

Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

2014-07-08

We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

Evidence against the selfish operon theory.

Science.gov (United States)

Pál, Csaba; Hurst, Laurence D

2004-06-01

According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

The Life-cycle of Operons

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

2007-03-15

Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

Awakening sleeping beauty: production of propionic acid in Escherichia coli through the sbm operon requires the activity of a methylmalonyl-CoA epimerase.

Science.gov (United States)

Gonzalez-Garcia, Ricardo Axayacatl; McCubbin, Tim; Wille, Annalena; Plan, Manuel; Nielsen, Lars Keld; Marcellin, Esteban

2017-07-17

Propionic acid is used primarily as a food preservative with smaller applications as a chemical building block for the production of many products including fabrics, cosmetics, drugs, and plastics. Biological production using propionibacteria would be competitive against chemical production through hydrocarboxylation of ethylene if native producers could be engineered to reach near-theoretical yield and good productivity. Unfortunately, engineering propionibacteria has proven very challenging. It has been suggested that activation of the sleeping beauty operon in Escherichia coli is sufficient to achieve propionic acid production. Optimising E. coli production should be much easier than engineering propionibacteria if tolerance issues can be addressed. Propionic acid is produced in E. coli via the sleeping beauty mutase operon under anaerobic conditions in rich medium via amino acid degradation. We observed that the sbm operon enhances amino acids degradation to propionic acid and allows E. coli to degrade isoleucine. However, we show here that the operon lacks an epimerase reaction that enables propionic acid production in minimal medium containing glucose as the sole carbon source. Production from glucose can be restored by engineering the system with a methylmalonyl-CoA epimerase from Propionibacterium acidipropionici (0.23 ± 0.02 mM). 1-Propanol production was also detected from the promiscuous activity of the native alcohol dehydrogenase (AdhE). We also show that aerobic conditions are favourable for propionic acid production. Finally, we increase titre 65 times using a combination of promoter engineering and process optimisation. The native sbm operon encodes an incomplete pathway. Production of propionic acid from glucose as sole carbon source is possible when the pathway is complemented with a methylmalonyl-CoA epimerase. Although propionic acid via the restored succinate dissimilation pathway is considered a fermentative process, the engineered pathway

Fermentation of lactose to ethanol in cheese whey permeate and concentrated permeate by engineered Escherichia coli.

Science.gov (United States)

Pasotti, Lorenzo; Zucca, Susanna; Casanova, Michela; Micoli, Giuseppina; Cusella De Angelis, Maria Gabriella; Magni, Paolo

2017-06-02

Whey permeate is a lactose-rich effluent remaining after protein extraction from milk-resulting cheese whey, an abundant dairy waste. The lactose to ethanol fermentation can complete whey valorization chain by decreasing dairy waste polluting potential, due to its nutritional load, and producing a biofuel from renewable source at the same time. Wild type and engineered microorganisms have been proposed as fermentation biocatalysts. However, they present different drawbacks (e.g., nutritional supplements requirement, high transcriptional demand of recombinant genes, precise oxygen level, and substrate inhibition) which limit the industrial attractiveness of such conversion process. In this work, we aim to engineer a new bacterial biocatalyst, specific for dairy waste fermentation. We metabolically engineered eight Escherichia coli strains via a new expression plasmid with the pyruvate-to-ethanol conversion genes, and we carried out the selection of the best strain among the candidates, in terms of growth in permeate, lactose consumption and ethanol formation. We finally showed that the selected engineered microbe (W strain) is able to efficiently ferment permeate and concentrated permeate, without nutritional supplements, in pH-controlled bioreactor. In the conditions tested in this work, the selected biocatalyst could complete the fermentation of permeate and concentrated permeate in about 50 and 85 h on average, producing up to 17 and 40 g/l of ethanol, respectively. To our knowledge, this is the first report showing efficient ethanol production from the lactose contained in whey permeate with engineered E. coli. The selected strain is amenable to further metabolic optimization and represents an advance towards efficient biofuel production from industrial waste stream.

Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

Science.gov (United States)

Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

2013-07-01

Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Rapid customised operon assembly by yeast recombinational cloning.

Science.gov (United States)

Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

2017-06-01

We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

Energy Technology Data Exchange (ETDEWEB)

Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

2005-04-12

Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Kenyon, C.J.; Walker, G.C.

1988-05-01

Operon fusions in Escherichia coli were obtained that showed increased beta-galactosidase expression in response to treatment with the DNA-damaging agent mitomycin C. These fusions were generated by using the Mud(ApR, lac) vector to insert the lactose structural genes randomly into the bacterial chromosome. Induction of beta-galactosidase in these strains, which carried fusions of lac to these din (damage-inducible) loci, was (i) triggered by UV light as well as by mitomycin C and (ii) abolished by either a recA- or a lexA- mutation. Similar characteristics of induction were observed when the lactose genes were fused to a prophage lambda promoter by using Mud(ApR, lac). These results indicate that E. coli contains a set of genes that, like prophage lambda genes, are expressed in response to DNA-damaging agents and regulated by the recA and lexA gene products. These din genes map at five bacterial loci. One din::Mud(ApR, lac) insertion results in a UV-sensitive phenotype and may be within the uvrA transcriptional unit.

A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

Science.gov (United States)

Chopra, Paras; Bender, Andreas

The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

Radiation-induced tetramer-to-dimer transition of Escherichia coli lactose repressor

International Nuclear Information System (INIS)

Goffinont, S.; Davidkova, M.; Spotheim-Maurizot, M.

2009-01-01

The wild type lactose repressor of Escherichia coli is a tetrameric protein formed by two identical dimers. They are associated via a C-terminal 4-helix bundle (called tetramerization domain) whose stability is ensured by the interaction of leucine zipper motifs. Upon in vitro γ-irradiation the repressor losses its ability to bind the operator DNA sequence due to damage of its DNA-binding domains. Using an engineered dimeric repressor for comparison, we show here that irradiation induces also the change of repressor oligomerisation state from tetramer to dimer. The splitting of the tetramer into dimers can result from the oxidation of the leucine residues of the tetramerization domain.

Dynamics and bistability in a reduced model of the lac operon

Science.gov (United States)

Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

2004-06-01

It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

Science.gov (United States)

Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

2015-01-01

Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

Role of the Escherichia coli glnALG operon in regulation of ammonium transport

International Nuclear Information System (INIS)

Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

1986-01-01

Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

Detecting uber-operons in prokaryotic genomes.

Science.gov (United States)

Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

2006-01-01

We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

Science.gov (United States)

Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

2016-11-08

Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

Transcriptome dynamics-based operon prediction in prokaryotes.

Science.gov (United States)

Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

2014-05-16

Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

Science.gov (United States)

Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

2017-10-01

One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

Structural characterization of the Salmonella typhimurium LT2 umu operon

International Nuclear Information System (INIS)

Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

1990-01-01

The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli

OpenAIRE

Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent

2000-01-01

In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...

UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

International Nuclear Information System (INIS)

Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

1994-01-01

UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

Science.gov (United States)

Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

2013-11-01

Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA

DEFF Research Database (Denmark)

Poulsen, Peter; Jensen, Kaj Frank

1992-01-01

We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...

Mutagenic action of heavy ions on Escherichia coli cells

International Nuclear Information System (INIS)

Tokarova, B.; Amirtayev, K.G.; Kozubek, S.; Krasavin, E.A.

1989-01-01

Introduction of direct mutations in the lactose operon of E.coli cells by γ radiation and accelerated heavy ions with different LET was studied. The experiments were performed with the wide type polA and lexA strains. The quadratic dependence of the mutation rate on the dose of different radiation for the wild type strain and the polA mutant was observed. However different radiations showed different relative genetic effectiveness. The dependence of RGE on LET for the wild type and polA strain has a maximum. In the experiments with the lexA strain low mutation rates and linear dose-response dependences N m /N(D) were observed. The RGE falls down with increasing LET of ionizing radiation. 22 refs.; 5 figs.; 2 tabs

Adaptation of Escherichia coli to glucose promotes evolvability in lactose.

Science.gov (United States)

Phillips, Kelly N; Castillo, Gerardo; Wünsche, Andrea; Cooper, Tim F

2016-02-01

The selective history of a population can influence its subsequent evolution, an effect known as historical contingency. We previously observed that five of six replicate populations that were evolved in a glucose-limited environment for 2000 generations, then switched to lactose for 1000 generations, had higher fitness increases in lactose than populations started directly from the ancestor. To test if selection in glucose systematically increased lactose evolvability, we started 12 replay populations--six from a population subsample and six from a single randomly selected clone--from each of the six glucose-evolved founder populations. These replay populations and 18 ancestral populations were evolved for 1000 generations in a lactose-limited environment. We found that replay populations were initially slightly less fit in lactose than the ancestor, but were more evolvable, in that they increased in fitness at a faster rate and to higher levels. This result indicates that evolution in the glucose environment resulted in genetic changes that increased the potential of genotypes to adapt to lactose. Genome sequencing identified four genes--iclR, nadR, spoT, and rbs--that were mutated in most glucose-evolved clones and are candidates for mediating increased evolvability. Our results demonstrate that short-term selective costs during selection in one environment can lead to changes in evolvability that confer longer term benefits. © 2016 The Author(s). Evolution © 2016 The Society for the Study of Evolution.

Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

Science.gov (United States)

Crawford, I P; Han, C Y; Silverman, M

1991-01-01

The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

Sequence analysis of the Legionella micdadei groELS operon

DEFF Research Database (Denmark)

Hindersson, P; Høiby, N; Bangsborg, Jette Marie

1991-01-01

shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

Sugar transport across lactose permease probed by steered molecular dynamics

DEFF Research Database (Denmark)

Jensen, Morten Østergaard; Yin, Ying; Tajkhorshid, Emad

2007-01-01

Escherichia coli lactose permease (LacY) transports sugar across the inner membrane of the bacterium using the proton motive force to accumulate sugar in the cytosol. We have probed lactose conduction across LacY using steered molecular dynamics, permitting us to follow molecular and energetic...... details of lactose interaction with the lumen of LacY during its permeation. Lactose induces a widening of the narrowest parts of the channel during permeation, the widening being largest within the periplasmic half-channel. During permeation, the water-filled lumen of LacY only partially hydrates lactose......, forcing it to interact with channel lining residues. Lactose forms a multitude of direct sugar-channel hydrogen bonds, predominantly with residues of the flexible N-domain, which is known to contribute a major part of LacY's affinity for lactose. In the periplasmic half-channel lactose predominantly...

Temperature dependence of the multistability of lactose utilization network of Escherichia coli

Science.gov (United States)

Nepal, Sudip; Kumar, Pradeep

Biological systems are capable of producing multiple states out of a single set of inputs. Multistability acts like a biological switch that allows organisms to respond differently to different environmental conditions and hence plays an important role in adaptation to changing environment. One of the widely studied gene regulatory networks underlying the metabolism of bacteria is the lactose utilization network, which exhibits a multistable behavior as a function of lactose concentration. We have studied the effect of temperature on multistability of the lactose utilization network at various concentrations of thio-methylgalactoside (TMG), a synthetic lactose. We find that while the lactose utilization network exhibits a bistable behavior for temperature T >20° C , a graded response arises for temperature T lactose utilization network as a function of temperature and TMG concentration. Our results suggest that environmental conditions, in this case temperature, can alter the nature of cellular regulation of metabolism.

A modified consumer inkjet for spatiotemporal control of gene expression.

Directory of Open Access Journals (Sweden)

Daniel J Cohen

Full Text Available This paper presents a low-cost inkjet dosing system capable of continuous, two-dimensional spatiotemporal regulation of gene expression via delivery of diffusible regulators to a custom-mounted gel culture of E. coli. A consumer-grade, inkjet printer was adapted for chemical printing; E. coli cultures were grown on 750 microm thick agar embedded in micro-wells machined into commercial compact discs. Spatio-temporal regulation of the lac operon was demonstrated via the printing of patterns of lactose and glucose directly into the cultures; X-Gal blue patterns were used for visual feedback. We demonstrate how the bistable nature of the lac operon's feedback, when perturbed by patterning lactose (inducer and glucose (inhibitor, can lead to coordination of cell expression patterns across a field in ways that mimic motifs seen in developmental biology. Examples of this include sharp boundaries and the generation of traveling waves of mRNA expression. To our knowledge, this is the first demonstration of reaction-diffusion effects in the well-studied lac operon. A finite element reaction-diffusion model of the lac operon is also presented which predicts pattern formation with good fidelity.

Stochastic simulations of the tetracycline operon

Science.gov (United States)

2011-01-01

Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

Stochastic simulations of the tetracycline operon

Directory of Open Access Journals (Sweden)

Kaznessis Yiannis N

2011-01-01

Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

Simulating Results of Experiments on Gene Regulation of the Lactose Operon in Escherichia coli; a Problem-Solving Exercise.

Science.gov (United States)

Hitchen, Trevor; Metcalfe, Judith

1987-01-01

Describes a simulation of the results of real experiments which use different strains of Escherichia coli. Provides an inexpensive practical problem-solving exercise to aid the teaching and understanding of the Jacob and Monod model of gene regulation. (Author/CW)

Genome analysis of E. coli isolated from Crohn's disease patients.

Science.gov (United States)

Rakitina, Daria V; Manolov, Alexander I; Kanygina, Alexandra V; Garushyants, Sofya K; Baikova, Julia P; Alexeev, Dmitry G; Ladygina, Valentina G; Kostryukova, Elena S; Larin, Andrei K; Semashko, Tatiana A; Karpova, Irina Y; Babenko, Vladislav V; Ismagilova, Ruzilya K; Malanin, Sergei Y; Gelfand, Mikhail S; Ilina, Elena N; Gorodnichev, Roman B; Lisitsyna, Eugenia S; Aleshkin, Gennady I; Scherbakov, Petr L; Khalif, Igor L; Shapina, Marina V; Maev, Igor V; Andreev, Dmitry N; Govorun, Vadim M

2017-07-19

Escherichia coli (E. coli) has been increasingly implicated in the pathogenesis of Crohn's disease (CD). The phylogeny of E. coli isolated from Crohn's disease patients (CDEC) was controversial, and while genotyping results suggested heterogeneity, the sequenced strains of E. coli from CD patients were closely related. We performed the shotgun genome sequencing of 28 E. coli isolates from ten CD patients and compared genomes from these isolates with already published genomes of CD strains and other pathogenic and non-pathogenic strains. CDEC was shown to belong to A, B1, B2 and D phylogenetic groups. The plasmid and several operons from the reference CD-associated E. coli strain LF82 were demonstrated to be more often present in CDEC genomes belonging to different phylogenetic groups than in genomes of commensal strains. The operons include carbon-source induced invasion GimA island, prophage I, iron uptake operons I and II, capsular assembly pathogenetic island IV and propanediol and galactitol utilization operons. Our findings suggest that CDEC are phylogenetically diverse. However, some strains isolated from independent sources possess highly similar chromosome or plasmids. Though no CD-specific genes or functional domains were present in all CD-associated strains, some genes and operons are more often found in the genomes of CDEC than in commensal E. coli. They are principally linked to gut colonization and utilization of propanediol and other sugar alcohols.

Inactivation of the lactose permease of Escherichia coli by monochromatic ultraviolet light

Energy Technology Data Exchange (ETDEWEB)

Robb, F T; Peak, M J [Rhodes Univ., Grahamstown (South Africa)

1979-09-01

The lactose permease of E. coli was inactivated exponetially by seven wavelengths of monochromatic UV light. An action spectrum revealed that the shorter wavelengths (243, 290 and 313 nm) were much more efficient than longer wavelengths. Inactivation at 290 nm was most efficient and was not due to generalized membrane damage. The rate of counterflux of intracellular ..beta..-galactoside in response to externally added ..beta..-galactoside was slowed by 290 nm irradiation, indicating destruction of the facilitated diffusion mechanism. The induction of ..beta..-galactosidase and ..beta..-galactoside permease was co-ordinate both with and without pre-irradiation by 290 nm light. The ..beta.. galactosidase was approximately 26-fold more resistant to 290 nm than the permease. These results are discussed in terms of a greater sensitivity of membrane proteins to 290 nm light, which may be due to the role of aromatic amino acids in conferring stability to the permease in the membrane.

Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

Directory of Open Access Journals (Sweden)

Hiraku Takada

Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

Mathematical model of rhamnolipid production using E.coli bacteria

Science.gov (United States)

Adham, Muhammad Fariduddin; Apri, Mochamad; Moeis, Maelita Ramdani

2018-03-01

Rhamnolipid is one of biosurfactants that is widely used in many industries. Despite its wide use, production of rhamnolipid usually involves a pathogen that may endanger our health. To tackle this issue, in iGEM (International Genetically Engineered Machine) competition 2015, our team engineered Escherichia coli (E.coli) to produce rhamnolipid. The bacteria were then put into medium containing glucose and lactose. It turned out that bacteria E. coli produced lower rhamnolipid than that by pseudomonas, therefore a good strategy is required to improve their productivity. We present a mathematical model to describe the production of rhamnolipid by the engineered E coli. Using bifurcation analysis, the equilibrium points of the model and their stabilities were analyzed as the amount of lactose was varied. We show that the system produces bistability behavior for some interval values of lactose. From this analysis we found that to guarantee a high production of rhamnolipid, a high level of lactose is required. To maintain the productivity, however, it is sufficient to maintain the lactose level above a certain threshold value.

Curli Fibers Are Highly Conserved between Salmonella typhimurium and Escherichia coli with Respect to Operon Structure and Regulation

Science.gov (United States)

Römling, Ute; Bian, Zhao; Hammar, Mårten; Sierralta, Walter D.; Normark, Staffan

1998-01-01

Mouse-virulent Salmonella typhimurium strains SR-11 and ATCC 14028-1s express curli fibers, thin aggregative fibers, at ambient temperature on plates as judged by Western blot analysis and electron microscopy. Concomitantly with curli expression, cells develop a rough and dry colony morphology and bind the dye Congo red (called the rdar morphotype). Cloning and characterization of the two divergently transcribed operons required for curli biogenesis, csgBA(C) and csgDEFG, from S. typhimurium SR-11 revealed the same gene order and flanking genes as in Escherichia coli. The divergence of the curli region between S. typhimurium and E. coli at the nucleotide level is above average (22.4%). However, a high level of conservation at the protein level, which ranged from 86% amino acid homology for the fiber subunit CsgA to 99% homology for the lipoprotein CsgG, implies functional constraints on the gene products. Consequently, S. typhimurium genes on low-copy-number plasmids were able to complement respective E. coli mutants, although not always to wild-type levels. rpoS and ompR are required for transcriptional activation of (at least) the csgD promoter. The high degree of conservation at the protein level and the identical regulation patterns in E. coli and S. typhimurium suggest similar roles of curli fibers in the same ecological niche in the two species. PMID:9457880

Lactose carrier protein of Escherichia coli. Structure and expression of plasmids carrying the Y gene of the lac operon.

Science.gov (United States)

Teather, R M; Bramhall, J; Riede, I; Wright, J K; Fürst, M; Aichele, G; Wilhelm, U; Overath, P

1980-01-01

The previously described hybrid plasmid pC7 which carries lacI+O+delta(Z)Y+A+ on a 12.3 X 10(6)-Mr DNA fragment [Teather et al. (1978) Mol. Gen. Genet. 159, 239-248] was partially digested with the restriction endonuclease EcoRI under conditions reducing the recognition sequence to d(A-A-T-T) and ligated to the vector pB322. lac Y-carrying inserts of various sized (Mr 1.5-4.7 X 10(6)) were obtained. Hybrid plasmid pTE18 (2300-base-pair insert) carries part of the I (repressor) gene, the promotor-operator region, part of the Z (beta-galactosidase) gene, the Y (lactose carrier) gene and part of the A (transacetylase) gene. Upon induction of pTE18-harbouring strains the Y-gene product is expressed at a nearly constant rate for several generations and accumulates to a level of 12-16% of the total cytoplasmic membrane protein. Integration into the membrane leads to active carrier as judged by binding and transport measurements.

Uso de antimicrobianos como promotores de crescimento e resistência em isolados de Escherichia coli e de Enterobacteriaceae lactose-negativa da microflora fecal de frangos de corte

Directory of Open Access Journals (Sweden)

Pessanha R.P.

2001-01-01

Full Text Available Foram coletadas amostras de fezes de aves durante um ciclo de criação (45 dias e analisadas quantitativamente quanto à presença de Escherichia coli e de Enterobacteriaceae lactose-negativa (ELN. As contagens de colônias lactose-positivas e negativas foram realizadas em placas de ágar MacConkey e os isolados foram submetidos ao teste de susceptibilidade aos antimicrobianos in vitro, pela técnica de difusão em gel. Os números desses microrganismos estabilizaram-se na faixa de 10(6 UFC/g de fezes para E. coli, e de 10(5 UFC/g de fezes para ELN. A resistência e a multirresistência aos antimicrobianos de isolados de E. coli foram observadas em 98,6% e 65,7%, e nos de ELN em 98,1% e 84,6%, respectivamente. Os espectros de resistência de E. coli e ELN foram: 52 e 57% ao cloranfenicol, 51 e 67% à cefalotina, 48 e 84% à tetraciclina, 45 e 74% ao ácido nalidíxico, 42 e 57% à ampicilina, 28 e 55% a sulfametoxazol + trimetoprim e 26 e 22% à gentamicina, respectivamente. O estudo demonstrou que os frangos de corte podem funcionar como reservatórios de genes de resistência a antibióticos importantes em medicina veterinária e humana.

Dynamic model of gene regulation for the lac operon

International Nuclear Information System (INIS)

Angelova, Maia; Ben-Halim, Asma

2011-01-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Dynamic model of gene regulation for the lac operon

Energy Technology Data Exchange (ETDEWEB)

Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

2011-03-01

Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

International Nuclear Information System (INIS)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

2007-01-01

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

Characterization of the Leptospira interrogans S10-spc-alpha operon

NARCIS (Netherlands)

Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

2000-01-01

A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

Clinical implications of lactose malabsorption versus lactose intolerance.

Science.gov (United States)

Levitt, Michael; Wilt, Timothy; Shaukat, Aasma

2013-07-01

The majority of the world's adult population and an estimated 80 million Americans are hypolactasic and hence malabsorb ingested lactose. Although lactose malabsorption is easily identified, less readily assessed is the clinically important question of how often does this malabsorption induce symptoms. This review summarizes: (1) knowledge concerning the etiology and diagnosis of hypolactasia and the pathophysiology of the symptoms of lactose malabsorption and (2) the results of well-controlled trials of the symptomatic response of lactose malabsorbers to varying dosages of lactose and the efficacy of therapeutic interventions to alleviate these symptoms. We conclude that the clinical significance of lactose malabsorption has been overestimated by both the lay public and physicians in that commonly ingested doses of lactose (ie, the quantity in a cup of milk) usually do not cause perceptible symptoms when ingested with a meal. Symptoms occur when the lactose dosage exceeds that in a cup of milk or when lactose is ingested without other nutrients. Simple dietary instruction, rather than the use of commercial products to reduce lactose intake, is recommended for the vast majority of lactose-malabsorbing subjects.

Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

DEFF Research Database (Denmark)

Danielsen, S; Kilstrup, M; Barilla, K

1992-01-01

. A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

The conserved nhaAR operon is drastically divergent between B2 and non-B2 Escherichia coli and is involved in extra-intestinal virulence.

Science.gov (United States)

Lescat, Mathilde; Reibel, Florence; Pintard, Coralie; Dion, Sara; Glodt, Jérémy; Gateau, Cecile; Launay, Adrien; Ledda, Alice; Cruveiller, Stephane; Cruvellier, Stephane; Tourret, Jérôme; Tenaillon, Olivier

2014-01-01

The Escherichia coli species is divided in phylogenetic groups that differ in their virulence and commensal distribution. Strains belonging to the B2 group are involved in extra-intestinal pathologies but also appear to be more prevalent as commensals among human occidental populations. To investigate the genetic specificities of B2 sub-group, we used 128 sequenced genomes and identified genes of the core genome that showed marked difference between B2 and non-B2 genomes. We focused on the gene and its surrounding region with the strongest divergence between B2 and non-B2, the antiporter gene nhaA. This gene is part of the nhaAR operon, which is in the core genome but flanked by mobile regions, and is involved in growth at high pH and high sodium concentrations. Consistently, we found that a panel of non-B2 strains grew faster than B2 at high pH and high sodium concentrations. However, we could not identify differences in expression of the nhaAR operon using fluorescence reporter plasmids. Furthermore, the operon deletion had no differential impact between B2 and non-B2 strains, and did not result in a fitness modification in a murine model of gut colonization. Nevertheless, sequence analysis and experiments in a murine model of septicemia revealed that recombination in nhaA among B2 strains was observed in strains with low virulence. Finally, nhaA and nhaAR operon deletions drastically decreased virulence in one B2 strain. This effect of nhaAR deletion appeared to be stronger than deletion of all pathogenicity islands. Thus, a population genetic approach allowed us to identify an operon in the core genome without strong effect in commensalism but with an important role in extra-intestinal virulence, a landmark of the B2 strains.

Lactose Intolerance

Science.gov (United States)

Lactose intolerance means that you cannot digest foods with lactose in them. Lactose is the sugar found in ... find out if your problems are due to lactose intolerance. Lactose intolerance is not serious. Eating less food ...

Mutagenic effect of the decay of 32P incorporated in mRNA

International Nuclear Information System (INIS)

Zakharov, I.A.; Korolev, V.G.; Gracheva, L.M.

1978-01-01

32 P decay in mRNA transcribed using the Escherichia coli lactose operone leads to an authentic increase of Lac - mutants frequency as compared to the check. The principle possibility of the realization of directed mutagenesis using molecules labeled with radioactive isotopes connected with certain RNA units is shown

Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

DEFF Research Database (Denmark)

Givskov, M; Eberl, L; Christiansen, Gunna

1995-01-01

. Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

[Lactose-containing tablets for patients with lactose intolerance?].

Science.gov (United States)

Picksak, Gesine; Stichtenoth, Dirk O

2009-01-01

Lactose is often used as an excipient in tablets because of its ideal characteristics. Most patients with lactose intolerance tolerate small amounts of lactose. However, the nocebo effect must be considered. Thus, patients should be informed about the very small amounts of lactose in the medication. If the patient is still suffering from gastrointestinal symptoms and there is no lactose-free alternative, the enzyme lactase can be substituted individually.

Mutagenic effect of the decay of /sup 32/P incorporated in mRNA

Energy Technology Data Exchange (ETDEWEB)

Zakharov, I A; Korolev, V G; Gracheva, L M [AN SSSR, Leningrad. Inst. Yadernoj Fiziki

1978-10-01

/sup 32/P decay in mRNA transcribed using the Escherichia coli lactose operone leads to an authentic increase of Lac/sup -/ mutants frequency as compared to the check. The principle possibility of the realization of directed mutagenesis using molecules labeled with radioactive isotopes connected with certain RNA units is shown.

Genetic variability of E. coli in southeastern reservoirs

International Nuclear Information System (INIS)

Kasweck, K.L.; Fliermans, C.B.

1978-01-01

The data indicate that there is an emergence of a lactose negative population in chambers containing a predominately lactose positive population when that population is subjected to conditions peculiar to the heated effluent from a nuclear production reactor. The effect is more than a temperature phenomenon, because E. coli colonies placed in chambers subjected to similar temperatures in other natural systems did not vary in their lactose utilization characteristics. Additionally, chambers placed in deeper cooler waters varied in their lactose characteristic but to a slower degree than the overlying epilimnion waters. Regardless of the cause of the lactose change, the result is that standard methods do not easily detect or quantitate E. coli in Par Pond waters. The assessment of water quality based on fecal coliform measurements in lakes similar to Par Pond would result in data that would indicate that the water quality of such lakes is better than it really is

A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

Science.gov (United States)

Zhu, Y; Lin, E C

1988-05-01

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

Subjective perception of lactose intolerance does not always indicate lactose malabsorption.

Science.gov (United States)

Casellas, Francesc; Aparici, Anna; Casaus, Maite; Rodríguez, Purificación; Malagelada, Juan R

2010-07-01

Symptomatic lactose intolerance is common; however, abdominal symptoms that patients experience after ingestion of lactose-containing foods can have causes beyond lactose malabsorption. We aimed to determine whether symptoms that patients usually attribute to lactose intolerance are comparable to symptoms provoked by a controlled lactose challenge and whether these symptoms are related to lactose absorption capacity. We performed an observational, prospective, transverse study of 353 patients referred for a lactose hydrogen breath test (HBT). Patients completed a validated questionnaire about symptoms associated with consumption of dairy products at home (home symptoms). After a 50-g lactose breath test, they completed the same questionnaire again (lactose challenge symptoms). Patients were assigned to groups of absorbers or malabsorbers according to HBT results and tolerants or intolerants according to the results of the questionnaire. The total symptom score was significantly higher for home symptoms than for the lactose challenge (16 vs 8, P lactose challenge for lactose absorbers compared with malabsorbers (16 vs 4, P lactose tolerants compared with intolerants (12 vs 2, P lactose intolerance at home was similar in men and women. Daily life symptoms that patients associate with lactose intolerance are often unrelated to lactose malabsorption. Even among true lactose malabsorbers, symptom recall tends to be amplified by the patient. Thus, conventional anamnesis is a highly unreliable tool to establish symptomatic lactose malabsorption. Copyright (c) 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

Surface area of lactose and lactose granulates on consolidation and compaction

OpenAIRE

Riepma, Klaas Alouis

1993-01-01

This dissertation discusses the effect of short time storage at different conditions on the strength and the specific BET surface area of lactose tablets. In addition, some aspects are studied of the consolidation and compaction properties of crystalline lactose fractions in heterogeneous systems. The crystalline lactose types used are: a-lactose monohydrate, anhydrous a-lactose, crystalline B-lactose and roller dried B-lactose. ... Zie: Summary

Effects of lactose as an inducer on expression of Helicobacter pylori rUreB and rHpaA,and Escherichia colirLTKA63 and rLTB

Institute of Scientific and Technical Information of China (English)

Jie Yan; Shou-Feng Zhao; Ya-Fei Mao; Yi-Hui Luo

2004-01-01

AIM: To demonstrate the effect of lactose as an inducer on expression of the recombinant proteins encoded by Helicobacter pylori ureB and hpaA, and Escherichia coli LTB and LTKA63 genes and to determine the optimal expression parameters.METHODS: By using SDS-PAGE and BIO-RAD gel image analysis system, the outputs of the target recombinant proteins expressed by pET32a-ureB-E. coliBL21, pET32ahpaA-E. coliBL21, pET32a-L TKA63-E. coliBL21 and pET32aLTB-E.coliBL21 were measured when using lactose as inducer at different dosages, original bacterial concentrations,various inducing temperatures and times. The results of the target protein expression induced by lactose were compared to those by isopropyl-β-D-thiogalactoside (IPTG).The proteins were expressed in E.coli.RESULTS: Lactose showed higher efficiency of inducing the expression of rHpaA, rUreB, rLTB and rLTKA63 than IPTG. The expression outputs of the target recombinant proteins induced at 37 ℃ were remarkably higher than those at 28 ℃. Other optimal expression parameters for the original bacterial concentrations, dosages of lactose and inducing time were 0.8, 50 g/L and 4 h for rHpaA; 0.8, 100 g/L and 4 h for rLTKA63; 1.2, 100 g/Land 5 h for both rUreB and rLTB, respectively.CONCLUSION: Lactose, a sugar with non-toxicity and low cost, is able to induce the recombinant genes to express the target proteins with higher efficiency than IPTG. The results in this study establish a beneficial foundation for industrial production of H pylori genetic engineering vaccine.

Genetic and biochemical analysis of peptide transport in Escherichia coli

International Nuclear Information System (INIS)

Andrews, J.C.

1986-01-01

E. coli peptide transport mutants have been isolated based on their resistance to toxic tripeptides. These genetic defects were found to map in two distinct chromosomal locations. The transport systems which require expression of the trp-linked opp genes and the oppE gene(s) for activity were shown to have different substrate preferences. Growth of E. coli in medium containing leucine results in increased entry of exogenously supplied tripeptides into the bacterial cell. This leucine-mediated elevation of peptide transport required expression of the trp-linked opp operon and was accompanied by increased sensitivity to toxic tripeptides, by an enhanced capacity to utilize nutritional peptides, and by an increase in both the velocity and apparent steady-state level of L-(U- 14 C)alanyl-L-alanyl-L-alanine accumulation for E. coli grown in leucine-containing medium relative to these parameters of peptide transport measured with bacteria grown in media lacking leucine. Direct measurement of opp operon expression by pulse-labeling experiments demonstrated that growth of E. coli in the presence of leucine resulted in increased synthesis of the oppA-encoded periplasmic binding protein. The transcriptional regulation of the trp-linked opp operon of E. coli was investigated using λ placMu51-generated lac operon fusions. Synthesis of β-galactosidase by strains harboring oppA-lac, oppB-lac, and oppD-lac fusions occurred at a basal level when the fusion-containing strains were grown in minimal medium

Mutational Analysis of the Escherichia coli melR Gene Suggests a Two-State Concerted Model To Explain Transcriptional Activation and Repression in the Melibiose Operon

OpenAIRE

Kahramanoglou, Christina; Webster, Christine L.; el-Robh, Mohamed Samir; Belyaeva, Tamara A.; Busby, Stephen J. W.

2006-01-01

Transcription of the Escherichia coli melAB operon is regulated by the MelR protein, an AraC family member whose activity is modulated by the binding of melibiose. In the absence of melibiose, MelR is unable to activate the melAB promoter but autoregulates its own expression by repressing the melR promoter. Melibiose triggers MelR-dependent activation of the melAB promoter and relieves MelR-dependent repression of the melR promoter. Twenty-nine single amino acid substitutions in MelR that res...

Lactose/whey utilization and ethanol production by transformed Saccharomyces cerevisiae cells.

Science.gov (United States)

Porro, D; Martegani, E; Ranzi, B M; Alberghina, L

1992-04-05

Strains of Saccharomyces cerevisiae transformed with a multicopy expression vector bearing both the Escherichia coli beta-galactosidase gene under the control of the upstream activating sequence of the GAL1-10 genes and the GAL4 activator gene release part of beta-galactosidase in the growth medium. This release is due to cell lysis of the older mother cells; the enzyme maintains its activity in buffered growth media. Fermentation studies with transformed yeast strains showed that the release of beta-galactosidase allowed an efficient growth on buffered media containing lactose as carbon source as well as on whey-based media. The transformed strains utilized up to 95% of the lactose and a high growth yield was obtained in rich media. High productions of ethanol were also observed in stationary phase after growth in lactose minimal media.

From 'lactose intolerance' to 'lactose nutrition'.

Science.gov (United States)

Lukito, Widjaja; Malik, Safarina G; Surono, Ingrid S; Wahlqvist, Mark L

2015-01-01

The concept of lactose intolerance has become embedded in Western medicine and developing economy medicine. It is based on evidence that intestinal lactase activity persists into later childhood and throughout life in only a minority of the world's population, notably northern European-derived populations. These people have the T single nucleotide polymorphism (SNP) of the rs49882359 allele (C/T), also known as C/T-13910, the MCM6 gene which positively influences the lactase LCT gene. Other lactase persistent (LP) populations are found in Africa and the Middle East with different genetic variants. These SNPs represent co-evolution with dairying since the agricultural revolution and nutrient-dependent ecological adaptation. That said, gastrointestinal symptoms considered due to small intestinal lactose malabsorption are poorly correlated with lactase non-persistence (LNP), the situation for most people. With LNP, colonic microbiome lactase enables lactose fermentation to occur so that none is found in faeces. Whether the short chain fatty acids (SCFAs) and gases (hydrogen, carbon dioxide and methane) produced cause symptoms is dose-dependent. Up to 25 g of lactose at any one time can usually be consumed by a LNP person, but its food and meal pattern context, the microbiomic characteristics, age and other factors may alter tolerance. Thus, the notion that lactose intolerance is a disorder or disease of LNP people is misplaced and has been one of cultural perspective. What actually matters is whether a particular dairy product as normally consumed give rise to symptoms. It is, therefore, proposed that lactose tolerance tests be replaced with dairy food tolerance tests.

[Lactose intolerance].

Science.gov (United States)

Rosado, Jorge L

2016-09-01

The most common problem limiting milk consumption worldwide is lactose intolerance (LI), which is defined as the experience of gastrointestinal symptoms due to the intake of lactose-containing food. When symptoms ensue the intake of milk, the condition is referred as milk intolerance, and it may or may not be due to LI. The most common cause of LI is primary lactase deficiency which occurs in 30% of Mexican adults when one glass of milk is consumed (12-18 g of lactose). LI occurs in less than 15% of adults after the intake of this dose of lactose. Another cause of lactose intolerance is due to secondary lactase deficiency, which occurs because lactase is reduced due to diseases that affect the intestinal mucosa. Lactose intolerance can be eliminated or significantly reduced by elimination or reduction of the intake of milk and milk containing products. Recent studies demonstrate that when β-casein-A1 contained in milk is hydrolyzed it produces β-casomorphine-7 which is an opioid associated with milk intolerance.

Coarse-grained Simulations of Sugar Transport and Conformational Changes of Lactose Permease

Science.gov (United States)

Liu, Jin; Jewel, S. M. Yead; Dutta, Prashanta

2016-11-01

Escherichia coli lactose permease (LacY) actively transports lactose and other galactosides across cell membranes through lactose/H+ symport process. Lactose/H+ symport is a highly complex process that involves sugar translocation, H+ transfer, as well as large-scale protein conformational changes. The complete picture of lactose/H+ symport is largely unclear due to the complexity and multiscale nature of the process. In this work, we develop the force field for sugar molecules compatible with PACE, a hybrid and coarse-grained force field that couples the united-atom protein models with the coarse-grained MARTINI water/lipid. After validation, we implement the new force field to investigate the transport of a β-D-galactopyranosyl-1-thio- β-D-galactopyranoside (TDG) molecule across a wild-type LacY during lactose/H+ symport process. Results show that the local interactions between TDG and LacY at the binding pocket are consistent with the X-ray experiment. Protonation of Glu325 stabilizes the TDG and inward-facing conformation of LacY. Protonation of Glu269 induces a dramatic protein structural reorganization and causes the expulsion of TDG from LacY to both sides of the membrane. The structural changes occur primarily in the N-terminal domain of LacY. This work is supported by NSF Grants: CBET-1250107 and CBET -1604211.

Genome Sequences of Two Copper-Resistant Escherichia coli Strains Isolated from Copper-Fed Pigs

DEFF Research Database (Denmark)

Lüthje, Freja L.; Hasman, Henrik; Aarestrup, Frank Møller

2014-01-01

The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances.......The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances....

Lactose Intolerance and Symptom Pattern of Lactose Intolerance among Healthy Volunteers.

Science.gov (United States)

Saha, Madhusudan; Parveen, Irin; Shil, Bimal Chandra; Saha, Shasanka Kumar; Banik, Ranjit Kumar; Majumder, Monojit; Salam, Mahjuba Umme; Islam, Asm Nazmul

2016-01-01

To see the prevalence of lactose intolerance (LI) and related symptoms following oral lactose challenge in healthy volunteers. Symptoms of abdominal pain, nausea, borborygmi, flatulence, and diarrhea were noted for 24 hours and blood glucose was estimated at 0 hour and 30 minutes after 25 gm oral lactose load to healthy volunteers. Failure to rise blood glucose level ≥ 1.1 mmol/l at 30 minutes after lactose intake from fasting level was taken as lactose malabsorption (LM), i.e., LI. A total of 166 volunteers (123 males, 43 females) with a mean age 34.78 ± 11.45 years participated in this study. Lactose intolerance was found among 85.54% (n = 142, M = 104, F = 38). The main symptoms of LI were diarrhea (n = 83, 58.4.0%), borborygmi (n = 81, 57.04%), abdominal pain (n = 35, 24.65%), and flatulence (n = 27, 19.0%). Lactose intolerance among healthy adults may be common in Bangladesh. Diarrhea and borborygmi were mostly associated symptoms of LI. Saha M, Parveen I, Shil BC, Saha SK, Banik RK, Majumder M, Salam MU, Nazmul Islam ASM. Lactose Intolerance and Symptom Pattern of Lactose Intolerance among Healthy Volunteers. Euroasian J Hepato-Gastroenterol 2016;6(1):5-7.

Radiation-induced tetramer-to-dimer transition of Esterichia coli lactose repressor

Czech Academy of Sciences Publication Activity Database

Goffinont, S.; Davídková, Marie; Spotheim-Maurizot, M.

2009-01-01

Roč. 386, č. 2 (2009), s. 300-304 ISSN 0006-291X R&D Projects: GA MŠk OC09012 Institutional research plan: CEZ:AV0Z10480505 Keywords : protein * DNA * radiation * oxidation * tetramer * dimer * lactose repressor Subject RIV: BO - Biophysics Impact factor: 2.548, year: 2009

[Lactose malabsorption and -intolerance - who will benefit from a lactose-reduced diet?

Science.gov (United States)

Malham, Mikkel; Olin, Anne Bille; Pærregaard, Anders

2017-02-06

During the last decade, lactose-free diets have become increasingly popular in the general population, either isolated or as a part of a cow's milk-free diet. However, health-related benefits from a lactose-free diet are only documented for individuals with clinical lactose intolerance due to decreased intestinal lactase activity and subsequent lactose malabsorption. In this paper we summarize the current knowledge of lactose intolerance regarding diagnostic procedures and treatment.

Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

Directory of Open Access Journals (Sweden)

Altenbuchner Josef

2011-10-01

Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

Science.gov (United States)

Stefanski, Katherine M.

A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

Effect of lactose on oro-cecal transit in lactose digesters and maldigesters

NARCIS (Netherlands)

He, T.; Priebe, M. G.; Welling, G. W.; Vonk, R. J.

2006-01-01

Background The transit time of the small intestine, in addition to lactase activity, may influence lactose digestion and thus play a role in the occurrence of lactose intolerance. The objectives of this study were to investigate the effect of lactose on the oro-cecal transit time (OCTT) in lactose

Molecular cloning of the recA analog from the marine fish pathogen Vibrio anguillarum 775

International Nuclear Information System (INIS)

Singer, J.T.

1989-01-01

The recA analog from Vibrio anguillarum 775 was isolated by complementation of recA mutations in Escherichia coli, and its protein product was identified. The recA analog promoted recombination between two partially deleted lactose operons, stimulated both spontaneous and mitomycin C-induced phage production in RecA- lambda lysogens, and restored near wild-type levels of resistance to UV radiation and methyl methanesulfonate

Lactose Intolerance (For Kids)

Science.gov (United States)

... Staying Safe Videos for Educators Search English Español Lactose Intolerance KidsHealth / For Kids / Lactose Intolerance What's in this ... LAK-tose in-TAHL-er-ents). What Is Lactose Intolerance? People who have lactose intolerance have trouble digesting ( ...

Lactose Intolerance (For Teens)

Science.gov (United States)

... Staying Safe Videos for Educators Search English Español Lactose Intolerance KidsHealth / For Teens / Lactose Intolerance What's in this ... t really consider it a disease. Who Gets Lactose Intolerance? A person may be or may become lactose ...

D-Allose catabolism of Escherichia coli

DEFF Research Database (Denmark)

Poulsen, Tim S.; Chang, Ying-Ying; Hove-Jensen, Bjarne

1999-01-01

Genes involved in allose utilization of Escherichia coli K-12 are organized in at least two operons, alsRBACE and alsI, located next to each other on the chromosome but divergently transcribed. Mutants defective in alsI (allose 6-phosphate isomerase gene) and alsE (allulose 6-phosphate epimerase...... gene) were Als-. Transcription of the two allose operons, measured as β-galactosidase activity specified by alsI-lacZ+ or alsE-lacZ+ operon fusions, was induced by allose. Ribose also caused derepression of expression of the regulon under conditions in which ribose phosphate catabolism was impaired....

Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

DEFF Research Database (Denmark)

Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E

2015-01-01

Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

OpenAIRE

Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

1993-01-01

CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

Science.gov (United States)

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

Selective and sensitive determination of lactose in low-lactose dairy products with HPAEC-PAD.

