WorldWideScience

Sample records for cold-adapted carotenogenic basidiomycetous

  1. Cold-Adapted Enzymes

    Science.gov (United States)

    Georlette, D.; Bentahir, M.; Claverie, P.; Collins, T.; D'amico, S.; Delille, D.; Feller, G.; Gratia, E.; Hoyoux, A.; Lonhienne, T.; Meuwis, M.-a.; Zecchinon, L.; Gerday, Ch.

    In the last few years, increased attention has been focused on enzymes produced by cold-adapted micro-organisms. It has emerged that psychrophilic enzymes represent an extremely powerful tool in both protein folding investigations and for biotechnological purposes. Such enzymes are characterised by an increased thermosensitivity and, most of them, by a higher catalytic efficiency at low and moderate temperatures, when compared to their mesophilic counterparts. The high thermosensitivity probably originates from an increased flexibility of either a selected area of the molecular edifice or the overall protein structure, providing enhanced abilities to undergo conformational changes during catalysis at low temperatures. Structure modelling and recent crystallographic data have allowed to elucidate the structural parameters that could be involved in this higher resilience. It was demonstrated that each psychrophilic enzyme adopts its own adaptive strategy. It appears, moreover, that there is a continuum in the strategy of protein adaptation to temperature, as the previously mentioned structural parameters are implicated in the stability of thermophilic proteins. Additional 3D crystal structures, site-directed and random mutagenesis experiments should now be undertaken to further investigate the stability-flexibility-activity relationship.

  2. Human whole body cold adaptation.

    NARCIS (Netherlands)

    Daanen, Hein A.M.; Van Marken Lichtenbelt, Wouter D.

    2016-01-01

    Reviews on whole body human cold adaptation generally do not distinguish between population studies and dedicated acclimation studies, leading to confusing results. Population studies show that indigenous black Africans have reduced shivering thermogenesis in the cold and poor cold induced

  3. Human whole body cold adaptation.

    OpenAIRE

    Daanen, Hein A.M.; Van Marken Lichtenbelt, Wouter D.

    2016-01-01

    ABSTRACT Reviews on whole body human cold adaptation generally do not distinguish between population studies and dedicated acclimation studies, leading to confusing results. Population studies show that indigenous black Africans have reduced shivering thermogenesis in the cold and poor cold induced vasodilation in fingers and toes compared to Caucasians and Inuit. About 40,000?y after humans left Africa, natives in cold terrestrial areas seems to have developed not only behavioral adaptations...

  4. Human whole body cold adaptation.

    Science.gov (United States)

    Daanen, Hein A M; Van Marken Lichtenbelt, Wouter D

    2016-01-01

    Reviews on whole body human cold adaptation generally do not distinguish between population studies and dedicated acclimation studies, leading to confusing results. Population studies show that indigenous black Africans have reduced shivering thermogenesis in the cold and poor cold induced vasodilation in fingers and toes compared to Caucasians and Inuit. About 40,000 y after humans left Africa, natives in cold terrestrial areas seems to have developed not only behavioral adaptations, but also physiological adaptations to cold. Dedicated studies show that repeated whole body exposure of individual volunteers, mainly Caucasians, to severe cold results in reduced cold sensation but no major physiological changes. Repeated cold water immersion seems to slightly reduce metabolic heat production, while repeated exposure to milder cold conditions shows some increase in metabolic heat production, in particular non-shivering thermogenesis. In conclusion, human cold adaptation in the form of increased metabolism and insulation seems to have occurred during recent evolution in populations, but cannot be developed during a lifetime in cold conditions as encountered in temperate and arctic regions. Therefore, we mainly depend on our behavioral skills to live in and survive the cold.

  5. Proteomic analysis of endothelial cold-adaptation

    Directory of Open Access Journals (Sweden)

    Zieger Michael AJ

    2011-12-01

    Full Text Available Abstract Background Understanding how human cells in tissue culture adapt to hypothermia may aid in developing new clinical procedures for improved ischemic and hypothermic protection. Human coronary artery endothelial cells grown to confluence at 37°C and then transferred to 25°C become resistant over time to oxidative stress and injury induced by 0°C storage and rewarming. This protection correlates with an increase in intracellular glutathione at 25°C. To help understand the molecular basis of endothelial cold-adaptation, isolated proteins from cold-adapted (25°C/72 h and pre-adapted cells were analyzed by quantitative proteomic methods and differentially expressed proteins were categorized using the DAVID Bioinformatics Resource. Results Cells adapted to 25°C expressed changes in the abundance of 219 unique proteins representing a broad range of categories such as translation, glycolysis, biosynthetic (anabolic processes, NAD, cytoskeletal organization, RNA processing, oxidoreductase activity, response-to-stress and cell redox homeostasis. The number of proteins that decreased significantly with cold-adaptation exceeded the number that increased by 2:1. Almost half of the decreases were associated with protein metabolic processes and a third were related to anabolic processes including protein, DNA and fatty acid synthesis. Changes consistent with the suppression of cytoskeletal dynamics provided further evidence that cold-adapted cells are in an energy conserving state. Among the specific changes were increases in the abundance and activity of redox proteins glutathione S-transferase, thioredoxin and thioredoxin reductase, which correlated with a decrease in oxidative stress, an increase in protein glutathionylation, and a recovery of reduced protein thiols during rewarming from 0°C. Increases in S-adenosylhomocysteine hydrolase and nicotinamide phosphoribosyltransferase implicate a central role for the methionine

  6. Hypothermic general cold adaptation induced by local cold acclimation.

    Science.gov (United States)

    Savourey, G; Barnavol, B; Caravel, J P; Feuerstein, C; Bittel, J H

    1996-01-01

    To study relationships between local cold adaptation of the lower limbs and general cold adaptation, eight subjects were submitted both to a cold foot test (CFT, 5 degrees C water immersion, 5 min) and to a whole-body standard cold air test (SCAT, 1 degree C, 2 h, nude at rest) before and after a local cold acclimation (LCA) of the lower limbs effected by repeated cold water immersions. The LCA induced a local cold adaptation confirmed by higher skin temperatures of the lower limbs during CFT and a hypothermic insulative general cold adaptation (decreased rectal temperature and mean skin temperature P adaptation was related to the habituation process confirmed by decreased plasma concentrations of noradrenaline (NA) during LCA (P general cold adaptation was unrelated either to local cold adaptation or to the habituation process, because an increased NA during SCAT after LCA (P syndrome" occurring during LCA.

  7. Fungicide selective for basidiomycetes.

    Science.gov (United States)

    Edgington, L V; Walton, G S; Miller, P M

    1966-07-15

    Concentrations of 2,3-dihydro-5-carboxanilido-6-methyl-1,4-oxathiin lower than 8 parts per million prevented mycelial growth of a number of Basidiomycetes. By contrast, mycelial growth of various other fungi-Phycomycetes, Ascomycetes, and Deuteromycetes-was 50 percent inhibited only by concentrations of 32 ppm or higher. Two exceptions to this pattern of selective fungitoxicity were found:an isolate of Rhizoctonia solani was not as sensitive as other Basidiomycetes, and the deuteromycete Verticillium alboatrum was inhibited by lower concentrations than affected other fungi in this group. Spore germination of two Basidiomycetes, Uromyces phaseoli and Ustilago nuda, was inhibited 95 percent or more at 10 ppm.

  8. Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785

    Science.gov (United States)

    2010-01-01

    Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1), lipid/biomass (68%) and lipid/glucose yields (16%). Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils. PMID:20863365

  9. Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785

    Directory of Open Access Journals (Sweden)

    De Lucia Marzia

    2010-09-01

    Full Text Available Abstract Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1, lipid/biomass (68% and lipid/glucose yields (16%. Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils.

  10. Evolutionary genomics of the cold-adapted diatom Fragilariopsis cylindrus

    KAUST Repository

    Mock, Thomas; Otillar, Robert P.; Strauss, Jan; McMullan, Mark; Paajanen, Pirita; Schmutz, Jeremy; Salamov, Asaf; Sanges, Remo; Toseland, Andrew; Ward, Ben J.; Allen, Andrew E.; Dupont, Christopher L.; Frickenhaus, Stephan; Maumus, Florian; Veluchamy, Alaguraj; Wu, Taoyang; Barry, Kerrie W.; Falciatore, Angela; Ferrante, Maria I.; Fortunato, Antonio E.; Glö ckner, Gernot; Gruber, Ansgar; Hipkin, Rachel; Janech, Michael G.; Kroth, Peter G.; Leese, Florian; Lindquist, Erika A.; Lyon, Barbara R.; Martin, Joel; Mayer, Christoph; Parker, Micaela; Quesneville, Hadi; Raymond, James A.; Uhlig, Christiane; Valas, Ruben E.; Valentin, Klaus U.; Worden, Alexandra Z.; Armbrust, E. Virginia; Clark, Matthew D.; Bowler, Chris; Green, Beverley R.; Moulton, Vincent; Oosterhout, Cock van; Grigoriev, Igor V.

    2017-01-01

    The Southern Ocean houses a diverse and productive community of organisms. Unicellular eukaryotic diatoms are the main primary producers in this environment, where photosynthesis is limited by low concentrations of dissolved iron and large seasonal fluctuations in light, temperature and the extent of sea ice. How diatoms have adapted to this extreme environment is largely unknown. Here we present insights into the genome evolution of a cold-adapted diatom from the Southern Ocean, Fragilariopsis cylindrus, based on a comparison with temperate diatoms. We find that approximately 24.7 per cent of the diploid F. cylindrus genome consists of genetic loci with alleles that are highly divergent (15.1 megabases of the total genome size of 61.1 megabases). These divergent alleles were differentially expressed across environmental conditions, including darkness, low iron, freezing, elevated temperature and increased CO2. Alleles with the largest ratio of non-synonymous to synonymous nucleotide substitutions also show the most pronounced condition-dependent expression, suggesting a correlation between diversifying selection and allelic differentiation. Divergent alleles may be involved in adaptation to environmental fluctuations in the Southern Ocean.

  11. Evolutionary genomics of the cold-adapted diatom Fragilariopsis cylindrus

    KAUST Repository

    Mock, Thomas

    2017-01-17

    The Southern Ocean houses a diverse and productive community of organisms. Unicellular eukaryotic diatoms are the main primary producers in this environment, where photosynthesis is limited by low concentrations of dissolved iron and large seasonal fluctuations in light, temperature and the extent of sea ice. How diatoms have adapted to this extreme environment is largely unknown. Here we present insights into the genome evolution of a cold-adapted diatom from the Southern Ocean, Fragilariopsis cylindrus, based on a comparison with temperate diatoms. We find that approximately 24.7 per cent of the diploid F. cylindrus genome consists of genetic loci with alleles that are highly divergent (15.1 megabases of the total genome size of 61.1 megabases). These divergent alleles were differentially expressed across environmental conditions, including darkness, low iron, freezing, elevated temperature and increased CO2. Alleles with the largest ratio of non-synonymous to synonymous nucleotide substitutions also show the most pronounced condition-dependent expression, suggesting a correlation between diversifying selection and allelic differentiation. Divergent alleles may be involved in adaptation to environmental fluctuations in the Southern Ocean.

  12. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea

    OpenAIRE

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-01-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, th...

  13. Purification and characterization of a novel cold-adapted phytase from Rhodotorula mucilaginosa strain JMUY14 isolated from Antarctic.

    Science.gov (United States)

    Yu, Peng; Wang, Xue-Ting; Liu, Jing-Wen

    2015-08-01

    A yeast producing a cold-adapted phytase was isolated from Antarctic deep-sea sediment and identified as a Rhodotorula mucilaginosa strain JMUY14 of basidiomycetous yeasts. It was cultured in fermentation optimized by a response surface methodology based on the Box-Behnken design. The maximum activity of phytase reached 205.447 U ml(-1), which was close to the predicted value of 201.948 U ml(-1) and approximately 3.4 times higher than its initial activity. The extracellular phytase was purified by 15.2-fold to homogeneity with a specific activity of 31,635 U mg(-1) by (NH4 )2 SO4 precipitation, and a combination of DEAE Sepharose Fast Flow, SP Sepharose Fast Flow, and Sephadex G-100. The molecular weight of the purified enzyme was estimated to be 63 kDa and its pI was 4.33. Its optimal temperature and pH were 50 °C and 5.0, respectively. Its activity was 85% at 37 °C, and showed good stability at pH 3.0 ∼ 7.0. When compared with mesophilic counterparts, the phytase not only exhibited a higher activity during 20 ∼ 30 °C but also had a low Km (247 µM) and high kcat (1394 s(-1)). The phytase activity was slightly stimulated in the presence of Mg(2+), Fe(2+), Fe(3+), K(+), Na(+), Ca(2+), EDTA, and EGTA and moderately inhibited by Cu(2+), Zn(2+), Mn(2+), Ag(+), PMSF, SDS, and phenylgloxal hydrate. It was resistant to both pepsin and trypsin. Since the phytase produced by the R. mucilaginosa JMUY14 showed a high specific activity, good pH stability, strong protease resistance, and high activity at low temperature, it has great potential for feed applications, especially in aquaculture. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Armillaria mellea: an ozonophilic basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Berliner, M D

    1963-01-19

    Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

  15. Lectins from Mycelia of Basidiomycetes

    Directory of Open Access Journals (Sweden)

    Valentina E. Nikitina

    2017-06-01

    Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

  16. Differences in cold adaptation of .i.Bacillus subtilis./i. under anaerobic and aerobic conditions

    Czech Academy of Sciences Publication Activity Database

    Beranová, J.; Mansilla, M.C.; de Mendoza, D.; Elhottová, Dana; Konopásek, I.

    2010-01-01

    Roč. 192, č. 16 (2010), s. 4164-4171 ISSN 0021-9193 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z60660521 Keywords : cold adaptation * Bacillus subtilis * anaerobiosis Subject RIV: EE - Microbiology, Virology Impact factor: 3.726, year: 2010

  17. Haemodynamic responses and changes of haemostatic risk factors in cold-adapted humans.

    Science.gov (United States)

    De Lorenzo, F; Kadziola, Z; Mukherjee, M; Saba, N; Kakkar, V V

    1999-09-01

    Epidemiological studies have shown an increase in acute myocardial infarctions or deaths due to myocardial infarction in colder weather; the mechanisms most likely involve increased blood levels of haemostatic risk factors, and increases in arterial blood pressure and heart rate. We studied the relationship between cold adaptation, haemostatic risk factors and haemodynamic variables. Cold adaptation was obtained by a programme of immersion of the whole body up to the neck in a water-filled bath, the temperature of which was gradually decreased from 22 degrees C to 14 degrees C, time of exposure being increased from 5 to 20 min over a period of 90 days. We studied 428 patients (44% men) and measured blood levels of fibrinogen, plasminogen activator inhibitor 1 (PAI-1), tissue plasminogen activator antigen (t-PA), plasma viscosity, von Willebrand factor, D-dimer and platelet count, both at baseline and after 90 days of daily immersion. There were significant reductions in von Willebrand factor (-3%; p cold adaptation (-310; p = 0.004). Cold adaptation, compared with exposure to cold weather, induces different haemodynamic responses and changes of blood levels of haemostatic risk factors.

  18. Recombinant cold-adapted attenuated influenza A vaccines for use in children: molecular genetic analysis of the cold-adapted donor and recombinants.

    OpenAIRE

    Ghendon, Y Z; Polezhaev, F I; Lisovskaya, K V; Medvedeva, T E; Alexandrova, G I; Klimov, A I

    1984-01-01

    A previously described cold-adapted attenuated virus, A/Leningrad/134/17/57 (H2N2), was further modified by 30 additional passages in chicken embryos at 25 degrees C. This virus had a distinct temperature-sensitive (ts) phenotype, grew well in chicken embryos at 25 degrees C, and failed to recombine with reference ts mutants of fowl plague virus containing ts lesions in five genes coding for non-glycosylated proteins (genes 1, 2, 5, 7, and 8). Recombination of A/Leningrad/134/47/57 with wild-...

  19. Recombinant cold-adapted attenuated influenza A vaccines for use in children: reactogenicity and antigenic activity of cold-adapted recombinants and analysis of isolates from the vaccinees.

    OpenAIRE

    Alexandrova, G I; Polezhaev, F I; Budilovsky, G N; Garmashova, L M; Topuria, N A; Egorov, A Y; Romejko-Gurko, Y R; Koval, T A; Lisovskaya, K V; Klimov, A I

    1984-01-01

    Reactogenicity and antigenic activity of recombinants obtained by crossing cold-adapted donor of attenuation A/Leningrad/134/47/57 with wild-type influenza virus strains A/Leningrad/322/79(H1N1) and A/Bangkok/1/79(H3N2) were studied. The recombinants were areactogenic when administered as an intranasal spray to children aged 3 to 15, including those who lacked or had only low titers of pre-existing anti-hemagglutinin and anti-neuraminidase antibody in their blood. After two administrations of...

  20. Cloning and functional analysis of the promoters that upregulate carotenogenic gene expression during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yang, Qingjie; Ni, Xiuzhen; Bai, Chao; Sheng, Yanmin; Shi, Lianxuan; Capell, Teresa; Sandmann, Gerhard; Christou, Paul

    2014-04-01

    Over the last two decades, many carotenogenic genes have been cloned and used to generate metabolically engineered plants producing higher levels of carotenoids. However, comparatively little is known about the regulation of endogenous carotenogenic genes in higher plants, and this restricts our ability to predict how engineered plants will perform in terms of carotenoid content and composition. During petal development in the Great Yellow Gentian (Gentiana lutea), carotenoid accumulation, the formation of chromoplasts and the upregulation of several carotenogenic genes are temporally coordinated. We investigated the regulatory mechanisms responsible for this coordinated expression by isolating five G. lutea carotenogenic gene (GlPDS, GlZDS, GlLYCB, GlBCH and GlLYCE) promoters by inverse polymerase chain reaction (PCR). Each promoter was sufficient for developmentally regulated expression of the gusA reporter gene following transient expression in tomato (Solanum lycopersicum cv. Micro-Tom). Interestingly, the GlLYCB and GlBCH promoters drove high levels of gusA expression in chromoplast-containing mature green fruits, but low levels in chloroplast-containing immature green fruits, indicating a strict correlation between promoter activity, tomato fruit development and chromoplast differentiation. As well as core promoter elements such as TATA and CAAT boxes, all five promoters together with previously characterized GlZEP promoter contained three common cis-regulatory motifs involved in the response to methyl jasmonate (CGTCA) and ethylene (ATCTA), and required for endosperm expression (Skn-1_motif, GTCAT). These shared common cis-acting elements may represent binding sites for transcription factors responsible for co-regulation. Our data provide insight into the regulatory basis of the coordinated upregulation of carotenogenic gene expression during flower development in G. lutea. © 2013 Scandinavian Plant Physiology Society.

  1. Plant-Polysaccharide-Degrading Enzymes from Basidiomycetes

    Science.gov (United States)

    Rytioja, Johanna; Hildén, Kristiina; Yuzon, Jennifer; Hatakka, Annele; de Vries, Ronald P.

    2014-01-01

    SUMMARY Basidiomycete fungi subsist on various types of plant material in diverse environments, from living and dead trees and forest litter to crops and grasses and to decaying plant matter in soils. Due to the variation in their natural carbon sources, basidiomycetes have highly varied plant-polysaccharide-degrading capabilities. This topic is not as well studied for basidiomycetes as for ascomycete fungi, which are the main sources of knowledge on fungal plant polysaccharide degradation. Research on plant-biomass-decaying fungi has focused on isolating enzymes for current and future applications, such as for the production of fuels, the food industry, and waste treatment. More recently, genomic studies of basidiomycete fungi have provided a profound view of the plant-biomass-degrading potential of wood-rotting, litter-decomposing, plant-pathogenic, and ectomycorrhizal (ECM) basidiomycetes. This review summarizes the current knowledge on plant polysaccharide depolymerization by basidiomycete species from diverse habitats. In addition, these data are compared to those for the most broadly studied ascomycete genus, Aspergillus, to provide insight into specific features of basidiomycetes with respect to plant polysaccharide degradation. PMID:25428937

  2. Enhancement of the safety of live influenza vaccine by attenuating mutations from cold-adapted hemagglutinin

    International Nuclear Information System (INIS)

    Lee, Yoon Jae; Jang, Yo Han; Kim, Paul; Lee, Yun Ha; Lee, Young Jae; Byun, Young Ho; Lee, Kwang-Hee; Kim, Kyusik; Seong, Baik Lin

    2016-01-01

    In our previous study, X-31ca-based H5N1 LAIVs, in particular, became more virulent in mice than the X-31ca MDV, possibly by the introduction of the surface antigens of highly pathogenic H5N1 influenza virus, implying that additional attenuation is needed in this cases to increase the safety level of the vaccine. In this report we suggest an approach to further increase the safety of LAIV through additional cold-adapted mutations in the hemagglutinin. The cold-adaptation of X-31 virus resulted in four amino acid mutations in the HA. We generated a panel of 7:1 reassortant viruses each carrying the hemagglutinins with individual single amino acid mutations. We examined their phenotypes and found a major attenuating mutation, N81K. This attenuation marker conferred additional temperature-sensitive and attenuation phenotype to the LAIV. Our data indicate that the cold-adapted mutation in the HA confers additional attenuation to the LAIV strain, without compromising its productivity and immune response. - Highlights: • Cold-adaptation process induced four amino acid mutations in the HA of X-31 virus. • The four mutations in the HA also contributed to attenuation of the X-31ca virus • N81K mutation was the most significant marker for the attenuation of X-31ca virus. • Introduction of N81K mutation into H3N2 LAIV further attenuated the vaccine. • This approach provides a useful guideline for enhancing the safety of the LAIVs.

  3. Enhancement of the safety of live influenza vaccine by attenuating mutations from cold-adapted hemagglutinin

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yoon Jae [Graduate Program in Biomaterials Science and Engineering, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Vaccine Translational Research Center, Yonsei University, Seoul (Korea, Republic of); Jang, Yo Han [Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Kim, Paul; Lee, Yun Ha; Lee, Young Jae [Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Vaccine Translational Research Center, Yonsei University, Seoul (Korea, Republic of); Byun, Young Ho; Lee, Kwang-Hee; Kim, Kyusik [Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Seong, Baik Lin, E-mail: blseong@yonsei.ac.kr [Graduate Program in Biomaterials Science and Engineering, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Vaccine Translational Research Center, Yonsei University, Seoul (Korea, Republic of)

    2016-04-15

    In our previous study, X-31ca-based H5N1 LAIVs, in particular, became more virulent in mice than the X-31ca MDV, possibly by the introduction of the surface antigens of highly pathogenic H5N1 influenza virus, implying that additional attenuation is needed in this cases to increase the safety level of the vaccine. In this report we suggest an approach to further increase the safety of LAIV through additional cold-adapted mutations in the hemagglutinin. The cold-adaptation of X-31 virus resulted in four amino acid mutations in the HA. We generated a panel of 7:1 reassortant viruses each carrying the hemagglutinins with individual single amino acid mutations. We examined their phenotypes and found a major attenuating mutation, N81K. This attenuation marker conferred additional temperature-sensitive and attenuation phenotype to the LAIV. Our data indicate that the cold-adapted mutation in the HA confers additional attenuation to the LAIV strain, without compromising its productivity and immune response. - Highlights: • Cold-adaptation process induced four amino acid mutations in the HA of X-31 virus. • The four mutations in the HA also contributed to attenuation of the X-31ca virus • N81K mutation was the most significant marker for the attenuation of X-31ca virus. • Introduction of N81K mutation into H3N2 LAIV further attenuated the vaccine. • This approach provides a useful guideline for enhancing the safety of the LAIVs.

  4. Anti-biofilm activities from marine cold adapted bacteria against staphylococci and Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Rosanna ePapa

    2015-12-01

    Full Text Available Microbial biofilms have great negative impacts on the world’s economy and pose serious problems to industry, public health and medicine. The interest in the development of new approaches for the prevention and treatment of bacterial adhesion and biofilm formation has increased. Since, bacterial pathogens living in biofilm induce persistent chronic infections due to the resistance to antibiotics and host immune system. A viable approach should target adhesive properties without affecting bacterial vitality in order to avoid the appearance of resistant mutants. Many bacteria secrete anti-biofilm molecules that function in regulating biofilm architecture or mediating the release of cells from it during the dispersal stage of biofilm life cycle. Cold-adapted marine bacteria represent an untapped reservoir of biodiversity able to synthesize a broad range of bioactive compounds, including anti-biofilm molecules.The anti-biofilm activity of cell-free supernatants derived from sessile and planktonic cultures of cold-adapted bacteria belonging to Pseudoalteromonas, Psychrobacter and Psychromonas species were tested against Staphylococcus aureus, Staphylococcus epidermidis and Pseudomonas aeruginosa strains. Reported results demonstrate that we have selected supernatants, from cold-adapted marine bacteria, containing non-biocidal agents able to destabilize biofilm matrix of all tested pathogens without killing cells. A preliminary physico-chemical characterization of supernatants was also performed, and these analyses highlighted the presence of molecules of different nature that act by inhibiting biofilm formation. Some of them are also able to impair the initial attachment of the bacterial cells to the surface, thus likely containing molecules acting as anti-biofilm surfactant molecules.The described ability of cold-adapted bacteria to produce effective anti-biofilm molecules paves the way to further characterization of the most promising molecules

  5. Cold adaptation, ca2+ dependency and autolytic stability are related features in a highly active cold-adapted trypsin resistant to autoproteolysis engineered for biotechnological applications.

    Directory of Open Access Journals (Sweden)

    Alvaro Olivera-Nappa

    Full Text Available Pig trypsin is routinely used as a biotechnological tool, due to its high specificity and ability to be stored as an inactive stable zymogen. However, it is not an optimum enzyme for conditions found in wound debriding for medical uses and trypsinization processes for protein analysis and animal cell culturing, where low Ca(2+ dependency, high activity in mild conditions and easy inactivation are crucial. We isolated and thermodynamically characterized a highly active cold-adapted trypsin for medical and laboratory use that is four times more active than pig trypsin at 10(° C and at least 50% more active than pig trypsin up to 50(° C. Contrary to pig trypsin, this enzyme has a broad optimum pH between 7 and 10 and is very insensitive to Ca(2+ concentration. The enzyme is only distantly related to previously described cryophilic trypsins. We built and studied molecular structure models of this trypsin and performed molecular dynamic calculations. Key residues and structures associated with calcium dependency and cryophilicity were identified. Experiments indicated that the protein is unstable and susceptible to autoproteolysis. Correlating experimental results and structural predictions, we designed mutations to improve the resistance to autoproteolysis and conserve activity for longer periods after activation. One single mutation provided around 25 times more proteolytic stability. Due to its cryophilic nature, this trypsin is easily inactivated by mild denaturation conditions, which is ideal for controlled proteolysis processes without requiring inhibitors or dilution. We clearly show that cold adaptation, Ca(2+ dependency and autolytic stability in trypsins are related phenomena that are linked to shared structural features and evolve in a concerted fashion. Hence, both structurally and evolutionarily they cannot be interpreted and studied separately as previously done.

  6. Comparative Genome Analysis of Basidiomycete Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Morin, Emmanuelle; Nagy, Laszlo; Manning, Gerard; Baker, Scott; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Hibbett, David; Martin, Francis; Grigoriev, Igor

    2012-03-19

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, symbionts, and plant and animal pathogens. To better understand the diversity of phenotypes in basidiomycetes, we performed a comparative analysis of 35 basidiomycete fungi spanning the diversity of the phylum. Phylogenetic patterns of lignocellulose degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay. Patterns of secondary metabolic enzymes give additional insight into the broad array of phenotypes found in the basidiomycetes. We suggest that the profile of an organism in lignocellulose-targeting genes can be used to predict its nutritional mode, and predict Dacryopinax sp. as a brown rot; Botryobasidium botryosum and Jaapia argillacea as white rots.

  7. Ethylene regulation of carotenoid accumulation and carotenogenic gene expression in colour-contrasted apricot varieties (Prunus armeniaca).

    Science.gov (United States)

    Marty, I; Bureau, S; Sarkissian, G; Gouble, B; Audergon, J M; Albagnac, G

    2005-07-01

    In order to elucidate the regulation mechanisms of carotenoid biosynthesis in apricot fruit (Prunus armeniaca), carotenoid content and carotenogenic gene expression were analysed as a function of ethylene production in two colour-contrasted apricot varieties. Fruits from Goldrich (GO) were orange, while Moniqui (MO) fruits were white. Biochemical analysis showed that GO accumulated precursors of the uncoloured carotenoids, phytoene and phytofluene, and the coloured carotenoid, beta-carotene, while Moniqui (MO) fruits only accumulated phytoene and phytofluene but no beta-carotene. Physiological analysis showed that ethylene production was clearly weaker in GO than in MO. Carotenogenic gene expression (Psy-1, Pds, and Zds) and carotenoid accumulation were measured with respect to ethylene production which is initiated in mature green fruits at the onset of the climacteric stage or following exo-ethylene or ethylene-receptor inhibitor (1-MCP) treatments. Results showed (i) systematically stronger expression of carotenogenic genes in white than in orange fruits, even for the Zds gene involved in beta-carotene synthesis that is undetectable in MO fruits, (ii) ethylene-induction of Psy-1 and Pds gene expression and the corresponding product accumulation, (iii) Zds gene expression and beta-carotene production independent of ethylene. The different results obtained at physiological, biochemical, and molecular levels revealed the complex regulation of carotenoid biosynthesis in apricots and led to suggestions regarding some possible ways to regulate it.

  8. Potential of cold-adapted microorganisms for bioremediation of oil-polluted Alpine soils

    International Nuclear Information System (INIS)

    Margesin, R.

    2000-01-01

    The environmental contamination by organic pollutants is a widespread problem in all climates. The most widely distributed pollution can be attributed to oil contamination. Bioremediation methods can provide efficient, inexpensive and environmentally safe cleanup tools. The role of cold-adapted microorganisms for the bioremediation of experimentally and chronically oil-contaminated Alpine soils was evaluated in the studies described. The results demonstrated that there is a considerable potential for oil bioremediation in Alpine soils. Oil biodegradation can be significantly enhanced by biostimulation (inorganic nutrient supply), but a complete oil elimination is not possible by employing biological decontamination alone. (Author)

  9. Cold adaptation of the mononuclear molybdoenzyme periplasmic nitrate reductase from the Antarctic bacterium Shewanella gelidimarina

    International Nuclear Information System (INIS)

    Simpson, Philippa J.L.; Codd, Rachel

    2011-01-01

    Highlights: ► Cold-adapted phenotype of NapA from the Antarctic bacterium Shewanella gelidimarina. ► Protein homology model of NapA from S. gelidimarina and mesophilic homologue. ► Six amino acid residues identified as lead candidates governing NapA cold adaptation. ► Molecular-level understanding of designing cool-temperature in situ oxyanion sensors. -- Abstract: The reduction of nitrate to nitrite is catalysed in bacteria by periplasmic nitrate reductase (Nap) which describes a system of variable protein subunits encoded by the nap operon. Nitrate reduction occurs in the NapA subunit, which contains a bis-molybdopterin guanine dinucleotide (Mo–MGD) cofactor and one [4Fe–4S] iron–sulfur cluster. The activity of periplasmic nitrate reductase (Nap) isolated as native protein from the cold-adapted (psychrophilic) Antarctic bacterium Shewanella gelidimarina (Nap Sgel ) and middle-temperature adapted (mesophilic) Shewanella putrefaciens (Nap Sput ) was examined at varied temperature. Irreversible deactivation of Nap Sgel and Nap Sput occurred at 54.5 and 65 °C, respectively. When Nap Sgel was preincubated at 21–70 °C for 30 min, the room-temperature nitrate reductase activity was maximal and invariant between 21 and 54 °C, which suggested that Nap Sgel was poised for optimal catalysis at modest temperatures and, unlike Nap Sput , did not benefit from thermally-induced refolding. At 20 °C, Nap Sgel reduced selenate at 16% of the rate of nitrate reduction. Nap Sput did not reduce selenate. Sequence alignment showed 46 amino acid residue substitutions in Nap Sgel that were conserved in NapA from mesophilic Shewanella, Rhodobacter and Escherichia species and could be associated with the Nap Sgel cold-adapted phenotype. Protein homology modeling of Nap Sgel using a mesophilic template with 66% amino acid identity showed the majority of substitutions occurred at the protein surface distal to the Mo–MGD cofactor. Two mesophilic ↔ psychrophilic

  10. Uncovering Mechanisms for Repair and Protection in Cold Environments Through Studies of Cold Adapted Archaea

    Science.gov (United States)

    2009-12-18

    Cpn60) subunits is more abundant during growth at 4°C compared to 23°C. Consistent with this, cold shock studies in thermophilic archaea, and...helicases (Mbur_0245, Mbur_1950): These enzymes may be responsible for unwinding secondary structures in messenger RNA, and a role in cold adaptation in M...limiting step, it is unsurprising that these enzymes showed higher abundance at 4ºC. ParA protein (Mbur_2141): ParA ATPases are a ubiquitous

  11. An update on organohalogen metabolites produced by basidiomycetes

    NARCIS (Netherlands)

    Field, J.A.; Wijnberg, J.B.P.A.

    2003-01-01

    Basidiomycetes are an ecologically important group of higher fungi known for their widespread capacity to produce organohalogen metabolites. To date, 100 different organohalogen metabolites (mostly chlorinated) have been identified from strains in 70 genera of Basidiomycetes. This manuscript

  12. Novel Cold-Adapted Esterase MHlip from an Antarctic Soil Metagenome

    Directory of Open Access Journals (Sweden)

    Moreno Galleni

    2013-01-01

    Full Text Available An Antarctic soil metagenomic library was screened for lipolytic enzymes and allowed for the isolation of a new cytosolic esterase from the a/b hydrolase family 6, named MHlip. This enzyme is related to hypothetical genes coding esterases, aryl-esterases and peroxydases, among others. MHlip was produced, purified and its activity was determined. The substrate profile of MHlip reveals a high specificity for short p-nitrophenyl-esters. The apparent optimal activity of MHlip was measured for p-nitrophenyl-acetate, at 33 °C, in the pH range of 6–9. The MHlip thermal unfolding was investigated by spectrophotometric methods, highlighting a transition (Tm at 50 °C. The biochemical characterization of this enzyme showed its adaptation to cold temperatures, even when it did not present evident signatures associated with cold-adapted proteins. Thus, MHlip adaptation to cold probably results from many discrete structural modifications, allowing the protein to remain active at low temperatures. Functional metagenomics is a powerful approach to isolate new enzymes with tailored biophysical properties (e.g., cold adaptation. In addition, beside the ever growing amount of sequenced DNA, the functional characterization of new catalysts derived from environment is still required, especially for poorly characterized protein families like α/b hydrolases.

  13. Metabolic cold adaptation of polar fish based on measurements of aerobic oxygen consumption: fact or artefact? Artefact!

    DEFF Research Database (Denmark)

    Steffensen, John Fleng

    2002-01-01

    Whether metabolic cold adaptation in polar fish, based on measurements of aerobic standard metabolic rate, is a fact or an artefact has been a dispute since Holeton asked the question in 1974. So far polar fish had been considered to be metabolically cold adapted because they were reported to have...... a considerably elevated resting oxygen consumption, or standard metabolic rate, compared with oxygen consumption values of tropical or temperate fish extrapolated to similar low polar temperatures. Recent experiments on arctic and Antarctic fish, however, do not show elevated resting aerobic oxygen consumption...

  14. PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans.

    Directory of Open Access Journals (Sweden)

    Emma Svensk

    Full Text Available C. elegans PAQR-2 is homologous to the insulin-sensitizing adiponectin receptors in mammals, and essential for adaptation to growth at 15°C, a low but usually acceptable temperature for this organism. By screening for novel paqr-2 suppressors, we identified mutations in genes involved in phosphatidylcholine synthesis (cept-1, pcyt-1 and sams-1 and fatty acid metabolism (ech-7, hacd-1, mdt-15, nhr-49 and sbp-1. We then show genetic evidence that paqr-2, phosphatidylcholines, sbp-1 and Δ9-desaturases form a cold adaptation pathway that regulates the increase in unsaturated fatty acids necessary to retain membrane fluidity at low temperatures. This model is supported by the observations that the paqr-2 suppressors normalize the levels of saturated fatty acids, and that low concentrations of detergents that increase membrane fluidity can rescue the paqr-2 mutant.

  15. PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans.

    Science.gov (United States)

    Svensk, Emma; Ståhlman, Marcus; Andersson, Carl-Henrik; Johansson, Maja; Borén, Jan; Pilon, Marc

    2013-01-01

    C. elegans PAQR-2 is homologous to the insulin-sensitizing adiponectin receptors in mammals, and essential for adaptation to growth at 15°C, a low but usually acceptable temperature for this organism. By screening for novel paqr-2 suppressors, we identified mutations in genes involved in phosphatidylcholine synthesis (cept-1, pcyt-1 and sams-1) and fatty acid metabolism (ech-7, hacd-1, mdt-15, nhr-49 and sbp-1). We then show genetic evidence that paqr-2, phosphatidylcholines, sbp-1 and Δ9-desaturases form a cold adaptation pathway that regulates the increase in unsaturated fatty acids necessary to retain membrane fluidity at low temperatures. This model is supported by the observations that the paqr-2 suppressors normalize the levels of saturated fatty acids, and that low concentrations of detergents that increase membrane fluidity can rescue the paqr-2 mutant.

  16. Cold adaptation of the mononuclear molybdoenzyme periplasmic nitrate reductase from the Antarctic bacterium Shewanella gelidimarina

    Energy Technology Data Exchange (ETDEWEB)

    Simpson, Philippa J.L. [School of Chemistry, University of Sydney, New South Wales 2006 (Australia); Codd, Rachel, E-mail: rachel.codd@sydney.edu.au [School of Chemistry, University of Sydney, New South Wales 2006 (Australia); School of Medical Sciences (Pharmacology) and Bosch Institute, University of New South Wales, New South Wales 2006 (Australia)

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Cold-adapted phenotype of NapA from the Antarctic bacterium Shewanella gelidimarina. Black-Right-Pointing-Pointer Protein homology model of NapA from S. gelidimarina and mesophilic homologue. Black-Right-Pointing-Pointer Six amino acid residues identified as lead candidates governing NapA cold adaptation. Black-Right-Pointing-Pointer Molecular-level understanding of designing cool-temperature in situ oxyanion sensors. -- Abstract: The reduction of nitrate to nitrite is catalysed in bacteria by periplasmic nitrate reductase (Nap) which describes a system of variable protein subunits encoded by the nap operon. Nitrate reduction occurs in the NapA subunit, which contains a bis-molybdopterin guanine dinucleotide (Mo-MGD) cofactor and one [4Fe-4S] iron-sulfur cluster. The activity of periplasmic nitrate reductase (Nap) isolated as native protein from the cold-adapted (psychrophilic) Antarctic bacterium Shewanella gelidimarina (Nap{sub Sgel}) and middle-temperature adapted (mesophilic) Shewanella putrefaciens (Nap{sub Sput}) was examined at varied temperature. Irreversible deactivation of Nap{sub Sgel} and Nap{sub Sput} occurred at 54.5 and 65 Degree-Sign C, respectively. When Nap{sub Sgel} was preincubated at 21-70 Degree-Sign C for 30 min, the room-temperature nitrate reductase activity was maximal and invariant between 21 and 54 Degree-Sign C, which suggested that Nap{sub Sgel} was poised for optimal catalysis at modest temperatures and, unlike Nap{sub Sput}, did not benefit from thermally-induced refolding. At 20 Degree-Sign C, Nap{sub Sgel} reduced selenate at 16% of the rate of nitrate reduction. Nap{sub Sput} did not reduce selenate. Sequence alignment showed 46 amino acid residue substitutions in Nap{sub Sgel} that were conserved in NapA from mesophilic Shewanella, Rhodobacter and Escherichia species and could be associated with the Nap{sub Sgel} cold-adapted phenotype. Protein homology modeling of Nap{sub Sgel} using a

  17. Characterization of a cold-adapted esterase and mutants from a psychotolerant Pseudomonas sp. strain.

    Science.gov (United States)

    Dong, Juan; Gasmalla, Mohammed A A; Zhao, Wei; Sun, Jingtao; Liu, Wenyu; Wang, Mingming; Han, Liang; Yang, Ruijin

    2017-09-01

    A cold-adapted esterase-producing strain named T1-39 was isolated from Glacier No. 1, Tianshan, People's Republic of China and identified as Pseudomonas sp. from 16S rRNA sequence analysis. The esterase (EstT1-39) secreted by this strain preferentially hydrolyzed esters of glycerol with short- and medium-chain fatty acids. Mutants of T1-39 were generated by the atmospheric and room temperature plasma method and screened for enhanced esterase activity. Among all the mutants, strain TB11 had 4.45-fold higher esterase productivity than T1-39, with high genetic stability over 10 generations of continuous cultivation. Maximum activity of EstT1-39 and EstTB11 was observed at 30 ℃, pH 9.0 and 25 ℃, pH 8.5, respectively. EstTB11 was thermally more stable (50 ℃ for 1 H) and active over a broader pH range than EstT1-39. EstTB11 also retained 38% of its maximal activity at 0 ℃ and was found to be able to hydrolyze milk fats into short- and medium-chain fatty acids at 4 ℃. The characteristics of EstT1-39 made it a cold-adapted enzyme and the EstTB11 from the mutant, with its higher activity at lower temperatures, may be suitable for the production of aromas and flavors in the dairy industry. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

  18. A bacterial acyl aminoacyl peptidase couples flexibility and stability as a result of cold adaptation.

    Science.gov (United States)

    Brocca, Stefania; Ferrari, Cristian; Barbiroli, Alberto; Pesce, Alessandra; Lotti, Marina; Nardini, Marco

    2016-12-01

    Life in cold environments requires an overall increase in the flexibility of macromolecular and supramolecular structures to allow biological processes to take place at low temperature. Conformational flexibility supports high catalytic rates of enzymes in the cold but in several cases is also a cause of instability. The three-dimensional structure of the psychrophilic acyl aminoacyl peptidase from Sporosarcina psychrophila (SpAAP) reported in this paper highlights adaptive molecular changes resulting in a fine-tuned trade-off between flexibility and stability. In its functional form SpAAP is a dimer, and an increase in flexibility is achieved through loosening of intersubunit hydrophobic interactions. The release of subunits from the quaternary structure is hindered by an 'arm exchange' mechanism, in which a tiny structural element at the N terminus of one subunit inserts into the other subunit. Mutants lacking the 'arm' are monomeric, inactive and highly prone to aggregation. Another feature of SpAAP cold adaptation is the enlargement of the tunnel connecting the exterior of the protein with the active site. Such a wide channel might compensate for the reduced molecular motions occurring in the cold and allow easy and direct access of substrates to the catalytic site, rendering transient movements between domains unnecessary. Thus, cold-adapted SpAAP has developed a molecular strategy unique within this group of proteins: it is able to enhance the flexibility of each functional unit while still preserving sufficient stability. Structural data are available in the Protein Data Bank under the accession number 5L8S. © 2016 Federation of European Biochemical Societies.

  19. Correlation of polyunsaturated fatty acids with the cold adaptation of Rhodotorula glutinis.

    Science.gov (United States)

    He, Jing; Yang, Zhaojie; Hu, Binbin; Ji, Xiuling; Wei, Yunlin; Lin, Lianbing; Zhang, Qi

    2015-11-01

    This study aimed to investigate the correlation between the cold adaptation of Rhodotorula glutinis YM25079 and the membrane fluidity, content of polyunsaturated fatty acids and mRNA expression level of the Δ(12)-desaturase gene. The optimum temperature for YM25079 growth was analysed first, then the composition changes of membrane lipid in YM25079 were detected by GC-MS and membrane fluidity was evaluated by 1-anilinonaphthalene-8-sulphonate (ANS) fluorescence. Meanwhile, the encoding sequence of Δ(12)-fatty acid desaturase in YM25079 was cloned and further transformed into Saccharomyces cerevisiae INVScl for functional analysis. The mRNA expression levels of Δ(12)-fatty acid desaturase at 15°C and 25°C were analysed by real-time PCR. YM25079 could grow at 5-30°C, with the optimum temperature of 15°C. The membrane fluidity of YM25079 was not significantly reduced when the culture temperature decreased from 25°C to 15°C, but the content of polyunsaturated fatty acids (PUFAs), including linoleic acid and α-Linolenic acid increased significantly from 29.4% to 55.39%. Furthermore, a novel Δ(12)-fatty acid desaturase gene YM25079RGD12 from YM25079 was successfully identified and characterized, and the mRNA transcription level of the Δ(12)-desaturase gene was about five-fold higher in YM25079 cells grown at 15°C than that at 25°C. These results suggests that the cold adaptation of Rhodotorula glutinis YM25079 might result from higher expression of genes, especially the Δ(12)-fatty acid desaturase gene, during polyunsaturated fatty acids biosynthesis, which increased the content of PUFAs in the cell membrane and maintained the membrane fluidity at low temperature. Copyright © 2015 John Wiley & Sons, Ltd.

  20. Degradation of cellulose by basidiomycetous fungi

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Valášková, Vendula

    2008-01-01

    Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

  1. Comparative genome analysis of Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Henrissat, Bernard; Nagy, Laszlo; Brown, Daren; Held, Benjamin; Baker, Scott; Blanchette, Robert; Boussau, Bastien; Doty, Sharon L.; Fagnan, Kirsten; Floudas, Dimitris; Levasseur, Anthony; Manning, Gerard; Martin, Francis; Morin, Emmanuelle; Otillar, Robert; Pisabarro, Antonio; Walton, Jonathan; Wolfe, Ken; Hibbett, David; Grigoriev, Igor

    2013-08-07

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To better understand the genetic diversity of this phylum we compared the genomes of 35 basidiomycetes including 6 newly sequenced genomes. These genomes span extremes of genome size, gene number, and repeat content. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) found in only one organism. Correlations between lifestyle and certain gene families are evident. Phylogenetic patterns of plant biomass-degrading genes in Agaricomycotina suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. Based on phylogenetically-informed PCA analysis of wood decay genes, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has typical ligninolytic class II fungal peroxidases (PODs). This prediction is supported by growth assays in which both fungi exhibit wood decay with white rot-like characteristics. Based on this, we suggest that the white/brown rot dichotomy may be inadequate to describe the full range of wood decaying fungi. Analysis of the rate of discovery of proteins with no or few homologs suggests the value of continued sequencing of basidiomycete fungi.

  2. Evidence for propagation of cold-adapted yeast in an ice core from a Siberian Altai glacier

    Science.gov (United States)

    Uetake, Jun; Kohshima, Shiro; Nakazawa, Fumio; Takeuchi, Nozomu; Fujita, Koji; Miyake, Takayuki; Narita, Hideki; Aizen, Vladimir; Nakawo, Masayoshi

    2011-03-01

    Cold environments, including glacier ice and snow, are known habitats for cold-adapted microorganisms. We investigated the potential for cold-adapted yeast to have propagated in the snow of the high-altitude Belukha glacier. We detected the presence of highly concentrated yeast (over 104 cells mL-1) in samples of both an ice core and firn snow. Increasing yeast cell concentrations in the same snow layer from July 2002 to July 2003 suggests that the yeast cells propagated in the glacier snow. A cold-adapted Rhodotorula sp. was isolated from the snow layer and found to be related to psychrophilic yeast previously found in other glacial environments (based on the D1/D2 26S rRNA domains). 26S rRNA clonal analysis directly amplified from meltwater within the ice core also revealed the presence of genus Rhodotorula. Analyses of the ice core showed that all peaks in yeast concentration corresponded to the peaks in indices of surface melting. These results support the hypothesis that occasional surface melting in an accumulation area is one of the major factors influencing cold-adapted yeast propagation.