Science.gov (United States)

van Scheppingen, Wibo B; van Hilten, Piet H; Vijverberg, Marieke P; Duchateau, Alexander L L

2017-08-15

The demand for low lactose dairy products is increasing and more different lactose free food is commercially available. The level of lactose in these products decreased during the last years and nowadays a concentration of lactose free". For the determination of the lactose concentrations in these dairy products a sensitive analysis method is needed. We developed a method for the determination of low concentrations of lactose in a wide range of dairy products. A simple sample preparation with dilution, centrifugation and ultrafiltration is efficient for the isolation of lactose from the sample matrix. In this paper, a new HPAEC-PAD analysis on a CarboPac PA100 column gives a good separation of lactose from the other saccharides. This separation in combination with the PAD detector yields a selective and sensitive method for the quantification at the desired concentrations of lactose in low lactose dairy products. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

2015-01-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

Science.gov (United States)

Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

2015-09-01

The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Isolation and characterization of mutant strains of Escherichia coli altered in H2 metabolism

International Nuclear Information System (INIS)

Lee, J.H.; Patel, P.; Sankar, P.; Shanmugam, K.T.

1985-01-01

A positive selection procedure is described for the isolation of hydrogenase-defective mutant strains of Escherichia coli. Mutant strains isolated by this procedure can be divided into two major classes. Class II mutants produced hydrogenase activity (determined by using a tritium-exchange assay) and formate hydrogenlyase activity but lacked the ability to reduce benzyl viologen or fumarate with H 2 as the electron donor. Class I mutants failed to produce active hydrogenase and hydrogenase-dependent activities. All the mutant strains produced detectable levels of formate dehydrogenase-1 and -2 and fumarate reductase. The mutation in class I mutants mapped near 65 min of the E. coli chromosome, whereas the mutation in class II mutants mapped between srl and cys operons (58 and 59 min, respectively) in the genome. The class II Hyd mutants can be further subdivided into two groups (hydA and hydB) based on the cotransduction characteristics with cys and srl. These results indicate that there are two hyd operons and one hup operon in the E. coli chromosome. The two hyd operons are needed for the production of active hydrogenase, and all three are essential for hydrogen-dependent growth of the cell

Reproducible gene targeting in recalcitrant Escherichia coli isolates

Directory of Open Access Journals (Sweden)

De Greve Henri

2011-06-01

Full Text Available Abstract Background A number of allele replacement methods can be used to mutate bacterial genes. For instance, the Red recombinase system of phage Lambda has been used very efficiently to inactivate chromosomal genes in E. coli K-12, through recombination between regions of homology. However, this method does not work reproducibly in some clinical E. coli isolates. Findings The procedure was modified by using longer homologous regions (85 bp and 500-600 bp, to inactivate genes in the uropathogenic E. coli strain UTI89. An lrhA regulator mutant, and deletions of the lac operon as well as the complete type 1 fimbrial gene cluster, were obtained reproducibly. The modified method is also functional in other recalcitrant E. coli, like the avian pathogenic E. coli strain APEC1. The lrhA regulator and lac operon deletion mutants of APEC1 were successfully constructed in the same way as the UTI89 mutants. In other avian pathogenic E. coli strains (APEC3E, APEC11A and APEC16A it was very difficult or impossible to construct these mutants, with the original Red recombinase-based method, with a Red recombinase-based method using longer (85 bp homologous regions or with our modified protocol, using 500 - 600 bp homologous regions. Conclusions The method using 500-600 bp homologous regions can be used reliably in some clinical isolates, to delete single genes or entire operons by homologous recombination. However, it does not invariably show a greater efficiency in obtaining mutants, when compared to the original Red-mediated gene targeting method or to the gene targeting method with 85 bp homologous regions. Therefore the length of the homology regions is not the only limiting factor for the construction of mutants in these recalcitrant strains.

Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

Science.gov (United States)

Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

2014-10-01

Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

Identification of lactose phosphotransferase systems in Lactobacillus gasseri ATCC 33323 required for lactose utilization.

Science.gov (United States)

Francl, Alyssa L; Hoeflinger, Jennifer L; Miller, Michael J

2012-04-01

Improving the annotation of sugar catabolism-related genes requires functional characterization. Our objective was to identify the genes necessary for lactose utilization by Lactobacillus gasseri ATCC 33323 (NCK334). The mechanism of lactose transport in many lactobacilli is a lactose/galactose-specific permease, yet no orthologue was found in NCK334. Characterization of an EI knockout strain [EI (enzyme I) is required for phosphotransferase system transporter (PTS) function] demonstrated that L. gasseri requires PTS(s) to utilize lactose. In order to determine which PTS(s) were necessary for lactose utilization, we compared transcript expression profiles in response to lactose for the 15 complete PTSs identified in the NCK334 genome. PTS 6CB (LGAS_343) and PTS 8C (LGAS_497) were induced in the presence of lactose 107- and 53-fold, respectively. However, L. gasseri ATCC 33323 PTS 6CB, PTS 8C had a growth rate similar to that of the wild-type on semisynthetic deMan, Rogosa, Sharpe (MRS) medium with lactose. Expression profiles of L. gasseri ATCC 33323 PTS 6CB, PTS 8C in response to lactose identified PTS 9BC (LGAS_501) as 373-fold induced, whereas PTS 9BC was not induced in NCK334. Elimination of growth on lactose required the inactivation of both PTS 6CB and PTS 9BC. Among the six candidate phospho-β-galactosidase genes present in the NCK334 genome, LGAS_344 was found to be induced 156-fold in the presence of lactose. In conclusion, we have determined that: (1) NCK334 uses a PTS to import lactose; (2) PTS 6CB and PTS 8C gene expression is strongly induced by lactose; and (3) elimination of PTS 6CB and PTS 9BC is required to prevent growth on lactose.

Enzymic lactose hydrolysis

Energy Technology Data Exchange (ETDEWEB)

Miller, J J; Brand, J C

1980-01-01

Acid or enzymic hydrolysis can be used to hydrolyze lactose. Advantages of both are compared and details of enzymic hydrolysis using yeast or fungal enzymes given. The new scheme outlined involves recycling lactase. Because lactose and lactase react to ultrafiltration (UF) membranes differently separation is possible. Milk or milk products are ultrafiltered to separate a concentrate from a lactose-rich permeate which is treated with lactase in a reactor until hydrolysis reaches a required level. The lactase can be removed by UF as it does not permeate the membrane, and it is recycled back to the reactor. Permeate from the second UF stage may or may not be recombined with the concentrate from the first stage to produce a low lactose product (analysis of a typical low-lactose dried whole milk is given). Batch or continuous processes are explained and a batch process without enzyme recovery is discussed. (Refs. 4).

Improved clinical tolerance to chronic lactose ingestion in subjects with lactose intolerance: a placebo effect?

Science.gov (United States)

Briet, F; Pochart, P; Marteau, P; Flourie, B; Arrigoni, E; Rambaud, J

1997-01-01

Background—Uncontrolled studies of lactose intolerant subjects have shown that symptom severity decreases after chronic lactose consumption. Adaptation of the colonic flora might explain this improvement. 
Aims—To compare the effects of regular administration of either lactose or sucrose on clinical tolerance and bacterial adaptation to lactose. 
Methods—Forty six lactose intolerant subjects underwent two 50 g lactose challenges on days 1 and 15. Between these days they were given 34 g of lactose or sucrose per day, in a double blind protocol. Stool samples were obtained on days 0 and 14, to measure faecal β-galactosidase and pH. Symptoms, breath H2 excretion, faecal weight and electrolytes, and orofaecal transit time were assessed. 
Results—Except for faecal weight, symptoms were significantly milder during the second challenge in both groups, and covariance analysis showed no statistical difference between them. In the lactose group, but not in the sucrose group, faecal β-galactosidase activity increased, pH dropped, and breath H2 excretion decreased. 
Conclusion—Bacterial adaptation occurred when lactose intolerant subjects ingested lactose for 13 days, and all symptoms except diarrhoea regressed. Clinical improvement was also observed in the control group which displayed no signs of metabolic adaptation. This suggests that improved clinical tolerance may be just a placebo effect. 

 Keywords: lactose; lactose intolerance; colonic adaptation; lactase deficiency PMID:9414969

Lactose Intolerance (For Parents)

Science.gov (United States)

... to the diet. If you think that your child has a lactose intolerance, call your doctor. Who Gets Lactose Intolerance? Lactose intolerance is more common among people of Asian, African, Native American, and Hispanic descent. For most people ...

REMap: Operon Map of M. tuberculosis

Science.gov (United States)

Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

2016-01-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

Science.gov (United States)

Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

2002-01-01

Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

ProOpDB: Prokaryotic Operon DataBase.

Science.gov (United States)

Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

2012-01-01

The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

Cloning, purification, crystallization and preliminary crystallographic analysis of LsrR from Escherichia coli

International Nuclear Information System (INIS)

Liu, Xiaotian; Wu, Minhao; Sun, Demeng; Zang, Jianye

2010-01-01

The E. coli transcription repressor LsrR has been overexpressed, purified and crystallized. Diffraction data were collected to about 3 Å resolution. In Escherichia coli, the lsr operon is composed of six genes lsrACDBFG which regulate uptake and modification of the signalling molecule AI-2. LsrR is a repressor of the lsr operon and itself, which can bind phospho-AI-2 and be released from the promoter region of the operon and thus activate gene expression. LsrR fused with an HHHHHH sequence at the C-terminus was expressed, purified and crystallized in order to determine its structure and elucidate the molecular mechanism of repression. The crystal belonged to space group I222, with unit-cell parameters a = 79.84, b = 116.65, c = 186.04 Å, and was estimated to contain two protein molecules per asymmetric unit

Undernourished Children and Milk Lactose.

Science.gov (United States)

Grenov, Benedikte; Briend, André; Sangild, Per T; Thymann, Thomas; Rytter, Maren H; Hother, Anne-Louise; Mølgaard, Christian; Michaelsen, Kim F

2016-03-01

Lactose is an important energy source in young mammals, and in fully breast-fed human infants, it constitutes around 40% of the total daily energy intake. The role of lactose in feeding of undernourished infants and young children is not well described. A narrative review of the potential positive and negative effects of lactose in the treatment of undernourished children. Searches were conducted using PUBMED and Web of Science up to July 2015. Relevant references in the retrieved articles were included. Lactose may exhibit several health benefits in young children, including a prebiotic effect on the gut microbiota and a positive effect on mineral absorption. Studies in piglets suggest there might also be a stimulating effect on growth, relative to other carbohydrates. Lactose intolerance is a potential concern for undernourished children. Most undernourished children seem to tolerate the currently recommended (low lactose level) therapeutic foods well. However, a subgroup of severely undernourished children with secondary lactase deficiency due to severe diarrhea or severe enteropathy may benefit from products with even more restricted lactose content. At limited extra costs, lactose or lactose-containing milk ingredients may have beneficial effects if added to food products for undernourished children. Lactose may be an overlooked beneficial nutrient for young and undernourished children. Research is needed to define the balance between beneficial and detrimental effects of lactose in undernourished children at different ages and with different degrees of diarrhea and intestinal integrity. © The Author(s) 2016.

The relative value of operon predictions

NARCIS (Netherlands)

Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

Lactose tolerance tests

Science.gov (United States)

Hydrogen breath test for lactose tolerance ... Two common methods include: Lactose tolerance blood test Hydrogen breath test The hydrogen breath test is the preferred method. It measures the amount of hydrogen ...

Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

Science.gov (United States)

Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

1994-10-25

DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.

Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

DEFF Research Database (Denmark)

Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

2011-01-01

Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

SOS-like induction in Bacillus subtilis: induction of the RecA protein analog and a damage-inducible operon by DNA damage in Rec+ and DNA repair-deficient strains

International Nuclear Information System (INIS)

Lovett, C.M. Jr.; Love, P.E.; Yasbin, R.E.; Roberts, J.W.

1988-01-01

We quantitated the induction of the Bacillus subtilis Rec protein (the analog of Escherichia coli RecA protein) and the B. subtilis din-22 operon (representative of a set of DNA damage-inducible operons in B. subtilis) following DNA damage in Rec+ and DNA repair-deficient strains. After exposure to mitomycin C or UV irradiation, each of four distinct rec (recA1, recB2, recE4, and recM13) mutations reduced to the same extent the rates of both Rec protein induction (determined by densitometric scanning of immunoblot transfers) and din-22 operon induction (determined by assaying beta-galactosidase activity in din-22::Tn917-lacZ fusion strains). The induction deficiencies in recA1 and recE4 strains were partially complemented by the E. coli RecA protein, which was expressed on a plasmid in B. subtilis; the E. coli RecA protein had no effect on either induction event in Rec+, recB2, or recM13 strains. These results suggest that (i) the expression of both the B. subtilis Rec protein and the din-22 operon share a common regulatory component, (ii) the recA1 and recE4 mutations affect the regulation and/or activity of the B. subtilis Rec protein, and (iii) an SOS regulatory system like the E. coli system is highly conserved in B. subtilis. We also showed that the basal level of B. subtilis Rec protein is about 4,500 molecules per cell and that maximum induction by DNA damage causes an approximately fivefold increase in the rate of Rec protein accumulation

The role of Cra in regulating acetate excretion and osmotic tolerance in E. coli K-12 and E. coli B at high density growth.

Science.gov (United States)

Son, Young-Jin; Phue, Je-Nie; Trinh, Loc B; Lee, Sang Jun; Shiloach, Joseph

2011-06-30

E. coli B (BL21), unlike E.coli K-12 (JM109) is insensitive to glucose concentration and, therefore, grows faster and produces less acetate than E. coli K-12, especially when growing to high cell densities at high glucose concentration. By performing genomic analysis, it was demonstrated that the cause of this difference in sensitivity to the glucose concentration is the result of the differences in the central carbon metabolism activity. We hypothesized that the global transcription regulator Cra (FruR) is constitutively expressed in E. coli B and may be responsible for the different behaviour of the two strains. To investigate this possibility and better understand the function of Cra in the two strains, cra - negative E. coli B (BL21) and E. coli K-12 (JM109) were prepared and their growth behaviour and gene expression at high glucose were evaluated using microarray and real-time PCR. The deletion of the cra gene in E. coli B (BL21) minimally affected the growth and maximal acetate accumulation, while the deletion of the same gene in E.coli K-12 (JM109) caused the cells to stop growing as soon as acetate concentration reached 6.6 g/L and the media conductivity reached 21 mS/cm. ppsA (gluconeogenesis gene), aceBA (the glyoxylate shunt genes) and poxB (the acetate producing gene) were down-regulated in both strains, while acs (acetate uptake gene) was down-regulated only in E.coli B (BL21). These transcriptional differences had little effect on acetate and pyruvate production. Additionally, it was found that the lower growth of E. coli K-12 (JM109) strain was the result of transcription inhibition of the osmoprotectant producing bet operon (betABT). The transcriptional changes caused by the deletion of cra gene did not affect the activity of the central carbon metabolism, suggesting that Cra does not act alone; rather it interacts with other pleiotropic regulators to create a network of metabolic effects. An unexpected outcome of this work is the finding that cra

Lactose intolerance and other disaccharidase deficiency.

Science.gov (United States)

Tomar, Balvir S

2014-09-01

Intolerance to foods which contain lactose can cause a range of intestinal and systemic symptoms. These symptoms are caused by Lactase deficiency which is encoded by a single gene (LCT) of ≈ 50 kb located on chromosome 2q21. In some food items, lactose has been missed because of "hidden" lactose due to inadequately labeled, confusing diagnosis of lactose intolerance based on dietary restriction of dairy foods. Two polymorphisms, C/T13910 and G/A22018, linked to hypolactasia, correlate with breath hydrogen and symptoms after lactose. The key in the management of lactose intolerance is the dietary removal of lactose. Patients diagnosed as lactose intolerant must be advised of "risk" foods, inadequately labeled, including processed meats, bread, cake mixes, soft drinks, and lagers. This review highlights the types, symptoms and management of lactose intolerance and also highlights differences from milk allergy which closely mimics the symptoms of lactose intolerance.

Production of chlorphenesin galactoside by whole cells of β-galactosidase-containing Escherichia coli.

Science.gov (United States)

Lee, Sang-Eun; Lee, Hyang-Yeol; Jung, Kyung-Hwan

2013-06-28

We investigated the transgalactosylation reaction of chlorphenesin (CPN) using β-galactosidase (β-gal)-containing Escherichia coli (E. coli) cells, in which galactose from lactose was transferred to CPN. The optimal CPN concentration for CPN galactoside (CPN-G) synthesis was observed at 40 mM under the conditions that lactose and β-gal (as E. coli cells) were 400 g/l and 4.8 U/ml, respectively, and the pH and temperature were 7.0 and 40oC, respectively. The time-course profile of CPN-G synthesis under these optimal conditions showed that CPN-G synthesis from 40 mM CPN reached a maximum of about 27 mM at 12 h. This value corresponded to an about 67% conversion of CPN to CPN-G, which was 4.47-5.36-fold higher than values in previous reports. In addition, we demonstrated by thin-layer chromatography to detect the sugar moiety that galactose was mainly transferred from lactose to CPN. Liquid chromatography-mass spectrometry revealed that CPN-G and CPN-GG (CPN galactoside, which accepted two galactose molecules) were definitively identified as the synthesized products using β-gal-containing E. coli cells. In particular, because we did not use purified β-gal, our β-gal-containing E. coli cells might be practical and cost-effective for enzymatically synthesizing CPN-G. It is expected that the use of β-gal-containing E. coli will be extended to galactose derivatization of other drugs to improve their functionality.

21 CFR 168.122 - Lactose.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Lactose. 168.122 Section 168.122 Food and Drugs... § 168.122 Lactose. (a) Lactose is the carbohydrate normally obtained from whey. It may be anhydrous or... the following specifications: (1) The lactose content is not less than 98.0 percent, mass over mass (m...

[Pharmaceutical drugs containing lactose can as a rule be used by persons with lactose intolerance].

Science.gov (United States)

Vinther, Siri; Rumessen, Jöri Johannes; Christensen, Mikkel

2015-03-09

Lactose is often used as an excipient in pharmaceutical drugs. Current evidence indicates that the amount of lactose in most drugs is not sufficient to cause symptoms in persons with lactose intolerance, although interindividual differences in sensitivity probably exist. Patient preferences and/or suboptimal treatment adherence could be reasons for considering lactose-free drug alternatives.

Control analysis of the dependence of Escherichia coli physiology on the H⁺ -ATPase

DEFF Research Database (Denmark)

Jensen, Peter Ruhdal; Michelsen, Ole; Westerhoff, Hans V.

1993-01-01

The H+-ATPase plays a central role in Escherichia coli free-energy transduction and hence in E. coli physiology. We here investigate the extent to which this enzyme also controls the growth rate, growth yield, and respiratory rate of E. coli. We modulate the expression of the atp operon and deter...

Construction of lactose-consuming Saccharomyces cerevisiae for lactose fermentation into ethanol fuel.

Science.gov (United States)

Zou, Jing; Guo, Xuewu; Shen, Tong; Dong, Jian; Zhang, Cuiying; Xiao, Dongguang

2013-04-01

Two lactose-consuming diploid Saccharomyces cerevisiae strains, AY-51024A and AY-51024M, were constructed by expressing the LAC4 and LAC12 genes of Kluyveromyces marxianus in the host strain AY-5. In AY-51024A, both genes were targeted to the ATH1 and NTH1 gene-encoding regions to abolish the activity of acid/neutral trehalase. In AY-51024M, both genes were respectively integrated into the MIG1 and NTH1 gene-encoding regions to relieve glucose repression. Physiologic studies of the two transformants under anaerobic cultivations in glucose and galactose media indicated that the expression of both LAC genes did not physiologically burden the cells, except for AY-51024A in glucose medium. Galactose consumption was initiated at higher glucose concentrations in the MIG1 deletion strain AY-51024M than in the corresponding wild-type strain and AY-51024A, wherein galactose was consumed until glucose was completely depleted in the mixture. In lactose medium, the Sp. growth rates of AY-51024A and AY-51024M under anaerobic shake-flasks were 0.025 and 0.067 h(-1), respectively. The specific lactose uptake rate and ethanol production of AY-51024M were 2.50 g lactose g CDW(-1) h(-1) and 23.4 g l(-1), respectively, whereas those of AY-51024A were 0.98 g lactose g CDW(-1) h(-1) and 24.3 g lactose g CDW(-1) h(-1), respectively. In concentrated cheese whey powder solutions, AY-51024M produced 63.3 g l(-1) ethanol from approximately 150 g l(-1) initial lactose in 120 h, conversely, AY-51024A consumed 63.7 % of the initial lactose and produced 35.9 g l(-1) ethanol. Therefore, relieving glucose repression is an effective strategy for constructing lactose-consuming S. cerevisiae.

The cell wall and cell division gene cluster in the Mra operon of Pseudomonas aeruginosa: cloning, production, and purification of active enzymes.

Science.gov (United States)

Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M

2001-04-01

We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.

Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

Science.gov (United States)

Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

2015-01-01

Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

Insight on specificity of uracil permeases of the NAT/NCS2 family from analysis of the transporter encoded in the pyrimidine utilization operon of Escherichia coli.

Science.gov (United States)

Botou, Maria; Lazou, Panayiota; Papakostas, Konstantinos; Lambrinidis, George; Evangelidis, Thomas; Mikros, Emmanuel; Frillingos, Stathis

2018-04-01

The uracil permease UraA of Escherichia coli is a structurally known prototype for the ubiquitous Nucleobase-Ascorbate Transporter (NAT) or Nucleobase-Cation Symporter-2 (NCS2) family and represents a well-defined subgroup of bacterial homologs that remain functionally unstudied. Here, we analyze four of these homologs, including RutG of E. coli which shares 35% identity with UraA and is encoded in the catabolic rut (pyrimidine utilization) operon. Using amplified expression in E. coli K-12, we show that RutG is a high-affinity permease for uracil, thymine and, at low efficiency, xanthine and recognizes also 5-fluorouracil and oxypurinol. In contrast, UraA and the homologs from Acinetobacter calcoaceticus and Aeromonas veronii are permeases specific for uracil and 5-fluorouracil. Molecular docking indicates that thymine is hindered from binding to UraA by a highly conserved Phe residue which is absent in RutG. Site-directed replacement of this Phe with Ala in the three uracil-specific homologs allows high-affinity recognition and/or transport of thymine, emulating the RutG profile. Furthermore, all RutG orthologs from enterobacteria retain an Ala at this position, implying that they can use both uracil and thymine and, possibly, xanthine as substrates and provide the bacterial cell with a range of catabolizable nucleobases. © 2018 John Wiley & Sons Ltd.

Exploration of Structural Changes in Lactose Permease on Sugar Binding and Proton Transport through Atomistic Simulations

Science.gov (United States)

Liu, Jin; Jewel, Yead; Dutta, Prashanta

2017-11-01

Escherichia coli lactose permease (LacY) actively transports lactose and other galactosides across cell membranes through lactose/H+ symport process. Lactose/H+ symport is a highly complex process that involves large-scale protein conformational changes. The complete picture of lactose/H+ symport is largely unclear. In this work, we develop the force field for sugar molecules compatible with PACE, a hybrid and coarse-grained force field that couples the united-atom protein models with the coarse-grained MARTINI water/lipid. After validation, we implement the new force field to investigate the binding of a β-D-galactopyranosyl-1-thio- β-D-galactopyranoside (TDG) molecule to a wild-type LacY. Transitions from inward-facing to outward-facing conformations upon TDG binding and protonation of Glu269 have been achieved from microsecond simulations. Both the opening of the periplasmic side and closure of the cytoplasmic side of LacY are consistent with experiments. Our analysis suggest that the conformational changes of LacY are a cumulative consequence of inter-domain H-bonds breaking at the periplasmic side, inter-domain salt-bridge formation at the cytoplasmic side, as well as the TDG orientational changes during the transition. This work is supported by US National Science Foundation under Grant No. CBET-1604211.

Analysis of the multimer resolution system encoded by the parCBA operon of broad-host-range plasmid RP4

DEFF Research Database (Denmark)

Eberl, Leo; Sternberg, Claus; Givskov, Michael Christian

1994-01-01

specific sites situated in the promoter region of the parCBA operon. The two ParA proteins that are produced as a result of independent translation initiation at two different start codons within the same open reading frame were overexpressed in Escherichia coli and partially purified. Both forms...

Decrease in TSH levels after lactose restriction in Hashimoto's thyroiditis patients with lactose intolerance.

Science.gov (United States)

Asik, Mehmet; Gunes, Fahri; Binnetoglu, Emine; Eroglu, Mustafa; Bozkurt, Neslihan; Sen, Hacer; Akbal, Erdem; Bakar, Coskum; Beyazit, Yavuz; Ukinc, Kubilay

2014-06-01

We aimed to evaluate the prevalence of lactose intolerance (LI) in patients with Hashimoto's thyroiditis(HT) and the effects of lactose restriction on thyroid function in these patients. Eighty-three HT patients taking L-thyroxine (LT4) were enrolled, and lactose tolerance tests were performed on all patients. Lactose intolerance was diagnosed in 75.9 % of the patients with HT. Thirty-eight patients with LI were started on a lactose-restricted diet for 8 weeks. Thirty-eight patients with LI (30 euthyroid and 8 with subclinical hypothyroidism), and 12 patients without LI were included in the final analysis. The level of TSH significantly decreased in the euthyroid and subclinical hypothyroid patients with LI [from 2.06 ± 1.02 to 1.51 ±1.1 IU/mL and from 5.45 ± 0.74 to 2.25 ± 1.88 IU/mL,respectively (both P0.05). Lactose intolerance occurs at a high frequency in HT patients. Lactose restriction leads to decreased levels of TSH, and LI should be considered in hypothyroid patients who require increasing LT4 doses,have irregular TSH levels and are resistant to LT4 treatment.

Structure of Escherichia coli RutC, a member of the YjgF family and putative aminoacrylate peracid reductase of the rut operon

International Nuclear Information System (INIS)

Knapik, Aleksandra Alicja; Petkowski, Janusz Jurand; Otwinowski, Zbyszek; Cymborowski, Marcin Tadeusz; Cooper, David Robert; Chruszcz, Maksymilian; Krajewska, Wanda Małgorzata; Minor, Wladek

2012-01-01

The structure of the putative aminoacrylate peracid reductase RutC of the rut operon, a member of the YjgF family, is reported. RutC is the third enzyme in the Escherichia coli rut pathway of uracil degradation. RutC belongs to the highly conserved YjgF family of proteins. The structure of the RutC protein was determined and refined to 1.95 Å resolution. The crystal belonged to space group P2 1 2 1 2 and contained six molecules in the asymmetric unit. The structure was solved by SAD phasing and was refined to an R work of 19.3% (R free = 21.7%). The final model revealed that this protein has a Bacillus chorismate mutase-like fold and forms a homotrimer with a hydrophobic cavity in the center of the structure and ligand-binding clefts between two subunits. A likely function for RutC is the reduction of peroxy-aminoacrylate to aminoacrylate as a part of a detoxification process

Water-lactose behavior as a function of concentration and presence of lactic acid in lactose model systems.

Science.gov (United States)

Wijayasinghe, Rangani; Vasiljevic, Todor; Chandrapala, Jayani

2015-12-01

The presence of high amounts of lactic acid in acid whey restricts its ability to be further processed because lactose appears to remain in its amorphous form. A systematic study is lacking in this regard especially during the concentration step. Hence, the main aim of the study was to establish the structure and behavior of water molecules surrounding lactose in the presence of 1% (wt/wt) lactic acid at a concentration up to 50% (wt/wt). Furthermore, the crystallization nature of freeze-dried lactose with or without lactic acid was established using differential scanning calorimetry and Fourier transform infrared spectroscopy. Two mechanisms were proposed to describe the behavior of water molecules around lactose molecules during the concentration of pure lactose and lactose solutions with lactic acid. Pure lactose solution exhibited a water evaporation enthalpy of ~679 J·g(-1), whereas lactose+ lactic acid solution resulted in ~965 J·g(-1) at a 50% (wt/wt) concentration. This indicates a greater energy requirement for water removal around lactose in the presence of lactic acid. Higher crystallization temperatures were observed with the presence of lactic acid, indicating a delay in crystallization. Furthermore, less crystalline lactose (~12%) was obtained in the presence of lactic acid, indicating high amorphous nature compared with pure lactose where ~50% crystallinity was obtained. The Fourier transform infrared spectra revealed that the strong hydration layer consisting lactic acid and H3O(+) ions surrounded lactose molecules via strong H bonds, which restricted water mobility, induced a change in structure of lactose, or both, creating unfavorable conditions for lactose crystallization. Thus, partial or complete removal of lactic acid from acid whey may be the first step toward improving the ability of acid whey to be processed. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Surface area of lactose and lactose granulates on consolidation and compaction

NARCIS (Netherlands)

Riepma, Klaas Alouis

1993-01-01

This dissertation discusses the effect of short time storage at different conditions on the strength and the specific BET surface area of lactose tablets. In addition, some aspects are studied of the consolidation and compaction properties of crystalline lactose fractions in heterogeneous systems.

Lactose Intolerance and the Irritable Colon

OpenAIRE

McSherry, J. A.

1982-01-01

Symptoms of lactase deficiency include nausea, abdominal pain, distension, bloating and diarrhea after ingesting foods which contain lactose. Lactose intolerance and bowel motility disorders have similar symptoms, and people with irritable bowel syndrome and unexplained abdominal pain may have lactose intolerance. A definite diagnosis can be made by detecting hydrogen in the breath after a lactose load, by lactase assay from a small bowel biopsy specimen or by lactose intolerance testing. Lac...

Prevalence of Lactose Malabsorption and Lactose Intolerance in Pediatric Patients with Selected Gastrointestinal Diseases.

Science.gov (United States)

Pawłowska, Katarzyna; Umławska, Wioleta; Iwańczak, Barbara

2015-01-01

Lactase is an enzyme involved in the hydrolysis of lactose. Deficiency of the enzyme (hypolactasia) may be determined genetically or arise secondarily to disease of small intestine. Under this condition, lactose enters the colon where it is fermented by intestinal microflora and turns to gases and short-chain fatty acids, causing gastrointestinal symptoms known as lactose intolerance (LI). To investigate the incidence of lactose malabsorption (LM), LI and the coexistence of these two conditions in children with upper gastrointestinal tract diseases (UGTD), malabsorption syndrome, inflammatory bowel disease (IBD) and functional gastrointestinal disorders (FGID). Hydrogen breath test (HBT) was conducted in 387 pediatric patients in years 2010-2013. Two hundred thirty two children with gastrointestinal tract diseases were selected and assigned to groups - UGTD, malabsorption syndrome, IBD or FGID. For each group the frequency of LM, frequency and severity of LI and the frequency of their co-occurrence were calculated. Lactose malabsorption was observed in 37.08% of patients with gastrointestinal diseases. Positive HBT result was the most common in children with malabsorption syndrome (52.50%) and less common in UGTD (30.85%), especially in ulcer disease (23.53%). Symptoms after lactose ingestion affected 36.64% of the subjects, and were more specific to lactose malabsorbers than to lactose absorbers (72.10% vs. 15.75%). The higher frequency of LI was noted in children with FGID, especially in irritable bowel syndrome (IBS) (65.22%). The lowest incidence of symptoms was obtained in children with UGTD, especially in those with ulcer disease (27.44%). The incidence of LM with LI was noted in 27.16% of all patients and was the highest in IBS (47.83%) and the lowest in ulcer disease (15.78%). Lactose malabsorption is a common problem in children with gastrointestinal diseases, especially in children with bowel diseases. Lactose intolerance is related to LM, but does not

Lysines 72, 80 and 213 and aspartic acid 210 of the Lactococcus lactis LacR repressor are involved in the response to the inducer tagatose-6-phosphate leading to induction of lac operon expression.

Science.gov (United States)

van Rooijen, R J; Dechering, K J; Niek, C; Wilmink, J; de Vos, W M

1993-02-01

Site-directed mutagenesis of the Lactococcus lactis lacR gene was performed to identify residues in the LacR repressor that are involved in the induction of lacABCDFEGX operon expression by tagatose-6-phosphate. A putative inducer binding domain located near the C-terminus was previously postulated based on homology studies with the Escherichia coli DeoR family of repressors, which all have a phosphorylated sugar as inducer. Residues within this domain and lysine residues that are charge conserved in the DeoR family were changed into alanine or arginine. The production of the LacR mutants K72A, K80A, K80R, D210A, K213A and K213R in the LacR-deficient L.lactis strain NZ3015 resulted in repressed phospho-beta-galactosidase (LacG) activities and decreased growth rates on lactose. Gel mobility shift assays showed that the complex between a DNA fragment carrying the lac operators and LacR mutants K72A, K80A, K213A and D210A did not dissociate in the presence of tagatose-6-phosphate, in contrast to wild type LacR. Other mutations (K62A/K63A, K72R, K73A, K73R, T212A, F214R, R216R and R216K) exhibited no gross effects on inducer response. The results strongly suggest that the lysines at positions 72, 80 and 213 and aspartic acid at position 210 are involved in the induction of lac operon expression by tagatose-6-phosphate.

The molecular basis of lactose intolerance.

Science.gov (United States)

Campbell, Anthony K; Waud, Jonathan P; Matthews, Stephanie B

2009-01-01

A staggering 4000 million people cannot digest lactose, the sugar in milk, properly. All mammals, apart from white Northern Europeans and few tribes in Africa and Asia, lose most of their lactase, the enzyme that cleaves lactose into galactose and glucose, after weaning. Lactose intolerance causes gut and a range of systemic symptoms, though the threshold to lactose varies considerably between ethnic groups and individuals within a group. The molecular basis of inherited hypolactasia has yet to be identified, though two polymorphisms in the introns of a helicase upstream from the lactase gene correlate closely with hypolactasia, and thus lactose intolerance. The symptoms of lactose intolerance are caused by gases and toxins produced by anaerobic bacteria in the large intestine. Bacterial toxins may play a key role in several other diseases, such as diabetes, rheumatoid arthritis, multiple sclerosis and some cancers. The problem of lactose intolerance has been exacerbated because of the addition of products containing lactose to various foods and drinks without being on the label. Lactose intolerance fits exactly the illness that Charles Darwin suffered from for over 40 years, and yet was never diagnosed. Darwin missed something else--the key to our own evolution--the Rubicon some 300 million years ago that produced lactose and lactase in sufficient amounts to be susceptible to natural selection.

Molecular simulations of lactose-bound and unbound forms of the FaeG adhesin reveal critical amino acids involved in sugar binding.

Science.gov (United States)

Baker, Joseph L; Jafri, Heba

2016-11-01

F4 fimbriae are protein filaments found in enterotoxigenic Escherichia coli cells and are implicated in the process of bacterial infection due to their function as bacterial adhesins. These filaments are comprised from several proteins, but the bacterial adhesin FaeG, which is a lactose-binding protein, is the major subunit comprising F4 fimbriae. Crystal structures for three variants of the FaeG protein were recently solved, including the ad variant of FaeG that was crystallized in complex with lactose. However, the dynamics of the FaeG protein bound to lactose have not been explored previously using molecular dynamics simulations. Therefore, in order to study the dynamical interactions between the FaeG ad variant and lactose, we have carried out the first all-atom molecular dynamics simulations of this system. We have also probed the role of crystallographic water molecules on the stability of lactose in the FaeG binding site, and have simulated seven FaeG mutants to probe the influence of amino acid substitutions on the ability of FaeG to bind lactose effectively. Our simulations agree well with experimental results for the influence of mutations on lactose binding, provide dynamical insights into the interactions of FaeG with lactose, and also suggest the possibility of additional regions of the FaeG protein that may act as secondary lactose binding sites. Copyright © 2016 Elsevier Inc. All rights reserved.

Novel high-performance metagenome β-galactosidases for lactose hydrolysis in the dairy industry.

Science.gov (United States)

Erich, Sarah; Kuschel, Beatrice; Schwarz, Thilo; Ewert, Jacob; Böhmer, Nico; Niehaus, Frank; Eck, Jürgen; Lutz-Wahl, Sabine; Stressler, Timo; Fischer, Lutz

2015-09-20

The industrially utilised β-galactosidases from Kluyveromyces spp. and Aspergillus spp. feature undesirable kinetic properties in praxis, such as an unsatisfactory lactose affinity (KM) and product inhibition (KI) by galactose. In this study, a metagenome library of about 1.3 million clones was investigated with a three-step activity-based screening strategy in order to find new β-galactosidases with more favourable kinetic properties. Six novel metagenome β-galactosidases (M1-M6) were found with an improved lactose hydrolysis performance in original milk when directly compared to the commercial β-galactosidase from Kluyveromyces lactis (GODO-YNL2). The best metagenome candidate, called "M1", was recombinantly produced in Escherichia coli BL21(DE3) in a bioreactor (volume 35 L), resulting in a total β-galactosidase M1 activity of about 1100 μkatoNPGal,37 °C L(-1). Since milk is a sensitive and complex medium, it has to be processed at 5-10 °C in the dairy industry. Therefore, the β-galactosidase M1 was tested at 8 °C in milk and possessed a good stability (t1/2=21.8 d), a desirably low apparent KM,lactose,8 °C value of 3.8±0.7 mM and a high apparent KI,galactose,8 °C value of 196.6±55.5 mM. A lactose hydrolysis process (milk, 40 nkatlactose mLmilk,8 °C(-1)) was conducted at a scale of 0.5L to compare the performance of M1 with the commercial β-galactosidase from K. lactis (GODO-YNL2). Lactose was completely (>99.99%) hydrolysed by M1 and to 99.6% (w/v) by K. lactis β-galactosidase after 25 h process time. Thus, M1 was able to achieve the limit of lactose per litre milk, which is recommended for dairy products labelled as "lactose-free". Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Lactose-free frozen yogurt: production and characteristics.

Science.gov (United States)

Skryplonek, Katarzyna; Gomes, David; Viegas, Jorge; Pereira, Carlos; Henriques, Marta

2017-01-01

Nowadays, consumer demand is driving better and more nutritious dairy products. Changing from traditional to new lactose-free products poses technological challenges for the food industry in order to maintain or improve their food characteristics and consumer preferences. This study investigates the production of lactose-free frozen yogurt by enzymati- cally hydrolysis of lactose, and its influence on the final product characteristics. In the case of lactose-free products, commercial Ha-lactase® was used for hydrolysis, and the reaction occurred simultaneously with fermentation. The effect of lactose hydrolysis on the physicochemical properties, texture, viscosity, overrun and sensory attributes in the final product was investigated. After yogurt maturation, the acidity of the lactose-free product was significantly higher than in the control, suggesting that breaking down lactose enhances the fermentation process. Lactose-free frozen yogurt had significantly lower hardness and stickiness and higher viscosity than control frozen yogurt. Moreover, lactose hydrolysis promoted a smooth and creamy consistency, whereas in the case of conventional prod- ucts a coarse structure, due to the presence of large ice crystals, was identified. Hydrolysis of lactose also improved the sweetness and brightness of frozen yogurt. The improved textural properties of lactose-free product results from the fact that monosaccharides produced during lactose hydrolysis depress the freezing point of the mix, which enables product with softer structure and bigger resistance to ice recrystallization to be obtained. The study showed that lactose-free frozen yogurt may be used successfully for production of novel lactose-free frozen desserts. Lactose hydrolysis improves the texture and viscosity of the product,     as well as enhancing its sensory quality.

HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

Science.gov (United States)

Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

2016-01-01

Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

Studies on tableting properties of lactose. VII. The effect of variations in primary particle size and percentage of amorphous lactose in spray dried lactose products

NARCIS (Netherlands)

Vromans, H.; Bolhuis, G.K.; Lerk, C.F.; van de Biggelaar, H.; Bosch, H.

1987-01-01

Sieve fractions of α-lactose monohydrate and dicalcium phosphate dihydrate, respectively, suspended in solutions of lactose, were spray dried in order to obtain products with various amorphous lactose contents. The compactibility of the samples appeared to be a function of both the primary particle

Systematic review: effective management strategies for lactose intolerance.

Science.gov (United States)

Shaukat, Aasma; Levitt, Michael D; Taylor, Brent C; MacDonald, Roderick; Shamliyan, Tatyana A; Kane, Robert L; Wilt, Timothy J

2010-06-15

Lactose intolerance resulting in gastrointestinal symptoms is a common health concern. Diagnosis and management of this condition remain unclear. To assess the maximum tolerable dose of lactose and interventions for reducing symptoms of lactose intolerance among persons with lactose intolerance and malabsorption. Multiple electronic databases, including MEDLINE and the Cochrane Library, for trials published in English from 1967 through November 2009. Randomized, controlled trials of individuals with lactose intolerance or malabsorption. Three investigators independently reviewed articles, extracted data, and assessed study quality. 36 unique randomized studies (26 on lactase- or lactose-hydrolyzed milk supplements, lactose-reduced milk, or tolerable doses of lactose; 7 on probiotics; 2 on incremental lactose administration for colonic adaptation; and 1 on another agent) met inclusion criteria. Moderate-quality evidence indicated that 12 to 15 g of lactose (approximately 1 cup of milk) is well tolerated by most adults. Evidence was insufficient that lactose-reduced solution or milk with a lactose content of 0 to 2 g, compared with greater than 12 g, is effective in reducing symptoms of lactose intolerance. Evidence for probiotics, colonic adaptation, and other agents was also insufficient. Most studies evaluated persons with lactose malabsorption rather than lactose intolerance. Variation in enrollment criteria, outcome reporting, and the composition and dosing of studied agents precluded pooling of results and limited interpretation. Most individuals with presumed lactose intolerance or malabsorption can tolerate 12 to 15 g of lactose. Additional studies are needed to determine the effectiveness of lactose intolerance treatment.

Regulation of crp gene expression by the catabolite repressor/activator, Cra, in Escherichia coli.

Science.gov (United States)

Zhang, Zhongge; Aboulwafa, Mohammad; Saier, Milton H

2014-01-01

Growth of E. coli on several carbon sources is dependent on the catabolite repressor/activator (Cra) protein although a Cra consensus DNA-binding site is not present in the control regions of the relevant catabolic operons. We show that Cra regulates growth by activating expression of the crp gene. It thereby mediates catabolite repression of catabolic operons by an indirect mechanism. © 2014 S. Karger AG, Basel.

[Calcium supplementation uncovering lactose intolerance - a case report].

Science.gov (United States)

Trifina, Eva; Geissler, Dietmar; Zwettler, Elisabeth; Klaushofer, Klaus; Mikosch, Peter

2012-03-01

A 44 yr-old female with osteoporosis had no relevant gastrointestinal symptoms and did not avoid any specific food. However, after prescription of a lactose-rich calcium supplementation, clinical symptoms suspicious for lactose intolerance occurred, which were thereafter confirmed by a lactose tolerance test. Lactose intolerance may present with only slight or subtle symptoms. Drugs containing lactose may induce or increase gastrointestinal symptoms in patients with lactose intolerance. In case of gastrointestinal symptoms occurring after the initiation of drugs containing lactose, the possibility of lactose intolerance should be considered and tested by lactose tolerance test or genetic testing for the LCT (-13910) polymorphism. Due to the prevalence of about 15-25% lactose intolerance in the Austrian population, lactose free drugs should be prescribed as widely as possible.

Is it just lactose intolerance?

Science.gov (United States)

Olivier, Celso Eduardo; Lorena, Sônia Letícia Silva; Pavan, Célia Regina; dos Santos, Raquel Acácia Pereira Gonçalves; dos Santos Lima, Regiane Patussi; Pinto, Daiana Guedes; da Silva, Mariana Dias; de Lima Zollner, Ricardo

2012-01-01

Acquired delayed-onset hypolactasia is a common autosomal recessive condition. Cow's milk allergies, conversely, are less common conditions that may manifest with equivalent symptoms and are able to simulate and/or aggravate lactose intolerance. This study was designed to evaluate the contribution of IgE-mediated cow's milk sensitization to the symptomatology of adult patients with lactose-free diet refractory lactose intolerance. Forty-six adult patients with lactose intolerance and persistent symptoms despite a lactose-free diet underwent skin-prick test to investigate cow's milk, goat's milk, and soy protein-specific-IgE. SDS-PAGE immunoblotting was used to investigate the presence of cow's milk protein-specific IgE. The percentage of patients who had skin reactions to whole cow's milk, alpha-lactalbumin, beta-lactoglobulin, caseins, goat's milk, and soy was 69.5, 36.9, 56.5, 56.5%, 54.3, and 50%, respectively. The percentage of patients with immunoblot-detected IgE specific for alpha-lactalbumin, beta-lactoglobulin, caseins, and bovine serum albumin was 21.7, 63, 67.3, and 2.1%, respectively. IgE-mediated sensitization to cow's milk is a frequent comorbidity in subjects with lactose-free diet refractory lactose intolerance and is worth consideration in patients with this condition.

Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

Science.gov (United States)

Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

2016-08-01

To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

Weak interactions in clobazam–lactose mixtures examined by differential scanning calorimetry: Comparison with the captopril–lactose system

International Nuclear Information System (INIS)

Toscani, S.; Cornevin, L.; Burgot, G.

2012-01-01

Highlights: ► Thermodynamic and kinetic parameters of weak interactions in binary systems by DSC. ► Energy-barrier decrease for lactose dehydration induced by clobazam. ► Recrystallisation of metastable liquid clobazam induced by anhydrous alpha lactose. ► Decrease of lactose dehydration temperature in binary mixtures with captopril. ► Increase of lactose dehydration enthalpy in binary mixtures with captopril. - Abstract: The thermal behaviour of binary mixtures of two drugs (clobazam and captopril, respectively) and a pharmaceutical excipient (lactose monohydrate) was measured with differential scanning calorimetry to determine thermodynamic and kinetic parameters (dehydration and melting enthalpies and dehydration and glass-transition activation energies) which might be affected by intermolecular interactions. A kinetic study showed that lactose dehydration is not a single-step conversion and that clobazam contributed to reduce the energy barrier for the bulk dehydration of the excipient. On the other hand, the physical interactions between metastable liquid clobazam and crystalline anhydrous α-lactose obtained from monohydrate dehydration gave rise to the recrystallisation of clobazam. In the captopril–lactose system, the liquid captopril influenced the lactose dehydration: a sharp increase of the dehydration enthalpy and a concurrent reduction of the dehydration temperature were observed. Finally, it turned out that solid-phase transitions were enhanced by the contact with a liquid phase.

Lactose intolerance: from diagnosis to correct management.

Science.gov (United States)

Di Rienzo, T; D'Angelo, G; D'Aversa, F; Campanale, M C; Cesario, V; Montalto, M; Gasbarrini, A; Ojetti, V

2013-01-01

This review discusses one of the most relevant problems in gastrointestinal clinical practice: lactose intolerance. The role of lactase-persistence alleles the diagnosis of lactose malabsorption the development of lactose intolerance symptoms and its management. Most people are born with the ability to digest lactose, the major carbohydrate in milk and the main source of nutrition until weaning. Approximately, 75% of the world's population loses this ability at some point, while others can digest lactose into adulthood. Symptoms of lactose intolerance include abdominal pain, bloating, flatulence and diarrhea with a considerable intraindividual and interindividual variability in the severity. Diagnosis is most commonly performed by the non invasive lactose hydrogen breath test. Management of lactose intolerance consists of two possible clinical choice not mutually exclusive: alimentary restriction and drug therapy.

Undernourished children and milk lactose

DEFF Research Database (Denmark)

Grenov, Benedikte; Briend, André; Sangild, Per Torp

2016-01-01

BACKGROUND: Lactose is an important energy source in young mammals, and in fully breast-fed human infants, it constitutes around 40% of the total daily energy intake. The role of lactose in feeding of undernourished infants and young children is not well described. OBJECTIVE: A narrative review...... of the potential positive and negative effects of lactose in the treatment of undernourished children. METHODS: Searches were conducted using PUBMED and Web of Science up to July 2015. Relevant references in the retrieved articles were included. RESULTS: Lactose may exhibit several health benefits in young...... children, including a prebiotic effect on the gut microbiota and a positive effect on mineral absorption. Studies in piglets suggest there might also be a stimulating effect on growth, relative to other carbohydrates. Lactose intolerance is a potential concern for undernourished children. Most...

Weak interactions in clobazam-lactose mixtures examined by differential scanning calorimetry: Comparison with the captopril-lactose system

Energy Technology Data Exchange (ETDEWEB)

Toscani, S. [Departement de Chimie - UMR 6226, Faculte des Sciences, Universite de Rennes 1, Batiment 10B, 263 avenue du General Leclerc, F-35042 Rennes Cedex (France); Cornevin, L. [Universite de Rennes 1, Faculte de Pharmacie, 2 Avenue Leon Bernard, F-35043 Rennes Cedex (France); Burgot, G., E-mail: Gwenola.burgot@univ-rennes1.fr [Universite de Rennes 1, Faculte de Pharmacie, Laboratoire de Chimie Analytique, EA 1274 ' Mouvement, sports, sante' , 2 Avenue Leon Bernard, F-35043 Rennes Cedex (France); CHGR Rennes, Pole Medico-Technique Pharmacie, F-35703 Rennes Cedex (France)

2012-09-10

Highlights: Black-Right-Pointing-Pointer Thermodynamic and kinetic parameters of weak interactions in binary systems by DSC. Black-Right-Pointing-Pointer Energy-barrier decrease for lactose dehydration induced by clobazam. Black-Right-Pointing-Pointer Recrystallisation of metastable liquid clobazam induced by anhydrous alpha lactose. Black-Right-Pointing-Pointer Decrease of lactose dehydration temperature in binary mixtures with captopril. Black-Right-Pointing-Pointer Increase of lactose dehydration enthalpy in binary mixtures with captopril. - Abstract: The thermal behaviour of binary mixtures of two drugs (clobazam and captopril, respectively) and a pharmaceutical excipient (lactose monohydrate) was measured with differential scanning calorimetry to determine thermodynamic and kinetic parameters (dehydration and melting enthalpies and dehydration and glass-transition activation energies) which might be affected by intermolecular interactions. A kinetic study showed that lactose dehydration is not a single-step conversion and that clobazam contributed to reduce the energy barrier for the bulk dehydration of the excipient. On the other hand, the physical interactions between metastable liquid clobazam and crystalline anhydrous {alpha}-lactose obtained from monohydrate dehydration gave rise to the recrystallisation of clobazam. In the captopril-lactose system, the liquid captopril influenced the lactose dehydration: a sharp increase of the dehydration enthalpy and a concurrent reduction of the dehydration temperature were observed. Finally, it turned out that solid-phase transitions were enhanced by the contact with a liquid phase.

Compaction behaviour and mechanical strength of lactose-sodium starch glycolate and lactose-croscarmellose sodium binary tablets

Science.gov (United States)

Ashikin Yaakub, Nur; Shamsul Anuar, Mohd; Tahir, Suraya Mohd

2018-04-01

The focus of this study is to elucidate the effects of adding super disintegrants (SSG and Acdisol) to a filler (lactose) in terms of the compaction behaviour and mechanical strength of the formed binary tablets. The tablets were formed in a uniaxial die compaction process with compaction pressures ranging from 37.7MPa to 150.7 MPa. Consequently, the findings indicated that the increasing of the compaction pressure and the percentage mass composition of the super disintegrants would led to the increased in the strength of the tablets as well as their plastic energies, where this was more apparent for the case of the binary lactose/Acdisol tablets. In addition, as the compaction pressure increased, the maximum ejection pressure required to eject the tablet from the die cavity also increased. In contrast, a decreased in the maximum ejection pressure was observed as the composition of both super disintegrants increased in the lactose-super disintegrant binary tablets. In conclusion, the addition of super disintegrant; SSG with lactose and Acdisol with lactose; would enhanced the mechanical strength of lactose based tablets especially for the case of acdisol-lactose binary tablets in the experimental conditions adopted in this current work.

Lactose malabsorption and intolerance: pathogenesis, diagnosis and treatment.

Science.gov (United States)

Misselwitz, Benjamin; Pohl, Daniel; Frühauf, Heiko; Fried, Michael; Vavricka, Stephan R; Fox, Mark

2013-06-01

Lactose malabsorption is a common condition caused by reduced expression or activity of lactase in the small intestine. In such patients, lactose intolerance is characterized by abdominal symptoms (e.g. nausea, bloating, and pain) after ingestion of dairy products. The genetic basis of lactose malabsorption is established and several tests for this condition are available, including genetic, endoscopic, and H2-breath tests. In contrast, lactose intolerance is less well understood. Recent studies show that the risk of symptoms after lactose ingestion depends on the dose of lactose, lactase expression, intestinal flora, and sensitivity of the gastrointestinal tract. Lactose intolerance has recently been defined as symptoms developing after ingestion of lactose which do not develop after placebo challenge in a person with lactose maldigestion. Such blinded testing might be especially important in those with functional gastrointestinal diseases in whom self-reported lactose intolerance is common. However, placebo-controlled testing is not part of current clinical practice. Updated protocols and high-quality outcome studies are needed. Treatment options of lactose intolerance include lactose-reduced diet and enzyme replacement. Documenting the response to multiple doses can guide rational dietary management; however, the clinical utility of this strategy has not been tested. This review summarizes the genetic basis, diagnosis, and treatment of lactose malabsorption and intolerance.

Lactose malabsorption and intolerance: pathogenesis, diagnosis and treatment

Science.gov (United States)

Pohl, Daniel; Frühauf, Heiko; Fried, Michael; Vavricka, Stephan R; Fox, Mark

2013-01-01

Lactose malabsorption is a common condition caused by reduced expression or activity of lactase in the small intestine. In such patients, lactose intolerance is characterized by abdominal symptoms (e.g. nausea, bloating, and pain) after ingestion of dairy products. The genetic basis of lactose malabsorption is established and several tests for this condition are available, including genetic, endoscopic, and H2-breath tests. In contrast, lactose intolerance is less well understood. Recent studies show that the risk of symptoms after lactose ingestion depends on the dose of lactose, lactase expression, intestinal flora, and sensitivity of the gastrointestinal tract. Lactose intolerance has recently been defined as symptoms developing after ingestion of lactose which do not develop after placebo challenge in a person with lactose maldigestion. Such blinded testing might be especially important in those with functional gastrointestinal diseases in whom self-reported lactose intolerance is common. However, placebo-controlled testing is not part of current clinical practice. Updated protocols and high-quality outcome studies are needed. Treatment options of lactose intolerance include lactose-reduced diet and enzyme replacement. Documenting the response to multiple doses can guide rational dietary management; however, the clinical utility of this strategy has not been tested. This review summarizes the genetic basis, diagnosis, and treatment of lactose malabsorption and intolerance. PMID:24917953

UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon

International Nuclear Information System (INIS)

Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.

1988-01-01

Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs

Redefining Lactose as a Conditional Prebiotic

Directory of Open Access Journals (Sweden)

Andrew Szilagyi

2004-01-01

Full Text Available Lactose in dairy products is maldigested by up to 70% to 75% of the world's population and many people may therefore suffer symptoms reminiscent of irritable bowel syndrome. As a result, most research to date has concentrated on ways of improving lactose tolerance to enhance dairy as a source of nutrition. However, research on other possible benefits of lactose and its maldigestion has lagged. In view of an exponential growth in the understanding of intestinal microfloral host interactions and the expanding therapeutical potential of probiotics, a reassessment of the role of lactose as a potential prebiotic in lactase nonpersistent subjects is required. Gibson and Roberfroid introduced the concept of prebiotics and outlined definitive requirements for such a compound. The present article examines scientific and clinical knowledge about the properties of lactose and argues that in lactase nonpersistent subjects, lactose qualifies as a prebiotic.

Tableting properties of an improved spray-dried lactose

NARCIS (Netherlands)

Rassu, G.; Eissens, A. C.; Bolhuis, G. K.

2006-01-01

Spray-dried lactose is one of the most widely used filler-binders for direct compaction. The compactibility is a function of both primary particle size and the presence of amorphous lactose. Commercially available spray-dried lactose contains 15-20% amorphous lactose and 80-85% alpha-lactose

Lactose intolerance : analysis of underlying factors

NARCIS (Netherlands)

Vonk, RJ; Priebe, MG; Koetse, HA; Stellaard, F; Lenoir-Wijnkoop, [No Value; Antoine, JM; Zhong, Y; Huang, CY

Background We studied the degree of lactose digestion and orocecal transit time (OCTT) as possible causes for the variability of symptoms of lactose intolerance (LI) in a sample of a population with genetically determined low lactase activity. Methods Lactose digestion index (LDI) was measured by

Rheological properties of lactose-free dairy desserts.

Science.gov (United States)

Sahin, Serpil; Hamamci, Haluk; Garayev, Sultan

2016-10-01

People suffering from lactose intolerance cannot digest milk or lactose-containing foods. Lactose-free diet is essential for them since they do not have the ability to produce lactase to breakdown milk sugar. Physical properties of lactose-free dairy desserts will most probably be different than that of lactose containing ones because of lactose hydrolysis. In this study, it was aimed to analyze the rheological and textural behaviors of different lactose-free dessert formulations containing different gum types and different waxy maize starch and sucrose concentrations. Waxy maize starch was used at concentrations of 0.032 g·mL -1 , 0.040 g·mL -1 , and 0.048 g·mL -1 In addition to waxy maize starch, guar gum, gum arabic, or κ-carrageenan at two different concentrations (1.0% w/w and 0.5% w/w) was added. Sucrose was added at concentrations of 0.14 g·mL -1 and 0.10 g·mL -1 in lactose-free desserts. Power law model was found to be suitable to explain the flow behavior of desserts. The storage and loss modulus of lactose-free desserts were higher than that of lactose-containing desserts. The κ-Carrageenan was found to be the most effective gum for structure build-up. © The Author(s) 2016.

Genomic and Transcriptomic Analysis of Escherichia coli Strains Associated with Persistent and Transient Bovine Mastitis and the Role of Colanic Acid.

Science.gov (United States)

Lippolis, John D; Holman, Devin B; Brunelle, Brian W; Thacker, Tyler C; Bearson, Bradley L; Reinhardt, Timothy A; Sacco, Randy E; Casey, Thomas A

2018-01-01

Escherichia coli is a leading cause of bacterial mastitis in dairy cattle. It is most often transient in nature, causing an infection that lasts 2 to 3 days. However, E. coli has been shown to cause a persistent infection in a minority of cases. Mechanisms that allow for a persistent E. coli infection are not fully understood. The goal of this work was to determine differences between E. coli strains originally isolated from dairy cattle with transient and persistent mastitis. Using RNA sequencing, we show gene expression differences in nearly 200 genes when bacteria from the two clinical phenotypes are compared. We sequenced the genomes of the E. coli strains and report genes unique to the two phenotypes. Differences in the wca operon, which encodes colanic acid, were identified by DNA as well as RNA sequencing and differentiated the two phenotypes. Previous work demonstrated that E. coli strains that cause persistent infections were more motile than those that cause transient infections. Deletion of genes in the wca operon from a persistent-infection strain resulted in a reduction of motility as measured in swimming and swarming assays. Furthermore, colanic acid has been shown to protect bacteria from complement-mediated killing. We show that transient-infection E. coli strains were more sensitive to complement-mediated killing. The deletion of genes from the wca operon caused a persistent-infection E. coli strain to become sensitive to complement-mediated killing. This work identifies important differences between E. coli strains that cause persistent and transient mammary infections in dairy cattle. This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.

Hydrolysis of lactose with -D-galactosidase

Directory of Open Access Journals (Sweden)

Vesna Stehlik-Tomas

2001-06-01

Full Text Available The conditions of lactose hydrolysis with enzyme preparation of D-galactosidase were investigated. The aim of this work was to considered the use of whey in fermentative processes with yeast Saccharomyces cerevisiae. Enzymatic hydrolysis was conducted at different temperatures, with different lactose concentrations in medium and different concentrations of added enzyme. The results show that optimal temperature for hydrolysis was 40°C. The optimal amount of enzyme preparation was 2 gL-1 in lactose medium with 5-10 % lactose.

Metazoan operons accelerate recovery from growth arrested states

Science.gov (United States)

Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

2011-01-01

Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

21 CFR 184.1979a - Reduced lactose whey.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Reduced lactose whey. 184.1979a Section 184.1979a... Listing of Specific Substances Affirmed as GRAS § 184.1979a Reduced lactose whey. (a) Reduced lactose whey is the substance obtained by the removal of lactose from whey. The lactose content of the finished...

Comparison of HPLC-RI, LC/MS-MS and enzymatic assays for the analysis of residual lactose in lactose-free milk.

Science.gov (United States)

Trani, A; Gambacorta, G; Loizzo, P; Cassone, A; Fasciano, C; Zambrini, A V; Faccia, M

2017-10-15

Lactose intolerance is the decreased ability to digest lactose, and the population involved is rapidly increasing all over the world. Different procedures have been reported in the literature to quantify lactose in dairy products, but the official method of analysis is based on enzymatic assay. In this paper, the effectiveness of two enzymatic kits in detecting residual lactose in lactose-free milk was investigated, and a comparison with two alternative chromatographic methods was done. The investigation used several samples of UHT milk containing different levels of lactose, and the results highlighted the inadequacy of the enzymatic assays and of the HPLC-RI method to analyse lactose-free milk. An LC-MS/MS method using the formate adduct was developed, and it allowed quantitation of lactose and lactulose in all samples at a high level of precision and repeatability. Copyright © 2017 Elsevier Ltd. All rights reserved.

Adult lactose digestion status and effects on disease

Science.gov (United States)

Szilagyi, Andrew

2015-01-01

BACKGROUND: Adult assimilation of lactose divides humans into dominant lactase-persistent and recessive nonpersistent phenotypes. OBJECTIVES: To review three medical parameters of lactose digestion, namely: the changing concept of lactose intolerance; the possible impact on diseases of microbial adaptation in lactase-nonpersistent populations; and the possibility that the evolution of lactase has influenced some disease pattern distributions. METHODS: A PubMed, Google Scholar and manual review of articles were used to provide a narrative review of the topic. RESULTS: The concept of lactose intolerance is changing and merging with food intolerances. Microbial adaptation to regular lactose consumption in lactase-nonpersistent individuals is supported by limited evidence. There is evidence suggestive of a relationship among geographical distributions of latitude, sunhine exposure and lactase proportional distributions worldwide. DISCUSSION: The definition of lactose intolerance has shifted away from association with lactose maldigestion. Lactose sensitivity is described equally in lactose digesters and maldigesters. The important medical consequence of withholding dairy foods could have a detrimental impact on several diseases; in addition, microbial adaptation in lactase-nonpersistent populations may alter risk for some diseases. There is suggestive evidence that the emergence of lactase persistence, together with human migrations before and after the emergence of lactase persistence, have impacted modern-day diseases. CONCLUSIONS: Lactose maldigestion and lactose intolerance are not synonymous. Withholding dairy foods is a poor method to treat lactose intolerance. Further epidemiological work could shed light on the possible effects of microbial adaptation in lactose maldigesters. The evolutionary impact of lactase may be still ongoing. PMID:25855879

Impurities enhance caking in lactose powder

DEFF Research Database (Denmark)

Carpin, M.; Bertelsen, H.; Dalberg, A.

2017-01-01

Caking of lactose and other dry ingredients is a common problem in the dairy and food industries. The lactose production process includes different purification steps, depending on the type of lactose produced. The aim of this study was therefore to investigate how the remaining impurities (i.......e. non-lactose components) affect the caking tendency of the final powder. The results from a combination of different methods, including dynamic vapor sorption, characterization of the physicochemical composition and assessment of caking with a ring shear tester, suggested humidity caking. Larger...... amounts of impurities in the lactose powder resulted in enhanced moisture sorption and greater caking tendency. These findings emphasize the importance of controlling the washing and purification steps throughout the production process in order to limit caking in the final product...

[Efficacy of Lactose-free Milk in Korean Adults with Lactose Intolerance].

Science.gov (United States)

Park, Sun Hee; Chang, Young Woon; Kim, Soo Jung; Lee, Min Hye; Nam, Ji Hyeok; Oh, Chi Hyuk; Kim, Jung-Wook; Jang, Jae-Young; Yang, Jin Oh; Yoo, Jin Ah; Chung, Jin Young

2016-01-25

Lactose-free milk (LFM) is available for nutrient supply for those with lactose intolerance (LI). However, there are no consistent results of the efficacy of LFM in LI subjects. We aimed to examine the changes of gastrointestinal (GI) symptoms and hydrogen breath test (HBT) values after ingestion of lactose contained milk (LCM) vs. LFM. From May 2015 to September 2015, thirty-five healthy adults with history of LCM-induced GI symptoms were recruited at a tertiary hospital. For the diagnosis of LI, HBT with LCM 550 mL (lactose 25 g) was performed every 20 minutes for 3 hours. The test was defined as "positive" when H2 peak exceeded 20 ppm above baseline values (ΔH2>20 ppm). When the subjects are diagnosed as LI, the second HBT using LFM 550 mL (lactose 0 g) was performed 7 days later. Subjects were asked to complete a questionnaire about the occurrence and severity of GI symptoms. Among a total of 35 subjects, 31 were diagnosed with LI at first visit, and their LCM-related symptoms were abdominal pain (98.6%), borborygmus (96.8%), diarrhea (90.3%), and flatus (87.1%). The ΔH2 value in subjects taking LCM (103.7±66.3ppm) significantly decreased to 6.3±4.9 ppm after ingesting LFM (p<0.0001). There were also significant reduction in total symptom scores and the severity of each symptom when LCM was changed to LFM (p<0.0001). This is the first report that LFM reduce LCM-related GI symptoms and H2 production in Korean adults. LFM can be an effective alternative for LCM in adults with LI.

Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

Science.gov (United States)

Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

2015-05-25

Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

Exploration of conformational changes in lactose permease upon sugar binding and proton transfer through coarse-grained simulations.

Science.gov (United States)

Jewel, Yead; Dutta, Prashanta; Liu, Jin

2017-10-01

Escherichia coli lactose permease (LacY) actively transports lactose and other galactosides across cell membranes through lactose/H + symport process. Lactose/H + symport is a highly complex process that involves sugar translocation, H + transfer, and large-scale protein conformational changes. The complete picture of lactose/H + symport is largely unclear due to the complexity and multiscale nature of the process. In this work, we develop the force field for sugar molecules compatible with PACE, a hybrid and coarse-grained force field that couples the united-atom protein models with the coarse-grained MARTINI water/lipid. After validation, we implement the new force field to investigate the binding of a β-d-galactopyranosyl-1-thio- β-d-galactopyranoside (TDG) molecule to a wild-type LacY. Results show that the local interactions between TDG and LacY at the binding pocket are consistent with the X-ray experiment. Transitions from inward-facing to outward-facing conformations upon TDG binding and protonation of Glu269 have been achieved from ∼5.5 µs simulations. Both the opening of the periplasmic side and closure of the cytoplasmic side of LacY are consistent with double electron-electron resonance and thiol cross-linking experiments. Our analysis suggests that the conformational changes of LacY are a cumulative consequence of interdomain H-bonds breaking at the periplasmic side, interdomain salt-bridge formation at the cytoplasmic side, and the TDG orientational changes during the transition. © 2017 Wiley Periodicals, Inc.

Lactose uptake driven by galactose efflux in Streptococcus thermophilus: Evidence for a galactose-lactose antiporter

International Nuclear Information System (INIS)

Hutkins, R.W.; Ponne, C.

1991-01-01

Galactose-nonfermenting (Gal - ) Streptococcus thermophilus TS2 releases galactose into the extracellular medium when grown in medium containing excess lactose. Starved and de-energized Gal - cells, however, could be loaded with galactose to levels approximately equal to the extracellular concentration (0 to 50 mM). When loaded cells were separated from the medium and resuspended in fresh broth containing 5 mM lactose, galactose efflux occurred. De-energized, galactose-loaded cells, resuspended in buffer or medium, accumulated [ 14 C]lactose at a greater rate and to significantly higher intracellular concentrations than unloaded cells. Uptake of lactose by loaded cells was inhibited more than that by unloaded cells in the presence of extracellular galactose, indicating that a galactose gradient was involved in the exchange system. When de-energized, galactose-loaded cells were resuspended in carbohydrate-free medium at pH 6.7, a proton motive force (Δp) of 86 to 90 mV was formed, whereas de-energized, nonloaded cells maintained a Δp of about 56 mV. However, uptake of lactose by loaded cells occurred when the proton motive force was abolished by the addition of an uncoupler or in the presence of a proton-translocating ATPase inhibitor. These results support the hypothesis that galactose efflux in Gal - S. thermophilus is electrogenic and that the exchange reaction (lactose uptake and galactose efflux) probably occurs via an antiporter system

Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

Science.gov (United States)

Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

2016-04-01

Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

An unsuspected autoregulatory pathway involving apocytochrome TorC and sensor TorS in Escherichia coli

OpenAIRE

Gon, Stéphanie; Jourlin-Castelli, Cécile; Théraulaz, Laurence; Méjean, Vincent

2001-01-01

Trimethylamine N-oxide (TMAO) respiration is carried out mainly by the Tor system in Escherichia coli. This system is encoded by the torCAD operon and comprises a periplasmic TMAO reductase (TorA) and a c-type cytochrome (TorC), which shuttles electrons to TorA. Expression of the tor operon is positively controlled by the TorS/TorR phosphorelay system in response to TMAO availability and negatively regulated by apocytochrome TorC. Interaction studies showed tha...

Cloning and identification of Group 1 mrp operon encoding a novel monovalent cation/proton antiporter system from the moderate halophile Halomonas zhaodongensis.

Science.gov (United States)

Meng, Lin; Hong, Shan; Liu, Henan; Huang, Haipeng; Sun, Hao; Xu, Tong; Jiang, Juquan

2014-11-01

The novel species Halomonas zhaodongensis NEAU-ST10-25(T) recently identified by our group is a moderate halophile which can grow at the range of 0-2.5 M NaCl (optimum 0.5 M) and pH 6-12 (optimum pH 9). To explore its halo-alkaline tolerant mechanism, genomic DNA was screened from NEAU-ST10-25(T) in this study for Na(+)(Li(+))/H(+) antiporter genes by selection in Escherichia coli KNabc lacking three major Na(+)(Li(+))/H(+) antiporters. One mrp operon could confer tolerance of E. coli KNabc to 0.8 M NaCl and 100 mM LiCl, and an alkaline pH. This operon was previously mainly designated mrp (also mnh, pha or sha) due to its multiple resistance and pH-related activity. Here, we will also use mrp to designate the homolog from H. zhaodongensis (Hz_mrp). Sequence analysis and protein alignment showed that Hz_mrp should belong to Group 1 mrp operons. Further phylogenetic analysis reveals that Hz_Mrp system should represent a novel sub-class of Group 1 Mrp systems. This was confirmed by a significant difference in pH-dependent activity profile or the specificity and affinity for the transported monovalent cations between Hz_Mrp system and all the known Mrp systems. Therefore, we propose that Hz_Mrp should be categorized as a novel Group 1 Mrp system.

A Radiochemical Biotechnological Approach: Preliminary Study of Lactose Uptake Rate by Kefir Cells, Using 14C-labeled Lactose, in Anaerobic Fermentation

Science.gov (United States)

Golfinopoulos, A.; Soupioni, M.; Kanellaki, M.; Koutinas, A. A.

2008-08-01

The effect of initial lactose concentration on lactose uptake rate by kefir free cells, during the lactose fermentation, was studied in this work. For the investigation 14C-labelled lactose was used due to the fact that labeled and unlabeled molecules are fermented in the same way. The results illustrated lactose uptake rates are about up to two fold higher at lower initial ∘Bé densities as compared with higher initial ∘Bé densities.

Systems Analysis of Lactose Metabolism in Trichoderma reesei Identifies a Lactose Permease That Is Essential for Cellulase Induction

Science.gov (United States)

Ivanova, Christa; Bååth, Jenny A.; Seiboth, Bernhard; Kubicek, Christian P.

2013-01-01

Trichoderma reesei colonizes predecayed wood in nature and metabolizes cellulose and hemicellulose from the plant biomass. The respective enzymes are industrially produced for application in the biofuel and biorefinery industry. However, these enzymes are also induced in the presence of lactose (1,4-0-ß-d-galactopyranosyl-d-glucose), a waste product from cheese manufacture or whey processing industries. In fact, lactose is the only soluble carbon source that induces these enzymes in T. reesei on an industrial level but the reason for this unique phenomenon is not understood. To answer this question, we used systems analysis of the T. reesei transcriptome during utilization of lactose. We found that the respective CAZome encoded all glycosyl hydrolases necessary for cellulose degradation and particularly for the attack of monocotyledon xyloglucan, from which ß-galactosides could be released that may act as the inducers of T. reesei’s cellulases and hemicellulases. In addition, lactose also induces a high number of putative transporters of the major facilitator superfamily. Deletion of fourteen of them identified one gene that is essential for lactose utilization and lactose uptake, and for cellulase induction by lactose (but not sophorose) in pregrown mycelia of T. reesei. These data shed new light on the mechanism by which T. reesei metabolizes lactose and offers strategies for its improvement. They also illuminate the key role of ß-D-galactosides in habitat specificity of this fungus. PMID:23690947

Molecular photonic imaging of cancer using light-emitting e. coli

International Nuclear Information System (INIS)

Park, Jae Hyo; Min, Jung Joon; Moon, Sung Min; Kim, Hyun Ju; Hong, Yeong Jin; Choy, Hyon E.; Bom, Hee Seung; Jeong, Jae Ho; Cho, Kyoung Oh

2005-01-01

Cancer research has long sought a magic bullet that would selectively target and destroy malignant cells. In this study, we exploited that E. coli injected into tumor-bearing mice selectively target and proliferate in solid tumors by employing optical imaging technique. Lux operon or GFP has been cloned into pUC19 plasmid to engineer pUC19Lux or pUC19gfp which was transformed into varying kinds of wild type (MG1655) or mutant E.coli strains. For stable expression, lux operon was cloned with asd (aspartate β-semialdehyde dehydrogenase) gene and transformed into asd defective E. coli (MG1655asd-/asd+lux). These bacteria were i.v. injected into tumor mice or directly into central necrosis of tumor. The imaging signal from wild type E.coli was detected initially at liver (20min), then migrated to and shine in the tumor mass until 2 weeks of injection which was consistently observed in immuno-defective (nude) and -competent (Balb/c) mice. Imaging signal of stbaly transformed strain (MG1655asd-/asd+lux) was stronger and longer-lasting than that of transiently transformed strain (MG1655lux). Flagella defective E. coli strain failed to reach tumor loci. Only a few amounts of stress regulatory defective E. coli strain arrived at but couldn't survive at the tumor loci. E. coli colonies expressing GFP was mostly observed at the border of central necrosis and peripheral proliferative areas in immunofluorescence studies. Directly injected MG1655ad-/asd+lux was transiently observed at central necrosis followed by spreading to the peripheral tumor mass which was consistent with the finding by tail vein injection. We successfully engineered E. coli strain stably expressing lux reporter gene. E. coli strongly targeted solid tumor regardless of host immune status. Our results support that the targeting of tumor by E.coli is an active process and would be applied as a delivery vehicle of varying imaging markers or therapeutic molecules

A Radiochemical Biotechnological Approach: Preliminary Study of Lactose Uptake Rate by Kefir Cells, Using 14C-labeled Lactose, in Anaerobic Fermentation

International Nuclear Information System (INIS)

Golfinopoulos, A.; Soupioni, M.; Kanellaki, M.; Koutinas, A. A.

2008-01-01

The effect of initial lactose concentration on lactose uptake rate by kefir free cells, during the lactose fermentation, was studied in this work. For the investigation 14 C-labelled lactose was used due to the fact that labeled and unlabeled molecules are fermented in the same way. The results illustrated lactose uptake rates are about up to two fold higher at lower initial (convolution sign)Be densities as compared with higher initial (convolution sign)Be densities

Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

Science.gov (United States)

Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

2016-01-01

The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

Lactose intolerance : the role of colonic metabolism

NARCIS (Netherlands)

He, Tao

2006-01-01

Dairy products provide us with calcium and other valuable nutrients. However, they also contain lactose which is maldigested by a large part of the world adult population. The mechanisms by which lactose maldigestion causes symptoms of lactose intolerance are not fully understood. Studies on the

Lactose digestion from yogurt: mechanism and relevance.

Science.gov (United States)

Savaiano, Dennis A

2014-05-01

Yogurt is traditionally consumed throughout the world among populations who are seemingly unable to digest lactose. This review provides a historical overview of the studies that show lactose digestion and tolerance from yogurt by lactose-intolerant people. The lactose in yogurt is digested more efficiently than other dairy sources of lactose because the bacteria inherent in yogurt assist with its digestion. The bacterial lactase survives the acidic conditions of the stomach, apparently being physically protected within the bacterial cells and facilitated by the buffering capacity of yogurt. The increasing pH as the yogurt enters the small intestine and a slower gastrointestinal transit time allow the bacterial lactase to be active, digesting lactose from yogurt sufficiently to prevent symptoms in lactose-intolerant people. There is little difference in the lactase capability of different commercial yogurts, because they apparently contain Lactobacillus bulgaricus and Streptococcus thermophilus in sufficient quantities (10(8) bacteria/mL). However, Lactobacillus acidophilus appears to require cell membrane disruption to physically release the lactase. Compared with unflavored yogurts, flavored yogurts appear to exhibit somewhat reduced lactase activity but are still well tolerated.

The role of colonic metabolism in lactose intolerance.

Science.gov (United States)

He, T; Venema, K; Priebe, M G; Welling, G W; Brummer, R-J M; Vonk, R J

2008-08-01

Lactose maldigestion and intolerance affect a large part of the world population. The underlying factors of lactose intolerance are not fully understood. In this review, the role of colonic metabolism is discussed, i.e. fermentation of lactose by the colonic microbiota, colonic processing of the fermentation metabolites and how these processes would play a role in the pathophysiology of lactose intolerance. We suggest that the balance between the removal and production rate of osmotic-active components (lactose, and intermediate metabolites, e.g. lactate, succinate, etc.) in the colon is a key factor in the development of symptoms. The involvement of the colon may provide the basis for designing new targeted strategies for dietary and clinical management of lactose intolerance.

Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

DEFF Research Database (Denmark)

Aagaard, C; Rosendahl, G; Dam, M

1991-01-01

The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

Perception of lactose intolerance in irritable bowel syndrome patients.

Science.gov (United States)

Dainese, Raffaella; Casellas, Francesc; Mariné-Barjoan, Eugènia; Vivinus-Nébot, Mylène; Schneider, Stéphane M; Hébuterne, Xavier; Piche, Thierry

2014-10-01

The importance of lactose malabsorption in irritable bowel syndrome (IBS) is not well defined and these patients often complain of lactose intolerance. To objectively measure lactose malabsorption, a hydrogen breath test (HBT) can be performed, but a discrepancy emerges between the results of the HBT and the symptomatic response during the HBT. To determine in a group of IBS patients whether self-perceived lactose intolerance and the symptomatic response to lactose HBT were conditioned by other factors besides the presence of lactose malabsorption. Oral challenge to lactose (50 g) was tested in 51 IBS patients to assess HBT malabsorption and the symptomatic response to lactose intolerance was scored on a validated questionnaire. Allergological screening for common inhalants and food allergens (including cow's milk) was performed. The presence of psychological factors (e.g. anxiety, depression, fatigue) was evaluated using validated questionnaires. A total of 21 out of 51 patients (41.1%) were self-perceived to be lactose intolerant, 24/51 (47%) had a positive HBT, and 14/51 (27.4%) presented with symptoms of lactose intolerance during HBT. The serological screening for inhalant and food allergens was positive in 6/21 (28.6%) and 4/21 (19%) of patients who self-perceived lactose intolerance and in 5/14 (37.5%) and 3/14 (21.4%) in intolerant patients symptomatic during HBT. Only 1/51 (1.9%) presented evidence of IgE-mediated hypersensitivity to cow's milk. Patients who experienced symptoms of lactose intolerance during HBT presented more severe IBS symptoms [326 (296-398) vs. 215 (126-295) P=0.05] and a higher score of anxiety, depression, and fatigue. Factors influencing the symptoms of lactose intolerance during HBT resulted in an increase in hydrogen produced and in the severity of IBS. In a cohort of 51 IBS patients, the symptoms of lactose intolerance during HBT were influenced by the capacity to absorb lactose and the severity of IBS. Other factors, such as

Lactose Intolerance in Adults: Biological Mechanism and Dietary Management.

Science.gov (United States)

Deng, Yanyong; Misselwitz, Benjamin; Dai, Ning; Fox, Mark

2015-09-18

Lactose intolerance related to primary or secondary lactase deficiency is characterized by abdominal pain and distension, borborygmi, flatus, and diarrhea induced by lactose in dairy products. The biological mechanism and lactose malabsorption is established and several investigations are available, including genetic, endoscopic and physiological tests. Lactose intolerance depends not only on the expression of lactase but also on the dose of lactose, intestinal flora, gastrointestinal motility, small intestinal bacterial overgrowth and sensitivity of the gastrointestinal tract to the generation of gas and other fermentation products of lactose digestion. Treatment of lactose intolerance can include lactose-reduced diet and enzyme replacement. This is effective if symptoms are only related to dairy products; however, lactose intolerance can be part of a wider intolerance to variably absorbed, fermentable oligo-, di-, monosaccharides and polyols (FODMAPs). This is present in at least half of patients with irritable bowel syndrome (IBS) and this group requires not only restriction of lactose intake but also a low FODMAP diet to improve gastrointestinal complaints. The long-term effects of a dairy-free, low FODMAPs diet on nutritional health and the fecal microbiome are not well defined. This review summarizes recent advances in our understanding of the genetic basis, biological mechanism, diagnosis and dietary management of lactose intolerance.

Lactose Intolerance in Adults: Biological Mechanism and Dietary Management

Directory of Open Access Journals (Sweden)

Yanyong Deng

2015-09-01

Full Text Available Lactose intolerance related to primary or secondary lactase deficiency is characterized by abdominal pain and distension, borborygmi, flatus, and diarrhea induced by lactose in dairy products. The biological mechanism and lactose malabsorption is established and several investigations are available, including genetic, endoscopic and physiological tests. Lactose intolerance depends not only on the expression of lactase but also on the dose of lactose, intestinal flora, gastrointestinal motility, small intestinal bacterial overgrowth and sensitivity of the gastrointestinal tract to the generation of gas and other fermentation products of lactose digestion. Treatment of lactose intolerance can include lactose-reduced diet and enzyme replacement. This is effective if symptoms are only related to dairy products; however, lactose intolerance can be part of a wider intolerance to variably absorbed, fermentable oligo-, di-, monosaccharides and polyols (FODMAPs. This is present in at least half of patients with irritable bowel syndrome (IBS and this group requires not only restriction of lactose intake but also a low FODMAP diet to improve gastrointestinal complaints. The long-term effects of a dairy-free, low FODMAPs diet on nutritional health and the fecal microbiome are not well defined. This review summarizes recent advances in our understanding of the genetic basis, biological mechanism, diagnosis and dietary management of lactose intolerance.

Teaching the Big Ideas of Biology with Operon Models

Science.gov (United States)

Cooper, Robert A.

2015-01-01

This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

Novel insights into E. coli's hexuronate metabolism: KduI facilitates the conversion of galacturonate and glucuronate under osmotic stress conditions.

Directory of Open Access Journals (Sweden)

Monique Rothe

Full Text Available Using a gnotobiotic mouse model, we previously observed the upregulation of 2-deoxy-D-gluconate 3-dehydrogenase (KduD in intestinal E. coli of mice fed a lactose-rich diet and the downregulation of this enzyme and of 5-keto 4-deoxyuronate isomerase (KduI on a casein-rich diet. The present study aimed to define the role of the so far poorly characterized E. coli proteins KduD and KduI in vitro. Galacturonate and glucuronate induced kduD and kduI gene expression 3-fold and 7 to 11-fold, respectively, under aerobic conditions as well as 9 to 20-fold and 19 to 54-fold, respectively, under anaerobic conditions. KduI facilitated the breakdown of these hexuronates. In E. coli, galacturonate and glucuronate are normally degraded by UxaABC and UxuAB. However, osmotic stress represses the expression of the corresponding genes in an OxyR-dependent manner. When grown in the presence of galacturonate or glucuronate, kduID-deficient E. coli had a 30% to 80% lower maximal cell density and 1.5 to 2-fold longer doubling times under osmotic stress conditions than wild type E. coli. Growth on lactose promoted the intracellular formation of hexuronates, which possibly explain the induction of KduD on a lactose-rich diet. These results indicate a novel function of KduI and KduD in E. coli and demonstrate the crucial influence of osmotic stress on the gene expression of hexuronate degrading enzymes.

A forward-design approach to increase the production of poly-3-hydroxybutyrate in genetically engineered Escherichia coli.

Directory of Open Access Journals (Sweden)

Richard Kelwick

Full Text Available Biopolymers, such as poly-3-hydroxybutyrate (P(3HB are produced as a carbon store in an array of organisms and exhibit characteristics which are similar to oil-derived plastics, yet have the added advantages of biodegradability and biocompatibility. Despite these advantages, P(3HB production is currently more expensive than the production of oil-derived plastics, and therefore, more efficient P(3HB production processes would be desirable. In this study, we describe the model-guided design and experimental validation of several engineered P(3HB producing operons. In particular, we describe the characterization of a hybrid phaCAB operon that consists of a dual promoter (native and J23104 and RBS (native and B0034 design. P(3HB production at 24 h was around six-fold higher in hybrid phaCAB engineered Escherichia coli in comparison to E. coli engineered with the native phaCAB operon from Ralstonia eutropha H16. Additionally, we describe the utilization of non-recyclable waste as a low-cost carbon source for the production of P(3HB.

A forward-design approach to increase the production of poly-3-hydroxybutyrate in genetically engineered Escherichia coli.

Science.gov (United States)

Kelwick, Richard; Kopniczky, Margarita; Bower, Iain; Chi, Wenqiang; Chin, Matthew Ho Wai; Fan, Sisi; Pilcher, Jemma; Strutt, James; Webb, Alexander J; Jensen, Kirsten; Stan, Guy-Bart; Kitney, Richard; Freemont, Paul

2015-01-01

Biopolymers, such as poly-3-hydroxybutyrate (P(3HB)) are produced as a carbon store in an array of organisms and exhibit characteristics which are similar to oil-derived plastics, yet have the added advantages of biodegradability and biocompatibility. Despite these advantages, P(3HB) production is currently more expensive than the production of oil-derived plastics, and therefore, more efficient P(3HB) production processes would be desirable. In this study, we describe the model-guided design and experimental validation of several engineered P(3HB) producing operons. In particular, we describe the characterization of a hybrid phaCAB operon that consists of a dual promoter (native and J23104) and RBS (native and B0034) design. P(3HB) production at 24 h was around six-fold higher in hybrid phaCAB engineered Escherichia coli in comparison to E. coli engineered with the native phaCAB operon from Ralstonia eutropha H16. Additionally, we describe the utilization of non-recyclable waste as a low-cost carbon source for the production of P(3HB).

Lactose intolerance in Indonesian children.

Science.gov (United States)

Hegar, Badriul; Widodo, Ariani

2015-01-01

"Lactose intolerance (LI)" is considered a common problem in Asians, and in many parts of the world. Its prevalence and age of manifestation varies between by Asian country, for possible genetic or cultural reasons. Studies in Indonesian children 3-15 years old (y) are available within the past two decades, using a pure lactose tolerance test. The prevalences of lactose malabsorption (LM) in pre-elementary (3-5 y), elementary (6-11 y), and junior high (12-14 y) school-children were 21.3%, 57.8%, and 73%, respectively. An increasing trend for LM prevalence was seen within the pre-elementary group, from 9.1% at 3 y to 28.6% at 5 y. The most frequent symptoms of LI in junior high school (JHS) group were abdominal pain (64.1%), abdominal distention (22.6%), nausea (15.1%), flatulence (5.7%), and diarrhea (1.9%), mostly within one hour of lactose ingestion. In children with regular and irregular milk drinking, LM occurred in 81.2% and 69.6%; LI was found in 56.2% and 52.1%, respectively. Most JHS children with dairy-associated recurrent abdominal pain (RAP) symptoms proved to be malabsorbers. Dairy products most related to RAP were milk and yogurt. LI was found in 81% of RAP children with abdominal pain most frequently, followed by nausea, bloating, diarrhea, borborygmi, and flatulence. Symp-tom onset occurred 30 minutes after lactose ingestion, especially nausea, bloating, and abdominal pain. In RAP children LI symptoms mostly found in breath hydrogen concentration>20 ppm. More LI symptoms were found in lactose malabsorbers, but symptoms were mild and generally disappeared in 7 hours, and in most by 15 hours.