  3. Cloning, expression and structural stability of a cold-adapted ß-Galactosidase from Rahnella sp.R3

    Science.gov (United States)

    A novel gene was isolated for the first time from a psychrophilic gram-negative bacterium Rahnella sp.R3. It encoded a cold-adapted ß-galactosidase (R-ß-Gal). Recombinant R-ß-Gal was expressed in Escherichia coli BL21 (DE3), purified, and characterized. R-ß-Gal belongs to the glycosyl hydrolase fami...

  4. Purification and characterization of a cold-adapted lipase from Oceanobacillus strain PT-11.

    Directory of Open Access Journals (Sweden)

    Tian Jiewei

    Full Text Available We isolated a moderately halophilic lipase-producing bacterium from the saline soil. Based on the morphological, physiological, chemotaxonomic and phylogenetic analysis, the isolate PT-11 was postulated to be a novel species identified as Oceanobacillus rekensis PT-11. The lipase was purified 2.50-fold by Q-Sepharose FF and SP-Sepharose FF chromatography and its molecular mass was estimated to be 23.5 kDa by SDS-PAGE. It was highly active over the broad temperature ranging from 10 to 35°C and showed up to 80% of the maximum activity at 10°C indicating the lipase to be a typical cold-adapted enzyme. The enzyme activity was slightly enhanced by Na+, Li+ and K+. Incubation with detergents, such as Tween-20 and Tween-80, slightly inhibited the enzyme activity; while Triton X-100decreased the enzyme activity. The enzyme was fairly stable in the presence of long-chain alcohols but was highly denatured in hydrophilic solvents such as acetone or short-chain alcohols (C1-C3.

  5. Purification and characterization of cold-adapted beta-agarase from an Antarctic psychrophilic strain

    Directory of Open Access Journals (Sweden)

    Jiang Li

    2015-09-01

    Full Text Available An extracellular β-agarase was purified from Pseudoalteromonas sp. NJ21, a Psychrophilic agar-degrading bacterium isolated from Antarctic Prydz Bay sediments. The purified agarase (Aga21 revealed a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, with an apparent molecular weight of 80 kDa. The optimum pH and temperature of the agarase were 8.0 and 30 °C, respectively. However, it maintained as much as 85% of the maximum activities at 10 °C. Significant activation of the agarase was observed in the presence of Mg2+, Mn2+, K+; Ca2+, Na+, Ba2+, Zn2+, Cu2+, Co2+, Fe2+, Sr2+ and EDTA inhibited the enzyme activity. The enzymatic hydrolyzed product of agar was characterized as neoagarobiose. Furthermore, this work is the first evidence of cold-adapted agarase in Antarctic psychrophilic bacteria and these results indicate the potential for the Antarctic agarase as a catalyst in medicine, food and cosmetic industries.

  6. Nicosulfuron Biodegradation by a Novel Cold-Adapted Strain Oceanisphaera psychrotolerans LAM-WHM-ZC.

    Science.gov (United States)

    Zhou, Shan; Song, Jinlong; Dong, Weiwei; Mu, Yingchun; Zhang, Qi; Fan, Ziwen; Wang, Yanwei; Kong, Delong; Zhou, Yiqing; Jiang, Xu; Zhao, Bin; Han, Gang; Ruan, Zhiyong

    2017-11-29

    Nicosulfuron is a common environmental pollutant, posing a great threat to aquatic systems and causing significant damage to crops. This study reported a cold-adapted strain Oceanisphaera psychrotolerans LAM-WHM-ZC, which efficiently degrades nicosulfuron over a wide range of temperatures (5 to 40 °C). The Box-Behnken design method was used to optimize the degradation conditions. O. psychrotolerans LAM-WHM-ZC can degrade 92.4% and 74.6% of initially supplemented 100 mg/L nicosulfuron under the optimum and low temperature of 18.1 and 5 °C, respectively, within 7 days. O. psychrotolerans LAM-WHM-ZC was found to be highly efficient in degrading cinosulfuron, chlorsulfuron, rimsulfuron, bensulfuron methyl, and ethametsulfuron methyl. Metabolites from nicosulfuron degradation were identified by UPLC-MS, and a possible degradation pathway was proposed. Furthermore, O. psychrotolerans LAM-WHM-ZC can also degrade nicosulfuron in soil; 78.6% and 67.4% of the initial nicosulfuron supplemented at 50 mg/kg were removed at 18.1 and 5 °C, respectively, within 15 days.

  7. Genome-wide analysis of cold adaptation in indigenous Siberian populations.

    Directory of Open Access Journals (Sweden)

    Alexia Cardona

    Full Text Available Following the dispersal out of Africa, where hominins evolved in warm environments for millions of years, our species has colonised different climate zones of the world, including high latitudes and cold environments. The extent to which human habitation in (sub-Arctic regions has been enabled by cultural buffering, short-term acclimatization and genetic adaptations is not clearly understood. Present day indigenous populations of Siberia show a number of phenotypic features, such as increased basal metabolic rate, low serum lipid levels and increased blood pressure that have been attributed to adaptation to the extreme cold climate. In this study we introduce a dataset of 200 individuals from ten indigenous Siberian populations that were genotyped for 730,525 SNPs across the genome to identify genes and non-coding regions that have undergone unusually rapid allele frequency and long-range haplotype homozygosity change in the recent past. At least three distinct population clusters could be identified among the Siberians, each of which showed a number of unique signals of selection. A region on chromosome 11 (chr11:66-69 Mb contained the largest amount of clustering of significant signals and also the strongest signals in all the different selection tests performed. We present a list of candidate cold adaption genes that showed significant signals of positive selection with our strongest signals associated with genes involved in energy regulation and metabolism (CPT1A, LRP5, THADA and vascular smooth muscle contraction (PRKG1. By employing a new method that paints phased chromosome chunks by their ancestry we distinguish local Siberian-specific long-range haplotype signals from those introduced by admixture.

  8. Molecular determinants of enzyme cold adaptation: comparative structural and computational studies of cold- and warm-adapted enzymes.

    Science.gov (United States)

    Papaleo, Elena; Tiberti, Matteo; Invernizzi, Gaetano; Pasi, Marco; Ranzani, Valeria

    2011-11-01

    The identification of molecular mechanisms underlying enzyme cold adaptation is a hot-topic both for fundamental research and industrial applications. In the present contribution, we review the last decades of structural computational investigations on cold-adapted enzymes in comparison to their warm-adapted counterparts. Comparative sequence and structural studies allow the definition of a multitude of adaptation strategies. Different enzymes carried out diverse mechanisms to adapt to low temperatures, so that a general theory for enzyme cold adaptation cannot be formulated. However, some common features can be traced in dynamic and flexibility properties of these enzymes, as well as in their intra- and inter-molecular interaction networks. Interestingly, the current data suggest that a family-centered point of view is necessary in the comparative analyses of cold- and warm-adapted enzymes. In fact, enzymes belonging to the same family or superfamily, thus sharing at least the three-dimensional fold and common features of the functional sites, have evolved similar structural and dynamic patterns to overcome the detrimental effects of low temperatures.

  9. [Optimization of fermentation conditions for cold-adapted amylase production by Micrococcus antarcticus and its enzymatic properties].

    Science.gov (United States)

    Fan, Hong-xi; Liu, Ying; Liu, Zhi-pei

    2009-08-15

    By single factor experiments, the fermentation conditions for cold-adapted amylase production from Micrococcus antarcticus were determined as follows(medium g/L): Na2 HPO4 2.0, KH2PO4 1.0, MgSO4 x 7H2O 0.1, NaCl 5.0, (NH4)2SO4 2.5, maltose 5.0, trace element solution 5.0 mL, pH 8.0, 100 mL/Erlenmeyer flask (500 mL); cultivation was in a rotating shaker at 12 degrees C and 160 r/min for 64 h.Under those conditions,the highest total enzyme activity (2.6 U/mL) was obtained and increased by 10.8 fold compared with the original value of 0.24 U/mL before optimization. This amylase was purified by concentration with ultrafiltration membrane module, Hitrap Q anion exchange chromatography and Superdex 200 gel filtration chromatography. The optimal temperature and pH for the purified amylase were 30 degrees C and 6.0, respectively.It still showed high activity at low temperature 10-15 degrees C. It was sensitive to high temperature but was stable at pH 6.0-10.0 with at least 70% activity remained. These results indicated that it was a typical cold-adapted enzyme. The enzyme activity was stimulated by Ca2+, Mn2+, Co2+ and Mg2+; but inhibited by Zn2+, Ba2+, Ag+, Cu2+, Al3+, Fe2, Fe3+, Hg2+, EDTA and citrate. This cold-adapted amylase showed resistance to inactivation of 0.1% nonionic surfactants such as Tween 80, TrintonX-100, etc. Its Km was 0.90 mg/mL.

  10. Functional analysis of Steller’s sea cow (Hydrodamalis gigas) hemoglobin provides new insights to cold adaptation

    DEFF Research Database (Denmark)

    Signore, Anthony V.; Fago, Angela; Weber, Roy E.

    sensitivity that can maintain adequate O2 delivery at low temperatures. This phenotype has primarily been attributed to the binding of additional allosteric effectors to the Hb moiety relative to those of non-cold adapted species. However, we find that Hb from the extinct Steller’s sea cow binds fewer...... paenungulate Hbs (woolly mammoth, Asian elephant, Steller’s sea cow, dugong, ancestral dugongid, and Florida manatee) in the presence of serially increasing Cl- and 2,3-diphosphoglycerate (DPG) concentrations at both 25 and 37C. Quantitation of effector binding revealed that the number of oxygenation...

  11. SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Fedotov О. V.

    2014-02-01

    Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

  12. Differential expression of carotenogenic genes, associated changes on astaxanthin production and photosynthesis features induced by JA in H. pluvialis.

    Directory of Open Access Journals (Sweden)

    Zhengquan Gao

    Full Text Available Haematococcus pluvialis is an organism that under certain conditions can produce astaxanthin, an economically important carotenoid. In this study, the transcriptional expression patterns of eight carotenogenic genes of H. pluvialis in response to jasmonic acid (JA were evaluated using real-time PCR. Astaxanthin accumulation action and photosynthesis flourescence were monitored at the same time. The results showed all eight genes exhibited higher transcriptional expression significantly under JA treatments. JA25 (25 mg/L induction had greater effect (>10-fold up-regulation on the transcriptional expression of pds, crtR-B and lyc than on ipi-1, ipi-2, psy, bkt2, and crtO. JA50 (50 mg/L treatment had greater impact on the transcriptional expression of ipi-1, ipi-2, psy, crtR-B and crtO than on pds, lyc and bkt2. Astaxanthin biosynthesis in the presence of JA appeared to be up-regulated mainly by psy, pds, crtR-B, lyc, bkt2 and crtO at the transcriptional level and ipi-1, ipi-2 at both transcriptional and post-transcriptional levels. Under JA induction, the photosynthetic efficiency [Y (II] and the maximum quantum efficiency of PS II (Fv/Fm decreased significantly, but the non-photochemical quenching of chlorophyll fluorescence (NPQ increased drastically with the accumulation of astaxanthin.

  13. Production of β-ionone by combined expression of carotenogenic and plant CCD1 genes in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Lopez, Javiera; Essus, Karen; Kim, Il-Kwon

    2015-01-01

    cells. The additional integration of the carotenoid cleavage dioxygenase gene from the plant Petunia hybrida (PhCCD1) let to the production of low amounts of beta-ionone (0.073 ± 0.01 mg/g DCW) and changed the color of the strain from orange to yellow. The expression of the crtYB gene from a high copy......, the carotenogenic crtYB, crtI genes and the plant PhCCD1 gene-the highest β-ionone concentration reported to date by a cell factory was achieved. This microbial cell factory represents a starting point for flavor production by a sustainable and efficient process that could replace current methods.......Background: Apocarotenoids, like the C13-norisoprenoids, are natural compounds that contribute to the flavor and/or aroma of flowers and foods. They are produced in aromatic plants-like raspberries and roses-by the enzymatic cleavage of carotenes. Due to their pleasant aroma and flavour...

  14. The ability of a cold-adapted Rhodotorula mucilaginosa strain from Tibet to control blue mold in pear fruit.

    Science.gov (United States)

    Hu, Hao; Yan, Fujie; Wilson, Charles; Shen, Qing; Zheng, Xiaodong

    2015-12-01

    Cold-adapted yeasts were isolated from soil samples collected in Tibet and evaluated as potential biocontrol agents against blue mold (Penicillium expansum) of pear fruit in cold storage. YC1, an isolate identified as Rhodotorula mucilaginosa, was found to exhibit the greatest biocontrol activity among the different isolates that were screened. A washed cell suspension of YC1 exhibited the best biocontrol activity among three different preparations that were used in the current study. A concentration of 10(8) cells/ml reduced the incidence of decay to 35 %, compared to the control where decay incidence was 100 %. A higher intracellular level of trehalose and a higher proportion of polyunsaturated acids present in YC1, was associated with increased the tolerance of this strain to low temperatures, relative to the other strains that were evaluated. The increased tolerance to low temperature allowed the YC1 strain of yeast to more effectively compete for nutrients and space in wounded pear fruit that had been inoculated with spores of P. expansum and placed in cold storage. The present study demonstrated the ability to select cold-adapted yeasts from cold climates and use them as biocontrol agents of postharvest diseases of fruit placed in cold storage.

  15. Genomic, Transcriptomic, and Proteomic Analysis Provide Insights Into the Cold Adaptation Mechanism of the Obligate Psychrophilic Fungus Mrakia psychrophila

    Directory of Open Access Journals (Sweden)

    Yao Su

    2016-11-01

    Full Text Available Mrakia psychrophila is an obligate psychrophilic fungus. The cold adaptation mechanism of psychrophilic fungi remains unknown. Comparative genomics analysis indicated that M. psychrophila had a specific codon usage preference, especially for codons of Gly and Arg and its major facilitator superfamily (MFS transporter gene family was expanded. Transcriptomic analysis revealed that genes involved in ribosome and energy metabolism were upregulated at 4°, while genes involved in unfolded protein binding, protein processing in the endoplasmic reticulum, proteasome, spliceosome, and mRNA surveillance were upregulated at 20°. In addition, genes related to unfolded protein binding were alternatively spliced. Consistent with other psychrophiles, desaturase and glycerol 3-phosphate dehydrogenase, which are involved in biosynthesis of unsaturated fatty acid and glycerol respectively, were upregulated at 4°. Cold adaptation of M. psychrophila is mediated by synthesizing unsaturated fatty acids to maintain membrane fluidity and accumulating glycerol as a cryoprotectant. The proteomic analysis indicated that the correlations between the dynamic patterns between transcript level changes and protein level changes for some pathways were positive at 4°, but negative at 20°. The death of M. psychrophila above 20° might be caused by an unfolded protein response.

  16. Biocontrol activity of a cold-adapted yeast from Tibet against gray mold in cherry tomato and its action mechanism.

    Science.gov (United States)

    Hu, Hao; Wisniewski, Michael E; Abdelfattah, Ahmed; Zheng, Xiaodong

    2017-07-01

    Cold-adapted biocontrol yeast was selected from four yeast isolates from Tibet against gray mold of cherry tomato in cold storage. The strain numbered LB2 showed the best biocontrol activity and identified as Cryptococcus laurentii. Competition for nutrient, space, and induced fruit resistance was also its antagonistic mechanism. Compared with C. laurentii from sea-level place, the reason why LB2 had a better biocontrol activity was studied. More trehalose and proline in cell of LB2 made it exhibit a better cellular activity at low temperature, such as higher population dynamics in the wounds of cherry tomato and more biocontrol-related enzyme secretion, chitinase and β-glucanase. The better oxidative stress tolerance was another characteristic of LB2. Maybe because of the ideal culture condition, there was no obvious difference between these two yeasts in the growth in vitro test at low temperature. Although the same phenomenon existed in the low pH stress test, LB2 still had higher cell concentration under this stress. Comparative transcriptomics method was also applied to analyze the cell activity of LB2 and C. laurentii at different temperatures. The results showed that more active response in the intracellular structure and intracellular metabolic process to cold temperature made LB2 had a better activity. The present study indicated a possibility to select cold-adapted biocontrol yeast from Tibet and also showed its primary action mechanism.

  17. Molecular cloning, expression and biochemical characterisation of a cold-adapted novel recombinant chitinase from Glaciozyma antarctica PI12

    Directory of Open Access Journals (Sweden)

    Ramli Aizi

    2011-11-01

    Full Text Available Abstract Background Cold-adapted enzymes are proteins produced by psychrophilic organisms that display a high catalytic efficiency at extremely low temperatures. Chitin consists of the insoluble homopolysaccharide β-(1, 4-linked N-acetylglucosamine, which is the second most abundant biopolymer found in nature. Chitinases (EC 3.2.1.14 play an important role in chitin recycling in nature. Biodegradation of chitin by the action of cold-adapted chitinases offers significant advantages in industrial applications such as the treatment of chitin-rich waste at low temperatures, the biocontrol of phytopathogens in cold environments and the biocontrol of microbial spoilage of refrigerated food. Results A gene encoding a cold-adapted chitinase (CHI II from Glaciozyma antarctica PI12 was isolated using Rapid Amplification of cDNA Ends (RACE and RT-PCR techniques. The isolated gene was successfully expressed in the Pichia pastoris expression system. Analysis of the nucleotide sequence revealed the presence of an open reading frame of 1,215 bp, which encodes a 404 amino acid protein. The recombinant chitinase was secreted into the medium when induced with 1% methanol in BMMY medium at 25°C. The purified recombinant chitinase exhibited two bands, corresponding to the non-glycosylated and glycosylated proteins, by SDS-PAGE with molecular masses of approximately 39 and 50 kDa, respectively. The enzyme displayed an acidic pH characteristic with an optimum pH at 4.0 and an optimum temperature at 15°C. The enzyme was stable between pH 3.0-4.5 and was able to retain its activity from 5 to 25°C. The presence of K+, Mn2+ and Co2+ ions increased the enzyme activity up to 20%. Analysis of the insoluble substrates showed that the purified recombinant chitinase had a strong affinity towards colloidal chitin and little effect on glycol chitosan. CHI II recombinant chitinase exhibited higher Vmax and Kcat values toward colloidal chitin than other substrates at low

  18. New isocoumarins from a cold-adapted fungal strain mucor sp. and their developmental toxicity to zebrafish embryos.

    Science.gov (United States)

    Feng, Chun-Chi; Chen, Guo-Dong; Zhao, Yan-Qiu; Xin, Sheng-Chang; Li, Song; Tang, Jin-Shan; Li, Xiao-Xia; Hu, Dan; Liu, Xing-Zhong; Gao, Hao

    2014-07-01

    Three new isocoumarin derivatives, mucorisocoumarins A-C (1-3, resp.), together with seven known compounds, 4-10, were isolated from the cold-adapted fungal strain Mucor sp. (No. XJ07027-5). The structures of the new compounds were identified by detailed IR, MS, and 1D- and 2D-NMR analyses. It was noteworthy that compounds 1, 2, 4, and 5 were successfully resolved by chiral HPLC, indicating that 1-7 should exist as enantiomers. In an embryonic developmental toxicity assay using a zebrafish model, compound 3 produced developmental abnormalities in the zebrafish embryos. This is the first report of isocoumarins with developmental toxicity to zebrafish embryos. Copyright © 2014 Verlag Helvetica Chimica Acta AG, Zürich.

  19. Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

    International Nuclear Information System (INIS)

    Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

    2005-01-01

    Monoclinic (P2 1 ) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2 1 , with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit

  20. Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

    Energy Technology Data Exchange (ETDEWEB)

    Riise, Ellen Kristin [The Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø (Norway); Lorentzen, Marit Sjo [Department of Molecular Biotechnology, Institute of Medical Biology, Faculty of Medicine, University of Tromsø, N-9037 Tromsø (Norway); Helland, Ronny [The Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø (Norway); Willassen, Nils Peder, E-mail: nilspw@fagmed.uit.no [The Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø (Norway); Department of Molecular Biotechnology, Institute of Medical Biology, Faculty of Medicine, University of Tromsø, N-9037 Tromsø (Norway)

    2006-01-01

    Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.

  1. Both brown adipose tissue and skeletal muscle thermogenesis processes are activated during mild to severe cold adaptation in mice.

    Science.gov (United States)

    Bal, Naresh C; Singh, Sushant; Reis, Felipe C G; Maurya, Santosh K; Pani, Sunil; Rowland, Leslie A; Periasamy, Muthu

    2017-10-06

    Thermogenesis is an important homeostatic mechanism essential for survival and normal physiological functions in mammals. Both brown adipose tissue (BAT) ( i.e. uncoupling protein 1 (UCP1)-based) and skeletal muscle ( i.e. sarcolipin (SLN)-based) thermogenesis processes play important roles in temperature homeostasis, but their relative contributions differ from small to large mammals. In this study, we investigated the functional interplay between skeletal muscle- and BAT-based thermogenesis under mild versus severe cold adaptation by employing UCP1 -/- and SLN -/- mice. Interestingly, adaptation of SLN -/- mice to mild cold conditions (16 °C) significantly increased UCP1 expression, suggesting increased reliance on BAT-based thermogenesis. This was also evident from structural alterations in BAT morphology, including mitochondrial architecture, increased expression of electron transport chain proteins, and depletion of fat droplets. Similarly, UCP1 -/- mice adapted to mild cold up-regulated muscle-based thermogenesis, indicated by increases in muscle succinate dehydrogenase activity, SLN expression, mitochondrial content, and neovascularization, compared with WT mice. These results further confirm that SLN-based thermogenesis is a key player in muscle non-shivering thermogenesis (NST) and can compensate for loss of BAT activity. We also present evidence that the increased reliance on BAT-based NST depends on increased autonomic input, as indicated by abundant levels of tyrosine hydroxylase and neuropeptide Y. Our findings demonstrate that both BAT and muscle-based NST are equally recruited during mild and severe cold adaptation and that loss of heat production from one thermogenic pathway leads to increased recruitment of the other, indicating a functional interplay between these two thermogenic processes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Development of an Agrobacterium-mediated transformation system for the cold-adapted fungi Pseudogymnoascus destructans and P. pannorum.

    Science.gov (United States)

    Zhang, Tao; Ren, Ping; Chaturvedi, Vishnu; Chaturvedi, Sudha

    2015-08-01

    The mechanisms of cold adaptation by fungi remain unknown. This topic is of high interest due to the emergence of white-nose syndrome (WNS), a skin infection of hibernating bats caused by Pseudogymnoascus destructans (Pd). Recent studies indicated that apart from Pd, there is an abundance of other Pseudogymnoascus species in the hibernacula soil. We developed an Agrobacterium tumefaciens-mediated transformation (ATMT) system for Pd and a related fungus Pseudogymnoascus pannorum (Pp) to advance experimental studies. URE1 gene encoding the enzyme urease was used as an easy to screen marker to facilitate molecular genetic analyses. A Uracil-Specific Excision Reagent (USER) Friendly pRF-HU2 vector containing Pd or Pp ure1::hygromycin (HYG) disruption cassette was introduced into A. tumefaciens AGL-1 cells by electroporation and the resulting strains were co-cultivated with conidia of Pd or Pp for various durations and temperatures to optimize the ATMT system. Overall, 680 Pd (0.006%) and 1800 Pp (0.018%) transformants were obtained from plating of 10(7) conidia; their recoveries were strongly correlated with the length of the incubation period (96h for Pd; 72h for Pp) and with temperature (15-18°C for Pd; 25°C for Pp). The homologous recombination in transformants was 3.1% for Pd and 16.7% for Pp. The availability of a standardized ATMT system would allow future molecular genetic analyses of Pd and related cold-adapted fungi. Copyright © 2015. Published by Elsevier Inc.

  3. Preservation of live cultures of basidiomycetes - recent methods.

    Science.gov (United States)

    Homolka, Ladislav

    2014-02-01

    Basidiomycetes are used in industrial processes, in basic or applied research, teaching, systematic and biodiversity studies. Efficient work with basidiomycete cultures requires their reliable source, which is ensured by their safe long-term storage. Repeated subculturing, frequently used for the preservation, is time-consuming, prone to contamination, and does not prevent genetic and physiological changes during long-term maintenance. Various storage methods have been developed in order to eliminate these disadvantages. Besides lyophilization (unsuitable for the majority of basidiomycetes), cryopreservation at low temperatures seems to be a very efficient way to attain this goal. Besides survival, another requirement for successful maintenance of fungal strains is the ability to preserve their features unchanged. An ideal method has not been created so far. Therefore it is highly desirable to develop new or improve the current preservation methods, combining advantages and eliminate disadvantages of individual techniques. Many reviews on preservation of microorganisms including basidiomycetes have been published, but the progress in the field requires an update. Although herbaria specimens of fungi (and of basidiomycetes in particular) are very important for taxonomic and especially typological studies, this review is limited to live fungal cultures. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  4. ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

    Directory of Open Access Journals (Sweden)

    N. P.

    2016-02-01

    Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

  5. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

    2011-03-14

    Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

  6. Diversity and evolution of ABC proteins in basidiomycetes.

    Science.gov (United States)

    Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

    2013-01-01

    ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

  7. Molecular dynamics of mesophilic-like mutants of a cold-adapted enzyme: insights into distal effects induced by the mutations.

    Directory of Open Access Journals (Sweden)

    Elena Papaleo

    Full Text Available Networks and clusters of intramolecular interactions, as well as their "communication" across the three-dimensional architecture have a prominent role in determining protein stability and function. Special attention has been dedicated to their role in thermal adaptation. In the present contribution, seven previously experimentally characterized mutants of a cold-adapted α-amylase, featuring mesophilic-like behavior, have been investigated by multiple molecular dynamics simulations, essential dynamics and analyses of correlated motions and electrostatic interactions. Our data elucidate the molecular mechanisms underlying the ability of single and multiple mutations to globally modulate dynamic properties of the cold-adapted α-amylase, including both local and complex unpredictable distal effects. Our investigation also shows, in agreement with the experimental data, that the conversion of the cold-adapted enzyme in a warm-adapted variant cannot be completely achieved by the introduction of few mutations, also providing the rationale behind these effects. Moreover, pivotal residues, which are likely to mediate the effects induced by the mutations, have been identified from our analyses, as well as a group of suitable candidates for protein engineering. In fact, a subset of residues here identified (as an isoleucine, or networks of mesophilic-like salt bridges in the proximity of the catalytic site should be considered, in experimental studies, to get a more efficient modification of the features of the cold-adapted enzyme.

  8. Cold-adapted live attenuated influenza vaccines developed in Russia: Can they contribute to meeting the needs for influenza control in other countries?

    International Nuclear Information System (INIS)

    Kendal, Alan P.

    1997-01-01

    It is now more than 30 years since the first cold-adapted influenza viruses were developed in Russia as potential live, attenuated vaccines. In the past 15-20 years considerable experience has been gained from Russian and joint Russian-US laboratory and clinical studies with type A monovalent and bivalent vaccines prepared with genetic reassortant viruses derived from one of these cold-adapted viruses in particular, A/Leningrad/134/57. More recent experiences include use of trivalent cold-adapted vaccines with a type B component. The overall high level of safety of individual and combined vaccines in pre-school and school-aged children, with illness reductions in open field trials equivalent to that seen with inactivated vaccines, is such as to suggest that practical measures might now be justified to facilitate expansion of the use of these vaccines to other countries. It is proposed that further experimentation with the Russian cold-adapted live attenuated vaccines should be focused on issues that will relate to the public health perspective, i.e. selection of the single best candidate type A and B vaccines for intense study using as criteria their potential for meeting licensing requirements outside Russia, and documenting the clinical protective efficacy of a single vaccine dose compared to two doses as studied until now. Resolution of these issues is important to ensure that costs for future live vaccine production, control, and utilization will be kept at lowest levels so that expanded use of live vaccines will have maximum cost-benefit and affordability. To guide those interested in these issues, examples are given of populations for whom a licensed live cold-adapted vaccine might be considered, together with indications of extra data needed to fully validate each suggested use

  9. Occurrence of indoor wood decay basidiomycetes in Europe

    Czech Academy of Sciences Publication Activity Database

    Gabriel, Jiří; Švec, Karel

    2017-01-01

    Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

  10. Bacterial communities in the fruit bodies of ground basidiomycetes

    Science.gov (United States)

    Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

    2015-06-01

    Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

  11. An exceptionally cold-adapted alpha-amylase from a metagenomic library of a cold and alkaline environment

    DEFF Research Database (Denmark)

    Vester, Jan Kjølhede; Glaring, Mikkel Andreas; Stougaard, Peter

    2015-01-01

    A cold-active α-amylase, AmyI3C6, identified by a functional metagenomics approach was expressed in Escherichia coli and purified to homogeneity. Sequence analysis showed that the AmyI3C6 amylase was similar to α-amylases from the class Clostridia and revealed classical characteristics of cold......-adapted enzymes, as did comparison of the kinetic parameters Km and kcat to a mesophilic α-amylase. AmyI3C6 was shown to be heat-labile. Temperature optimum was at 10-15 °C, and more than 70 % of the relative activity was retained at 1 °C. The pH optimum of AmyI3C6 was at pH 8-9, and the enzyme displayed activity...... in two commercial detergents tested, suggesting that the AmyI3C6 α-amylase may be useful as a detergent enzyme in environmentally friendly, low-temperature laundry processes....

  12. Engineered disulfide bonds increase active-site local stability and reduce catalytic activity of a cold-adapted alkaline phosphatase.

    Science.gov (United States)

    Asgeirsson, Bjarni; Adalbjörnsson, Björn Vidar; Gylfason, Gudjón Andri

    2007-06-01

    Alkaline phosphatase is an extracellular enzyme that is membrane-bound in eukaryotes but resides in the periplasmic space of bacteria. It normally carries four cysteine residues that form two disulfide bonds, for instance in the APs of Escherichia coli and vertebrates. An AP variant from a Vibrio sp. has only one cysteine residue. This cysteine is second next to the nucleophilic serine in the active site. We have individually modified seven residues to cysteine that are on two loops predicted to be within a 5 A radius. Four of them formed a disulfide bond to the endogenous cysteine. Thermal stability was monitored by circular dichroism and activity measurements. Global stability was similar to the wild-type enzyme. However, a significant increase in heat-stability was observed for the disulfide-containing variants using activity as a measure, together with a large reduction in catalytic rates (k(cat)) and a general decrease in Km values. The results suggest that a high degree of mobility near the active site and in the helix carrying the endogenous cysteine is essential for full catalytic efficiency in the cold-adapted AP.

  13. Cold adaptation and replicable microbial community development during long-term low-temperature anaerobic digestion treatment of synthetic sewage.

    Science.gov (United States)

    Keating, C; Hughes, D; Mahony, T; Cysneiros, D; Ijaz, U Z; Smith, C J; O'Flaherty, V

    2018-07-01

    The development and activity of a cold-adapting microbial community was monitored during low-temperature anaerobic digestion (LtAD) treatment of wastewater. Two replicate hybrid anaerobic sludge bed-fixed-film reactors treated a synthetic sewage wastewater at 12°C, at organic loading rates of 0.25-1.0 kg chemical oxygen demand (COD) m-3 d-1, over 889 days. The inoculum was obtained from a full-scale anaerobic digestion reactor, which was operated at 37°C. Both LtAD reactors readily degraded the influent with COD removal efficiencies regularly exceeding 78% for both the total and soluble COD fractions. The biomass from both reactors was sampled temporally and tested for activity against hydrolytic and methanogenic substrates at 12°C and 37°C. Data indicated that significantly enhanced low-temperature hydrolytic and methanogenic activity developed in both systems. For example, the hydrolysis rate constant (k) at 12°C had increased 20-30-fold by comparison to the inoculum by day 500. Substrate affinity also increased for hydrolytic substrates at low temperature. Next generation sequencing demonstrated that a shift in a community structure occurred over the trial, involving a 1-log-fold change in 25 SEQS (OTU-free approach) from the inoculum. Microbial community structure changes and process performance were replicable in the LtAD reactors.

  14. A cold-adapted endoglucanase from camel rumen with high catalytic activity at moderate and low temperatures: an anomaly of truly cold-adapted evolution in a mesophilic environment.

    Science.gov (United States)

    Khalili Ghadikolaei, Kamran; Gharechahi, Javad; Haghbeen, Kamahldin; Akbari Noghabi, Kambiz; Hosseini Salekdeh, Ghasem; Shahbani Zahiri, Hossein

    2018-03-01

    Endoglucanases are important enzymes in plant biomass degradation. They have current and potential applications in various industrial sectors including human and animal food processing, textile, paper, and renewable biofuel production. It is assumed that the cold-active endoglucanases, with high catalytic rates in moderate and cold temperatures, can improve the cost-effectiveness of industrial processes by lowering the need for heating and, thus, energy consumption. In this study, the endoglucanase CelCM3 was procured from a camel rumen metagenome via gene cloning and expression in Escherichia coli BL21 (DE3). The maximum activity of the enzyme on carboxymethyl cellulose (CMC) was obtained at pH 5 and 30 °C with a V max and K m of 339 U/mg and 2.57 mg/ml, respectively. The enzyme with an estimated low melting temperature of 45 °C and about 50% activity at 4 °C was identified to be cold-adapted. A thermodynamic analysis corroborated that CelCM3 with an activation energy (E a ), enthalpy of activation (ΔH), and Gibb's free energy (ΔG) of, respectively, 18.47 kJ mol -1 , 16.12 kJ mol -1 , and 56.09 kJ mol -1 is a cold-active endoglucanase. In addition, CelCM3 was tolerant of metal ions, non-ionic detergents, urea, and organic solvents. Given these interesting characteristics, CelCM3 shows promise to meet the requirements of industrial applications.

  15. Exploring the Antarctic soil metagenome as a source of novel cold-adapted enzymes and genetic mobile elements

    Directory of Open Access Journals (Sweden)

    Renaud Berlemont

    2011-06-01

    Full Text Available Metagenomic library PP1 was obtained from Antarctic soil samples. Both functional and genotypic metagenomic screening were used for the isolation of novel cold-adapted enzymes with potential applications, and for the detection of genetic elements associated with gene mobilization, respectively. Fourteen lipase/esterase-, 14 amylase-, 3 protease-, and 11 cellulase-producing clones were detected by activity-driven screening, with apparent maximum activities around 35 °C for both amylolytic and lipolytic enzymes, and 35-55 °C for cellulases, as observed for other cold-adapted enzymes. However, the behavior of at least one of the studied cellulases is more compatible to that observed for mesophilic enzymes. These enzymes are usually still active at temperatures above 60 °C, probably resulting in a psychrotolerant behavior in Antarctic soils. Metagenomics allows to access novel genes encoding for enzymatic and biophysic properties from almost every environment with potential benefits for biotechnological and industrial applications. Only intI- and tnp-like genes were detected by PCR, encoding for proteins with 58-86 %, and 58-73 % amino acid identity with known entries, respectively. Two clones, BAC 27A-9 and BAC 14A-5, seem to present unique syntenic organizations, suggesting the occurrence of gene rearrangements that were probably due to evolutionary divergences within the genus or facilitated by the association with transposable elements. The evidence for genetic elements related to recruitment and mobilization of genes (transposons/integrons in an extreme environment like Antarctica reinforces the hypothesis of the origin of some of the genes disseminated by mobile elements among "human-associated" microorganisms.A partir de muestras de suelo antártico se obtuvo la metagenoteca PP1. Esta fue sometida a análisis funcionales y genotípicos para el aislamiento de nuevas enzimas adaptadas al frío con potenciales aplicaciones, y para la detecci

  16. The Genome Sequence of the psychrophilic archaeon, Methanococcoides burtonii: the Role of Genome Evolution in Cold-adaptation

    Energy Technology Data Exchange (ETDEWEB)

    Allen, Michelle A.; Lauro, Federico M.; Williams, Timothy J.; Burg, Dominic; Siddiqui, Khawar S.; De Francisci, David; Chong, Kevin W.Y.; Pilak, Oliver; Chew, Hwee H.; De Maere, Matthew Z.; Ting, Lily; Katrib, Marilyn; Ng, Charmaine; Sowers, Kevin R.; Galperin, Michael Y.; Anderson, Iain J.; Ivanova, Natalia; Dalin, Eileen; Martinez, Michelle; Lapidus, Alla; Hauser, Loren; Land, Miriam; Thomas, Torsten; Cavicchioli, Ricardo

    2009-04-01

    Psychrophilic archaea are abundant and perform critical roles throughout the Earth's expansive cold biosphere. Here we report the first complete genome sequence for a psychrophilic methanogenic archaeon, Methanococcoides burtonii. The genome sequence was manually annotated including the use of a five tiered Evidence Rating system that ranked annotations from Evidence Rating (ER) 1 (gene product experimentally characterized from the parent organism) to ER5 (hypothetical gene product) to provide a rapid means of assessing the certainty of gene function predictions. The genome is characterized by a higher level of aberrant sequence composition (51%) than any other archaeon. In comparison to hyper/thermophilic archaea which are subject to selection of synonymous codon usage, M. burtonii has evolved cold adaptation through a genomic capacity to accommodate highly skewed amino acid content, while retaining codon usage in common with its mesophilic Methanosarcina cousins. Polysaccharide biosynthesis genes comprise at least 3.3% of protein coding genes in the genome, and Cell wall/membrane/envelope biogenesis COG genes are over-represented. Likewise, signal transduction (COG category T) genes are over-represented and M. burtonii has a high 'IQ' (a measure of adaptive potential) compared to many methanogens. Numerous genes in these two over-represented COG categories appear to have been acquired from {var_epsilon}- and {delta}-proteobacteria, as do specific genes involved in central metabolism such as a novel B form of aconitase. Transposases also distinguish M. burtonii from other archaea, and their genomic characteristics indicate they play an important role in evolving the M. burtonii genome. Our study reveals a capacity for this model psychrophile to evolve through genome plasticity (including nucleotide skew, horizontal gene transfer and transposase activity) that enables adaptation to the cold, and to the biological and physical changes that have

  17. In vivo assessment of cold adaptation in insect larvae by magnetic resonance imaging and magnetic resonance spectroscopy.

    Directory of Open Access Journals (Sweden)

    Daniel Mietchen

    Full Text Available Temperatures below the freezing point of water and the ensuing ice crystal formation pose serious challenges to cell structure and function. Consequently, species living in seasonally cold environments have evolved a multitude of strategies to reorganize their cellular architecture and metabolism, and the underlying mechanisms are crucial to our understanding of life. In multicellular organisms, and poikilotherm animals in particular, our knowledge about these processes is almost exclusively due to invasive studies, thereby limiting the range of conclusions that can be drawn about intact living systems.Given that non-destructive techniques like (1H Magnetic Resonance (MR imaging and spectroscopy have proven useful for in vivo investigations of a wide range of biological systems, we aimed at evaluating their potential to observe cold adaptations in living insect larvae. Specifically, we chose two cold-hardy insect species that frequently serve as cryobiological model systems--the freeze-avoiding gall moth Epiblema scudderiana and the freeze-tolerant gall fly Eurosta solidaginis.In vivo MR images were acquired from autumn-collected larvae at temperatures between 0 degrees C and about -70 degrees C and at spatial resolutions down to 27 microm. These images revealed three-dimensional (3D larval anatomy at a level of detail currently not in reach of other in vivo techniques. Furthermore, they allowed visualization of the 3D distribution of the remaining liquid water and of the endogenous cryoprotectants at subzero temperatures, and temperature-weighted images of these distributions could be derived. Finally, individual fat body cells and their nuclei could be identified in intact frozen Eurosta larvae.These findings suggest that high resolution MR techniques provide for interesting methodological options in comparative cryobiological investigations, especially in vivo.

  18. Comparative genomics of the marine bacterial genus Glaciecola reveals the high degree of genomic diversity and genomic characteristic for cold adaptation.

    Science.gov (United States)

    Qin, Qi-Long; Xie, Bin-Bin; Yu, Yong; Shu, Yan-Li; Rong, Jin-Cheng; Zhang, Yan-Jiao; Zhao, Dian-Li; Chen, Xiu-Lan; Zhang, Xi-Ying; Chen, Bo; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2014-06-01

    To what extent the genomes of different species belonging to one genus can be diverse and the relationship between genomic differentiation and environmental factor remain unclear for oceanic bacteria. With many new bacterial genera and species being isolated from marine environments, this question warrants attention. In this study, we sequenced all the type strains of the published species of Glaciecola, a recently defined cold-adapted genus with species from diverse marine locations, to study the genomic diversity and cold-adaptation strategy in this genus.The genome size diverged widely from 3.08 to 5.96 Mb, which can be explained by massive gene gain and loss events. Horizontal gene transfer and new gene emergence contributed substantially to the genome size expansion. The genus Glaciecola had an open pan-genome. Comparative genomic research indicated that species of the genus Glaciecola had high diversity in genome size, gene content and genetic relatedness. This may be prevalent in marine bacterial genera considering the dynamic and complex environments of the ocean. Species of Glaciecola had some common genomic features related to cold adaptation, which enable them to thrive and play a role in biogeochemical cycle in the cold marine environments.

  19. Oligomerization as a strategy for cold adaptation: Structure and dynamics of the GH1 β-glucosidase from Exiguobacterium antarcticum B7

    Science.gov (United States)

    Zanphorlin, Leticia Maria; de Giuseppe, Priscila Oliveira; Honorato, Rodrigo Vargas; Tonoli, Celisa Caldana Costa; Fattori, Juliana; Crespim, Elaine; de Oliveira, Paulo Sergio Lopes; Ruller, Roberto; Murakami, Mario Tyago

    2016-03-01

    Psychrophilic enzymes evolved from a plethora of structural scaffolds via multiple molecular pathways. Elucidating their adaptive strategies is instrumental to understand how life can thrive in cold ecosystems and to tailor enzymes for biotechnological applications at low temperatures. In this work, we used X-ray crystallography, in solution studies and molecular dynamics simulations to reveal the structural basis for cold adaptation of the GH1 β-glucosidase from Exiguobacterium antarcticum B7. We discovered that the selective pressure of low temperatures favored mutations that redesigned the protein surface, reduced the number of salt bridges, exposed more hydrophobic regions to the solvent and gave rise to a tetrameric arrangement not found in mesophilic and thermophilic homologues. As a result, some solvent-exposed regions became more flexible in the cold-adapted tetramer, likely contributing to enhance enzymatic activity at cold environments. The tetramer stabilizes the native conformation of the enzyme, leading to a 10-fold higher activity compared to the disassembled monomers. According to phylogenetic analysis, diverse adaptive strategies to cold environments emerged in the GH1 family, being tetramerization an alternative, not a rule. These findings reveal a novel strategy for enzyme cold adaptation and provide a framework for the semi-rational engineering of β-glucosidases aiming at cold industrial processes.

  20. Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

    Science.gov (United States)

    Johnson, Eric A

    2013-09-01

    Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

  1. DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

    OpenAIRE

    B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

    2014-01-01

    ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need...

  2. Basidiomycete fungal communities in Australian sclerophyll forest soil are altered by repeated prescribed burning.

    Science.gov (United States)

    Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G

    2007-04-01

    Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.

  3. Cloning, expression and characterization of a cold-adapted endo-1, 4-β-glucanase from Citrobacter farmeri A1, a symbiotic bacterium of Reticulitermes labralis

    Directory of Open Access Journals (Sweden)

    Xi Bai

    2016-11-01

    Full Text Available Background Many biotechnological and industrial applications can benefit from cold-adapted EglCs through increased efficiency of catalytic processes at low temperature. In our previous study, Citrobacter farmeri A1 which was isolated from a wood-inhabiting termite Reticulitermes labralis could secrete a cold-adapted EglC. However, its EglC was difficult to purify for enzymatic properties detection because of its low activity (0.8 U/ml. The objective of the present study was to clone and express the C. farmeri EglC gene in Escherichia coli to improve production level and determine the enzymatic properties of the recombinant enzyme. Methods The EglC gene was cloned from C. farmeri A1 by thermal asymmetric interlaced PCR. EglC was transformed into vector pET22b and functionally expressed in E. coli. The recombination protein EglC22b was purified for properties detection. Results SDS-PAGE revealed that the molecular mass of the recombinant endoglucanase was approximately 42 kDa. The activity of the E. coli pET22b-EglC crude extract was 9.5 U/ml. Additionally, it was active at pH 6.5–8.0 with an optimum pH of 7.0. The recombinant enzyme had an optimal temperature of 30–40 °C and exhibited >50% relative activity even at 5 °C, whereas it lost approximately 90% of its activity after incubation at 60 °C for 30 min. Its activity was enhanced by Co2+ and Fe3+, but inhibited by Cd2+, Zn2+, Li+, Triton X-100, DMSO, acetonitrile, Tween 80, SDS, and EDTA. Conclusion These biochemical properties indicate that the recombinant enzyme is a cold-adapted endoglucanase that can be used for various industrial applications.

  4. Functional analysis of multiple carotenogenic genes from Lycium barbarum and Gentiana lutea L. for their effects on beta-carotene production in transgenic tobacco.

    Science.gov (United States)

    Ji, Jing; Wang, Gang; Wang, Jiehua; Wang, Ping

    2009-02-01

    Carotenoids are red, yellow and orange pigments, which are widely distributed in nature and are especially abundant in yellow-orange fruits and vegetables and dark green leafy vegetables. Carotenoids are essential for photosynthesis and photoprotection in plant life and also have different beneficial effects in humans and animals (van den Berg et al. 2000). For example, beta-carotene plays an essential role as the main dietary source of vitamin A. To obtain further insight into beta-carotene biosynthesis in two important economic plant species, Lycium barbarum and Gentiana lutea L., and to investigate and prioritize potential genetic engineering targets in the pathway, the effects of five carotenogenic genes from these two species, encoding proteins including geranylgeranyl diphosphate synthase, phytoene synthase and delta-carotene desaturase gene, lycopene beta-cyclase, lycopene epsilon-cyclase were functionally analyzed in transgenic tobacco (Nicotiana tabacum) plants. All transgenic tobacco plants constitutively expressing these genes showed enhanced beta-carotene contents in their leaves and flowers to different extents. The addictive effects of co-ordinate expression of double transgenes have also been investigated.

  5. Citric acid production from partly deproteinized whey under non-sterile culture conditions using immobilized cells of lactose-positive and cold-adapted Yarrowia lipolytica B9.

    Science.gov (United States)

    Arslan, Nazli Pinar; Aydogan, Mehmet Nuri; Taskin, Mesut

    2016-08-10

    The present study was performed to produce citric acid (CA) from partly deproteinized cheese whey (DPCW) under non-sterile culture conditions using immobilized cells of the cold-adapted and lactose-positive yeast Yarrowia lipolytica B9. DPCW was prepared using the temperature treatment of 90°C for 15min. Sodium alginate was used as entrapping agent for cell immobilization. Optimum conditions for the maximum CA production (33.3g/L) in non-sterile DPCW medium were the temperature of 20°C, pH 5.5, additional lactose concentration of 20g/L, sodium alginate concentration of 2%, number of 150 beads/100mL and incubation time of 120h. Similarly, maximum citric acid/isocitric acid (CA/ICA) ratio (6.79) could be reached under these optimal conditions. Additional nitrogen and phosphorus sources decreased CA concentration and CA/ICA ratio. Immobilized cells were reused in three continuous reaction cycles without any loss in the maximum CA concentration. The unique combination of low pH and temperature values as well as cell immobilization procedure could prevent undesired microbial contaminants during CA production. This is the first work on CA production by cold-adapted microorganisms under non-sterile culture conditions. Besides, CA production using a lactose-positive strain of the yeast Y. lipolytica was investigated for the first time in the present study. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Cloning and characterization of a new cold-adapted and thermo-tolerant ι-carrageenase from marine bacterium Flavobacterium sp. YS-80-122.

    Science.gov (United States)

    Li, Shangyong; Hao, Jianhua; Sun, Mi

    2017-09-01

    ι-Carrageenases play a role in marine ι-carrageenan degradation, and their enzymatic hydrolysates are thought to be excellent antioxidants. In this study, we identified a new ι-carrageenase, encoded by cgiF, in psychrophilic bacterium Flavobacterium sp. YS-80-122. The deduced ι-carrageenase, CgiF, belongs to glycoside hydrolase family 82 and shows less than 40% amino acid identity with characterized ι-carrageenases. The activity of recombinant CgiF peaked at 30°C (1,207.8U/mg). Notably, CgiF is a cold-adapted ι-carrageenase, which showed 36.5% and 57% of the maximum activity at 10°C and 15°C, respectively. In addition, it is a thermo-tolerant enzyme that recovered 58.2% of its initial activity after heat shock. Furthermore, although the activity of CgiF was enhanced by NaCl, the enzyme is active in absence of NaCl. This study also shows that CgiF is an endo-type ι-carrageenase that hydrolyzes β-1,4-linkages of ι-carrageenan, yielding neo-ι-carratetraose as the main product. Its cold-adaptation, thermo-tolerance, NaCl independence and high neo-ι-carratetraose yield make CgiF an excellent candidate for industrial applications in production of ι-carrageen oligosaccharides from seaweed polysaccharides. Copyright © 2017. Published by Elsevier B.V.

  7. Functional annotation of the mesophilic-like character of mutants in a cold-adapted enzyme by self-organising map analysis of their molecular dynamics.

    Science.gov (United States)

    Fraccalvieri, Domenico; Tiberti, Matteo; Pandini, Alessandro; Bonati, Laura; Papaleo, Elena

    2012-10-01

    Multiple comparison of the Molecular Dynamics (MD) trajectories of mutants in a cold-adapted α-amylase (AHA) could be used to elucidate functional features required to restore mesophilic-like activity. Unfortunately it is challenging to identify the different dynamic behaviors and correctly relate them to functional activity by routine analysis. We here employed a previously developed and robust two-stage approach that combines Self-Organising Maps (SOMs) and hierarchical clustering to compare conformational ensembles of proteins. Moreover, we designed a novel strategy to identify the specific mutations that more efficiently convert the dynamic signature of the psychrophilic enzyme (AHA) to that of the mesophilic counterpart (PPA). The SOM trained on AHA and its variants was used to classify a PPA MD ensemble and successfully highlighted the relationships between the flexibilities of the target enzyme and of the different mutants. Moreover the local features of the mutants that mostly influence their global flexibility in a mesophilic-like direction were detected. It turns out that mutations of the cold-adapted enzyme to hydrophobic and aromatic residues are the most effective in restoring the PPA dynamic features and could guide the design of more mesophilic-like mutants. In conclusion, our strategy can efficiently extract specific dynamic signatures related to function from multiple comparisons of MD conformational ensembles. Therefore, it can be a promising tool for protein engineering.

  8. Analysis of basidiomycete pigments in situ by Raman spectroscopy.

    Science.gov (United States)

    Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

    2018-02-07

    Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Rational Engineering of a Cold-Adapted α-Amylase from the Antarctic Ciliate Euplotes focardii for Simultaneous Improvement of Thermostability and Catalytic Activity.

    Science.gov (United States)

    Yang, Guang; Yao, Hua; Mozzicafreddo, Matteo; Ballarini, Patrizia; Pucciarelli, Sandra; Miceli, Cristina

    2017-07-01

    The α-amylases are endo-acting enzymes that hydrolyze starch by randomly cleaving the 1,4-α-d-glucosidic linkages between the adjacent glucose units in a linear amylose chain. They have significant advantages in a wide range of applications, particularly in the food industry. The eukaryotic α-amylase isolated from the Antarctic ciliated protozoon Euplotes focardii ( Ef Amy) is an alkaline enzyme, different from most of the α-amylases characterized so far. Furthermore, Ef Amy has the characteristics of a psychrophilic α-amylase, such as the highest hydrolytic activity at a low temperature and high thermolability, which is the major drawback of cold-active enzymes in industrial applications. In this work, we applied site-directed mutagenesis combined with rational design to generate a cold-active Ef Amy with improved thermostability and catalytic efficiency at low temperatures. We engineered two Ef Amy mutants. In one mutant, we introduced Pro residues on the A and B domains in surface loops. In the second mutant, we changed Val residues to Thr close to the catalytic site. The aim of these substitutions was to rigidify the molecular structure of the enzyme. Furthermore, we also analyzed mutants containing these combined substitutions. Biochemical enzymatic assays of engineered versions of Ef Amy revealed that the combination of mutations at the surface loops increased the thermostability and catalytic efficiency of the enzyme. The possible mechanisms responsible for the changes in the biochemical properties are discussed by analyzing the three-dimensional structural model. IMPORTANCE Cold-adapted enzymes have high specific activity at low and moderate temperatures, a property that can be extremely useful in various applications as it implies a reduction in energy consumption during the catalyzed reaction. However, the concurrent high thermolability of cold-adapted enzymes often limits their applications in industrial processes. The α-amylase from the

  10. Gene cloning and characterization of a cold-adapted β-glucosidase belonging to glycosyl hydrolase family 1 from a psychrotolerant bacterium Micrococcus antarcticus.

    Science.gov (United States)

    Fan, Hong-Xia; Miao, Li-Li; Liu, Ying; Liu, Hong-Can; Liu, Zhi-Pei

    2011-06-10

    The gene bglU encoding a cold-adapted β-glucosidase (BglU) was cloned from Micrococcus antarcticus. Sequence analysis revealed that the bglU contained an open reading frame of 1419 bp and encoded a protein of 472 amino acid residues. Based on its putative catalytic domains, BglU was classified as a member of the glycosyl hydrolase family 1 (GH1). BglU possessed lower arginine content and Arg/(Arg+Lys) ratio than mesophilic GH1 β-glucosidases. Recombinant BglU was purified with Ni2+ affinity chromatography and subjected to enzymatic characterization. SDS-PAGE and native staining showed that it was a monomeric protein with an apparent molecular mass of 48 kDa. BglU was particularly thermolabile since its half-life time was only 30 min at 30°C and it exhibited maximal activity at 25°C and pH 6.5. Recombinant BglU could hydrolyze a wide range of aryl-β-glucosides and β-linked oligosaccharides with highest activity towards cellobiose and then p-nitrophenyl-β-d-glucopyranoside (pNPG). Under the optimal conditions with pNPG as substrate, the K(m) and k(cat) were 7 mmol/L and 7.85 × 103/s, respectively. This is the first report of cloning and characterization of a cold-adapted β-glucosidase belonging to GH1 from a psychrotolerant bacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.

    Science.gov (United States)

    Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C

    2008-07-01

    The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.

  12. BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES

    Directory of Open Access Journals (Sweden)

    Tiberius BALAEŞ

    2015-12-01

    Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

  13. DNA quantification of basidiomycetous fungi during storage of logging residues

    Directory of Open Access Journals (Sweden)

    Isabella Børja

    2015-04-01

    Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

  14. Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

    Science.gov (United States)

    Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

    2014-01-01

    Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

  15. Characteristics of mutants designed to incorporate a new ion pair into the structure of a cold adapted subtilisin-like serine proteinase.

    Science.gov (United States)

    Sigurdardóttir, Anna Gudný; Arnórsdóttir, Jóhanna; Thorbjarnardóttir, Sigrídur H; Eggertsson, Gudmundur; Suhre, Karsten; Kristjánsson, Magnús M

    2009-03-01

    Structural comparisons of VPR, a subtilisin-like serine proteinase from a psychrotrophic Vibrio species and a thermophilic homologue, aqualysin I, have led us to hypothesize about the roles of different residues in the temperature adaptation of the enzymes. Some of these hypotheses are now being examined by analysis of mutants of the enzymes. The selected substitutions are believed to increase the stability of the cold adapted enzyme based on structural analysis of the thermostable structure. We report here on mutants, which were designed to incorporate an ion pair into the structure of VPR. The residues Asp17 and Arg259 are assumed to form an ion pair in aqualysin I. The cold adapted VPR contains Asn (Asn15) and Lys (Lys257) at corresponding sites in its structure. In VPR, Asn 15 is located on a surface loop with its side group pointing towards the side chain of Lys257. By substituting Asn15 by Asp (N15D) it was considered feasible that a salt bridge would form between the oppositely charged groups. To mimic further the putative salt bridge from the thermophile enzyme the corresponding double mutant (N15D/K257R) was also produced. The N15D mutation increased the thermal stability of VPR by approximately 3 degrees C, both in T(50%) and T(m). Addition of the K257R mutation did not however, increase the stability of the double mutant any further. Despite this stabilization of the VPR mutants the catalytic activity (k(cat)) against the substrate Suc-AAPF-NH-Np was increased in the mutants. Molecular dynamics simulations on wild type and the two mutant proteins suggested that indeed a salt bridge was formed in both cases. Furthermore, a truncated form of the N15D mutant (N15DDeltaC) was produced, lacking a 15 residue long C-terminal extended sequence not present in the thermophilic enzyme. In wild type VPR this supposedly moveable, negatively charged arm on the protein molecule might interfere with the new salt bridge introduced as a result of the N15D mutation

  16. Cold-Adapted Viral Attenuation (CAVA): Highly Temperature Sensitive Polioviruses as Novel Vaccine Strains for a Next Generation Inactivated Poliovirus Vaccine.

    Science.gov (United States)

    Sanders, Barbara P; de Los Rios Oakes, Isabel; van Hoek, Vladimir; Bockstal, Viki; Kamphuis, Tobias; Uil, Taco G; Song, Yutong; Cooper, Gillian; Crawt, Laura E; Martín, Javier; Zahn, Roland; Lewis, John; Wimmer, Eckard; Custers, Jerome H H V; Schuitemaker, Hanneke; Cello, Jeronimo; Edo-Matas, Diana

    2016-03-01

    The poliovirus vaccine field is moving towards novel vaccination strategies. Withdrawal of the Oral Poliovirus Vaccine and implementation of the conventional Inactivated Poliovirus Vaccine (cIPV) is imminent. Moreover, replacement of the virulent poliovirus strains currently used for cIPV with attenuated strains is preferred. We generated Cold-Adapted Viral Attenuation (CAVA) poliovirus strains by serial passage at low temperature and subsequent genetic engineering, which contain the capsid sequences of cIPV strains combined with a set of mutations identified during cold-adaptation. These viruses displayed a highly temperature sensitive phenotype with no signs of productive infection at 37°C as visualized by electron microscopy. Furthermore, decreases in infectious titers, viral RNA, and protein levels were measured during infection at 37°C, suggesting a block in the viral replication cycle at RNA replication, protein translation, or earlier. However, at 30°C, they could be propagated to high titers (9.4-9.9 Log10TCID50/ml) on the PER.C6 cell culture platform. We identified 14 mutations in the IRES and non-structural regions, which in combination induced the temperature sensitive phenotype, also when transferred to the genomes of other wild-type and attenuated polioviruses. The temperature sensitivity translated to complete absence of neurovirulence in CD155 transgenic mice. Attenuation was also confirmed after extended in vitro passage at small scale using conditions (MOI, cell density, temperature) anticipated for vaccine production. The inability of CAVA strains to replicate at 37°C makes reversion to a neurovirulent phenotype in vivo highly unlikely, therefore, these strains can be considered safe for the manufacture of IPV. The CAVA strains were immunogenic in the Wistar rat potency model for cIPV, inducing high neutralizing antibody titers in a dose-dependent manner in response to D-antigen doses used for cIPV. In combination with the highly productive

  17. Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

    2013-03-11

    Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

  18. [The structure of micromycete communities and their synecologic interactions with basidiomycetes during decomposition of plant debris].

    Science.gov (United States)

    Terekhova, V A; Semenova, T A

    2005-01-01

    We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.

  19. Safety, immunogencity, and efficacy of a cold-adapted A/Ann Arbor/6/60 (H2N2) vaccine in mice and ferrets

    International Nuclear Information System (INIS)

    Chen, Grace L.; Lamirande, Elaine W.; Jin Hong; Kemble, George; Subbarao, Kanta

    2010-01-01

    We studied the attenuation, immunogenicity and efficacy of the cold-adapted A/Ann Arbor/6/60 (AA ca) (H2N2) virus in mice and ferrets to evaluate its use in the event of an H2 influenza pandemic. The AA ca virus was restricted in replication in the respiratory tract of mice and ferrets. In mice, 2 doses of vaccine elicited a > 4-fold rise in hemagglutination-inhibition (HAI) titer and resulted in complete inhibition of viral replication following lethal homologous wild-type virus challenge. In ferrets, a single dose of the vaccine elicited a > 4-fold rise in HAI titer and conferred complete protection against homologous wild-type virus challenge in the upper respiratory tract. In both mice and ferrets, the AA ca virus provided significant protection from challenge with heterologous H2 virus challenge in the respiratory tract. The AA ca vaccine is safe, immunogenic, and efficacious against homologous and heterologous challenge in mice and ferrets, supporting the evaluation of this vaccine in clinical trials.

  20. Long-distance dispersal or postglacial contraction? Insights into disjunction between Himalaya-Hengduan Mountains and Taiwan in a cold-adapted herbaceous genus, Triplostegia.

    Science.gov (United States)

    Niu, Yan-Ting; Ye, Jian-Fei; Zhang, Jin-Long; Wan, Ji-Zhong; Yang, Tuo; Wei, Xiao-Xin; Lu, Li-Min; Li, Jian-Hua; Chen, Zhi-Duan

    2018-01-01

    Current disjunct patterns can result from long-distance dispersal or postglacial contraction. We herein investigate the evolutionary history of Triplostegia to elucidate the disjunction between the Himalaya-Hengduan Mountain region (HHM) and Taiwan (TW). Genetic structure of Triplostegia was investigated for 48 populations using sequences from five chloroplast loci and the ribosomal nuclear internal transcribed spacer. Divergence time estimation, ancestral area reconstruction, and species distribution modeling (SDM) were employed to examine the biogeographic history of Triplostegia . Substantial genetic differentiation among populations from southwestern China (SW), Central China (CC), and TW was detected. Triplostegia was inferred to have originated in SW, and diversification began during the late Miocene; CC was colonized in the mid-Pliocene, and TW was finally colonized in the early Pleistocene. SDM suggested an expansion of climatically suitable areas during the Last Glacial Maximum and range contraction during the Last interglacial in Triplostegia . Disjunction between HHM and TW in Triplostegia is most likely the consequence of topographic isolation and postglacial contraction. The potential climatic suitability areas for Triplostegia by 2070s (2061-2080) are predicted to slightly shrink and move northward. With continued global warming and human-induced deforestation, extinction risk may increase for the cold-adapted species, and appropriate strategies should be employed for ecosystem conservation.

  1. Range shifts or extinction? Ancient DNA and distribution modelling reveal past and future responses to climate warming in cold-adapted birds.

    Science.gov (United States)

    Lagerholm, Vendela K; Sandoval-Castellanos, Edson; Vaniscotte, Amélie; Potapova, Olga R; Tomek, Teresa; Bochenski, Zbigniew M; Shepherd, Paul; Barton, Nick; Van Dyck, Marie-Claire; Miller, Rebecca; Höglund, Jacob; Yoccoz, Nigel G; Dalén, Love; Stewart, John R

    2017-04-01

    Global warming is predicted to cause substantial habitat rearrangements, with the most severe effects expected to occur in high-latitude biomes. However, one major uncertainty is whether species will be able to shift their ranges to keep pace with climate-driven environmental changes. Many recent studies on mammals have shown that past range contractions have been associated with local extinctions rather than survival by habitat tracking. Here, we have used an interdisciplinary approach that combines ancient DNA techniques, coalescent simulations and species distribution modelling, to investigate how two common cold-adapted bird species, willow and rock ptarmigan (Lagopus lagopus and Lagopus muta), respond to long-term climate warming. Contrary to previous findings in mammals, we demonstrate a genetic continuity in Europe over the last 20 millennia. Results from back-casted species distribution models suggest that this continuity may have been facilitated by uninterrupted habitat availability and potentially also the greater dispersal ability of birds. However, our predictions show that in the near future, some isolated regions will have little suitable habitat left, implying a future decrease in local populations at a scale unprecedented since the last glacial maximum. © 2016 John Wiley & Sons Ltd.

  2. A live attenuated cold-adapted influenza A H7N3 virus vaccine provides protection against homologous and heterologous H7 viruses in mice and ferrets

    International Nuclear Information System (INIS)

    Joseph, Tomy; McAuliffe, Josephine; Lu, Bin; Vogel, Leatrice; Swayne, David; Jin, Hong; Kemble, George; Subbarao, Kanta

    2008-01-01

    The appearance of human infections caused by avian influenza A H7 subtype viruses underscores their pandemic potential and the need to develop vaccines to protect humans from viruses of this subtype. A live attenuated H7N3 virus vaccine was generated by reverse genetics using the HA and NA genes of a low pathogenicity A/chicken/BC/CN-6/04 (H7N3) virus and the six internal protein genes of the cold-adapted A/Ann Arbor/6/60 ca (H2N2) virus. The reassortant H7N3 BC 04 ca vaccine virus was temperature sensitive and showed attenuation in mice and ferrets. Intranasal immunization with one dose of the vaccine protected mice and ferrets when challenged with homologous and heterologous H7 viruses. The reassortant H7N3 BC 04 ca vaccine virus showed comparable levels of attenuation, immunogenicity and efficacy in mice and ferret models. The safety, immunogenicity, and efficacy of this vaccine in mice and ferrets support the evaluation of this vaccine in clinical trials

  3. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

    Science.gov (United States)

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

  4. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

    2014-01-01

    Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

  5. ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

    Directory of Open Access Journals (Sweden)

    А. Бухало

    2011-02-01

    Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

  6. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

    Science.gov (United States)

    Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

    2013-12-01

    Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  7. Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

    Directory of Open Access Journals (Sweden)

    R.L. Arakaki

    2013-12-01

    Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

  8. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

    Directory of Open Access Journals (Sweden)

    Chaika A. V.

    2013-12-01

    Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

  10. Pan-Influenza A Protection by Prime-Boost Vaccination with Cold-Adapted Live-Attenuated Influenza Vaccine in a Mouse Model.

    Science.gov (United States)

    Jang, Yo Han; Kim, Joo Young; Byun, Young Ho; Son, Ahyun; Lee, Jeong-Yoon; Lee, Yoon Jae; Chang, Jun; Seong, Baik Lin

    2018-01-01

    Influenza virus infections continually pose a major public health threat with seasonal epidemics and sporadic pandemics worldwide. While currently licensed influenza vaccines provide only strain-specific protection, antigenic drift and shift occasionally render the viruses resistant to the host immune responses, which highlight the need for a vaccine that provides broad protection against multiple subtypes. In this study, we suggest a vaccination strategy using cold-adapted, live attenuated influenza vaccines (CAIVs) to provide a broad, potent, and safe cross-protection covering antigenically distinct hemagglutinin (HA) groups 1 and 2 influenza viruses. Using a mouse model, we tested different prime-boost combinations of CAIVs for their ability to induce humoral and T-cell responses, and protective efficacy against H1 and H5 (HA group 1) as well as H3 and H7 (HA group 2) influenza viruses. Notably, even in the absence of antibody-mediated neutralizing activity or HA inhibitory activity in vitro , CAIVs provided a potent protection against heterologous and heterosubtypic lethal challenges in vivo . Heterologous combination of prime (H1)-boost (H5) vaccine strains showed the most potent cross-protection efficacy. In vivo depletion experiments demonstrated not only that T cells and natural killer cells contributed to the cross-protection, but also the involvement of antibody-dependent mechanisms for the cross-protection. Vaccination-induced antibodies did not enhance the infectivity of heterologous viruses, and prime vaccination did not interfere with neutralizing antibody generation by the boost vaccination, allaying vaccine safety concerns associated with heterogeneity between the vaccines and challenge strains. Our data show that CAIV-based strategy can serve as a simple but powerful option for developing a "truly" universal influenza vaccine providing pan-influenza A protection, which has not been achieved yet by other vaccine strategies. The promising results

  11. Pan-Influenza A Protection by Prime–Boost Vaccination with Cold-Adapted Live-Attenuated Influenza Vaccine in a Mouse Model

    Science.gov (United States)

    Jang, Yo Han; Kim, Joo Young; Byun, Young Ho; Son, Ahyun; Lee, Jeong-Yoon; Lee, Yoon Jae; Chang, Jun; Seong, Baik Lin

    2018-01-01

    Influenza virus infections continually pose a major public health threat with seasonal epidemics and sporadic pandemics worldwide. While currently licensed influenza vaccines provide only strain-specific protection, antigenic drift and shift occasionally render the viruses resistant to the host immune responses, which highlight the need for a vaccine that provides broad protection against multiple subtypes. In this study, we suggest a vaccination strategy using cold-adapted, live attenuated influenza vaccines (CAIVs) to provide a broad, potent, and safe cross-protection covering antigenically distinct hemagglutinin (HA) groups 1 and 2 influenza viruses. Using a mouse model, we tested different prime–boost combinations of CAIVs for their ability to induce humoral and T-cell responses, and protective efficacy against H1 and H5 (HA group 1) as well as H3 and H7 (HA group 2) influenza viruses. Notably, even in the absence of antibody-mediated neutralizing activity or HA inhibitory activity in vitro, CAIVs provided a potent protection against heterologous and heterosubtypic lethal challenges in vivo. Heterologous combination of prime (H1)–boost (H5) vaccine strains showed the most potent cross-protection efficacy. In vivo depletion experiments demonstrated not only that T cells and natural killer cells contributed to the cross-protection, but also the involvement of antibody-dependent mechanisms for the cross-protection. Vaccination-induced antibodies did not enhance the infectivity of heterologous viruses, and prime vaccination did not interfere with neutralizing antibody generation by the boost vaccination, allaying vaccine safety concerns associated with heterogeneity between the vaccines and challenge strains. Our data show that CAIV-based strategy can serve as a simple but powerful option for developing a “truly” universal influenza vaccine providing pan-influenza A protection, which has not been achieved yet by other vaccine strategies. The promising

  12. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  13. Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

    Science.gov (United States)

    Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

    2004-01-01

    Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

  14. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  15. Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

    Science.gov (United States)

    Chiaki Hori; Daniel Cullen

    2016-01-01

    Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

  16. Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

    2011-01-01

    Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

  17. Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

    Directory of Open Access Journals (Sweden)

    Masahiko Isaka

    2016-08-01

    Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

  18. Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

    2015-01-01

    Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

  19. Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands.

    Science.gov (United States)

    Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

    2015-02-01

    Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

  20. Nitrogen availability alters macrofungal basidiomycete Blackwell Publishing, Ltd. community structure in optimally fertilized loblolly pine forests

    Science.gov (United States)

    Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco

    2004-01-01

    We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...

  1. Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

    CSIR Research Space (South Africa)

    Wolfaardt, F

    2004-10-01

    Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

  2. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens

  3. Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

    Science.gov (United States)

    Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R

    2017-01-01

    The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

  4. Cold-Adapted Influenza and Recombinant Adenovirus Vaccines Induce Cross-Protective Immunity against pH1N1 Challenge in Mice

    Science.gov (United States)

    Soboleski, Mark R.; Gabbard, Jon D.; Price, Graeme E.; Misplon, Julia A.; Lo, Chia-Yun; Perez, Daniel R.; Ye, Jianqiang; Tompkins, S. Mark; Epstein, Suzanne L.

    2011-01-01

    Background The rapid spread of the 2009 H1N1 pandemic influenza virus (pH1N1) highlighted problems associated with relying on strain-matched vaccines. A lengthy process of strain identification, manufacture, and testing is required for current strain-matched vaccines and delays vaccine availability. Vaccines inducing immunity to conserved viral proteins could be manufactured and tested in advance and provide cross-protection against novel influenza viruses until strain-matched vaccines became available. Here we test two prototype vaccines for cross-protection against the recent pandemic virus. Methodology/Principal Findings BALB/c and C57BL/6 mice were intranasally immunized with a single dose of cold-adapted (ca) influenza viruses from 1977 or recombinant adenoviruses (rAd) expressing 1934 nucleoprotein (NP) and consensus matrix 2 (M2) (NP+M2-rAd). Antibodies against the M2 ectodomain (M2e) were seen in NP+M2-rAd immunized BALB/c but not C57BL/6 mice, and cross-reacted with pH1N1 M2e. The ca-immunized mice did not develop antibodies against M2e. Despite sequence differences between vaccine and challenge virus NP and M2e epitopes, extensive cross-reactivity of lung T cells with pH1N1 peptides was detected following immunization. Both ca and NP+M2-rAd immunization protected BALB/c and C57BL/6 mice against challenge with a mouse-adapted pH1N1 virus. Conclusion/Significance Cross-protective vaccines such as NP+M2-rAd and ca virus are effective against pH1N1 challenge within 3 weeks of immunization. Protection was not dependent on recognition of the highly variable external viral proteins and could be achieved with a single vaccine dose. The rAd vaccine was superior to the ca vaccine by certain measures, justifying continued investigation of this experimental vaccine even though ca vaccine is already available. This study highlights the potential for cross-protective vaccines as a public health option early in an influenza pandemic. PMID:21789196

  5. Cold-adapted influenza and recombinant adenovirus vaccines induce cross-protective immunity against pH1N1 challenge in mice.

    Directory of Open Access Journals (Sweden)

    Mark R Soboleski

    Full Text Available The rapid spread of the 2009 H1N1 pandemic influenza virus (pH1N1 highlighted problems associated with relying on strain-matched vaccines. A lengthy process of strain identification, manufacture, and testing is required for current strain-matched vaccines and delays vaccine availability. Vaccines inducing immunity to conserved viral proteins could be manufactured and tested in advance and provide cross-protection against novel influenza viruses until strain-matched vaccines became available. Here we test two prototype vaccines for cross-protection against the recent pandemic virus.BALB/c and C57BL/6 mice were intranasally immunized with a single dose of cold-adapted (ca influenza viruses from 1977 or recombinant adenoviruses (rAd expressing 1934 nucleoprotein (NP and consensus matrix 2 (M2 (NP+M2-rAd. Antibodies against the M2 ectodomain (M2e were seen in NP+M2-rAd immunized BALB/c but not C57BL/6 mice, and cross-reacted with pH1N1 M2e. The ca-immunized mice did not develop antibodies against M2e. Despite sequence differences between vaccine and challenge virus NP and M2e epitopes, extensive cross-reactivity of lung T cells with pH1N1 peptides was detected following immunization. Both ca and NP+M2-rAd immunization protected BALB/c and C57BL/6 mice against challenge with a mouse-adapted pH1N1 virus.Cross-protective vaccines such as NP+M2-rAd and ca virus are effective against pH1N1 challenge within 3 weeks of immunization. Protection was not dependent on recognition of the highly variable external viral proteins and could be achieved with a single vaccine dose. The rAd vaccine was superior to the ca vaccine by certain measures, justifying continued investigation of this experimental vaccine even though ca vaccine is already available. This study highlights the potential for cross-protective vaccines as a public health option early in an influenza pandemic.

  6. A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.

    Science.gov (United States)

    Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk

    2017-08-25

    The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the

  7. [Phylogenetic diversity and cold-adaptive hydrolytic enzymes of culturable psychrophilic bacteria associated with sea ice from high latitude ocean, Artic].

    Science.gov (United States)

    Yu, Yong; Li, Hui-Rong; Chen, Bo; Zeng, Yin-Xin; He, Jian-Feng

    2006-04-01

    showing 100% similarity each other are retrieved from the database, eleven from Antarctic seawater bacteria, three from Antarctic sea-ice bacteria, one from Spitzbergen sea-ice bacteria, two from Chukchi Sea sea-ice bacteria, two from Canadian Basin sea-ice bacteria (in this study) and one from uncultured bacterium clone PDA-OTU11 associated with the coral Pocillopora damicornis from the Great Barrier Reef. These may indicate that the physiological and geographic barriers appear to be permeable and some bacterial species can survive in different environment. The majority of the bacterial strains are able to secrete diversity cold-adaptive hydrolytic enzymes into the medium at 4 degrees C. The isolates that are able to degrade Tween-80, glutin, and starch account for, respectively, 62.6%, 51.4% and 40.5%.

  8. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

    International Nuclear Information System (INIS)

    Bayles, C.J.; Aist, J.R.; Berns, M.W.

    1993-01-01

    Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

  9. Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum

    International Nuclear Information System (INIS)

    Takimoto, K.

    1980-01-01

    The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)

  10. Isolation and characterization of microsatellite loci from the ectomycorrhizal basidiomycete Suillus luteus

    OpenAIRE

    Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan

    2006-01-01

    Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.

  11. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    OpenAIRE

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

    2005-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

  12. Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

    Science.gov (United States)

    Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

    2011-01-01

    When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

  13. Purification, characterisation and expression in Saccharomyces cerevisiae of LipG7 an enantioselective, cold-adapted lipase from the Antarctic filamentous fungus Geomyces sp. P7 with unusual thermostability characteristics.

    Science.gov (United States)

    Florczak, Tomasz; Daroch, Maurycy; Wilkinson, Mark Charles; Białkowska, Aneta; Bates, Andrew Derek; Turkiewicz, Marianna; Iwanejko, Lesley Ann

    2013-06-10

    A lipase, LipG7, has been purified from the Antarctic filamentous fungus Geomyces sp. P7 which was found to be cold-adapted and able to retain/regain its activity after heat denaturation. The LipG7 exhibits 100% residual activity following 1h incubation at 100°C whilst simultaneously showing kinetic adaptations to cold temperatures. LipG7 was also found to have industrial potential as an enantioselective biocatalyst as it is able to effectively catalyse the enantioselective transesterification of a secondary alcohol. The LipG7 coding sequence has been identified and cloned using 454 pyrosequencing of the transcriptome and inverse PCR. The LipG7 protein has been heterologously expressed in Saccharomyces cerevisiae BJ5465 and shown to exhibit the same characteristics as the native protein. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

    Science.gov (United States)

    Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

    2012-01-01

    Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

  15. VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2013-12-01

    Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

  16. Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

    Directory of Open Access Journals (Sweden)

    FELIPE B. VALER

    2016-01-01

    Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

  17. [Oil degradation by basidiomycetes in soil and peat at low temperatures].

    Science.gov (United States)

    Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V

    2016-01-01

    A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

  18. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

    Science.gov (United States)

    Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

  19. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

    2012-01-01

    Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

  20. Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

    Directory of Open Access Journals (Sweden)

    Martin Vohník

    Full Text Available Ericaceae (the heath family are widely distributed calcifuges inhabiting soils with inherently poor nutrient status. Ericaceae overcome nutrient limitation through symbiosis with ericoid mycorrhizal (ErM fungi that mobilize nutrients complexed in recalcitrant organic matter. At present, recognized ErM fungi include a narrow taxonomic range within the Ascomycota, and the Sebacinales, basal Hymenomycetes with unclamped hyphae and imperforate parenthesomes. Here we describe a novel type of basidiomycetous ErM symbiosis, termed 'sheathed ericoid mycorrhiza', discovered in two habitats in mid-Norway as a co-dominant mycorrhizal symbiosis in Vaccinium spp. The basidiomycete forming sheathed ErM possesses clamped hyphae with perforate parenthesomes, produces 1- to 3-layer sheaths around terminal parts of hair roots and colonizes their rhizodermis intracellularly forming hyphal coils typical for ErM symbiosis. Two basidiomycetous isolates were obtained from sheathed ErM and molecular and phylogenetic tools were used to determine their identity; they were also examined for the ability to form sheathed ErM and lignocellulolytic potential. Surprisingly, ITS rDNA of both conspecific isolates failed to amplify with the most commonly used primer pairs, including ITS1 and ITS1F + ITS4. Phylogenetic analysis of nuclear LSU, SSU and 5.8S rDNA indicates that the basidiomycete occupies a long branch residing in the proximity of Trechisporales and Hymenochaetales, but lacks a clear sequence relationship (>90% similarity to fungi currently placed in these orders. The basidiomycete formed the characteristic sheathed ErM symbiosis and enhanced growth of Vaccinium spp. in vitro, and degraded a recalcitrant aromatic substrate that was left unaltered by common ErM ascomycetes. Our findings provide coherent evidence that this hitherto undescribed basidiomycete forms a morphologically distinct ErM symbiosis that may occur at significant levels under natural conditions, yet

  1. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    A. K. Veligodska

    2015-11-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  2. Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

    Directory of Open Access Journals (Sweden)

    Daniil N. Olennikov

    2014-03-01

    Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

  3. Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Tony Hadibarata

    2011-11-01

    Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

  4. Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

    Science.gov (United States)

    Laich, Federico; Vaca, Inmaculada; Chávez, Renato

    2013-10-01

    During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

  5. Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

    2014-07-20

    We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Induction and catabolite repression of cellulase and xylanase synthesis in the selected white-rot basidiomycetes

    Directory of Open Access Journals (Sweden)

    Aza Kobakhidze

    2016-09-01

    Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.

  7. Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

    Directory of Open Access Journals (Sweden)

    Sônia C. Melo

    2015-06-01

    Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

  8. Genome-Wide Annotation and Comparative Analysis of Cytochrome P450 Monooxygenases in Basidiomycete Biotrophic Plant Pathogens.

    Directory of Open Access Journals (Sweden)

    Lehlohonolo Benedict Qhanya

    Full Text Available Fungi are an exceptional source of diverse and novel cytochrome P450 monooxygenases (P450s, heme-thiolate proteins, with catalytic versatility. Agaricomycotina saprophytes have yielded most of the available information on basidiomycete P450s. This resulted in observing similar P450 family types in basidiomycetes with few differences in P450 families among Agaricomycotina saprophytes. The present study demonstrated the presence of unique P450 family patterns in basidiomycete biotrophic plant pathogens that could possibly have originated from the adaptation of these species to different ecological niches (host influence. Systematic analysis of P450s in basidiomycete biotrophic plant pathogens belonging to three different orders, Agaricomycotina (Armillaria mellea, Pucciniomycotina (Melampsora laricis-populina, M. lini, Mixia osmundae and Puccinia graminis and Ustilaginomycotina (Ustilago maydis, Sporisorium reilianum and Tilletiaria anomala, revealed the presence of numerous putative P450s ranging from 267 (A. mellea to 14 (M. osmundae. Analysis of P450 families revealed the presence of 41 new P450 families and 27 new P450 subfamilies in these biotrophic plant pathogens. Order-level comparison of P450 families between biotrophic plant pathogens revealed the presence of unique P450 family patterns in these organisms, possibly reflecting the characteristics of their order. Further comparison of P450 families with basidiomycete non-pathogens confirmed that biotrophic plant pathogens harbour the unique P450 families in their genomes. The CYP63, CYP5037, CYP5136, CYP5137 and CYP5341 P450 families were expanded in A. mellea when compared to other Agaricomycotina saprophytes and the CYP5221 and CYP5233 P450 families in P. graminis and M. laricis-populina. The present study revealed that expansion of these P450 families is due to paralogous evolution of member P450s. The presence of unique P450 families in these organisms serves as evidence of how a host

  9. Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

    Directory of Open Access Journals (Sweden)

    Marcin Piątek

    2014-08-01

    Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

  10. Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

    Science.gov (United States)

    Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

    2010-11-01

    Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

  11. The cold adapted and temperature sensitive influenza A/Ann Arbor/6/60 virus, the master donor virus for live attenuated influenza vaccines, has multiple defects in replication at the restrictive temperature

    International Nuclear Information System (INIS)

    Chan, Winnie; Zhou, Helen; Kemble, George; Jin Hong

    2008-01-01

    We have previously determined that the temperature sensitive (ts) and attenuated (att) phenotypes of the cold adapted influenza A/Ann Arbor/6/60 strain (MDV-A), the master donor virus for the live attenuated influenza A vaccines (FluMist), are specified by the five amino acids in the PB1, PB2 and NP gene segments. To understand how these loci control the ts phenotype of MDV-A, replication of MDV-A at the non-permissive temperature (39 deg. C) was compared with recombinant wild-type A/Ann Arbor/6/60 (rWt). The mRNA and protein synthesis of MDV-A in the infected MDCK cells were not significantly reduced at 39 deg. C during a single-step replication, however, vRNA synthesis was reduced and the nuclear-cytoplasmic export of viral RNP (vRNP) was blocked. In addition, the virions released from MDV-A infected cells at 39 deg. C exhibited irregular morphology and had a greatly reduced amount of the M1 protein incorporated. The reduced M1 protein incorporation and vRNP export blockage correlated well with the virus ts phenotype because these defects could be partially alleviated by removing the three ts loci from the PB1 gene. The virions and vRNPs isolated from the MDV-A infected cells contained a higher level of heat shock protein 70 (Hsp70) than those of rWt, however, whether Hsp70 is involved in thermal inhibition of MDV-A replication remains to be determined. Our studies demonstrate that restrictive replication of MDV-A at the non-permissive temperature occurs in multiple steps of the virus replication cycle

  12. The Neanderthal face is not cold adapted.

    Science.gov (United States)

    Rae, Todd C; Koppe, Thomas; Stringer, Chris B

    2011-02-01

    Many morphological features of the Pleistocene fossil hominin Homo neanderthalensis, including the reputed large size of its paranasal sinuses, have been interpreted as adaptations to extreme cold, as some Neanderthals lived in Europe during glacial periods. This interpretation of sinus evolution rests on two assumptions: that increased craniofacial pneumatization is an adaptation to lower ambient temperatures, and that Neanderthals have relatively large sinuses. Analysis of humans, other primates, and rodents, however, suggests that the first assumption is suspect; at least the maxillary sinus undergoes a significant reduction in volume in extreme cold, in both wild and laboratory conditions. The second assumption, that Neanderthal sinuses are large, extensive, or even 'hyperpneumatized,' has held sway since the first specimen was described and has been interpreted as the causal explanation for some of the distinctive aspects of Neanderthal facial form, but has never been evaluated with respect to scaling. To test the latter assumption, previously published measurements from two-dimensional (2D) X-rays and new three-dimensional (3D) data from computed tomography (CT) of Neanderthals and temperate-climate European Homo sapiens are regressed against cranial size to determine the relative size of their sinuses. The 2D data reveal a degree of craniofacial pneumatization in Neanderthals that is both commensurate with the size of the cranium and comparable in scale with that seen in temperate climate H. sapiens. The 3D analysis of CT data from a smaller sample supports this conclusion. These results suggest that the distinctive Neanderthal face cannot be interpreted as a direct result of increased pneumatization, nor is it likely to be an adaptation to resist cold stress; an alternative explanation is thus required. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

    Directory of Open Access Journals (Sweden)

    Veligodska A. K.

    2015-12-01

    Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

  14. Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

    Science.gov (United States)

    Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

    2018-01-01

    Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

  15. Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process.

    Science.gov (United States)

    Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D

    2018-05-03

    Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

  16. De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete

    Energy Technology Data Exchange (ETDEWEB)

    Lundquist, K; Kirk, T K

    1978-01-01

    In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.

  17. Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

    Science.gov (United States)

    Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

    2015-01-14

    Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

  18. Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

    Directory of Open Access Journals (Sweden)

    Olga A. Glazunova

    2018-04-01

    Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

  19. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    Science.gov (United States)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-01-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  20. A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

    Directory of Open Access Journals (Sweden)

    Grażyna Końska

    2014-01-01

    Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

  1. Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Hong, J. S.; Kim, D.H.

    1981-01-01

    Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

  2. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  3. Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

    Science.gov (United States)

    Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

    2009-03-01

    Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

  4. Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

    Science.gov (United States)

    Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

    2015-10-01

    In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

  5. Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

    Energy Technology Data Exchange (ETDEWEB)

    Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

    2014-03-14

    Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

  6. Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

    Science.gov (United States)

    Degenkolb, Thomas; Vilcinskas, Andreas

    2016-05-01

    In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

  7. Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study

    Science.gov (United States)

    Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.

    2015-01-01

    The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

  8. Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

    Science.gov (United States)

    Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

    2015-02-01

    A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

  9. Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

    Science.gov (United States)

    Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

    1996-01-01

    Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

  10. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi

    Energy Technology Data Exchange (ETDEWEB)

    Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)

    2003-07-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)

  11. Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hatakka, A; Hofrichter, M

    2002-10-01

    Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

  12. Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

    Science.gov (United States)

    Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

    2015-02-01

    Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

  13. Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

    1999-12-01

    Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

  14. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  15. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2010-04-09

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  16. Mineralisation of 14C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi.

    Science.gov (United States)

    Steffen, K T; Hofrichter, M; Hatakka, A

    2000-12-01

    Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.

  17. Implementation of Optical Meanders in the Temperature Measurement of the Extermination of Basidiomycete Serpula Lacrymans Using Microwave Heating

    Directory of Open Access Journals (Sweden)

    Andrej Liner

    2013-01-01

    Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.

  18. Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

    2010-01-01

    We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

  19. Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

    Science.gov (United States)

    Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

    2006-01-01

    The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

  20. Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

    2010-01-01

    Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

  1. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  2. Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

    International Nuclear Information System (INIS)

    Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.

    1990-01-01

    During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

  3. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat

    2014-09-19

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

  4. Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

    Science.gov (United States)

    Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

    2014-01-01

    The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

  5. Effect of Cold Stress on Fruiting Body Production by Medicinal Basidiomycetes in Submerged and Solid-phase Culture

    Directory of Open Access Journals (Sweden)

    E.P. Vetchinkina

    2017-05-01

    Full Text Available The ability of the medicinal xylotrophic basidiomycetes Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum and Grifola frondosa to produce typical and atypical fruiting bodies with viable basidiospores in submerged and solid-phase culture under stationary conditions in a beer wort-containing medium under cold stress was shown. The examined mushrooms, when not exposed to temperature stress, did not form fruiting bodies. In solid-phase culture in an agarized medium after cold treatment, the basidiome formation period was shortened by 1.5–2 times. Furthermore, the use of a mycelium subjected to temperature stress for inoculation induced and accelerated the formation of fruiting bodies on an industrial wood substrate, which is of great biotechnological importance.

  6. Isolation of basidiomycetous yeast Pseudozyma tsukubaensis and production of glycolipid biosurfactant, a diastereomer type of mannosylerythritol lipid-B.

    Science.gov (United States)

    Morita, Tomotake; Takashima, Masako; Fukuoka, Tokuma; Konishi, Masaaki; Imura, Tomohiro; Kitamoto, Dai

    2010-10-01

    The producers of glycolipid biosurfactant, mannosylerythritol lipid-B (MEL-B), were isolated from leaves of Perilla frutescens on Ibaraki in Japan. Four isolates, 1D9, 1D10, 1D11, and 1E5, were identified as basidiomycetous yeast Pseudozyma tsukubaensis by rDNA sequence and biochemical properties. The structure of MEL-B produced by these strains was analyzed by (1)H nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as the diastereomer MEL-B produced by P. tsukubaensis NBRC 1940. Of these isolates, P. tsukubaensis 1E5 (JCM 16987) is capable of producing the largest amount of the diastereomer MEL-B from vegetable oils. In order to progress the diastereomer MEL-B production by strain 1E5, factors affecting the production, such as carbon and organic nutrient sources, were further examined. Olive oil and yeast extract were the best carbon and nutrient sources, respectively. Under the optimal conditions, a maximum yield, productivity, and yield coefficient of 73.1 g/L, 10.4 g L(-1) day(-1), and 43.5 g/g were achieved by feeding of olive oil in a 5-L jar-fermenter culture using strain 1E5.

  7. Potential of Basidiomycetous Fungi Isolated from Gunung Barus Forest North Sumatera in Decolorization of Wastewater of Textile Industry

    Science.gov (United States)

    Munir, E.; Priyani, N.; Suryanto, D.; Naimah, Z.

    2017-03-01

    A study of basidiomycetous fungi in decolorization of wastewater of textile industry has been started in our laboratory. The objective of this study was to obtain potential isolates and to examine their decolorization acitity. The fungi were isolated from local forest, Gunung Barus Forest, in North Sumatera and screened their ligninolytic activity qualitatively by bavendam method and the waste was obtained from local textile industry in Medan. Nineteen fungal isolates grew on plate agar medium containing 100% of waste supplemented with 2% glucose, and 6 of those exhibited good growth when glucose in the media was reduced to 1%. Surprisingly, these six potential isolates grew, although relatively at lower rate, when glucose was not included in the media. Meanwhile, there was no substantial decolorization of media could be observed on all plates cultures. Analyses of decolorization on liquid condition containing 25% of wastewater and no glucose showed that fungal grew at the bottom culture flask. All 6 isolates exhibited decolorization activity. Interestingly, mass of mycelia growth at the bottom absorbed dyes and dissolved suspended solid which was seemingly separated from very clean solution medium surrounding. These results indicated that the cultures utilized carbon source from waste and the extracellular matrixes produced by fungal isolates might involve in decolorization of textile wastewater.

  8. Solid-state fermentation of cornmeal with the basidiomycete Ganoderma lucidum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, J R; An, C H; Yuan, J M

    2005-01-01

    The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.

  9. Solid-state fermentation of cornmeal with the basidiomycete Hericium erinaceum for degrading starch and upgrading nutritional value.

    Science.gov (United States)

    Han, Jianrong

    2003-01-15

    The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.

  10. Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

    Science.gov (United States)

    Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

    2017-02-01

    The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

  11. Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

    Science.gov (United States)

    Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

    2010-01-01

    During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

  12. Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

    Directory of Open Access Journals (Sweden)

    S. Lupo

    2006-04-01

    Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

  13. Discovery of novel xylosides in co-culture of basidiomycetes Trametes versicolor and Ganoderma applanatum by integrated metabolomics and bioinformatics

    Science.gov (United States)

    Yao, Lu; Zhu, Li-Ping; Xu, Xiao-Yan; Tan, Ling-Ling; Sadilek, Martin; Fan, Huan; Hu, Bo; Shen, Xiao-Ting; Yang, Jie; Qiao, Bin; Yang, Song

    2016-09-01

    Transcriptomic analysis of cultured fungi suggests that many genes for secondary metabolite synthesis are presumably silent under standard laboratory condition. In order to investigate the expression of silent genes in symbiotic systems, 136 fungi-fungi symbiotic systems were built up by co-culturing seventeen basidiomycetes, among which the co-culture of Trametes versicolor and Ganoderma applanatum demonstrated the strongest coloration of confrontation zones. Metabolomics study of this co-culture discovered that sixty-two features were either newly synthesized or highly produced in the co-culture compared with individual cultures. Molecular network analysis highlighted a subnetwork including two novel xylosides (compounds 2 and 3). Compound 2 was further identified as N-(4-methoxyphenyl)formamide 2-O-β-D-xyloside and was revealed to have the potential to enhance the cell viability of human immortalized bronchial epithelial cell line of Beas-2B. Moreover, bioinformatics and transcriptional analysis of T. versicolor revealed a potential candidate gene (GI: 636605689) encoding xylosyltransferases for xylosylation. Additionally, 3-phenyllactic acid and orsellinic acid were detected for the first time in G. applanatum, which may be ascribed to response against T.versicolor stress. In general, the described co-culture platform provides a powerful tool to discover novel metabolites and help gain insights into the mechanism of silent gene activation in fungal defense.

  14. Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

    Science.gov (United States)

    Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

    2014-01-01

    Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

  15. Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

    Science.gov (United States)

    Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

    2017-04-01

    The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

  16. Contrasting diversity and host association of ectomycorrhizal basidiomycetes versus root-associated ascomycetes in a dipterocarp rainforest.

    Directory of Open Access Journals (Sweden)

    Hirotoshi Sato

    Full Text Available Root-associated fungi, including ectomycorrhizal and root-endophytic fungi, are among the most diverse and important belowground plant symbionts in dipterocarp rainforests. Our study aimed to reveal the biodiversity, host association, and community structure of ectomycorrhizal Basidiomycota and root-associated Ascomycota (including root-endophytic Ascomycota in a lowland dipterocarp rainforest in Southeast Asia. The host plant chloroplast ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL region and fungal internal transcribed spacer 2 (ITS2 region were sequenced using tag-encoded, massively parallel 454 pyrosequencing to identify host plant and root-associated fungal taxa in root samples. In total, 1245 ascomycetous and 127 putative ectomycorrhizal basidiomycetous taxa were detected from 442 root samples. The putative ectomycorrhizal Basidiomycota were likely to be associated with closely related dipterocarp taxa to greater or lesser extents, whereas host association patterns of the root-associated Ascomycota were much less distinct. The community structure of the putative ectomycorrhizal Basidiomycota was possibly more influenced by host genetic distances than was that of the root-associated Ascomycota. This study also indicated that in dipterocarp rainforests, root-associated Ascomycota were characterized by high biodiversity and indistinct host association patterns, whereas ectomycorrhizal Basidiomycota showed less biodiversity and a strong host phylogenetic preference for dipterocarp trees. Our findings lead to the working hypothesis that root-associated Ascomycota, which might be mainly represented by root-endophytic fungi, have biodiversity hotspots in the tropics, whereas biodiversity of ectomycorrhizal Basidiomycota increases with host genetic diversity.