Dynamics of lactose changes during ripening of Edam cheese

Directory of Open Access Journals (Sweden)

Lenka Vorlová

2017-01-01

Full Text Available The published data show that milk and dairy products are an important part of the diet in the European population and the population of North America, where they cover from 20 to 30% of protein, 15% of lipids and about 80% of calcium from food sources. The exclusion of milk and dairy products from human diet due to lactose intolerance (approximately 75% of the global population are lactose malabsorbers can cause very serious health consequences. From a public health point of view, it is therefore extremely important for diary products to capture all the facts about the fluctuation process or rather reduction of lactose content during dairy production technology. The aim of our study was to determine the lactose in various stages of Edam cheese ripening, to assess its suitability for consumption on the afflicted population. For the determination of lactose (day of production, first, second and sixth month of storage the reference enzymatic method using the enzymatic set Megazyme International Ireland with a detection limit of 0.00296 g.100 g-1was applied. This set is intended for determination of lactose in samples presented as low-lactose or lactose-free products and is based on the hydrolysis of lactose to D-galactose and D-glucose by the enzyme β-galactosidase. After the subsequent oxidation of galactose, the amount of formed NADH (stoichiometrically related to the amount of lactose contained in the sample is measured in a spectrophotometer at 340 nm.  According to current legislation, the lactose-free product must contain less than 10 mg of lactose per 100 g or 100 mL of the consumed product, while a product that contains up to 1 g of lactose in 100 g or 100 mL of the product consumed is considered as a product with low lactose content. The study results showed that even after one month of storage Edam cheese can be, according to current national and EU legislation, designated as a lactose-free food. This means that the consumer receives a

Effect of pelvic irradiation of lactose absorption

International Nuclear Information System (INIS)

Stryker, J.A.; Mortel, R.; Hepner, G.W.

1978-01-01

Twenty-four patients undergoing pelvic irradiation for gynecologic malignancies had 14 C-lactose breath tests performed in the first and fifth weeks of their treatment. The 14 C-lactose breath test was performed by administering 2 μCi of 14 C-lactose by mouth along with 50 g of lactose. Breath samples were collected in ethanolic hyamine 1, 2, and 3 hr later; the radioactivity of the trapped 14 CO 2 was determined by liquid scintillation spectroscopy. In the first week of treatment the percentage of administered 14 C excreted as 14 CO 2 at 1, 2, and 3 hr was 1.7 +- 0.8% (mean +- SD), 4.5 +- 1.6%, and 5.8 +- 1.4%, respectively. In the fifth week of treatment the 1-hr, 2-hr, and 3-hr values were 1.2 +- 0.9%, 3.6 +- 2.0%, and 4.7 +- 1.9%, respectively. The difference between the first week and fifth week test results at 1, 2, and 3 hr was statistically significant (t = 2.64, p 14 C-lactose breath test results in the fifth week and the stool frequency at that time (r = -0.44, p 14 C-lactose breath test results in the fifth week were below normal (<1.2%) had nausea at that time. The data suggest that in some patients, lactose malabsorption as a result of the effect of radiation on small intestinal function may be etiologically related to the symptoms of nausea and diarrhea which occur commonly in patients who are undergoing pelvic irradiation. In addition, the results suggest that lactose-containing foods should be restricted in some patients who are undergoing pelvic irradiation to prevent symptoms resulting from radiation-induced lactose intolerance

Lactase Non-persistence and Lactose Intolerance.

Science.gov (United States)

Bayless, Theodore M; Brown, Elizabeth; Paige, David M

2017-05-01

To evaluate the clinical and nutritional significance of genetically determined lactase non-persistence and potential lactose and milk intolerance in 65-70% of the world's adult population. Milk consumption is decreasing in the USA and is the lowest in countries with a high prevalence of lactase non-persistence. The dairy industry and Minnesota investigators have made efforts to minimize the influence of lactose intolerance on milk consumption. Some lactose intolerant individuals, without co-existent irritable bowel syndrome, are able to consume a glass of milk with a meal with no or minor symptoms. The high frequency of lactase persistence in offspring of Northern European countries and in some nomadic African tribes is due to mutations in the promoter of the lactase gene in association with survival advantage of milk drinking. Educational and commercial efforts to improve calcium and Vitamin D intake have focused on urging consumption of tolerable amounts of milk with a meal, use of lowered lactose-content foods including hard cheeses, yogurt, and lactose-hydrolyzed milk products.

Failure to Improve Parameters of Lactose Maldigestion using the Multiprobiotic Product VSL3 in Lactose Maldigesters: A Pilot Study

Directory of Open Access Journals (Sweden)

Rose Yesovitch

2004-01-01

Full Text Available Lactose maldigestion is a common genetic trait in up to 70% of the world's population. In these subjects, the ingestion of lactose may lead to prebiotic effects which can be confirmed by measurement of breath hydrogen. After a period of continuous lactose ingestion, colonic bacterial adaptation is measurable as improved parameters of lactose digestion. There may be inherent benefits in this process of adaptation which may protect against some diseases. We attempt to link therapeutically beneficial probiotics (VSL3, Seaford Pharmaceuticals Inc, Ontario with improvement in parameters of lactose maldigestion. Two groups of five subjects with maldigestion were fed one or four packets of VSL3 (one packet containing 450x109 live bacteria before testing and then 17 days later. A 50 g lactose challenge was carried out before and after feeding. While there was a trend toward increasing rather than reducing of summed breath hydrogen, no statistically significant changes were observed between results from before testing and those from testing 17 days later. The authors conclude that direct consumption of the probiotic VSL3 may not improve parameters of lactose maldigestion without metabolic activation. In its present format, therefore, the test for colonic adaptation cannot be used to demonstrate direct bacterial embedding with VSL3.

Lactose fermentation by engineered Saccharomyces cerevisiae capable of fermenting cellobiose.

Science.gov (United States)

Liu, Jing-Jing; Zhang, Guo-Chang; Oh, Eun Joong; Pathanibul, Panchalee; Turner, Timothy L; Jin, Yong-Su

2016-09-20

Lactose is an inevitable byproduct of the dairy industry. In addition to cheese manufacturing, the growing Greek yogurt industry generates excess acid whey, which contains lactose. Therefore, rapid and efficient conversion of lactose to fuels and chemicals would be useful for recycling the otherwise harmful acid whey. Saccharomyces cerevisiae, a popular metabolic engineering host, cannot natively utilize lactose. However, we discovered that an engineered S. cerevisiae strain (EJ2) capable of fermenting cellobiose can also ferment lactose. This finding suggests that a cellobiose transporter (CDT-1) can transport lactose and a β-glucosidase (GH1-1) can hydrolyze lactose by acting as a β-galactosidase. While the lactose fermentation by the EJ2 strain was much slower than the cellobiose fermentation, a faster lactose-fermenting strain (EJ2e8) was obtained through serial subcultures on lactose. The EJ2e8 strain fermented lactose with a consumption rate of 2.16g/Lh. The improved lactose fermentation by the EJ2e8 strain was due to the increased copy number of cdt-1 and gh1-1 genes. Looking ahead, the EJ2e8 strain could be exploited for the production of other non-ethanol fuels and chemicals from lactose through further metabolic engineering. Copyright © 2016 Elsevier B.V. All rights reserved.

[Lactose intolerance: past and present. Part 1].

Science.gov (United States)

Buzás, György Miklós

2015-09-20

Lactose intolerance is the most prevalent intestinal malabsorption disorder. After presentation of its history, the author describes the emergence of lactose intolerance during the evolution of species, and the biochemistry of lactose as well as features of human and bacterial lactase enzymes are then described. The unequal distribution of lactose intolerance in different continents and population is discussed, followed by presentation of past and present prevalence data in Hungary. Adult-type hypolactasia is caused by a polymorphism of the MCM6 gene located upstream from the lactase gene on the long arm of the chromosome 2. It can be determined with the polymerase chain reaction. The intestinal symptoms of lactose intolerance are well known, but its extra-intestinal manifestations are less recognised. Invasive diagnostic methods (determination of lactase activity from small intestinal biopsies, lactose tolerance test), are accurate, but have been replaced by the non-invasive methods; their gold standard is the H2 breath test. Genetic testing is being used more and more frequently in Hungary too, and, presumably, the methane breath test will be also available in the near future. Lactose intolerance can be accompanied by inflammatory bowel diseases, coeliac disease and irritable bowel syndrome; it could be established whether this association is causal or not in order to start a correct diet and therapy.

Formation of ethanol from lactose by Zymomonas mobilis

Energy Technology Data Exchange (ETDEWEB)

Goodman, A E; Strzelecki, A T; Rogers, P L

1984-01-01

The lactose transposon Tn951 on the IncP plasmid RP1, was introduced into a strain of Zymomonas mobilis. The lac Z gene was expressed and US -galactosidase was produced. The synthesis of US -galactosidase was induced by either isopropyl-US -D-thiogalactopyranoside or lactose, and was not sensitive to catabolite repression. Cells of Zymomonas mobilis containing Tn951 were unable to form colonies on lactose plates, but in liquid medium produced ethanol from lactose as the sole carbon source. The original strain of Zymomonas mobilis without Tn951 produced little or no US -galactosidase and was unable to produce ethanol from lactose in liquid medium.

Biochemical characterization of a novel β-galactosidase from Paenibacillus barengoltzii suitable for lactose hydrolysis and galactooligosaccharides synthesis.

Science.gov (United States)

Liu, Yu; Chen, Zhou; Jiang, Zhengqiang; Yan, Qiaojuan; Yang, Shaoqing

2017-11-01

A β-galactosidase gene (PbBGal2A) was cloned from Paenibacillus barengoltzii and expressed in Escherichia coli. The in silico analysis of the deduced amino acid sequences revealed that PbBGal2A shared the highest identity of 40% with the characterized glycoside hydrolase (GH) family 2 β-galactosidase from Actinobacillus pleuropneumoniae. The recombinant β-galactosidase (PbBGal2A) was purified with a molecular mass of 124.2kDa on SDS-PAGE. The optimal pH and temperature of PbBGal2A were determined to be pH 7.5 and 45°C, respectively. PbBGal2A was stable within pH 6.0-8.0 and up to 45°C. It completely hydrolyzed the lactose in milk and whey powder solution. In addition, PbBGal2A exhibited high transglycosylation activity and a maximum yield of 47.9% (w/w) for galactooligosaccharides (GOS) production was obtained in 8h at a lactose concentration of 350g/L. These properties make PbBGal2A an ideal candidate for commercial use in the production of lactose-free milk and GOS. Copyright © 2017. Published by Elsevier B.V.

Teores de cloretos, lactose e índice cloretos/lactose na secreção láctea de bovinos da raça Jersey no primeiro mês da lactação Chloride and lactose contents and chloride/lactose ratio in milk from Jersey cows in the first month of lactation

Directory of Open Access Journals (Sweden)

R.F.S. Raimondo

2009-02-01

Full Text Available Avaliou-se a influência do período colostral nos teores lácteos de cloretos, lactose e do índice cloretos/lactose. Foram colhidas 418 amostras de leite provenientes de glândulas mamárias sadias, e que não apresentavam crescimento bacteriano ao exame microbiológico, de 127 vacas da raça Jersey. As amostras foram distribuídas em oito grupos: 0 ┤1/2 dia; 1/2 ┤1 dia; 1 ┤2 dias; 2 ┤3 dias; 3 ┤5 dias; 5 ┤7 dias; 7 ┤15 dias; 15 ┤30 dias em lactação. Nas amostras, colhidas antes da ordenha, foram determinados os valores de cloretos, por titulação colorimétrica, e de lactose, por radiação infravermelho, e calculou-se o índice cloretos/lactose. Nas primeiras 24 horas da lactação, observou-se abrupta diminuição no teor lácteo de cloretos e do índice cloretos/lactose, associada com o aumento no teor lácteo de lactose. A transição da secreção de colostro para leite em relação ao teor de cloretos e lactose e ao índice cloretos/lactose na secreção láctea ocorreu na primeira semana da lactação, a partir do terceiro dia da lactação para o valor de cloretos e para a relação cloretos/lactose e a partir do quarto dia da lactação para o teor de lactose. Recomenda-se, nas primeiras 24 horas da lactação, a adoção dos seguintes limites de normalidade: cloretos, 3,94g/dL e índice cloretos/lactose, 4,03g/dL e índice cloretos/lactose In order to assess the influence of the colostral period on chloride and lactose levels and on the chloride/lactose ratio, 419 milk samples from 127 Jersey cows were analyzed. The samples were collected from healthy udders that did not present any bacterial growth in the microbiological examination. Cows were distributed into eight groups as follows: 0 ┤1/2 day; 1/2 ┤1 day; 1 ┤2 days; 2 ┤3 days; 3 ┤5 days; 5 ┤7 days; 7 ┤15 days; 15 ┤30 days of lactation. The samples were collected before milking to analyze the levels of chloride by colorimetric titration, lactose

Lactose Intolerance: Exploring Reaction Kinetics Governing Lactose Conversion of Dairy Products within the Undergraduate Laboratory

Science.gov (United States)

Smart, Jimmy L.

2008-01-01

Lactose intolerance is a condition suffered by an estimated 50 million Americans. Certain ethnic and racial populations are more widely affected than others. As many as 75 percent of all African-American, Jewish, Native American, and Mexican-American adults, and 90 percent of Asian-American adults are lactose intolerant. Some populations in Africa…

Lactose Intolerance

Science.gov (United States)

... test. Undigested lactose creates lactic acid and other fatty acids that a stool acidity test can detect in ... of Digestive Diseases and Nutrition conducts and supports basic and clinical research into digestive disorders such as ...

New map location of ilvO in Escherichia coli

International Nuclear Information System (INIS)

Cohen, B.M.; Jones, E.W.

1976-01-01

Mutations in ilνO, the operator site for operon A of the ilν region of E. coli K-12, are reported to cause a cis dominant depression of the operon. A gene products and to map between ilνC and ilνA. Studies reported here demonstrate that the F25 episome which does not carry the region between ilνC and ilνA but only ilνE, ilνD and a part of ilνA, can transfer ilνO genetic material. Also, genes of operon A on the F25 episome respond normally to a derepression signal. It is proposed that ilνO is on the F25 episome. Five-point crosses demonstrate that mutations in ilνO map nearer to ilνE than to ilνA. Considering this and other evidence, it is proposed that the gene order in the ilν region is CADEO, not COADE, with transcription and translation in operon A being from ilνE to ilνA to ilνE. It is confirmed that mutations in ilνO cause a cis dominant depression of the operon A gene products but it is also noted that mutations in ilνO lead to the appearance of an AHAS activity more resistant to inhibition by valine than that of the present O + strain

Four-sample lactose hydrogen breath test for diagnosis of lactose malabsorption in irritable bowel syndrome patients with diarrhea.

Science.gov (United States)

Yang, Jian-Feng; Fox, Mark; Chu, Hua; Zheng, Xia; Long, Yan-Qin; Pohl, Daniel; Fried, Michael; Dai, Ning

2015-06-28

To validate 4-sample lactose hydrogen breath testing (4SLHBT) compared to standard 13-sample LHBT in the clinical setting. Irritable bowel syndrome patients with diarrhea (IBS-D) and healthy volunteers (HVs) were enrolled and received a 10 g, 20 g, or 40 g dose lactose hydrogen breath test (LHBT) in a randomized, double-blinded, controlled trial. The lactase gene promoter region was sequenced. Breath samples and symptoms were acquired at baseline and every 15 min for 3 h (13 measurements). The detection rates of lactose malabsorption (LM) and lactose intolerance (LI) for a 4SLHBT that acquired four measurements at 0, 90, 120, and 180 min from the same data set were compared with the results of standard LHBT. Sixty IBS-D patients and 60 HVs were studied. The genotype in all participants was C/C-13910. LM and LI detection rates increased with lactose dose from 10 g, 20 g to 40 g in both groups (P lactose doses in both groups. Reducing the number of measurements from 13 to 4 samples did not significantly impact on the accuracy of LHBT in health and IBS-D. 4SLHBT is a valid test for assessment of LM and LI in clinical practice.

Analysis of experimental biosensor/FIA lactose measurements

Directory of Open Access Journals (Sweden)

Ferreira L.S.

2003-01-01

Full Text Available Whey is an abundant effluent in the production of cheese and casein. The biotechnological utilization of this economically important and nutritive source is limited mainly because of the presence of high percentages of lactose. This disaccharide has poor solubility, which can cause crystallization and insufficient sweetness in dairy food; additionally, part of the adult population suffers from associated lactose intolerance diseases. There are several methods to determine lactose such as spectrophotometry, polarimetry, infrared spectroscopy, titrimetry and chromatography. However these methods are tedious and time-consuming due to long sample preparation. These disadvantages stimulated the development of an enzymatic lactose biosensor. It employs two immobilized enzymes, beta-galactosidase and glucose oxidase and the quantitative analysis of lactose is based on determination of oxygen consumption in the enzymatic reaction. The influence of temperature on the biosensor signal was experimentally studied. It was observed that a nonlinear relationship exists between the electric response of the biosensor - provided by CAFCA (Computer Assisted Flow Control & Analysis - ANASYSCON, Hannover - and lactose concentration. In this work, attempts were made to correlate these variables using a simple nonlinear model and multilayered neural networks, with the latter providing the best modeling of the experimental data.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Science.gov (United States)

Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

2017-01-01

Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

Directory of Open Access Journals (Sweden)

Kathleen Jwanoswki

Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

Blood lactose after dairy product intake in healthy men.

Science.gov (United States)

Pimentel, Grégory; Burton, Kathryn J; Rosikiewicz, Marta; Freiburghaus, Carola; von Ah, Ueli; Münger, Linda H; Pralong, François P; Vionnet, Nathalie; Greub, Gilbert; Badertscher, René; Vergères, Guy

2017-12-01

The absence of a dedicated transport for disaccharides in the intestine implicates that the metabolic use of dietary lactose relies on its prior hydrolysis at the intestinal brush border. Consequently, lactose in blood or urine has mostly been associated with specific cases in which the gastrointestinal barrier is damaged. On the other hand, lactose appears in the blood of lactating women and has been detected in the blood and urine of healthy men, indicating that the presence of lactose in the circulation of healthy subjects is not incompatible with normal physiology. In this cross-over study we have characterised the postprandial kinetics of lactose, and its major constituent, galactose, in the serum of fourteen healthy men who consumed a unique dose of 800 g milk or yogurt. Genetic testing for lactase persistence and microbiota profiling of the subjects were also performed. Data revealed that lactose does appear in serum after dairy intake, although with delayed kinetics compared with galactose. Median serum concentrations of approximately 0·02 mmol/l lactose and approximately 0·2 mmol/l galactose were observed after the ingestion of milk and yogurt respectively. The serum concentrations of lactose were inversely correlated with the concentrations of galactose, and the variability observed between the subjects' responses could not be explained by the presence of the lactase persistence allele. Finally, lactose levels have been associated with the abundance of the Veillonella genus in faecal microbiota. The measurement of systemic lactose following dietary intake could provide information about lactose metabolism and nutrient transport processes under normal or pathological conditions.

Lactose intolerance: diagnosis, genetic, and clinical factors

Directory of Open Access Journals (Sweden)

Mattar R

2012-07-01

Full Text Available Rejane Mattar, Daniel Ferraz de Campos Mazo, Flair José CarrilhoDepartment of Gastroenterology, University of São Paulo School of Medicine, São Paulo, BrazilAbstract: Most people are born with the ability to digest lactose, the major carbohydrate in milk and the main source of nutrition until weaning. Approximately 75% of the world's population loses this ability at some point, while others can digest lactose into adulthood. This review discusses the lactase-persistence alleles that have arisen in different populations around the world, diagnosis of lactose intolerance, and its symptomatology and management.Keywords: hypolactasia, lactase persistence, lactase non-persistence, lactose, LCT gene, MCM6 gene

Mfd translocase is necessary and sufficient for transcription-coupled repair in Escherichia coli.

Science.gov (United States)

Adebali, Ogun; Sancar, Aziz; Selby, Christopher P

2017-11-10

Nucleotide excision repair in Escherichia coli is stimulated by transcription, specifically in the transcribed strand. Previously, it was shown that this transcription-coupled repair (TCR) is mediated by the Mfd translocase. Recently, it was proposed that in fact the majority of TCR in E. coli is catalyzed by a second pathway ("backtracking-mediated TCR") that is dependent on the UvrD helicase and the guanosine pentaphosphate (ppGpp) alarmone/stringent response regulator. Recently, we reported that as measured by the excision repair-sequencing (XR-seq), UvrD plays no role in TCR genome-wide. Here, we tested the role of ppGpp and UvrD in TCR genome-wide and in the lacZ operon using the XR-seq method, which directly measures repair. We found that the mfd mutation abolishes TCR genome-wide and in the lacZ operon. In contrast, the relA - spoT - mutant deficient in ppGpp synthesis carries out normal TCR. We conclude that UvrD and ppGpp play no role in TCR in E. coli . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

Science.gov (United States)

Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

2001-01-01

Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

The role of colonic metabolism in lactose intolerance

NARCIS (Netherlands)

He, T.; Venema, K.; Priebe, M. G.; Welling, G. W.; Brummer, R. -J. M.; Vonk, R. J.

Lactose maldigestion and intolerance affect a large part of the world population. The underlying factors of lactose intolerance are not fully understood. In this review, the role of colonic metabolism is discussed, i.e. fermentation of lactose by the colonic microbiota, colonic processing of the

The role of colonic metabolism in lactose intolerance

NARCIS (Netherlands)

He, T.; Venema, K.; Priebe, M.G.; Welling, G.W.; Brummer, R.J.M.; Vonk, R.J.

2008-01-01

Lactose maldigestion and intolerance affect a large part of the world population. The underlying factors of lactose intolerance are not fully understood. In this review, the role of colonic metabolism is discussed, i.e. fermentation of lactose by the colonic microbiota, colonic processing of the

LÁCTEOS COM BAIXO TEOR DE LACTOSE: UMA NECESSIDADE PARA PORTADORES DE MÁ DIGESTÃO DA LACTOSE E UM NICHO DE MERCADO

Directory of Open Access Journals (Sweden)

Mônica Cecília Santana Pereira

2014-06-01

Full Text Available A lactose é o principal carboidrato presente no leite, um alimento composto por nutrientes fundamentais à manutenção da saúde. A intolerância à lactose é o termo habitualmente usado para descrever os sintomas relatados por pessoas que apresentam má digestão da lactose após ingerirem leite e derivados, sendo um tema de extrema relevância para profissionais da área de alimentos, consumidores e profissionais de saúde. Estima-se que 65% da população mundial adulta manifestem sinais e sintomas de má digestão da lactose. Ideias equivocadas sobre sua manifestação e desenvolvimento, induzem a crenças de que o leite e seus derivados devem ser excluídos da alimentação de pessoas que manifestam sintomas de intolerância à lactose. Este artigo visa revisar os principais conceitos relacionados à lactose compreendendo: suas propriedades, importância nutricional e industrial, a distinção entre a má digestão, alergia e a intolerância à lactose, rotulagem, métodos de diagnóstico e de tratamento, bem como a diversidade de produtos com baixos teores de lactose como alternativas para os portadores de má digestão da lactose.

Lactose, galactose and glucose determination in naturally "lactose free" hard cheese: HPAEC-PAD method validation.

Science.gov (United States)

Monti, Lucia; Negri, Stefano; Meucci, Aurora; Stroppa, Angelo; Galli, Andrea; Contarini, Giovanna

2017-04-01

A chromatographic method by HPAEC-PAD was developed and in-house validated for the quantification of low sugar levels in hard cheese, specifically Grana Padano PDO cheese. Particular attention was paid to the extraction procedure, due to residual microbial and enzymatic activities. Specificity in detection and linearity were verified. Recoveries ranged from 93% for lactose to 98% for glucose and galactose. The obtained LOD and LOQ values were, respectively, 0.25 and 0.41mg/100g for lactose, 0.14 and 0.27mg/100g for galactose, and 0.16 and 0.26mg/100g for glucose. The method was applied to 59 samples of Grana Padano PDO cheese: galactose showed the highest concentration and variability among the samples (1.36±0.89), compared to both lactose (0.45±0.12) and glucose (0.46±0.13). Considering the very low levels of sugars detected, authentic PDO Grana Padano could be safely included in the diet of people suffering from lactose intolerance. Copyright © 2016 Elsevier Ltd. All rights reserved.

What People with Lactose Intolerance Need to Know about Osteoporosis

Science.gov (United States)

... Lactose Intolerance Need to Know About Osteoporosis What People With Lactose Intolerance Need to Know About Osteoporosis ... 2 hours after eating dairy products containing lactose, people with lactose intolerance start to develop stomach cramps ...

A numerical scheme for optimal transition paths of stochastic chemical kinetic systems

International Nuclear Information System (INIS)

Liu Di

2008-01-01

We present a new framework for finding the optimal transition paths of metastable stochastic chemical kinetic systems with large system size. The optimal transition paths are identified to be the most probable paths according to the Large Deviation Theory of stochastic processes. Dynamical equations for the optimal transition paths are derived using the variational principle. A modified Minimum Action Method (MAM) is proposed as a numerical scheme to solve the optimal transition paths. Applications to Gene Regulatory Networks such as the toggle switch model and the Lactose Operon Model in Escherichia coli are presented as numerical examples

Influence of lactose hydrolysis on galacto-oligosaccharides, lactose, volatile profile and physicochemical parameters of different yogurt varieties.

Science.gov (United States)

Vénica, Claudia I; Wolf, Irma V; Bergamini, Carina V; Perotti, María C

2016-12-01

Different types of reduced-lactose yogurt, obtained by lactose hydrolysis using β-galactosidase enzyme, are commercially available. The breakdown of lactose modifies the carbohydrate profile, including the production of prebiotic galacto-oligosaccharides (GOS), which could affect the survival and activity of starter and probiotic cultures and the parameters of yogurt quality. The extension of these changes is dependent on the yogurt matrix composition. This study aimed to evaluate the influence of lactose hydrolysis on GOS, lactose, volatile profile and physicochemical parameters of different yogurt varieties during storage. The presence of β-galactosidase enzyme did not affect either the global composition or the survival of cultures. Overall, the hydrolyzed products had lower acidity than traditional ones. GOS were found at similar levels in fresh hydrolyzed yogurts, whereas in traditional yogurts they were not detected. The proportion of ketones, acids and aldehydes seems to be more dependent on yogurt variety than on addition of the enzyme. Likewise, the storage period affected the volatile fraction to different degree; the increase in acid compounds was more pronounced in hydrolyzed than in traditional yogurts. This work shows that it is possible to obtain different varieties of reduced-lactose yogurt, some of them with additional benefits to health such as reduced fat, reduced calories, added with probiotic/inulin and enriched in GOS, with similar characteristics to traditional products. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of health claims related to foods with reduced lactose content and decreasing gastro-intestinal discomfort caused by lactose intake in lactose intolerant individuals (ID 646, 1224, 1238, 1339

DEFF Research Database (Denmark)

Tetens, Inge

claims in relation to foods with reduced lactose content and decreasing gastro-intestinal discomfort caused by lactose intake in lactose intolerant individuals. The scientific substantiation is based on the information provided by the Member States in the consolidated list of Article 13 health claims...... and references that EFSA has received from Member States or directly from stakeholders. The food constituent that is the subject of the health claim is lactose, which should be “decreased” or “reduced” in foods in order to obtain the claimed effect. The Panel considers that lactose is sufficiently characterised....... The claimed effects are “lactose intolerance”, “decrease lactose malabsorption symptoms” and “lactose digestion”. The target population is assumed to be lactose intolerant individuals. The Panel assumes that the claimed effects refer to decreasing gastro-intestinal discomfort caused by lactose intake...

Lactose intolerance: diagnosis, genetic, and clinical factors

Science.gov (United States)

Mattar, Rejane; de Campos Mazo, Daniel Ferraz; Carrilho, Flair José

2012-01-01

Most people are born with the ability to digest lactose, the major carbohydrate in milk and the main source of nutrition until weaning. Approximately 75% of the world’s population loses this ability at some point, while others can digest lactose into adulthood. This review discusses the lactase-persistence alleles that have arisen in different populations around the world, diagnosis of lactose intolerance, and its symptomatology and management. PMID:22826639

LÁCTEOS COM BAIXO TEOR DE LACTOSE: UMA NECESSIDADE PARA PORTADORES DE MÁ DIGESTÃO DA LACTOSE E UM NICHO DE MERCADO

OpenAIRE

Pereira, Mônica Cecília Santana; Brumano, Larissa Pereira; Kamiyama, Carolina Martins; Pereira, João Pablo Fortes; Rodarte, Mirian Pereira; Pinto, Miriam Aparecida de Oliveira

2013-01-01

Lactose is the main carbohydrate in milk, containing in nutrients food to health maintenance. Lactose intolerance is the term commonly used to describe the symptoms reported by people with lactose maldigestion after eating dairy products, being a very important topic for food professionals, consumers and health professionals. It is estimated that 65% of the world adult population manifesting symptoms of lactose maldigestion. Haven misconceptions about its manifestation and development, induci...

Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

Science.gov (United States)

Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

2017-01-01

Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

[Lactose intolerance in neonates with non-infectious diarrhea].

Science.gov (United States)

Su, Hui-Min; Jiang, Yi; Hu, Yu-Lian; Yang, Hui; Dong, Tian-Jin

2016-04-01

To investigate the development of lactose intolerance in neonates with non-infectious diarrhea and its association with diarrhea, and to evaluate the diagnostic values of fecal pH value and urine galactose determination for neonatal lactase deficiency. Seventy hospitalized neonates who developed non-infectious diarrhea between October 2012 and June 2015 were enrolled as the diarrhea group, and 162 hospitalized neonates without non-infectious diarrhea were enrolled as the non-diarrhea group. Test paper was used to determine fecal pH value. The galactose oxidase method was used to detect urine galactose. The neonates with positive galactose oxidase were diagnosed with lactase deficiency, and those with lactase deficiency and diarrhea were diagnosed with lactose intolerance. According to the results of urine galactose detection, 69 neonates in the diarrhea group who underwent urine galactose detection were classified into lactose intolerance group (45 neonates) and lactose tolerance group (24 neonates), and their conditions after treatment were compared between the two groups. The follow-up visits were performed for neonates with diarrhea at 3 months after discharge. Fecal pH value and positive rate of urine galactose (65% vs 54%) showed no significant differences between the diarrhea and non-diarrhea groups (P>0.05). Fecal pH value showed no significant difference between the lactose intolerance and lactose tolerance groups (P>0.05), while the neonates in the lactose intolerance group had a significantly longer time to recovery of defecation than those in the lactose tolerance group (Plactose intolerance tends to occur. Determination of fecal pH value has no significance in the diagnosis of lactose intolerance in neonates with diarrhea.

K88 Fimbrial Adhesin Targeting of Microspheres Containing Gentamicin Made with Albumin Glycated with Lactose

Directory of Open Access Journals (Sweden)

Andre-i Sarabia-Sainz

2015-09-01

Full Text Available The formulation and characterization of gentamicin-loaded microspheres as a delivery system targeting enterotoxigenic Escherichia coli K88 (E. coli K88 was investigated. Glycated albumin with lactose (BSA-glucose-β (4-1 galactose was used as the microsphere matrix (MS-Lac and gentamicin included as the transported antibiotic. The proposed target strategy was that exposed galactoses of MS-Lac could be specifically recognized by E. coli K88 adhesins, and the delivery of gentamicin would inhibit bacterial growth. Lactosylated microspheres (MS-Lac1, MS-Lac2 and MS-Lac3 were obtained using a water-in-oil emulsion, containing gentamicin, followed by crosslinking with different concentrations of glutaraldehyde. Electron microscopy displayed spherical particles with a mean size of 10–17 µm. In vitro release of gentamicin from MS-Lac was best fitted to a first order model, and the antibacterial activity of encapsulated and free gentamicin was comparable. MS-Lac treatments were recognized by plant galactose-specific lectins from Ricinus communis and Sophora japonica and by E. coli K88 adhesins. Results indicate MS-Lac1, produced with 4.2 mg/mL of crosslinker, as the best treatment and that lactosylated microsphere are promising platforms to obtain an active, targeted system against E. coli K88 infections.

Identification and localization of a gene that specifies production of Escherichia coli DNA topoisomerase I

International Nuclear Information System (INIS)

Trucksis, M.; Depew, R.E.

1981-01-01

A gene that specifies production of Escherichia coli DNA topoisomerase I (ω protein) was identified with the aid of a radioimmunoassay for this protein. E. coli DNA topoisomerase I was produced by Salmonella typhimurium merodiploids that harbored E. coli plasmid F' 123, but not by strains that lost this plasmid. Analysis of strains with spontaneous deletions of F' 123 showed that the gene, topA, required for production of the E. coli ω protein was between the trp operon and the cysB gene. Deletions that eliminated topA also eliminated the supX gene. We suggest that topA is the structural gene of E. coli DNA topoisomerase I and that topA is identical to supX

Characterization of Physical and Mechanical Properties of Miscible Lactose-Sugars Systems.

Science.gov (United States)

Li, Runjing; Roos, Yrjö H; Miao, Song

2017-09-01

Lactose-sugars systems were produced by spray drying. They were lactose, lactose-glucose (4:1) mixtures, lactose-maltose (4:1) mixtures, lactose-sucrose (4:1) mixtures, lactose-trehalose (4:1) mixtures, and lactose-corn syrup solids (CSS) (4:1) mixtures. The physical characteristics, water sorption behavior, glass transition, and mechanical properties of miscible lactose-sugars systems were investigated. Lactose-glucose mixtures had larger particle size than other lactose-sugars systems after spray drying. The presence of glucose or sucrose in lactose-sugars mixtures decreased the glass transition temperatures of amorphous systems, while the presence of maltose and trehalose had only minor impact on the glass transition temperatures. Moreover, glucose accelerated the crystallization of amorphous system at 0.44 a w , but its presence delayed the loss of sorbed water at higher water activities (≥0.54 a w ). Mechanical property study indicated that glucose and sucrose in amorphous system could result in an increase of molecular mobility, while the presence of CSS could decrease the free volume and maintain the stiffness of the miscible systems. © 2017 Institute of Food Technologists®.

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

Science.gov (United States)

Lawrence, J

1999-12-01

The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

Lactose behaviour in the presence of lactic acid and calcium.

Science.gov (United States)

Wijayasinghe, Rangani; Vasiljevic, Todor; Chandrapala, Jayani

2016-08-01

Physical properties of lactose appeared influenced by presence of lactic acid in the system. Some other components such as Ca may further attenuate lactose behaviour and impact its phase transition. A model-based study was thus implemented with varying concentrations of Ca (0·12, 0·072 or 0·035% w/w) and lactic acid (0·05, 0·2, 0·4 or 1% w/w) in establishing the effects of these two main acid whey constituents on lactose phase behaviour. Concentrated solutions (50% w/w) containing lactose, lactic acid and Ca were analysed for thermal behaviour and structural changes by Differential Scanning Colorimetry (DSC) and Fourier Transform Infrared Spectroscopy (FTIR), respectively. Presence of 1% (w/w) lactic acid and 0·12% (w/w) Ca in lactose solution significantly increased the evaporation enthalpy of water, delayed and increased the energy required for lactose crystallisation as compared to pure lactose. FTIR analysis indicated a strong hydration layer surrounding lactose molecules, restricting water mobility and/or inducing structural changes of lactose, hindering its crystallisation. The formation of calcium lactate, which restricts the diffusion of lactose molecules, is also partly responsible. It appears that Ca removal from acid whey may be a necessary step in improving the processability of acid whey.

Lactose in dairy ingredients: Effect on processing and storage stability.

Science.gov (United States)

Huppertz, Thom; Gazi, Inge

2016-08-01

Lactose is the main carbohydrate in the milk of most species. It is present in virtually all dry dairy ingredients, with levels ranging from lactose powders. The presence of lactose has a strong effect on ingredient processing and stability. Lactose can negatively influence powder properties and lead to undesirable effects, such as the stickiness of powder resulting in fouling during drying, or caking and related phenomena during storage. In addition, being a reducing carbohydrate, lactose can also participate in the Maillard reaction with free amino groups of proteins, peptides, and free AA. In this review, the influence of the presence (or absence) of lactose on physiochemical properties of dairy ingredients is reviewed, with particular emphasis on behavior during processing and storage. Particularly important features in this respect are whether lactose is in the (glassy) amorphous phase or in the crystalline phase, which is strongly affected by precrystallization conditions (e.g., in lactose, permeate, and whey powders) and by drying conditions. Furthermore, the moisture content and water activity of the ingredients are important parameters to consider, as they determine both mobility and reactivity, influencing Maillard reactions and concomitant browning, the crystallization of amorphous lactose during storage of dairy ingredients, glass transitions temperatures, and associated stickiness and caking phenomena. For the stickiness and caking, a crucial aspect to take into account is powder particle surface composition in relation to the bulk powder. Lactose is typically underrepresented at the powder surface, as a result of which deviations between observed lactose-induced caking and stickiness temperatures, and determined glass transition temperatures arise. By considering lactose as an integral part of ingredient composition along with all other compositional and environmental properties, lactose behavior in dairy ingredients can be understood, controlled, and

Lactose hydrolysis and milk powder production: technological aspects

Directory of Open Access Journals (Sweden)

Jansen Kelis Ferreira Torres

2017-06-01

Full Text Available The food industry has the challenge and the opportunity to develop new products with reduced or low lactose content in order to meet the needs of a growing mass of people with lactose intolerance. The manufacture of spray dried products with hydrolyzed lactose is extremely challenging. These products are highly hygroscopic, which influence the productivity and conservation of the powders, not to mention the undesirable and inevitable technological problem of constant clogging of drying chambers. The aim of this study was to evaluate the effect of different levels (0%, 25%, 50%, 75% and > 99% of enzymatic lactose hydrolysis on the production and storage of whole milk powder. The samples were processed in a pilot plant and characterized in relation to their composition analysis; to their degree of hydrolysis of lactose; and to their sorption isotherms. The results indicated the hydrolysis of lactose may affect the milk powder production due to a higher extent of powder adhesion within the spray dryer chambers and due to a higher tendency to absorb water during storage.

Improving lactose digestion and symptoms of lactose intolerance with a novel galacto-oligosaccharide (RP-G28): a randomized, double-blind clinical trial.

Science.gov (United States)

Savaiano, Dennis A; Ritter, Andrew J; Klaenhammer, Todd R; James, Gareth M; Longcore, Amy T; Chandler, Justin R; Walker, W Allan; Foyt, Howard L

2013-12-13

Lactose intolerance (LI) is a common medical problem with limited treatment options. The primary symptoms are abdominal pain, diarrhea, bloating, flatulence, and cramping. Limiting dairy foods to reduce symptoms contributes to low calcium intake and the risk for chronic disease. Adaptation of the colon bacteria to effectively metabolize lactose is a novel and potentially useful approach to improve lactose digestion and tolerance. RP-G28 is novel galacto-oligosaccharide (GOS) being investigated to improve lactose digestion and the symptoms of lactose intolerance in affected patients. A randomized, double-blind, parallel group, placebo-controlled study was conducted at 2 sites in the United States. RP-G28 or placebo was administered to 85 patients with LI for 35 days. Post-treatment, subjects reintroduced dairy into their daily diets and were followed for 30 additional days to evaluate lactose digestion as measured by hydrogen production and symptom improvements via a patient-reported symptom assessment instrument. Lactose digestion and symptoms of LI trended toward improvement on RP-G28 at the end of treatment and 30 days post-treatment. A reduction in abdominal pain was also demonstrated in the study results. Fifty percent of RP-G28 subjects with abdominal pain at baseline reported no abdominal pain at the end of treatment and 30 days post treatment (p = 0.0190). RP-G28 subjects were also six times more likely to claim lactose tolerance post-treatment once dairy foods had been re-introduced into their diets (p = 0.0389). Efficacy trends and favorable safety/tolerability findings suggest that RP-G28 appears to be a potentially useful approach for improving lactose digestion and LI symptoms. The concurrent reduction in abdominal pain and improved overall tolerance could be a meaningful benefit to lactose intolerant individuals.

Improving lactose digestion and symptoms of lactose intolerance with a novel galacto-oligosaccharide (RP-G28): a randomized, double-blind clinical trial

Science.gov (United States)

2013-01-01

Background Lactose intolerance (LI) is a common medical problem with limited treatment options. The primary symptoms are abdominal pain, diarrhea, bloating, flatulence, and cramping. Limiting dairy foods to reduce symptoms contributes to low calcium intake and the risk for chronic disease. Adaptation of the colon bacteria to effectively metabolize lactose is a novel and potentially useful approach to improve lactose digestion and tolerance. RP-G28 is novel galacto-oligosaccharide (GOS) being investigated to improve lactose digestion and the symptoms of lactose intolerance in affected patients. Methods A randomized, double-blind, parallel group, placebo-controlled study was conducted at 2 sites in the United States. RP-G28 or placebo was administered to 85 patients with LI for 35 days. Post-treatment, subjects reintroduced dairy into their daily diets and were followed for 30 additional days to evaluate lactose digestion as measured by hydrogen production and symptom improvements via a patient-reported symptom assessment instrument. Results Lactose digestion and symptoms of LI trended toward improvement on RP-G28 at the end of treatment and 30 days post-treatment. A reduction in abdominal pain was also demonstrated in the study results. Fifty percent of RP-G28 subjects with abdominal pain at baseline reported no abdominal pain at the end of treatment and 30 days post treatment (p = 0.0190). RP-G28 subjects were also six times more likely to claim lactose tolerance post-treatment once dairy foods had been re-introduced into their diets (p = 0.0389). Conclusions Efficacy trends and favorable safety/tolerability findings suggest that RP-G28 appears to be a potentially useful approach for improving lactose digestion and LI symptoms. The concurrent reduction in abdominal pain and improved overall tolerance could be a meaningful benefit to lactose intolerant individuals. Study registration ClinicalTrials.gov NCT01113619. PMID:24330605

Mini review on role of β-galactosidase in lactose intolerance

Science.gov (United States)

A, Nivetha; V, Mohanasrinivasan

2017-11-01

This review mainly focuses on the role and properties of β-galactosidase in lactose intolerance and its industrial application. β-Galactosidase, hydrolyses the lactose into glucose and galactose and it is most commonly used in food based technology, particularly in the dairy manufacturing industry. This catalyst mainly focus for the improvement of new and novel products with hydrolyzed lactose, which can be appropriate for the lactose-intolerant persons, to improve the technological, texture and scientific properties of non-fermented dairy products. β-Galactosidase derived from the group of saccharides which is a converting enzymes in the family of hydrolases. They are broadly distributed in the several biological living systems. The enzymatic hydrolysis of lactose is also preferred in food based technology due to the low soluble range of lactose. The concentration lactose was found to be high in fermented dairy products such as ice cream, butter, cheese curd, yogurt, etc., can prompt extreme lactose crystallization bringing about items through a coarse, abrasive surface. Lactose hydrolysis in dairy products enhances adaptability also, richness altogether. These products are extra edible. Also for this purpose, the utilization of β-galactosidase enzyme prior to the condensing operation can reduce the lactose content to a point where lactose was no longer a problem industrial application of β-galactosidase. In Industries, due to the positive and constructive effect on intestinal bacterial microflora, different types of applications are possible in β-galactosidase enzyme.

Lyoluminescence characteristics of lactose

International Nuclear Information System (INIS)

Oommen, I.K.; Sengupta, S.; Iyengar, T.S.

1994-01-01

The lyoluminescence (LL) of lactose shows a linear γ-ray dose response in the range 1-10 4 Gy. LL standardization measurement of lactose with a luminol sensitizer shows a sharp increase in light output in the pH range 10-11. Effects of radical scavengers and oxygen confirm that the radiation-induced free radicals take part in the LL process and oxygen is essential for initiating the LL mechanism. LL emission spectral measurements indicate an energy transfer from diffusing free radicals to sensitizer molecules to produce light. (author)

[Lactose intolerance: past and present. Part II].

Science.gov (United States)

Buzás, György Miklós

2015-10-25

The author summarises the interrelations between lactose intolerance, calcium and vitamin D metabolism and osteoporosis. Lactose intolerance enhances the risk of forearm and hip fractures in some patients. Lactase gene genotype and fracture risk are related in some populations. Calcium and vitamin D supplementation increase bone mineral content and they are justified in children, during pregnancy and lactation, and in postmenopausal women. The intake of milk and milk products could increase the risk of ovarian carcinoma. CC genotype of the lactase gene increased the risk of colorectal carcinoma in Finns; no such effect was observed in British, Spanish and Italian patients. Even small quantities of lactose in drugs (10-750 mg) could elicit intolerance symptoms due to individual susceptibility. In spite of public knowledge and advertising, controlled studies did not prove the beneficial effect of either a lactose-free diet, enzyme supplementation or probiotics in an evidence-based manner. While accepted guidelines are lacking, a personalised therapy is mandatory. In spite of increasing public interest in lactose intolerance, many unknown factors must still be studied.