  17. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  18. Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

    Science.gov (United States)

    Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

    2015-04-01

    Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

  19. Cloning, expression and purification of cold adapted acetate kinase ...

    African Journals Online (AJOL)

    shell) Neobuccinum living in the Antarctic ice-covered sea. An open reading frame of 1203 bp, coding for acetate kinase gene, called ack, was amplified, cloned into the expression vector, pETY-16b, and the enzyme was overproduced by ...

  20. Yersinia enterocolitica : Genes involved in cold-adaptation

    NARCIS (Netherlands)

    Goverde, R.L.J.

    1999-01-01

    It is known from the literature that: -The application of chilling as a means of food preservation has frequently resulted in food borne infections with psychrotrophic micro-organisms, such as Yersinia enterocolitica, Listeria monocytogenes and Aeromonas hydrophila; - The injurious effect on

  1. Heterologous production of cellobiose dehydrogenases from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina and their effect on saccharification of wheat straw.

    Science.gov (United States)

    Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony

    2013-06-01

    Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for

  2. Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

    Directory of Open Access Journals (Sweden)

    Liang Huo

    2018-02-01

    Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

  3. A novel, highly conserved metallothionein family in basidiomycete fungi and characterization of two representative SlMTa and SlMTb genes in the ectomycorrhizal fungus Suillus luteus.

    Science.gov (United States)

    Nguyen, Hoai; Rineau, François; Vangronsveld, Jaco; Cuypers, Ann; Colpaert, Jan V; Ruytinx, Joske

    2017-07-01

    The basidiomycete Suillus luteus is an important member of the ectomycorrhizal community that thrives in heavy metal polluted soils covered with pioneer pine forests. This study aimed to identify potential heavy metal chelators in S. luteus. Two metallothionein (MT) coding genes, SlMTa and SlMTb, were identified. When heterologously expressed in yeast, both SlMTa and SlMTb can rescue the Cu sensitive mutant from Cu toxicity. In S. luteus, transcription of both SlMTa and SlMTb is induced by Cu but not Cd or Zn. Several putative Cu-sensing and metal-response elements are present in the promoter sequences. These results indicate that SlMTa and SlMTb function as Cu-thioneins. Homologs of the S. luteus MTs are present in 49 species belonging to 10 different orders of the subphylum Agaricomycotina and are remarkably conserved. The length of the proteins, number and distribution of cysteine residues indicate a novel family of fungal MTs. The ubiquitous and highly conserved features of these MTs suggest that they are important for basic cellular functions in species in the subphylum Agaricomycotina. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Alteration of white-rot basidiomycetes cellulase and xylanase activities in the submerged co-cultivation and optimization of enzyme production by Irpex lacteus and Schizophyllum commune.

    Science.gov (United States)

    Metreveli, Eka; Kachlishvili, Eva; Singer, Steven W; Elisashvili, Vladimir

    2017-10-01

    Mono and dual cultures of four white-rot basidiomycete species were evaluated for cellulase and xylanase activity under submerged fermentation conditions. Co-cultivation of Pycnoporus coccineus or Trametes hirsuta with Schizophyllum commune displayed antagonistic interactions resulting in the decrease of endoglucanase and total cellulase activities. In contrast, increases in cellulase and xylanase activity were revealed through the compatible interactions of Irpex lacteus with S. commune. Co-cultivation conditions were optimized for maximum enzyme production by I. lacteus and S. commune, the best producers of cellulase/xylanase and β-glucosidase, respectively. An optimized medium for the target enzyme production by the mixed culture was established in a laboratory fermenter yielding 7U/mL total cellulase, 142U/mL endoglucanase, 104U/mL xylanase, and 5.2U/mL β-glucosidase. The dual culture approach resulted in an enzymatic mixture with 11% improved lignocellulose saccharification potential compared to enzymes from a monoculture of I. lacteus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Microbial competition, lack in macronutrients, and acidity as main obstacles to the transfer of basidiomycetous ground fungi into (organically or heavy-metal contaminated) soils.

    Science.gov (United States)

    Gramss, Gerhard; Bergmann, Hans

    2007-08-01

    Non-symbiotic soil microorganisms which have been expensively engineered or selected to support plant nutrition, control root diseases, degrade xenobiotic hydrocarbons, and repress or stimulate heavy metal uptake of plants fail to survive in target soils. This prompted studies into the role of chemistry and microbial pre-colonization of 23 top soils in long-term growth of basidiomycetes. Fungi are seen as auxiliary agents in soil remediation. Untreated soils (1.5 L) were colonized by lignocellulose preferring ground fungi such as Agaricus aestivalis, A. bisporus, A. campestris, A. edulis, A. macrocarpus, A. porphyrizon, Agrocybe dura, A. praecox, Clitocybe sp., Coprinus comatus, Lepista nuda, L. sordida, Macrolepiota excoriata, M. procera, Stropharia coronilla, and S. rugoso-annulata. Spawn mycelia of fairy-ring-type fungi such as Agaricus arvensis, A. fissuratus, A. langei, A. lanipes, A. pilatianus, Lyophyllum sp., and Marasmius oreades died back in contact with non-sterile soils. Fungal growth correlated positively with the soils' Ct Ca K Mg content and negatively with microbial CO2 evolution. Pasteurization and autoclaving increased mycelial growth and life span in soils pH 6.6-8.2. Growth of pH-sensitive but not of pH-tolerant fungi was inhibited on the Ca-deficient soils pH 4-4.4 (-5.6) and was not improved by autoclaving. The pretended fungistasis of acid soils to pH-sensitive fungi was controlled by N P K mineral (pH not altering) or organic (pH increasing) fertilizing as well as by neutralization with NaOH or CaCO3. Although microbial competition was mortal to 33% of the fungal mycelia inserted into natural unplanted soils, further seriously antifungal effects beyond those pretended by low pH conditions and shortage in mineral macronutrients were not identified.

  6. Type studies in Basidiomycetes. X

    NARCIS (Netherlands)

    Singer, R.

    1961-01-01

    For the first time a systematic study of the types and authentic specimens of agarics and boletes preserved in the Persoon Herbarium has been carried out. Some aspects of the possibilities of type analysis with regard to specimens over 130 year old are discussed. 137 species were analyzed. The

  7. Bivalent Carbohydrate Binding Is Required for Biological Activity of Clitocybe nebularis Lectin (CNL), the N,N′-Diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc)-specific Lectin from Basidiomycete C. nebularis*

    Science.gov (United States)

    Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica

    2012-01-01

    Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779

  8. RNA metabolism in Xylella fastidiosa during cold adaptation and survival responses

    Science.gov (United States)

    Fastidious plant pathogen Xylella fastidiosa has a reduced ability to adapt to cold temperatures, limiting persistence in perennial hosts, such as grapevine, growing in colder regions. RNA metabolism is an essential part of bacterial response to low temperature, including inducible expression of RNA...

  9. The genome of the polar eukaryotic microalga Coccomyxa subellipsoidea reveals traits of cold adaptation

    Energy Technology Data Exchange (ETDEWEB)

    Blanc, Guillaume; Agarkova, Irina; Grimwood, Jane; Kuo, Alan; Brueggeman, Andrew; Dunigan, David D.; Gurnon, James; Ladunga, Istvan; Lindquist, Erika; Lucas, Susan; Pangilinan, Jasmyn; Proschold, Thomas; Salamov, Asaf; Schmutz, Jeremy; Weeks, Donald; Tamada, Takashi; Lomsadze, Alexandre; Borodovsky, Mark; Claverie, Jean-Michel; Grigoriev, Igor V.; Van Etten, James L.

    2012-02-13

    Background Little is known about the mechanisms of adaptation of life to the extreme environmental conditions encountered in polar regions. Here we present the genome sequence of a unicellular green alga from the division chlorophyta, Coccomyxa subellipsoidea C-169, which we will hereafter refer to as C-169. This is the first eukaryotic microorganism from a polar environment to have its genome sequenced. Results The 48.8 Mb genome contained in 20 chromosomes exhibits significant synteny conservation with the chromosomes of its relatives Chlorella variabilis and Chlamydomonas reinhardtii. The order of the genes is highly reshuffled within synteny blocks, suggesting that intra-chromosomal rearrangements were more prevalent than inter-chromosomal rearrangements. Remarkably, Zepp retrotransposons occur in clusters of nested elements with strictly one cluster per chromosome probably residing at the centromere. Several protein families overrepresented in C. subellipsoidae include proteins involved in lipid metabolism, transporters, cellulose synthases and short alcohol dehydrogenases. Conversely, C-169 lacks proteins that exist in all other sequenced chlorophytes, including components of the glycosyl phosphatidyl inositol anchoring system, pyruvate phosphate dikinase and the photosystem 1 reaction center subunit N (PsaN). Conclusions We suggest that some of these gene losses and gains could have contributed to adaptation to low temperatures. Comparison of these genomic features with the adaptive strategies of psychrophilic microbes suggests that prokaryotes and eukaryotes followed comparable evolutionary routes to adapt to cold environments.

  10. Legionella species diversity and dynamics from surface reservoir to tap water: from cold adaptation to thermophily.

    Science.gov (United States)

    Lesnik, René; Brettar, Ingrid; Höfle, Manfred G

    2016-05-01

    Water samples of the Drinking Water Supply System (DWSS) of the city of Braunschweig were analysed for its Legionella species composition using genus-specific PCR amplicons and single-strand conformation polymorphism (SSCP) fingerprint analyses based on 16S rRNA genes. These analyses comprised the whole supply chain including raw water, treatment process and large-scale storage, and a seasonal study of finished drinking water sampled monthly from cold and hot tap water. Treatment of raw water had a major impact on Legionella species by reducing their diversity and abundances. The Legionella species composition of the tap water was highly distinct from that of both source waters. In cold water, 8-14 different phylotypes of Legionella (PTLs) were observed per sample with relative abundances ranging from >1% to 53%. In hot water, L. pneumophila was present during all seasons at high relative abundances (8-40%) accompanied by 5-14 other PTLs of which 6 PTLs were in common with cold water. This thermophilic Legionella community, including L. pneumophila, was able to grow in the hot water above 50 °C. Such thermophilic Legionella populations are of general relevance for drinking water management and public health, but also for the ecology and evolution of the genus Legionella.

  11. Cold adaptive thermogenesis following consumption of certain pungent spice principles: A validation study.

    Science.gov (United States)

    Pandit, Chaitanya; Anilakumar, K R

    2017-02-01

    Identifying a means to activate or potentiate thermogenic mechanisms through ingestion of dietary compounds have important implications in cold endurance and survival. Although many reports discuss the thermogenic potential of spices, it is surprising that none of the studies verify whether consumption of spices can improve cold endurance. In this study, we have attempted to evaluate if ingestion of certain spices can activate heat-generating mechanisms in the body such that a fall in. core body temperature (CBT) can be delayed or prevented when faced with a cold challenge. Ten commonly used spices in the Indian cuisine were chosen and 70% ethanol extract of the spices were fed orally to male Wistar rats at a dose of 250mg/kg for a period of 7 days. A change in CBT during cold exposure was recorded before and after treatment. At the end of the experiment, plasma norepinephrine and serum free fatty acid levels were estimated. We observed that among the ten spices, treatment with cinnamon and pepper extracts showed significant improvement in comparison to the control group. Based on evidence in literature and the HPLC-MS analysis from our lab, we hypothesized that the effects of the pepper and cinnamon extracts might be due to their piperine and cinnamaldehyde content respectively. However, no improved endurance was observed when they were administered alone. Poor endurance following depletion of endogenous norepinephrine levels using reserpine indicated its involvement in mediating the heat generating processes. However, it is noteworthy that green tea and spice treated animals exhibited a fall in CBT which was lower than their initial fall. In conclusion, our findings provide experimental evidence that ingestion of spices, viz., pepper and cinnamon, might elicit thermogenic responses such that hypothermia can be delayed or prevented upon cold exposure. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Occurrence and formation of endogenous histidine hexa-coordination in cold-adapted hemoglobins.

    Science.gov (United States)

    Merlino, Antonello; Howes, Barry D; Prisco, Guido di; Verde, Cinzia; Smulevich, Giulietta; Mazzarella, Lelio; Vergara, Alessandro

    2011-05-01

    Spectroscopic and crystallographic evidence of endogenous (His) ligation at the sixth coordination site of the heme iron has been reported for monomeric, dimeric, and tetrameric hemoglobins (Hbs) in both ferrous (hemochrome) and ferric (hemichrome) oxidation states. In particular, the ferric bis- histidyl adduct represents a common accessible ordered state for the β chains of all tetrameric Hbs isolated from Antarctic and sub-Antarctic fish. Indeed, the crystal structures of known tetrameric Hbs in the bis-His state are characterized by a different binding state of the α and β chains. An overall analysis of the bis-histidyl adduct of globin structures deposited in the Protein Data Bank reveals a marked difference between hemichromes in tetrameric Hbs compared to monomeric/dimeric Hbs. Herein, we review the structural, spectroscopic and stability features of hemichromes in tetrameric Antarctic fish Hbs. The role of bis-histidyl adducts is also addressed in a more evolutionary context alongside the concept of its potential physiological role. Copyright © 2011 Wiley Periodicals, Inc.

  13. Effects of thyroid status on cold-adaptive thermogenesis in Brandt's vole, Microtus brandti.

    Science.gov (United States)

    Liu, X T; LI, Q F; Huang, C X; Sun, R Y

    1997-01-01

    Hyper- and hypothyroidism were induced by subcutaneous injection of thyroxine and by oral administration of methimazol in Brandt's voles. The effects of the two treatments on metabolic thermogenesis at 25 degrees C and 4 degrees C were investigated. The level of resting metabolic rate was closely related to thyroid status: high in the hyperthyroid case and low in the hypothyroid case. However, no increase in resting metabolic rate occurred in either case during further cold acclimation. Hyperthyroidism resulted in an increased nonshivering thermogenesis, which was much enhanced by lower temperature, but hypothyroidism led to a suppressed nonshivering thermogenesis in the cold. The state-4 and state-3 respirations and the activities of cytochrome-c oxidase of liver mitochondria were elevated in hyperthyroid animals but attenuated in hypothyroid ones. However, these levels were scarcely changed after further cold acclimation. Both hyperthyroidism and cold acclimation induced the recruitment of brown adipose tissue, but brown adipose tissue was different biochemically in the two cases: in hyperthyroidism, the total protein was reduced, while fat content increased; in cold acclimation, the total and mitochondrial proteins were increased. However, in hypothyroid voles, the normal adaptive changes in brown adipose tissue were impaired in further cold acclimation. The activity of cytochromec oxidase in brown adipose tissue was increased by hyperthyroidism and enhanced in further cold. In contrast, its activity was inhibited in hypothyroid animals, though activated to some extent in cold. These results demonstrate that normal thyroid function is essential for the cold-induced increase of resting metabolic rate and nonshivering thermogenesis and that there is a synergism between thyroid hormone and cold acclimation in the regulation of nonshivering thermogenesis in Brandt's vole. In addition, the blunted response of brown adipocytes to the cold may be the cytological mechanism for the suppressed nonshivering thermogenesis found with hypothyroidism.

  14. Can paleorefugia of cold-adapted species in talus slopes resist global warming?

    Czech Academy of Sciences Publication Activity Database

    Růžička, Vlastimil; Zacharda, M.; Šmilauer, P.; Kučera, T.

    2015-01-01

    Roč. 20, č. 3 (2015), s. 403-412 ISSN 1239-6095 Grant - others:GA JU(CZ) 04-142/2010/P Institutional support: RVO:60077344 Keywords : global warming Subject RIV: EH - Ecology, Behaviour Impact factor: 1.476, year: 2015 http://www.borenv.net/BER/pdfs/ber20/ber20-403.pdf

  15. Carotenogenic gene expression and carotenoid accumulation in three varieties of Cucurbita pepo during fruit development.

    Science.gov (United States)

    Obrero, Ángeles; González-Verdejo, Clara I; Die, Jose V; Gómez, Pedro; Del Río-Celestino, Mercedes; Román, Belén

    2013-07-03

    The control of gene expression is a crucial regulatory mechanism in carotenoid accumulation of fruits and flowers. We investigated the role of transcriptional regulation of nine genes involved in the carotenoid biosynthesis pathway in three varieties of Cucurbita pepo with evident differences in fruit color. The transcriptional levels of the key genes involved in the carotenoid biosynthesis were higher in flower-, leaf-, and fruit skin tissues than flesh tissues. This correlated with higher concentration of carotenoid content in these tissues. The differential expression among the colored and white cultivars detected for some genes, such as LCYe, in combination with other regulatory mechanisms, could explain the large differences found in terms of carotenoid content among the three varieties. These results are a first step to elucidate carotenogenesis in C. pepo and demonstrate that, in general, regulation of the pathway genes is a critical factor that determines the accumulation of these compounds.

  16. CAR gene cluster and transcript levels of carotenogenic genes in Rhodotorula mucilaginosa.

    Science.gov (United States)

    Landolfo, Sara; Ianiri, Giuseppe; Camiolo, Salvatore; Porceddu, Andrea; Mulas, Giuliana; Chessa, Rossella; Zara, Giacomo; Mannazzu, Ilaria

    2018-01-01

    A molecular approach was applied to the study of the carotenoid biosynthetic pathway of Rhodotorula mucilaginosa. At first, functional annotation of the genome of R. mucilaginosa C2.5t1 was carried out and gene ontology categories were assigned to 4033 predicted proteins. Then, a set of genes involved in different steps of carotenogenesis was identified and those coding for phytoene desaturase, phytoene synthase/lycopene cyclase and carotenoid dioxygenase (CAR genes) proved to be clustered within a region of ~10 kb. Quantitative PCR of the genes involved in carotenoid biosynthesis showed that genes coding for 3-hydroxy-3-methylglutharyl-CoA reductase and mevalonate kinase are induced during exponential phase while no clear trend of induction was observed for phytoene synthase/lycopene cyclase and phytoene dehydrogenase encoding genes. Thus, in R. mucilaginosa the induction of genes involved in the early steps of carotenoid biosynthesis is transient and accompanies the onset of carotenoid production, while that of CAR genes does not correlate with the amount of carotenoids produced. The transcript levels of genes coding for carotenoid dioxygenase, superoxide dismutase and catalase A increased during the accumulation of carotenoids, thus suggesting the activation of a mechanism aimed at the protection of cell structures from oxidative stress during carotenoid biosynthesis. The data presented herein, besides being suitable for the elucidation of the mechanisms that underlie carotenoid biosynthesis, will contribute to boosting the biotechnological potential of this yeast by improving the outcome of further research efforts aimed at also exploring other features of interest.

  17. cDNA cloning and expression of carotenogenic genes during flower development in Gentiana lutea.

    Science.gov (United States)

    Zhu, Changfu; Yamamura, Saburo; Koiwa, Hiroyuki; Nishihara, Masashiro; Sandmann, Gerhard

    2002-02-01

    All cDNAs involved in carotenoid biosynthesis leading to lycopene in yellow petals of Gentiana lutea have been cloned from a cDNA library. They encode a geranylgeranyl pyrophosphate synthase, a phytoene synthase, a phytoene desaturase and a zeta-carotene desaturase. The indicated function of all cDNAs was established by heterologous complementation in Escherichia coli. The amino acid sequences deduced from the cDNAs were between 47.5% and 78.9% identical to those reported for the corresponding enzymes from other higher plants. Southern analysis suggested that the genes for each enzyme probably represent a small multi-gene family. Tissue-specific expression of the genes and expression during flower development was investigated. The expression of the phytoene synthase gene, psy, was enhanced in flowers but transcripts were not detected in stems and leaves by northern blotting. Transcripts of the genes for geranylgeranyl pyrophosphate (ggpps), phytoene desaturase (pds) and zeta-carotene desaturase (zds) were detected in flowers and leaves but not in stems. Analysis of the expression of psy and zds in petals revealed that levels of the transcripts were lowest in young buds and highest in fully open flowers, in parallel with the formation of carotenoids. Obviously, the transcription of these genes control the accumulation of carotenoids during flower development in G. lutea. For pds only a very slight increase of mRNA was found whereas the transcripts of ggpps decreased during flower development.

  18. Plastid structure and carotenogenic gene expression in red- and white-fleshed loquat (Eriobotrya japonica) fruits

    Science.gov (United States)

    Fu, Xiumin; Kong, Wenbin; Peng, Gang; Zhou, Jingyi; Azam, Muhammad; Xu, Changjie; Grierson, Don; Chen, Kunsong

    2012-01-01

    Loquat (Eriobotrya japonica Lindl.) can be sorted into red- and white-fleshed cultivars. The flesh of Luoyangqing (LYQ, red-fleshed) appears red-orange because of a high content of carotenoids while the flesh of Baisha (BS, white-fleshed) appears ivory white due to a lack of carotenoid accumulation. The carotenoid content in the peel and flesh of LYQ was approximately 68 μg g−1 and 13 μg g−1 fresh weight (FW), respectively, and for BS 19 μg g−1 and 0.27 μg g−1 FW. The mRNA levels of 15 carotenogenesis-related genes were analysed during fruit development and ripening. After the breaker stage (S4), the mRNA levels of phytoene synthase 1 (PSY1) and chromoplast-specific lycopene β-cyclase (CYCB) were higher in the peel, and CYCB and β-carotene hydroxylase (BCH) mRNAs were higher in the flesh of LYQ, compared with BS. Plastid morphogenesis during fruit ripening was also studied. The ultrastructure of plastids in the peel of BS changed less than in LYQ during fruit development. Two different chromoplast shapes were observed in the cells of LYQ peel and flesh at the fully ripe stage. Carotenoids were incorporated in the globules in chromoplasts of LYQ and BS peel but were in a crystalline form in the chromoplasts of LYQ flesh. However, no chromoplast structure was found in the cells of fully ripe BS fruit flesh. The mRNA level of plastid lipid-associated protein (PAP) in the peel and flesh of LYQ was over five times higher than in BS peel and flesh. In conclusion, the lower carotenoid content in BS fruit was associated with the lower mRNA levels of PSY1, CYCB, and BCH; however, the failure to develop normal chromoplasts in BS flesh is the most convincing explanation for the lack of carotenoid accumulation. The expression of PAP was well correlated with chromoplast numbers and carotenoid accumulation, suggesting its possible role in chromoplast biogenesis or interconversion of loquat fruit. PMID:21994170

  19. Plastid structure and carotenogenic gene expression in red- and white-fleshed loquat (Eriobotrya japonica) fruits

    NARCIS (Netherlands)

    Fu, X.; Kong, W.; Peng, G.; Zhou, J.; Azam, M.; Xu, C.; Grierson, D.; Chen, K.

    2012-01-01

    Loquat (Eriobotrya japonica Lindl.) can be sorted into red- and white-fleshed cultivars. The flesh of Luoyangqing (LYQ, red-fleshed) appears red-orange because of a high content of carotenoids while the flesh of Baisha (BS, white-fleshed) appears ivory white due to a lack of carotenoid accumulation.

  20. A Gene Cluster for Biosynthesis of Mannosylerythritol Lipids Consisted of 4-O-β-D-Mannopyranosyl-(2R,3S-Erythritol as the Sugar Moiety in a Basidiomycetous Yeast Pseudozyma tsukubaensis.

    Directory of Open Access Journals (Sweden)

    Azusa Saika

    Full Text Available Mannosylerythritol lipids (MELs belong to the glycolipid biosurfactants and are produced by various fungi. The basidiomycetous yeast Pseudozyma tsukubaensis produces diastereomer type of MEL-B, which contains 4-O-β-D-mannopyranosyl-(2R,3S-erythritol (R-form as the sugar moiety. In this respect it differs from conventional type of MELs, which contain 4-O-β-D-mannopyranosyl-(2S,3R-erythritol (S-form as the sugar moiety. While the biosynthetic gene cluster for conventional type of MELs has been previously identified in Ustilago maydis and Pseudozyma antarctica, the genetic basis for MEL biosynthesis in P. tsukubaensis is unknown. Here, we identified a gene cluster involved in MEL biosynthesis in P. tsukubaensis. Among these genes, PtEMT1, which encodes erythritol/mannose transferase, had greater than 69% identity with homologs from strains in the genera Ustilago, Melanopsichium, Sporisorium and Pseudozyma. However, phylogenetic analysis placed PtEMT1p in a separate clade from the other proteins. To investigate the function of PtEMT1, we introduced the gene into a P. antarctica mutant strain, ΔPaEMT1, which lacks MEL biosynthesis ability owing to the deletion of PaEMT1. Using NMR spectroscopy, we identified the biosynthetic product as MEL-A with altered sugar conformation. These results indicate that PtEMT1p catalyzes the sugar conformation of MELs. This is the first report of a gene cluster for the biosynthesis of diastereomer type of MEL.

  1. Diversification of the cold-adapted butterfly genus Oeneis related to Holarctic biogeography and climatic niche shifts.

    Science.gov (United States)

    Kleckova, I; Cesanek, M; Fric, Z; Pellissier, L

    2015-11-01

    Both geographical and ecological speciation interact during the evolution of a clade, but the relative contribution of these processes is rarely assessed for cold-dwelling biota. Here, we investigate the role of biogeography and the evolution of ecological traits on the diversification of the Holarctic arcto-alpine butterfly genus Oeneis (Lepidoptera: Satyrinae). We reconstructed the molecular phylogeny of the genus based on one mitochondrial (COI) and three nuclear (GAPDH, RpS5, wingless) genes. We inferred the biogeographical scenario and the ancestral state reconstructions of climatic and habitat requirements. Within the genus, we detected five main species groups corresponding to the taxonomic division and further paraphyletic position of Neominois (syn. n.). Next, we transferred O. aktashi from the hora to the polixenes species group on the bases of molecular relationships. We found that the genus originated in the dry grasslands of the mountains of Central Asia and dispersed over the Beringian Land Bridges to North America several times independently. Holarctic mountains, in particular the Asian Altai Mts. and Sayan Mts., host the oldest lineages and most of the species diversity. Arctic species are more recent, with Pliocene or Pleistocene origin. We detected a strong phylogenetic signal for the climatic niche, where one lineage diversified towards colder conditions. Altogether, our results indicate that both dispersal across geographical areas and occupation of distinct climatic niches promoted the diversification of the Oeneis genus. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Cold-adapted digestive aspartic protease of the clawed lobsters Homarus americanus and Homarus gammarus: biochemical characterization.

    Science.gov (United States)

    Rojo, Liliana; García-Carreño, Fernando; de Los Angeles Navarrete del Toro, Maria

    2013-02-01

    Aspartic proteinases in the gastric fluid of clawed lobsters Homarus americanus and Homarus gammarus were isolated to homogeneity by single-step pepstatin-A affinity chromatography; such enzymes have been previously identified as cathepsin D-like enzymes based on their deduced amino acid sequence. Here, we describe their biochemical characteristics; the properties of the lobster enzymes were compared with those of its homolog, bovine cathepsin D, and found to be unique in a number of ways. The lobster enzymes demonstrated hydrolytic activity against synthetic and natural substrates at a wider range of pH; they were more temperature-sensitive, showed no changes in the K(M) value at 4°C, 10°C, and 25°C, and had 20-fold higher k(cat)/K(M) values than bovine enzyme. The bovine enzyme was temperature-dependent. We propose that both properties arose from an increase in molecular flexibility required to compensate for the reduction of reaction rates at low habitat temperatures. This is supported by the fast denaturation rates induced by temperature.

  3. Expression and enzymatic characterization of a cold-adapted β-agarase from Antarctic bacterium Pseudoalteromonas sp. NJ21

    Science.gov (United States)

    Li, Jiang; Sha, Yujie

    2015-03-01

    An agar-degrading bacterium, designated as Pseudoalteromonas sp. NJ21, was isolated from an Antarctic sediment sample. The agarase gene aga1161 from Pseudoalteromonas sp. NJ21 consisting of a 2 382-bp coding region was cloned. The gene encodes a 793-amino acids protein and was found to possess characteristic features of the Glyco_hydro_42 family. The recombinant agarase (rAga1161) was overexpressed in Escherichia coli and purified as a fusion protein. Enzyme activity analysis revealed that the optimum temperature and pH for the purified recombinant agarase were 30-40°C and 8.0, respectively. rAga1161 was found to maintain as much as 80% of its maximum activity at 10°C, which is typical of a coldadapted enzyme. The pattern of agar hydrolysis demonstrated that the enzyme is an β-agarase, producing neoagarobiose (NA2) as the final main product. Furthermore, this work is the first proof of an agarolytic activity in Antarctic bacteria and these results indicate the potential for the Antarctic agarase as a catalyst in medicine, food and cosmetic industries.

  4. Uncoupling protein and ATP/ADP carrier increase mitochondrial proton conductance after cold adaptation of king penguins.

    Science.gov (United States)

    Talbot, Darren A; Duchamp, Claude; Rey, Benjamin; Hanuise, Nicolas; Rouanet, Jean Louis; Sibille, Brigitte; Brand, Martin D

    2004-07-01

    Juvenile king penguins develop adaptive thermogenesis after repeated immersion in cold water. However, the mechanisms of such metabolic adaptation in birds are unknown, as they lack brown adipose tissue and uncoupling protein-1 (UCP1), which mediate adaptive non-shivering thermogenesis in mammals. We used three different groups of juvenile king penguins to investigate the mitochondrial basis of avian adaptive thermogenesis in vitro. Skeletal muscle mitochondria isolated from penguins that had never been immersed in cold water showed no superoxide-stimulated proton conductance, indicating no functional avian UCP. Skeletal muscle mitochondria from penguins that had been either experimentally immersed or naturally adapted to cold water did possess functional avian UCP, demonstrated by a superoxide-stimulated, GDP-inhibitable proton conductance across their inner membrane. This was associated with a markedly greater abundance of avian UCP mRNA. In the presence (but not the absence) of fatty acids, these mitochondria also showed a greater adenine nucleotide translocase-catalysed proton conductance than those from never-immersed penguins. This was due to an increase in the amount of adenine nucleotide translocase. Therefore, adaptive thermogenesis in juvenile king penguins is linked to two separate mechanisms of uncoupling of oxidative phosphorylation in skeletal muscle mitochondria: increased proton transport activity of avian UCP (dependent on superoxide and inhibited by GDP) and increased proton transport activity of the adenine nucleotide translocase (dependent on fatty acids and inhibited by carboxyatractylate).

  5. Diversification of the cold-adapted butterfly genus Oeneis related to Holarctic biogeography and climatic niche shifts

    Czech Academy of Sciences Publication Activity Database

    Klečková, Irena; Cesanek, M.; Fric, Zdeněk; Pellissier, L.

    2015-01-01

    Roč. 92, NOV 01 (2015), s. 255-265 ISSN 1055-7903 R&D Projects: GA ČR GAP505/10/2248 Grant - others:GA JU(CZ) 106/2010/P; GA JU(CZ) 135/2010/P Institutional support: RVO:60077344 Keywords : molecular systematics * Lepidoptera * temperate Subject RIV: EH - Ecology, Behaviour Impact factor: 3.792, year: 2015 http://www.sciencedirect.com/science/article/pii/S1055790315001827

  6. Isolation and characterization of a novel cold-adapted esterase, MtEst45, from Microbulbifer thermotolerans DAU221

    Directory of Open Access Journals (Sweden)

    Yong-Suk eLee

    2016-03-01

    Full Text Available A novel esterase, MtEst45, was isolated from a fosmid genomic library of Microbulbifer thermotolerans DAU221. The encoding gene is predicted to have a mass of 45,564 Da and encodes 495 amino acids, excluding a 21 amino acid signal peptide. MtEst45 showed a low amino acid identity (approximately 23–24% compared with other lipolytic enzymes belonging to Family III, a closely related bacterial lipolytic enzyme family. MtEst45 also showed a conserved GXSXG motif, G131IS133YG135, which was reported as active site of known lipolytic enzymes, and the putative catalytic triad composed of D237 and H265. Because these mutants of MtEst45, which was S133A, D237N, and H265L, had no activity, these catalytic triad essential for the enzyme catalysis. MtEst45 was overexpressed in Escherichia coli BL21 (DE3 and purified via His-tag affinity chromatography. The optimal pH and temperature of MtEst45 were estimated to be 8.17 and 46.27°C by response surface methodology, respectively. Additionally, MtEst45 was also active between 1–15°C. The optimal hydrolysis substrate for MtEst45 among p-nitrophenyl esters (C2–C18 was p-nitrophenyl butyrate, and the Km and Vmax values were 0.0998 mM and 550 μmol/min/mg of protein, respectively. MtEst45 was strongly inhibited by Hg2+, Zn2+, and Cu2+ ions; by phenylmethanesulfonyl fluoride; and by β-mercaptoethanol. Ca2+ did not affect the enzyme’s activity. These biochemical properties, sequence identity, and phylogenetic analysis suggest that MtEst45 represents a novel and valuable bacterial lipolytic enzyme family and is useful for biotechnological applications.

  7. Carotenoid accumulation and carotenogenic gene expression during fruit development in novel interspecific inbred squash lines and their parents.

    Science.gov (United States)

    Nakkanong, Korakot; Yang, Jing Hua; Zhang, Ming Fang

    2012-06-13

    Carotenoid levels and composition during squash fruit development were compared in Cucurbita moschata , Cucurbita maxima , and two lines of their interspecific inbred lines, namely, Maxchata1 and Maxchata2. Eight genes associated with carotenoid biosynthesis were analyzed by quantitative RT-PCR. The two squash species and their interspecific inbred lines exhibited different qualitative and quantitative carotenoid profiles and regulatory mechanisms. C. moschata had the lowest total carotenoid content and mainly accumulated α-carotene and β-carotene, as expected in a fruit with pale-orange flesh. Low carotenoid content in this species was probably due to the comparatively low expression of all genes investigated, especially PSY1 gene, compared to the other squashes. The predominant carotenoids in C. maxima were violaxanthin and lutein, which produced a corresponding yellow flesh color in mature fruit. The relationship between the expression of the CHYB and ZEP genes may result in almost equal concentrations of violaxanthin and lutein in C. maxima at fruit ripening. In contrast, their interspecific inbred lines principally accumulated lutein and β-carotene, leading to orange flesh color. The PSY1 gene exhibited higher expression levels at earlier stages of fruit development in the Maxchata lines, potentially triggering the increased carotenoid accumulation seen in these fruits. Likewise, the higher transcription level of CHYB gene observed in the two interspecific inbred lines might be correlated with high lutein in these hybrids. However, this study could not explain the observed β-carotene accumulation on the basis of gene expression.

  8. Correlations of carotenoid content and transcript abundances for fibrillin and carotenogenic enzymes in Capsicum annum fruit pericarp.

    Science.gov (United States)

    Kilcrease, James; Rodriguez-Uribe, Laura; Richins, Richard D; Arcos, Juan Manuel Garcia; Victorino, Jesus; O'Connell, Mary A

    2015-03-01

    The fruits of Capsicum spp. are especially rich sites for carotenoid synthesis and accumulation, with cultivar-specific carotenoid accumulation profiles. Differences in chromoplast structure as well as carotenoid biosynthesis are correlated with distinct carotenoid accumulations and fruit color. In the present study, the inheritance of chromoplast shape, carotenoid accumulation profiles, and transcript levels of four genes were measured. Comparisons of these traits were conducted using fruit from contrasting variants, Costeño Amarillo versus Costeño Red, and from F1 hybrids; crosses between parental lines with novel versions of these traits. Intermediate chromoplast shapes were observed in the F1, but no association between specific carotenoid accumulation and chromoplast shape was detected. Increased total carotenoid content was associated with increased β-carotene and violaxanthin content. Transcript levels for phytoene synthase (Psy) and β-carotene hydroxylase (CrtZ-2) were positively correlated with increased levels of specific carotenoids. No correlation was detected between transcript levels of capsanthin/capsorubin synthase (Ccs) and carotenoid composition or chromoplast shape. Transcript levels of fibrillin, were differentially correlated with specific carotenoids, negatively correlated with accumulation of capsanthin, and positively correlated with violaxanthin. The regulation of carotenoid accumulation in chromoplasts in Capsicum fruit continues to be a complex process with multiple steps for control. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. Ligninases production by Basidiomycetes strains on lignocellulosic agricultural residues and their application in the decolorization of synthetic dyes Produção de ligninases por linhagens de fungos Basidiomicetos usando resíduos agrícolas lignocelulósicos e aplicação das enzimas na descoloração de corantes sintéticos

    Directory of Open Access Journals (Sweden)

    Eleni Gomes

    2009-03-01

    Full Text Available Wood rotting Basidiomycetes collected in the "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo State, Brazil, concerning Aphyllophorales order and identified as Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp SXS48, Picnoporus sanguineus SXS 43 and Phellinus rimosus SXS47 were tested for ligninases production by solid state fermentation (SSF using wheat bran or rice straw as culture media. C. byrsina produced the highest laccase (200 U mL-1 and Lentinus sp produced the highest activities of manganese peroxidase (MnP and lignin peroxidase (LiP (7 and 8 U mL-1, respectively, when cultivated on wheat bran. The effect of N addition on enzyme production was studied in medium containing rice straw and the data showed an increase of 3 up to 4-fold in the laccase production compared to that obtained in SSF on wheat bran. The laccases presented optimum pH at 3.0-3.5 and were stable at neutral pH values. Optimum pH for MnP and LiP activities was at 3.5 and between 4.5 and 6.0, respectively. All the strains produced laccase with optimum activities between 55-60°C while the peroxidases presented maximum activity at temperatures of 30 to 55°C. The crude enzymes promoted decolorization of chemically different dyes with around 70% of decolorization of RBBR and cybacron blue 3GA in 6h of treatment. The data indicated that enzymes from these basidiomycetes strains are able to decolorize synthetic dyes.Fungos decompositores de madeira, do grupo Basidiomicetes, coletados na "Estação Ecológica do Noroeste Paulista", São José do Rio Preto, São Paulo, Brasil, pertencentes a ordem Aphyllophorales e identificados como Coriolopsis byrsina SXS16, Lentinus strigellus SXS355, Lentinus sp. SXS48, Picnoporus sanguineus SXS 43 e Phellinus rimosus SXS47 foram estudados para a produção de ligninases por FES (fermentação em estado sólido usando farelo de trigo ou palha de arroz como meio de cultura. A espécie C

  10. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  11. Septal Pore Caps in Basidiomycetes, Composition and Ultrastructure

    NARCIS (Netherlands)

    Driel, K.G.A. van

    2007-01-01

    Filamentous fungi, including Ascomycota and Basidiomycota, form mycelia that consist of a network of apical growing hyphae. These hyphae are separated into cellular compartments by septa that have pores of about 70 to 500 nm in diameter. The cytoplasm within the mycelium is thus continuous

  12. New records of truffle fungi (Basidiomycetes) from Turkey

    Science.gov (United States)

    Aziz Turkoglu; Michael Angelo. Castellano

    2013-01-01

    We report the first records of 5 truffle taxa in Turkey: Gymnomyces xanthosporus (Hawker) A.H.Sm., Hymenogaster griseus Vittad., Hymenogaster olivaceous Vittad., Hymenogaster thwaitesii Berk. & Broome, and Hymenogaster vulgaris Tul. & C.Tul. We also report a new...

  13. Decolorization of synthetic dyes and textile effluents by basidiomycetous fungi

    Digital Repository Service at National Institute of Oceanography (India)

    Diwaniyan, S.; Kharb, D.; Raghukumar, C.; Kuhad, R.C.

    of their ability to degrade xenobiotic compounds. Owing to extra- cellular non-specific free-radical-based ligninolytic system of WRF, they can completely eliminate a variety of xenobiotics, including synthetic dyes, giving rise to non-toxic compounds (Kuhad et al... and decolorization and ligninolytic enzymes activity was determined in the cell-free supernatant (CS). 2.5 Decolorization Assays The fungal biomass from each 250-ml Erlenmeyer flask was taken after respective incubation period. It was crushed into a paste...

  14. Interspecific interactions between wood-inhabiting basidiomycetes in boreal forests

    Energy Technology Data Exchange (ETDEWEB)

    Holmer, L.

    1996-05-01

    Studies of competition and succession in communities of wood-decomposing fungi were carried out using laboratory tests with different approaches. Based on results of these tests, an attempt to biologically control Heterobasidion annosum was made in field. Competitive interactions between six species of wood decay fungi were studied using a system of preinoculated wood blocks in unsterilized soil. Two of the species were root-rotting pathogens with a primary resource capture strategy, and four were primarily saprotrophic cord-forming species assumed to use secondary resource capture strategy. Of the species tested, Resinicium bicolor was the most successful in spreading through the soil, and it replaced other species, including the pathogens. When R. bicolor was absent other cord-forming species were able to expand their domain. A new system for measuring competitive success was developed. `Pie slices` were cut from round wood-discs, and after preinoculation, the pieces were paired in all possible combinations on water agar. In this way, inoculum size could be varied while the size of the contact area remained the same. Large mycelia had more competitive success than did smaller ones when paired with the same species. In a pilot study, R. bicolor was most successful in replacing the opposing species and H. annosum had the least success. In general, species found late in the succession were strong competitors, while earlier colonizers had less success. Species acting as selective replacers of primary decay species were found to be more competitive than the latter. 134 refs, 8 figs, 1 tab

  15. Growth of the mycelium of different basidiomycetes on various media

    International Nuclear Information System (INIS)

    Nasreen, Z.; Kausar, T.; Baig, S.; Bajwa, R.

    2008-01-01

    Potato dextrose extract as solid or liquid static media was found best medium tested for both rate and amount of fungal growth of Pleurotus ostreatus, Ganoderma lucidum, Coriolus versicolor and Schizophyllum commune strains. Malt, Yeast and kirk + glucose making second and third respectively, for rate and amount of fungal growth. Kirk+ molasses was the fourth best medium. Addition of sucrose, glucose and molasses as carbon sources, increased the mycelial growth in each fungal species. Similarly, the Highest fresh and dry weight in submerged fermentation was observed for P.ostreatus, G.lucidum. C.versicolor and S.commune in sucrose and glucose as compared to molasses media. (author)

  16. Rate Growth comparison of basidiomycetous fungi isolated in Mexico

    International Nuclear Information System (INIS)

    Rivera-Rios, J. M.; Cruz Ramirez, M. G.; Cruz Madrid, L. C.; Medina Moreno, S. A.; Tellez-Jurado, A.; Mercado-Flores, Y.; Arana-Cuenca, A.

    2009-01-01

    Huejutla de Reyes is a place with a warm-humid climate and counts on an annual average temperature of 30 degree centigrade. We collected fungi that growth in wood or trees with the purpose of isolation this lignionolytic fungi in two seasons (one is spring, before raining station and another one in autumn, during raining station). (Author)

  17. Chapter 5: Organopollutant Degradation by Wood Decay Basidiomycetes

    Science.gov (United States)

    Yitzhak Hadar; Daniel Cullen

    2013-01-01

    Wood decay fungi are obligate aerobes, deriving nutrients from the biological ‘combustion’ of wood, using molecular oxygen as terminal electron acceptor (Kirk and Farrell 1987; Blanchette 1991). Non-specific extracellular enzymes are generally viewed as key components in lignin depolymerization. The major enzymes implicated in lignin degradation are lignin peroxidase (...

  18. Biologically Active Metabolites Produced by the Basidiomycete Quambalaria cyanescens

    Czech Academy of Sciences Publication Activity Database

    Stodůlková, Eva; Císařová, I.; Kolařík, Miroslav; Chudíčková, Milada; Novák, Petr; Man, Petr; Kuzma, Marek; Pavlů, B.; Černý, J.; Flieger, Miroslav

    2015-01-01

    Roč. 10, č. 2 (2015) E-ISSN 1932-6203 R&D Projects: GA ČR GA13-16565S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:61388971 Keywords : ENDOPHYTIC FUNGUS * SP NOV * NAPHTHOQUINONE Subject RIV: EE - Microbiology, Virology Impact factor: 3.057, year: 2015

  19. Preservation of basidiomycete strains on perlite using different protocols

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav

    2014-01-01

    Roč. 55, č. 6 (2014), s. 439-448 ISSN 1340-3540 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Cryopreservation * Laccase * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 1.418, year: 2014

  20. Preservation of live cultures of basidiomycetes - Recent methods

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav

    2014-01-01

    Roč. 118, č. 2 (2014), s. 107-125 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Fungi * Maintenance methods * Long-term preservation Subject RIV: EE - Microbiology, Virology Impact factor: 2.342, year: 2014

  1. Cold adaptive traits revealed by comparative genomic analysis of the eurypsychrophile Rhodococcus sp. JG3 isolated from high elevation McMurdo Dry Valley permafrost, Antarctica.

    Science.gov (United States)

    Goordial, Jacqueline; Raymond-Bouchard, Isabelle; Zolotarov, Yevgen; de Bethencourt, Luis; Ronholm, Jennifer; Shapiro, Nicole; Woyke, Tanja; Stromvik, Martina; Greer, Charles W; Bakermans, Corien; Whyte, Lyle

    2016-02-01

    The permafrost soils of the high elevation McMurdo Dry Valleys are the most cold, desiccating and oligotrophic on Earth. Rhodococcus sp. JG3 is one of very few bacterial isolates from Antarctic Dry Valley permafrost, and displays subzero growth down to -5°C. To understand how Rhodococcus sp. JG3 is able to survive extreme permafrost conditions and be metabolically active at subzero temperatures, we sequenced its genome and compared it to the genomes of 14 mesophilic rhodococci. Rhodococcus sp. JG3 possessed a higher copy number of genes for general stress response, UV protection and protection from cold shock, osmotic stress and oxidative stress. We characterized genome wide molecular adaptations to cold, and identified genes that had amino acid compositions favourable for increased flexibility and functionality at low temperatures. Rhodococcus sp. JG3 possesses multiple complimentary strategies which may enable its survival in some of the harshest permafrost on Earth. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Where do adaptive shifts occur during invasion A multidisciplinary approach to unravel cold adaptation in a tropical ant species invading the Mediterranean zone

    Science.gov (United States)

    Although evolution is now recognized as improving the invasive success of populations, where and when key adaptation event(s) occur often remains unclear. Here we used a multidisciplinary approach to disentangle the eco-evolutionary scenario of invasion of a Mediterranean zone (i.e. Israel) by the t...

  3. A new cold-adapted β-D-galactosidase from the Antarctic Arthrobacter sp. 32c – gene cloning, overexpression, purification and properties

    Directory of Open Access Journals (Sweden)

    Kur Józef

    2009-07-01

    Full Text Available Abstract Background The development of a new cold-active β-D-galactosidases and microorganisms that efficiently ferment lactose is of high biotechnological interest, particularly for lactose removal in milk and dairy products at low temperatures and for cheese whey bioremediation processes with simultaneous bio-ethanol production. Results In this article, we present a new β-D-galactosidase as a candidate to be applied in the above mentioned biotechnological processes. The gene encoding this β-D-galactosidase has been isolated from the genomic DNA library of Antarctic bacterium Arthrobacter sp. 32c, sequenced, cloned, expressed in Escherichia coli and Pichia pastoris, purified and characterized. 27 mg of β-D-galactosidase was purified from 1 L of culture with the use of an intracellular E. coli expression system. The protein was also produced extracellularly by P. pastoris in high amounts giving approximately 137 mg and 97 mg of purified enzyme from 1 L of P. pastoris culture for the AOX1 and a constitutive system, respectively. The enzyme was purified to electrophoretic homogeneity by using either one step- or a fast two step- procedure including protein precipitation and affinity chromatography. The enzyme was found to be active as a homotrimeric protein consisting of 695 amino acid residues in each monomer. Although, the maximum activity of the enzyme was determined at pH 6.5 and 50°C, 60% of the maximum activity of the enzyme was determined at 25°C and 15% of the maximum activity was detected at 0°C. Conclusion The properties of Arthrobacter sp. 32cβ-D-galactosidase suggest that this enzyme could be useful for low-cost, industrial conversion of lactose into galactose and glucose in milk products and could be an interesting alternative for the production of ethanol from lactose-based feedstock.

  4. Heat death in the crayfish Austropotamobius pallipes: thermal inactivation of muscle membrane-bound ATPases in warm and cold adapted animals

    Energy Technology Data Exchange (ETDEWEB)

    Gladwell, R T

    1976-01-01

    The thermal sensitivity of the membrane-bound Mg/sup 2 +/ and Na/sup +/ + K/sup +/ + Mg/sup 2 +/ ATPases from the abdominal flexor muscles of 10 and 25/sup 0/C acclimated animals was investigated. The Mg/sup 2 +/ ATPase was inactivated by milder heat treatments than the Na/sup +/ + K/sup +/ + Mg/sup 2 +/ ATPase. The effect of high lethal temperatures on the Mg/sup 2 +/ ATPase was dependent on the previous thermal history of the animal, the enzyme preparations from 10/sup 0/C acclimated animals being more sensitive than those from 25/sup 0/C acclimated animals. The thermal sensitivity of the Na/sup +/ + K/sup +/ + Mg/sup 2 +/ ATPase was not altered by temperature acclimation. The change in the thermal sensitivity of the Mg/sup 2 +/ ATPase with the acclimation temperature of the whole animal was correlated with the survival times of 10 and 25/sup 0/C acclimated animals. The K/sub m/ and V/sub max/ of the ATPases was investigated and the K/sub m/ of both enzymes was found to decrease with acclimation of the whole animal to lower temperatures, so that enzyme/substrate affinity increased with cold acclimation. It was concluded that the inactivation of the muscle Mg/sup 2 +/ ATPase was the primary lesion of heat death in the crayfish, and that the changes in the kinetic properties of the ATPases were an important mechanism in the process of physiological temperature acclimation.

  5. Distribution, diversity and bioprospecting of bioactive compounds from cryptic fungal communities associated with endemic and cold-adapted macroalgae in Antarctica

    Science.gov (United States)

    We surveyed the distribution and diversity of fungi associated with eight macroalgae from Antarctica and their capability to produce bioactive compounds. The collections yielded 148 fungal isolates identified using molecular methods into 21 genera and 43 species. The most frequent taxa were Geomyces...

  6. The cold-adapted population of Folsomia manolachei (Hexapoda, Collembola) from a glaciated karst doline of Central Europe: evidence for a cryptic species?

    Czech Academy of Sciences Publication Activity Database

    Raschmanová, N.; Žurovcová, Martina; Kováč, Ľ.; Paučulová, L.; Šustr, Vladimír; Jarošová, Andrea; Chundelová, Daniela

    2017-01-01

    Roč. 55, č. 1 (2017), s. 19-28 ISSN 0947-5745 Institutional support: RVO:60077344 Keywords : DNA barcoding * genetic distance * ecophysiology Subject RIV: EG - Zoology OBOR OECD: Zoology Impact factor: 2.444, year: 2016 http://onlinelibrary.wiley.com/doi/10.1111/jzs.12150/abstract

  7. Survival of cold-adapted species in isolated mountains: the population genetics of the Sudeten ringlet, Erebia sudetica sudetica, in Jeseník Mts., Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Konvička, Martin; Mihaly, C. V.; Rákosy, L.; Beneš, Jiří; Schmitt, T.

    2014-01-01

    Roč. 18, č. 2 (2014), s. 153-161 ISSN 1366-638X Grant - others:GA JU(CZ) GAP505/10/1630 Institutional support: RVO:60077344 Keywords : climate change * relic species * subalpine grasslands Subject RIV: EH - Ecology, Behaviour Impact factor: 1.717, year: 2014 http://link.springer.com/article/10.1007%2Fs10841-014-9621-0

  8. Methylovulum psychrotolerans sp. nov., a cold-adapted methanotroph from low-temperature terrestrial environments, and emended description of the genus Methylovulum.

    Science.gov (United States)

    Oshkin, Igor Y; Belova, Svetlana E; Danilova, Olga V; Miroshnikov, Kirill K; Rijpstra, W Irene C; Sinninghe Damsté, Jaap S; Liesack, Werner; Dedysh, Svetlana N

    2016-06-01

    Two isolates of aerobic methanotrophic bacteria, strains Sph1T and Sph2, were obtained from cold methane seeps in a floodplain of the river Mukhrinskaya, Irtysh basin, West Siberia. Another morphologically and phenotypically similar methanotroph, strain OZ2, was isolated from a sediment of a subarctic freshwater lake, Archangelsk region, northern Russia. Cells of these three strains were Gram-stain-negative, light-pink-pigmented, non-motile, encapsulated, large cocci that contained an intracytoplasmic membrane system typical of type I methanotrophs. They possessed a particulate methane monooxygenase enzyme and utilized only methane and methanol. Strains Sph1T, Sph2 and OZ2 were able to grow at a pH range of 4.0-8.9 (optimum at pH 6.0-7.0) and at temperatures between 2 and 36 °C. Although their temperature optimum was at 20-25 °C, these methanotrophs grew well at lower temperatures, down to 4 °C. The major cellular fatty acids were C16 : 1ω5c, C16 : 1ω6c, C16 : 1ω7c, C16 : 1ω8c, C16 : 0 and C14 : 0; the DNA G+C content was 51.4-51.9 mol%. Strains Sph1T, Sph2 and OZ2 displayed nearly identical (99.1-99.7 % similarity) 16S rRNA gene sequences and belonged to the family Methylococcaceae of the class Gammaproteobacteria. The most closely related organism was Methylovulum miyakonense HT12T (96.0-96.5 % 16S rRNA gene sequence similarity and 90 % pmoA sequence similarity). The novel isolates, however, differed from Methylovulum miyakonense HT12T by cell morphology, pigmentation, absence of soluble methane monooxygenase, more active growth at low temperatures, growth over a broader pH range and higher DNA G+C content. On the basis of these differences, we propose a novel species, Methylovulum psychrotolerans sp. nov., to accommodate these methanotrophs. Strain Sph1T (=LMG 29227T=VKM B-3018T) is the type strain.

  9. Distribution patterns of the cold adapted bumblebee Bombus alpinus in the Alps and hints of an uphill shift (Insecta: Hymenoptera: Apidae)

    Czech Academy of Sciences Publication Activity Database

    Biella, Paolo; Bogliani, G.; Cornalba, M.; Manino, A.; Neumayer, J.; Porporato, M.; Rasmont, P.; Milanesi, P.

    2017-01-01

    Roč. 21, č. 2 (2017), s. 357-366 ISSN 1366-638X R&D Projects: GA ČR(CZ) GP14-10035P Grant - others:GA JU(CZ) 152/2016/P Institutional support: RVO:60077344 Keywords : climate change * specialist * rare species Subject RIV: EH - Ecology, Behaviour OBOR OECD: Ecology Impact factor: 1.462, year: 2016 https://link.springer.com/article/10.1007/s10841-017-9983-1

  10. Metabolic cold adaptation and aerobic performance of blue mussels (Mytilus edulis) along a temperature gradient into the High Arctic region

    DEFF Research Database (Denmark)

    Thyrring, Jakob; Rysgaard, Søren; Blicher, Martin

    2015-01-01

    and plasticity of blue mussels across latitudes spanning from 56 to 77ºN. This indicates that low ocean temperature per se does not constrain metabolic activity of Mytilus in the Arctic; rather, we speculate that maturation of reproductive tissues, larval supply and annual energy budgets are the most relevant...

  11. Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

    Science.gov (United States)

    Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

    2016-01-01

    An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

  12. Xylobolus subpileatus, a specialized basidiomycete functionally linked to old canopy gaps

    DEFF Research Database (Denmark)

    Taudiere, A.; Bellanger, J. M.; Moreau, P. A.

    2017-01-01

    Documenting succession in forest canopy gaps provides insights into the ecological processes governing the temporal dynamics of species within communities. We analyzed the fruiting patterns of a rare but widely distributed saproxylic macromycete, Xylobolus subpileatus, during the ageing of natura...

  13. Hydrophobins in the Life Cycle of the Ectomycorrhizal Basidiomycete Tricholoma vaccinum.

    Directory of Open Access Journals (Sweden)

    Dominik Sammer

    Full Text Available Hydrophobins-secreted small cysteine-rich, amphipathic proteins-foster interactions of fungal hyphae with hydrophobic surfaces, and are involved in the formation of aerial hyphae. Phylogenetic analyses of Tricholoma vaccinum hydrophobins showed a grouping with hydrophobins of other ectomycorrhizal fungi, which might be a result of co-evolution. Further analyses indicate angiosperms as likely host trees for the last common ancestor of the genus Tricholoma. The nine hydrophobin genes in the T. vaccinum genome were investigated to infer their individual roles in different stages of the life cycle, host interaction, asexual and sexual development, and with respect to different stresses. In aerial mycelium, hyd8 was up-regulated. In silico analysis predicted three packing arrangements, i.e., ring-like, plus-like and sheet-like structure for Hyd8; the first two may assemble to rodlets of hydrophobin covering aerial hyphae, whereas the third is expected to be involved in forming a two-dimensional network of hydrophobins. Metal stress induced hydrophobin gene hyd5. In early steps of mycorrhization, induction of hyd4 and hyd5 by plant root exudates and root volatiles could be shown, followed by hyd5 up-regulation during formation of mantle, Hartig' net, and rhizomorphs with concomitant repression of hyd8 and hyd9. During fruiting body formation, mainly hyd3, but also hyd8 were induced. Host preference between the compatible host Picea abies and the low compatibility host Pinus sylvestris could be linked to a stronger induction of hyd4 and hyd5 by the preferred host and a stronger repression of hyd8, whereas the repression of hyd9 was comparable between the two hosts.

  14. Biodegradation of tetrabromobisphenol A by oxidases in basidiomycetous fungi and estrogenic activity of the biotransformation products

    Czech Academy of Sciences Publication Activity Database

    Uhnáková, Bronislava; Ludwig, R.; Pěknicová, Jana; Homolka, Ladislav; Lisá, Ludmila; Šulc, Miroslav; Petříčková, Alena; Elzeinová, Fatima; Pelantová, Helena; Monti, D.; Křen, Vladimír; Haltrich, D.; Martínková, Ludmila

    2011-01-01

    Roč. 102, č. 20 (2011), s. 9409-9415 ISSN 0960-8524 R&D Projects: GA MŠk 2B06151 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z50520701 Keywords : White rot fungi * Cellobiose dehydrogenase * Laccase Subject RIV: CE - Biochemistry Impact factor: 4.980, year: 2011

  15. Wood decay by Chlorociboria aeruginascens (Nyl.) Kanouse (Helotiales, Leotiaceae) and associated basidiomycete fungi

    Science.gov (United States)

    Dana L. Richter; Jessie A. Glaeser

    2015-01-01

    Two isolates of Chlorociboria aeruginascens (Nyl.) Kanouse incubated axenically on aspen wood blocks resulted in 18% and 32% mass loss after 134 wks (2 yrs 8 mo). Aspen wood decayed by C. aeruginascens contained cavities in the S2 layer of the secondary cell wall, similar to Type I soft rot attack, as well as erosion troughs and...

  16. Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

    Science.gov (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

    2014-01-01

    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

    Directory of Open Access Journals (Sweden)

    Xianghe Yuan

    2016-02-01

    Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

  18. Lignin-modifying enzymes of Flavodon flavus, a basidiomycete isolated from a coastal marine environment

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; DeSouza, T.M.; Thorn, R.G.; Reddy, C.A.

    seen, but LIP production either was not seen or was minimal. LME rpoduction was also seen in media prepared with artificial seawater. Fast rpotein liquid chromatography and isoelectric focusing resolved LMEs into four isozymes each of MNP and LIP, while...

  19. Cd and Zn interactions and toxicity in ectomycorrhizal basidiomycetes in axenic culture

    Directory of Open Access Journals (Sweden)

    Vinicius H. De Oliveira

    2018-03-01

    Full Text Available Background Metal contamination in soils affects both above- and belowground communities, including soil microorganisms. Ectomycorrhizal (ECM fungi are an important component in belowground community and tolerant strains have great potential in enhancing plant-based remediation techniques. We assessed cadmium and zinc toxicity in five ECM species in liquid media (Hebeloma subsaponaceum; H. cylindrosporum; H. crustuliniforme; Scleroderma sp.; Austroboletus occidentalis and investigated the potential of Zn to alleviate Cd toxicity. Due to highly divergent results reported in the literature, liquid and solid media were compared experimentally for the first time in terms of differential toxicity thresholds in Cd and Zn interactions. Methods A wide range of Cd and Zn concentrations were applied to ectomycorrhizal fungi in axenic cultures (in mg L−1: 0; 1; 3; 9; 27; 81; 243 for the Cd treatments, and 0; 1; 30; 90; 270; 810; 2,430 for Zn. Combined Zn and Cd treatments were also applied to H. subsaponaceum and Scleroderma sp. Dry weight was recorded after 30 days, and in case of solid medium treatments, radial growth was also measured. Results and Discussion All species were adversely affected by high levels of Cd and Zn, and A. occidentalis was the most sensitive, with considerable biomass decrease at 1 mg L−1 Cd, while Scleroderma sp. and H. subsaponaceum were the most tolerant, which are species commonly found in highly contaminated sites. Cd was generally 10 times more toxic than Zn, which may explain why Zn had little impact in alleviating Cd effects. In some cases, Cd and Zn interactions led to a synergistic toxicity, depending on the concentrations applied and type of media used. Increased tolerance patterns were detected in fungi grown in solid medium and may be the cause of divergent toxicity thresholds found in the literature. Furthermore, solid medium allows measuring radial growth/mycelial density as endpoints which are informative and in this case appeared be related to the high tolerance indices found in H. subsaponaceum.

  20. Indole compounds in some culinary-medicinal higher basidiomycetes from Poland.

    Science.gov (United States)

    Muszynska, Bozena; Sutkowska-Ziaja, Katarzyna; Ekiert, Halina

    2011-01-01

    Methanolic extracts of two species collected from natural habitats in Poland, Boletus edulis and Suillus luteus, and one species from a commercial source, Pleurotus ostreatus, were analyzed for the presence of non-hallucinogenic indole compounds. The contents of indole compounds in these species were both qualitatively and quantitatively diverse, ranging from 0.01 to 34.11 mg/100 g d.w. Two of 11 tested indole compounds, 5-hydroxytryptophan (0.18, 2.08, 1.63 mg/100 g d.w.) and serotonin (6.52, 10.14, 34.11 mg/100 g d.w.), were present in all three species under study. B. edulis and S. luteus were found to contain L-tryptophan (0.39 and 2.61 mg/100g d.w.) and melatonin (0.68 and 0.71 mg/100 g d.w.). Tryptamine was present in two species, i.e., B. edulis (1.17 mg/100 g d.w.) and in P. ostreatus (0.91 mg/100 g d.w.), in which slight amounts of indole acetonitrile (0.04 and 0.01 mg/100 g d.w., respectively) were also identified. Indoleacetic acid was a common metabolite for P. ostreatus and S. luteus and its contents amounted to 0.21 and 0.04 mg/100 g d.w., respectively. Indole compounds degradation products kynurenic acid (2.63 mg/100 g d.w.) and kynurenine sulfate were (19.57 mg/100 g d.w.) were observed only in S. luteus.

  1. Cytotoxic activity of methanol extracts from Basidiomycete mushrooms on murine cancer cell lines.

    Science.gov (United States)

    Tomasi, S; Lohézic-Le Dévéhat, F; Sauleau, P; Bézivin, C; Boustie, J

    2004-04-01

    Crude methanol extracts of 58 mushroom species were screened for their cytotoxic activities against two murine cancer cell lines, L1210 and 3LL, using the tetrazolium assay. A majority of extracts (74%) exhibited IC50 > 100 microg/ml against both cell lines. A most marked activity against one of the cell lines was noted for nine species (14% of the tested species). While Amanitales and Russulales tested were not found active, Polyporales and Boletales gave better results. Four species exhibited a significant cytotoxic activity (IC50 Suillus granulatus, S. luteus). The last one had never been investigated for its cytotoxic compounds before.

  2. Highly-efficient liposome-mediated transformation system for the basidiomycetous fungus Flammulina velutipes.

    Science.gov (United States)

    Shi, Liang; Chen, Dongdong; Xu, Chao; Ren, Ang; Yu, Hanshou; Zhao, Mingwen

    2017-07-11

    Flammulina velutipes is a well-known edible mushroom cultivated all over the world. However, because of the low transformation frequency, the expensive instruments required, and the complicated, time-consuming procedures necessary, there is insufficient genetic research on F. velutipes. In this study, we report a liposome-mediated transformation (LMT) system for the genetic transformation of F. velutipes. Using the LMT system, we obtained 82 ± 4 stable F. velutipes transformants per 10 5 protoplasts, which is a clear increase in transformation frequency compared to the other methods used. We were able to detect the expression of an EGFP reporter gene in the F. velutipes transformants using fluorescence imaging assays. Furthermore, we used this method to transfer the laccase gene into F. velutipes and found that the transcriptional level and enzymatic activity increased in these transformants. Mitotic stability analysis showed that all of the selected transformants remained mitotically stable, even after five successive rounds of sub-culturing. These results demonstrate a new transgenic approach that will facilitate F. velutipes research.

  3. Rapid polyether cleavage via extracellular one-electron oxidation by a brown-rot basidiomycete

    OpenAIRE

    Kerem, Zohar; Bao, Wuli; Hammel, Kenneth E.

    1998-01-01

    Fungi that cause brown rot of wood are essential biomass recyclers and also the principal agents of decay in wooden structures, but the extracellular mechanisms by which they degrade lignocellulose remain unknown. To test the hypothesis that brown-rot fungi use extracellular free radical oxidants as biodegradative tools, Gloeophyllum trabeum was examined for its ability to depolymerize an environmentally recalcitrant polyether, poly(ethylene oxide) (PEO), that cannot penetrate cell membranes....

  4. Rapid polyether cleavage via extracellular one-electron oxidation by a brown-rot basidiomycete.

    Science.gov (United States)

    Kerem, Z; Bao, W; Hammel, K E

    1998-09-01

    Fungi that cause brown rot of wood are essential biomass recyclers and also the principal agents of decay in wooden structures, but the extracellular mechanisms by which they degrade lignocellulose remain unknown. To test the hypothesis that brown-rot fungi use extracellular free radical oxidants as biodegradative tools, Gloeophyllum trabeum was examined for its ability to depolymerize an environmentally recalcitrant polyether, poly(ethylene oxide) (PEO), that cannot penetrate cell membranes. Analyses of degraded PEOs by gel permeation chromatography showed that the fungus cleaved PEO rapidly by an endo route. 13C NMR analyses of unlabeled and perdeuterated PEOs recovered from G. trabeum cultures showed that a major route for depolymerization was oxidative C---C bond cleavage, a reaction diagnostic for hydrogen abstraction from a PEO methylene group by a radical oxidant. Fenton reagent (Fe(II)/H2O2) oxidized PEO by the same route in vitro and therefore might account for PEO biodegradation if it is produced by the fungus, but the data do not rule out involvement of less reactive radicals. The reactivity and extrahyphal location of this PEO-degrading system suggest that its natural function is to participate in the brown rot of wood and that it may enable brown-rot fungi to degrade recalcitrant organopollutants.

  5. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  6. Effect of phenol on the mycelial growth and fructification in some of basidiomycetous fungi.

    Science.gov (United States)

    Upadhyay, R C; Hofrichter, M

    1993-01-01

    Cometabolic growth studies with phenol were undertaken to screen 32 strains of white and brown rot fungi. All the cultures studied grew well up to 4 mM of phenol on Czapekdox agar except Agaricus bisporus (white button mushroom) and Pleurotus cystidiosus. Most of them could grow even up to 6 mM of phenol. Phenol induced a brown pigmentation of the culture medium. P. flabellatus and P. pulmonarius metabolized 67 and 64 mg/l phenol in 10 days. Studies have indicated that phenol (0.1 to 1.0 mM) incorporated in malt-extract agar has no inhibitory effect on fruitbody formation. Preliminary studies indicate that soaking of wheat straw with phenol solution up to 1600 mg/l give better mycelial growth and fructification of P. cornucopiae, P. ostreatus Z-15 and Calocybe indica than water soaked. Soaking of wheat straw in phenol inhibited the growth of common competitor weed fungi like Stachybotrys sp. and Coprinus sp.

  7. Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

    Science.gov (United States)

    Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

    2015-07-01

    Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

  8. Cytotoxic grifolin derivatives isolated from the wild mushroom Boletus pseudocalopus (Basidiomycetes).

    Science.gov (United States)

    Song, Junsik; Manir, Md Maniruzzaman; Moon, Surk-Sik

    2009-09-01

    Activity-guided purification of a MeOH extract of the Korean wild mushroom Boletus pseudocalopus afforded three new grifolin derivatives, 1-3, along with four known phenolic compounds 4-7. Their structures were established by a combination of 1H- and 13C-NMR, NOESY, and extensive two-dimensional NMR spectroscopic experiments such as gCOSY, gHSQC, gHMBC, and ROESY. The major metabolites 4 and 5 were subjected to reduction to provide the side chain-reduced compounds 8 and 9 for biological testing. All of the compounds except compound 6 showed anticancer activities in the range of IC(50) 3.5-11.0 microg/ml against human lung carcinoma A549 and mouse melanoma B16F1 cell lines. In addition, all compounds showed moderate radical-scavenging activities determined by DPPH assay.

  9. Concentration and behavior of radiocesium in higher basidiomycetes in some Kanto and the Koshin districts, Japan

    International Nuclear Information System (INIS)

    Sugiyama, Hideo; Iwashima, Kiyoshi; Shibata, Hisashi.

    1990-01-01

    Concentration of 137 Cs, 134 Cs and potassium were measured in several higher fungi and in substrates, soils, woods and litters in some Kanto and the Koshin districts, Japan, following the Chernobyl accident during October to November 1989. 137 Cs concentrations in fungi were in the range of 0.7-101 Bq kg -1 · fresh. Maximum 137 Cs level in them was observed in Boletopsis leucomelas (Pers.: Fr.) Fayod. Significantly higher levels of concentration ratios of 137 Cs in fungi to substrates (e.g.; 137 Cs concentration · fresh in fungus/ 137 Cs concentration · dry in soil), 10 -1 to 10 x 10 -1 , were found nearly 10 to 1000 times as much as leaf vegetables, root crops and potatoes to substrates. It was confirmed that levels of concentration ratios of potassium were similar to those of 137 Cs. In all fungi, 134 Cs which released from the Chernobyl accident and is not present in nuclear weapons fallout was not detected. (author)

  10. Hydrolysis of residuals of barley straw using white-rot basidiomycetes

    International Nuclear Information System (INIS)

    Lazaro-Anell, A. C.; Arana-Cuenca, A.; Tellez-Jurado, A.

    2009-01-01

    The imminent term of the fossil fuels has generated different initiatives focused to the development of a alternative fuels in the entire world, one of the main alternatives for the bio combustible production is the agricultural waste, all they have as main characteristic those of being compound for 3 biopolymers that represent, one of the biggest renewable sources of energy. (Author)

  11. Saprotrophic basidiomycete mycelia and their interspecific interactions affect the spatial distribution of extracellular enzymes in soil

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Dobiášová, Petra; Větrovský, Tomáš; Valášková, Vendula; Alawi, A.; Boddy, L.; Baldrian, Petr

    2011-01-01

    Roč. 78, č. 1 (2011), s. 80-90 ISSN 0168-6496 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) OC10064 Institutional research plan: CEZ:AV0Z50200510 Keywords : decomposition * forest soil * fungal ecology Subject RIV: EE - Microbiology, Virology Impact factor: 3.408, year: 2011

  12. Chemical composition of litter affects the growth and enzyme production by the saprotrophic basidiomycete Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Voříšková, Jana; Dobiášová, Petra; Šnajdr, Jaroslav; Vaněk, D.; Cajthaml, Tomáš; Šantrůčková, D.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 417-426 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk(CZ) ME10028; GA MŠk(CZ) LA10001 Institutional research plan: CEZ:AV0Z50200510 Keywords : Extracellular enzymes * decomposition * fungal biomass Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  13. Ability of some species of fungi of the Basidiomycetes class to degrade cellulose and lignocellulose substrates

    Directory of Open Access Journals (Sweden)

    Zdzisław Tagoński

    2014-08-01

    Full Text Available Studies were carried-out on the ability of 18 strains of 15 white-rot and brown-rot basidiomycetons fungi to degrade wood components and to synthesize cellulolytic enzymes and laccase. 28,5% lignin and 26,1% carbohydrates of pine wood meal, 46,2% lignin and 67,8% carbohydrates of beech wood meal was degraded after 6 weeks incubation by the white-rot fungus Phanerochate chrysosporium. The highest activity of laccase was obtained in from fungi Coriotus zonatus and Fomes fomentarius.

  14. Differetial degradation of oak (Quercus petraea) leaf litter by litter-decomposing basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Steffen, K. T.; Cajthaml, Tomáš; Šnajdr, Jaroslav; Baldrian, Petr

    2007-01-01

    Roč. 158, č. 5 (2007), s. 447-455 ISSN 0923-2508 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : biopolymers * carbohydrate * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.219, year: 2007

  15. Production and regulation of lignocellulose-degrading enzymes of Poria-like wood-inhabiting basidiomycetes

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, M.; Popelářová, Petra; Baldrian, Petr

    2009-01-01

    Roč. 54, č. 1 (2009), s. 74-80 ISSN 0015-5632 R&D Projects: GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : FUNGUS DICHOMITUS-SQUALENS * WHITE-ROT FUNGI * CERIPORIOPSIS-SUBVERMISPORA Subject RIV: EE - Microbiology, Virology Impact factor: 0.978, year: 2009

  16. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2002-01-01

    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  17. Comparative Study of Worldwide Species of Genus Lentinus (=Lentinula, Higher Basidiomycetes) Based on Linear Mycelium Growth.

    Science.gov (United States)

    Mata, Juan Luis; Mishra, Nutan Tulapurkar

    2015-01-01

    Species of mushroom genus Lentinus (=Lentinula) are best known for the commercially important and extensively studied culinary-medicinal shiitake, L. edodes. A few mycelium growth studies have focused on Lentinus boryana, but information is lacking for L. raphanica and L. aciculospora, endemic to the Americas. In this study, 14 dikaryon strains representing 5 Lentinus species were grown on 5 nutritive agar media at increments of 5°C. Growth for each species was significantly slower on corn meal agar, but no differences were found among malt extract, potato dextrose, malt peptone, and yeast malt extract agars. Lentinus aciculospora and L. boryana consistently exhibited the slowest mycelium growth rates among all species and across all temperatures tested, with optima at 15°C and 20°C. The fastest mycelium growth rates for L. edodes, L. novaezelandiae, and L. raphanica occurred at 25°C. Strains of the latter continued to grow well at 30°C, whereas growth of the other 2 species declined significantly. Differences in mycelium growth rates for American strains could be partially explained by their geographic locations, indicating that understanding this physiological parameter has important ramifications for the edible mushroom industry.

  18. Cellulase production by white-rot basidiomycetous fungi: solid-state versus submerged cultivation

    DEFF Research Database (Denmark)

    Bentil, Joseph A.; Thygesen, Anders; Mensah, Moses

    2018-01-01

    fungi for improved enzyme expression, as well as on-site approaches for production of enzyme blends for industrial biomass conversion. The quantitative comparisons made have implications for selection of the most appropriate cultivation method for WRB fungi for attaining maximal cellulase production....... on different biomass residues in SSC or SmC systems. Although some variation in cellulase production yields have been reported for certain substrates, the analysis convincingly shows that SmC is generally more efficient than SSC for obtaining high cellulase production yields and high cellulase production rates......) or submerged cultivation (SmC) systems. In this review, we quantitatively assess the data available in the literature on cellulase production yields by WRB fungi cultivated by SSC or SmC. The review also assesses cellulolytic enzyme production rates and enzyme recovery when WRB fungi are cultivated...

  19. Characterisation of recombinant pyranose oxidase from the cultivated mycorrhizal basidiomycete Lyophyllum shimeji (hon-shimeji

    Directory of Open Access Journals (Sweden)

    Yamabhai Montarop

    2010-07-01

    Full Text Available Abstract Background The flavin-dependent enzyme pyranose 2-oxidase (P2Ox has gained increased attention during the last years because of a number of attractive applications for this enzyme. P2Ox is a unique biocatalyst with high potential for biotransformations of carbohydrates and in synthetic carbohydrate chemistry. Recently, it was shown that P2Ox is useful as bioelement in biofuel cells, replacing glucose oxidase (GOx, which traditionally is used in these applications. P2Ox offers several advantages over GOx for this application, e.g., its much broader substrate specificity. Because of this renewed interest in P2Ox, knowledge on novel pyranose oxidases isolated from organisms other than white-rot fungi, which represent the traditional source of this enzyme, is of importance, as these novel enzymes might differ in their biochemical and physical properties. Results We isolated and over-expressed the p2ox gene encoding P2Ox from the ectomycorrhizal fungus Lyophyllum shimeji. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+ and successfully expressed in E. coli Rosetta 2. We obtained active, flavinylated recombinant P2Ox in yields of approximately 130 mg per L of medium. The enzyme was purified by a two-step procedure based on anion exchange chromatography and preparative native PAGE, yielding an apparently homogenous enzyme preparation with a specific activity of 1.92 U/mg (using glucose and air oxygen as the substrates. Recombinant P2Ox from L. shimeji was characterized in some detail with respect to its physical and catalytic properties, and compared to the well-characterised enzymes from Phanerochaete chrysosporium and Trametes multicolor. Conclusion L. shimeji P2Ox shows properties that are comparable to those of P2Ox from white-rot fungal origin, and is in general characterised by lower Km and kcat values both for electron donor (sugar as well as electron acceptor (ferrocenium ion, 1,4-benzoquinone, 2,6-dichloroindophenol. While L. shimeji P2Ox is the least thermostable of these three enzymes (melting temperature Tm of 54.9°C; half-life time of activity τ1/2 of 0.12 at 50°C and pH 6.5, P. chrysosporium P2Ox showed remarkable thermostability with Tm of 75.4°C and τ1/2 of 96 h under identical conditions.

  20. Wood-inhabiting ligninolytic basidiomycetes in soils: Ecology and constraints for applicability in bioremediation

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr

    2008-01-01

    Roč. 1, č. 1 (2008), s. 4-12 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA MŠk OC 155 Institutional research plan: CEZ:AV0Z50200510 Keywords : bioremedation * ecology * interspecific interactions Subject RIV: EE - Microbiology, Virology

  1. Decomposition, nitrogen and phosphorus mineralization from beech leaf litter colonized with ectomycorrhizal or litter decomposing basidiomycetes

    OpenAIRE

    COLPAERT, Jan; VAN TICHELEN, Katia

    1996-01-01

    The decomposition and the nitrogen and phosphorus mineralization of fresh beech (Fagus sylvatica L.) leaf litter are described. Leaves were buried for up to 6 months in plant containers in which Scots pine (Pinus sylvestris L.) seedlings were cultivated at a low rate of nutrient addition. The saprotrophic abilities of three ectomycorrhizal fungi, Thelephora terrestris Ehrh.: Fr., Suillus bovinus (L.: Fr.) O. Kuntze and Paxillus involutes (Batsch: Fr) Fr., were compared with the degradation ca...

  2. Nutritional and neutraceutical composition of five wild culinary-medicinal species of genus Pleurotus (higher Basidiomycetes) from northwest India.

    Science.gov (United States)

    Atri, N; Sharma, Sapan Kumar; Joshi, Robin; Gulati, Ashu; Gulati, Arvind

    2013-01-01

    Five wild culinary-medicinal species of genus Pleurotus (Fr.) P. Kumm. (P. floridanus Singer, P. pulmonarius (Fr.) Quél., P. sapidus Quél., P. cystidiosus O.K. Miller, and P. sajor-caju (Fr.) Singer), collected from different localities of Northwest India, were studied for their nutritional and nutraceutical composition. Composition analysis of nutrients involved determining proteins, fats, ash, fiber, and carbohydrates using standard biochemical techniques. Minerals were estimated by an atomic absorption spectrophotometer and toxic metals were determined by the Reinsch test method. The analysis of nutraceuticals included determination of sugars by high-performance liquid chromatography, fatty acids by gas chromatography, and antioxidants such as β-carotene, lycopene, and total phenolic compounds with methanolic extract using a colorimetric assay. In the samples analyzed, carbohydrates dominated over protein and other macronutrients. Carbohydrates ranged from 85.86 to 88.38%, protein 0.98 to 2.17%, crude fat 0.62 to 0.84%, crude fibers 2.76 to 3.12%, and ash content 1.03 to 2.20%. Macro- and microminerals (calcium, magnesium, sodium, potassium, copper, zinc, and iron) also were found in substantial amount, whereas toxic metals (lead, silver, arsenic, mercury, and antimony) were not detected. Three main sugars-sucrose (0.338-2.011%), glucose (0.553-0.791%), and xylose (0.01%)-were detected. Among fatty acids, monounsaturated fatty (37.17-68.29%) acids were documented in a higher proportion than saturated fatty acids (26.07-47.77%). In terms of antioxidant composition, all species contained ascorbic acid, phenols, carotene, and lycopene. Ascorbic acid content ranged from 0.46 to 0.49 mg/100 g, total phenolic compounds ranged from 6.76 to 16.92 mg/100 g of gallic acid, β-carotene ranged from 0.134 to 0.221 μg/100 g, and lycopene from 0.055 to 0 .075 μg/100 g.

  3. Antioxidant Potential of Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum (Higher Basidiomycetes) Cultivated on Artocarpus heterophyllus Sawdust Substrate in India.

    Science.gov (United States)

    Rani, P; Lal, Merlin Rajesh; Maheshwari, Uma; Krishnan, Sreeram

    2015-01-01

    The artificial cultivation of Ganoderma lucidum (MTCC1039) using Artocarpus heterophyllus as sawdust substrate was optimized and free radical scavenging activities of the generated fruiting bodies were investigated. The choice of A. heterophyllus as substrate was due to its easy availability in South India. Sawdust supplemented with dextrose medium yielded better spawn hyphae and early fruiting body initiation (15 days). The biological yield obtained was 42.06 ± 2.14 g/packet and the biological efficiency was 8.41 ± 0.48%. Both aqueous and methanolic extracts of fruiting body were analyzed for radical scavenging activity. Methanolic extract showed maximum scavenging activity for 1,1-diphenyl-2-picrylhydrazyl (IC50 = 290 μg/ml) and 2,2'-azino-bis(3-ethylbenzothiazoline- 6-sulphonic acid (IC50 = 580 μg/ml), whereas aqueous extract had better scavenging for ferric reducing antioxidant power (IC50 = 5 μg/ml). Total phenolic content and total antioxidant capacity were significantly higher in methanolic extract (p < 0.01). A positive correlation existed between the phenolic content and antioxidant activity. Our results indicated that fruiting bodies of G. lucidum cultivated in sawdust medium possess antioxidant property, which can be exploited for therapeutic application.

  4. An application of wastewater treatment in a cold environment and stable lipase production of Antarctic basidiomycetous yeast Mrakia blollopis.

    Directory of Open Access Journals (Sweden)

    Masaharu Tsuji

    Full Text Available Milk fat curdle in sewage is one of the refractory materials for active sludge treatment under low temperature conditions. For the purpose of solving this problem by using a bio-remediation agent, we screened Antarctic yeasts and isolated SK-4 strain from algal mat of sediments of Naga-ike, a lake in Skarvsnes, East Antarctica. The yeast strain showed high nucleotide sequence homologies (>99.6% to Mrakia blollopis CBS8921(T in ITS and D1/D2 sequences and had two unique characteristics when applied on an active sludge; i.e., it showed a potential to use various carbon sources and to grow under vitamin-free conditions. Indeed, it showed a biochemical oxygen demand (BOD removal rate that was 1.25-fold higher than that of the control. We considered that the improved BOD removal rate by applying SK-4 strain was based on its lipase activity and characteristics. Finally, we purified the lipase from SK-4 and found that the enzyme was quite stable under wide ranges of temperatures and pH, even in the presence of various metal ions and organic solvents. SK-4, therefore, is a promising bio-remediation agent for cleaning up unwanted milk fat curdles from dairy milk wastewater under low temperature conditions.

  5. Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

    Science.gov (United States)

    Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

    2015-01-01

    The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

  6. Hypocholesterolemic Effects of the Cauliflower Culinary-Medicinal Mushroom, Sparassis crispa (Higher Basidiomycetes), in Diet-Induced Hypercholesterolemic Rats.

    Science.gov (United States)

    Hong, Ki Bae; Hong, Sung-Yong; Joung, Eun Young; Kim, Byung Hee; Bae, Song-Hwan; Park, Yooheon; Suh, Hyung Joo

    2015-01-01

    The cauliflower culinary-medicinal mushroom, Sparassis crispa, possesses various biological activities that have been widely reported to have therapeutic applications. We examined the effects of S. crispa on serum cholesterol, hepatic enzymes related to cholesterol metabolism, and fecal sterol excretion in rats fed a cholesterol-rich diet for 4 weeks. Male Sprague-Dawley rats (8 weeks old) were randomly divided into 5 groups (n = 6 mice per group): normal diet (normal control [NC]), cholesterol-rich diet (cholesterol control [CC]), cholesterol-rich diet plus S. crispa fruiting body (SC), cholesterol-rich diet plus S. crispa extract (SCE), and cholesterol-rich diet plus S. crispa residue (SCR). SCE supplementation significantly enhanced hepatic cholesterol catabolism through the upregulation of cholesterol 7α-hydroxylase (CYP7A1) messenger RNA (mRNA) expression (2.55-fold compared with that in the NC group; P < 0.05) and the downregulation of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase mRNA expression (0.57-fold compared with that in the NC group; P < 0.05). Additionally, the SCE diet resulted in the highest fecal excretion of cholesterol and bile acid in hypercholesterolemic rats. In conclusion, mRNA expression of CYP7A1 and HMG-CoA reductase were significantly modulated by the absorption of SCE samples. Also, SCE samples had a significant effect on fecal bile acid and cholesterol excretion. These results suggest that SCE samples can induce hypocholesterolic effects through cholesterol metabolism and the reduction of circulating cholesterol levels.

  7. Transcriptome analysis and its application in identifying genes associated with fruiting body development in basidiomycete Hypsizygus marmoreus.

    Directory of Open Access Journals (Sweden)

    Jinjing Zhang

    Full Text Available To elucidate the mechanisms of fruit body development in H. marmoreus, a total of 43609521 high-quality RNA-seq reads were obtained from four developmental stages, including the mycelial knot (H-M, mycelial pigmentation (H-V, primordium (H-P and fruiting body (H-F stages. These reads were assembled to obtain 40568 unigenes with an average length of 1074 bp. A total of 26800 (66.06% unigenes were annotated and analyzed with the Kyoto Encyclopedia of Genes and Genomes (KEGG, Gene Ontology (GO, and Eukaryotic Orthologous Group (KOG databases. Differentially expressed genes (DEGs from the four transcriptomes were analyzed. The KEGG enrichment analysis revealed that the mycelium pigmentation stage was associated with the MAPK, cAMP, and blue light signal transduction pathways. In addition, expression of the two-component system members changed with the transition from H-M to H-V, suggesting that light affected the expression of genes related to fruit body initiation in H. marmoreus. During the transition from H-V to H-P, stress signals associated with MAPK, cAMP and ROS signals might be the most important inducers. Our data suggested that nitrogen starvation might be one of the most important factors in promoting fruit body maturation, and nitrogen metabolism and mTOR signaling pathway were associated with this process. In addition, 30 genes of interest were analyzed by quantitative real-time PCR to verify their expression profiles at the four developmental stages. This study advances our understanding of the molecular mechanism of fruiting body development in H. marmoreus by identifying a wealth of new genes that may play important roles in mushroom morphogenesis.

  8. Effect of cultural conditions on antrodin C production by basidiomycete Antrodia camphorata in solid-state fermentation.

    Science.gov (United States)

    Xia, Yongjun; Wang, Yuanlong; Zhang, Bobo; Xu, Ganrong; Ai, Lianzhong

    2014-01-01

    Antrodia camphorata is a medicinal fungus and antrodin C is one of the main bioactive components of A. camphorata in the submerged fermentation (SmF). To optimize the culture conditions, the factors influencing the production of antrodin C by A. camphorata under solid-state fermentation (SSF) were investigated in this study. Different solid substrates and external nitrogen sources were tested for their efficiency in producing antrodin C. The response surface methodology was applied to evaluate the influence of several variables, namely, the concentrations of soybean meal, initial moisture content, and inoculum density on antrodin C production in solid-state fermentation. The experimental results show that the optimum fermentation medium for antrodin C production by A. camphorata was composed of 0.578 g soybean meal, 0.05 g Na2 HPO4 , 0.05 g MgSO4 for 100 g rice, with 51.83% initial moisture content, 22 day culture time, 28 °C culture temperature, and 35.54% inoculum density. At optimized conditions, 6,617.36 ± 92.71 mg kg(-1) yield of antrodin C was achieved. Solid-state fermentation is one good cultural method to improve the production of antrodin C by A. camphorata. © 2014 International Union of Biochemistry and Molecular Biology, Inc.

  9. Registro preliminar de Basidiomycetes del Páramo De Ocetá (Monguí-Boyacá, Colombia

    Directory of Open Access Journals (Sweden)

    Helbert David Siabatto F.

    2005-07-01

    órdenes: Agaricales, Afiloforales, Lycoperdales y Russulales. Se realizó un análisis de acuerdo al gradiente altitudinal muestreado (3.265 a 3.455 msnm y su incidencia en la morfología, indicando posibles adaptaciones en contraste a colecciones consultadas.

  10. Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

    Science.gov (United States)

    Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2013-01-01

    With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

  11. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    Science.gov (United States)

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos.

  12. Fire and the production of Astraeus odoratus (Basidiomycetes sporocarps in deciduous dipterocarp-oak forests of northern Thailand

    Directory of Open Access Journals (Sweden)

    Keegan H. Kennedy

    2012-12-01

    Full Text Available The genus Astraeus (Diplocystidiaceae forms ectomycorrhizal associations with many tree species and is a common gasteromycete in tropical and temperate ecosystems worldwide. In Thailand, Astraeus is most prevalent in deciduous dipterocarp-oak forest (DOF in the north and north-east and its ecology is uniquely associated with fire. Rural villagers often burn the seasonally dry DOF ground vegetation causing significant environmental disturbance to promote the growth of Astraeus sporocraps—a local culinary delicacy and important source of household income. The purpose of this work is to investigate whether the practice of burning DOF stimulates the production of Astraeus sporocarps in DOF. Burned and unburned Astraeus habitat was surveyed over two years at two sites in Chiang Mai province and one site in Mae Hong Son province. Changes in soil fungi after a fire as well as vascular vegetation growing with Astraeus were studied. All sporocarps collected were identified as Astraeus odoratus. Astraeus sporocarps were found in both burned and unburned areas in 2010. In 2011, an unusually wet year, no sporocarps were found in burned or unburned areas. The top 2 cm of soil experienced high temperatures which killed fungi, but lower depths were well insulated from the heat. A wide range of vascular flora grew in Astraeus habitat, the most common tree species being Dipterocarpus tuberculatus var. tuberculatus and Dipterocarpus obtusifolius var. obtusifolius. This study shows that Astraeus can produce sporocarps without fire and future work can focus on more environmentally benign methods of harvesting this popular mushroom.

  13. Immunolocalization of hydrophobin HYDPt-1 from the ectomycorrhizal basidiomycete Pisolithus tinctorius during colonization of Eucalyptus globulus roots

    NARCIS (Netherlands)

    Tagu, D; De Bellis, R; Balestrini, R; De Vries, OMH; Piccoli, G; Stocchi, [No Value; Bonfante, P; Martin, F

    The immunolocalization of one of the hydrophobins of Pisolithus tinctorius (HYDPt-1) is reported. Hydrophobin proteins play key roles in adhesion and aggregation of fungal hyphae, and it is already known that formation of ectomycorrhizas on eucalypt roots enhances the accumulation of hydrophobin

  14. Cryptococcus haglerorum, sp. nov., an anamorphic basidiomycetous yeast isolated from nests of the leaf-cutting ant Atta sexdens.

    NARCIS (Netherlands)

    Middelhoven, W.J.; Fonseca, A.; Carreiro, S.C.; Pagnocca, F.C.; Bueno, O.C.

    2003-01-01

    A yeast strain (CBS 8902) was isolated from the nest of a leaf-cutting ant and was shown to be related to Cryptococcus humicola. Sequencing of the D1/D2 region of the 26S ribosomal DNA and physiological characterization revealed a separate taxonomic position. A novel species named Cryptococcus

  15. Immunomodulatory activities of different solvent extracts from Tricholoma matsutake (S. Ito et S. Imai) singer (higher basidiomycetes) on normal mice.

    Science.gov (United States)

    Yin, Xiulian; You, Qinghong; Jiang, Zhonghai

    2012-01-01

    The immunomodulatory activities of different solvent extracts from the culinary-medicinal mushroom Tricholoma matsutake were studied in vivo in normal mice. The extracts were prepared using different solvents in an order of increasing polarity. The immunomodulatory activities were investigated by measuring the thymus and spleen index, phagocytic rate of macrophage phagocytosis, delayed-type hypersensitivity, plaque-forming cell, and proliferation of splenocytes. Results demonstrated that water extract (WE) and n-butyl alcohol extract (BAE) of T. matsutake could enhance the immunity of mice significantly compared with the control group. Main components of WE and BAE were polysaccharides, proteins, and flavonoids; we presume that these may be the main immunomodulating and immuno-enhancing agents in T. matsutake.

  16. Extraction, Antimicrobial, and Antioxidant Activities of Crude Polysaccharides from the Wood Ear Medicinal Mushroom Auricularia auricula-judae (Higher Basidiomycetes).

    Science.gov (United States)

    Cai, Ming; Lin, Yang; Luo, Yin-long; Liang, Han-hua; Sun, Pei-long

    2015-01-01

    In this study, crude polysaccharides of culinary-medicinal mushroom Auricularia auricular-judae were extracted by hot water extraction and alcohol precipitation, and their antimicrobial and antioxidant activities were investigated. An optimum extraction condition was obtained at a ratio of liquid to solid 70 mL/g, temperature 90°C, time 4 h and extraction number 4. Accordingly, the best yield of crude polysaccharides was 6.89% with 76.12% in purity. Some bacteria and fungi were used for antimicrobial studies. It was found that crude A. auricula-judae had great antimicrobial activities against Escherichia coli and Staphylococcus aureus, but no activities on the others. The inhibitory diameters of antimicrobial zones for the two were 5.55 ± 0.182 and 9.84 ± 0.076 mm, respectively. Moreover, crude A. auricula-judae had significant antioxidant activities in scavenging free radicals, reducing power assays, and Fe2+ chelating ability assay. Results revealed that crude A. auricula-judae has a great potential as antimicrobial and antioxidant, and it can be a supplementary food for human health.