[Breath tests in children with suspected lactose intolerance].

Science.gov (United States)

Parra, P Ángela; Furió, C Simone; Arancibia, A Gabriel

2015-01-01

Up to 70% of the world population is lactose intolerance. However, there are no epidemiological studies among Chilean pediatric population affected by this condition. Clinical characterization of a series of children who underwent the lactose intolerance breath test for lactose intolerance study, establishing intolerance and malabsorption frequencies, the most frequent symptoms, and test performance depending on the origin. Patients under 18 years old who took the lactose intolerance breath test in the Gastroenterology Laboratory of the Catholic University of Chile, and who were admitted due to clinically suspected lactose intolerance. Malabsorption was considered when there was as an increase of ≥20ppm above the baseline (H2) or ≥34ppm of H2 and methane (CH4) combined. Intolerance was considered when the above was associated with a symptom intensity score ≥7 during registration. The analysis included194 patients aged 1 to17 years of age. Of these, 102 (53%) presented with malabsorption, and 53 (27%) were intolerant. The frequency of lactose intolerance varied from 7.1 to 45.4%, and it occurred more frequently at older ages. The most common reported symptoms were abdominal pain, bloating and rumbling. Lactose malabsorption and intolerance can be investigated from the first years of life using the lactose breath test plus a symptom questionnaire. An increase in the frequency of intolerance with age, and a greater number of positive tests, if they were requested by a gastroenterologist, were observed. Copyright © 2015 Sociedad Chilena de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

NARCIS (Netherlands)

Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

2013-01-01

Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

Differential Impact of Lactose/Lactase Phenotype on Colonic Microflora

Directory of Open Access Journals (Sweden)

Andrew Szilagyi

2010-01-01

Full Text Available BACKGROUND: The ability to digest lactose divides the world’s population into two phenotypes that may be risk variability markers for several diseases. Prebiotic effects likely favour lactose maldigesters who experience lactose spilling into their colon.

Lactose reduced ice cream enriched with whey powder

Directory of Open Access Journals (Sweden)

Ana Claudia Tsuchiya

2017-05-01

Full Text Available Ice cream is a food product that pleases the palate of consumers worldwide. Whey powder (WP has various technological and functional properties. However, WP increases the lactose content of the final products in which it is incorporated and causes grittiness and intolerance in lactose-sensitive individuals. This study aimed to produce ice cream with milk powder (MP replaced by WP (MP/WP, decrease the lactose content by enzymatic hydrolysis and verify the physicochemical and microbiological parameters of the final product. Initially, the variables ?-galactosidase concentration and reaction time were studied for the response of the percentage of lactose hydrolysis in a milk ice cream base, using a full 22 factorial design(FFD.With the reaction conditions defined (0.5 g L-1 of ?-galactosidase at 37 C for 4 hthe sucrose concentration and MP/WP replacement variables were then studied in the ice cream formulation for the percentage of lactose hydrolysis and overrun responses using a 22 FFD. The lactose hydrolysis, which ranged between 86.59-97.97%, was not affected by the MP/WP replacement in the ice cream, whilst the overrun was increased by the MP/WP replacement. The physicochemical and microbiological parameters of the ice cream were either not influenced or positively influenced by lactose hydrolysis and MP/WP replacement.

Control of Ribosome Synthesis in Escherichia coli

DEFF Research Database (Denmark)

Molin, Søren; Meyenburg, K. von; Måløe, O.

1977-01-01

The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

NMR Study on the Interaction of Trehalose with Lactose and Its Effect on the Hydrogen Bond Interaction in Lactose

Directory of Open Access Journals (Sweden)

Eric Morssing Vilén

2013-08-01

Full Text Available Trehalose, a well-known stress-protector of biomolecules, has been investigated for its effect on the mobility, hydration and hydrogen bond interaction of lactose using diffusion-ordered NMR spectroscopy and NMR of hydroxy protons. In ternary mixtures of trehalose, lactose and water, the two sugars have the same rate of diffusion. The chemical shifts, temperature coefficients, vicinal coupling constants and ROE of the hydroxy protons in trehalose, lactose and sucrose were measured for the disaccharides alone in water/acetone-d6 solutions as well as in mixtures. The data indicated that addition of trehalose did not change significantly the strength of the hydrogen bond interaction between GlcOH3 and GalO5' in lactose. Small upfield shifts were however measured for all hydroxy protons when the sugar concentration was increased. The chemical shift of the GlcOH3 signal in lactose showed less change, attributed to the spatial proximity to GalO5'. Chemical exchange between hydroxy protons of lactose and trehalose was observed in the ROESY NMR spectra. Similar effects were observed with sucrose indicating no specific effect of trehalose at the concentrations investigated (73 to 763 mg/mL and suggesting that it is the concentration of hydroxy groups more than the type of sugars which is guiding intermolecular interactions.

Lactose malabsorption and intolerance: What should be the best clinical management?

Science.gov (United States)

Usai-Satta, Paolo; Scarpa, Mariella; Oppia, Francesco; Cabras, Francesco

2012-06-06

Lactose malabsorption (LM) is the incomplete hydrolysis of lactose due to lactase deficiency, which may occur as a primary disorder or secondary to other intestinal diseases. Primary adult-type hypolactasia is an autosomal recessive condition resulting from the physiological decline of lactase activity. Different methods have been used to diagnose LM. Lactose breath test represents the most reliable technique. A recent consensus conference has proposed the more physiological dosage of 25 g of lactose and a standardized procedure for breath testing. Recently a new genetic test, based on C/T13910 polymorphism, has been proposed for the diagnosis of adult-type hypolactasia, complementing the role of breath testing. LM represents a well-known cause of abdominal symptoms although only some lactose malabsorbers are also intolerants. Diagnosing lactose intolerance is not straightforward. Many non-malabsorber subjects diagnose themselves as being lactose intolerant. Blind lactose challenge studies should be recommended to obtain objective results. Besides several studies indicate that subjects with lactose intolerance can ingest up to 15 g of lactose with no or minor symptoms. Therefore a therapeutic strategy consists of a lactose restricted diet avoiding the nutritional disadvantages of reduced calcium and vitamin intake.Various pharmacological options are also available. Unfortunately there is insufficient evidence that these therapies are effective. Further double-blind studies are needed to demonstrate treatment effectiveness in lactose intolerance.

Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

Directory of Open Access Journals (Sweden)

Gogarten J Peter

2008-01-01

Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

Recent advances on lactose intolerance: Tolerance thresholds and currently available answers.

Science.gov (United States)

Corgneau, M; Scher, J; Ritie-Pertusa, L; Le, D T L; Petit, J; Nikolova, Y; Banon, S; Gaiani, C

2017-10-13

The genetically programmed reduction in lactase activity during adulthood affects 70% of the world adult population and can cause severe digestive disorders, which are the sign of lactose intolerance. Lactose intolerance symptoms vary depending on the residual lactase activity, the small bowel transit time, and especially the amount of ingested lactose. To formulate dairy products suitable for the vast majority of lactose intolerants, it is essential to define lactose intolerance threshold. A recent meta-analysis permitted to show that almost all lactose intolerants tolerate 12 g of lactose in one intake and approximately 18 g of lactose spread over the day. The prevalence and severity of lactose intolerance are probably overestimated by the general public. This misconception usually leads to an unnecessary reduction of dairy foodstuff consumption. Nevertheless, dairy products are essential for health mainly due to their calcium content and the positive influence of probiotic bacteria. The formulation of dairy products suitable for most intolerant and suspicious subjects seems necessary. The use of exogenous enzyme preparations, as well as the consumption of lactose-free products or products rich in probiotic bacteria are proposed as symptom-reducing strategies.

Perception of lactose intolerance impairs health-related quality of life.

Science.gov (United States)

Casellas, F; Aparici, A; Pérez, M J; Rodríguez, P

2016-09-01

Chronic conditions impair perception of well-being. Malabsorption of lactose is the most frequent form of malabsorption and manifests as lactose intolerance. There is a lack of information regarding their impact on self-perception of health. The objective of this study is to determine the subjective impact of self-reported lactose intolerance or objective lactose malabsorption on patient health by using a patient-reported outcome to measure health-related quality of life (HRQOL) and modification of lactose-containing food diet. A 3-year prospective, cross-sectional study was performed in patients referred for a lactose hydrogen breath test. Patients were asked about their subjective opinion relative to their lactose tolerance and completed a validated, specific questionnaire to determine symptoms of intolerance during habitual consumption of dairy. A 50-g lactose breath test was then performed. Patients were grouped as absorbers vs malabsorbers and tolerant vs intolerants. A total of 580 patients were included (median age 30 years, 419 female). Overall, 324 patients (56%) considered themselves lactose intolerant and that perception was associated with avoidance of dairy consumption (55% vs only 9% of self-defined tolerants). Self-perception of intolerance was associated with lower HRQOL scores (median, 60 vs 70, Plactose objective malabsorption was not clearly associated with dairy avoidance (41% of malabsorbers avoided dairy vs 31% of absorbers). However, HRQOL scores were also significantly lower in malabsorbers than in absorbers (60 vs 70 respectively, Plactose intolerance affects the decision to avoid dairy even more than objective malabsorption. However, both self-perception of lactose intolerance and objective lactose malabsorption are associated with poorer perceived quality of life.

Randomized, double-blind clinical trial of a lactose-free and a lactose-containing formula in dietary management of acute childhood diarrhea.

Science.gov (United States)

Simakachorn, Nipat; Tongpenyai, Yothi; Tongtan, Orapin; Varavithya, Wandee

2004-06-01

Refeeding of artificially fed infants with lactose-containing formula after oral rehydration therapy in the treatment of acute diarrhea was concluded to be indifferent to non-lactose formula by a meta-analysis. In Thai as well as Asian infants and children with low lactase level from genetically determinant and with rotavirus infection, lactose malabsorption is most likely to occur and cause delayed recovery. The aim of this study was to compare the effect of a lactose-free and a lactose-containing formula in dietary management of acute childhood diarrhea. A randomized, double-blind clinical trial of 80 male children, formula-fed, aged 3 to 24 months, admitted with acute watery diarrhea and mild or moderate dehydration, was carried out. All children received oral rehydration therapy for the first 4 hours. After appropriate rehydration, they were fed either a lactose-free formula (Dumex Lactose-Free Formula; treatment group, n = 40) or a lactose-containing formula (Dumex Infant Formula; control group, n = 40) in adjunction with oral rehydration solution. In addition, the infants were fed rice gruel as tolerated. Comparisons of duration of diarrhea, weight gain, vomiting, biochemical changes, stool frequency and weight and unscheduled intravenous fluid were made. Three children (2 treatment, and 1 control) dropped out from the study. The total number of unscheduled intravenous infusions were 6 of 80 children (7.5%), including 2 (5.0%) in the treatment group and 4 (10.0%) in the control group. Three children in the control group did not resolve from diarrhea within 7 days of treatment. Rotavirus was identified in approximately 50% of the children in each group. Using survival analysis, the median duration of diarrhea was significantly shortened by 20.5 hours in the treatment group compared to the control group (77.0 hours in the treatment group vs 97.5 hours in the control group; P = 0.002). Significantly decrease in stool frequency and increase in percent weight gain

Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

Science.gov (United States)

Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

2017-01-01

The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

Prevalence of lactose intolerance in Chile: a double-blind placebo study.

Science.gov (United States)

Latorre, Gonzalo; Besa, Pablo; Parodi, Carmen G; Ferrer, Verónica; Azocar, Lorena; Quirola, Marife; Villarroel, Luis; Miquel, Juan F; Agosin, Eduardo; Chianale, José

2014-01-01

Lactase non-persistence (LNP), or primary hypolactasia, is a genetic condition that mediates lactose malabsorption and can cause lactose intolerance. Here we report the prevalence of lactose intolerance in a double-blind placebo study. The LCT C>T-13910 variant was genotyped by RT-PCR in 121 volunteers and lactose malabsorption was assessed using the hydrogen breath test (HBT) after consuming 25 g of lactose. Lactose intolerance was assessed by scoring symptoms (SS) using a standardized questionnaire following challenge with a lactose solution or saccharose placebo. The LNP genotype was observed in 57% of the volunteers, among whom 87% were HBT⁺. In the HBT⁺ group the median SS was 9 and in the HBT⁻ group the median SS was 3 (p lactose intolerance was defined as the presence of an SS ≥ 6 points after subtracting the placebo effect and 34% of the study population met this definition. The LNP genotype was present in more than half of subjects evaluated and the observed prevalence of lactose intolerance was 34%. © 2014 S. Karger AG, Basel.

The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

Science.gov (United States)

Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

2011-06-10

The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

Recombinant cholera toxin B subunit in Escherichia coli: high-level secretion, purification, and characterization

NARCIS (Netherlands)

Slos, P.; Speck, D.; Accart, N.; Kolbe, H.V.; Schubnel, D.; Bouchon, B.; Bischoff, Rainer; Kieny, M.P.

1994-01-01

The gene coding for cholera toxin subunit B (CT-B) was fused to a modified ompA signal sequence and subsequently cloned into a high expression vector based on the regulatory signals of the arabinose operon of Salmonella typhimurium. Upon induction of gene expression in Escherichia coli, a product of

Perceived lactose intolerance in adult Canadians: a national survey.

Science.gov (United States)

Barr, Susan I

2013-08-01

Although double-blind studies show that lactose-intolerant individuals can consume moderate quantities of milk products without perceptible symptoms, many who perceive that they are lactose intolerant limit or avoid milk products, potentially compromising calcium and vitamin D intakes. Adult Canadians are at risk of inadequate intakes of these nutrients, but no data exist on the prevalence, correlates, and potential impact of perceived lactose intolerance among Canadians. To address this, a Web-based survey of a population-representative sample of 2251 Canadians aged ≥19 years was conducted. Overall, 16% self-reported lactose intolerance. This was more common in women (odds ratio (OR), 1.84; 95% CI, 1.46-2.33) and in nonwhites (OR, 1.79; 95% CI, 1.24-2.58) and less common in those >50 years of age (OR, 0.71; 95% CI, 0.56-0.90) and in those completing the survey in French (OR, 0.74; 95% CI, 0.56-0.99). Those with self-reported lactose intolerance had lower covariate-adjusted milk product and alternative intakes (mean ± SE; 1.40 ± 0.08 servings·day(-1) vs. 2.33 ± 0.03 servings·day(-1), p lactose intolerance by sex, age, and language preference was unexpected and suggests that some groups may be more vulnerable to the perception that they are lactose intolerant. Regardless of whether lactose intolerance is physiologically based or perceptual, education is required to ensure that calcium intakes are not compromised.

REMap: Operon map of M. tuberculosis based on RNA sequence data.

Science.gov (United States)

Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

2016-07-01

A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

Science.gov (United States)

Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

2012-01-01

During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

Science.gov (United States)

Ray, J. Christian J; Igoshin, Oleg A.

2012-01-01

Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

Colonic fermentation may play a role in lactose intolerance in humans

NARCIS (Netherlands)

He, T; Priebe, MG; Harmsen, HJM; Stellaard, F; Sun, XH; Welling, GW; Vonk, RJ

The results of our previous study suggested that in addition to the small intestinal lactase activity and transit time, colonic processing of lactose may play a role in lactose intolerance. We investigated whether colonic fermentation of lactose is correlated with lactose intolerance. After 28

A comparison between lactose breath test and quick test on duodenal biopsies for diagnosing lactase deficiency in patients with self-reported lactose intolerance.

Science.gov (United States)

Furnari, Manuele; Bonfanti, Daria; Parodi, Andrea; Franzè, Jolanda; Savarino, Edoardo; Bruzzone, Luca; Moscatelli, Alessandro; Di Mario, Francesco; Dulbecco, Pietro; Savarino, Vincenzo

2013-02-01

A lactose breath test (LBT) is usually used to diagnose lactase deficiency, and a lactose quick test (LQT) has been proposed as a new test on duodenal biopsies to detect this disorder. We aimed to assess the diagnostic accuracy of LBT and LQT and their ability to predict the clinical response to a lactose-free diet in patients with self-reported lactose intolerance. Fifty-five patients (age 47 ± 14 y; M/F 15/36) underwent upper gastrointestinal endoscopy and 25g-LBT. Two duodenal biopsies were taken to determine lactase deficiency (normal, mild, or severe) by LQT and to rule out other causes of secondary lactose malabsorption. Patients with a positive LBT and normal LQT also underwent a glucose breath test to exclude small intestinal bacterial overgrowth as a cause of the former result. The severity of gastrointestinal symptoms was measured with a GSS questionnaire, under basal condition and 1 month after a lactose-free diet. Lactose malabsorption was detected in 31/51 patients with LBT and in 37/51 patients with LQT (P = NS). Celiac disease was found in 2 patients. Two LBT+ patients showed a positive glucose breath test for small intestinal bacterial overgrowth. Eight patients had a mild hypolactasia by LQT and a negative LBT, but they had a significant improvement of symptoms after diet. LQT and LBT were concordant in 83% of cases and predicted the response to a lactose-free diet in 98% and 81% of the cases, respectively (P = 0.03). LQT is as sensitive as LBT in detecting lactase deficiency; however, it seems to be more accurate than LBT in predicting the clinical response to a lactose-free diet.

papA gene of avian pathogenic Escherichia coli.

Science.gov (United States)

Kariyawasam, Subhashinie; Nolan, Lisa K

2011-12-01

P fimbrial adhesins may be associated with the virulence of avian pathogenic Escherichia coli (APEC). However, most APECs are unable to express P fimbriae even when they are grown under conditions that favor P fimbrial expression. This failure can be explained by the complete absence of the pap operon or the presence of an incomplete pap operon in Pap-negative APEC strains. In the present study, we analyzed the pap operon, specifically the papA gene that encodes the major fimbrial shaft, to better understand the pap gene cluster at the genetic level. First, by PCR, we examined a collection of 500 APEC strains for the presence of 11 genes comprising the pap operon. Except for papA, all the other genes of the operon were present in 38% to 41.2% of APEC, whereas the papA was present only in 10.4% of the APEC tested. Using multiplex PCR to probe for allelic variants of papA, we sought to determine if the low prevalence of papA among APEC was related to genetic heterogeneity of the gene itself. It was determined that the papA of APEC always belongs to the F11 allelic variant. Finally, we sequenced the 'papA region' from two papA-negative strains, both of which contain all the other genes of the pap operon. Interestingly, both strains had an 11,104-bp contig interruptingpapA at the 281-bp position. This contig harbored a streptomycin resistance gene and a classic Tn10 transposon containing the genes that confer tetracycline resistance. However, we noted that the papA gene of every papA-negative APEC strain was not interrupted by an 11,104-bp contig. It is likely that transposons bearing antibiotic resistance genes have inserted within pap gene cluster of some APEC strains, and such genetic events may have been selected for by antibiotic use.

Solving a discrete model of the lac operon using Z3

Science.gov (United States)

Gutierrez, Natalia A.

2014-05-01

A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

Change of lactose content after milk fermentation using various microbial cultures

Directory of Open Access Journals (Sweden)

Ivana Vinko

2011-06-01

Full Text Available The purpose of this study was to determine lactose and lactic acid content and acidity changes in typified milk prior to fermentation and in dairy products on 1st and 28th day of their storage at 8 °C in cold environment. In this study 5 different dairy products were observed: yogurt, extra lactose yogurt, bifido milk, sour cream and sour milk. The enzymatic method for determination of lactose has been used. The biggest change in lactose and lactic acid content, according to study results, has happened in the process of fermentation, as expected. About 16-20 % of lactose has been converted by mesophilus, while significantly bigger part (round 30 % of lactose to lactic acid has been converted by thermophilus. The smallest part of lactose conversion was performed by Bifidobacterium therapy culture (just 15 % after the first day and 19 % on 28th day of cold storage which is due to the greater adjustment period of Bifidobacterium in milk for lactose fermentation.

Is the subjective perception of lactose intolerance influenced by the psychological profile?

Science.gov (United States)

Tomba, C; Baldassarri, A; Coletta, M; Cesana, B M; Basilisco, G

2012-10-01

Symptoms of lactose intolerance are often attributed to lactose malabsorption but, as this relationship has not been demonstrated when a small dose of lactose similar to that contained in one cup of milk is ingested by intolerant patients, psychological factors may play a role in altered symptom perception. To assess the hypothesis that the psychological profile influences the symptoms of lactose intolerance. One hundred and two consecutive patients underwent a 15 g lactose hydrogen breath test to assess lactose malabsorption. The patients recorded the presence and severity of symptoms of lactose intolerance during the breath test using visual analogue scales. The psychological profile was assessed using a psychological symptom checklist, and health-related quality of life by means of the short-form health survey. Lactose malabsorption and intolerance were diagnosed in, respectively, 18% and 29% of the patients. The two conditions were not associated, and the severity of intolerance was even less in the patients with malabsorption. Multivariate logistic analysis showed that a high somatisation t-score was significantly associated with lactose intolerance (odds ratio 4.184; 1.704-10.309); the effects of the other psychological variables and of lactose malabsorption were not statistically significant. Health-related quality of life was significantly reduced in the patients with somatisation, but not in those with lactose malabsorption. The symptoms of lactose intolerance during hydrogen breath testing at a low physiological lactose load, are unrelated to lactose malabsorption, but may reveal a tendency towards somatisation that could impair the quality of life. © 2012 Blackwell Publishing Ltd.

Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

2003-01-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

Science.gov (United States)

Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

2003-09-01

The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

[Determination of lactose intolerance frequency in children with food allergy].

Science.gov (United States)

Hutyra, Tomasz; Iwańczak, Barbara

2008-10-01

Lactose malabsorption and lactose intolerance symptoms are the most common alimentary tract disorders in children. Lactose intolerance is a result of lactase deficiency or lack of lactase and lactose malabsorption. Hypersensitivity in food allergy is connected with the presence of specific IgE (specific antibodies against some allergens) or lymphocytes. Lactose intolerance and food allergy may coexist in the same patient. The aim of this study was determination of lactose intolerance frequency in children with food allergy who were below and above 5 years of age. The number of 87 children with food allergy aged from 0.7 to 18 years were included in the study (48 boys and 39 girls). 51 patients above 5 years of age and 36 patients below 5 years of age were studied. Lactose intolerance symptoms, hydrogen breath test, activity of lactase and villous atrophy were investigated. Decreased absorption of lactose in hydrogen breath test was observed in 28% of children above 5 years of age and in 5% in younger children. Positive result of biological trial in hydrogen breath test was observed in 10% of patients who were below 5 years of age and in 26% patients above 5 years. There was no statistically significant difference in lactose intolerance frequency and in decreased activity of lactase in intestinal mucosa between these two groups. Frequent partial villous atrophy was observed in younger patients (41,38%) than in children above 5 years of age (17.86%). Lactose intolerance was observed in 10% patients who were below 5 years of age and in 26% patients above 5 years of age with food allergy. There was no statistically significant difference between these two groups.

A combination of acid lactase from Aspergillus oryzae and yogurt bacteria improves lactose digestion in lactose maldigesters synergistically: A randomized, controlled, double-blind cross-over trial.

Science.gov (United States)

de Vrese, Michael; Laue, Christiane; Offick, Birte; Soeth, Edlyn; Repenning, Frauke; Thoß, Angelika; Schrezenmeir, Jürgen

2015-06-01

Lactose digestion can be improved in subjects with impaired or completely absent intestinal lactase activity by administration of lactase preparations and particularly of acid lactase, which is active in the stomach, or by yogurt containing live lactic acid bacteria. It is the question, if lactose digestion can be further enhanced by combining these two approaches. We investigated in a randomised, placebo-controlled, double-blind, 5-arm crossover study on 24 lactose malabsorbers with variable degrees of lactase deficiency if different lactase preparations and freeze-dried yogurt culture affect gastrointestinal lactose digestion after consuming moderate amounts of lactose (12.5 g) by assessing hydrogen exhalation over 6 h. Furthermore, symptoms of lactose intolerance (excess gas production, abdominal pain, diarrhoea or nausea) were assessed using validated questionnaires. All preparations increased lactose digestion and reduced peak hydrogen exhalation by -27% (yogurt), -29/-33% (3300/9000 FCC(1) ((1) One FCC hydrolyses about 5 or 1.7-2.5 mg lactose in aquous solution or in (artificial) chyme, respectively, according to the FCC-III method of the Committee on Codex Specifications, Food and Nutrition Board, National Research Council. Food Chemicals Codex, 3rd edition. Washington, DC, National Academy Press, 1981 It cannot precisely be defined how much lactose can be hydrolysed in vivo by the consumption of a certain number of FCC units.) units acid lactase from Aspergillus oryzae) or -46%, respectively (3300 FCC units lactase plus yogurt culture combined), as compared with placebo (p yogurt cultures and acid lactase increases lactose digestion more than either freeze-dried yogurt cultures or acid lactase alone, and more lactose malabsorbers benefited from this effect. Copyright © 2014. Published by Elsevier Ltd.

Research and determination of process parameters of milk lactose hydrolysis

OpenAIRE

Калинина, Елена Дмитриевна; Коваленко, Александр Владимирович

2014-01-01

The researches of enzymatic milk lactose hydrolysis by using the β - galactosidase enzyme are given in the paper. For carrying out a lactose hydrolysis, two β-galactosidase enzyme preparations GODO-YNL2 and Neolactase are offered. For setting lactose hydrolysis parameters, the influence of a pH medium, temperature, enzyme preparation doses, the duration of hydrolyzing the milk lactose affected by the β- galactosidase enzyme preparations, was studied. In terms of effectiveness, adaptability an...

Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

DEFF Research Database (Denmark)

Givskov, M; Eberl, L; Christiansen, Gunna

1995-01-01

When a liquid culture of Serratia spp. reaches the last part of the logarithmic phase of growth it induces the synthesis of several extracellular hydrolytic enzymes. In this communication we show that synthesis and secretion of the extracellular phospholipase is coupled to expression of flagella....... Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...

Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

Science.gov (United States)

García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

2017-09-01

Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Crystallization and preliminary X-ray diffraction analysis of mouse galectin-4 N-terminal carbohydrate recognition domain in complex with lactose

International Nuclear Information System (INIS)

Krejčiříková, Veronika; Fábry, Milan; Marková, Vladimíra; Malý, Petr; Řezáčová, Pavlína; Brynda, Jiří

2008-01-01

Mouse galectin-4 carbohydrate binding domain was overexpressed in E. coli and crystallized in the presence of lactose. The crystals belong to tetragonal space group P42 1 2 and diffraction data were collected to 2.1 Å resolution. Galectin-4 is thought to play a role in the process of tumour conversion of cells of the alimentary tract and the breast tissue; however, its exact function remains unknown. With the aim of elucidating the structural basis of mouse galectin-4 (mGal-4) binding specificity, we have undertaken X-ray analysis of the N-terminal domain, CRD1, of mGal-4 in complex with lactose (the basic building block of known galectin-4 carbohydrate ligands). Crystals of CRD1 in complex with lactose were obtained using vapour-diffusion techniques. The crystals belong to tetragonal space group P42 1 2 with unit-cell parameters a = 91.1, b = 91.16, c = 57.10 Å and preliminary X-ray diffraction data were collected to 3.2 Å resolution. An optimized crystallization procedure and cryocooling protocol allowed us to extend resolution to 2.1 Å. Structure refinement is currently under way; the initial electron-density maps clearly show non-protein electron density in the vicinity of the carbohydrate binding site, indicating the presence of one lactose molecule. The structure will help to improve understanding of the binding specificity and function of the potential colon cancer marker galectin-4

THE RELATIONSHIP BETWEEN BULK-DENSITY AND COMPACTIBILITY OF LACTOSE GRANULATIONS

NARCIS (Netherlands)

ZUURMAN, K; RIEPMA, KA; BOLHUIS, GK; VROMANS, H; LERK, CF

1994-01-01

The relationship between the bulk density and the compactibility of lactose granulations was studied. The granulations were prepared from different alpha-lactose monohydrate and roller dried beta-lactose powders by wet granulation, using different techniques with only water as a binder, or by

Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

Science.gov (United States)

Igoshin, Oleg

2011-03-01

Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

Expression, crystallization and preliminary diffraction studies of the Pseudomonas putida cytochrome P450cam operon repressor CamR

International Nuclear Information System (INIS)

Maenaka, Katsumi; Fukushi, Kouji; Aramaki, Hironori; Shirakihara, Yasuo

2005-01-01

The P. putida cytochrome P450cam operon repressor CamR has been expressed in E. coli and crystallized in space group P2 1 2 1 2. The Pseudomonas putida cam repressor (CamR) is a homodimeric protein that binds to the camO DNA operator to inhibit the transcription of the cytochrome P450cam operon camDCAB. CamR has two functional domains: a regulatory domain and a DNA-binding domain. The binding of the inducer d-camphor to the regulatory domain renders the DNA-binding domain unable to bind camO. Native CamR and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. Native CamR was crystallized under the following conditions: (i) 12–14% PEG 4000, 50 mM Na PIPES, 0.1 M KCl, 1% glycerol pH 7.3 at 288 K with and without camphor and (ii) 1.6 M P i , 50 mM Na PIPES, 2 mM camphor pH 6.7 at 278 K. The selenomethionyl derivative CamR did not crystallize under either of these conditions, but did crystallize using 12.5% PEG MME 550, 25 mM Na PIPES, 2.5 mM MgCl 2 pH 7.3 at 298 K. Preliminary X-ray diffraction studies revealed the space group to be orthorhombic (P2 1 2 1 2), with unit-cell parameters a = 48.0, b = 73.3, c = 105.7 Å. Native and selenomethionyl derivative data sets were collected to 3 Å resolution at SPring-8 and the Photon Factory

Intolerância à lactose: mudança de paradigmas com a biologia molecular Lactose intolerance: changing paradigms due to molecular biology

Directory of Open Access Journals (Sweden)

Rejane Mattar

2010-01-01

Full Text Available Na maioria dos mamíferos a atividade da enzima lactase diminui na parede intestinal após o desmame, caracterizando a hipolactasia primária que provoca sintomas de intolerância à lactose. A intensidade dos sintomas de distensão, flatulência, dor abdominal e diarreia variam, dependendo da quantidade de lactose ingerida, e aumentam com o passar da idade. A hipolactasia é determinada geneticamente, porém uma mutação ocorreu para que fizesse parte da humanidade tolerar o leite na idade adulta. O diagnóstico é feito por teste de tolerância, empregando a lactose como desafio. Com a descoberta dos finlandeses do polimorfismo associado com a persistência da lactase, principalmente no norte da Europa, o exame genético passou a ser outra ferramenta diagnóstica mais confortável para o intolerante. No Brasil, 43% dos brancos e dos mulatos têm alelo de persistência da lactase, sendo a hipolactasia mais frequente entre os negros e japoneses. Entretanto, na prática clínica indivíduos com hipolactasia podem ser orientados a consumir alguns derivados do leite e alimentos contendo lactose sem apresentar sintomas de intolerância, enquanto que outros terão que fazer restrição de lactose na dieta.In most mammals, lactase activity declines on the intestinal wall after weaning, characterizing primary hypolactasia that provokes symptoms of lactose intolerance. The intensity of symptoms of distention, flatulence, abdominal pain and diarrhea varies, according to the amount of ingested lactose, and increases with age. Hypolactasia is genetically determined; nonetheless, a mutation occurred that had made a part of mankind tolerate milk in adulthood. Diagnosis is made by a tolerance test, using the lactose challenge. With the discovery made by the Finns of polymorphism associated with lactase persistence, mainly, in Northern Europe, the genetic test was incorporated as a more comfortable diagnostic tool for the intolerant. In Brazil, 43% of

Biochemical and genetic improvement of Zymomonas mobilis

Energy Technology Data Exchange (ETDEWEB)

Ingram, L O; Carey, V C; Dombek, K M; Holt, A S; Holt, W A; Osman, Y A; Walia, S K

1984-01-01

Zymomonas mobilis offers many advantages for alcohol production including three- to five-fold higher rates of substrate conversion. Current progress and approaches are discussed for the biochemical and genetic improvement of this organism. These include the isolation of salt-resistant mutants and low pH-tolerant mutants. Gene banks of Lactobacillus heterohiochi are being screened for genes encoding alcohol resistance which can be subsequently introduced into Zymomonas mobilis. In addition, an enteric lactose operon has been inserted into Zymomonas mobilis and is expressed. These new strains are being further modified to increase the substrate range of Zymomonas mobilis to include lactose. This lactose operon serves as a model system to investigate the expression of foreign genes in Zymomonas mobilis. 25 references.

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

Science.gov (United States)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.

Science.gov (United States)

Chen, Y M; Zhu, Y; Lin, E C

1987-12-01

In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.

75 FR 2551 - NIH Consensus Development Conference: Lactose Intolerance and Health; Notice

Science.gov (United States)

2010-01-15

... Conference: Lactose Intolerance and Health; Notice Notice is hereby given by the National Institutes of Health (NIH) of the ``NIH Consensus Development Conference: Lactose Intolerance and Health'' to be held... the public. Lactose intolerance is the inability to digest significant amounts of lactose, a sugar...

Enzymatic hydrolysis of lactose of whey permeate

Directory of Open Access Journals (Sweden)

Karina Nascimento de Almeida

2015-09-01

Full Text Available The whey permeate is the residual of the concentration process of the whey proteins by ultrafiltration method. It contains important nutrients such as lactose, minerals and some proteins and lipids. It is without an ending industrial waste that causes serious damage to the environment. For its full use the lactose must be hydrolyzed to enable its consumption by intolerant people. The enzymatic hydrolysis by lactase (β-galactosidase of Kluyveromyces lactis yeast is a safe method that does not compromise the integrity of other nutrients, enabling further use of the permeate as a raw material. This study aimed to perform tests of enzymatic hydrolysis of lactose in whey permeate formulations in a concentration of 0.2%, 0.7% and 1% at 30, 60 and 90 minutes with pH 6.3 medium and 37 °C. The reactions were monitored by high performance liquid chromatography which showed that the enzyme concentration of 0.7% at time 30 minutes formulations became safe for consumption by lactose intolerant people, according to minimum levels established by law.

Lactose intolerance and cow's milk protein allergy

Directory of Open Access Journals (Sweden)

Adriano Henrique do Nascimento RANGEL

2016-01-01

Full Text Available Abstract Adverse reactions to food intake have very diverse etiology and symptomatology. Regarding milk, its food allergy is presented as lactose intolerance, the sugar in milk, or allergy to milk protein. Despite having different symptomatology, confusions among allergic conditions to dairy and its mediators are common. Milk protein allergy originates from protein components present in milk, causing reactions to either the protein fractions in emulsion (caseins or in whey (milk albumin. The allergic reaction is type IV mediated by T lymphocytes. The allergic reaction produces severe cellular damage and it triggers physical, mental and emotional symptomatology that may vary in time, intensity and severity. Lactose intolerance is originated by total or partial absence of the enzyme that digests this disaccharide. Lactose intolerance can be primary or congenital and secondary; the former being more rare and severe, the latter being more common. Lactase deficiency can be diagnosed by symptoms associated with cramping and diarrhea. Thus, the objective of this study was to conduct a review of available literature on cow’s milk protein allergy and lactose intolerance.

The effect of lactose-in-saline infusion on packed cell volume ...

African Journals Online (AJOL)

STORAGESEVER

2008-06-03

Jun 3, 2008 ... concluded that lactose ameliorated anaemia, by inhibiting the sequestration of desialylated ..... lactose infusion further supports the conclusion that lactose played ... statistics. 3rd. Ed. Chapman and Hall, London, pp. 191-194.

Global impact of mature biofilm lifestyle on Escherichia coli K-12 gene expression

DEFF Research Database (Denmark)

Beloin, C.; Valle, J.; Latour-Lambert, P.

2004-01-01

The formation of biofilm results in a major lifestyle switch that is thought to affect the expression of multiple genes and operons. We used DNA arrays to study the global effect of biofilm formation on gene expression in mature Escherichia coli K-12 biofilm. We show that, when biofilm is compared...... that 20 of these genes are required for the formation of mature biofilm. This group includes 11 genes of previously unknown function. These results constitute a comprehensive analysis of the global transcriptional response triggered in mature E. coli biofilms and provide insights into its physiological...

Development of “requeijão cremoso” without lactose

Directory of Open Access Journals (Sweden)

Andréia Paula Dal Castel

2018-02-01

Full Text Available Lactose intolerance is the name given to a dysfunction of the body, which has a deficiency or lack of production of enzyme lactase (β-galactosidase, responsible for the conversion of lactose into glucose and galactose. It is common in all age groups and ethnicities, its main consequence is the impossibility of ingesting products containing lactose, such as milk and its derivatives. Anticipating this, the food industry hydrolyzes lactose in order to obtain a product compatible with the disease, without compromising the characteristics already found in products without this treatment. Therefore, the objective of this work was to develop a “requeijão cremoso” without lactose. Skim milk were used as the main ingredient and β-galactosidase was added in concentrations of 0.07%, 0.1% and 0.2%, the hydrolysis time was 90 minutes at a pH of 6.55 and a temperature of 40 ºC. Analyses mode by high performance liquid chromatography showed that the degree of hydrolysis of the formulations was satisfactory. The developed product was adequate to the standards established by Brazilian legislation regarding to microbiological and physico-chemical standards. The sensorial analysis was performed with a hedonic scale of 9 points with a panel of 100 untrained judges, showing no statistically significant difference between samples of lactose-free and traditional curd. Thus, the formulation containing 0.07% of β-galactosidase enzyme can be considered a low-lactose curd, it is a good alternative for intolerants, since it has a similar taste and cost to the traditional one.

An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

Science.gov (United States)

Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

2013-07-01

The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Effect of lactose on intestinal absorption of calcium; Effet du lactose sur l'absorption intestinale du calcium

Energy Technology Data Exchange (ETDEWEB)

Labat, Marie-Louise

1972-06-15

Calcium absorption was immediately increased when lactose was administered in large amounts in the intestine of standard rats fed on a vitamin D diet. The same effect could be reproduced with lactulose, a glucid un-hydrolyzed by lactase and unabsorbed. The occurrence of a saturation process for high doses of calcium agrees with a biochemical process through a carrier; this process was not inhibited by actinomycin D, which does not agree with a 'de novo' synthesis of a calcium binding protein; yet activation of the preexisting protein cannot be excluded. The intestinal effect of lactose resulted in an inhibition of bone catabolism in the adult normocalcemic rat indicating a possible interference of thyrocalcitonin. Finally in the young rat, hypocalcemic by lack of vitamin D, on account of the lactose effect, calcium can be considered as a 'third messenger' in the chain of intracellular events between the interaction of the parathyroid hormone with the bone receptor and the expression of its activity. (author) [French] Le lactose introduit en quantite importante dans l'intestin augmente immediatement l'absorption du calcium chez le rat normal recevant par ailleurs de la vitamine D. Cet effet peut etre reproduit par le lactulose, glucide non hydrolyse par la lactase et non absorbe. L'apparition d'un phenomene de saturation pour les doses elevees de calcium s'accorde avec un mecanisme biochimique mettant en jeu un transporteur. Ce mecanisme n'est pas inhibe par l'actinomycine D, ce qui ne s'accorde pas avec une synthese 'de novo' de proteine transporteuse liant le calcium; on ne peut toutefois exclure une activation de cette proteine preexistante. L'effet intestinal du lactose a pour consequence l'inhibition du catabolisme osseux chez le rat adulte normocalcemique; ceci pose le probleme d'une intervention eventuelle de la thyrocalcitonine. Enfin, l'effet lactose nous permet d'attribuer au calcium le role de 'troisieme messager' dans la chaine d

Quantitative aspects of crystalline lactose in milk products

NARCIS (Netherlands)

Roetman, K.

1982-01-01

The occurrence of crystalline lactose in milk products and its influence on their physical properties are briefly reviewed. The importance of the quantitive determination of crystalline lactose for scientific and industrial purposes is indicated, and a summary is given of our earlier work. This

Transcription factor DecR (YbaO) controls detoxification of L-cysteine in Escherichia coli.

Science.gov (United States)

Shimada, Tomohiro; Tanaka, Kan; Ishihama, Akira

2016-09-01

YbaO is an uncharacterized AsnC-family transcription factor of Escherichia coli. In both Salmonella enterica and Pantoea ananatis, YbaO homologues were identified to regulate the adjacent gene encoding cysteine desulfhydrase for detoxification of cysteine. Using the genomic SELEX (systematic evolution of ligands by exponential enrichment) screening system, we identified the yhaOM operon, located far from the ybaO gene on the E. coli genome, as a single regulatory target of YbaO. In both gel shift assay in vitro and reporter and Northern blot assays in vivo, YbaO was found to regulate the yhaOM promoter. The growth of mutants lacking either ybaO or its targets yhaOM was delayed in the presence of cysteine, indicating involvement of these genes in cysteine detoxification. In the major pathway of cysteine degradation, hydrogen sulfide is produced in wild-type E. coli, but its production was not observed in each of the ybaO, yhaO and yhaM mutants. The yhaOM promoter was activated in the presence of cysteine, implying the role of cysteine in activation of YbaO. Taken together, we propose that YbaO is the cysteine-sensing transcriptional activator of the yhaOM operon, which is involved in the detoxification of cysteine. We then propose the naming of ybaO as decR (regulator of detoxification of cysteine).

Induction of the mar operon by miscellaneous groceries.

Science.gov (United States)

Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

2004-01-01

To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

Novel cellobiose 2-epimerases for the production of epilactose from milk ultrafiltrate containing lactose.

Science.gov (United States)

Krewinkel, Manuel; Kaiser, Jana; Merz, Michael; Rentschler, Eva; Kuschel, Beatrice; Hinrichs, Jörg; Fischer, Lutz

2015-06-01

A selected number of enzymes have recently been assigned to the emerging class of cellobiose 2-epimerases (CE). All CE convert lactose to the rare sugar epilactose, which is regarded as a new prebiotic. Within this study, the gene products of 2 potential CE genes originating from the mesophilic bacteria Cellulosilyticum lentocellum and Dysgonomonas gadei were recombinantly produced in Escherichia coli and purified by chromatography. The enzymes have been identified as novel CE by sequence analysis and biochemical characterizations. The biochemical characterizations included the determination of the molecular weight, the substrate spectrum, and the kinetic parameters, as well as the pH and temperature profiles in buffer and food matrices. Both identified CE epimerize cellobiose and lactose into the C2 epimerization products glucosylmannose and epilactose, respectively. The epimerization activity for lactose was maximal at pH 8.0 or 7.5 and 40°C in defined buffer systems for the CE from C. lentocellum and the CE from D. gadei, respectively. In addition, biotransformations of the foodstuff milk ultrafiltrate containing lactose were demonstrated. The CE from D. gadei was produced in a stirred-tank reactor (12 L) and purified using an automatic system. Enzyme production and purification in this scale indicates that a future upscaling of CE production is possible. The bioconversions of lactose in milk ultrafiltrate were carried out either in a batch process or in a continuously operated enzyme membrane reactor (EMR) process. Both processes ran at an industrially relevant low temperature of 8°C to reduce undesirable microbial growth. The enzyme was reasonably active at the low process temperature because the CE originated from a mesophilic organism. An epilactose yield of 29.9% was achieved in the batch process within 28 h of operation time. In the continuous EMR process, the epilactose yield in the product stream was lower, at 18.5%. However, the enzyme productivity

Preparation and Characterization of High Purity Anhydrous β-Lactose from α-Lactose Monohydrate at Mild Temperature

Directory of Open Access Journals (Sweden)

Ana L. López-Pablos

2018-01-01

Full Text Available Lactose is a disaccharide of importance in humans dietary, food products, and the pharmaceutical industry. From the existing isomeric forms, β-lactose is rarely found in nature. Thus, in this work, a simple methodology to obtain anhydrous β-lactose (βL from α-lactose monohydrate (αL·H2O is presented. The αL·H2O powder was dispersed into a basic alcoholic solution (72 hours, at controlled conditions of temperature (27, 29, 31, and 32°C, without stirring. The slurry was dried at room temperature and characterized. Fourier transform infrared spectroscopy showed the formation of βL for the samples prepared at 29 and 32°C. Raman spectroscopy confirmed this result and suggested the occurrence of crystalline βL. Rietveld refinement of the X-ray diffraction patterns was employed to identify and quantify the composition of the isomers. The samples prepared at 29 and 31°C showed the formation of pure βL, while those at 27 and 32°C showed the presence of αL·H2O and a mixture of the two isomers, respectively. The morphology of the powders was studied by scanning electron microscopy, observing the formation of irregular shape αL·H2O particles and axe-like βL particles. Clearly, with this methodology, it was possible to obtain pure, crystalline, and anhydrous βL at mild temperature.