  17. Mating tests among geographically separated collections of the Trametes versicolor (Fr.) Pilát (Basidiomycetes, Polyporales) group

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 79, 3-4 (2004), s. 425-431 ISSN 0029-5035 R&D Projects: GA ČR GA526/02/1216; GA ČR GD206/03/H137 Institutional research plan: CEZ:AV0Z5020903 Keywords : trametes versicolor * mating tests Subject RIV: EE - Microbiology, Virology Impact factor: 0.594, year: 2004

  18. Production of lignocellulose-degrading enzymes and degradation of leaf litter by saprotrophic basidiomycetes isolated from a Quercus petraea forest

    Czech Academy of Sciences Publication Activity Database

    Valášková, Vendula; Šnajdr, Jaroslav; Bittner, B.; Cajthaml, Tomáš; Merhautová, Věra; Hoftrichter, M.; Baldrian, Petr

    2007-01-01

    Roč. 39, č. 10 (2007), s. 2651-2660 ISSN 0038-0717 R&D Projects: GA ČR GA526/05/0168; GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellulose * hemicelluloses * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 2.580, year: 2007

  19. Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Manohar, C.S.; Boekhout, T.; Muller, W.H.; Stoeck, T.

    with Anaeroclip® clips and Anaerotest® indicatorwere incubated at 25ºC, according to the 4 manufacturer’s instructions, either directly orafter oxicpre-incubation for 24 or 48 h. Growth was inspected at regular intervals up to one year. 2.3 Electron... °C. The PCR amplicons were purified using GenEluteTMGel Extraction kit (Sigma Aldrich, USA) and cloned individually for each gene using the TA cloning kit (Invitrogen, USA) according to the manufacturer’s instructions. A representative clone...

  20. Medicinal Mushroom Cracked-Cap Polypore, Phellinus rimosus (Higher Basidiomycetes) Attenuates Acute Ethanol-Induced Lipid Peroxidation in Mice.

    Science.gov (United States)

    Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K

    2015-01-01

    Alcohol abuse and alcoholism remain one of the major health issues worldwide, especially in developing countries. The protective effect of Phellinus rimosus against acute alcohol-induced lipid peroxidation in the liver, kidney, and brain as well as its effect against antioxidant enzyme activity such as superoxide (SOD) and catalase (CAT) in the liver was evaluated in mice. Ethyl acetate extract of Ph. Rimosus (50 mg/kg body wt, p.o.) 1 h before each administration of alcohol (3 mL/kg, p.o.; total 2 doses at 24-h intervals) protected against lipid peroxidation in all organs and attenuated the decline of SOD and CAT activity in the liver. The fold increase in lipid peroxidation, including conjugated diene and thiobarbituric acid reactive substance (TBARS) levels, was highest in the liver. There were 2.6- and 1.5- fold increases in TBARS levels in the liver of the alcohol alone- and alcohol+Ph. Rimosus-treated groups, compared with that of the normal group. Activity of SOD and CAT in the liver of alcohol- and alcohol+Ph. Rimosus- treated animals was 9.05±1.38, 18.76±1.71, and 11.26±1.02, 31.58±3.35 IU/mg protein, respectively. Extract at 1 mg/mL inhibited 50.6% activity of aniline hydroxylase (CYP2E1) in liver homogenate. From these results, we concluded that the extract significantly protected against the lipid peroxidation. Protection in the liver may be due to the inhibitory effect on CYP2E1 as well as the direct radical scavenging effect of Ph. Rimosus, which warrants further research.

  1. Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

    KAUST Repository

    Ali, Shawkat; Bakkeren, Guus

    2014-01-01

    The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer

  2. Current Advances in the Antimicrobial Potential of Species of Genus Ganoderma (Higher Basidiomycetes) against Human Pathogenic Microorganisms (Review).

    Science.gov (United States)

    Rai, Mahendra K; Gaikwad, Swapnil; Nagaonkar, Dipali; dos Santos, Carolina Alves

    2015-01-01

    Ganoderma spp. are very important therapeutic mushrooms and have been used traditionally for 4000 years in the treatment of various human disorders. Different species of Ganoderma possess bioactive compounds, which have already demonstrated antiviral, antibacterial, and antifungal activities. Various bioactive compounds such as triterpenoids, colossolactones, and polysaccharides, which are responsible for the antimicrobial potential of the genus, are discussed here in detail. Some Ganoderma spp. have been reported to be potential agents for the synthesis of metal nanoparticles. These nanoparticles have demonstrated antimicrobial activity and also are reviewed herein. The main aim of this review is to discuss the possible use of Ganoderma extracts and their active principles in antimicrobial therapy.

  3. Shiitake Medicinal Mushroom, Lentinus edodes (Higher Basidiomycetes) Productivity and Lignocellulolytic Enzyme Profiles during Wheat Straw and Tree Leaf Bioconversion.

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Asatiani, Mikheil D

    2015-01-01

    Two commercial strains of Lentinus edodes have been comparatively evaluated for their productivity and lignocellulolytic enzyme profiles in mushroom cultivation using wheat straw or tree leaves as the growth substrates. Both substrates are profitable for recycling into shiitake fruit bodies. L. edodes 3715 gave the lowest yield of mushroom during tree leaves bioconversion with the biological efficiency (BE) 74.8% while the L. edodes 3721 BE achieved 83.4%. Cultivation of shiitake on wheat straw, especially in the presence of additional nitrogen source, increased the L. edodes 3721 BE to 92-95.3% owing to the high hydrolases activity and favorable conditions. Despite the quantitative variations, each strain of L. edodes had a similar pattern for secreting enzymes into the wheat straw and tree leaves. The mushrooms laccase and MnP activities were high during substrate colonization and declined rapidly during primordia appearance and fruit body development. While oxidase activity decreased, during the same period cellulases and xylanase activity raised sharply. Both cellulase and xylanase activity peaked at the mature fruit body stage. When mushrooms again shifted to the vegetative growth, oxidase activity gradually increased, whereas the hydrolases activity dropped rapidly. The MnP, CMCase, and FP activities of L. edodes 3721 during cultivation on wheat straw were higher than those during mushroom growth on tree leaves whereas the laccase activity was rather higher in fermentation of tree leaves. Enrichment of wheat straw with an additional nitrogen source rather favored to laccase, MnP, and FPA secretion during the vegetative stage of the L. edodes 3721 growth.

  4. The evolution of non-reciprocal nuclear exchange in mushrooms as a consequence of genomic conflict

    DEFF Research Database (Denmark)

    Aanen, Duur Kornelis; Kuyper, T.W.; Debets, A.J.M.

    2004-01-01

    nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility......nucleo-mitochondrial conflict, mitochondrial inheritance, doubly uniparental inheritance, basidiomycetes, cytoplasmic male sterility...

  5. Effect of Different Proportions of Agrowaste on Cultivation Yield and Nutritional Composition of the Culinary-Medicinal Jelly Mushroom Auricularia polytricha (Higher Basidiomycetes).

    Science.gov (United States)

    Wu, Chiu-Yeh; Liang, Chih-Hung; Wu, Kuan-Jzen; Shih, Hsin-Der; Liang, Zeng-Chin

    2017-01-01

    In this study, Auricularia polytricha was cultivated on a sawdust basal substrate supplemented with different proportions (30%, 45%, and 60%, respectively) of agrowastes-sugarcane bagasse (SB), rice straw (RS), and rice husk (RH)-to evaluate the alternative substrates. The mycelial growth rate, total colonization time, time to first primordia, biological efficiency, and chemical composition of the fruiting bodies were determined. Results indicated that the 60% SB substrate was the best substrate for mycelial growth of A. polytricha, with a corresponding total colonization period of 35.2 days, followed by the control (35.5 days) and 45% SB (36.2 days) substrates. The most suitable substrate with a high biological efficiency was 60% RS substrate (159.14%), followed by the 45% SB (128.45%), and 20% RH (124.47%) substrates. The nutrient values of fruiting bodies showed the largest amounts of ash, protein, fat, carbohydrates, and energy cultivated on 60% SB, 60% SB, 30% SB, 30% RH, and 30% RH/the control substrates, respectively. The results indicated that 60% RS was an appropriate substrate for A. polytricha cultivation.

  6. Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

    Science.gov (United States)

    Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

    2015-01-01

    The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

  7. Metabolic regulation at the tricarboxylic acid and glyoxylate cycles of the lignin-degrading basidiomycete Phanerochaete chrysosporium against exogenous addition of vanillin.

    Science.gov (United States)

    Shimizu, Motoyuki; Yuda, Naoki; Nakamura, Tomofumi; Tanaka, Hiroo; Wariishi, Hiroyuki

    2005-10-01

    A proteomic differential display technique was utilized to study cellular responses of Phanerochaete chrysosporium exposed to vanillin, one of the key intermediates found during lignin biodegradation. Intracellular proteins were resolved by 2-DE and target protein spots were identified using MALDI-MS after in-gel tryptic digestions. Upon addition of vanillin to P. chrysosporium, up-regulation of homogentisate 1,2-dioxygenase, 1,4-benzoquinone reductases, aldehyde dehydrogenase, and aryl-alcohol dehydrogenase, which seem to play roles in vanillin metabolism, was observed. Furthermore, enzymes involved in glycolysis, the tricarboxylic acid cycle, the pentose-phosphate cycle, and heme biosynthesis were also activated. Up-regulation of extracellular peroxidase was also observed. One of the most unique phenomena against exogenous vanillin was a switch from the glyoxylate cycle to the tricarboxylic acid cycle, where a drastic increase in isocitrate dehydrogenase activity was observed. The exogenous addition of other aromatic compounds also caused an increase in its activity, which in turn triggered NAD(P)H production via the action of dehydrogenases in the tricarboxylic acid cycle, heme biosynthesis via the action of aminolevulinic acid synthase on succinyl-CoA, and energy production via activation of the mitochondrial electron transfer system. These metabolic shifts seem to be required for activating a metabolic system for aromatic compounds.

  8. Production of biomass and polysaccharides of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (W.Curt. :Fr.) P. Karst. (higher Basidiomycetes), by submerged cultivation.

    Science.gov (United States)

    Habijanic, Jozica; Berovic, Marin; Boh, Bojana; Wraber, Branka; Petravic-Tominac, Vlatka

    2013-01-01

    Submerged batch and repeated fed-batch cultivation techniques were used for mycelia cultivation and polysaccharide production of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum. Although most publications use various Asiatic G. lucidum strains, the growth of the strain Ga.l 4 (Biotechnical Faculty Strain Collection, Ljubljana, Slovenia), originally isolated from the Slovenian forest, is much faster. The results between the batch and repeated fed-batch cultivation are compared with the polysaccharide production in batch cultivation. From the aspect of biomass production, the best results were obtained in repeated fed-batch after 44 days, where 12.4 g/L of dry fungal biomass was obtained.

  9. The Effects of Light Intensity, Casing Layers, and Layering Styles on Royal Sun Medicinal Mushroom, Agaricus brasiliensis (Higher Basidiomycetes) Cultivation in Turkey.

    Science.gov (United States)

    Adanacioglu, Neşe; Boztok, Kaya; Akdeniz, Ramazan Cengiz

    2015-01-01

    The aim of this research is to evaluate the effects of light intensity, casing layers, and layering styles on the production of the culinary-medicinal mushroom Agaricus brasiliensis in Turkey. The experiments were designed in split-split plots and replicated twice. Three different light intensities-I1, 350 lux; I2, 450 lux; and I3, 750 lux-were used in main plots as environmental factors. A mixture of 4 different casing layers- peat (100%), peat-perlite (75%:25%), peat-clinoptilolite (75%:25%), and peat-perlite-clinoptilolite (60%:20%:20%)-were used at split plots and at split plots. S1, a flat, 3-cm casing layer; S2, a flat, 5-cm casing layer; and S3, casing soil ridges 10 cm wide × 4 cm high, 10 cm apart, were deposited on top of 1-cm overall soil casing layers. At the end of the harvest phase, the total yield was estimated per 100 kg of substrate. Biological efficiency (percentage) was determined from the fresh weight of the mushrooms and the dry weight of the compost at the end of the harvesting period. The highest total yield (7.2 kg/100 kg compost) and biological efficiency (27.63%) were achieved from I2 × peat-perlite-clinoptilolite × S2 treatment. Influence of light intensity, casing layer, layering style, and their interaction in treatments with color values (L*, a*, b*, chroma*, and hue*) also were examined. It has been shown that within color values, chroma* (saturation) values of mushroom caps were affected by light intensity, casing layer, and layering style treatments and light intensity × casing layer treatments and the brightness of mushroom caps tended to increase as light intensity increased.

  10. Optimization of cultivation conditions of fermented shaggy ink cap culinary-medicinal mushroom, Coprinus comatus (O.Mull.:Fr.) Pers. (higher Basidiomycetes) rich in Vanadium.

    Science.gov (United States)

    Zhang, Chunjing; Qi, Xiaodan; Shi, Yan; Sun, Yan; Li, Shuyan; Gao, Xiulan; Yu, Haitao

    2012-01-01

    The present paper is mainly aimed at optimization of cultivation conditions of fermented mushrooms of Coprinus comatus rich in vanadium (CCRV). Initial screening of effects of carbon source, temperature, pH, and inoculum size were done by using a one-factor-at-a-time method. The results obtained in that study showed that the optimal medium composition was 30 g glucose/Lin YEPG medium, initial pH 6.0, inoculum volume 10%, and incubation time 120 h. Then the medium was subjected to screening of the most significant parameters using the L9 orthogonal array to solve multivariable equations simultaneously. The results obtained in this study showed that the optimal medium composition was 0.4% V and 30 g glucose/Lin YEPG medium, initial pH 5.0, inoculum volume 15%, and incubation time 120 h. At this medium composition, the mycelial biomass and V content were 7.18 ± 0.24 g/L and 3786.0 ± 17 μg/g, respectively. The anti-diabetic potential of CCRV produced with the optimal level was tested in alloxan-induced diabetes. After the mice were administered (i.g.) with CCRV, the level of blood sugar in the CCRV group was very close to that of the control group. These findings suggested that CCRV produced with the optimal level is useful in the control of diabetes mellitus.

  11. Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

    Science.gov (United States)

    Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

    2013-01-01

    The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

  12. Systemic Screening of Strains of the Lion's Mane Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) and Its Protective Effects on Aβ-Triggered Neurotoxicity in PC12 Cells.

    Science.gov (United States)

    Liu, Zongying; Wang, Qinglong; Cui, Jian; Wang, Lili; Xiong, Lili; Wang, Wei; Li, Diqiang; Liu, Na; Wu, Yiran; Mao, Canquan

    2015-01-01

    Hericium erinaceus possesses multiple medicinal values. To date, however, there have been few studies of the systemic screening of H. erinaceus strains, and the neuroprotective effects of H. erinaceus prepared from homogenized, fresh fruiting bodies are not fully understood. In this study, 4 random primers were selected and used in random amplified polymorphic DNA (RAPD) polymerase chain reaction (PCR) to screen and evaluate the genetic diversity of 19 commercial strains of H. erinaceus from different localities in China. A total of 66 bands were obtained, and the percentage of polymorphic loci reached 80.30%. Five dendrograms were constructed based on RAPD by Jaccard cluster and within-group linkage analysis. Primer S20 as well as all 4 primers had great potential as specific primers for RAPD-PCR molecular identification and differentiation of H. erinaceus strains. Based on the results of submerged culture and fruiting body cultivation, strains HT-N, HT-J1, HT-C, and HT-M were identified as superior among the 19 H. erinaceus strains. Further study showed that the oral preparation of homogenized, fresh fruiting bodies of H. erinaceus could attenuate the Aβ25-35-triggered damage in PC12 cells by significantly increasing cell viability and by decreasing the release of lactate dehydrogenase. In conclusion, RAPD-PCR combined with liquid and solid cultures can be used well in the screening and identification of H. erinaceus strains, and products prepared from homogenized, fresh fruiting bodies of H. erinaceus had neuroprotective effects on PC12 cells.

  13. COMPARATIVE GENOME ANALYSES OF MONILIOPHTHORA PERNICIOSA AND MONILIOPHTHORA RORERI: TWO CLOSELY RELATED PHYTOPATHOGENIC BASIDIOMYCETES THAT CAUSE DISTINCTLY DIFFERENT DISEASES OF THEOBROMA CACAO

    Science.gov (United States)

    Theobroma cacao (cacao), the source of chocolate, is a tropical understory tree. Fungal diseases such as Witches’ Broom Disease (WBD) and Frosty Pod Rot Disease (FPRD) of cacao have devastated cacao production in much of the Western Hemisphere and are threats to the main cacao producing regions in A...

  14. Structural elucidation of novel bioactive compound (2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone from basidiomycetous fungus Lentinus squarrosulus

    Directory of Open Access Journals (Sweden)

    Usha N.

    2016-02-01

    Full Text Available While screening for bioactive compounds from macrofungi of Western Ghats of Karnataka, Lentinus squarrosulus a member of polyporaceae was collected and mycelium of the fungus was obtained on potato dextrose agar medium and cultured in a liquid medium (containing 2% glucose, 1% peptone and 2% yeast extract for 20 days on a rotary shaker for the production of secondary metabolites. The cell free culture fluid (100ml was subjected to solvent extraction with dichloromethane (100ml and the extract was evaluated for antimicrobial activity by agar diffusion method and cytotoxic activity of the extract was also determined by MTT and SRB assay on MCF7 cell line. The results revealed that the dichloromethane extract was inhibitory against Escherichia coli, Enterobacter aerogenes, Staphylococcus aureus and Bacillus subtilus and also fungi such as Aspergillus niger, Fusarium solani and Trichoderma harzianum. The extract showed 13-27% cell inhibition at 63-1000 µg/ml concentration by MTT and SRB assays on MCF7 cell line. The structural elucidation of the compound by spectroscopic NMR (1H and C13, IR and mass spectrometric analysis confirmed the presence of 2-chloro-1-(2-chlorocyclopropyl-2-(4-nitrophenylethanone responsible for antimicrobial and cytotoxic activity.

  15. Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

    Science.gov (United States)

    Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

    2015-01-01

    Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

  16. Antitumor and Immunomodulating Activities of Exopolysaccharide Produced by Big Cup Culinary- Medicinal Mushroom Clitocybe maxima (Higher Basidiomycetes) in Liquid Submerged Culture.

    Science.gov (United States)

    Hu, Shu-Hui; Cheung, Peter Chi Keung; Hung, Raw-Pou; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

    2015-01-01

    Water-soluble polysaccharides extracted from mushrooms have been found to have some physiological effects. In this study, exopolysaccharides (EPSs) were extracted by alcohol precipitation from cultivated broth of the mushroom Clitocybe maxima. EPSs with molecular weights of 10(4) and 10(5) Da were obtained by ultrafiltration; they are referred to as EPA and EPB, respectively. The major components of these EPSs were glucose, galactose, mannose, rhamnose, and arabinose. ICR mice with artificially induced metastatic pulmonary tumors were fed a daily diet containing EPA or EPB at doses of 8, 20, or 50 mg/kg. Results showed that the proliferation of pulmonary sarcoma lesions was lower in the groups fed EPS. In addition, the numbers of total T cells, CD4+ cells, CD8+ cells, and macrophages significantly increased in EPS-fed mice compared with the negative control group. The antitumor and immunomodulating effects observed in the EPB-fed groups were higher than those of EPA-fed groups. These results demonstrate the ability of EPSs of C. maxima to inhibit tumor cells while enhancing immune response.

  17. Inoculation with a ligninolytic basidiomycete, but not root symbiotic ascomycetes, positively affects growth of highbush blueberry (Ericaceae) grown in a pine litter substrate

    Czech Academy of Sciences Publication Activity Database

    Vohník, Martin; Sadowsky, J. J.; Lukešová, Tereza; Albrechtová, Jana; Vosátka, Miroslav

    2012-01-01

    Roč. 355, č. 1-2 (2012), s. 341-352 ISSN 0032-079X R&D Projects: GA ČR GP206/09/P340; GA MŠk OE08019 Institutional research plan: CEZ:AV0Z60050516 Keywords : ericoid mycorrhiza * saprotrophic fungi * Ericaceae Subject RIV: EF - Botanics Impact factor: 2.638, year: 2012

  18. Chemical Compositions and Macrophage Activation of Polysaccharides from Leon's Mane Culinary-Medicinal Mushroom Hericium erinaceus (Higher Basidiomycetes) in Different Maturation Stages.

    Science.gov (United States)

    Li, Qiao-Zhen; Wu, Di; Chen, Xia; Zhou, Shuai; Liu, Yanfang; Yang, Yan; Cui, Fengjie

    2015-01-01

    We studied the effect of the maturation stage on the chemical compositions and macrophage activation activity of polysaccharides from the culinary-medicinal mushroom Hericium erinaceus. Results showed that total polysaccharides increased, whereas protein content decreased with the maturation stage development of fruiting body. Nine polysaccharide fractions, 3 from each of the maturity stages IV (small fungal spine stage), V (mid-fungal spine stage) and VI (mature), were prepared using the gradient ethanol precipitation method. The polysaccharide fraction HP4A isolated from the maturating-stage (stage IV) fruiting body had a significant difference from the fractions HP5A (stage V) and HP6A (stage VI) in the molecular weight distribution and monosaccharide compositions. Immunostimulating tests revealed that the polysaccharide fraction HP6 isolated from the mature stage (stage VI) fruiting body presented higher macrophage activation activity. Our findings provided important information for the harvest and use of H. erinaceus with higher qualities and functional benefits.

  19. A shift in nuclear state as the result of natural interspecific hybridization between two North American taxa of the basidiomycete complex Heterobasidion

    Science.gov (United States)

    Matteo Garbelotto; Paolo Gonthier; Rachel Linzer; Giovanni Nicolotti; William Otrosina

    2004-01-01

    A natural first generation hybrid fungus shows interspecific heterozygosity. The nuclear condition of a rare natural hybrid between two taxa of the Heterobasidion complex is investigated. Heterobasidion species are known to be either homokaryotic (haploid) or heterokaryotic (n + n), but heterokaryons are made up of both...

  20. Oxalic acid overproduction by copper-tolerant brown-rot basidiomycetes on southern yellow pine treated with copper-based preservatives

    Science.gov (United States)

    Carol A. Clausen; Frederick Green

    2003-01-01

    Accumulation of oxalic acid (OA) by brown-rot fungi and precipitation of copper oxalate crystals in wood decayed by copper-tolerant decay fungi has implicated OA in the mechanism of copper tolerance. Understanding the role of OA in copper tolerance is important due to an increasing reliance on copper-based wood preservatives. In this study, four copper-tolerant brown-...

  1. HS/GC-MS analyzed chemical composition of the aroma of fruiting bodies of two species of genus Lentinus (Higher Basidiomycetes).

    Science.gov (United States)

    Mata, Gerardo; Valdez, Karina; Mendoza, Remedios; Trigos, Ángel

    2014-01-01

    The chemical composition of the aroma of fresh fruiting bodies of the cultivated mushroom Lentinus boryanus is described here and compared with medicinal shiitake mushroom L. edodes. Volatile compounds were analyzed through headspace sampling coupled with gas chromatography-mass spectrometry. The mushrooms under study were grown on different substrates based on barley straw, sugarcane bagasse, oak wood sawdust, and beech leaf litter. It was determined that L. boryanus as well as L. edodes contain an abundant amount of a volatile compound identified as 3-octanone with a sweet fruity aroma. On the other hand, only L. boryanus produced 3-octanol a characteristic aroma of cod liver oil. In total, 10 aromatic compounds were identified, some of which were obtained exclusively in one species or substrate.

  2. Transformation of 14C-labelled lignin and humic substances in forest soil by the saprobic basidiomycetes Gymnopus erythropus and Hypholoma fasciculare

    Czech Academy of Sciences Publication Activity Database

    Šnajdr, Jaroslav; Steffen, K. T.; Hofrichter, M.; Baldrian, Petr

    2010-01-01

    Roč. 42, č. 9 (2010), s. 1541-1548 ISSN 0038-0717 R&D Projects: GA MŠk LC06066; GA MŠk OC 155; GA MŠk OC08050 Institutional research plan: CEZ:AV0Z50200510 Keywords : Forest soil * Humic acid * Gymnopus erythropus Subject RIV: EE - Microbiology, Virology Impact factor: 3.242, year: 2010

  3. Hypoglycemic and Hypolipidemic Effects of the Cracked-Cap Medicinal Mushroom Phellinus rimosus (Higher Basidiomycetes) in Streptozotocin-Induced Diabetic Rats.

    Science.gov (United States)

    Rony, Kuttikkadan A; Ajith, Thekkuttuparambil A; Janardhanan, Kainoor K

    2015-01-01

    Phellinus rimosus is a parasitic host specific polypore mushroom with profound antioxidant, antihepatotoxic, anti-inflammatory, antitumor, and antimutagenic activities. This study investigated the hypoglycemic and hypolipidemic activities of the wood-inhabiting polypore mushroom Ph. Rimosus in streptozotocin (STZ)-induced diabetic rats. Diabetes was induced by single intraperitoneal injection of STZ (45 mg/kg) to Wistar rats. The effects of 30 days treatment with Ph. Rimosus (50 and 250 mg/ kg) and glibenclamide (0.65 mg/kg) on blood glucose level, serum insulin, serum lipid profile, liver glycogen, liver function enzymes, and non-enzymic and enzymic antioxidants activities in pancreas, liver, and kidney were evaluated in STZ-induced diabetic rats. Oral administration of Ph. Rimosus extract exhibited a significant reduction in blood glucose, triacylglycerol, total cholesterol, LDL-cholesterol, and liver function enzymes, and increased serum insulin, liver glycogen, and HDL-cholesterol levels in STZ-induced diabetic rats. Furthermore, Ph. Rimosus treatment increased antioxidant status in pancreas, liver, and kidney tissues with concomitant decreases in levels of thiobarbituric acid- reactive substances. Results of this study indicated that Ph. Rimosus possessed significant hypoglycemic and hypolipidemic activities and this effect may be related to its insulinogenic and antioxidant effect.

  4. An arctic community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA

    Science.gov (United States)

    J. Geml; I. Timling; C.H. Robinson; N. Lennon; H.C. Nusbaum; C. Brochmann; M.E. Noordeloos; D.L. Taylor

    2011-01-01

    Current evidence from temperate studies suggests that ectomycorrhizal (ECM) fungi require overland routes for migration because of their obligate symbiotic associations with woody plants. Despite their key roles in arctic ecosystems, the phylogenetic diversity and phylogeography of arctic ECM fungi remains little known. Here we assess the phylogenetic diversity of ECM...

  5. Solid-substrate fermentation of wheat grains by mycelia of indigenous species of the genus Ganoderma (higher Basidiomycetes) to enhance the antioxidant activities.

    Science.gov (United States)

    Subramaniam, Sarasvathy; Sabaratnam, Vikineswary; Kuppusamy, Umah Rani; Tan, Yee Shin

    2014-01-01

    Species of the genus Ganoderma are a cosmopolitan wood decaying white rot fungi, which has been used by the Asians for therapeutic purposes for centuries. In the present study, solid-substrate fermentation (SSF) of wheat grains (Triticum aestivum L.) was carried out with indigenous Ganoderma australe (KUM60813) and G. neo-japonicum (KUM61076) selected based on ethnomycological knowledge. G. lucidum (VITA GL) (a commercial strain) was also included in the study. Antioxidant activities of the crude ethanol and aqueous extracts of the fermented and unfermented wheat grains were investigated by ferric reducing antioxidant power (FRAP), Trolox equivalent antioxidant capacity (TEAC), diphenyl-1-picryl-hydrazyl (DPPH) free radical scavenging ability, and lipid peroxidation assay. Among the six mycelia extracts tested, the ethanol extract from wheat fermented with KUM61076 mycelia showed the most potent antioxidant activities, whereas the ethanol extract of wheat grains fermented with KUM60813 mycelia has a good potential in protecting frying oils against oxidation. Total phenolic content (TPC) in the ethanol extracts were higher than that in the aqueous extract. The wheat grains fermented with G. australe (KUM60813) and G. neo-japonicum KUM61076 have greater antioxidant potential compared to the commercially available G. lucidum (VITA GL). The antioxidant activities of the mycelia extracts had a positive correlation with their phenolic contents. Thus phenolic compounds may play a vital role in the antioxidant activities of the selected Ganoderma spp.

  6. Evaluation of the antigenotoxic effects of the royal sun mushroom, agaricus brasiliensis (Higher basidiomycetes) in human lymphocytes treated with thymol in the comet assay

    NARCIS (Netherlands)

    Radaković, Milena; Stevanović, Jevrosima; Soković, Marina; Radović, Dejan; Griensven, Van Leo J.L.D.; Stanimirović, Zoran

    2015-01-01

    The aim of this investigation was to evaluate the possible protective activity of Agaricus brasiliensis (=A. blazei sensu Murrill) ethanol extract against thymol-induced DNA damage in human lymphocytes. Before we studied the possible interaction of thymol and A. brasiliensis extract, each

  7. Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

    Science.gov (United States)

    Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

    2015-01-01

    In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

  8. Higher marine fungi from mangroves (Manglicolous fungi)

    Digital Repository Service at National Institute of Oceanography (India)

    ChinnaRaj, S.

    of higher marine fungi which included 23 Ascomycetes, 2 Basidiomycetes and 17 Deuteromycetes (Kohlmeyer and Kohlmeyer, 1979). Hyde (1990a) listed 120 species from 29 mangroves from all over the World this includes 87 Ascomycetes, 2 Basidiomycetes and 31...

  9. Registro Preliminar de Macrohongos (Ascomycetes y Basidiomycetes en el Bosque Húmedo Montano del Alto El Romeral (Municipio de Angelópolis, Departamento de Antioquia - Colombia Preliminar Report of Macrofungi (Ascomycetes and Basidiomycetes in the Romeral's Montain Humid Forest (Angelopolis, Antioquia - Colombia

    Directory of Open Access Journals (Sweden)

    José David Sierra Toro

    2011-12-01

    Full Text Available Los macrohongos desempeñan un papel importante en el ciclado de nutrientes, en especial en el del carbono, al participar activamente en los procesos de descomposición de la materia orgánica dentro de los bosques tropicales. El conocimiento de la diversidad de este grupo en Colombia está aún incompleto. Como contribución a este tema, se desarrolló durante cinco meses en cuatro hectáreas de un bosque húmedo montano del Departamento de Antioquia, el trabajo que reporta y describe un total de 40 especies de macrohongos (dos de ellas posiblemente nuevas para la ciencia pertenecientes a 34 géneros y 18 familias, creciendo sobre diferentes tipos de sustrato. La familia Marasmiaceae fue la más diversa con cinco especies, seguida por Boletaceae, Polyporacea y Russulaceae con cuatro especies cada una. Hypholoma, Lactarius y Marasmius fueron los géneros más importantes con tres especies cada uno. Las especies de mayor ocurrencia fueron Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. La mayor cantidad de especies se registró creciendo sobre troncos caídos (19 especies y la menor sobre hojarasca (seis especies.Macrofungi play an important role in nutrient cycling. Especially, they are important drivers in the carbon cycling and in the organic matter decomposition process in tropical forests. In Colombia the knowledge on diversity of this group is still very poor. Through this work we intend to contribute to this knowledge. The macrofungi diversity was assessed on three different substrates on a 4 ha wet montane forest in the Antioquia province during five months. Forty species of macrofungi (two of them possible new species to science belonging to 34 genera and 18 families were recorded. Marasmiaceae was the most diverse family with five species followed by Boletaceae, Polyporacea and Russulaceae with four species each one. Hypholoma, Lactarius and Marasmius were the most important genera with three species each one. Auricularia delicata (Fr. Henn., Xylaria polymorpha (Pers. Grev. y Ganoderma applanatum (Pers. Pat. were the most frequently found species. The highest species numbers were growing on dead wood (19 species and the lowest were recorded on litter (six species.

  10. Carotenoid accumulation in orange-pigmented Capsicum annuum fruit, regulated at multiple levels

    Science.gov (United States)

    Rodriguez-Uribe, Laura; Guzman, Ivette; Rajapakse, Wathsala; Richins, Richard D.; O’Connell, Mary A.

    2012-01-01

    The pericarp of Capsicum fruit is a rich dietary source of carotenoids. Accumulation of these compounds may be controlled, in part, by gene transcription of biosynthetic enzymes. The carotenoid composition in a number of orange-coloured C. annuum cultivars was determined using HPLC and compared with transcript abundances for four carotenogenic enzymes, Psy, LcyB, CrtZ-2, and Ccs determined by qRT-PCR. There were unique carotenoid profiles as well as distinct patterns of transcription of carotenogenic enzymes within the seven orange-coloured cultivars. In one cultivar, ‘Fogo’, carrying the mutant ccs-3 allele, transcripts were detected for this gene, but no CCS protein accumulated. The premature stop termination in ccs-3 prevented expression of the biosynthetic activity to synthesize the capsanthin and capsorubin forms of carotenoids. In two other orange-coloured cultivars, ‘Orange Grande’ and ‘Oriole’, both with wild-type versions of all four carotenogenic enzymes, no transcripts for Ccs were detected and no red pigments accumulated. Finally, in a third case, the orange-coloured cultivar, Canary, transcripts for all four of the wild-type carotenogenic enzymes were readily detected yet no CCS protein appeared to accumulate and no red carotenoids were synthesized. In the past, mutations in Psy and Ccs have been identified as the loci controlling colour in the fruit. Now there is evidence that a non-structural gene may control colour development in Capsicum. PMID:21948863

  11. Effect of L-Cysteine Pretreatment on the Control of Formaldehyde and Browning of the Culinary-Medicinal Shiitake Mushroom, Lentinus edodes (Higher Basidiomycetes) during Drying and Canning Processes.

    Science.gov (United States)

    Li, Guijie; Wang, Qiang; Sun, Peng; Chen, Feng; Chen, Xiaolin; Wang, Cun; Zhao, Xin

    2015-01-01

    Fresh culinary-medicinal Shiitake mushrooms (Lentinus edodes) were pretreated by soaking in 0.1 mg/mL of L-cysteine solution for 1 hour; then the variation in formaldehyde content and browning degree were studied during hot air-drying and canning processes. The results indicated that L-cysteine pretreatment significantly inhibited the increase of formaldehyde content and browning during the drying process; these increases in the pretreatment groups ranged from 7.0% to 14.0% and 65.4% to 68.9%, respectively, of that of the control groups. While the L-cysteine pretreatment did not seem to have a significant effect on controlling the formaldehyde content during the canning process, the increase of the browning degree of the canned products of the pretreatment groups ranged from 64.8% to 78.5% of that of the control groups, indicating the inhibitive effect of L-cysteine on browning during the canning process of L. edodes. Overall, L-cysteine pretreatment improved the sensory quality of both dried and canned L. edodes.

  12. The protective effects of aqueous extracts of wild-growing and fermented Royal Sun mushroom, Agaricus brasiliensis S. Wasser et al. (higher basidiomycetes), in CCl4-induced oxidative damage in rats.

    Science.gov (United States)

    Zhang, Chunjing; Han, Chunchao; Zhao, Baosheng; Yu, Haitao

    2012-01-01

    Culinary-medicinal Royal Sun mushroom, Agaricus brasiliensis (AbS), has traditionally been used for the prevention of a range of diseases, including cancer, hepatitis, atherosclerosis, hypercholesterolemia, diabetes, and dermatitis. The hepatoprotective effect of the fermented mushroom of A. brasiliensis (FMAE) and wild-growing A. brasiliensis (WMAE) were studied in this paper. An in vivo study of carbon tetrachloride (CCl4)-induced antioxidant activity in 2-month-old rats was conducted by examining the levels of activities of alanine aminotransaminase (ALT) and aspartate aminotransaminase (AST) and the antioxidant enzymes, including glutathione peroxidase (GSHPx) and catalase (CAT). Rats were divided into four groups, each containing six rats. The first group served as a control group. The second group was the CCl4 group. Group I and group II were treated orally with distilled water for 14 days respectively. Group III and Group IV were treated orally by WMAE and FMAE at oral doses of 50 mg/kg-day, respectively. Both WMAE and FMAE could reduce CCl4-induced toxicity, particularly hepatotoxicity, by suppressing ALT and AST activities, and increasing antioxidant enzyme activity. The studies demonstrate that both the fermented and wild-growing A. brasiliensis could protect the liver against CCl4-induced oxidative damage in rats.

  13. Use of remazol blue dyed avicel for the determination of cellulolytic activity in basidiomycetes Uso de Avicel colorida com Remazol Blue para determinação da atividade celulolítica em Basidiomycetos

    Directory of Open Access Journals (Sweden)

    Marcos José Correia

    1998-10-01

    Full Text Available A modified method for direct determination of cellulolytic activity using Avicel colored with Remazol Brilliant Blue R (RBBR in Agar test tubes is discussed. Refinements were introduced in a simple method for quantitation of cellulase activity, based on the release of dye from Avicel-RBBR medium by the enzymatic hydrolysis. Modifications in Avicel-dye preparation were enhanced and a spectrophotometer for direct OD measurement in agar test tubes used. The use of a spectrophotometer improved the precision of the collected data, since absorbance measurements could be done at the maximum wavelenght for RBBR (595 nm.Neste trabalho, é discutido um método modificado para determinação da atividade celulolítica em fungos utilizando Avicel colorida com Remazol Brilliant Blue R (RBBR, diretamente em tubos com ágar, a partir de refinamentos introduzidos em uma metodologia simples e baseada na liberação deste corante pela ação hidrolítica em Avicel colorida com o RBBR. Foram feitas modificações no preparo da Avicel colorida, bem como um espectrofotômetro para medição direta da absorbância nos tubos com ágar foi usado. O uso de espectrofotômetro aumentou a precisão dos dados coletados, pois permitiu leituras de absorbância no comprimento de onda máximo para RBBR (595 nm.

  14. The influence of the hot water extract from shiitake medicinal mushroom, Lentinus edodes (higher Basidiomycetes) on the food intake, life span, and age-related locomotor activity of Drosophila melanogaster.

    Science.gov (United States)

    Matjuskova, Natalya; Azena, Elena; Serstnova, Ksenija; Muiznieks, Indrikis

    2014-01-01

    Shiitake medicinal mushroom, Lentinus edodes, is among the most widely cultivated edible mushrooms in the world and is a well-studied source of nutrients and biologically active compounds. We have studied the influence of the dietary supplement of the polysaccharides containing a hot water extract of the mushroom L. edodes on the fruit fly Drosophila melanogaster in terms of food intake, body weight, life span, and age-related locomotor activity. L. edodes extract, when added to the D. melanogaster feeding substrate at a 0.003-0.030% concentration (calculated for the dry weight of the polysaccharide fraction) did not influence food intake or body weight of the flies. It increased the life span and locomotor activities of male flies but was associated with early mortality and decreased locomotor activity of female flies. We conclude that the observed anti-aging effects of L. edodes extracts in the male D. melanogaster are not the result of dietary restriction. We propose that D. melanogaster is a suitable model organism for researching the molecular basis of the anti-aging effect of the shiitake mushroom extracts and sex linkage of these effects.

  15. The Anti-Inflammatory Effects of Lion's Mane Culinary-Medicinal Mushroom, Hericium erinaceus (Higher Basidiomycetes) in a Coculture System of 3T3-L1 Adipocytes and RAW264 Macrophages.

    Science.gov (United States)

    Mori, Koichiro; Ouchi, Kenji; Hirasawa, Noriyasu

    2015-01-01

    Chronic low-grade inflammation in the adipose tissue accompanying obesity is thought to be an underlying driver of metabolic diseases. In this study, we aimed to investigate the efficacy of Hericium erinaceus on adipose tissue inflammation. The anti-inflammatory effects of the ethyl acetate soluble fraction of H. erinaceus (EAHE) were examined using cocultures of 3T3-L1 adipocytes and RAW264 macrophages. EAHE significantly suppressed tumor necrosis factor (TNF)-α and interleukin (IL)-6 production in cultured RAW264 macrophages stimulated by lipopolysaccharide (LPS). EAHE also caused notable inhibition of c-Jun N-terminal kinase (JNK) activation, which is thought to be involved in the suppression of proinflammatory cytokines by EAHE. In a coculture system with 3T3-L1 and RAW264 cells stimulated with LPS, EAHE reduced TNF-α and IL-6 concentrations in the conditioned medium and lowered the gene expression levels of these cytokines in 3T3-L1 adipocytes. Furthermore, EAHE suppressed the LPS-induced reduction of adiponectin mRNA levels in 3T3-L1 adipocytes cocultured with RAW264 macrophages. However, in 3T3-L1 adipocytes cultured alone, the concentration of LPS used in this study did not affect the gene expression levels of these adipokines. We attributed the anti-inflammatory effects of EAHE on 3T3-L1 adipocytes cocultured with RAW264 macrophages to the suppression of Toll-like receptor 4 (TLR4) signaling and subsequent proinflammatory cytokine secretion in RAW264 cells. Our findings indicate the possibility that H. erinaceus exerts anti-inflammatory effects on macrophages through the inhibition of TLR4-JNK signaling and prevents or ameliorates adipose tissue inflammation associated with obesity.

  16. Lion's Mane, Hericium erinaceus and Tiger Milk, Lignosus rhinocerotis (Higher Basidiomycetes) Medicinal Mushrooms Stimulate Neurite Outgrowth in Dissociated Cells of Brain, Spinal Cord, and Retina: An In Vitro Study.

    Science.gov (United States)

    Samberkar, Snehlata; Gandhi, Sivasangkary; Naidu, Murali; Wong, Kah-Hui; Raman, Jegadeesh; Sabaratnam, Vikineswary

    2015-01-01

    Neurodegenerative disease is defined as a deterioration of the nervous system in the intellectual and cognitive capabilities. Statistics show that more than 80-90 million individuals age 65 and above in 2050 may be affected by neurodegenerative conditions like Alzheimer's and Parkinson's disease. Studies have shown that out of 2000 different types of edible and/or medicinal mushrooms, only a few countable mushrooms have been selected until now for neurohealth activity. Hericium erinaceus is one of the well-established medicinal mushrooms for neuronal health. It has been documented for its regenerative capability in peripheral nerve. Another mushroom used as traditional medicine is Lignosus rhinocerotis, which has been used for various illnesses. It has been documented for its neurite outgrowth potential in PC12 cells. Based on the regenerative capabilities of both the mushrooms, priority was given to select them for our study. The aim of this study was to investigate the potential of H. erinaceus and L. rhinocerotis to stimulate neurite outgrowth in dissociated cells of brain, spinal cord, and retina from chick embryo when compared to brain derived neurotrophic factor (BDNF). Neurite outgrowth activity was confirmed by the immu-nofluorescence method in all tissue samples. Treatment with different concentrations of extracts resulted in neuronal differentiation and neuronal elongation. H. erinaceus extract at 50 µg/mL triggered neurite outgrowth at 20.47%, 22.47%, and 21.70% in brain, spinal cord, and retinal cells. L. rhinocerotis sclerotium extract at 50 µg/mL induced maximum neurite outgrowth of 20.77% and 24.73% in brain and spinal cord, whereas 20.77% of neurite outgrowth was observed in retinal cells at 25 µg/mL, respectively.

  17. Fulltext PDF

    Indian Academy of Sciences (India)

    Unknown

    The mechanisms of adaptation to different stresses overlap ... The work highlighted here provides a possible link between cold adaptation and radiation ... The protein that appears to have a dual role in low temperature tolerance and radiation ...

  18. Cloning of a novel stearoyl-acyl desaturase gene from white ash ...

    African Journals Online (AJOL)

    use

    2011-12-10

    Dec 10, 2011 ... Using reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends, ..... blocks and another belongs to ferritin-like family. These .... In Cold-Adapted Organisms-Ecology, Physiology,.

  19. Cloning and expression of an amylase gene from Bacillus sp ...

    African Journals Online (AJOL)

    SAM

    2014-08-06

    Aug 6, 2014 ... Bacillus sp. isolated from an agricultural field in West. Bengal, India ... plants, even though, the competition is incipient (Sen,. 2007), and therefore ..... proteins: Engineering mesophilic–like activity and stability in a cold adapted ...

  20. Permafrost Meta-Omics and Climate Change

    DEFF Research Database (Denmark)

    Mackelprang, Rachel; Saleska, Scott R.; Jacobsen, Carsten Suhr

    2016-01-01

    Permanently frozen soil, or permafrost, covers a large portion of the Earth's terrestrial surface and represents a unique environment for cold-adapted microorganisms. As permafrost thaws, previously protected organic matter becomes available for microbial degradation. Microbes that decompose soil...

  1. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    2007-03-22

    Mar 22, 2007 ... Adaptation; Arabidopsis; molecular response to stress; stressors: cold, forst, ... only the biomembranes in ripening seeds (late embryogenesis abundant ... and roots during cold adaptation, especially in drought tolerant plants.

  2. Thermal, cardiac and adrenergic responses to repeated local cooling.

    Science.gov (United States)

    Janský, L; Matousková, E; Vávra, V; Vybíral, S; Janský, P; Jandová, D; Knízková, I; Kunc, P

    2006-01-01

    The aim of this study was to ascertain whether repeated local cooling induces the same or different adaptational responses as repeated whole body cooling. Repeated cooling of the legs (immersion into 12 degrees C water up to the knees for 30 min, 20 times during 4 weeks = local cold adaptation - LCA) attenuated the initial increase in heart rate and blood pressure currently observed in control subjects immersed in cold water up to the knees. After LCA the initial skin temperature decrease tended to be lower, indicating reduced vasoconstriction. Heart rate and systolic blood pressure appeared to be generally lower during rest and during the time course of cooling in LCA humans, when compared to controls. All these changes seem to indicate attenuation of the sympathetic tone. In contrast, the sustained skin temperature in different areas of the body (finger, palm, forearm, thigh, chest) appeared to be generally lower in LCA subjects than in controls (except for temperatures on the forehead). Plasma levels of catecholamines (measured 20 and 40 min after the onset of cooling) were also not influenced by local cold adaptation. Locally cold adapted subjects, when exposed to whole body cold water immersion test, showed no change in the threshold temperature for induction of cold thermogenesis. This indicates that the hypothermic type of cold adaptation, typically occurring after systemic cold adaptation, does not appear after local cold adaptation of the intensity used. It is concluded that in humans the cold adaptation due to repeated local cooling of legs induces different physiological changes than systemic cold adaptation.

  3. Books received by the Rijksherbarium library

    NARCIS (Netherlands)

    NN,

    1982-01-01

    A new systematic arrangement of the Basidiomycetes is presented. The first fifty pages are devoted to special characters found in Basidiomycetes, and to a discussion of previous classifications. The major part of the book (c. 300 pp.) gives descriptions of the recognized orders and families as well

  4. 26 - 30 Kutama

    African Journals Online (AJOL)

    DR. AMINU

    wood popularly known as white rot. Wood and root rot basidiomycetes are occasional problem in desert plants including cliff rose, Canotia (Canotia holacantha) e.t.c (P.D.P, 2011). Also cacti which have a large amount of solid wood tissues may be invaded and decayed by wood rotting basidiomycetes (Uno et al., 2008).

  5. In vitro decomposition of Sphagnum by some microfungi resembles white rot of wood.

    Science.gov (United States)

    Rice, Adrianne V; Tsuneda, Akihiko; Currah, Randolph S

    2006-06-01

    The abilities of some ascomycetes (Myxotrichaceae) from a Sphagnum bog in Alberta to degrade cellulose, phenolics, and Sphagnum tissue were compared with those of two basidiomycetes. Most Myxotrichaceae degraded cellulose and tannic acid, and removed cell-wall components simultaneously from Sphagnum tissues, whereas the basidiomycetes degraded cellulose and insoluble phenolics, and preferentially removed the polyphenolic matrix from Sphagnum cell walls. Mass losses from Sphagnum varied from up to 50% for some ascomycetes to a maximum of 35% for the basidiomycetes. The decomposition of Sphagnum by the Myxotrichaceae was analogous to the white rot of wood and indicates that these fungi have the potential to cause significant mineralization of carbon in bogs.

  6. Medium selection for exopolysaccharide and biomass production in submerged cultures of culinary-medicinal mushrooms from Turkey

    NARCIS (Netherlands)

    Kizilcik, M.; Yamaç, M.; Griensven, van L.J.L.D.

    2010-01-01

    The present study investigates the exopolysaccharide (EPS) and biomass production of 18 strains of 15 species of culinary-medicinal higher Basidiomycetes in submerged culture under four different media. Gloeophyllum abietinum and Schizophyllum commune produced the highest EPS and biomass

  7. Molecular characterisation of fungal endophytic morphospecies associated with the indigenous forest tree, Theobroma gileri, in Ecuador.

    Science.gov (United States)

    Thomas, Sarah E; Crozier, Jayne; Catherine Aime, M; Evans, Harry C; Holmes, Keith A

    2008-07-01

    Fungal endophytes were isolated from healthy stems and pods of Theobroma gileri, an alternative host of the frosty pod rot pathogen of cacao. Non-sporulating isolates were grouped into 46 different morphological species according to their colony morphology. Many of these morphospecies were assumed to be basidiomycetes and, therefore, were of particular interest. Basidiomycetous endophytes have received far less attention than ascomycetes and also have potential as biological control agents of the basidiomycetous pathogens of T. cacao: Moniliophthora roreri (frosty pod rot pathogen) and M. perniciosa (witches' broom disease). The morphospecies were further characterised by molecular analyses. Amplification of the nuLSU was undertaken for phylogenetic placement of these non-sporulating cultures and revealed a total of 31 different taxa of which 15 were basidiomycetes belonging to the class Agaricomycetes, and 16 ascomycetes primarily belonging to the Sordariomycetes.

  8. Decolorization of molasses spent wash by the white-rot fungus Flavodon flavus, isolated from a marine habitat

    Digital Repository Service at National Institute of Oceanography (India)

    Raghukumar, C.; Rivonkar, G.

    Flavodon flavus (Klotzsch) Ryvarden, a basidiomycete (NIOCC strain 312) isolated from decomposing leaves of a sea grass, decolorized pigments in molasses spent wash (MSW) by 80% after 8 days of incubation, when used at concentrations of 10% and 50...

  9. Changes in oxidative enzyme activity during interspecific mycelial interactions involving the white-rot fungus Trametes versicolor

    Czech Academy of Sciences Publication Activity Database

    Hiscox, J.; Baldrian, Petr; Rogers, H. J.; Boddy, L.

    2010-01-01

    Roč. 47, č. 6 (2010), s. 562-571 ISSN 1087-1845 Institutional research plan: CEZ:AV0Z50200510 Keywords : Interactions * Basidiomycetes * Trametes Subject RIV: EE - Microbiology, Virology Impact factor: 3.333, year: 2010

  10. 782-IJBCS-Article-Rose Masalu

    African Journals Online (AJOL)

    DR GATSING

    Cantharellus miomboensis is a new basidiomycete fungus recently found in Miombo woodlands in. Tanzania. .... bacterial and fungal contamination and ..... functions of secondary metabolites. In ... metabolites from marine actinomycetes. Curr.

  11. Books received by the Rijksherbarium library

    NARCIS (Netherlands)

    NN,

    1993-01-01

    Pleurotus ostreatus and P. pulmonarius, wood-destroying and edible basidiomycetes, were the subject of an ecophysiological study with regard to the connection between water household in the fruitbody and sporulation. Field observations were combined with controlled laboratory experiments on

  12. Bioleaching of copper, aluminum, magnesium and manganese from ...

    African Journals Online (AJOL)

    Administrator

    2011-09-12

    Sep 12, 2011 ... Takao screened organic acid producing strains of basidiomycetes and found that oxalic acid was the main acid along with citric and tartaric acid. .... process by using nitric acid and hydrogen peroxide. Statistical analysis.

  13. 12038_2016_9614_Article_print 265..275

    Indian Academy of Sciences (India)

    2016-05-13

    May 13, 2016 ... The stimulatory effect of the aqueous extract of G. lucidum, a basidiomycetes class fungus ... activity of GL extract was observed through the inhibition of ...... ides and its effect on antioxidant enzymes and immunity activities in.

  14. Manglicolous fungi from atolls of Maldives, Indian Ocean

    Digital Repository Service at National Institute of Oceanography (India)

    Chinnaraj, S.

    Thirty nine species represented by 29 species of Ascomycetes, 2 of Basidiomycetes and 8 of Deuteromycetes were collected from partially submerged, dead and decayed parts of 5 mangrove species. The dominant species were Dactylospora haliotrepha...

  15. Effect of nutrient nitrogen on laccase production, its isozyme pattern and effluent decolorization by the fungus NIOCC No. 2a, isolated from mangrove wood

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Verma, A.K.; Mathew, M.; Raghukumar, C.

    Carbon and nitrogen sources in the growth medium play an important role in the production of lignin-degrading enzymes in the white-rot basidiomyceteous fungi. The role of nutrient nitrogen sources in growth media on production of lignin...

  16. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

  17. octadecenoic acid in tomato

    African Journals Online (AJOL)

    User

    bly involved in plant defense responses is synthesized in tomato fruits and subjected to metabo- lism. Its catabolism or .... stored at -20°C. Enzymatic in vitro synthesis of radiolabeled ..... with nematicidal activity from Culture of basidiomycetes.

  18. Specificity of the mutualistic association between actinomycete bacteria and two sympatric species of Acromyrmex leaf-cutting ants

    DEFF Research Database (Denmark)

    Poulsen, M; Cafaro, M; Boomsma, J J

    2005-01-01

    Acromyrmex leaf-cutting ants maintain two highly specialized, vertically transmitted mutualistic ectosymbionts: basidiomycete fungi that are cultivated for food in underground gardens and actinomycete Pseudonocardia bacteria that are reared on the cuticle to produce antibiotics that suppress...

  19. Formation and cell wall regeneration of protoplasts from Schizophyllum commune

    NARCIS (Netherlands)

    de Vries, Onno Minne Hotze

    1974-01-01

    Osmotically sensitive protoplasts were released from the mycelium of the basidiomycete Schizophyllum commune through the action ofan extracellular enzyme preparation isolated from the culture filtrate of Trichoderma viride (recently renamed T. harzianum) grown on hyphal walls of the former organism.

  20. Variations in mitochondrial DNA and gene transcription in freezing-tolerant larvae of Eurosta solidaginis (Diptera: Tephritidae) and Gynaephora groenlandica (Lepidoptera: Lymantriidae).

    Science.gov (United States)

    Levin, D B; Danks, H V; Barber, S A

    2003-06-01

    Respiration, mitochondrial (mt)DNA content, and mitochondrial-specific RNA expression in fat body cells from active and cold-adapted larvae of the goldenrod gall fly, Eurosta solidaginis, and the Arctic woolly bear caterpillar, Gynaephora groenlandica, were compared. Reduced amounts of mtDNA were observed in cold-adapted larvae of both E. solidaginis and G. groenlandica collected in fall or winter, compared with summer-collected larvae. mtDNA increased to levels similar to those of summer-collected larvae after incubation at 10 degrees C or 15 degrees C for 5 h. Mitochondrial-specific RNAs (COI and 16S) were observed in fat body cells of both active and cold-adapted E. solidaginis larvae. Our results suggest that mitochondrial proteins required for respiration may be restored rapidly from stable RNAs present in overwintering larvae.

  1. Proteomic analysis of Rhodotorula mucilaginosa: dealing with the issues of a non-conventional yeast.

    Science.gov (United States)

    Addis, Maria Filippa; Tanca, Alessandro; Landolfo, Sara; Abbondio, Marcello; Cutzu, Raffaela; Biosa, Grazia; Pagnozzi, Daniela; Uzzau, Sergio; Mannazzu, Ilaria

    2016-08-01

    Red yeasts ascribed to the species Rhodotorula mucilaginosa are gaining increasing attention, due to their numerous biotechnological applications, spanning carotenoid production, liquid bioremediation, heavy metal biotransformation and antifungal and plant growth-promoting actions, but also for their role as opportunistic pathogens. Nevertheless, their characterization at the 'omic' level is still scarce. Here, we applied different proteomic workflows to R. mucilaginosa with the aim of assessing their potential in generating information on proteins and functions of biotechnological interest, with a particular focus on the carotenogenic pathway. After optimization of protein extraction, we tested several gel-based (including 2D-DIGE) and gel-free sample preparation techniques, followed by tandem mass spectrometry analysis. Contextually, we evaluated different bioinformatic strategies for protein identification and interpretation of the biological significance of the dataset. When 2D-DIGE analysis was applied, not all spots returned a unambiguous identification and no carotenogenic enzymes were identified, even upon the application of different database search strategies. Then, the application of shotgun proteomic workflows with varying levels of sensitivity provided a picture of the information depth that can be reached with different analytical resources, and resulted in a plethora of information on R. mucilaginosa metabolism. However, also in these cases no proteins related to the carotenogenic pathway were identified, thus indicating that further improvements in sequence databases and functional annotations are strictly needed for increasing the outcome of proteomic analysis of this and other non-conventional yeasts. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  2. Characterization and cultivation of a wild mushroom species isolated in Brazil
    Caracterização e cultivo de uma espécie de cogumelo silvestre isolado no Brasil

    OpenAIRE

    Luzia Doretto Paccola-Meirelles; Cristina Sayuri Maki

    2002-01-01

    Wild mushrooms were collected close to cattle manure in pasture areas in Tamarana (Paraná/Brazil), with the objective of finding and domesticating new non-exploited basidiomycetes. An edible basidiomycete of the Agaricales order was classified as belonging to the Macrolepiota bonaerensis species (=Lepiota procera, form bonaerensis (Speg.) Rick or M. procera (Scop.:Fr) Sing.). The mycelia was isolated and characterized for growth rate in different culture media. A vigorous growth was observed ...

  3. Decolorization of six synthetic dyes by fungi

    OpenAIRE

    Hartikainen, E. Samuel; Miettinen, Otto; Hatakka, Annele; Kähkönen, Mika A.

    2016-01-01

    To find out ability of fourteen basidiomycetes and four ascomycetes strains to grow in the presence of synthetic colour dyes and to degrade them, fungi were cultivated on the malt agar plates containing 0.5 g kg-1 dye, either Remazol Brilliant Blue R, Remazol Brilliant Yellow GL, Remazol Brilliant Orange 3 R, Reactive Blue 4, Remazol Brilliant Red F3B or Reactive Black 5. Fungi representing basidiomycetes were Phlebia radiata (FBCC 43), Tremella encephala (FBCC 1145), Dichomitus squalens (FBC...

  4. Effect of Trichoderma-enriched organic charcoal in the integrated wood protection strategy.

    Directory of Open Access Journals (Sweden)

    Javier Ribera

    Full Text Available The gradual elimination of chromium from wood preservative formulations results in higher Cu leaching and increased susceptibility to wood decay fungi. Finding a sustainable strategy in wood protection has become of great interest among researchers. The objective of these in vitro studies was to demonstrate the effect of T-720-enriched organic charcoal (biochar against five wood decay basidiomycetes isolated from strongly damaged poles. For this purpose, the antagonistic potential of Trichoderma harzianum (strain T-720 was confirmed among other four Trichoderma spp. against five brown-rot basidiomycetes in dual culture tests. T-720 was genetically transformed and tagged with the green fluorescent protein (GFP in order to study its antagonistic mechanism against wood decay basidiomycetes. It was also demonstrated that T-720 inhibits the oxalic acid production by basidiomycetes, a well-known mechanism used by brown-rot fungi to detoxify Cu from impregnated wood. Additionally, this study evaluated the effect of biochar, alone or in combination with T-720, on Cu leaching by different preservatives, pH stabilization and prevention of wood decay caused by five basidiomycetes. Addition of biochar resulted in a significant Cu binding released from impregnated wood specimens. T-720-enriched biochar showed a significant reduction of wood decay caused by four basidiomycetes. The addition of T-720-enriched biochar to the soil into which utility poles are placed may improve the efficiency of Cr-free wood preservatives.

  5. Control of light-dependent keto carotenoid biosynthesis in Nostoc 7120 by the transcription factor NtcA.

    Science.gov (United States)

    Sandmann, Gerhard; Mautz, Jürgen; Breitenbach, Jürgen

    2016-09-01

    In Nostoc PCC 7120, two different ketolases, CrtW and CrtO are involved in the formation of keto carotenoids from β-carotene. In contrast to other cyanobacteria, CrtW catalyzes the formation of monoketo echinenone whereas CrtO is the only enzyme for the synthesis of diketo canthaxanthin. This is the major photo protective carotenoid in this cyanobacterium. Under high-light conditions, basic canthaxanthin formation was transcriptionally up-regulated. Upon transfer to high light, the transcript levels of all investigated carotenogenic genes including those coding for phytoene synthase, phytoene desaturase and both ketolases were increased. These transcription changes proceeded via binding of the transcription factor NtcA to the promoter regions of the carotenogenic genes. The binding was absolutely dependent on the presence of reductants and oxo-glutarate. Light-stimulated transcript formation was inhibited by DCMU. Therefore, photosynthetic electron transport is proposed as the sensor for high-light and a changing redox state as a signal for NtcA binding.

  6. Clp Protease and OR Directly Control the Proteostasis of Phytoene Synthase, the Crucial Enzyme for Carotenoid Biosynthesis in Arabidopsis.

    Science.gov (United States)

    Welsch, Ralf; Zhou, Xiangjun; Yuan, Hui; Álvarez, Daniel; Sun, Tianhu; Schlossarek, Dennis; Yang, Yong; Shen, Guoxin; Zhang, Hong; Rodriguez-Concepcion, Manuel; Thannhauser, Theodore W; Li, Li

    2018-01-08

    Phytoene synthase (PSY) is the crucial plastidial enzyme in the carotenoid biosynthetic pathway. However, its post-translational regulation remains elusive. Likewise, Clp protease constitutes a central part of the plastid protease network, but its substrates for degradation are not well known. In this study, we report that PSY is a substrate of the Clp protease. PSY was uncovered to physically interact with various Clp protease subunits (i.e., ClpS1, ClpC1, and ClpD). High levels of PSY and several other carotenogenic enzyme proteins overaccumulate in the clpc1, clpp4, and clpr1-2 mutants. The overaccumulated PSY was found to be partially enzymatically active. Impairment of Clp activity in clpc1 results in a reduced rate of PSY protein turnover, further supporting the role of Clp protease in degrading PSY protein. On the other hand, the ORANGE (OR) protein, a major post-translational regulator of PSY with holdase chaperone activity, enhances PSY protein stability and increases the enzymatically active proportion of PSY in clpc1, counterbalancing Clp-mediated proteolysis in maintaining PSY protein homeostasis. Collectively, these findings provide novel insights into the quality control of plastid-localized proteins and establish a hitherto unidentified post-translational regulatory mechanism of carotenogenic enzymes in modulating carotenoid biosynthesis in plants. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

  7. Pseudoalteromonas haloplanktis TAC125 produces 4-hydroxybenzoic acid that induces pyroptosis in human A459 lung adenocarcinoma cells

    DEFF Research Database (Denmark)

    Sannino, Filomena; Sansone, Clementina; Galasso, Christian

    2018-01-01

    In order to exploit the rich reservoir of marine cold-adapted bacteria as a source of bioactive metabolites, ethyl acetate crude extracts of thirteen polar marine bacteria were tested for their antiproliferative activity on A549 lung epithelial cancer cells. The crude extract from Pseudoalteromon...

  8. Whole-Genome Shotgun Sequence of the Keratinolytic Bacterium Lysobacter sp. A03, Isolated from the Antarctic Environment

    OpenAIRE

    Pereira, Jamile Queiroz; Ambrosini, Adriana; Sant?Anna, Fernando Hayashi; Tadra-Sfeir, Michele; Faoro, Helisson; Pedrosa, F?bio Oliveira; Souza, Emanuel Maltempi; Brandelli, Adriano; Passaglia, Luciane M. P.

    2015-01-01

    Lysobacter sp. strain A03 is a protease-producing bacterium isolated from decomposing-penguin feathers collected in the Antarctic environment. This strain has the ability to degrade keratin at low temperatures. The A03 genome sequence provides the possibility of finding new genes with biotechnological potential to better understand its cold-adaptation mechanism and survival in cold environments.

  9. ADD1/SREBP1c activates the PGC1-alpha promoter in brown adipocytes

    DEFF Research Database (Denmark)

    Hao, Qin; Hansen, Jacob B; Petersen, Rasmus K

    2010-01-01

    Cold adaptation elicits a paradoxical simultaneous induction of fatty acid synthesis and beta-oxidation in brown adipose tissue. We show here that cold exposure coordinately induced liver X receptor alpha (LXRalpha), adipocyte determination and differentiation-dependent factor 1 (ADD1)/sterol...

  10. Comparison of the Effectiveness of Trivalent Inactivated Influenza Vaccine and Live, Attenuated Influenza Vaccine in Preventing Influenza-Like Illness among US Service Members, 2006-2009

    Science.gov (United States)

    2012-11-26

    controlled studies. Vaccine 2012; 30:886–92. 11. Piedra PA, Gaglani MJ, Kozinetz CA, et al. Trivalent live attenuated intranasal influenza vaccine...120:e553–64. 12. Halloran ME, Piedra PA, Longini IM Jr, et al. Efficacy of trivalent, cold-adapted, influenza virus vaccine against influenza A (Fujian

  11. Differences in thermal acclimation of chloroplast functioning in two ecotypes of Valonia utricularis (Chlorophyta)

    NARCIS (Netherlands)

    Eggert, A.; van Hasselt, P.R; Breeman, Arno

    Chloroplast functioning in two temperature ecotypes of the tropical to warm-temperate green macrophyte Valonia ultricularis was monitored by measuring chlorophyll a fluorescence parameters. One ecotype from the Mediterranean Sea is, with respect to growth and survival, more cold-adapted and

  12. Psychrophilic fungi from the world’s roof

    NARCIS (Netherlands)

    Wang, M.; Jiang, X.; Wu, W.; Hao, Y.; Su, Y.; Cai, L.; Xiang, M.; Liu, X.

    2015-01-01

    During a survey of cold-adapted fungi in alpine glaciers on the Qinghai-Tibet Plateau, 1 428 fungal isolates were obtained of which 150 species were preliminary identified. Phoma sclerotioides and Pseudogymnoascus pannorum were the most dominant species. Psychrotolerant species in Helotiales

  13. Brown Fat AKT2 Is a Cold-Induced Kinase that Stimulates ChREBP-Mediated De Novo Lipogenesis to Optimize Fuel Storage and Thermogenesis

    DEFF Research Database (Denmark)

    Sanchez-Gurmaches, Joan; Tang, Yuefeng; Jespersen, Naja Zenius

    2018-01-01

    Brown adipose tissue (BAT) is a therapeutic target for metabolic diseases; thus, understanding its metabolic circuitry is clinically important. Many studies of BAT compare rodents mildly cold to those severely cold. Here, we compared BAT remodeling between thermoneutral and mild-cold-adapted mice...

  14. Reference: 493 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available , and cold treatments and by sugar. During cold adaptation, tmt knockout lines ac...e taken up by the same carrier. Glucose import into vacuoles from two cold-induced tmt1 knockout lines or from triple knock... feeding into leaf discs revealed the strongest response to sugar in tmt1 knockou

  15. Genomic analyses and expression evaluation of thaumatin-like gene family in the cacao fungal pathogen Moniliophthora perniciosa.

    Science.gov (United States)

    Franco, Sulamita de Freitas; Baroni, Renata Moro; Carazzolle, Marcelo Falsarella; Teixeira, Paulo José Pereira Lima; Reis, Osvaldo; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

    2015-10-30

    Thaumatin-like proteins (TLPs) are found in diverse eukaryotes. Plant TLPs, known as Pathogenicity Related Protein (PR-5), are considered fungal inhibitors. However, genes encoding TLPs are frequently found in fungal genomes. In this work, we have identified that Moniliophthora perniciosa, a basidiomycete pathogen that causes the Witches' Broom Disease (WBD) of cacao, presents thirteen putative TLPs from which four are expressed during WBD progression. One of them is similar to small TLPs, which are present in phytopathogenic basidiomycete, such as wheat stem rust fungus Puccinia graminis. Fungi genomes annotation and phylogenetic data revealed a larger number of TLPs in basidiomycetes when comparing with ascomycetes, suggesting that these proteins could be involved in specific traits of mushroom-forming species. Based on the present data, we discuss the contribution of TLPs in the combat against fungal competitors and hypothesize a role of these proteins in M. perniciosa pathogenicity. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O'Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  17. Ultrastructure of the dikaryotic form of Cyathus bulleri Brodie.

    Science.gov (United States)

    Kozar, F; MacDonald, B R; Weijer, J

    1977-01-01

    The fine structure of the dikaryotic form of Cyathus bulleri Brodie was generally found to be similar to that of other hyphal forms of the Basidiomycetes. The nuclear walls were doubled, porous and in some cases connected to the endoplasmic reticulum. The presence of typical as well as filamentous and U-shaped mitochondria was confirmed. Other cellular structures and organelles, among them vacuoles, vesicular and myelinoid-like bodies, often associated with the cell membranes, glycogen and ribosomes were also observed in the cytoplasm. The presence of the dolipore/parenthesome apparatus and clamp connections typical of the Basidiomycetes was established.

  18. Antibiotics in the chemical communication of fungi.

    Science.gov (United States)

    Kettering, Melanie; Sterner, Olov; Anke, Timm

    2004-01-01

    In dual cultures Oudemansiella mucida and Xerula melanotricha (basidiomycetes) react to the presence of living Penicillium notatum or P. turbatum with an increased production of strobilurin A (1) or X (2). P. notatum in turn reacts to the two basidiomycetes or their antibiotic strobilurin A alone with the production of N-(2-hydroxypropanoyl)-2-aminobenzoic acid amide (3) or chrysogine (4). P. melinii and P. urticae overgrow O. mucida due to complete resistance to strobilurin A. P. brevicompactum, P. citrinum, P. janczewskii and the other Penicillium strains are all sensitive but apparently do not induce O. mucida to produce the amounts of strobilurin A needed to inhibit their growth.

  19. Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.

    2011-01-01

    The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

  20. [Characterization of an extracellular glycolipid from Lentinus edodes (Berk.) Sing [Lentinula edodes (Berk.) Pegler

    Science.gov (United States)

    Tsivileva, O M; Nikitina, V E; Makarov, O E

    2008-01-01

    Submerged mycelium of a xylotrophic basidiomycete Lentinus edodes produces an extracellular glycolipid, S3, associated with a lectin. Galactose glycan residue, as well as the lipid pool composition, which includes nonhydroxylated short-chain fatty acids, is uncommon for basidiomycetes. The glycolipid consists of D-galactopyranose (15% of S3 contains galactose sulfate) acylated by octadecanoic and nonadecanoic fatty acid residues (28 and 72%, respectively). The glycolipid structure and composition are confirmed by physicochemical analysis. The glycolipid is assumed to be a regulator of lectin activity.

  1. Potential production of carotenoids from Neurospora

    Directory of Open Access Journals (Sweden)

    SRI PRIATNI

    2014-05-01

    Full Text Available Priatni S. 2014. Review: Potential production of carotenoids from Neurospora. Nusantara Bioscience 6: 63-68. Carotenoids are abundant and widely distributed in plants, animals and microorganisms. Commercial use of carotenoids competes between microorganisms and synthetic manufacture. Carotenoids production can be increased by improving the efficiency of carotenoid synthesis in microbes. Some of the cultural and environmental stimulants are positively affecting the carotenoid content of carotenogenic strains such as Neurospora. Neurospora is a fungus that exhibits the formation of spores and conidia, the part of the cell for carotenoids biosynthesis. The Indonesian traditional fermented food, red peanut cake or oncom, especially in West Java, is produced from legume residues of Neurospora sp. This fungus has been isolated and identified as Neurospora intermedia. In order to apply this pigment for food and cosmetic colorants, encapsulation techniques of carotenoids have been developed to improve its solubility and stability.

  2. Carotenoid Metabolism in Plants: The Role of Plastids.

    Science.gov (United States)

    Sun, Tianhu; Yuan, Hui; Cao, Hongbo; Yazdani, Mohammad; Tadmor, Yaakov; Li, Li

    2018-01-08

    Carotenoids are indispensable to plants and critical in human diets. Plastids are the organelles for carotenoid biosynthesis and storage in plant cells. They exist in various types, which include proplastids, etioplasts, chloroplasts, amyloplasts, and chromoplasts. These plastids have dramatic differences in their capacity to synthesize and sequester carotenoids. Clearly, plastids play a central role in governing carotenogenic activity, carotenoid stability, and pigment diversity. Understanding of carotenoid metabolism and accumulation in various plastids expands our view on the multifaceted regulation of carotenogenesis and facilitates our efforts toward developing nutrient-enriched food crops. In this review, we provide a comprehensive overview of the impact of various types of plastids on carotenoid biosynthesis and accumulation, and discuss recent advances in our understanding of the regulatory control of carotenogenesis and metabolic engineering of carotenoids in light of plastid types in plants. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

  3. RNA-Seq and Mass-Spectrometry-Based Lipidomics Reveal Extensive Changes of Glycerolipid Pathways in Brown Adipose Tissue in Response to Cold

    DEFF Research Database (Denmark)

    Marcher, Ann-Britt; Loft, Anne; Nielsen, Ronni

    2015-01-01

    involved in glycerophospholipid synthesis and fatty acid elongation. This is accompanied by significant changes in the acyl chain composition of triacylglycerols (TAGs) as well as subspecies-selective changes of acyl chains in glycerophospholipids. These results indicate that cold adaptation of BAT......Cold exposure greatly alters brown adipose tissue (BAT) gene expression and metabolism to increase thermogenic capacity. Here, we used RNA sequencing and mass-spectrometry-based lipidomics to provide a comprehensive resource describing the molecular signature of cold adaptation at the level...... of the transcriptome and lipidome. We show that short-term (3-day) cold exposure leads to a robust increase in expression of several brown adipocyte genes related to thermogenesis as well as the gene encoding the hormone irisin. However, pathway analysis shows that the most significantly induced genes are those...

  4. Thermal niche of Atlantic cod Gadus morhua: limits, tolerance and optima

    DEFF Research Database (Denmark)

    Righton, David A.; Andersen, Ken Haste; Neat, Francis

    2010-01-01

    Recent studies in the marine environment have suggested that the limited phenotypic plasticity of cold-adapted species such as Atlantic cod Gadus morhua L. will cause distributions to shift toward the poles in response to rising sea temperatures. Some cod stocks are predicted to collapse, but thi......Recent studies in the marine environment have suggested that the limited phenotypic plasticity of cold-adapted species such as Atlantic cod Gadus morhua L. will cause distributions to shift toward the poles in response to rising sea temperatures. Some cod stocks are predicted to collapse...... niche of approximately 12°C, but latitudinal differences in water temperature meant that cod in the warmer, southern regions experienced 3 times the degree days (DD; ~4000 DD yr–1) than individuals from northern regions (~1200 DD yr–1). Growth rates increased with temperature, reaching a maximum...

  5. Carotenoids in staple cereals: Metabolism, regulation, and genetic manipulation

    Directory of Open Access Journals (Sweden)

    shengnan zhai

    2016-08-01

    Full Text Available Carotenoids play a critical role in animal and human health. Animals and humans are unable to synthesize carotenoids de novo, and therefore rely upon diet as sources of these compounds. However, major staple cereals often contain only small amounts of carotenoids in their grain. Consequently, there is considerable interest in genetic manipulation of carotenoid content in cereal grain. In this review, we focus on carotenoid metabolism and regulation in non-green plant tissues, as well as genetic manipulation in staple cereals such as rice, maize, and wheat. Significant progress has been made in three aspects: (1 seven carotenogenes play vital roles in carotenoid regulation in non-green plant tissues, including DXS (1-deoxyxylulose-5-phosphate synthase influencing isoprenoid precursor supply, PSY (phytoene synthase, LCYB (β-cyclase and LCYE (ε-cyclase controlling biosynthesis, HYDB (1-hydroxy-2-methyl-2-(E-butenyl 4-diphosphate reductase and CCDs (carotenoid cleavage dioxygenases responsible for degradation, and OR (orange conditioning sequestration sink; (2 pro-vitamin A-biofortified crops, such as rice and maize, were developed by either metabolic engineering or marker-assisted breeding; (3 QTLs for carotenoid content on chromosomes 3B, 7A, and 7B were consistently identified, eight carotenogenes including 23 loci were detected, and ten gene-specific markers for carotenoid accumulation were developed and applied in wheat improvement. A comprehensive and deeper understanding of the regulatory mechanisms of carotenoid metabolism in crops will be benefitical in improving our precision in improving carotenoid contents. Genomic selection and gene editing are emerging as transformative technologies for vitamin A biofortification.

  6. Latin American food sources of carotenoids.

    Science.gov (United States)

    Rodriguez-Amaya, D B

    1999-09-01

    Latin America has a wide variety of carotenogenic foods, notable for the diversity and high levels of carotenoids. A part of this natural wealth has been analyzed. Carrot, red palm oil and some cultivars of squash and pumpkin are sources of both beta-carotene and alpha-carotene. beta-carotene is the principal carotenoid of the palm fruits burití, tucumã and bocaiuva, other fruits such as loquat, marolo and West Indian cherry, and sweet potato. Buriti also has high amounts of alpha-carotene and gamma-carotene. beta-Cryptoxanthin is the major carotenoid in caja, nectarine, orange-fleshed papaya, orange, peach, tangerine and the tree tomato. Lycopene predominates in tomato, red-fleshed papaya, guava, pitanga and watermelon. Pitanga also has substantial amounts of beta-cryptoxanthin, gamma-carotene and rubixanthin. Zeaxanthin, principal carotenoid of corn, is also predominant only in piquí. delta-Carotene is the main carotenoid of the peach palm and zeta-carotene of passion fruit. Lutein and beta-carotene, in high concentrations, are encountered in the numerous leafy vegetables of the region, as well as in other green vegetables and in some varieties of squash and pumpkin. Violaxanthin is the principal carotenoid of mango and mamey and is also found in appreciable amounts in green vegetables. Quantitative, in some cases also qualitative, differences exist among cultivars of the same food. Generally, carotenoids are in greater concentrations in the peel than in the pulp, increase considerably during ripening and are in higher levels in foods produced in hot places. Other Latin America indigenous carotenogenic foods must be investigated before they are supplanted by introduced crops, which are often poorer sources of carotenoids.

  7. Immunogenicity and protective efficacy of a live attenuated H5N1 vaccine in nonhuman primates.

    Directory of Open Access Journals (Sweden)

    Shufang Fan

    2009-05-01

    Full Text Available The continued spread of highly pathogenic H5N1 influenza viruses among poultry and wild birds, together with the emergence of drug-resistant variants and the possibility of human-to-human transmission, has spurred attempts to develop an effective vaccine. Inactivated subvirion or whole-virion H5N1 vaccines have shown promising immunogenicity in clinical trials, but their ability to elicit protective immunity in unprimed human populations remains unknown. A cold-adapted, live attenuated vaccine with the hemagglutinin (HA and neuraminidase (NA genes of an H5N1 virus A/VN/1203/2004 (clade 1 was protective against the pulmonary replication of homologous and heterologous wild-type H5N1 viruses in mice and ferrets. In this study, we used reverse genetics to produce a cold-adapted, live attenuated H5N1 vaccine (AH/AAca that contains HA and NA genes from a recent H5N1 isolate, A/Anhui/2/05 virus (AH/05 (clade 2.3, and the backbone of the cold-adapted influenza H2N2 A/AnnArbor/6/60 virus (AAca. AH/AAca was attenuated in chickens, mice, and monkeys, and it induced robust neutralizing antibody responses as well as HA-specific CD4+ T cell immune responses in rhesus macaques immunized twice intranasally. Importantly, the vaccinated macaques were fully protected from challenge with either the homologous AH/05 virus or a heterologous H5N1 virus, A/bar-headed goose/Qinghai/3/05 (BHG/05; clade 2.2. These results demonstrate for the first time that a cold-adapted H5N1 vaccine can elicit protective immunity against highly pathogenic H5N1 virus infection in a nonhuman primate model and provide a compelling argument for further testing of double immunization with live attenuated H5N1 vaccines in human trials.

  8. Whole-Genome Shotgun Sequence of the Keratinolytic Bacterium Lysobacter sp. A03, Isolated from the Antarctic Environment.

    Science.gov (United States)

    Pereira, Jamile Queiroz; Ambrosini, Adriana; Sant'Anna, Fernando Hayashi; Tadra-Sfeir, Michele; Faoro, Helisson; Pedrosa, Fábio Oliveira; Souza, Emanuel Maltempi; Brandelli, Adriano; Passaglia, Luciane M P

    2015-04-02

    Lysobacter sp. strain A03 is a protease-producing bacterium isolated from decomposing-penguin feathers collected in the Antarctic environment. This strain has the ability to degrade keratin at low temperatures. The A03 genome sequence provides the possibility of finding new genes with biotechnological potential to better understand its cold-adaptation mechanism and survival in cold environments. Copyright © 2015 Pereira et al.

  9. Herbivore grazing—or trampling? Trampling effects by a large ungulate in cold high- latitude ecosystems

    OpenAIRE

    Heggenes, Jan; Odland, Arvid; Chevalier, Tomas; Ahlberg, Jörgen; Berg, Amanda; Larsson, Håkan; Bjerketvedt, Dag Kjartan

    2017-01-01

    Mammalian herbivores have important top-down effects on ecological processes and landscapes by generating vegetation changes through grazing and trampling. For free-ranging herbivores on large landscapes, trampling is an important ecological factor. However, whereas grazing is widely studied, low-intensity trampling is rarely studied and quantified. The cold-adapted northern tundra reindeer (Rangifer tarandus) is a wide-ranging keystone herbivore in large open alpine and Arctic ecosystems. Re...

  10. Herbivore grazing?or trampling? Trampling effects by a large ungulate in cold high?latitude ecosystems

    OpenAIRE

    Heggenes, Jan; Odland, Arvid; Chevalier, Tomas; Ahlberg, J?rgen; Berg, Amanda; Larsson, H?kan; Bjerketvedt, Dag K.

    2017-01-01

    Mammalian herbivores have important top-down effects on ecological processes and landscapes by generating vegetation changes through grazing and trampling. For free-ranging herbivores on large landscapes, trampling is an important ecological factor. However, whereas grazing is widely studied, low-intensity trampling is rarely studied and quantified. The cold-adapted northern tundra reindeer (Rangifer tarandus) is a wide-ranging keystone herbivore in large open alpine and Arctic ecosystems. Re...

  11. Biotechnological potential of the microflora associated with the brown alga Ascophyllum nodosum

    OpenAIRE

    Martin, Marjolaine; Martin, Renée; Barbeyron, Tristan; Portetelle, Daniel; Michel, Gurvan; Vandenbol, Micheline

    2015-01-01

    Bacteria associated with algae are underexplored despite their huge biodiversity and the fact that they differ markedly from those living freely in seawater. These bacterial communities are known to represent great potential for the production of diverse bioactive compounds, such as specific glycoside hydrolases, as they interact in multiple complex ways with their host. Furthermore, enzymes from marine bacteria have original properties, like cold-adapted, halotolerant and highly stable, whic...

  12. A live attenuated H7N7 candidate vaccine virus induces neutralizing antibody that confers protection from challenge in mice, ferrets and monkeys

    Science.gov (United States)

    A live attenuated H7N7 candidate vaccine virus was generated by reverse genetics using the modified hemagglutinin (HA) and neuraminidase (NA) genes of HP A/Netherlands/219/03 (NL/03) (H7N7) wild-type (wt) virus and the six internal protein genes of the cold-adapted (ca) A/Ann Arbor/6/60 ca (AA ca) (...

  13. Mycorrhizal fungi of aspen forests: Natural occurrence and potential applications

    Science.gov (United States)

    Cathy L. Cripps

    2001-01-01

    Native mycorrhizal fungi associated with aspen were surveyed on three soil types in the north-central Rocky Mountains. Selected isolates were tested for the ability to enhance aspen seedling growth in vitro. Over 50 species of ectomycorrhizal fungi occur with Populus tremuloides in this region, primarily basidiomycete fungi in the Agaricales. Almost one-third (30%)...

  14. Global warming and mycoflora in the Baltic Region

    Directory of Open Access Journals (Sweden)

    Hanns Kreisel

    2013-12-01

    Full Text Available The author discusses possible effects of global warming on distribution and ecology of larger fungi, and presents examples of suggested indicator species which apparently are spreading from south to north. Only Basidiomycetes are corncerned, while actually no case of non-lichenized Ascomycetes is known. A continued monitoring of the mentioned species is recommended.

  15. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  16. Leaf-cutting ant fungi produce cell wall degrading pectinase complexes reminiscent of phytopathogenic fungi

    DEFF Research Database (Denmark)

    Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Roepstorff, Peter

    2010-01-01

    Leaf-cutting (attine) ants use their own fecal material to manure fungus gardens, which consist of leaf material overgrown by hyphal threads of the basidiomycete fungus Leucocoprinus gongylophorus that lives in symbiosis with the ants. Previous studies have suggested that the fecal droplets conta...

  17. Novel mandibular gland volatiles from Apterostigma ants

    DEFF Research Database (Denmark)

    Hogan, Conor T.; Jones, Tappey H.; Zhukova, Mariya

    2017-01-01

    The fungus-farming ants are a well-studied evolutionary radiation within the subfamily Myrmicinae that associate with a web of symbionts that span kingdoms. Members of the Apterostigma pilosum species group cultivate unique basidiomycete fungi belonging to the coral-mushroom family Pterulaceae...

  18. On the asymmetry of mating in natural populations of the mushroom fungus Schizophyllum commune

    NARCIS (Netherlands)

    Nieuwenhuis, B.P.S.; Nieuwhof, S.; Aanen, D.K.

    2013-01-01

    Before a mycelium of a mushroom-forming basidiomycete develops mushrooms, the monokaryotic mycelium needs to become fertilized. Although the mechanistic details of mating in mushrooms have been studied thoroughly in laboratory research, very little is known on mating patterns in nature. In this

  19. Molecular identification, genetic diversity, population genetics and genomics of Rhizoctonia solani. In:perspective of plant pathology in genomic era

    Science.gov (United States)

    The basidiomycetous soilborne fungus Rhizoctonia (sensu lato) is an economically important pathogen of worldwide distribution and it is known to attack at least 188 species of higher plants, including agronomic crops, vegetables, ornamentals, forest trees and turfgrasses. The pathogenic isolates may...

  20. Phylogenetic position and physiology of Cerinosterus cyanescens

    NARCIS (Netherlands)

    Middelhoven, W.J.; Gueho, E.; Hoog, de G.S.

    2000-01-01

    Partial 25S rRNA sequencing of Cerinosterus cyanescens showed it to be a close relative of Microstroma juglandis, a member of the basidiomycetous order Microstromatales. It is unrelated to the generic type species, C. luteoalba, which is a member of the order Dacrymycetales. The clinical occurrence

  1. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

    Science.gov (United States)

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

    2009-01-01

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  2. Clonality and α-a recombination in the Australian Cryptococcus gattii VGII population - an emerging outbreak in Australia

    NARCIS (Netherlands)

    Carriconde, Fabian; Gilgado, Félix; Arthur, Ian; Ellis, David; Malik, Richard; van de Wiele, Nathalie; Robert, Vincent; Currie, Bart J.; Meyer, Wieland

    2011-01-01

    Cryptococcus gattii is a basidiomycetous yeast that causes life-threatening disease in humans and animals. Within C. gattii, four molecular types are recognized (VGI to VGIV). The Australian VGII population has been in the spotlight since 2005, when it was suggested as the possible origin for the

  3. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, Miaomiao; Jurak, E.; Heck, A.; Hildén, K.; Kabel, M.A.; Makela, M.R.; Altelaar, Maarten; Vries, De Ronald P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on
    decaying plant material in forests and grasslands of North America and Europe. It degrades forest
    litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in

  4. How (post-)genomic insights can provide new leads for improvements of mushroom cultivation

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, Harm; Zhou, Miaomiao; Jurak, Edita; Heck, Albert; Hildén, Kristiina S.; Kabel, Mirjam; Mäkelä, Miia R.; Altelaar, Maarten; de Vries, R.P.

    2016-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and contributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  5. Polyphenol extract from Phellinus igniarius protects against acrolein toxicity in vitro and provides protection in a mouse stroke model

    NARCIS (Netherlands)

    Suabjakyong, Papawee; Saiki, Ryotaro; Griensven, Van Leo J.L.D.; Higashi, Kyohei; Nishimura, Kazuhiro; Igarashi, Kazuei; Toida, Toshihiko

    2015-01-01

    The basidiomycetous mushroom Phellinus igniarius (L.) Quel. has been used as traditional medicine in various Asian countries for many years. Although many reports exist on its antioxidative and anti-inflammatory activities and therapeutic effects against various diseases, our current knowledge of

  6. [First report of Montagnea arenaria (D.C.) Zeller (Agaricales) in Chile].

    Science.gov (United States)

    Madrid Lorca, Hugo; Muñoz, Mélica

    2006-06-01

    Montagnea arenaria (D.C.) Zeller (Agaricales), an interesting basidiomycete adapted to arid environments is recorded for the first time from a sample collected on sandy soil in the northern zone of Chile. Its mature fruiting body is described. Taxonomic and ecological comments are also addressed.

  7. Moniliophthora roreri Genome and Transcriptome

    Science.gov (United States)

    Frosty pod rot disease of cacao is one of the most destructive diseases of cacao and at this time is limited to regions in South America and Central America. Frosty pod rot is caused by a fungal pathogen Moniliophthora roreri, a basidiomycete that is closely related to another cacao pathogen that ca...

  8. Elevated tropospheric CO2 and O3 may not alter initial wood decomposition rate or wood-decaying fungal community composition of Northern hardwoods

    Science.gov (United States)

    Emmanuel Ebanyenle; Andrew J. Burton; Andrew J. Storer; Dana L. Richter; Jessie A. Glaeser

    2016-01-01

    We examined the effects of elevated CO2 and/or O3 on the wood-decaying basidiomycete fungal community and wood decomposition rates at the Aspen Free-Air CO2 and O3 Enrichment (Aspen FACE) project. Mass loss rates were determined after one year of log decomposition on the soil...

  9. Fungal Systematics and Evolution: FUSE 3

    NARCIS (Netherlands)

    Krisai-Greilhuber, Irmgard; Chen, Yun; Jabeen, Sana; Madrid, Hugo; Marincowitz, Seonju; Razaq, Abdul; Sevcíková, Hana; Voglmayr, Hermann; Yazici, Kenan; Aptroot, André; Aslan, Ali; Boekhout, T.; Borovicka, Jan; Crous, P.W.; Ilyas, Sobia; Jami, Fahimeh; Jiang, Yu-Lan; Nasir Khalid, Abdul; Kolecka, Anna; Konvalinková, Tereza; Norphanphoun, Chada; Shaheen, Shabnum; Wang, Yong; Wingfield, Michael J.; Wu, Shi-Ping; Wu, Yue-Ming; Yu, Jie-Ying

    2017-01-01

    The present study introduces seven new species, one new combination, one new variety and several interesting taxonomical notes and/or geographical records. Most of the new taxa are Ascomycetes, but the study also includes a new variety of a Basidiomycete. Novel species include Gyromitra

  10. Novel Phialophora species from leaf-cutting ants (tribe Attini)

    NARCIS (Netherlands)

    Attili-Angelis, D.; Duarte, A.P.M.; Pagnocca, F.C.; Nagamoto, N.S.; de Vries, M.; Stielow, J.B.; de Hoog, G.S.

    2014-01-01

    Ants in the tribe Attini (Hymenoptera, Formicidae) maintain a 50 million-year-old lifestyle of co-evolution with symbiotic basidiomycetous fungi which they cultivate as essential source of nutrition. However, other microorganisms have been reported from ant habitats indicating a higher diversity of

  11. Bio-softening of mature coconut husk for facile coir recovery.

    Science.gov (United States)

    Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S

    2007-06-01

    Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.

  12. A potential role for an extracellular methanol oxidase secreted by Moniliophthora perniciosa in Witches' broom disease in cacao

    Science.gov (United States)

    The hemibiotrophic basidiomycete fungus Moniliophthora perniciosa, the causal agent of witches’ broom disease (WBD) of cacao, is able to grow in methanol as sole carbon source. In plants, one of the main sources of methanol is the pectin present in the structure of cell walls. Pectin is composed b...

  13. Identification and first report of Inonotus (Phellinus) tropicalis as an etiologic agent in a patient with chronic granulomatous disease

    Science.gov (United States)

    D.A. Sutton; E.H. Thompson; M.G. Rinaldi; P.C. Iwen; K.K. Nakasone; H.S. Jung; H.M. Rosenblatt; M.E. Paul

    2005-01-01

    Although isolates of filamentous basidiomycetes can usually be recognized in a clinical laboratory setting, identification is problematic, as they seldom exhibit diagnostic morphological features formed in nature. This paper is the first report of Inonotus (Phellinus ) tropicalis inciting human disease and describes the methods used to support the identification.

  14. Fungal Systematics and Evolution: FUSE 2

    NARCIS (Netherlands)

    Hernández-Restrepo, Margarita; Schumacher, René K.; Wingfield, Michael J.; Ahmad, Ishtiaq; Cai, Lei; Duong, Tuan A.; Edwards, Jacqueline; Gené, Josepa; Groenewald, Johannes Z.; Jabeen, Sana; Nasir Khalid, Abdul; Lombard, Lorenzo; Madrid, Hugo; Marin-Felix, Yasmina; Marincowitz, Seonju; Miller, Andrew N.; Rajeshkumar, Kunhiraman C.; Rashid, Abdul; Sarwar, Samina; Stchigel, Alberto M.; Taylor, Paul W.J.; Zhou, Nan; Crous, Pedro W.

    2016-01-01

    The present study introduces two new genera, 14 new species, five new combinations and 12 interesting host and/or geographical records. A majority of the fungi are Ascomycetes, but the study also includes a Basidiomycete, Xerocomellus fulvus described from Pakistan. Under single name nomenclature

  15. The yeast flora of some decaying mushrooms on trunks of living trees

    NARCIS (Netherlands)

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii

  16. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    DEFF Research Database (Denmark)

    Aanen, Duur K; Ros, Vera I D; de Fine Licht, Henrik H

    2007-01-01

    BACKGROUND: Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species di...

  17. Patterns of interaction specificity of fungus-growing termites and Termitomyces symbionts in South Africa

    NARCIS (Netherlands)

    Aanen, D.K.; Ros, V.I.D.; Fine Licht, de H.H.; Mitchell, J.; Beer, de Z.W.; Slippers, B.; Rouland-Lefevre, C.; Boomsma, J.J.

    2007-01-01

    Background Termites of the subfamily Macrotermitinae live in a mutualistic symbiosis with basidiomycete fungi of the genus Termitomyces. Here, we explored interaction specificity in fungus-growing termites using samples from 101 colonies in South-Africa and Senegal, belonging to eight species

  18. The genus Actiniceps Berk. & Br

    NARCIS (Netherlands)

    Boedijn, K.B.

    1959-01-01

    The genus Actiniceps Berk. & Br. is shown to be a Basidiomycete. Wiesnerina Höhn. and Dimorphocystis Corner are regarded synonymous. The type species A. thwaitesii Berk. & Br. is redescribed with D. capitatus Corner as synonym. The following new combinations are proposed: A. horrida (Höhn.) Boedijn,

  19. Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, M.; Lisá, Ludmila

    2015-01-01

    Roč. 119, č. 12 (2015), s. 1345-1353 ISSN 1878-6146 R&D Projects: GA ČR GAP504/12/0709 Institutional support: RVO:61388971 Keywords : Basidiomycetes * Cryopreservant * Liquid nitrogen Subject RIV: EE - Microbiology, Virology Impact factor: 2.244, year: 2015

  20. Temporal Alterations in the Secretome of the Selective Ligninolytic Fungus Ceriporipsis subvermispora during growth on Aspen Wood Reveal this Organism's Strategy for Degrading Lighnocellulose

    Science.gov (United States)

    Chiaki Hori; Jill Gaskell; Kiyohiko Igarashi; Phil Kersten; Michael Mozuch; Masahiro Samejima; Dan Cullen

    2014-01-01

    The white-rot basidiomycetes efficiently degrade all wood cell wall polymers. Generally, these fungi simultaneously degrade cellulose and lignin, but certain organisms, such as Ceriporiopsis subvermispora, selectively remove lignin in advance of cellulose degradation. However, relatively little is known about themechanismof selective ligninolysis. To...