Impact of orocecal transit time on patient´s perception of lactose intolerance.

Science.gov (United States)

Casellas, Francesc; Aparici, Anna; Casaus, Maite; Rodríguez, Purificación; Malagelada, Juan R

2013-01-01

symptoms attributed to the lactose intolerance are an important public health issue because of their prevalence and social relevance. Also because they may cause undue rejection of dairy products consume with potential health consequences. Transit time is a putative factor implied in the severity of symptoms associated with lactose. to elucidate the relation between orocecal transit time (OCTT) and lactose intolerance symptoms. observational study in patients referred to a lactose hydrogen breath test who showed an increase in breath H2 excretion higher than 25 ppm. OCTT was measured with the breath test and symptoms of lactose tolerance with a validated scale. Symptoms were measured twice: before receiving the lactose, inquiring about self perceived symptoms when patients consumed dairy products at home ("home symptoms"), and again after completing the lactose breath test ("test symptoms"). 161 patients were included. There was no correlation between OCTT and home symptoms (r = -0.1). When OCTT was faster than 60 minutes, intensity of "test symptoms" was similar to "home symptoms". However, in patients with normal or slow OCTT, the "home symptoms" were more intense than the "test symptoms" (p lactose test load the symptoms were proportionately more intense with faster OCTT. in lactose maldigesters, selfreported symptoms of lactose intolerance are more pronounced at home than after a high lactose challenge. Intolerance symptoms that patients attributed to lactose consume at home are due to factors other than fast OCTT.

Regulation of Expression of Uropathogenic Escherichia coli Nonfimbrial Adhesin TosA by PapB Homolog TosR in Conjunction with H-NS and Lrp

Science.gov (United States)

Engstrom, Michael D.

2016-01-01

Urinary tract infections (UTIs) are a major burden to human health. The overwhelming majority of UTIs are caused by uropathogenic Escherichia coli (UPEC) strains. Unlike some pathogens, UPEC strains do not have a fixed core set of virulence and fitness factors but do have a variety of adhesins and regulatory pathways. One such UPEC adhesin is the nonfimbrial adhesin TosA, which mediates adherence to the epithelium of the upper urinary tract. The tos operon is AT rich, resides on pathogenicity island aspV, and is not expressed under laboratory conditions. Because of this, we hypothesized that tosA expression is silenced by H-NS. Lrp, based on its prominent function in the regulation of other adhesins, is also hypothesized to contribute to tos operon regulation. Using a variety of in vitro techniques, we mapped both the tos operon promoter and TosR binding sites. We have now identified TosR as a dual regulator of the tos operon, which could control the tos operon in association with H-NS and Lrp. H-NS is a negative regulator of the tos operon, and Lrp positively regulates the tos operon. Exogenous leucine also inhibits Lrp-mediated tos operon positive regulation. In addition, TosR binds to the pap operon, which encodes another important UPEC adhesin, P fimbria. Induction of TosR synthesis reduces production of P fimbria. These studies advance our knowledge of regulation of adhesin expression associated with uropathogen colonization of a host. PMID:26755158

The role of colonic microbiota in lactose intolerance

NARCIS (Netherlands)

Zhong, Y; Priebe, M. G.; Vonk, R. J.; Huang, CY; Antoine, JM; He, T; Harmsen, HJM; Welling, GW

In a previous study we observed a clear difference in lactose intolerance symptoms after a 25-g lactose load in two groups of persons with lactase nonpersistence and similar small intestinal lactase activity. From this observation we hypothesized a colon resistance factor. To identify this factor,

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Science.gov (United States)

Deng, Ziqing; Shan, Yue; Pan, Qing; Gao, Xiang; Yan, Aixin

2013-01-01

The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of Escherichia coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF in the operon has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798 bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full-length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

CONDOP: an R package for CONdition-Dependent Operon Predictions.

Science.gov (United States)

Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

2016-10-15

The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Regulatory switches for hierarchical use of carbon sources in E. coli

Directory of Open Access Journals (Sweden)

Ruth S. Perez-Alfaro

2014-09-01

Full Text Available In this work we study the preferential use of carbon sources in the bacterium Escherichia coli. To that end we engineered transcriptional fusions of the reporter gene gfpmut2, downstream of transcription-factor promoters, and analyzed their activity under several conditions. The chosen transcription factors are known to regulate catabolic operons associated to the consumption of alternative sugars. The obtained results indicate the following hierarchical order of sugar preference in this bacterium: glucose > arabinose > sorbitol > galactose. Further dynamical results allowed us to conjecture that this hierarchical behavior might be operated by at least the following three regulatory strategies: 1 the coordinated activation of the corresponding operons by the global regulator catabolic repressor protein (CRP, 2 their asymmetrical responses to specific and unspecific sugars and, 3 the architecture of the associated gene regulatory networks.

Novel products and new technologies for use of a familiar carbohydrate, milk lactose.

Science.gov (United States)

Yang, S T; Silva, E M

1995-11-01

The cheese industry produces large amounts of lactose in the form of cheese whey and whey permeate, generating approximately 27 million tonnes/yr in the US alone. Many uses have been found for whey and lactose, including uses in infant formula; bakery, dairy, and confectionery products; animal feed; and feedstocks for lactose derivatives and several industrial fermentations. Lactose use in food products, however, is somewhat limited because of its low solubility and indigestibility in many individuals. For this reason, lactose is often hydrolyzed before use. Still, demand is insufficient to use all available whey lactose. The result is a low market value for lactose; almost half of the whey produced each year remains unused and is a significant waste disposal problem. Several approaches are possible for transforming lactose into value-added products. For example, galactooligosaccharides can be produce through enzymatic treatments of lactose and may be used as a probiotic food ingredient. Organic acids or xanthan gum may be produced via whey fermentation, and the fermented whey product can be used as a food ingredient with special functionality. This paper reviews the physical characteristics, production techniques, and current uses of lactose, whey, and lactose derivatives. Also examined are novel fermentation and separation technologies developed in our laboratory for the production of lactate, propionate, acetate, and xanthan gum from whey.

Spectroscopy of Cu(II)-PcoC and the multicopper oxidase function of PcoA, two essential components of Escherichia coli pco copper resistance operon.

Science.gov (United States)

Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V

2002-08-06

The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.

Presence and Characterization of Extraintestinal Pathogenic Escherichia coli Virulence Genes in F165-Positive E. coli Strains Isolated from Diseased Calves and Pigs

OpenAIRE

Dezfulian, Hojabr; Batisson, Isabelle; Fairbrother, John M.; Lau, Peter C. K.; Nassar, Atef; Szatmari, George; Harel, Josée

2003-01-01

The virulence genotype profile and presence of a pathogenicity island(s) (PAI) were studied in 18 strains of F165-positive Escherichia coli originally isolated from diseased calves or piglets. On the basis of their adhesion phenotypes and genotypes, these extraintestinal pathogenic strains were classified into three groups. The F165 fimbrial complex consists of at least two serologically and genetically distinct fimbriae: F1651 and F1652. F1651 is encoded by the foo operon (pap-like), and F16...

Roller compaction: Effect of relative humidity of lactose powder.

Science.gov (United States)

Omar, Chalak S; Dhenge, Ranjit M; Palzer, Stefan; Hounslow, Michael J; Salman, Agba D

2016-09-01

The effect of storage at different relative humidity conditions, for various types of lactose, on roller compaction behaviour was investigated. Three types of lactose were used in this study: anhydrous lactose (SuperTab21AN), spray dried lactose (SuperTab11SD) and α-lactose monohydrate 200M. These powders differ in their amorphous contents, due to different manufacturing processes. The powders were stored in a climatic chamber at different relative humidity values ranging from 10% to 80% RH. It was found that the roller compaction behaviour and ribbon properties were different for powders conditioned to different relative humidities. The amount of fines produced, which is undesirable in roller compaction, was found to be different at different relative humidity. The minimum amount of fines produced was found to be for powders conditioned at 20-40% RH. The maximum amount of fines was produced for powders conditioned at 80% RH. This was attributed to the decrease in powder flowability, as indicated by the flow function coefficient ffc and the angle of repose. Particle Image Velocimetry (PIV) was also applied to determine the velocity of primary particles during ribbon production, and it was found that the velocity of the powder during the roller compaction decreased with powders stored at high RH. This resulted in less powder being present in the compaction zone at the edges of the rollers, which resulted in ribbons with a smaller overall width. The relative humidity for the storage of powders has shown to have minimal effect on the ribbon tensile strength at low RH conditions (10-20%). The lowest tensile strength of ribbons produced from lactose 200M and SD was for powders conditioned at 80% RH, whereas, ribbons produced from lactose 21AN at the same condition of 80% RH showed the highest tensile strength. The storage RH range 20-40% was found to be an optimum condition for roll compacting three lactose powders, as it resulted in a minimum amount of fines in the

The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

Science.gov (United States)

Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

2012-01-01

Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

Effects of glucose on lactose synthesis in mammary epithelial cells from dairy cow.

Science.gov (United States)

Lin, Ye; Sun, Xiaoxu; Hou, Xiaoming; Qu, Bo; Gao, Xuejun; Li, Qingzhang

2016-05-26

Lactose, as the primary osmotic component in milk, is the major determinant of milk volume. Glucose is the primary precursor of lactose. However, the effect of glucose on lactose synthesis in dairy cow mammary glands and the mechanism governing this process are poorly understood. Here we showed that glucose has the ability to induce lactose synthesis in dairy cow mammary epithelial cells, as well as increase cell viability and proliferation. A concentration of 12 mM glucose was the optimum concentration to induce cell growth and lactose synthesis in cultured dairy cow mammary epithelial cells. In vitro, 12 mM glucose enhanced lactose content, along with the expression of genes involved in glucose transportation and the lactose biosynthesis pathway, including GLUT1, SLC35A2, SLC35B1, HK2, β4GalT-I, and AKT1. In addition, we found that AKT1 knockdown inhibited cell growth and lactose synthesis as well as expression of GLUT1, SLC35A2, SLC35B1, HK2, and β4GalT-I. Glucose induces cell growth and lactose synthesis in dairy cow mammary epithelial cells. Protein kinase B alpha acts as a regulator of metabolism in dairy cow mammary gland to mediate the effects of glucose on lactose synthesis.

Sorbitol-Fermenting Enterohemorrhagic Escherichia coli O157:H- Isolates from Czech Patients with Novel Plasmid Composition Not Previously Seen in German Isolates.

Science.gov (United States)

Bauwens, Andreas; Marejková, Monika; Middendorf-Bauchart, Barbara; Prager, Rita; Kossow, Annelene; Zhang, Wenlan; Karch, Helge; Mellmann, Alexander; Bielaszewska, Martina

2017-12-01

Sorbitol-fermenting (SF) enterohemorrhagic Escherichia coli (EHEC) O157:H - strains, first identified in Germany, have emerged as important pathogens throughout Europe. Besides chromosomally encoded Shiga toxin 2a (the major virulence factor), several putative virulence loci, including the hly , etp , and sfp operons, encoding EHEC hemolysin, type II secretion system proteins, and Sfp fimbriae, respectively, are located on the 121-kb plasmid pSFO157 in German strains. Here we report novel SF EHEC O157:H - strains isolated from patients in the Czech Republic. These strains share the core genomes and chromosomal virulence loci encoding toxins ( stx 2a and the cdtV -ABC operon) and adhesins ( eae -γ, efa1 , lpfA O157OI-141 , and lpfA O157OI-154 ) with German strains but differ essentially in their plasmids. In contrast to all previously detected SF EHEC O157:H - strains, the Czech strains carry two plasmids, of 79 kb and 86 kb. The 79-kb plasmid harbors the sfp operon, but neither of the plasmids contains the hly and etp operons. Sequence analyses demonstrated that the 79-kb plasmid (pSFO157 258/98-1) evolved from pSFO157 of German strains by deletion of a 41,534-bp region via homologous recombination, resulting in loss of the hly and etp operons. The 86-kb plasmid (pSFO157 258/98-2) displays 98% sequence similarity to a 92.7-kb plasmid of an extraintestinal pathogenic E. coli bloodstream isolate. Our finding of this novel plasmid composition in SF EHEC O157:H - strains extends the evolutionary history of EHEC O157 plasmids. Moreover, the unique molecular plasmid characteristics permit the identification of such strains, thereby facilitating further investigations of their geographic distribution, clinical significance, and epidemiology. IMPORTANCE Since their first identification in Germany in 1989, sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H - (nonmotile) strains have emerged as important causes of the life-threatening disease hemolytic

Sorbitol-Fermenting Enterohemorrhagic Escherichia coli O157:H− Isolates from Czech Patients with Novel Plasmid Composition Not Previously Seen in German Isolates

Science.gov (United States)

Bauwens, Andreas; Marejková, Monika; Middendorf-Bauchart, Barbara; Prager, Rita; Kossow, Annelene; Zhang, Wenlan; Karch, Helge

2017-01-01

ABSTRACT Sorbitol-fermenting (SF) enterohemorrhagic Escherichia coli (EHEC) O157:H− strains, first identified in Germany, have emerged as important pathogens throughout Europe. Besides chromosomally encoded Shiga toxin 2a (the major virulence factor), several putative virulence loci, including the hly, etp, and sfp operons, encoding EHEC hemolysin, type II secretion system proteins, and Sfp fimbriae, respectively, are located on the 121-kb plasmid pSFO157 in German strains. Here we report novel SF EHEC O157:H− strains isolated from patients in the Czech Republic. These strains share the core genomes and chromosomal virulence loci encoding toxins (stx2a and the cdtV-ABC operon) and adhesins (eae-γ, efa1, lpfAO157OI-141, and lpfAO157OI-154) with German strains but differ essentially in their plasmids. In contrast to all previously detected SF EHEC O157:H− strains, the Czech strains carry two plasmids, of 79 kb and 86 kb. The 79-kb plasmid harbors the sfp operon, but neither of the plasmids contains the hly and etp operons. Sequence analyses demonstrated that the 79-kb plasmid (pSFO157 258/98-1) evolved from pSFO157 of German strains by deletion of a 41,534-bp region via homologous recombination, resulting in loss of the hly and etp operons. The 86-kb plasmid (pSFO157 258/98-2) displays 98% sequence similarity to a 92.7-kb plasmid of an extraintestinal pathogenic E. coli bloodstream isolate. Our finding of this novel plasmid composition in SF EHEC O157:H− strains extends the evolutionary history of EHEC O157 plasmids. Moreover, the unique molecular plasmid characteristics permit the identification of such strains, thereby facilitating further investigations of their geographic distribution, clinical significance, and epidemiology. IMPORTANCE Since their first identification in Germany in 1989, sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H− (nonmotile) strains have emerged as important causes of the life-threatening disease hemolytic

Quantitative determination of micronization-induced changes in the solid state of lactose.

Science.gov (United States)

Della Bella, A; Müller, M; Soldati, L; Elviri, L; Bettini, R

2016-05-30

Lactose, in particular α-lactose monohydrate, is the most used carrier for inhalation. Its surface and solid-state properties play a key role in determining Dry Powder Inhalers (DPIs) performance. Techniques such as X-Ray Powder Diffraction (XRPD) and Differential Scanning Calorimetry (DSC), which are commonly used for the characterization of lactose, are not always capable of explaining the solid-state changes induced by processing, such as micronization. In the present work, the evaluation of the effect of the micronization process on the solid-state properties of lactose was carried out by XRPD and DSC and a satisfactory, although not unequivocal, interpretation of the thermal behaviour of lactose was obtained. Thus, a new gravimetric method correlating in a quantitative manner the weight change in specific sections of the Dynamic Vapour Sorption (DVS) profile and the amount of different forms of α-lactose (hygroscopic anhydrous, stable anhydrous and amorphous) simultaneously present in a given sample was developed and validated. The method is very simple and provides acceptable accuracy in phase quantitation (LOD=1.6, 2.4 and 2.7%, LOQ=5.4, 8.0 and 8.9% for hygroscopic anhydrous, stable anhydrous and amorphous α-lactose, respectively). The application of this method to a sample of micronized lactose led to results in agreement with those obtained by DSC and evidenced that hygroscopic anhydrous α-lactose, rather than amorphous lactose, can be generated in the micronization process. The proposed method may find a more general application for the quantification of polymorphs of compounds different than lactose, provided that the various solid phases afford different weight variations in specific regions of the DVS profile. Copyright © 2016 Elsevier B.V. All rights reserved.

Some Peculiarities of Growth and Functional Activity of Escherichia coli Strain from Probiotic Formula "ASAP"

OpenAIRE

Marine A. Balayan; Susanna S. Mirzabekyan; Marine Isajanyan; Zaven S. Pepoyan; Аrmen H. Trchounian; Аstghik Z. Pepoyan; Helena Bujdakova

2010-01-01

It has been shown that pH 7,3 and 37 0C are the optimal condition for the growth of E. coli “ASAP". The cells grow well on Glucose, Lactose, D-Mannitol, D-Sorbitol, (+)-Xylose, L- (+)-Arabinose and Dulcitol. No growth has been observed on Sucrose, Inositol, Phenylalanine, and Tryptophan. The strain is sensitive to a range of antibiotics. The present study has demonstrated that E. coli “ASAP" inhibit the growth of S. enterica ATCC #700931 in vitro. The studies on conjugating activity has revea...

The pyrimidine operon pyrRPB-carA from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Schallert, J.; Andersen, Birgit

2001-01-01

The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

Lactose and Fructose Intolerance in Turkish Children with Chronic Abdominal Pain.

Science.gov (United States)

Yuce, Ozlem; Kalayci, Ayhan Gazi; Comba, Atakan; Eren, Esra; Caltepe, Gonul

2016-05-08

To investigate the prevalence of lactose and fructose intolerance in children with chronic abdominal pain. Hydrogen breath tests were done to detect lactose and fructose malabsorption in 86 children with chronic abdominal pain (44 irritable bowel syndrome, 24 functional abdominal pain and 17 functional abdominal pain syndrome as per Rome III criteria) presenting to a Pediatric Gastroentreology department. 14 (16.3%) of patients were diagnosed with lactose intolerance and 11 (12.8%) with fructose intolerance. Lactose and fructose intolerance in children can lead to chronic abdominal pain and symptoms improve with dietary modifications.

Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

DEFF Research Database (Denmark)

Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

1994-01-01

Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

Lactose maldigestion - age-specific prevalence black and Indian ...

African Journals Online (AJOL)

A study was performed to determine the prevalence and age of onset of primary lactose maldigestion in healthy black and Indian children, and to determine whether this was of clinical significance. More black (22 of 44 - 50%) than Indian children (10 of 45 - 22,2%) had lactose maldigestion (P < 0,02), the development of ...

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

Clinical Significance of Excess Lactose in the Diet (part 1

Directory of Open Access Journals (Sweden)

A.Ye. Abaturov

2016-02-01

Full Text Available In the article on the basis of the literature there has been considered the statistics of average consumption of lactose in the countries of the world community, reviewed the clinical significance of the excess lactose in the diet depending on the polymorphism of the lactase gene. Lactose is the main source of energy for the children of the first months of life, which provides about 40–45 % of the daily energy needs of a body of a child. Lactose malabsorption, deficiency of the enzyme lactase is accompanied by symptoms of lactose intolerance. Interest in the study of the influence of an immunomodulatory β-galactoside lactose was caused by the suppression of its galectin 9 ­(Gal-9, the regulatory T-cell immune response involving T-helper cells 1 and 17 (Th1, Th17 and regulatory T-lymphocytes (Treg, which are involved in many immune-mediated human disea­ses. Galectin 9 is the representative of the class of galectins such as «tandem repeat». The highest level of LGALS9 expression is observed in the tissues of colon, lung, bone marrow, lymph nodes, thymus, liver, kidney, endocrine glands, placenta, skin, smooth muscle, adipose tissue.

The practical significance of lactose maldigestion in institutionalised ...

African Journals Online (AJOL)

A study was carried out to determine the practical significance of a high prevalence of lactose maldigestion in institu- tionalised children whose diet included 500 ml milk daily. Thirty of 34 children at a child we"are home were found to be lactose maldigesters as judged by a 2-hour rise in breath hydrogen of 20 parts per ...

The practical significance of lactose maldigestion in institutionalised ...

African Journals Online (AJOL)

A study was carried out to determine the practical significance of a high prevalence of lactose maldigestion in institutionalised children whose diet included 500 ml milk daily. Thirty of 34 children at a child we"are home were found to be lactose maldigesters as judged by a 2-hour rise in breath hydrogen of 20 parts per ...

High-level expression of a fungal pyranose oxidase in high cell-density fed-batch cultivations of Escherichia coli using lactose as inducer

Czech Academy of Sciences Publication Activity Database

Kotík, Michael; Kočanová, Marcela; Marešová, Helena; Kyslík, Pavel

2004-01-01

Roč. 36, - (2004), s. 61-69 ISSN 1046-5928 Institutional research plan: CEZ:AV0Z5020903 Keywords : fed-batch * lactose * inclusion bodies Subject RIV: EE - Microbiology, Virology Impact factor: 1.336, year: 2004

Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

Science.gov (United States)

Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

2016-01-01

Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

Prediction of transcriptional regulatory sites in the complete genome sequence of Escherichia coli K-12.

Science.gov (United States)

Thieffry, D; Salgado, H; Huerta, A M; Collado-Vides, J

1998-06-01

As one of the best-characterized free-living organisms, Escherichia coli and its recently completed genomic sequence offer a special opportunity to exploit systematically the variety of regulatory data available in the literature in order to make a comprehensive set of regulatory predictions in the whole genome. The complete genome sequence of E.coli was analyzed for the binding of transcriptional regulators upstream of coding sequences. The biological information contained in RegulonDB (Huerta, A.M. et al., Nucleic Acids Res.,26,55-60, 1998) for 56 different transcriptional proteins was the support to implement a stringent strategy combining string search and weight matrices. We estimate that our search included representatives of 15-25% of the total number of regulatory binding proteins in E.coli. This search was performed on the set of 4288 putative regulatory regions, each 450 bp long. Within the regions with predicted sites, 89% are regulated by one protein and 81% involve only one site. These numbers are reasonably consistent with the distribution of experimental regulatory sites. Regulatory sites are found in 603 regions corresponding to 16% of operon regions and 10% of intra-operonic regions. Additional evidence gives stronger support to some of these predictions, including the position of the site, biological consistency with the function of the downstream gene, as well as genetic evidence for the regulatory interaction. The predictions described here were incorporated into the map presented in the paper describing the complete E.coli genome (Blattner,F.R. et al., Science, 277, 1453-1461, 1997). The complete set of predictions in GenBank format is available at the url: http://www. cifn.unam.mx/Computational_Biology/E.coli-predictions ecoli-reg@cifn.unam.mx, collado@cifn.unam.mx

Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

NARCIS (Netherlands)

Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

2015-01-01

In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

Crystal engineering of lactose using electrospray technology: carrier for pulmonary drug delivery.

Science.gov (United States)

Patil, Sharvil; Mahadik, Abhijeet; Nalawade, Pradeep; More, Priyesh

2017-12-01

Dry powder inhalers (DPIs) consisting of a powder mixture containing coarse carrier particles (generally lactose) and micronized drug particles are used for lung drug delivery. The effective drug delivery to the lungs depends on size and shape of carrier particles. Thus, various methods have been proposed for engineering lactose particles to enhance drug delivery to lungs. The objective of current work was to assess suitability of electrospray technology toward crystal engineering of lactose. Further, utility of the prepared lactose particles as a carrier in DPI was evaluated. Saturated lactose solutions were electrosprayed to obtain electrosprayed lactose (EL) particles. The polymorphic form of EL was determined using Fourier transform infrared spectroscopy, powder X-ray diffractometry, and differential scanning calorimetry. In addition, morphological, surface textural, and flow properties of EL were determined using scanning electron microscopy and Carr's index, respectively. The aerosolization properties of EL were determined using twin-stage impinger and compared with commercial lactose particles [Respitose ® (SV003, Goch, Germany)] used in DPI formulations. EL was found to contain both isomers (α and β) of lactose having flow properties comparable to Respitose ® (SV003). In addition, the aerosolization properties of EL were found to be significantly improved when compared to Respitose ® (SV003) which could be attributed to morphological (high elongation ratio) and surface characteristic (smooth surface) alterations induced by electrospray technology. Electrospray technology can serve as an alternative technique for continuous manufacturing of engineered lactose particles which can be used as a carrier in DPI formulations.

The post-transcriptional operon

DEFF Research Database (Denmark)

Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

2011-01-01

model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

Inhibition of Recrystallization of Amorphous Lactose in Nanocomposites Formed by Spray-Drying.

Science.gov (United States)

Hellrup, Joel; Alderborn, Göran; Mahlin, Denny

2015-11-01

This study aims at investigating the recrystallization of amorphous lactose in nanocomposites. In particular, the focus is on the influence of the nano- to micrometer length scale nanofiller arrangement on the amorphous to crystalline transition. Further, the relative significance of formulation composition and manufacturing process parameters for the properties of the nanocomposite was investigated. Nanocomposites of amorphous lactose and fumed silica were produced by co-spray-drying. Solid-state transformation of the lactose was studied at 43%, 84%, and 94% relative humidity using X-ray powder diffraction and microcalorimetry. Design of experiments was used to analyze spray-drying process parameters and nanocomposite composition as factors influencing the time to 50% recrystallization. The spray-drying process parameters showed no significant influence. However, the recrystallization of the lactose in the nanocomposites was affected by the composition (fraction silica). The recrystallization rate constant decreased as a function of silica content. The lowered recrystallization rate of the lactose in the nanocomposites could be explained by three mechanisms: (1) separation of the amorphous lactose into discrete compartments on a micrometer length scale (compartmentalization), (2) lowered molecular mobility caused by molecular interactions between the lactose molecules and the surface of the silica (rigidification), and/or (3) intraparticle confinement of the amorphous lactose. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

Clinical significance of fermentation and lactose malabsorption

OpenAIRE

Olesen, Merete; Gudmand-Høyer, Eivind

2001-01-01

Fermentation, the bacterial process of gaining energy from the breakdown of carbohydrates, takes place in the human large intestine as well as that of the animals. This process is important for the health of the colon. Due to changing dietary habits, the available substrates for fermentation in the human colon are scarce, and this fact may contribute to the increased number of colonic diseases in the Western world. Lactose in lactose-maldigesters increase the amounts of fermentable substrate,...

Short communication: Lactose enhances bile tolerance of yogurt culture bacteria.

Science.gov (United States)

Mena, Behannis; Aryana, Kayanush

2018-03-01

Lactose is an energy source for culture bacteria. Bile tolerance is an important probiotic property. Our aim was to elucidate the effect of lactose on bile tolerance of yogurt starter culture Lactobacillus bulgaricus LB-12 and Streptococcus thermophilus ST-M5. Bile tolerance of pure cultures was determined using 0.3% oxgall in MRS THIO broth (Difco, Becton Dickinson, Sparks, MD) for L. bulgaricus and 0.3% oxgall in M17 broth (Oxoid, Basingstoke, UK) for Strep. thermophilus. Lactose was added to both broths at 0 (control), 1, 3, and 5% (wt/vol) broth. Dilutions were plated hourly for 12 h. Experiments were replicated 3 times. At 2, 4, and 12 h of incubation, lactose incorporated at all amounts, 1, 3, and 5% (wt/vol), showed higher counts of Strep. thermophilus ST-M5 compared with the control. Lactose use at 5% (wt/vol) significantly enhanced bile tolerance of both L. bulgaricus and Strep. thermophilus compared with control. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Lactose hydrolysis by free and fibre-entrapped β-galactosidase from Streptococcus thermophilus

Directory of Open Access Journals (Sweden)

Zhennai Yang

1993-09-01

Full Text Available To study lactose hydrolysis by β-galactosidase, this enzyme was produced from Streptococcus thermophilus strain 11F and partially purified by acetone and ammonium sulphate fractionation, and ion exchange chromatography on a Q Sepharose FF column. Lactose hydrolysis by the enzyme was affected by lactose concentrations, sugars and milk proteins. The maximum extent of lactose hydrolysis in buffer was obtained with a 15% lactose concentration. Addition of 2% of lactose, glucose, galactose or sucrose in milk inhibited the enzymatic hydrolysis. The enzyme was activated by bovine serum albumin and a combination of αs-casein and β-casein. Of the casein fractions, the principal fraction, αs-casein, was less effective than β-casein and κ-casein. The fibre entrapped enzyme had a temperature optimum of 57°C, and a pH optimum from 7.5 to at least 9.0 with O-nitrophenyl-β-D-galactopyranoside as substrate. By recycling with whey and skim milk through a jacketed glass column (1.6 cm x 30 cm loaded with fibre-entrapped enzyme at 55°C, a lactose hydrolysis of 49.5% and 47.9% was achieved in 11 h and 7 h respectively.

Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

Directory of Open Access Journals (Sweden)

Juliana Teixeira de Magalhães

2005-06-01

Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

Lactose and ''tris'' lyoluminescence dosimetry systems and ESR correlation studies

International Nuclear Information System (INIS)

Oommen, I.K.; Nambi, K.S.V.; Sengupta, S.; Rao, T.K.G.; Ravikumar, M.

1989-01-01

Lyoluminescence (LL) dosimeters have been developed using lactose monohydrate (disaccharide) and tris(hydroxymethyl)aminomethane (''Tris'') systems and attempts have been made to understand the LL mechanism through ESR correlation studies. Tris LL dosimeter has a γ-ray sensitivity with a linear response in the absorbed-dose range 0.05-200 Gy (5-2 x 10 4 rad), while the lactose response extends to a higher range from 1 to 10 4 Gy (10 2 -10 6 rad). The LL output of lactose and Tris did not show any appreciable decay for a period of 6 months after irradiation. ESR measurements show that free-radical concentration in both the systems increases with γ-ray dose in the range 10 2 -10 5 Gy. The minimum dose required to measure the radiation-induced ESR signal for Tris is ∼ 500 Gy, the dose at which the LL output saturates, while lactose shows a radiation-induced ESR signal right at the minimum dose where LL could be detected. The estimated spin density on the radical carbon atom is 0.7. ESR signal stabilities of lactose and Tris were also studied. Lactose did not show any appreciable ESR decay for a period of 3 months after irradiation, while, for Tris, one of the radicals showed a decay of 45% for the same period. (author)

TABLETING PROPERTIES OF EXPERIMENTAL AND COMMERCIALLY AVAILABLE LACTOSE GRANULATIONS FOR DIRECT COMPRESSION

NARCIS (Netherlands)

BOLHUIS, GK; ZUURMAN, K

1995-01-01

Lactose granulations (125-250 mu m) were prepared from two different alpha-lactose monohydrate powders and one roller dried beta-lactose powder respectively, by wet granulation with only water as a binder. As an effect of the granulation process, the flow properties improved, but the compactibility

Construction and expression of immunogenic hybrid enterotoxigenic Escherichia coli CFA/I and CS2 colonization fimbriae for use in vaccines.

Science.gov (United States)

Tobias, Joshua; Svennerholm, Ann-Mari; Holmgren, Jan; Lebens, Michael

2010-07-01

Enterotoxigenic Escherichia coli (ETEC) are an important cause of diarrheal morbidity in developing countries, especially in children and also of traveler's diarrhea. Colonization factors (CFs) of ETEC, like CFA/I and CS2 which are genetically and structurally related, play a substantial role in pathogenicity, and since intestinal-mucosal immune responses against CFs appear to be protective, much effort has focused on the development of a CF-based ETEC vaccine. We have constructed hybrid operons in which the major CS2 subunit-encoding cotA gene was inserted into the CFA/I operon, either replacing (hybrid I) or being added to the major CFA/I subunit-encoding cfaB gene (hybrid II). Using specific monoclonal antibodies against the major subunits of CFA/I and CS2, high levels of surface expression of both fimbrial subunits were shown in E. coli carrying the hybrid II operon. Oral immunization of mice with formalin-killed bacteria expressing hybrid II fimbriae induced strong CFA/I- and CS2-specific serum IgG + IgM and fecal IgA antibody responses, which were higher than those achieved by similar immunization with the reference strains. Bacteria expressing hybrid fimbriae are potential candidate strains in an oral-killed CF-ETEC vaccine, and the approach represents an attractive and novel means of producing a broad-spectrum ETEC vaccine.

Effect of age and lactose on 67Cu utilization in rats

International Nuclear Information System (INIS)

Link, J.; Dowdy, R.; Michelmann, E.; Hill, G.; Zinn, K.; Trrokey, D.; Ellersieck, M.

1991-01-01

Young and old male Fischer 344 rats were fed a control diet or a lactose diet. After four weeks rats were gavaged with approximately 6.24 uCl 67 Cu, placed in metabolism cages, and fed their respective diets for an additional two weeks. Daily whole body, urine and fecal radioactivity measurements were made. Rats were killed on day 42 and livers removed for radioactivity determination. Diet had no effect on whole body retention of 67 Cu in the old rats; approximately 20% of the initial dose was retained by the end of the study. In the young rats, however, lactose appeared to enhance initial 67 Cu retention; by day three young control rats retained only 30% of the initial dose, while the young lactose rats retained about 50%. Retention of 67 Cu at the end of the study was approximately 15% and 20% for young control and young lactose rats, respectively. During the first four days post dosing, cumulative fecal 67 Cu excretion was approximately 83% for young control rats and 69% for young lactose rats indicating enhancement of 67 Cu absorption by lactose in the young rats. For old rats cumulative 67 Cu excretion in feces was about 50% regardless of diet. Cumulative urinary 67 Cu excretion was approximately 6% and 8% for young control and lactose rats, respectively vs about 11% for old rats. 67 Cu retention in liver was greater in old rats regardless of diet. The early increase in 67 Cu absorption after a bolus dose may have therapeutic implications. In light of current concern regarding Cu-carbohydrate interactions, the apparent enhancement Cu retention by lactose in young rats deserves further attention

Nondestructive evaluation of crystallized-particle size in lactose-powder by terahertz time-domain spectroscopy

Science.gov (United States)

Yamauchi, Satoshi; Hatakeyama, Sakura; Imai, Yoh; Tonouchi, Masayoshi

2014-03-01

Transmission-type terahertz time-domain spectroscopy is applied to evaluate crystallized lactose particle of size below 30 μm, which is far too small compared to the wavelength of incident terahertz (THz)-wave. The THz-absorption spectrum of lactose is successfully deconvoluted by Lorentzian to two spectra with peaks at 17.1 cm-1 (0.53 THz) and 45.6 cm-1 (1.37 THz) derived from α-lactose monohydrate, and a spectrum at 39.7 cm-1 (1.19 THz) from anhydrous β-lactose after removal of the broad-band spectrum by polynomial cubic function. Lactose is mainly crystallized into α-lactose monohydrate from the supersaturated solution at room temperature with a small amount of anhydrous β-lactose below 4%. The absorption feature is dependent on the crystallized particle size and the integrated intensity ratio of the two absorptions due to α-lactose monohydrate is correlated in linear for the size.

Lactose-Inducible System for Metabolic Engineering of Clostridium ljungdahlii

Energy Technology Data Exchange (ETDEWEB)

Banerjee, A; Leang, C; Ueki, T; Nevin, KP; Lovley, DR

2014-03-25

The development of tools for genetic manipulation of Clostridium ljungdahlii has increased its attractiveness as a chassis for autotrophic production of organic commodities and biofuels from syngas and microbial electrosynthesis and established it as a model organism for the study of the basic physiology of acetogenesis. In an attempt to expand the genetic toolbox for C. ljungdahlii, the possibility of adapting a lactose-inducible system for gene expression, previously reported for Clostridium perfringens, was investigated. The plasmid pAH2, originally developed for C. perfringens with a gusA reporter gene, functioned as an effective lactose-inducible system in C. ljungdahlii. Lactose induction of C. ljungdahlii containing pB1, in which the gene for the aldehyde/alcohol dehydrogenase AdhE1 was downstream of the lactose-inducible promoter, increased expression of adhE1 30-fold over the wild-type level, increasing ethanol production 1.5-fold, with a corresponding decrease in acetate production. Lactose-inducible expression of adhE1 in a strain in which adhE1 and the adhE1 homolog adhE2 had been deleted from the chromosome restored ethanol production to levels comparable to those in the wild-type strain. Inducing expression of adhE2 similarly failed to restore ethanol production, suggesting that adhE1 is the homolog responsible for ethanol production. Lactose-inducible expression of the four heterologous genes necessary to convert acetyl coenzyme A (acetyl-CoA) to acetone diverted ca. 60% of carbon flow to acetone production during growth on fructose, and 25% of carbon flow went to acetone when carbon monoxide was the electron donor. These studies demonstrate that the lactose-inducible system described here will be useful for redirecting carbon and electron flow for the biosynthesis of products more valuable than acetate. Furthermore, this tool should aid in optimizing microbial electrosynthesis and for basic studies on the physiology of acetogenesis.

Lactose-Inducible System for Metabolic Engineering of Clostridium ljungdahlii

Science.gov (United States)

Ueki, Toshiyuki; Nevin, Kelly P.; Lovley, Derek R.

2014-01-01

The development of tools for genetic manipulation of Clostridium ljungdahlii has increased its attractiveness as a chassis for autotrophic production of organic commodities and biofuels from syngas and microbial electrosynthesis and established it as a model organism for the study of the basic physiology of acetogenesis. In an attempt to expand the genetic toolbox for C. ljungdahlii, the possibility of adapting a lactose-inducible system for gene expression, previously reported for Clostridium perfringens, was investigated. The plasmid pAH2, originally developed for C. perfringens with a gusA reporter gene, functioned as an effective lactose-inducible system in C. ljungdahlii. Lactose induction of C. ljungdahlii containing pB1, in which the gene for the aldehyde/alcohol dehydrogenase AdhE1 was downstream of the lactose-inducible promoter, increased expression of adhE1 30-fold over the wild-type level, increasing ethanol production 1.5-fold, with a corresponding decrease in acetate production. Lactose-inducible expression of adhE1 in a strain in which adhE1 and the adhE1 homolog adhE2 had been deleted from the chromosome restored ethanol production to levels comparable to those in the wild-type strain. Inducing expression of adhE2 similarly failed to restore ethanol production, suggesting that adhE1 is the homolog responsible for ethanol production. Lactose-inducible expression of the four heterologous genes necessary to convert acetyl coenzyme A (acetyl-CoA) to acetone diverted ca. 60% of carbon flow to acetone production during growth on fructose, and 25% of carbon flow went to acetone when carbon monoxide was the electron donor. These studies demonstrate that the lactose-inducible system described here will be useful for redirecting carbon and electron flow for the biosynthesis of products more valuable than acetate. Furthermore, this tool should aid in optimizing microbial electrosynthesis and for basic studies on the physiology of acetogenesis. PMID:24509933

Treatment of chronic portal-systemic encephalopathy with lactose in lactase-deficient patients.

Science.gov (United States)

Uribe, M; Márquez, M A; García-Ramos, G; Escobedo, V; Murillo, H; Guevara, L; Lisker, R

1980-12-01

A controlled cross-over clinical comparison of lactose (50 g twice a day) versus neomycin (3 g/day) plus milk of magnesia, was carried out in ten cirrhotic patients with chronic portal-systemic encephalopathy and documented lactase deficiency. Serial semiquantitative assessments were done including: mental state, asterixis, number connection test, electroencephalogram, and blood ammonia levels. No patient developed deep coma while ingesting either lactose or neomycin plus milk of magnesia. However, a significant improvement of mental state, asterixis, number connection tests, and electroencephalograms was evident during lactose therapy. apart from mild diarrhea and bloating, no severe side effects were noticeable during lactose treatment. Based on these results, we propose lactose as a valuable alternate treatment of portal-systemic encephalopathy in lactase-deficient populations.

An homolog of the Frz Phosphoenolpyruvate:carbohydrate phosphoTransferase System of extraintestinal pathogenic Escherichia coli is encoded on a genomic island in specific lineages of Streptococcus agalactiae.

Science.gov (United States)

Patron, Kévin; Gilot, Philippe; Camiade, Emilie; Mereghetti, Laurent

2015-06-01

We identified a Streptococcus agalactiae metabolic region (fru2) coding for a Phosphoenolpyruvate:carbohydrate phosphoTransferase System (PTS) homologous to the Frz system of extraintestinal pathogenic Escherichia coli strains. The Frz system is involved in environmental sensing and regulation of the expression of adaptation and virulence genes in E. coli. The S. agalactiae fru2 region codes three subunits of a PTS transporter of the fructose-mannitol family, a transcriptional activator of PTSs of the MtlR family, an allulose-6 phosphate-3-epimerase, a transaldolase and a transketolase. We demonstrated that all these genes form an operon. The fru2 operon is present in a 17494-bp genomic island. We analyzed by multilocus sequence typing a population of 492 strains representative of the S. agalactiae population and we showed that the presence of the fru2 operon is linked to the phylogeny of S. agalactiae. The fru2 operon is always present within strains of clonal complexes CC 1, CC 7, CC 10, CC 283 and singletons ST 130 and ST 288, but never found in other CCs and STs. Our results indicate that the fru2 operon was acquired during the evolution of the S. agalactiae species from a common ancestor before the divergence of CC 1, CC 7, CC 10, CC 283, ST 130 and ST 288. As S. agalactiae strains of CC 1 and CC 10 are frequently isolated from adults with invasive disease, we hypothesize that the S. agalactiae Fru2 system senses the environment to allow the bacterium to adapt to new conditions encountered during the infection of adults. Copyright © 2015 Elsevier B.V. All rights reserved.

The incidence of infants with rotavirus enteritis combined with lactose intolerance.

Science.gov (United States)

Hu, Yulian; Gui, Linyan; Chang, Jing; Liu, Jingyan; Xu, Shuling; Deng, Caiyan; Yu, Fengqin; Ma, Zhanmin; Wang, Guangzhou; Zhang, Changjun

2016-01-01

This study was to research the incidence of infants with rotavirus enteritis combined with lactose intolerance and the clinical effect of low lactose milk powder for infantile rotavirus enteritis with lactose intolerance. The control groups were 126 cases of infants with diarrhea randomly collected from our hospital at the same period, which their rotavirus detection was negative. The observation group was 185 cases of infants with rotavirus, which was tested to be positive. Through the urine galactose determination, 62 cases of the control group were positive and 124 cases of the observation group were positive. Then 124 cases of infants with rotavirus combined with lactose intolerance were randomly divided into two groups. 60 cases in the control group were given rehydration, correction of acidosis, oral smecta, Intestinal probiotics and other conventional treatment, then continued to the original feeding method. While, 64 cases in the treatment group, on the basis of routine treatment, applied the low lactose milk feeding. To observe the total effective rate for the two groups. The incidence of lactose intolerance in children with rotavirus enteritis (67.03%) was significantly higher than that of children with diarrhea (49.2%), which was tested to be negative. And the difference was statistically significant (plactose intolerance. The low lactose milk powder could improve the therapeutic effectively and could reduce the duration of disease, and restored to normal diet for 2 weeks feeding time.

Exacerbation of substrate toxicity by IPTG in Escherichia coli BL21(DE3) carrying a synthetic metabolic pathway.

Science.gov (United States)

Dvorak, Pavel; Chrast, Lukas; Nikel, Pablo I; Fedr, Radek; Soucek, Karel; Sedlackova, Miroslava; Chaloupkova, Radka; de Lorenzo, Víctor; Prokop, Zbynek; Damborsky, Jiri

2015-12-21

Heterologous expression systems based on promoters inducible with isopropyl-β-D-1-thiogalactopyranoside (IPTG), e.g., Escherichia coli BL21(DE3) and cognate LacI(Q)/P(lacUV5)-T7 vectors, are commonly used for production of recombinant proteins and metabolic pathways. The applicability of such cell factories is limited by the complex physiological burden imposed by overexpression of the exogenous genes during a bioprocess. This burden originates from a combination of stresses that may include competition for the expression machinery, side-reactions due to the activity of the recombinant proteins, or the toxicity of their substrates, products and intermediates. However, the physiological impact of IPTG-induced conditional expression on the recombinant host under such harsh conditions is often overlooked. The physiological responses to IPTG of the E. coli BL21(DE3) strain and three different recombinants carrying a synthetic metabolic pathway for biodegradation of the toxic anthropogenic pollutant 1,2,3-trichloropropane (TCP) were investigated using plating, flow cytometry, and electron microscopy. Collected data revealed unexpected negative synergistic effect of inducer of the expression system and toxic substrate resulting in pronounced physiological stress. Replacing IPTG with the natural sugar effector lactose greatly reduced such stress, demonstrating that the effect was due to the original inducer's chemical properties. IPTG is not an innocuous inducer; instead, it exacerbates the toxicity of haloalkane substrate and causes appreciable damage to the E. coli BL21(DE3) host, which is already bearing a metabolic burden due to its content of plasmids carrying the genes of the synthetic metabolic pathway. The concentration of IPTG can be effectively tuned to mitigate this negative effect. Importantly, we show that induction with lactose, the natural inducer of P lac , dramatically lightens the burden without reducing the efficiency of the synthetic TCP degradation

Impact of short-chain galactooligosaccharides on the gut microbiome of lactose-intolerant individuals.

Science.gov (United States)

Azcarate-Peril, M Andrea; Ritter, Andrew J; Savaiano, Dennis; Monteagudo-Mera, Andrea; Anderson, Carlton; Magness, Scott T; Klaenhammer, Todd R

2017-01-17

Directed modulation of the colonic bacteria to metabolize lactose effectively is a potentially useful approach to improve lactose digestion and tolerance. A randomized, double-blind, multisite placebo-controlled trial conducted in human subjects demonstrated that administration of a highly purified (>95%) short-chain galactooligosaccharide (GOS), designated "RP-G28," significantly improved clinical outcomes for lactose digestion and tolerance. In these individuals, stool samples were collected pretreatment (day 0), after GOS treatment (day 36), and 30 d after GOS feeding stopped and consumption of dairy products was encouraged (day 66). In this study, changes in the fecal microbiome were investigated using 16S rRNA amplicon pyrosequencing and high-throughput quantitative PCR. At day 36, bifidobacterial populations were increased in 27 of 30 of GOS subjects (90%), demonstrating a bifidogenic response in vivo. Relative abundance of lactose-fermenting Bifidobacterium, Faecalibacterium, and Lactobacillus were significantly increased in response to GOS. When dairy was introduced into the diet, lactose-fermenting Roseburia species increased from day 36 to day 66. The results indicated a definitive change in the fecal microbiome of lactose-intolerant individuals, increasing the abundance of lactose-metabolizing bacteria that were responsive to dietary adaptation to GOS. This change correlated with clinical outcomes of improved lactose tolerance.

Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

Science.gov (United States)

Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

2016-01-01

Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

Prevalence of abnormal lactose breath hydrogen tests in children with functional abdominal pain.

Science.gov (United States)

Garg, Neha; Basu, Srikanta; Singh, Preeti; Kumar, Ruchika; Sharma, Lokesh; Kumar, Praveen

2017-05-01

The study was undertaken to determine the prevalence of abnormal lactose breath hydrogen test in children with non-organic chronic abdominal pain. Children with chronic abdominal pain were examined and investigated for organic causes. All children without a known organic cause underwent lactose and glucose breath hydrogen test. After a standard dose of 2 g/kg of lactose to a maximum of 50 g, hydrogen in breath was measured at 15 min intervals for 3 h. A rise of 20 ppm above baseline was considered suggestive of lactose malabsorption. Of 108 children screened, organic causes were found in 46 children. Sixty-two patients without any organic cause underwent hydrogen breath test. Lactose hydrogen breath test (HBT) was positive in 36 of 62 (58%), while 11 (17%) had positive HBT with glucose suggestive of small intestinal bacterial overgrowth (SIBO). Twenty out of 34 (59%) improved on lactose free diet while 8 out of 11 (72%) children of SIBO improved on antibiotics. Lactose malabsorption was seen in 58% of children with non-organic chronic abdominal pain.

Lactose intolerance: a non-allergic disorder often managed by allergologists.

Science.gov (United States)

Perino, A; Cabras, S; Obinu, D; Cavalli Sforza, L

2009-02-01

Lactose malabsorption is a very common condition characterized by intestinal lactase deficiency. Primary lactose malabsorption is an inherited deficit present in the majority of the world's population, while secondary bypolactasia can be the consequence of an intestinal disease. The presence of malabsorbed lactose in the colonic lumen may cause gastrointestinal symptoms. This condition is known as lactose intolerance. Lactase non-persistence is the ancestral state, whilst two single nucleotide polymorphisms in the lactase gene have been associated with lactase persistence. These are C/T 13910 and G/A 22018 substitutions. Lactase persistence, this Mendelian dominant trait, only became advantageous after the invention of agriculture, when milk from domesticated animals became available for adults to drink. Lactase persistence is then strongly correlated with the diary history of the population. Diagnosis is assessed clinically by elimination of dietary lactose or, better, by non-invasive tests including hydrogen breath test and genetic test. In patients with lactase non-persistence, treatment should be considered exclusively if intolerance symptoms are present. In the absence of guidelines, the common therapeutic approach tends to exclude milk and dairy products from the diet. However, this strategy may have serious nutritional disadvantages. Several studies have been carried out to find alternative approaches, such as exogenous beta-galactosidase, yogurt and probiotics for their bacterial lactase activity, strategies that can prolong contact time between enzyme and substrate delaying gastrointestinal transit time, and chronic lactose ingestion to enhance colonic adaptation.

Biofilm formation in Escherichia coli cra mutants is impaired due to down-regulation of curli biosynthesis.

Science.gov (United States)

Reshamwala, Shamlan M S; Noronha, Santosh B

2011-10-01

Cra is a pleiotropic regulatory protein that controls carbon and energy flux in enteric bacteria. Recent studies have shown that Cra also regulates other cell processes and influences biofilm formation. The purpose of the present study was to investigate the role of Cra in biofilm formation in Escherichia coli. Congo red-binding studies suggested that curli biosynthesis is impaired in cra mutants. Microarray analysis of wild-type and mutant E. coli cultivated in conditions promoting biofilm formation revealed that the curli biosynthesis genes, csgBAC and csgDEFG, are poorly expressed in the mutant, suggesting that transcription of genes required for curli production is regulated by Cra. Four putative Cra-binding sites were identified in the curli intergenic region, which were experimentally validated by performing electromobility shift assays. Site-directed mutagenesis of three Cra-binding sites in the promoter region of the csgDEFG operon suggests that Cra activates transcription of this operon upon binding to operator regions both downstream and upstream of the transcription start site. Based on the Cra-binding sites identified in this and other studies, the Cra consensus sequence is refined.

Lactose Hydrolysis in Milk and Dairy Whey Using Microbial β-Galactosidases

Directory of Open Access Journals (Sweden)

Michele Dutra Rosolen

2015-01-01

Full Text Available This work aimed at evaluating the influence of enzyme concentration, temperature, and reaction time in the lactose hydrolysis process in milk, cheese whey, and whey permeate, using two commercial β-galactosidases of microbial origins. We used Aspergillus oryzae (at temperatures of 10 and 55°C and Kluyveromyces lactis (at temperatures of 10 and 37°C β-galactosidases, both in 3, 6, and 9 U/mL concentrations. In the temperature of 10°C, the K. lactis β-galactosidase enzyme is more efficient in the milk, cheese whey, and whey permeate lactose hydrolysis when compared to A. oryzae. However, in the enzyme reaction time and concentration conditions evaluated, 100% lactose hydrolysis was not reached using the K. lactis β-galactosidase. The total lactose hydrolysis in whey and permeate was obtained with the A. oryzae enzyme, when using its optimum temperature (55°C, at the end of a 12 h reaction, regardless of the enzyme concentration used. For the lactose present in milk, this result occurred in the concentrations of 6 and 9 U/mL, with the same time and temperature conditions. The studied parameters in the lactose enzymatic hydrolysis are critical for enabling the application of β-galactosidases in the food industry.

Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

Directory of Open Access Journals (Sweden)

Catherine E Dana

Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

Genetics Home Reference: lactose intolerance

Science.gov (United States)

... Thomas MG, Swallow DM. Lactose digestion and the evolutionary genetics of lactase persistence. Hum Genet. 2009 Jan; ... genome editing and CRISPR-Cas9? What is precision medicine? What is newborn screening? New Pages Alopecia areata ...

Anaerobic expression of the gadE-mdtEF multidrug efflux operon is primarily regulated by the two-component system ArcBA through antagonizing the H-NS mediated repression

Directory of Open Access Journals (Sweden)

Ziqing eDeng

2013-07-01

Full Text Available The gadE-mdtEF operon encodes a central acid resistance regulator GadE and two multidrug efflux proteins MdtEF. Although transcriptional regulation of gadE in the context of acid resistance under the aerobic growth environment of E. coli has been extensively studied, regulation of the operon under the physiologically relevant environment of anaerobic growth and its effect on the expression of the multidrug efflux proteins MdtEF has not been disclosed. Our previous study revealed that anaerobic induction of the operon was dependent on ArcA, the response regulator of the ArcBA two-component system, in the M9 glucose minimal medium. However, the detailed regulatory mechanism remains unknown. In this study, we showed that anaerobic activation of mdtEF was driven by the 798bp unusually long gadE promoter. Deletion of evgA, ydeO, rpoS, and gadX which has been shown to activate the gadE expression during acid stresses under aerobic condition did not have a significant effect on the anaerobic activation of the operon. Rather, anaerobic activation of the operon was largely dependent on the global regulator ArcA and a GTPase MnmE. Under aerobic condition, transcription of gadE was repressed by the global DNA silencer H-NS in M9 minimal medium. Interestingly, under anaerobic condition, while ΔarcA almost completely abolished transcription of gadE-mdtEF, further deletion of hns in ΔarcA mutant restored the transcription of the full length PgadE-lacZ, and P1- and P3-lacZ fusions, suggesting an antagonistic effect of ArcA on the H-NS mediated repression. Taken together, we conclude that the anaerobic activation of the gadE-mdtEF was primarily mediated by the two-component system ArcBA through antagonizing the H-NS mediated repression.

Prevalence and Symptom Correlation of Lactose Intolerance in the North East Part of Bangladesh.

Science.gov (United States)

Saha, M; Shil, B C; Saha, S K; Chowdhury, M; Perveen, I; Banik, R; Rahman, M H

2016-01-01

This study was designed to see the prevalence of lactose intolerance and symptom correlation following oral lactose challenge in healthy volunteers in the north east part of Bangladesh. Symptoms of abdominal pain, nausea, borborygmi, flatulence, diarrhea and others were noted for 24 hours and blood glucose was estimated at 0 hour and 30 minutes after 50 gm oral lactose load to healthy volunteers. Failure to rise blood glucose level ≥1.1 mmol/l at 30 minutes after lactose intake from fasting level was taken as lactose malabsorption (LM) i.e., lactose intolerance. Sensitivity and specificity of different symptoms were then found out. A total of 171 volunteers (male 123, female 48) with a mean age 34.08 years participated in this study. Lactose intolerance was found among 82.5% (n=141, M=100, F=41) subjects. Symptoms mostly experience by the lactose malabsorbers were diarrhea 93(66.0%), borborygmi 80(56.7%), abdominal pain 31(22.0%) and flatulence 32(22.7%). LM prevalence was found to increase with increasing number of symptoms up to 3 symptoms. A week positive correlation (r=0.205, P=0.007) was found between the number of symptoms and proportion of subjects having positive lactose tolerance test. Lactose intolerance among healthy adults of North East part of our country is as common as in other Asian countries including China and Malaysia. But LM is higher than that of Europeans and south Indians. Diarrhea and borborygmi were mostly associated with LM.

THE EFFECT OF DRY GRANULATION ON THE CONSOLIDATION AND COMPACTION OF CRYSTALLINE LACTOSE

NARCIS (Netherlands)

RIEPMA, KA; VROMANS, H; ZUURMAN, K; LERK, CF

1993-01-01

The consolidation and compaction properties of granule fractions prepared by dry granulation (slugging) of alpha-lactose monohydrate and roller dried beta-lactose, respectively, were studied. The results showed that the compactibility of the granule fractions was determined by the type of lactose

Roller compaction: Effect of morphology and amorphous content of lactose powder on product quality.

Science.gov (United States)

Omar, Chalak S; Dhenge, Ranjit M; Osborne, James D; Althaus, Tim O; Palzer, Stefan; Hounslow, Michael J; Salman, Agba D

2015-12-30

The effect of morphology and amorphous content, of three types of lactose, on the properties of ribbon produced using roller compaction was investigated. The three types of lactose powders were; anhydrous SuperTab21AN, α-lactose monohydrate 200 M, and spray dried lactose SuperTab11SD. The morphology of the primary particles was identified using scanning electron microscopy (SEM) and the powder amorphous content was quantified using NIR technique. SEM images showed that 21AN and SD are agglomerated type of lactose whereas the 200 M is a non-agglomerated type. During ribbon production, an online thermal imaging technique was used to monitor the surface temperature of the ribbon. It was found that the morphology and the amorphous content of lactose powders have significant effects on the roller compaction behaviour and on ribbon properties. The agglomerated types of lactose produced ribbon with higher surface temperature and tensile strength, larger fragment size, lower porosity and lesser fines percentages than the non-agglomerated type of lactose. The lactose powder with the highest amorphous content showed to result in a better binding ability between the primary particles. This type of lactose produced ribbons with the highest temperature and tensile strength, and the lowest porosity and amount of fines in the product. It also produced ribbon with more smooth surfaces in comparison to the other two types of lactose. It was noticed that there is a relationship between the surface temperature of the ribbon during production and the tensile strength of the ribbon; the higher the temperature of the ribbon during production the higher the tensile strength of the ribbon. Copyright © 2015 Elsevier B.V. All rights reserved.

Characterization of the Deep-Sea Streptomyces sp. SCSIO 02999 Derived VapC/VapB Toxin-Antitoxin System in Escherichia coli

Directory of Open Access Journals (Sweden)

Yunxue Guo

2016-07-01

Full Text Available Toxin-antitoxin (TA systems are small genetic elements that are ubiquitous in prokaryotes. Most studies on TA systems have focused on commensal and pathogenic bacteria; yet very few studies have focused on TAs in marine bacteria, especially those isolated from a deep sea environment. Here, we characterized a type II VapC/VapB TA system from the deep-sea derived Streptomyces sp. SCSIO 02999. The VapC (virulence-associated protein protein belongs to the PIN (PilT N-terminal superfamily. Overproduction of VapC strongly inhibited cell growth and resulted in a bleb-containing morphology in E. coli. The toxicity of VapC was neutralized through direct protein–protein interaction by a small protein antitoxin VapB encoded by a neighboring gene. Antitoxin VapB alone or the VapB/VapC complex negatively regulated the vapBC promoter activity. We further revealed that three conserved Asp residues in the PIN domain were essential for the toxic effect of VapC. Additionally, the VapC/VapB TA system stabilized plasmid in E. coli. Furthermore, VapC cross-activated transcription of several TA operons via a partially Lon-dependent mechanism in E. coli, and the activated toxins accumulated more preferentially than their antitoxin partners. Collectively, we identified and characterized a new deep sea TA system in the deep sea Streptomyces sp. and demonstrated that the VapC toxin in this system can cross-activate TA operons in E. coli.

Characterization of the Deep-Sea Streptomyces sp. SCSIO 02999 Derived VapC/VapB Toxin-Antitoxin System in Escherichia coli.

Science.gov (United States)

Guo, Yunxue; Yao, Jianyun; Sun, Chenglong; Wen, Zhongling; Wang, Xiaoxue

2016-07-01

Toxin-antitoxin (TA) systems are small genetic elements that are ubiquitous in prokaryotes. Most studies on TA systems have focused on commensal and pathogenic bacteria; yet very few studies have focused on TAs in marine bacteria, especially those isolated from a deep sea environment. Here, we characterized a type II VapC/VapB TA system from the deep-sea derived Streptomyces sp. SCSIO 02999. The VapC (virulence-associated protein) protein belongs to the PIN (PilT N-terminal) superfamily. Overproduction of VapC strongly inhibited cell growth and resulted in a bleb-containing morphology in E. coli. The toxicity of VapC was neutralized through direct protein-protein interaction by a small protein antitoxin VapB encoded by a neighboring gene. Antitoxin VapB alone or the VapB/VapC complex negatively regulated the vapBC promoter activity. We further revealed that three conserved Asp residues in the PIN domain were essential for the toxic effect of VapC. Additionally, the VapC/VapB TA system stabilized plasmid in E. coli. Furthermore, VapC cross-activated transcription of several TA operons via a partially Lon-dependent mechanism in E. coli, and the activated toxins accumulated more preferentially than their antitoxin partners. Collectively, we identified and characterized a new deep sea TA system in the deep sea Streptomyces sp. and demonstrated that the VapC toxin in this system can cross-activate TA operons in E. coli.

Structural organization of the transfer RNA operon I of Vibrio cholerae

Indian Academy of Sciences (India)

Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

Novel epoxy activated hydrogels for solving lactose intolerance.

Science.gov (United States)

Elnashar, Magdy M M; Hassan, Mohamed E

2014-01-01

"Lactose intolerance" is a medical problem for almost 70% of the world population. Milk and dairy products contain 5-10% w/v lactose. Hydrolysis of lactose by immobilized lactase is an industrial solution. In this work, we succeeded to increase the lactase loading capacity to more than 3-fold to 36.3 U/g gel using epoxy activated hydrogels compared to 11 U/g gel using aldehyde activated carrageenan. The hydrogel's mode of interaction was proven by FTIR, DSC, and TGA. The high activity of the epoxy group was regarded to its ability to attach to the enzyme's -SH, -NH, and -OH groups, whereas the aldehyde group could only bind to the enzyme's -NH2 group. The optimum conditions for immobilization such as epoxy chain length and enzyme concentration have been studied. Furthermore, the optimum enzyme conditions were also deliberated and showed better stability for the immobilized enzyme and the Michaelis constants, K m and V max, were doubled. Results revealed also that both free and immobilized enzymes reached their maximum rate of lactose conversion after 2 h, albeit, the aldehyde activated hydrogel could only reach 63% of the free enzyme. In brief, the epoxy activated hydrogels are more efficient in immobilizing more enzymes than the aldehyde activated hydrogel.

Lowering the milk lactose content in vivo: potential interests, strategies and physiological consequences.

Science.gov (United States)

Vilotte, Jean-Luc

2002-01-01

Lactose is the major sugar present in milk and an important osmotic regulator of lactation. It is digested by intestinal lactase, an enzyme expressed in new-borns. Its activity declines following weaning. As a result, adult mammals are normally lactose-intolerant and more than 75% of the human adult population suffers from lactase deficiency. A reduction in milk lactose content could be beneficial for nutritional but also agricultural and industrial purposes (less volume to transport, better milk coagulation, less effluent production). Several attempts to create transgenic mice producing milk with modified carbohydrate compositions have recently been described. Depending on whether these modifications resulted from an alteration of lactose synthesis or from lactose hydrolysis, striking physiological differences are observed.

Ribosomal protein L10(L12)4 autoregulates expression of the Bacillus subtilis rplJL operon by a transcription attenuation mechanism.

Science.gov (United States)

Yakhnin, Helen; Yakhnin, Alexander V; Babitzke, Paul

2015-08-18

Ribosomal protein genes are often controlled by autoregulatory mechanisms in which a protein encoded in the operon can either bind to newly synthesized rRNA during rapid growth or to a similar target in its mRNA during poor growth conditions. The rplJL operon encodes the ribosomal L10(L12)4 complex. In Escherichia coli L10(L12)4 represses its translation by binding to the rplJL leader transcript. We identified three RNA structures in the Bacillus subtilis rplJL leader transcript that function as an anti-antiterminator, antiterminator or intrinsic terminator. Expression studies with transcriptional and translational fusions indicated that L10(L12)4 represses rplJL expression at the transcriptional level. RNA binding studies demonstrated that L10(L12)4 stabilizes the anti-antiterminator structure, while in vitro transcription results indicated that L10(L12)4 promotes termination. Disruption of anti-antiterminator, antiterminator or terminator function by competitor oligonucleotides in vitro and by mutations in vivo demonstrated that each structure functions as predicted. Thus, rplJL expression is regulated by an autogenous transcription attenuation mechanism in which L10(L12)4 binding to the anti-antiterminator structure promotes termination. We also found that translation of a leader peptide increases rplJL expression, presumably by inhibiting Rho-dependent termination. Thus, the rplJL operon of B. subtilis is regulated by transcription attenuation and antitermination mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Metabolic engineering of Escherichia coli to produce 2'-fucosyllactose via salvage pathway of guanosine 5'-diphosphate (GDP)-l-fucose.

Science.gov (United States)

Chin, Young-Wook; Seo, Nari; Kim, Jae-Han; Seo, Jin-Ho

2016-11-01

2'-Fucosyllactose (2-FL) is one of the key oligosaccharides in human milk. In the present study, the salvage guanosine 5'-diphosphate (GDP)-l-fucose biosynthetic pathway from fucose was employed in engineered Escherichia coli BL21star(DE3) for efficient production of 2-FL. Introduction of the fkp gene coding for fucokinase/GDP-l-fucose pyrophosphorylase (Fkp) from Bacteroides fragilis and the fucT2 gene encoding α-1,2-fucosyltransferase from Helicobacter pylori allows the engineered E. coli to produce 2-FL from fucose, lactose and glycerol. To enhance the lactose flux to 2-FL production, the attenuated, and deleted mutants of β-galactosidase were employed. Moreover, the 2-FL yield and productivity were further improved by deletion of the fucI-fucK gene cluster coding for fucose isomerase (FucI) and fuculose kinase (FucK). Finally, fed-batch fermentation of engineered E. coli BL21star(DE3) deleting lacZ and fucI-fucK, and expressing fkp and fucT2 resulted in 23.1 g/L of extracellular concentration of 2-FL and 0.39 g/L/h productivity. Biotechnol. Bioeng. 2016;113: 2443-2452. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Conhecimento sobre intolerância à lactose entre nutricionistas = Knowledge about lactose intolerance among nutritionists

Directory of Open Access Journals (Sweden)

Bauermann, Andreia

2013-01-01

Conclusões: A maioria dos nutricionistas desta amostra não estava suficientemente preparada para tratar indivíduos intolerantes à lactose; faltavam conhecimentos adequados sobre essa condição e seu manejo nutricional

The pressure-induced, lactose-dependent changes in the composition and size of casein micelles.

Science.gov (United States)

Wang, Pengjie; Jin, Shaoming; Guo, Huiyuan; Zhao, Liang; Ren, Fazheng

2015-04-15

The effects of lactose on the changes in the composition and size of casein micelles induced by high-pressure treatment and the related mechanism of action were investigated. Dispersions of ultracentrifuged casein micelle pellets with 0-10% (w/v) lactose were subjected to high pressure (400 MPa) at 20 °C for 40 min. The results indicated that the level of non-sedimentable caseins was positively related to the amount of lactose added prior to pressure treatment, and negatively correlated to the size. A mechanism for the pressure-induced, lactose-dependent changes in the casein micelles is proposed. Lactose inhibits the hydrophobic interactions between the micellar fragments during or after pressure release, through the hydrophilic layer formed by their hydrogen bonds around the micellar fragments. In addition, lactose does not favour the association between calcium and the casein aggregates after pressure release. Due to these two functions, lactose inhibited the formation of larger micelles after pressure treatment. Copyright © 2014 Elsevier Ltd. All rights reserved.

Lactose oleate as new biocompatible surfactant for pharmaceutical applications.

Science.gov (United States)

Perinelli, D R; Lucarini, S; Fagioli, L; Campana, R; Vllasaliu, D; Duranti, A; Casettari, L

2018-03-01

Sugar fatty acid esters are an interesting class of non-ionic, biocompatible and biodegradable sugar-based surfactants, recently emerged as a valid alternative to the traditional commonly employed (e.g. polysorbates and polyethylene glycol derivatives). By varying the polar head (carbohydrate moiety) and the hydrophobic tail (fatty acid), surfactants with different physico-chemical characteristics can be easily prepared. While many research papers have focused on sucrose derivatives, relatively few studies have been carried out on lactose-based surfactants. In this work, we present the synthesis and the physico-chemical characterization of lactose oleate. The new derivative was obtained by enzymatic mono-esterification of lactose with oleic acid. Thermal, surface, and aggregation properties of the surfactant were studied in detail and the cytotoxicity profile was investigated by MTS and LDH assays on intestinal Caco-2 monolayers. Transepithelial electrical resistance (TEER) measurements on Caco-2 cells showed a transient and reversible effect on the tight junctions opening, which correlates with the increased permeability of 4 kDa fluorescein-labelled dextran (as model for macromolecular drugs) in a concentration dependent manner. Moreover, lactose oleate displayed a satisfactory antimicrobial activity over a range of Gram-positive and Gram-negative bacteria. Overall, the obtained results are promising for a further development of lactose oleate as an intestinal absorption enhancer and/or an alternative biodegradable preservative for pharmaceutical and food applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of raw milk on lactose intolerance: a randomized controlled pilot study.

Science.gov (United States)

Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D

2014-01-01

This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). AUC H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10(-2), respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10(-2), respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC H2 and symptom severities were higher for both dairy milks compared with soy milk. Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance.

Diauxic growth of Fibrobacter succinogenes S85 on cellobiose and lactose.

Science.gov (United States)

Ghali, Ines; Sofyan, Ahmad; Ohmori, Hideyuki; Shinkai, Takumi; Mitsumori, Makoto

2017-08-15

Fibrobacter succinogenes rapidly colonizes the preruminant calf rumen and becomes a dominant cellulolytic bacterium in the rumen after weaning. Although F. succinogenes actively degrades cellulose in the rumen, it seems that there is no or little of its substrate, cellulose, in the rumen of preweaned calves. We thus evaluated the ability of F. succinogenes to utilize lactose, a main sugar of milk, with or without the presence of cellobiose. We grew F. succinogenes S85 on media containing 2.5% lactose combined with 0%-0.2% cellobiose or a medium with 0.2% cellobiose but without lactose. The generation times on the 0.2% cellobiose medium and the 2.5% lactose medium were 1.9 and 16.2 h, respectively. The bacterium showed rapid growth on cellobiose and diauxic growth on the lactose media containing 0.05%-0.2% cellobiose. Moreover, the production of β-galactosidase was low in the presence of 0.1%-0.2% cellobiose. Since the β-galactosidase contained a signal peptide and a Por secretion system C-terminal sorting domain, we speculate that the β-galactosidase would be secreted from the bacterial cells by the Por secretion system. Our data indicate the possibility that F. succinogenes could colonize preruminant calf rumen, consuming the lactose present in cow milk. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Liquid crystalline phase as a probe for crystal engineering of lactose: carrier for pulmonary drug delivery.

Science.gov (United States)

Patil, Sharvil S; Mahadik, Kakasaheb R; Paradkar, Anant R

2015-02-20

The current work was undertaken to assess suitability of liquid crystalline phase for engineering of lactose crystals and their utility as a carrier in dry powder inhalation formulations. Saturated lactose solution was poured in molten glyceryl monooleate which subsequently transformed into gel. The gel microstructure was analyzed by PPL microscopy and SAXS. Lactose particles recovered from gels after 48 h were analyzed for polymorphism using techniques such as FTIR, XRD, DSC and TGA. Particle size, morphology and aerosolisation properties of prepared lactose were analyzed using Anderson cascade impactor. In situ seeding followed by growth of lactose crystals took place in gels with cubic microstructure as revealed by PPL microscopy and SAXS. Elongated (size ∼ 71 μm) lactose particles with smooth surface containing mixture of α and β-lactose was recovered from gel, however percentage of α-lactose was more as compared to β-lactose. The aerosolisation parameters such as RD, ED, %FPF and % recovery of lactose recovered from gel (LPL) were found to be comparable to Respitose® ML001. Thus LC phase (cubic) can be used for engineering of lactose crystals so as to obtain particles with smooth surface, high elongation ratio and further they can be used as carrier in DPI formulations. Copyright © 2014 Elsevier B.V. All rights reserved.

The intracellular galactoglycome in Trichoderma reesei during growth on lactose

NARCIS (Netherlands)

Karaffa, L.; Coulier, L.; Fekete, E.; Overkamp, K.M.; Druzhinina, I.S.; Mikus, M.; Seiboth, B.; Novák, L.; Punt, P.J.; Kubicek, C.P.

2013-01-01

Lactose (1,4-0-β-d-galactopyranosyl-d-glucose) is used as a soluble carbon source for the production of cellulases and hemicellulases for - among other purposes - use in biofuel and biorefinery industries. The mechanism how lactose induces cellulase formation in T. reesei is enigmatic, however.

Increased riboflavin production by knockout of 6-phosphofructokinase I and blocking the Entner-Doudoroff pathway in Escherichia coli.

Science.gov (United States)

Liu, Shuang; Kang, Pei; Cui, Zhenzhen; Wang, Zhiwen; Chen, Tao

2016-08-01

To construct an Escherichia coli strain capable of producing riboflavin with high titer and yield. A low copy number plasmid pLS01 containing a riboflavin operon under the control of a constitutive promoter was constructed and introduced into Escherichia coli MG1655. Subsequently, the pfkA, edd and ead genes were disrupted, and the resulting strain LS02T produced 667 mg riboflavin/l in MSY medium supplied with 10 g glucose/l in flask cultivation. In a fed-batch process, riboflavin production of the strain reached 10.4 g/l with a yield of 56.8 mg riboflavin/g glucose. To our knowledge, this is the first report of engineered E. coli strains that can produce more than 10 g riboflavin/l in fed-batch cultivation, indicating that E. coli has potential for riboflavin production.

Managing acute pain in patients who report lactose intolerance: the safety of an old excipient re-examined.

Science.gov (United States)

Mill, Deanna; Dawson, Jessica; Johnson, Jacinta Lee

2018-05-01

Lactose intolerance is exceedingly common, reportedly affecting up to 70% of the world's population, leading to both abdominal and systemic symptoms. Current treatment focuses predominantly on restricting dietary consumption of lactose. Given lactose is one of the most commonly used excipients in the pharmaceutical industry, consideration must be given to the lactose content and therefore safety of pharmaceutical preparations prescribed for patients with lactose intolerance. This article summarizes the current literature examining the likelihood of inducing adverse effects through the administration of lactose-containing pharmaceutical preparations in patients reporting lactose intolerance, describes how to assess this risk on an individual patient basis and reviews suitable analgesic options for this population. A case study is presented detailing a patient reporting lactose intolerance who insists on treatment with the lactose-free product codeine/ibuprofen (Nurofen Plus) rather than other codeine-free analgesics. It is important to assess the likelihood of lactose as an excipient inducing symptoms in this scenario, as reluctance to cease codeine could suggest codeine dependence, an issue that is becoming increasingly common in countries such as Australia and Canada. Given codeine dependence is associated with serious sequelae including hospitalization and death, the patient must either be reassured the lactose component in their prescribed analgesics will not induce symptoms or an alternative treatment strategy must be confirmed. General recommendations applying theory from the literature to the management of acute pain in lactose-intolerant patients are discussed and specific treatment options are outlined. Although large inter-individual variability is reported, most lactose-intolerant patients can tolerate the small quantities of lactose found in pharmaceutical preparations. Cumulative lactose exposure can be assessed in patients taking multiple medications

Quantification of lactose content in human and cow's milk using UPLC-tandem mass spectrometry.

Science.gov (United States)

Fusch, Gerhard; Choi, Arum; Rochow, Niels; Fusch, Christoph

2011-12-01

A sensitive, accurate, and specific quantitative UPLC-MS/MS method was developed for lactose measurement of cow's and human milk and validated with cow's milk samples certified by an external laboratory. The new method employs only a dilution of raw cow's and human milk for simple preparation with no need to remove protein and fat prior to analysis with UPLC-MS/MS. It was operated in negative mode to detect lactose molecules and labeled (13)C(12)-lactose with the highest sensitivity. The principle advantages of the new LC-MS/MS method were: completed lactose determination in 5 min, absolute recovery of 97-107%, lower limit of detection milk. The mean lactose concentration of 51 human milk samples was measured as 56.8 ± 5.5 g/L ranging from 43 to 65 g/L. The described method represents validated lactose analysis with high accuracy and precision for a routine lactose determination in raw human milk. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

Cop-like operon: Structure and organization in species of the Lactobacillale order

Directory of Open Access Journals (Sweden)

ANGÉLICA REYES

2006-01-01

Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

Regulation of the csgD promoter by global regulators HN-S, IHF, and RpoS in E. coli O157:H7 isolates

Science.gov (United States)

Introduction: Curli production is essential for the biofilm formation in E. coli and Salmonella. The control of expression of CsgD, the key regulator of the curli operon, is very complex, and has been shown to be regulated by several global regulators and is influenced by various growth and stress...

Novel Epoxy Activated Hydrogels for Solving Lactose Intolerance

Directory of Open Access Journals (Sweden)

Magdy M. M. Elnashar

2014-01-01

Full Text Available “Lactose intolerance” is a medical problem for almost 70% of the world population. Milk and dairy products contain 5–10% w/v lactose. Hydrolysis of lactose by immobilized lactase is an industrial solution. In this work, we succeeded to increase the lactase loading capacity to more than 3-fold to 36.3 U/g gel using epoxy activated hydrogels compared to 11 U/g gel using aldehyde activated carrageenan. The hydrogel’s mode of interaction was proven by FTIR, DSC, and TGA. The high activity of the epoxy group was regarded to its ability to attach to the enzyme’s –SH, –NH, and –OH groups, whereas the aldehyde group could only bind to the enzyme’s –NH2 group. The optimum conditions for immobilization such as epoxy chain length and enzyme concentration have been studied. Furthermore, the optimum enzyme conditions were also deliberated and showed better stability for the immobilized enzyme and the Michaelis constants, Km and Vmax, were doubled. Results revealed also that both free and immobilized enzymes reached their maximum rate of lactose conversion after 2 h, albeit, the aldehyde activated hydrogel could only reach 63% of the free enzyme. In brief, the epoxy activated hydrogels are more efficient in immobilizing more enzymes than the aldehyde activated hydrogel.

Low Lactose Milk Production of Soybean by Fermentation Technique Using Rhizopus oligosporus

Directory of Open Access Journals (Sweden)

Farid Salahudin

2013-06-01

Full Text Available Milk is an important food for baby that contains lactose. Normally, a baby could produce lactase enzyme that digest lactose, but in the diarrhea case lactose could not be digested. So, Low Lactose Milk is needed. Low Lactose Milk usually produced from rice or almonds that have low protein. Soybean (Glycine max is the commodity with rich of protein and also contains raffinose and stachyose, which can lead flatulence. Raffinose and stachyose could be reduced by Rhizopus oryzae at tempe process from lamtoro beans.  So the aim in this research is to know the optimum time of soybean fermentation with R. oryzae to reduce stachyiose  and raffinose. The research was done with innoculation of R. oryzae isolate in the soybeans fermentation for 72 hours. N index, raffinose and stachyose level was tested. The result shows that optimum fermentation time is 48 hour and using 5% skim milk as filler.

Effect of Raw Milk on Lactose Intolerance: A Randomized Controlled Pilot Study

Science.gov (United States)

Mummah, Sarah; Oelrich, Beibei; Hope, Jessica; Vu, Quyen; Gardner, Christopher D.

2014-01-01

PURPOSE This pilot study aimed to determine whether raw milk reduces lactose malabsorption and/or lactose intolerance symptoms relative to pasteurized milk. METHODS We performed a crossover trial involving 16 adults with self-reported lactose intolerance and lactose malabsorption confirmed by hydrogen (H2) breath testing. Participants underwent 3, 8-day milk phases (raw vs 2 controls: pasteurized, soy) in randomized order separated by 1-week washout periods. On days 1 and 8 of each phase, milk consumption was 473 mL (16 oz); on days 2 to 7, milk dosage increased daily by 118 mL (4 oz), beginning with 118 mL (4 oz) on day 2 and reaching 710 mL (24 oz) on day 7. Outcomes were area under the breath H2 curve (AUC ∆H2) and self-reported symptom severity (visual analog scales: flatulence/gas, audible bowel sounds, abdominal cramping, diarrhea). RESULTS AUC ∆H2 (mean ± standard error of the mean) was higher for raw vs pasteurized on day 1 (113 ± 21 vs 71 ± 12 ppm·min·10−2, respectively, P = .01) but not day 8 (72 ± 14 vs 74 ± 15 ppm·min·10−2, respectively, P = .9). Symptom severities were not different for raw vs pasteurized on day 7 with the highest dosage (P >.7). AUC ∆H2 and symptom severities were higher for both dairy milks compared with soy milk. CONCLUSIONS Raw milk failed to reduce lactose malabsorption or lactose intolerance symptoms compared with pasteurized milk among adults positive for lactose malabsorption. These results do not support widespread anecdotal claims that raw milk reduces the symptoms of lactose intolerance. PMID:24615309

Elucidation of Operon Structures across Closely Related Bacterial Genomes

Science.gov (United States)

Li, Guojun

2014-01-01

About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

Studies on the preparation of immobilized enzymes by radio-polymerization, 10. Preparation of. beta. -galactosidase and its utilization for the continuous determination of lactose. [Gamma radiation

Energy Technology Data Exchange (ETDEWEB)

Amarakone, S P [Ceylon Inst. of Scientific and Industrial Research, Colombo (Sri Lanka); Hayashi, Toru; Kawashima, Koji

1983-03-01

..beta..-Galactosidase of E. coli origin was immobilized in the form of beads by the radiopolymerization of different combinations of monomers using a gamma irradiation technique. With the dialysed enzyme, recoveries of over 300 % could be obtained on suitable monomer combinations containing magnesium and sodium acrylates. The recovery of the enzyme also depended on the irradiation time. The immobilized enzyme had better pH and temperature stability and was less affected by the presence of metal ions in the medium, compared to the native enzyme. The optimum pH and temperatures of the immobilized enzyme were different from those of the native enzyme and were 7.0 to 7.5 and 50 deg C respectively. The immobilized enzyme was used in a column for the continuous determination of lactose with a standard type autoanalyser. Good linearity could be observed even up to 3% lactose in the sample.

Resolution of Holliday junctions in Escherichia coli: identification of the ruvC gene product as a 19-kilodalton protein.

Science.gov (United States)

Sharples, G J; Lloyd, R G

1991-12-01

The ruvC gene of Escherichia coli specifies a nuclease that resolves Holliday junction intermediates in genetic recombination (B. Connolly, C.A. Parsons, F.E. Benson, H.J. Dunderdale, G.J. Sharples, R.G. Lloyd, and S.C. West, Proc. Natl. Acad, Sci. USA 88:6063-6067, 1991). The gene was located between aspS and the ruvAB operon by DNA sequencing and deletion analysis of ruvC plasmids and was shown to encode a protein of 18,747 Da. Analysis of the DNA flanking ruvC indicated that the gene is transcribed independently of the LexA-regulated ruvAB operon and is not under direct SOS control. ruvC lies downstream of an open reading frame, orf-33, for a protein which migrates during sodium dodecyl sulfate-polyacrylamide gel electrophoresis as a 33-kDa polypeptide. These two genes probably form an operon. However, expression of ruvC was found to be very poor relative to that of orf-33. A double ribosomal frameshift between these genes is proposed as a possible reason for the low level of RuvC. Two further open reading frames of unknown function were identified, one on either side of the orf-33-ruvC operon.

Cheese whey-induced high-cell-density production of recombinant proteins in Escherichia coli

Directory of Open Access Journals (Sweden)

Neubauer Peter

2003-04-01

Full Text Available Abstract Background Use of lactose-rich concentrates from dairy processes for the induction of recombinant gene's expression has not received much attention although they are interesting low cost substrates for production of recombinant enzymes. Applicability of dairy waste for induction of recombinant genes in Escherichia coli was studied. Clones expressing Lactobacillus phage muramidase and Lactobacillus alcohol dehydrogenase were used for the experiments. Results Shake flask cultivations in mineral salt medium showed that cheese whey or deproteinised whey induced gene expression as efficiently as IPTG (isopropyl-β-D-thiogalactopyranoside or pure lactose. Addition of yeast extract or proteolytically degraded whey proteins did not improve the recombinant protein yield. In contrast, addition of yeast extract to the well-balanced mineral salt medium decreased the product yield. Feeding with glycerol provided sufficient amount of easily assimilable carbon source during the induction period without preventing lactose intake and induction by lactose. High-cell-density fed-batch cultivations showed that product yields comparable to IPTG-induction can be achieved by feeding bacteria with a mixture of glycerol and concentrated whey permeate during the induction. Conclusion Whey and concentrated whey permeate can be applied as an alternative inducer in recombinant high-cell-density fed-batch fermentations. The yield of the recombinant product was comparable to fermentations induced by IPTG. In low-cell-density shake flask experiments the yield was higher with whey or whey permeate than with IPTG.

Effect of lactose on intestinal absorption of calcium

International Nuclear Information System (INIS)

Labat, Marie-Louise

1972-01-01

Calcium absorption was immediately increased when lactose was administered in large amounts in the intestine of standard rats fed on a vitamin D diet. The same effect could be reproduced with lactulose, a glucid un-hydrolyzed by lactase and unabsorbed. The occurrence of a saturation process for high doses of calcium agrees with a biochemical process through a carrier; this process was not inhibited by actinomycin D, which does not agree with a 'de novo' synthesis of a calcium binding protein; yet activation of the preexisting protein cannot be excluded. The intestinal effect of lactose resulted in an inhibition of bone catabolism in the adult normocalcemic rat indicating a possible interference of thyrocalcitonin. Finally in the young rat, hypocalcemic by lack of vitamin D, on account of the lactose effect, calcium can be considered as a 'third messenger' in the chain of intracellular events between the interaction of the parathyroid hormone with the bone receptor and the expression of its activity. (author) [fr

The morphogenetic MreBCD proteins of Escherichia coli form an essential membrane-bound complex

DEFF Research Database (Denmark)

Kruse, Thomas; Bork-Jensen, Jette; Gerdes, Kenn

2005-01-01

MreB proteins of Escherichia coli, Bacillus subtilis and Caulobacter crescentus form actin-like cables lying beneath the cell surface. The cables are required to guide longitudinal cell wall synthesis and their absence leads to merodiploid spherical and inflated cells prone to cell lysis. In B...... carrying the ftsQAZ genes suppressed the lethality of deletions in the mre operon. Using GFP and cell fractionation methods, we showed that the MreC and MreD proteins were associated with the cell membrane. Using a bacterial two-hybrid system, we found that MreC interacted with both MreB and Mre....... subtilis and C. crescentus, the mreB gene is essential. However, in E. coli, mreB was inferred not to be essential. Using a tight, conditional gene depletion system, we systematically investigated whether the E. coli mreBCD-encoded components were essential. We found that cells depleted of mreBCD became...

Contribution of Colonic Fermentation and Fecal Water Toxicity to the Pathophysiology of Lactose-Intolerance.

Science.gov (United States)

Windey, Karen; Houben, Els; Deroover, Lise; Verbeke, Kristin

2015-09-08

Whether or not abdominal symptoms occur in subjects with small intestinal lactose malabsorption might depend on differences in colonic fermentation. To evaluate this hypothesis, we collected fecal samples from subjects with lactose malabsorption with abdominal complaints (LM-IT, n = 11) and without abdominal complaints (LM-T, n = 8) and subjects with normal lactose digestion (NLD, n = 15). Lactose malabsorption was diagnosed using a (13)C-lactose breath test. Colonic fermentation was characterized in fecal samples at baseline and after incubation with lactose for 3 h, 6 h and 24 h through a metabolomics approach using gas chromatography-mass spectrometry (GC-MS). Fecal water cytotoxicity was analyzed using a colorimetric assay. Fecal water cytotoxicity was not different between the three groups (Kruskall-Wallis p = 0.164). Cluster analysis of the metabolite patterns revealed separate clusters for NLD, LM-T and LM-IT samples at baseline and after 24 h incubation with lactose. Levels of 5-methyl-2-furancarboxaldehyde were significantly higher in LM-IT and LM-T compared to NLD whereas those of an unidentified aldehyde were significantly higher in LM-IT compared to LM-T and NLD. Incubation with lactose increased short chain fatty acid (SCFA) concentrations more in LM-IT and LM-T compared to NLD. In conclusion, fermentation patterns were clearly different in NLD, LM-IT and LM-T, but not related to differences in fecal water cytotoxicity.

Optimization and shelf life of a low-lactose yogurt with Lactobacillus rhamnosus HN001.

Science.gov (United States)

Ibarra, A; Acha, R; Calleja, M-T; Chiralt-Boix, A; Wittig, E

2012-07-01

Lactose intolerance results in gastrointestinal discomfort and the malabsorption of certain nutrients, such as calcium. The replacement of milk with low-lactose and probiotic-enriched dairy products is an effective strategy of mitigating the symptoms of lactose intolerance. Lactobacillus rhamnosus HN001 (HN001) is a safe, immunity-stimulating probiotic. We have developed a process to increase the hydrolysis of lactose and HN001 growth in yogurt versus β-galactosidase (βG) concentration and enzymatic hydrolysis time (EHT) before bacterial fermentation. The objective of this study was to optimize the conditions by which yogurt is processed as a function of βG and EHT using a multifactorial design, with lactose content, HN001 growth, process time, and sensory quality as dependent variables. Further, the shelf life of the optimized yogurt was evaluated. In the optimization study, polynomials explained the dependent variables. Based on Pearson correlation coefficients, HN001 growth correlated positively with the hydrolysis of lactose. However, low lactose content and high HN001 count increased the fermentation time and lowered the sensory quality. The optimized conditions-using polynomials to obtain yogurt with >1 × 10(7) cfu of HN001/mL, yogurt to which HN001 has been added for lactose-intolerant persons who wish to strengthen their immune system. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

Science.gov (United States)

Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

2014-01-01

The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

Lactose intolerance in prostate cancer patients: incidence and associated factors.

Science.gov (United States)

Agarwal, Mayank Mohan; Rana, Satyavati V; Mandal, Arup Kumar; Malhotra, Sunita; Khandelwal, Niranjan; Kumar, Santosh; Acharya, Naveen Chandra; Singh, Shrawan Kumar

2008-03-01

Osteoporosis is common in prostate cancer (CaP) patients both before and after institution of androgen deprivation therapy and is associated with significant morbidity. Lactose intolerance (LI) can affect bone mass but has not been studied in this group of patients. The objective of this study was to compare the incidence of LI in CaP patients with that in the general population and to identify factors affecting lactose intolerance in CaP patients. Fifty-five men with CaP planned for bilateral orchidectomy were enrolled in the study and their baseline characteristics including age, weight, height, body mass index (BMI), prostate-specific antigen, serum calcium profile, lactose tolerance status, physical activity, alcohol intake and smoking, bone mineral density and calcium intake were registered. The data on lactose tolerance in these patients were compared with those of 81 age-matched controls (data taken from the available database). The incidence of LI in CaP patients was significantly less than that in the control group (36.2% and 58.3%, respectively, p = 0.027). A significantly greater number of CaP patients in the lactose-tolerant group had a calcium intake of >1500 mg/day (p = 0.03) and that of milk >500 ml/day (p = 0.05) than those in the intolerant group. Age >70 years, BMI 163 cm, lower physical activity and co-abuse of alcohol and smoking significantly correlated with the presence of LI (p 25 kg/m2 and weight >65 kg. The incidence of LI in CaP patients is less than that in the general population despite a higher incidence of osteoporosis, indicating a complex etiology of CaP-related osteoporosis. Certain physical characteristics and personal habits are important in determining lactose-tolerant status.

Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

Science.gov (United States)

Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

2011-10-01

Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

SOS gene induction and possible mutagenic effects of freeze-drying in Escherichia coli and Salmonella typhimurium.

Science.gov (United States)

Rosen, Rachel; Buchinger, Sebastian; Pfänder, Ramona; Pedhazur, Rami; Reifferscheid, Georg; Belkin, Shimshon

2016-11-01

We report the results of a study of the potential negative effects of the freeze-drying process, normally considered a benign means for long-term conservation of living cells and the golden standard in bacterial preservation. By monitoring gene induction using a whole-cell Escherichia coli bioreporter panel, in which diverse stress-responsive gene promoters are fused to luminescent or fluorescent reporting systems, we have demonstrated that DNA repair genes belonging to the SOS operon (recA, sulA, uvrA, umuD, and lexA) were induced upon resuscitation from the freeze-dried state, whereas other stress-responsive promoters such as grpE, katG, phoA, soxS, and sodA were not affected. This observation was confirmed by the UMU-chromotest (activation of the umuD gene promoter) in Salmonella typhimurium, as well as by real-time PCR analyses of selected E. coli SOS genes. We further show that a functional SOS operon is important in viability maintenance following resuscitation, but that at the same time, this repair system may introduce significantly higher mutation rates, comparable to those induced by high concentrations of a known mutagen. Our results also indicate that the entire freeze-drying process, rather than either freezing or drying separately, is instrumental in the induction of DNA damage.

Lambda Red-mediated mutagenesis and efficient large scale affinity purification of the Escherichia coli NADH:ubiquinone oxidoreductase (complex I).

Science.gov (United States)

Pohl, Thomas; Uhlmann, Mareike; Kaufenstein, Miriam; Friedrich, Thorsten

2007-09-18

The proton-pumping NADH:ubiquinone oxidoreductase, the respiratory complex I, couples the transfer of electrons from NADH to ubiquinone with the translocation of protons across the membrane. The Escherichia coli complex I consists of 13 different subunits named NuoA-N (from NADH:ubiquinone oxidoreductase), that are coded by the genes of the nuo-operon. Genetic manipulation of the operon is difficult due to its enormous size. The enzymatic activity of variants is obscured by an alternative NADH dehydrogenase, and purification of the variants is hampered by their instability. To overcome these problems the entire E. coli nuo-operon was cloned and placed under control of the l-arabinose inducible promoter ParaBAD. The exposed N-terminus of subunit NuoF was chosen for engineering the complex with a hexahistidine-tag by lambda-Red-mediated recombineering. Overproduction of the complex from this construct in a strain which is devoid of any membrane-bound NADH dehydrogenase led to the assembly of a catalytically active complex causing the entire NADH oxidase activity of the cytoplasmic membranes. After solubilization with dodecyl maltoside the engineered complex binds to a Ni2+-iminodiacetic acid matrix allowing the purification of approximately 11 mg of complex I from 25 g of cells. The preparation is pure and monodisperse and comprises all known subunits and cofactors. It contains more lipids than earlier preparations due to the gentle and fast purification procedure. After reconstitution in proteoliposomes it couples the electron transfer with proton translocation in an inhibitor sensitive manner, thus meeting all prerequisites for structural and functional studies.

Powder compression mechanics of spray-dried lactose nanocomposites.

Science.gov (United States)

Hellrup, Joel; Nordström, Josefina; Mahlin, Denny

2017-02-25

The aim of this study was to investigate the structural impact of the nanofiller incorporation on the powder compression mechanics of spray-dried lactose. The lactose was co-spray-dried with three different nanofillers, that is, cellulose nanocrystals, sodium montmorillonite and fumed silica, which led to lower micron-sized nanocomposite particles with varying structure and morphology. The powder compression mechanics of the nanocomposites and physical mixtures of the neat spray-dried components were evaluated by a rational evaluation method with compression analysis as a tool, using the Kawakita equation and the Shapiro-Konopicky-Heckel equation. Particle rearrangement dominated the initial compression profiles due to the small particle size of the materials. The strong contribution of particle rearrangement in the materials with fumed silica continued throughout the whole compression profile, which prohibited an in-depth material characterization. However, the lactose/cellulose nanocrystals and the lactose/sodium montmorillonite nanocomposites demonstrated high yield pressure compared with the physical mixtures indicating increased particle hardness upon composite formation. This increase has likely to do with a reinforcement of the nanocomposite particles by skeleton formation of the nanoparticles. In summary, the rational evaluation of mechanical properties done by applying powder compression analysis proved to be a valuable tool for mechanical evaluation for this type of spray-dried composite materials, unless they demonstrate particle rearrangement throughout the whole compression profile. Copyright © 2016 Elsevier B.V. All rights reserved.

Confinement of Amorphous Lactose in Pores Formed Upon Co-Spray Drying With Nanoparticles.

Science.gov (United States)

Hellrup, Joel; Mahlin, Denny

2017-01-01

This study aims at investigating factors influencing humidity-induced recrystallization of amorphous lactose, produced by co-spray drying with particles of cellulose nanocrystals or sodium montmorillonite. In particular, the focus is on how the nanoparticle shape and surface properties influence the nanometer to micrometer length scale nanofiller arrangement in the nanocomposites and how the arrangements influence the mechanisms involved in the inhibition of the amorphous to crystalline transition. The nanocomposites were produced by co-spray drying. Solid-state transformations were analyzed at 60%-94% relative humidity using X-ray powder diffraction, microcalorimetry, and light microscopy. The recrystallization rate constant for the lactose/cellulose nanocrystals and lactose/sodium montmorillonite nanocomposites was lowered at nanofiller contents higher than 60% and was stable for months at 80% nanofiller. The most likely explanation to these results is spontaneous formations of mesoporous particle networks that the lactose is confined upon co-spray drying at high filler content. Compartmentalization and rigidification of the amorphous lactose proved to be less important mechanisms involved in the stabilization of lactose in the nanocomposites. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Reactions of lactose during heat treatment of milk : a quantitative study

NARCIS (Netherlands)

Berg, H.E.

1993-01-01

The kinetics of the chemical reactions of lactose during heat treatment of milk were studied. Skim milk and model solutions resembling milk were heated. Reaction products were determined and the influence of varying lactose, casein and fat concentration on the formation of these products

Prevalence of self-reported lactose intolerance in multiethnic sample of adults

Science.gov (United States)

According to the National Institute of Diabetes and Digestive and Kidney Diseases, between 30 and 50 million Americans have the potential for lactose-intolerance symptoms. However, lactose-intolerance prevalence rates in practical life settings may be lower than originally suggested. The goal of thi...

Lack of Effect of Lactose Digestion Status on Baseline Fecal Microflora

Directory of Open Access Journals (Sweden)

Andrew Szilagyi

2009-01-01

Full Text Available BACKGROUND: The genetics of intestinal lactase divide the world’s population into two phenotypes: the ability (a dominant trait or inability (a recessive trait to digest lactose. A prebiotic effect of lactose may impact the colonic flora of these phenotypes differently.

Hydrolysis of lactose: a literature review

Energy Technology Data Exchange (ETDEWEB)

Gekas, V; Lopez-Leiva, M

1985-02-01

Lactose is the sugar found in milk and whey. Its hydrolysis to glucose and galactose in milk would solve the problem of milk-intolerant people and in whey it would avoid environmental pollution and offer an interesting possibility of by-product utilization. The prepared sweet syrup has many potential applications in the food industry. Hydrolysis of lactose can be carried out by heating at low pH (acid hydrolysis) or by enzymatic catalysis with the enzyme (lactase or ..beta..-D-galactosidase) either free in solution or immobilized by one of the several enzyme immobilization methods which are abundant in the literature. Selection of the proper method depends on many factors: the nature of substrate, use of the final product, need for sanitary conditions, and, of course, capital and processing costs. 157 references.

Dairy Intake, Dietary Adequacy, and Lactose Intolerance12

Science.gov (United States)

Heaney, Robert P.

2013-01-01

Despite repeated emphasis in the Dietary Guidelines for Americans on the importance of calcium in the adult American diet and the recommendation to consume 3 dairy servings a day, dairy intake remains well below recommendations. Insufficient health professional awareness of the benefits of calcium and concern for lactose intolerance are among several possible reasons, This mini-review highlights both the role of calcium (and of dairy, its principal source in modern diets) in health maintenance and reviews the means for overcoming lactose intolerance (real or perceived). PMID:23493531

Proteomic analysis of lactose-starved Lactobacillus casei during stationary growth phase.

Science.gov (United States)

Hussain, M A; Knight, M I; Britz, M L

2009-03-01

Starvation stress is a condition that nonstarter lactic acid bacteria (NSLAB) normally encounter. This study was aimed to investigate starvation-induced proteins in Lactobacillus casei during stationary growth phase. The impact of carbohydrate starvation on L. casei GCRL163 was investigated using two different media (a modified de Man, Rogosa and Sharpe broth and a semi-defined medium). Cells were grown in the presence of excess lactose (1%) or starvation (0%) and differences in the patterns of one-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis and two-dimensional electrophoresis of the cytosolic protein fractions were investigated. Differentially regulated proteins were identified by MALDI-TOF/TOF mass spectrometry. Many differentially regulated proteins were enzymes of various metabolic pathways involved in carbohydrate metabolism to yield energy. Differences in protein expression were also observed in the two culture conditions tested in this experiment. Numerous glycolytic enzymes were differentially regulated under lactose starvation. The differential expression of these glycolytic enzymes suggests a potential survival strategy under harsh growth conditions (i.e. lactose starvation). This paper reports improved understanding of stress responses and survival mechanism of NSLAB under lactose-depleted cheese-ripening condition. This knowledge of how NSLAB bacteria adapt to lactose starvation could be applied to predict the performances of bacteria in other industrial applications.

Effect of process parameters on crystal size and morphology of lactose in ultrasound-assisted crystallization

Energy Technology Data Exchange (ETDEWEB)

Patel, S.R.; Murthy, Z.V.P. [Chemical Engineering Department, S.V. National Institute of Technology, Surat - 395 007, Gujarat (India)

2011-03-15

{alpha}-lactose monohydrate is widely used as a pharmaceutical excipient. Drug delivery system requires the excipient to be of narrow particle size distribution with regular particle shape. Application of ultrasound is known to increase or decrease the growth rate of certain crystal faces and controls the crystal size distribution. In the present paper, effect of process parameters such as sonication time, anti-solvent concentration, initial lactose concentration and initial pH of sample on lactose crystal size, shape and thermal transition temperature was studied. The parameters were set according to the L{sub 9}-orthogonal array method at three levels and recovered lactose from whey by sonocrystallization. The recovered lactose was analyzed by particle size analyzer, scanning electron microscopy and differential scanning calorimeter. It was found that the morphology of lactose crystal was rod/needle like shape. Crystal size distribution of lactose was observed to be influenced by different process parameters. From the results of analysis of variance, the sonication time interval was found to be the most significant parameter affecting the volume median diameter of lactose with the highest percentage contribution (74.28%) among other parameters. (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Genetic determinants of heat resistance in Escherichia coli

Directory of Open Access Journals (Sweden)

Ryan eMercer

2015-09-01

Full Text Available Escherichia coli AW1.7 is a heat resistant food isolate and the occurrence of pathogenic strains with comparable heat resistance may pose a risk to food safety. To identify the genetic determinants of heat resistance, 29 strains of E. coli that differed in their of heat resistance were analyzed by comparative genomics. Strains were classified as highly heat resistant strains, exhibiting a D60-value of more than 6 min; moderately heat resistant strains, exhibiting a D60-value of more than 1 min; or as heat sensitive. A ~14 kb genomic island containing 16 predicted open reading frames encoding putative heat shock proteins and proteases was identified only in highly heat resistant strains. The genomic island was termed the locus of heat resistance (LHR. This putative operon is flanked by mobile elements and possesses >99% sequence identity to genomic islands contributing to heat resistance in Cronobacter sakazakii and Klebsiella pneumoniae. An additional 41 LHR sequences with >87% sequence identity were identified in 11 different species of β- and γ-proteobacteria. Cloning of the full length LHR conferred high heat resistance to the heat sensitive E. coli AW1.7ΔpHR1 and DH5α. The presence of the LHR correlates perfectly to heat resistance in several species of Enterobacteriaceae and occurs at a frequency of 2% of all E. coli genomes, including pathogenic strains. This study suggests the LHR has been laterally exchanged among the β- and γ-proteobacteria and is a reliable indicator of high heat resistance in E. coli.

Lactose Induces Phenotypic and Functional Changes of Neutrophils and Macrophages to Alleviate Acute Pancreatitis in Mice

Directory of Open Access Journals (Sweden)

Li-Long Pan

2018-04-01

Full Text Available Acute pancreatitis (AP is one common clinical acute abdominal disease, for which specific pharmacological or nutritional therapies remain elusive. Lactose, a macronutrient and an inducer of host innate immune responses, possesses immune modulatory functions. The current study aimed to investigate potential modulatory effects of lactose and the interplay between the nutrient and pancreatic immunity during experimentally induced AP in mice. We found that either prophylactic or therapeutic treatment of lactose time-dependently reduced the severity of AP, as evidenced by reduced pancreatic edema, serum amylase levels, and pancreatic myeloperoxidase activities, as well as by histological examination of pancreatic damage. Overall, lactose promoted a regulatory cytokine milieu in the pancreas and reduced infiltration of inflammatory neutrophils and macrophages. On acinar cells, lactose was able to suppress caerulein-induced inflammatory signaling pathways and to suppress chemoattractant tumor necrosis factor (TNF-α and monocyte chemotactic protein-1 production. Additionally, lactose acted on pancreas-infiltrated macrophages, increasing interleukin-10 and decreasing tumor necrosis factor alpha production. Notably, lactose treatment reversed AP-associated infiltration of activated neutrophils. Last, the effect of lactose on neutrophil infiltration was mimicked by a galectin-3 antagonist, suggesting a potential endogenous target of lactose. Together, the current study demonstrates an immune regulatory effect of lactose to alleviate AP and suggests its potential as a convenient, value-added therapeutic macronutrient to control AP, and lower the risk of its systemic complications.

Impact of Glycerol as Carbon Source onto Specific Sugar and Inducer Uptake Rates and Inclusion Body Productivity in E. coli BL21(DE3

Directory of Open Access Journals (Sweden)

Julian Kopp

2017-12-01

Full Text Available The Gram-negative bacterium E. coli is the host of choice for a multitude of used recombinant proteins. Generally, cultivation is easy, media are cheap, and a high product titer can be obtained. However, harsh induction procedures using isopropyl β-d-1 thiogalactopyranoside as inducer are often referred to cause stress reactions, leading to a phenomenon known as “metabolic” or “product burden”. These high expressions of recombinant proteins mainly result in decreased growth rates and cell lysis at elevated induction times. Therefore, approaches tend to use “soft” or “tunable” induction with lactose and reduce the stress level of the production host. The usage of glucose as energy source in combination with lactose as induction reagent causes catabolite repression effects on lactose uptake kinetics and as a consequence reduced product titer. Glycerol—as an alternative carbon source—is already known to have positive impact on product formation when coupled with glucose and lactose in auto-induction systems, and has been referred to show no signs of repression when cultivated with lactose concomitantly. In recent research activities, the impact of different products on the lactose uptake using glucose as carbon source was highlighted, and a mechanistic model for glucose-lactose induction systems showed correlations between specific substrate uptake rate for glucose or glycerol (qs,C and the maximum specific lactose uptake rate (qs,lac,max. In this study, we investigated the mechanistic of glycerol uptake when using the inducer lactose. We were able to show that a product-producing strain has significantly higher inducer uptake rates when being compared to a non-producer strain. Additionally, it was shown that glycerol has beneficial effects on viability of cells and on productivity of the recombinant protein compared to glucose.

ENTRAPMENT OF FLUORESCENT E. COLI CELLS IN ALGINATE GEL

Directory of Open Access Journals (Sweden)

T. VINTILA

2009-05-01

Full Text Available By this experiment we will demonstrate the possibility to obtain genetically modified microbial strains that can be used as markers in different studies. The trait transferred in this study is the fluorescence in UV light expressed by a gene isolated from jellyfish. This gene was insered into a plasmid carrying ampiciline resistance and in the operon for arabinose fermentation. The plasmid was called pGLO. E coli HB101 K-12, ampicillin resistant colonies has been obtained. The colonies on the LB/amp/ara plate fluoresce green under UV light and the transformed colonies can grow on ampicillin. Transformation efficiency = 362 transformed colonies/ μg DNA. The cells where immobilized by entrapment in alginate gel to study the phenomenon involved in cells immobilization. After immobilization in alginate gel, 5x104 cells of E. coli pGLO / capsule and 1,4 x 105 cells of E. coli HB101/capsule has been found. Fluorescent microscopy revealed the presence of pGLO carrying cells into the capsules. After cultivation of alginate capsules containing E. coli in LB broth, and fluorescent microscopy of the capsule sections, several observations of the phenomenon involved in continuous fermentation using biocatalysts in has been made. These cells grow and migrate to the cortical part of the matrix where they are immobilized.

The Interrelationships between Lactose Intolerance and the Modern Dairy Industry: Global Perspectives in Evolutional and Historical Backgrounds

Directory of Open Access Journals (Sweden)

Nissim Silanikove

2015-08-01

Full Text Available Humans learned to exploit ruminants as a source of milk about 10,000 years ago. Since then, the use of domesticated ruminants as a source of milk and dairy products has expanded until today when the dairy industry has become one of the largest sectors in the modern food industry, including the spread at the present time to countries such as China and Japan. This review analyzes the reasons for this expansion and flourishing. As reviewed in detail, milk has numerous nutritional advantages, most important being almost an irreplaceable source of dietary calcium, hence justifying the effort required to increase its consumption. On the other hand, widespread lactose intolerance among the adult population is a considerable drawback to dairy-based foods consumption. Over the centuries, three factors allowed humans to overcome limitations imposed by lactose intolerance: (i mutations, which occurred in particular populations, most notably in the north European Celtic societies and African nomads, in which carriers of the lactose intolerance gene converted from being lactose intolerant to lactose tolerant; (ii the ability to develop low-lactose products such as cheese and yogurt; and (iii colon microbiome adaptation, which allow lactose intolerant individuals to overcome its intolerance. However, in a few examples in the last decade, modern dairy products, such as the popular and widespread bio-cultured yogurts, were suspected to be unsuitable for lactose intolerant peoples. In addition, the use of lactose and milk-derived products containing lactose in non-dairy products has become widespread. For these reasons, it is concluded that it might be important and helpful to label food that may contain lactose because such information will allow lactose intolerant groups to control lactose intake within the physiological limitations of ~12 g per a single meal.

The Interrelationships between Lactose Intolerance and the Modern Dairy Industry: Global Perspectives in Evolutional and Historical Backgrounds.

Science.gov (United States)

Silanikove, Nissim; Leitner, Gabriel; Merin, Uzi

2015-08-31

Humans learned to exploit ruminants as a source of milk about 10,000 years ago. Since then, the use of domesticated ruminants as a source of milk and dairy products has expanded until today when the dairy industry has become one of the largest sectors in the modern food industry, including the spread at the present time to countries such as China and Japan. This review analyzes the reasons for this expansion and flourishing. As reviewed in detail, milk has numerous nutritional advantages, most important being almost an irreplaceable source of dietary calcium, hence justifying the effort required to increase its consumption. On the other hand, widespread lactose intolerance among the adult population is a considerable drawback to dairy-based foods consumption. Over the centuries, three factors allowed humans to overcome limitations imposed by lactose intolerance: (i) mutations, which occurred in particular populations, most notably in the north European Celtic societies and African nomads, in which carriers of the lactose intolerance gene converted from being lactose intolerant to lactose tolerant; (ii) the ability to develop low-lactose products such as cheese and yogurt; and (iii) colon microbiome adaptation, which allow lactose intolerant individuals to overcome its intolerance. However, in a few examples in the last decade, modern dairy products, such as the popular and widespread bio-cultured yogurts, were suspected to be unsuitable for lactose intolerant peoples. In addition, the use of lactose and milk-derived products containing lactose in non-dairy products has become widespread. For these reasons, it is concluded that it might be important and helpful to label food that may contain lactose because such information will allow lactose intolerant groups to control lactose intake within the physiological limitations of ~12 g per a single meal.

Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

Science.gov (United States)

Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

2016-09-01

The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

Expression of colonization factor CS5 of enterotoxigenic Escherichia coli (ETEC is enhanced in vivo and by the bile component Na glycocholate hydrate.

Directory of Open Access Journals (Sweden)

Matilda Nicklasson

Full Text Available Enterotoxigenic Escherichia coli (ETEC is an important cause of acute watery diarrhoea in developing countries. Colonization factors (CFs on the bacterial surface mediate adhesion to the small intestinal epithelium. Two of the most common CFs worldwide are coli surface antigens 5 and 6 (CS5, CS6. In this study we investigated the expression of CS5 and CS6 in vivo, and the effects of bile and sodium bicarbonate, present in the human gut, on the expression of CS5. Five CS5+CS6 ETEC isolates from adult Bangladeshi patients with acute diarrhoea were studied. The level of transcription from the CS5 operon was approximately 100-fold higher than from the CS6 operon in ETEC bacteria recovered directly from diarrhoeal stool without sub-culturing (in vivo. The glyco-conjugated primary bile salt sodium glycocholate hydrate (NaGCH induced phenotypic expression of CS5 in a dose-dependent manner and caused a 100-fold up-regulation of CS5 mRNA levels; this is the first description of NaGCH as an enteropathogenic virulence inducer. The relative transcription levels from the CS5 and CS6 operons in the presence of bile or NaGCH in vitro were similar to those in vivo. Another bile salt, sodium deoxycholate (NaDC, previously reported to induce enteropathogenic virulence, also induced expression of CS5, whereas sodium bicarbonate did not.

ANALYSIS OF A NEW DIAFILTRATION METHOD OF CLEANING BUTTERMILK FROM LACTOSE WITH MINERAL COMPOSITION PRESERVED

Directory of Open Access Journals (Sweden)

S. Bondar

2018-04-01

Full Text Available Removing lactose from buttermilk and other dairy products is a topical problem, as there is a significant increase in morbidity rates due to lactose intolerance. In many cases, milk and dairy products containing lactose can not be completely excluded from the diet. These products have a number of valuable components. There are several ways to remove lactose from milk or other dairy products. They are based on separation methods of processing and on the use of enzymes. Among the separation methods, membrane treatment, including diafiltration, is of particular importance. A technique of engineering calculation of cleaning an ultrafiltration buttermilk concentrate is suggested. As a solvent that reduces the concentration of lactose, a nanofiltrate permeate of buttermilk ultrafiltration is used. This method allows preserving the chemical composition of the concentrate with lactose effectively removed. Basing on the experimental data of membrane productivity and their selectivity for lactose, the main characteristics of diafiltration are calculated for various practical applications. For practical purposes, it is advisable to use a buttermilk permeate nanofiltrate using highly selective lactose membranes. Selectivity for salts should be minimal. When comparing the different diafiltration variants, the most suitable is a periodic method, with continuous dilution, and a continuous method with a crossflow and reverse flow of the nanofiltrate. The smallest аmount of a nanofiltrate is observed in the case of a continuous countercurrent. The time for diafiltration treatment depends on the membrane’s specific parameters, process operating parameters, and the selected lactose purification variant. The most cost-effective is the continuous variant with a countercurrent nanofiltrate. However, it can not be recommended because of the considerable duration of the process. The suggested technique for calculating diafiltration allows quick evaluation of

A combination of luxR1 and luxR2 genes activates Pr-promoters of psychrophilic Aliivibrio logei lux-operon independently of chaperonin GroEL/ES and protease Lon at high concentrations of autoinducer.

Science.gov (United States)

Konopleva, Maria N; Khrulnova, Svetlana A; Baranova, Ancha; Ekimov, Leonid V; Bazhenov, Sergey V; Goryanin, Ignatiy I; Manukhov, Ilya V

2016-05-13

Lux-operon of psychrophilic bacteria Aliivibrio logei contains two copies of luxR and is regulated by Type I quorum sensing (QS). Activation of lux-operon of psychrophilic bacteria A. logei by LuxR1 requires about 100 times higher concentrations of autoinducer (AI) than the activation by LuxR2. On the other hand, LuxR1 does not require GroEL/ES chaperonin for its folding and cannot be degraded by protease Lon, while LuxR2 sensitive to Lon and requires GroEL/ES. Here we show that at 10(-5) - 10(-4)М concentrations of AI a combination of luxR1 and luxR2 products is capable of activating the Pr-promoters of A. logei lux-operon in Escherichia coli independently of GroEL/ES and protease Lon. The presence of LuxR1 assists LuxR2 in gro(-) cells when AI was added at high concentration, while at low concentration of AI in a cell LuxR1 decreases the LuxR2 activity. These observations may be explained by the formation of LuxR1/LuxR2 heterodimers that act in complex with AI independently from GroEL/ES and protease Lon. This study expands current understanding of QS regulation in A. logei as it implies cooperative regulation of lux-operon by LuxR1 and LuxR2 proteins. Copyright © 2016 Elsevier Inc. All rights reserved.

Prevalence of transcription promoters within archaeal operons and coding sequences.

Science.gov (United States)

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

Proteomic differences between tellurite-sensitive and tellurite-resistant E.coli.

Directory of Open Access Journals (Sweden)

Jana Aradská

Full Text Available Tellurite containing compounds are in use for industrial processes and increasing delivery into the environment generates specific pollution that may well result in contamination and subsequent potential adverse effects on public health. It was the aim of the current study to reveal mechanism of toxicity in tellurite-sensitive and tellurite-resistant E. coli at the protein level. In this work an approach using gel-based mass spectrometrical analysis to identify a differential protein profile related to tellurite toxicity was used and the mechanism of ter operon-mediated tellurite resistance was addressed. E. coli BL21 was genetically manipulated for tellurite-resistance by the introduction of the resistance-conferring ter genes on the pLK18 plasmid. Potassium tellurite was added to cultures in order to obtain a final 3.9 micromolar concentration. Proteins from tellurite-sensitive and tellurite-resistant E. coli were run on 2-D gel electrophoresis, spots of interest were picked, in-gel digested and subsequently analysed by nano-LC-MS/MS (ion trap. In addition, Western blotting and measurement of enzymatic activity were performed to verify the expression of certain candidate proteins. Following exposure to tellurite, in contrast to tellurite-resistant bacteria, sensitive cells exhibited increased levels of antioxidant enzymes superoxide dismutases, catalase and oxidoreductase YqhD. Cysteine desulfurase, known to be related to tellurite toxicity as well as proteins involved in protein folding: GroEL, DnaK and EF-Tu were upregulated in sensitive cells. In resistant bacteria, several isoforms of four essential Ter proteins were observed and following tellurite treatment the abovementioned protein levels did not show any significant proteome changes as compared to the sensitive control. The absence of general defense mechanisms against tellurite toxicity in resistant bacteria thus provides further evidence that the four proteins of the ter operon

Chemical and proteolysis-derived changes during long-term storage of lactose-hydrolyzed ultrahigh-temperature (UHT) milk.

Science.gov (United States)

Jansson, Therese; Jensen, Hanne B; Sundekilde, Ulrik K; Clausen, Morten R; Eggers, Nina; Larsen, Lotte B; Ray, Colin; Andersen, Henrik J; Bertram, Hanne C

2014-11-19

Proteolytic activity in milk may release bitter-tasting peptides and generate free amino terminals that react with carbohydrates, which initiate Maillard reaction. Ultrahigh temperature (UHT) heat treatment inactivates the majority of proteolytic enzymes in milk. In lactose-hydrolyzed milk a β-galactosidase preparation is applied to the milk after heat treatment, which has proteolytic side activities that may induce quality deterioration of long-term-stored milk. In the present study proteolysis, glycation, and volatile compound formation were investigated in conventional (100% lactose), filtered (60% lactose), and lactose-hydrolyzed (<1% lactose) UHT milk using reverse phase high-pressure liquid chromatography-mass spectrometry, proton nuclear magnetic resonance, and gas chromatography-mass spectrometry. Proteolysis was observed in all milk types. However, the degree of proteolysis was significantly higher in the lactose-hydrolyzed milk compared to the conventional and filtered milk. The proteins most prone to proteolysis were β-CN and αs1-CN, which were clearly hydrolyzed after approximately 90 days of storage in the lactose-hydrolyzed milk.

Characterization of a second physiologically relevant lactose permease gene (lacpB) in Aspergillus nidulans.

Science.gov (United States)

Fekete, Erzsébet; Orosz, Anita; Kulcsár, László; Kavalecz, Napsugár; Flipphi, Michel; Karaffa, Levente

2016-05-01

In Aspergillus nidulans, uptake rather than hydrolysis is the rate-limiting step of lactose catabolism. Deletion of the lactose permease A-encoding gene (lacpA) reduces the growth rate on lactose, while its overexpression enables faster growth than wild-type strains are capable of. We have identified a second physiologically relevant lactose transporter, LacpB. Glycerol-grown mycelia from mutants deleted for lacpB appear to take up only minute amounts of lactose during the first 60 h after a medium transfer, while mycelia of double lacpA/lacpB-deletant strains are unable to produce new biomass from lactose. Although transcription of both lacp genes was strongly induced by lactose, their inducer profiles differ markedly. lacpA but not lacpB expression was high in d-galactose cultures. However, lacpB responded strongly also to β-linked glucopyranose dimers cellobiose and sophorose, while these inducers of the cellulolytic system did not provoke any lacpA response. Nevertheless, lacpB transcript was induced to higher levels on cellobiose in strains that lack the lacpA gene than in a wild-type background. Indeed, cellobiose uptake was faster and biomass formation accelerated in lacpA deletants. In contrast, in lacpB knockout strains, growth rate and cellobiose uptake were considerably reduced relative to wild-type, indicating that the cellulose and lactose catabolic systems employ common elements. Nevertheless, our permease mutants still grew on cellobiose, which suggests that its uptake in A. nidulans prominently involves hitherto unknown transport systems.

Experimental study of lactose hydrolysis and separation in cstr-uf membrane reactor

Directory of Open Access Journals (Sweden)

M. Namvar-Mahboub

2012-09-01

Full Text Available In this study, the effect of processing conditions on the performance of continuous stirred tank -ultrafiltration (CSTR-UF in dead - end mode was investigated. An UF membrane with a molecular weight cutoff of 3 kDa made of regenerated cellulose material was used to separate enzyme from products. The effect of operating pressure ranging between 2 and 5 bar and time on the performance of the CSTR-UF system was studied. The experiments were performed with a 0.139 molar aqueous solution of lactose as feed. According to the experimental data, the lactose concentration in the permeate decreased with time due to concentration polarization and hydrolysis. It was found that the rejection factor of lactose increases from 33 to 77% with time from 5 to 85 min. Permeation flux of the membrane was evaluated in terms of pure water flux (PWF and lactose aqueous solution. Results showed that a high operating pressure led to a high permeation flux for both mentioned cases. Also, adding lactose and enzyme to pure water caused a reduction of the permeation flux due to concentration polarization.

Improving Dry Powder Inhaler Performance by Surface Roughening of Lactose Carrier Particles.

Science.gov (United States)

Tan, Bernice Mei Jin; Chan, Lai Wah; Heng, Paul Wan Sia

2016-08-01

This study investigated the impact of macro-scale carrier surface roughness on the performance of dry powder inhaler (DPI) formulations. Fluid-bed processing and roller compaction were explored as processing methods to increase the surface roughness (Ra) of lactose carrier particles. DPI formulations containing either (a) different concentrations of fine lactose at a fixed concentration of micronized drug (isoniazid) or (b) various concentrations of drug in the absence of fine lactose were prepared. The fine particle fraction (FPF) and aerodynamic particle size of micronized drug of all formulations were determined using the Next Generation Impactor. Fluid-bed processing resulted in a modest increase in the Ra from 562 to 907 nm while roller compaction led to significant increases in Ra > 1300 nm. The roller compacted carriers exhibited FPF > 35%, which were twice that of the smoothest carriers. The addition of up to 5%, w/w of fine lactose improved the FPF of smoother carriers by 60-200% whereas only lactose carrier particles by roller compaction was immensely beneficial to improving DPI performance, primarily due to increased surface roughness at the macro-scale.

clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

Science.gov (United States)

Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

2015-03-01

The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Hydroxyurea-Lactose Interaction Study: In Silico and In Vitro Evaluation.

Science.gov (United States)

Bachchhao, Kunal B; Patil, R R; Patil, C R; Patil, Dipak D

2017-11-01

The Maillard reaction between hydroxyurea (a primary amine-containing drug) and lactose (used as an excipient) was explored. The adduct of these compounds was synthesized by heating hydroxyurea with lactose monohydrate at 60 °C in borate buffer (pH 9.2) for 12 h. Synthesis of the adduct was confirmed using UV-visible spectroscopy and Fourier transform infrared, differential scanning calorimetry, high-pressure liquid chromatography, and liquid chromatography-mass spectrometry studies. An in silico investigation of how the adduct formation affected the interactions of hydroxyurea with its biological target oxyhemoglobin, to which it binds to generate nitric oxide and regulates fetal hemoglobin synthesis, was carried out. The in silico evaluations were complemented by an in vitro assay of the anti-sickling activity. Co-incubation of hydroxyurea with deoxygenated blood samples reduced the percentage of sickled cells from 38% to 12 ± 1.6%, whereas the percentage of sickled cells in samples treated with the adduct was 17 ± 1.2%. This indicated loss of anti-sickling activity in the case of the adduct. This study confirmed that hydroxyurea can participate in a Maillard reaction if lactose is used as a diluent. Although an extended study at environmentally feasible temperatures was not carried out in the present investigation, the partial loss of the anti-sickling activity of hydroxyurea was investigated along with the in silico drug-target interactions. The results indicated that the use of lactose in hydroxyurea formulations needs urgent reconsideration and that lactose must be replaced by other diluents that do not form Maillard adducts.

Relationship among Shigella spp. and enteroinvasive Escherichia coli (EIEC) and their differentiation.

Science.gov (United States)

Ud-Din, Abu; Wahid, Syeda

2014-01-01

Shigellosis produces inflammatory reactions and ulceration on the intestinal epithelium followed by bloody or mucoid diarrhea. It is caused by enteroinvasive E. coli (EIEC) as well as any species of the genus Shigella, namely, S. dysenteriae, S. flexneri, S. boydii, and S. sonnei. This current species designation of Shigella does not specify genetic similarity. Shigella spp. could be easily differentiated from E. coli, but difficulties observed for the EIEC-Shigella differentiation as both show similar biochemical traits and can cause dysentery using the same mode of invasion. Sequencing of multiple housekeeping genes indicates that Shigella has derived on several different occasions via acquisition of the transferable forms of ancestral virulence plasmids within commensal E. coli and form a Shigella-EIEC pathovar. EIEC showed lower expression of virulence genes compared to Shigella, hence EIEC produce less severe disease than Shigella spp. Conventional microbiological techniques often lead to confusing results concerning the discrimination between EIEC and Shigella spp. The lactose permease gene (lacY) is present in all E. coli strains but absent in Shigella spp., whereas β-glucuronidase gene (uidA) is present in both E. coli and Shigella spp. Thus uidA gene and lacY gene based duplex real-time PCR assay could be used for easy identification and differentiation of Shigella spp. from E. coli and in particular EIEC.

Systematic appraisal of lactose intolerance as cause of increased need for oral thyroxine.

Science.gov (United States)

Cellini, Miriam; Santaguida, Maria Giulia; Gatto, Ilenia; Virili, Camilla; Del Duca, Susanna Carlotta; Brusca, Nunzia; Capriello, Silvia; Gargano, Lucilla; Centanni, Marco

2014-08-01

An increased need for T4 has been described in patients with different gastrointestinal disorders. However, there is a lack of systematic studies assessing the need for T4 in hypothyroid patients with lactose intolerance, a widespread and often occult disorder. The objective of the study was to assess the replacement T4 dose required in hypothyroid patients with lactose intolerance. This was a cohort study. The study was conducted at an outpatient endocrinology unit in a University Hospital. The replacement T4 dose has been analyzed, from 2009 to 2012, in 34 hypothyroid patients due to Hashimoto's thyroiditis and lactose intolerance and being noncompliant with a lactose-free diet. An individually tailored T4 dose was measured. In all patients with isolated Hashimoto's thyroiditis, target TSH (median TSH 1.02 mU/L) was obtained at a median T4 dose of 1.31 μg/kg/d. In patients with lactose intolerance, only five of 34 patients reached the desired TSH (median TSH 0.83 mU/L) with a similar T4 dose (1.29 μg/kg/d). In the remaining 29 patients, the T4 dose was progressively increased and the target TSH (median TSH 1.21 mU/L) was attained at a median T4 dose of 1.81 μg/kg/d (+38%, P lactose intolerance, a median T4 dose of 1.72 μg/kg/d (+31% P lactose intolerance significantly increased the need for oral T4 in hypothyroid patients.

Production and characterization of aluminium oxide nanoshells on spray dried lactose.

Science.gov (United States)

Hellrup, Joel; Rooth, Mårten; Johansson, Anders; Mahlin, Denny

2017-08-30

Atomic layer deposition (ALD) enables deposition of dense nanometer thick metal oxide nanoshells on powder particles with precise thickness control. This leads to products with low weight fraction coating, also when depositing on nano- or micron sized powder particles. This study aimed at investigating the aluminium oxide nanoshell thickness required to prevent moisture sorption. The nanoshells were produced with ALD on spray-dried lactose, which is amorphous and extremely hygroscopic. The particles were studied with dynamic vapor sorption between 0 and 50% RH, light scattering, scanning electron microscopy, X-ray diffraction, differential scanning calorimetry, and polarized light microscopy. The ALD did not induce any recrystallization of the amorphous lactose. The dynamic vapor sorption indicated that the moisture sorption was almost completely inhibited by the nanoshell. Neat amorphous lactose rapidly recrystallized upon moisture exposure. However, only ca. 15% of the amorphous lactose particles recrystallized of a sample with 9% (by weight) aluminium oxide nanoshell at storage for six months upon 75% RH/40°C, which indicate that the moisture sorption was completely inhibited in the majority of the particles. In conclusion, the aluminium oxide nanoshells prevented moisture sorption and dramatically improved the long term physical stability of amorphous lactose. This shows the potential of the ALD-technique to protect drug microparticles. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of lactose ureide, a urea derivative of lactose, in milk and milk products.

Science.gov (United States)

Suyama, K; Sasaki, A; Oritani, T; Hosono, A

2011-12-01

With the widespread consumption of milk, the complete characterization of the constituents of milk and milk products is important in terms of functionality and safety. In this study, a novel nonreducing carbohydrate was separated from powdered skim milk and was identified using electron spray ionization-mass spectrometry (m/z 385.1[M + H(+)]), ¹H, ¹³C, ¹H¹H-correlation spectroscopy, and heteronuclear single quantum-nuclear magnetic resonance spectra. The carbohydrate was identified as a lactose derivative of urea, N-carbamoyl-o-β-D-galactopyranosyl-(1-4)-D-glucopyranosylamine (lactose ureide, LU). For the HPLC analysis of LU in milk and milk products, benzoylated LU, hepta-o-benzoyl lactose ureide (melting point 137-139°C; m/z 1,113 [M + H⁺]; wavelength of maximum absorption, λ(max), 229 nm; molar extinction coefficient, ε, 8.1037 × 10⁷), was used as a standard. The crude nonreducing carbohydrate fraction from raw milk, thermally processed milk, and milk products such as powdered milks were directly benzoylated and subjected to HPLC analysis using an octadecylsilyl column to determine the quantity of LU. The content of LU in 10% solutions of powdered skim milk and powdered infant formula (5.0±1.1 and 4.9±1.5 mg/L, respectively) were almost 3-fold higher than that of UHT milk (1.6±0.5 mg/L) and higher than that of low-temperature, long-time-processed (pasteurized at 65°C for 30 min) milk (1.2±0.3 mg/L) and the fresh raw milk sample (0.3±0.1 mg/L). A time-course of the LU content in raw milk during heating at 110°C revealed that LU increased with time. From these results, it is likely that LU is formed by the Maillard-type reaction between the lactose and urea in milk and milk products. Because the concentration of LU in milk increased with the degree of processing heat treatment, it could serve as an indicator of the thermal deterioration of milk. Although it is known that the human intestine is unable to digest LU, the gastrointestinal bacteria

rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

Science.gov (United States)

Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

2016-01-01

The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

The effects of probiotics in lactose intolerance: A systematic review.

Science.gov (United States)

Oak, Sophia J; Jha, Rajesh

2018-02-09

Over 60 percent of the human population has a reduced ability to digest lactose due to low levels of lactase enzyme activity. Probiotics are live bacteria or yeast that supplements the gastrointestinal flora. Studies have shown that probiotics exhibit various health beneficial properties such as improvement of intestinal health, enhancement of the immune responses, and reduction of serum cholesterol. Accumulating evidence has shown that probiotic bacteria in fermented and unfermented milk products can be used to alleviate the clinical symptoms of lactose intolerance (LI). In this systematic review, the effectiveness of probiotics in the treatment of LI was evaluated using 15 randomized double-blind studies. Eight probiotic strains with the greatest number of proven benefits were studied. Results showed varying degrees of efficacy but an overall positive relationship between probiotics and lactose intolerance.

Síntese de galacto-oligossacarídeos a partir de lactose usando β-galactosidase comercial de Kluyveromyces lactis Synthesis of galactooligosaccharides from lactose using commercial β-galactosidase from Kluyveromyces lactis