  1. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-01-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  2. First report of frosty pod rot caused by Moniliophthora roreri on cacao in Bolivia

    Science.gov (United States)

    Frosty pod rot (FPR) is a devastating cacao disease caused by the basidiomycete Moniliophthora roreri (Aime and Phillips-Mora, 2005). The disease is confined to 13 countries in Central and South America and constitutes a permanent threat for cacao cultivation worldwide. In July 2012, FPR was detect...

  3. SECONDARY METABOLITES FROM MARINE PENICILLIUM BREVICOMPACTUM

    OpenAIRE

    ROVIROSA, JUANA; DIAZ-MARRERO, ANA; DARIAS, JOSE; PAINEMAL, KARIN; SAN MARTIN, AURELIO

    2006-01-01

    In a screening of Basidiomycete cultures isolated from marine invertebrates collected along the Chilean coastline for the production of antibiotics we identified a Penicillium brevicompactum strain as a producer of metabolites inhibiting the growth of bacteria and fungi. Bioactivity guided purification resulted in the isolation of four known metabolites. Their structures were elucidated by spectroscopic methods.

  4. Comparative genomics of Ceriporiopsis subvermispora and Phanerochaete chrysosporium provide insight into selective ligninolysis

    Science.gov (United States)

    Elena Fernandez-Fueyo; Francisco J. Ruiz-Dueñas; Patricia Ferreira; Dimitrios Floudas; David S. Hibbett; Paulo Canessa; Luis F. Larrondo; Tim Y. James; Daniela Seelenfreund; Sergio Lobos; Rubén Polanco; Mario Tello; Yoichi Honda; Takahito Watanabe; Takashi Watanabe; Jae San Ryu; Christian P. Kubicek; Monika Schmoll; Jill Gaskell; Kenneth E. Hammel; Franz J. St. John; Amber Vanden Wymelenberg; Grzegorz Sabat; Sandra Splinter BonDurant; Khajamohiddin Syed; Jagjit S. Yadav; Harshavardhan Dodapaneni; Venkataramanan Subramanian; José L. Lavin; José A. Oguiza; Gumer Perez; Antonio G. Pisabarro; Lucia Ramirez; Francisco Santoyo; Emma Master; Pedro M. Coutinho; Bernard Henrissat; Vincent Lombard; Jon Karl Magnuson; Ursula Kües; Chiaki Hori; Kiyohiko Igarashi; Masahiro Samejima; Benjamin W. Held; Kerrie W. Barry; Kurt M. LaButti; Alla Lapidus; Erika A. Lindquist; Susan M. Lucas; Robert Riley; Asaf A. Salamov; Dirk Hoffmeister; Daniel Schwenk; Yitzhak Hadar; Oded Yarden; Ronald P. de Vries; Ad Wiebenga; Jan Stenlid; Daniel Eastwood; Igor V. Grigoriev; Randy M. Berka; Robert A. Blanchette; Phil Kersten; Angel T. Martinez; Rafael Vicuna; Daniel Cullen

    2012-01-01

    Efficient lignin depolymerization is unique to the wood decay basidiomycetes, collectively referred to as white rot fungi. Phanerochaete chrysosporium simultaneously degrades lignin and cellulose, whereas the closely related species, Ceriporiopsis subvermispora, also depolymerizes lignin but may do so with relatively little...

  5. ASSIGNMENT OF GENES TO PULSE-FIELD SEPARATED CHROMOSOMES OF SCHIZOPHYLLUM-COMMUNE

    NARCIS (Netherlands)

    ASGEIRSDOTTIR, SA; SCHUREN, FHJ; WESSELS, JGH

    Chromosomal DNAs of the basidiomycete Schizophyllum commune were separated by Contour-Clamped Homogeneous Electric Field Electrophoresis (CHEF). The estimated sizes of the chromosomal DNAs ranged from 4.7 Megabase pairs (Mbp) to 1.6 Mbp, totalling 35.6 Mbp. Using sequences from 20 cloned genes we

  6. Epidemiologische trends in cryptokokkose : De Cryptococcus gattii-uitbraak in Canada

    NARCIS (Netherlands)

    Hagen, F; Boekhout, T

    2006-01-01

    Cryptococcosis is, when untreated, a fatal disease, which in the Netherlands is mainly caused by the basidiomycetous yeast Cryptococcus neoformans, and in more rare cases by Cryptococcus gattii. Infections with C. gattii occur almost only in immunocompetent individuals, while C. neoformans has a

  7. Two yeast species Cystobasidium psychroaquaticum f.a. sp. nov. and Cystobasidium rietchieii f.a. sp. nov. isolated from natural environments, and the transfer of Rhodotorula minuta clade members to the genus Cystobasidium

    NARCIS (Netherlands)

    Yurkov, A M; Kachalkin, A V; Daniel, H M; Groenewald, M; Libkind, D; de Garcia, V; Zalar, P; Gouliamova, D E; Boekhout, T; Begerow, D

    Many species of dimorphic basidiomycetes are known only in their asexual phase and typically those pigmented in different hues of red have been classified in the large polyphyletic genus Rhodotorula. These yeasts are ubiquitous and include a few species of some clinical relevance. The phylogenetic

  8. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  9. Enzyme activities of fungi associated with Picea abies needles

    Czech Academy of Sciences Publication Activity Database

    Žifčáková, Lucia; Dobiášová, Petra; Kolářová, Zuzana; Koukol, O.; Baldrian, Petr

    2011-01-01

    Roč. 4, č. 6 (2011), s. 427-436 ISSN 1754-5048 R&D Projects: GA MŠk LC06066; GA ČR GA526/08/0751 Institutional research plan: CEZ:AV0Z50200510 Keywords : Ascomycetes * Decomposition * Basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 2.507, year: 2011

  10. Enzyme activity of a Phanerochaete chrysosporium cellobiohydrolase

    African Journals Online (AJOL)

    The white-rot, basidiomycete fungus, Phanerochaete chrysosporium, has attracted .... with Congo red (1 mg/ml) solution, incubated at room temperature for 15 min and washed several times with sterile 1 .... white rot fungus Phanerochaete chrysosporium: cloning, sequence analysis and regulation of differential expression.

  11. Proteomic and functional analysis of the cellulase system expressed by Postia placenta during brown rot of solid wood

    Science.gov (United States)

    Jae San Ryu; Semarjit Shary; Carl J. Houtman; Ellen A. Panisko; Premsagar Korripally; Franz J. St. John; Casey Crooks; Matti Siika-aho; Jon K. Magnuson; Kenneth E. Hammel

    2011-01-01

    Brown rot basidiomycetes have an important ecological role in lignocellulose recycling and are notable for their rapid degradation of wood polymers via oxidative and hydrolytic mechanisms. However, most of these fungi apparently lack processive (exo-acting) cellulases, such as cellobiohydrolases, which are generally required for efficient cellulolysis. The recent...

  12. Comparative transcriptome and secretome analysis of wood decay fungi Postia placenta and Phanerochaete chrysosporium

    Science.gov (United States)

    Amber J. Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D Mansfield; Robert A. Blanchette; Diego Martinez; Igor Grigoriev; Philip J Kersten; Daniel Cullen

    2010-01-01

    Cellulose degradation by brown rot fungi, such as Postia placenta, is poorly understood relative to the phylogenetically related white rot basidiomycete, Phanerochaete chrysosporium. To elucidate the number, structure, and regulation of genes involved in lignocellulosic cell wall attack, secretome and transcriptome analyses were performed on both wood decay fungi...

  13. INSOLUBLE HYDROPHOBIN COMPLEXES IN THE WALLS OF SCHIZOPHYLLUM-COMMUNE AND OTHER FILAMENTOUS FUNGI

    NARCIS (Netherlands)

    DEVRIES, OMH; FEKKES, MP; WOSTEN, HAB; WESSELS, JGH

    Two closely related cysteine-rich hydrophobic proteins, Sc3p and Sc4p, of the basidiomycete Schizophyllum commune are developmentally regulated and associated with the walls of aerial hyphae and fruit-body hyphae. They are present in the walls as hot-SDS-insoluble complexes which can be extracted

  14. The edible mushroom Laetiporus sulphureus as potential source of natural antioxidants

    NARCIS (Netherlands)

    Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Stefanoska, I.; Griensven, van L.J.L.D.

    2013-01-01

    Hot water extract (LN), partially purified polysaccharides (LP) and hot alkali extracted polysaccharides (LNa) obtained from fruiting bodies of the wild basidiomycete Laetiporus sulphureus were examined for their antioxidant activities. LNa was the most active antioxidant, as shown by the median

  15. HYDROPHOBIN GENES INVOLVED IN FORMATION OF AERIAL HYPHAE AND FRUIT BODIES IN SCHIZOPHYLLUM

    NARCIS (Netherlands)

    WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SCHUREN, FHJ

    Fungi typically grow by apical extension of hyphae that penetrate moist substrates. After establishing a branched feeding mycelium, the hyphae differentiate and grow away from the substrate into the air where they form various structures such as aerial hyphae and mushrooms. In the basidiomycete

  16. THE THN MUTATION OF SCHIZOPHYLLUM-COMMUNE, WHICH SUPPRESSES FORMATION OF AERIAL HYPHAE, AFFECTS EXPRESSION OF THE SC3 HYDROPHOBIN GENE

    NARCIS (Netherlands)

    WESSELS, JGH; DEVRIES, OMH; ASGEIRSDOTTIR, SA; SPRINGER, J

    1991-01-01

    The spontaneous and recessive mutation thn in the basidiomycete Schizophyllum commune suppresses the formation of aerial hyphae in the monokaryon and, if present as a double dose, the formation of both aerial hyphae and fruit-bodies in the dikaryon. In the monokaryon, the mutation prevents

  17. The SC15 protein of Schizophyllum commune mediates formation of aerial hyphae and attachment in the absence of the SC3 hydrophobin

    NARCIS (Netherlands)

    Lugones, L G; de Jong, J F; de Vries, O M H; Jalving, R; Dijksterhuis, J; Wösten, H A B

    Disruption of the SC3 gene in the basidiomycete Schizophyllum commune affected not only formation of aerial hyphae but also attachment to hydrophobic surfaces. However, these processes were not completely abolished, indicating involvement of other molecules. We here show that the SC15 protein

  18. Bioconcentration of manganese and iron in Panaeoloideae Sing

    NARCIS (Netherlands)

    Stijve, T.; Blake, C.

    1994-01-01

    According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae,

  19. Uncovering the abilities of Agaricus bisporus to degrade plant biomass throughout its life cycle

    NARCIS (Netherlands)

    Patyshakuliyeva, A.; Post, H.; Zhou, M.; Jurak, E.; Heck, A.J.R.; Hilden, K.S.; Kabel, M.A.; Makela, M.R.; Altenaar, M.A.F.; Vries, de R.P.

    2015-01-01

    The economically important edible basidiomycete mushroom Agaricus bisporus thrives on decaying plant material in forests and grasslands of North America and Europe. It degrades forest litter and con-tributes to global carbon recycling, depolymerizing (hemi-)cellulose and lignin in plant biomass.

  20. A New Perspective on Radiation Resistance Based on Deinococcus radiodurans

    Science.gov (United States)

    2009-03-01

    tolerate 3,000–5000 Gy, but are rendered sterile. As a haploid, the basidiomycete fungus Ustilago maydis carries a single set of chromosomes per...salinarum NRC-1. Environ. Microbiol. 5 Jan 2009 (doi:10.1111/j.1462-2920.2008.01828.x). 21. Chan, H. L. et al. Proteomic analysis of UVC irradiation

  1. Enzymology and molecular biology of lignin degradation

    Science.gov (United States)

    D. Cullen; P.J. Kersten

    2004-01-01

    This review provides an overview of the physiology and genetics of lignin degradation by white rot basidiomycetes. Emphasis is on recent advances and the reader is referred to earlier comprehensive reviews for historical perspective and background (Kirk and Farrell 1987; Gold and Alic 1993; Higuchi 1993; Cullen and Kersten 1996; Cullen 1997). Recent completion of a...

  2. Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.

    2013-01-01

    Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are atta...

  3. Author Details

    African Journals Online (AJOL)

    Goud, MJP. Vol 2, No 3 (2007) - Articles Antibacterial activity and biomolecular composition of certain fresh water micro-algae from River Godavari (India) Abstract PDF · Vol 3, No 1 (2008) - Articles Replica plate screening method for detecting phosphatase activity in basidiomycetes using 1-Napthyl Phosphate as a ...

  4. Analysis of the Phlebiopsis gigantea Genome, Transcriptome and Secretome Provides Insight into Its Pioneer Colonization Strategies of Wood

    Science.gov (United States)

    Chiaki Hori; Takuya Ishida; Kiyohiko Igarashi; Masahiro Samejima; Hitoshi Suzuki; Emma Master; Patricia Ferreira; Francisco J. Ruiz-Duenas; Benjamin Held; Paulo Canessa; Luis F. Larrondo; Monika Schmoll; Irina S. Druzhinina; Christian P. Kubicek; Jill A. Gaskell; Phil Kersten; Franz St. John; Jeremy Glasner; Grzegorz Sabat; Sandra Splinter Bondurant; Khajamohiddin Syed; Jagjit Yadav; Anthony C. Mgbeahuruike; Andriy Kovalchuk; Fred O. Asiegbu; Gerald Lackner; Dirk Hoffmeister; Jorge Recoret; Ana Gutierrez; Hui Sun; Erika Lindquist; Kerrie Barry; Robert Riley; Igor V. Grigoriev; Bernard Henrissat; Ursula Kues; Randy M. Berka; Angel T. Martinez; Sarah F. Covert; Robert A. Blanchette; Daniel Cullen

    2014-01-01

    Collectively classified as white-rot fungi, certain basidiomycetes efficiently degrade the major structural polymers of wood cell walls. A small subset of these Agaricomycetes, exemplified by Phlebiopsis gigantea, is capable of colonizing freshly exposed conifer sapwood despite its high content of extractives, which retards the establishment of other...

  5. Transcriptome and secretome analyses of the wood decay fungus Wolfiporia cocos support alternative mechanisms of lignocellulose conversion

    Science.gov (United States)

    Jill Gaskell; Robert A. Blanchette; Philip E. Stewart; Sandra Splinter BonDurant; Marie Adams; Grzegorz Sabat; Philip Kersten; Daniel Cullen

    2016-01-01

    Certain wood decay basidiomycetes, collectively referred to as brown rot fungi, rapidly depolymerize cellulose while leaving behind the bulk of cell wall lignin as a modified residue. The mechanism(s) employed is unclear, but considerable evidence implicates the involvement of diffusible oxidants generated via Fenton-like chemistry. Toward a better understanding of...

  6. Significant alteration of gene expression in wood decay fungi Postia placenta and Phanerochaete chrysosporium by plant species

    Science.gov (United States)

    Amber Vanden Wymelenberg; Jill Gaskell; Michael Mozuch; Sandra Splinter BonDurant; Grzegorz Sabat; John Ralph; Oleksandr Skyba; Shawn D. Mansfield; Robert A. Blanchette; Igor Grigoriev; Philip J. Kersten; Daniel Cullen

    2011-01-01

    Identification of specific genes and enzymes involved in conversion of lignocellulosics from an expanding number of potential feedstocks is of growing interest to bioenergy process development. The basidiomycetous wood decay fungi Phanerochaete chrysosporium and Postia placenta are promising in this regard because they are able to utilize a wide range of simple and...

  7. A rare case of urinary tract infection due to Trichosporonasahii in a ...

    African Journals Online (AJOL)

    Trichosporonasahii is a basidiomycete yeast responsible for white piedra and onychomycosis in the immunocompetent host. In the immunocompromised patients, invasive infections are reported; their diagnosis is difficult and they are associated with high mortality rate. Urinary infection due to Trichosporon Asahi is rare but ...

  8. Cultural characteristics, sexuality and ligninolytic enzyme production of Trametes cervina

    Czech Academy of Sciences Publication Activity Database

    Tomšovský, Michal; Homolka, Ladislav

    2004-01-01

    Roč. 25, č. 1 (2004), s. 49-55 ISSN 0181-1584 R&D Projects: GA ČR GA526/02/1216 Institutional research plan: CEZ:AV0Z5020903 Keywords : basidiomycetes * trametes * culture Subject RIV: EE - Microbiology, Virology Impact factor: 0.250, year: 2004

  9. Draft Genome Sequence of the Animal and Human Pathogen Malassezia pachydermatis Strain CBS 1879

    Science.gov (United States)

    Triana, Sergio; González, Andrés; Ohm, Robin A.; Wösten, Han A. B.; de Cock, Hans; Restrepo, Silvia

    2015-01-01

    Malassezia pachydermatis is a basidiomycetous yeast that causes infections in humans and animals. Here, we report the genome sequence of Malassezia pachydermatis strain CBS 1879, which will facilitate the study of mechanisms underlying pathogenicity of the only non-lipid-dependent Malasezzia species. PMID:26472839

  10. Long-term Maintenance of Fungal Cultures on Perlite in Cryovials – an Alternative for Agar Slants

    Czech Academy of Sciences Publication Activity Database

    Homolka, Ladislav; Lisá, Ludmila

    2008-01-01

    Roč. 53, č. 6 (2008), s. 534-536 ISSN 0015-5632 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : basidiomycete * perlite * long-term maintenance Subject RIV: EE - Microbiology, Virology Impact factor: 1.172, year: 2008

  11. Draft genome sequence of the white-rot fungus Obba rivulosa 3A-2

    Science.gov (United States)

    Otto Miettinen; Robert Riley; Kerrie Barry; Daniel Cullen; Ronald P. de Vries; Matthieu Hainaut; Annele Hatakka; Bernard Henrissat; Kristiina Hilden; Rita Kuo; Kurt LaButti; Anna Lipzen; Miia R. Makela; Laura Sandor; Joseph W. Spatafora; Igor V. Grigoriev; David S. Hibbett

    2016-01-01

    We report here the first genome sequence of the white-rot fungus Obba rivulsa (Polyporales, Basidiomycota), a polypore known for its lignin-decomposing ability. The genome is based on the homokaryon 3A-2 originating in Finland. The genome is typical in size and carbohydrate active enzyme (CAZy) content for wood-decomposing basidiomycetes.

  12. Phenolic compounds present in medicinal mushroom extracts generate reactive oxygen species in human cells in vitro

    NARCIS (Netherlands)

    Wei, S.; Helsper, J.P.F.G.; Griensven, van L.J.L.D.

    2008-01-01

    Hot-water extracts of the higher Basidiomycetes Agaricus bisporus (J. Lge) Imbach, A. brasiliensis S. Wasser et al., Coprinus comatus (O.F. Mull.) Pers., Ganoderma lucidum (W. Curt.: Fr.) P. Karst., and Phellinus linteus (Berk. et Curt.) Teng were made, and the resulting polysaccharide mixtures were

  13. Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation

    DEFF Research Database (Denmark)

    Sitarz, Anna Katarzyna; Mikkelsen, Jørn Dalgaard; Højrup, Peter

    2013-01-01

    Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt...

  14. Purification, molecular cloning, and enzymatic properties of a family 12 endoglucanase (EG-II) from fomitopsis palustris: role of EG-II in larch holocellulose hydrolysis.

    Science.gov (United States)

    Shimokawa, Tomoko; Shibuya, Hajime; Nojiri, Masanobu; Yoshida, Shigeki; Ishihara, Mitsuro

    2008-09-01

    A family 12 endoglucanase with a molecular mass of 23,926 Da (EG-II) from the brown-rot basidiomycete Fomitopsis palustris was purified and characterized. One of the roles of EG-II in wood degradation is thought to be to loosen the polysaccharide network in cell walls by disentangling hemicelluloses that are associated with cellulose.

  15. Humic Acid-Like Material from Sewage Sludge Stimulates Culture Growth of Ectomycorrhizal Fungi in Vitro

    Czech Academy of Sciences Publication Activity Database

    Hršelová, Hana; Soukupová, Lucie; Gryndler, Milan

    2007-01-01

    Roč. 52, č. 6 (2007), s. 627-630 ISSN 0015-5632 R&D Projects: GA ČR GA526/06/0540 Institutional research plan: CEZ:AV0Z50200510 Keywords : ectomycorrhizal basidiomycetes * sewage sludge * humic-acid-like materials Subject RIV: EE - Microbiology, Virology Impact factor: 0.989, year: 2007

  16. Disease control by chemical and biological fungicides in cultivated mushrooms: Button mushroom, oyster mushroom and shiitake

    OpenAIRE

    Potočnik, Ivana; Stepanović, Miloš; Rekanović, Emil; Todorović, Biljana; Milijašević-Marčić, Svetlana

    2015-01-01

    The most commonly cultivated basidiomycetes worldwide and in Serbia are button mushroom (Agaricus bisporus), oyster mushroom (Pleurotus sp.) and shiitake (Lentinus edodes). Production of their fruiting bodies is severely afflicted by fungal, bacterial, and viral pathogens that are able to cause diseases which affect yield and quality. Major A. bisporus fungal pathogens include Mycogone perniciosa, Lecanicillium fungicola, and Cladobotryum spp., the causal a...

  17. Taxonomic studies in Chrysoderma, Corneromyces, Dendrophsellum, Hyphoradulum, and Mycobonia

    Science.gov (United States)

    Karen K. Nakasone

    2015-01-01

    Eight poorly known or unusual crustose and pileate basidiomycete species were studied. These included the type specimens of three monotypic genera: Chrysoderma alboluteum from Réunion is conspecific with Cerocorticium molle; Dendrophysellum amurense from the Russian Far East is a species of Vararia; and ...

  18. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

    Science.gov (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  19. Functional foods from mushroom

    Science.gov (United States)

    Mushrooms are defined as “a macro fungus with distinctive fruiting bodies that could be hypogeous or epigeous, large enough to be seen by naked eyes and to be picked by hands.” The Basidiomycetes and some species of Ascomycetes are categorized as mushrooms. Mushrooms constitute 22,000 known species ...

  20. Carotene-degrading activities from Bjerkandera adusta possess an application in detergent industries.

    Science.gov (United States)

    Linke, Diana; Leonhardt, Robin; Eisele, Nadine; Petersen, Laura M; Riemer, Stephanie; Nimtz, Manfred; Berger, Ralf G

    2015-06-01

    Four extracellular enzymes, a versatile peroxidase, a manganese peroxidase, a dye-decolorizing peroxidase and a lignin peroxidase were discovered in liquid cultures of the basidiomycete Bjerkandera adusta. All of them cleaved β-carotene effectively. Expression was enhanced in the presence of β-carotene or Coomassie Brilliant Blue and peaked after 7-9 days. The monomeric proteins were purified by ion exchange and size exclusion chromatography and exhibited molecular masses of 41, 43, 51 and 43 kDa, respectively. The coding sequences showed homologies from 61 to 89 % to peroxidases from other basidiomycetes. The novel enzymes retained strong activity even in the absence of hydrogen peroxide and at alkaline pH. De-staining of fabrics using detergent-tolerant enzymes may help to save the most important bio-resources, energy and water, in washing processes and led to green processes in textile cleaning.

  1. Hydrophobins in ectomycorrhizas: heterologous transcription of the Pisolithus HydPt-1 gene in yeast and Hebeloma cylindrosporum

    Directory of Open Access Journals (Sweden)

    D Tagu

    2009-12-01

    Full Text Available Hydrophobins are fungal cell wall proteins involved in aggregation of hyphae. Upon the development of the ectomycorrhizal symbiosis between tree roots and fungal hyphae, the transcripts of hydrophobin genes markedly accumulated. As the precise role of these proteins in symbiosis is not yet known, we develop heterologous expression system of the Pisolithus hydrophobin HYDPt-1. This gene has been introduced in Saccharomyces cerevisiae and in the ectomycorrhizal basidiomycete Hebeloma cylindrosporum. Introns were required for hydPt-1 transcript accumulation in the basidiomycete H. cylindrosporum. Heterologous transcript accumulation did not alter the phenotype of either species. The lack of altered phenotype resulted from the absence of HYDPt-1 polypeptide accumulation in transformed strains.

  2. Dissimilar pigment regulation in Serpula lacrymans and Paxillus involutus during inter-kingdom interactions

    DEFF Research Database (Denmark)

    Tauber, James P.; Gallegos-Monterrosa, Ramses; Kovács, Ákos T.

    2018-01-01

    Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S...... of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine....... lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S...

  3. A novel expansin protein from the white-rot fungus Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Omar Eduardo Tovar-Herrera

    Full Text Available A novel expansin protein (ScExlx1 was found, cloned and expressed from the Basidiomycete fungus Schizophylum commune. This protein showed the canonical features of plant expansins. ScExlx1 showed the ability to form "bubbles" in cotton fibers, reduce the size of avicel particles and enhance reducing sugar liberation from cotton fibers pretreated with the protein and then treated with cellulases. ScExlx1 was able to bind cellulose, birchwood xylan and chitin and this property was not affected by different sodium chloride concentrations. A novel property of ScExlx1 is its capacity to enhance reducing sugars (N-acetyl glucosamine liberation from pretreated chitin and further added with chitinase, which has not been reported for any expansin or expansin-like protein. To the best of our knowledge, this is the first report of a bona fide fungal expansin found in a basidiomycete and we could express the bioactive protein in Pichia pastoris.

  4. Various Stages of Pink Fungus (Upasia salmonicolor in Java

    Directory of Open Access Journals (Sweden)

    Ambarwati Harsojo Tjokrosoedarmo

    1995-12-01

    Full Text Available Pink fungus in Java is classified as Upasia salmonicolor (Basidiomycetes: Corticiaceae and its anamorph is Necator decretus. This fungus is a serious pathogen which attacks many woody plants. The pink fungus in Java exhibits five developmental stages on the surface of the host bark: I. An initial cobweb stage as thin, white, cobweb-like hyphal layer, which creeps over the surface of the bark, during which penetration of the host occurs; II. Pseudonodular stage, as conical white pustules occurring only on lenticels or cracks, and only on shady side of branches; III. Teleomorph, occurs as pink incrustation and pink pustules on shady side of branches; IV. Nodular stages, as globose white pustules occurring chiefly on intact bark, but also on the lenticels or cracks, on exposed side of branches; V. Anamorph, as small orange-red sporodochium, on exposed side of branches. Key words: pink fungus, Corticiaceae, Basidiomycetes, Necator

  5. Why Mycophoris is not an orchid seedling, and why Synaptomitus is not a fungal symbiont within this fossil

    DEFF Research Database (Denmark)

    Selosse, Marc-Andre; Brundrett, Mark; Dearnaley, John

    2017-01-01

    A recent publication in Botany introduced two new taxa: a fossil orchid seed (Mycophoris) and a fossilized basidiomycete fungus (Synaptomitus) in an alleged relationship with this orchid, encased in 15–20 million year old Dominican amber (Poinar, G. 2017. Two new genera, Mycophoris gen. nov......., (Orchidaceae) and Synaptomitus gen. nov. (Basidiomycota) based on a fossil seed with developing embryo and associated fungus in Dominican amber. Botany, 95: 1–8). From the working knowledge of extant orchid seeds, seedlings, and mycorrhiza shared among us, we cannot support these interpretations. Here we...... analyse: (i) why Mycophoris may not be an orchid seed, (ii) why Mycophoris is not a germinating seed, (iii) why fungal hyphae and a symbiotic fungus are absent in Mycophoris, and (iv) why Synaptomitus is likely not a fossil basidiomycete....

  6. Oxidoreductases from Trametes spp. in Biotechnology: A Wealth of Catalytic Activity

    Directory of Open Access Journals (Sweden)

    Gibson S. Nyanhongo

    2007-01-01

    Full Text Available Those oxidoreductases that are part of the ligninolytic complex of basidiomycete and ascomycete fungi have played an increasingly important role in biotechnological applications during the last decade. The stability of these extracellular enzymes, their good solubility, and a multitude of catalyzed reactions contribute to this trend. This review focuses on a single genus of white-rot basidiomycetes, Trametes, to highlight the numerous possibilities for the application of this microorganism as well as three of its enzymes: laccase, cellobiose dehydrogenase, and pyranose 2-oxidase. Whereas laccase is without doubt a major player in biotechnology, the two other enzymes are less well known, but represent emerging biocatalysts with potential. Both cellobiose dehydrogenase and pyranose 2-oxidase are presumed to participate in lignin breakdown and will be used to exemplify the potential of less prominent oxidoreductases from this genus.

  7. Genetic recombination in auxotrophic strains of Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Krejci, R.

    1987-01-01

    Four auxotrophic strains of ligninolytic basidiomycete Phanerochaete chrysosporium were obtained by UV mutagenesis. The heterokaryotic mycelium formed by complementation of different auxotrophic isolates was able to fruit and produce basidiospores. Prototrophic strains and strains with a recombined set of parental nutritional requirements were isolated from the basidiospore progeny of the heterokaryons. Genetic recombination hence takes place in fruit bodies produced by the heterokaryotic mycelium. (author). 3 tabs., 13 refs

  8. CELLULASES FROM THE BASIDIO - MYCETES CULTURAL LIQUID

    Directory of Open Access Journals (Sweden)

    К. G. Dreval

    2013-04-01

    Full Text Available Adsorption of cellulases on substrate taking place during the cultivation process was determined. Adsorbed enzymes can be eluted by buffer solution with high ionic strength, but for determine their activity they should be transferred into the aqueous solution. On the basis of the results a method for obtaining of cellulases preparations from cultural liquids of basidiomycetes was developed. This method is the elution of cellulases from the cultivation substrate of basidiomycetes. It was found that using of the last allows to obtain enzymatic preparations with a high degree of purification in 3 stages (salting out of proteins — dialysis — gelchromatography. Cellulase preparations received original products of basidiomycetes strains К-1, А-Дон-02, Д-1 Irpex lacteus and AnSc-1 Daedaleopsis confragosa f. confragosa were obtained. They contained different proteins, enzymes with specific peaks out of column and their activity. However, common to them was a distinct maximum of outing from the column by endoglucanases or cellobiases, which may indicate that the studied cellulolytic complexes of basidiomycetes do not contain multiple forms of cellulases with different molecular mass. This method allowed to obtain preparations with different degree of purification in comparing with the original culture filtrate 7,3 for endoglucanase and 33,3 for cellobiase of strain А-Дон-02 I. lacteus; 13,1 for endoglucanase and 25,5 for cellobiase of strain Д-1 I. lacteus; 29,9 for endoglucanase and 90,1 for cellobiase of strain К-1 I. lacteus; 2,1 for endoglucanase and 30,6 for cellobiase of strain AnSc-1 D. confragosa f. confragosa.

  9. In memoriam Rudolf Arnold Maas Geesteranus Den Haag, 20 january 1911-Oegstgeest, 18 may 2003

    OpenAIRE

    NN

    2003-01-01

    On 18 May 2003 Rudolf Maas Geesteranus died peacefully at the age of 92. With him the mycological world has lost a remarkable and versatile personality, who worked on the taxonomy of fungi for almost 60 years producing papers and books on a wide range of topics, including both asco- and basidiomycetes. The bibliographical notes and publication list printed in this journal on his retirement from active service at the Rijksherbarium in 1976, and on his eightieth birthday in 1991 (Bas, Persoonia...

  10. The use of secondary metabolite profiling in chemotaxonomy of filamentous fungi

    DEFF Research Database (Denmark)

    Frisvad, Jens Christian; Andersen, Birgitte; Thrane, Ulf

    2008-01-01

    A secondary metabolite is a chemical compound produced by a limited number of fungal species in a genus, an order, or even phylum. A profile of secondary metabolites consists of all the different compounds a fungus can produce on a given substratum and includes toxins, antibiotics and other outwa......, Xylaria and in few basidiomycete genera, but not in Zygomycota and Chytridiomycota. (C) 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved....

  11. Gene expression profiling of a Zn-tolerant and a Zn-sensitive Suillus luteus isolate exposed to increased external zinc concentrations

    OpenAIRE

    MULLER, Ludo; Craciun, A. R.; RUYTINX, Joske; LAMBAERTS, Marc; Verbruggen, N.; VANGRONSVELD, Jaco; COLPAERT, Jan

    2007-01-01

    Complementary DNA (cDNA)-amplified fragment-length polymorphism (AFLP) was applied to analyze transcript profiles of a Zn-tolerant and a Zn-sensitive isolate of the ectomycorrhizal basidiomycete Suillus luteus, both cultured with and without increased external zinc concentrations. From the obtained transcript profiles that covered approximately 2% of the total expected complement of genes in S. luteus, 144 nonredundant, differentially expressed transcript-derived fragments (TDFs), falling in ...

  12. The yeast flora of some decaying mushrooms on trunks of living trees

    OpenAIRE

    Middelhoven, W.J.

    2004-01-01

    Several ascomycetous and basidiomycetous yeasts were isolated from rotten mushrooms on the trunks of beech and tamarisk trees. One strain, identified as the novel species Cryptococcus allantoinivorans, assimilated allantoin as the sole carbon source. Phylogenetically it belongs to the C. laurentii complex, Papiliotrema bandonii being the closest relative. Some ascomycetous strains could not be distinguished from Pichia guillermondii, but deviated considerably in rDNA sequences. In addition to...

  13. New phenyl-ethanediols from the culture broth of Boletus edulis.

    Science.gov (United States)

    Yang, Wan-Qiu; Qin, Xiang-Dong; Shao, Hong-Jun; Fang, Li-Zhen; Wang, Fei; Ding, Zhi-Hui; Dong, Ze-Jun; Liu, Ji-Kai

    2007-04-01

    A new phenyl-ethanediol, (1S)-(4-acetylphenyl)-1, 2-ethanediol (1), and a new natural product, (1S)-(3-ethenylphenyl)-1, 2-ethanediol (2), were isolated from the culture broth of the basidiomycete Boletus edulis together with three related known compounds, 1-(4-ethylphenyl)-1, 2-ethanediol (3), 1-(3-ethylphenyl)-1, 2-ethanediol (4) and 1-(3-formylphenyl)-ethanone (5). Their structures were elucidated by spectroscopic methods including extensive 2D-NMR techniques.

  14. Effects of some added carbohydrates on cellulases and ligninase and decomposition of whole bagasse

    Energy Technology Data Exchange (ETDEWEB)

    Nigam, P; Prabhu, K A

    1986-01-01

    Two basidiomycetes mould isolates were studied for the production of extracellular cellulases and ligninase in submerged shake culture using whole bagasse as substrate. The effects of some added carbohydrates on enzyme production, substrate decomposition and biomass formation were examined. In both cultures the addition of lactose stimulated biomass production and increased the decomposition of total carbohydrate and lignin contents of bagasse. Lactose was the only sugar which stimulated cellulase and ligninase in both cultures. 19 references.

  15. Laboratory studies of the degradation of chloropyrifos pesticide in soils supplemented by the fungus Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Lopera Mesa, Margarita Maria; Penuela Mesa, Gustavo Antonio; Dominguez Gual, Maria Carolina; Mejia Zapata, Gloria Maria

    2005-01-01

    Degradation of the insecticide chloropyrifos was investigated in sterilized soil samples supplemented by the white rot basidiomycetes Phanerochaete chrysosporium. Degradation rates were measured during 21-day incubation at pesticide concentrations of 0,95, 5,3, and 9,41 μ/g. Phanerochaete chrysosporium showed ability to biodegrade the insecticide in values of 96,3%, 82,4% and 62,2%, respectively, followed by rapid degradation at low initial concentration of chloropyrifos

  16. Bioconcentration of manganese and iron in Panaeoloideae Sing

    OpenAIRE

    Stijve, T.; Blake, C.

    1994-01-01

    According to literature, the manganese content of most basidiomycetes fluctuates between 10 and 60 mg/kg, whereas the iron levels range from 100-500 mg/kg (both expressed on dry weight). The present authors report that bioconcentration of manganese is a distinguishing feature of the Panaeoloideae, as demonstrated by the analysis of 44 collections representing 15 taxons. Carpophores generally contain between 250 and 2500 mg/kg on dry weight, and, with the notable exception of Panaeolus semiova...

  17. Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

    Science.gov (United States)

    Diane Dietrich; Casey Crooks

    2009-01-01

    A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

  18. Natural Protection of Wood with Antagonism Fungi

    Directory of Open Access Journals (Sweden)

    Alba ZAREMSKI

    2011-03-01

    Full Text Available Biological environments contain a certain number of microbial populations which, within a givenecological niche, display various relations ranging from symbiosis to parasitism. Researchers have beeninterested in these types of relations for around fifty years, especially in one very particular type ofrelationship: the antagonism exerted between individuals of the same microbial population.Today, the role played by biological agents, bringing into play inhibitive or destructive antibioticsubstances, reveals a certain potential for their use in controlling microorganisms associated with suchdegradation processes.The work undertaken by HydroQuébec and CIRAD involved two types of experiment: 1 in Petri dishes toassess and characterize the antagonistic capacity of Trichoderma against white rot and brown rot fungi; 2on pieces taken from untreated poles in order to study confrontation between the basidiomycete and theantagonistic strain in wood.This study investigated the antagonism of three ascomycetes of the genus Trichoderma against two whiterot basidiomycetes, Pycnoporus sanguineus and Coriolus versicolor, and two brown rot basidiomycetes,Antrodia sp. and Coniophora puteana, through direct confrontation in Petri dishes and in the wood ofHydroQuébec poles.The results obtained seemed to complete each other coherently. They revealed that the Trichodermagroup of fungi was not aggressive to wood and the results obtained after direct confrontation in Petri disheswere confirmed in wood.By directly exposing the different basidiomycetes and antagonists to each other in Petri dishes, two bytwo, we effectively revealed an antagonism effect for a large majority of the pairs. However, there wassubstantial variability in reactions from one pair to the next.

  19. Temperature development and sterilization of red pine poles during CCA treatment, elevated temperature fixation and drying

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, P.; Albright, M.; Srinivasan, U.; Ung, A. [New Brunswick Univ., Fredericton, NB (Canada). Wood Science and Technology Centre

    2002-07-01

    The application of chromated copper arsenate (CCA) treatment and fixation and drying under the conditions of the study to large red pine poles left for an air seasoning period of 10 months in Quebec, Canada progressively reduced the number of micro-organisms present. A large number of microfungi isolations were effected before the treatment from the sapwood and heartwood of all poles and wood decay fungi on 8 selected poles from the 20 test poles. They originated from the sapwood zone. A reduction of approximately 50 per cent in the number of microfungi isolated from the sapwood was noted after the CCA treatment. In the case of 9 of 30 poles, basidiomycetes were isolated after treatment primarily from the untreated heartwood. There were a few instances where basidiomycetes were isolated from unpenetrated sapwood (wet pockets). Temperatures of 55 to 60 degrees Celsius were achieved under moderate temperature fixation schedules (20 hours) for approximately 5 hours at full sapwood depth. Only by the end of the schedule was a temperature of 55 degrees celsius achieved at the centre of the poles. Most of the microfungi were eliminated by this temperature regime. Trichoderma was eliminated, and only one isolation of basidiomycetes was left from the heartwood of one pole. Temperatures of 55 to 60 degrees Celsius were achieved in the wood core for 9 to 10 days during kiln drying. No basidiomycete isolations remained after this exposure. In several of the poles, there was evidence of Paecilomyces variotii, a thermo-tolerant species and a number of species of Penicillium moulds. It was concluded that there was a negligible probability of decay fungi surviving the sequence of processes as described, given the effectiveness of the fixation exposure and the higher wood temperatures sustained for longer periods. 16 refs., 5 tabs., 2 figs.

  20. Fungal bioremediation of the creosote-contaminated soil: Influence of Pleurotus ostreatus and Irpex lacteus on polycyclic aromatic hydrocarbons removal and soil microbial community composition in the laboratory-scale study

    Czech Academy of Sciences Publication Activity Database

    Byss, Marius; Elhottová, Dana; Tříska, Jan; Baldrian, Petr

    2008-01-01

    Roč. 2008, č. 73 (2008), s. 1518-1523 ISSN 0045-6535 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z60870520; CEZ:AV0Z60660521; CEZ:AV0Z50200510 Keywords : Wood-rotting basidiomycetes * Soil microbial community * PLFA, PAH Subject RIV: EH - Ecology, Behaviour Impact factor: 3.054, year: 2008

  1. Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

    Science.gov (United States)

    Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

    2004-01-01

    A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

  2. Test of Lignin and Cellulose Decomposition and Phosphate Solubilization by Soil Fungi of Gunung Halimun

    OpenAIRE

    Suciatmih, Suciatmih

    2001-01-01

    In order to know the capability of lignin and cellulose degradation and phosphate solubilization by soil fungi of Gunung Halimun National Park, a study was carried out to qualitatively analyse its physiological properties. Out of 35 soil fungi tested, 1 species that belonged to Basidiomycetes degraded lignin, 32 species degraded cellulose, and 31 species dissolved inorganic phosphate.The presence of soil fungi that degraded cellulose and dissolved phosphate could be used as a candidate for bi...

  3. Environmental Assessment for the Continued Exclusive Use of Department of the Army Land Located at U.S. Army Dugway Proving Ground by Members of the U.S. Air Force

    Science.gov (United States)

    2012-07-01

    canned and prepared foods with gamma rays in an effort to kill micro -organisms, trichina in pork, and food-infesting insects (DPG 2001). The Avery...microcommunity consisting of fungi (Basidiomycetes), lichens, soil algae , and mosses typically occurring in semiarid regions. Cyanobacteria-dominated soil... ponds , playas, and wetlands. Constructed surface water features include wastewater lagoons, evaporation ponds , an excavated pond , a bermed pond , and

  4. Overproduction of ligninolytic enzymes

    Science.gov (United States)

    Elisashvili, Vladimir; Kachlishvili, Eva; Torok, Tamas

    2014-06-17

    Methods, compositions, and systems for overproducing ligninolytic enzymes from the basidiomycetous fungus are described herein. As described, the method can include incubating a fungal strain of Cerrena unicolor IBB 303 in a fermentation system having growth medium which includes lignocellulosic material and then cultivating the fungal strain in the fermentation system under conditions wherein the fungus expresses the ligninolytic enzymes. In some cases, the lignocellulosic material is mandarin peel, ethanol production residue, walnut pericarp, wheat bran, wheat straw, or banana peel.

  5. Two New Cyathane Diterpenoids from Mycelial Cultures of the Medicinal Mushroom Hericium erinaceus and the Rare Species, Hericium flagellum

    OpenAIRE

    Rupcic, Zeljka; Rascher, Monique; Kanaki, Sae; Köster, Reinhard W.; Stadler, Marc; Wittstein, Kathrin

    2018-01-01

    Basidiomycetes of the genus Hericium are among the most praised medicinal and edible mushrooms, which are known to produce secondary metabolites with the potential to treat neurodegenerative diseases. This activity has been attributed to the discovery of various terpenoids that can stimulate the production of nerve growth factor (NGF) or (as established more recently) brain-derived neurotrophic factor (BDNF) in cell-based bioassays. The present study reports on the metabolite profiles of a Li...

  6. Molecular Structural Basis for the Cold Adaptedness of the Psychrophilic β-Glucosidase BglU in Micrococcus antarcticus.

    Science.gov (United States)

    Miao, Li-Li; Hou, Yan-Jie; Fan, Hong-Xia; Qu, Jie; Qi, Chao; Liu, Ying; Li, De-Feng; Liu, Zhi-Pei

    2016-01-22

    Psychrophilic enzymes play crucial roles in cold adaptation of microbes and provide useful models for studies of protein evolution, folding, and dynamic properties. We examined the crystal structure (2.2-Å resolution) of the psychrophilic β-glucosidase BglU, a member of the glycosyl hydrolase 1 (GH1) enzyme family found in the cold-adapted bacterium Micrococcus antarcticus. Structural comparison and sequence alignment between BglU and its mesophilic and thermophilic counterpart enzymes (BglB and GlyTn, respectively) revealed two notable features distinct to BglU: (i) a unique long-loop L3 (35 versus 7 amino acids in others) involved in substrate binding and (ii) a unique amino acid, His299 (Tyr in others), involved in the stabilization of an ordered water molecule chain. Shortening of loop L3 to 25 amino acids reduced low-temperature catalytic activity, substrate-binding ability, the optimal temperature, and the melting temperature (Tm). Mutation of His299 to Tyr increased the optimal temperature, the Tm, and the catalytic activity. Conversely, mutation of Tyr301 to His in BglB caused a reduction in catalytic activity, thermostability, and the optimal temperature (45 to 35°C). Loop L3 shortening and H299Y substitution jointly restored enzyme activity to the level of BglU, but at moderate temperatures. Our findings indicate that loop L3 controls the level of catalytic activity at low temperatures, residue His299 is responsible for thermolability (particularly heat lability of the active center), and long-loop L3 and His299 are jointly responsible for the psychrophilic properties. The described structural basis for the cold adaptedness of BglU will be helpful for structure-based engineering of new cold-adapted enzymes and for the production of mutants useful in a variety of industrial processes at different temperatures. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. Proteomic analysis of Mortierella isabellina M6-22 during cold stress.

    Science.gov (United States)

    Hu, Binbin; Luo, Minzhou; Ji, Xiuling; Lin, Lianbing; Wei, Yunlin; Zhang, Qi

    2016-11-01

    We aimed to gain a better understanding of cold adaption in Mortierella isabellina M6-22 by using proteomics approaches. The temperature range and optimal temperature for M6-22 growth were investigated, and composition changes in fatty acids were analyzed. Accompanied with the 2-D gel electrophoresis, MALDI-TOF/TOF-MS analysis was conducted to characterize alterations in protein profiling in M6-22 cultured at 30 °C for 24 h and 15 °C for another 24 h when compared with those cultured at 30 °C for 48 h. Gene Ontology (GO) cluster analysis was finally conducted for successfully identified proteins. M6-22 cells could grow well at temperatures ranging from 15 to 30 °C. As temperature decreased from 30 to 15 °C, LA and GLA significantly increased from 11.63 to 17.85 % and from 9.12 to 13.19 %, respectively, while oleic acid significantly decreased from 47.25 to 36.53 %. Proteomics analyses revealed 111 differentially expressed protein spots, among which 5 unique proteins (A38, A40, A47, A49 and A58), 29 up-regulated proteins and 10 down-regulated proteins were identified by MALDI-TOF/TOF-MS. GO enrichment analysis demonstrated that these proteins mainly involved in glycolytic pathway (A34 and A50), electron transport (A28), ATP production (A35 and B39) and protein modification (A38). A total of 44 differentially expressed proteins have been successfully identified in M. isabellina M6-22 cultured at 15 °C. These proteins may play important roles in cold adaption via regulation of ATP synthesis, activation of cold-adaptive proteins, degradation of needless protein, accumulation of PUFAs, etc.

  8. An assessment of postcranial indices, ratios, and body mass versus eco-geographical variables of prehistoric Jomon, Yayoi agriculturalists, and Kumejima Islanders of Japan.

    Science.gov (United States)

    Seguchi, Noriko; Quintyn, Conrad B; Yonemoto, Shiori; Takamuku, Hirofumi

    2017-09-10

    We explore variations in body and limb proportions of the Jomon hunter-gatherers (14,000-2500 BP), the Yayoi agriculturalists (2500-1700 BP) of Japan, and the Kumejima Islanders of the Ryukyus (1600-1800 AD) with 11 geographically diverse skeletal postcranial samples from Africa, Europe, Asia, Australia, and North America using brachial-crural indices, femur head-breadth-to-femur length ratio, femur head-breadth-to-lower-limb-length ratio, and body mass as indicators of phenotypic climatic adaptation. Specifically, we test the hypothesis that variation in limb proportions seen in Jomon, Yayoi, and Kumejima is a complex interaction of genetic adaptation; development and allometric constraints; selection, gene flow and genetic drift with changing cultural factors (i.e., nutrition) and climate. The skeletal data (1127 individuals) were subjected to principle components analysis, Manly's permutation multiple regression tests, and Relethford-Blangero analysis. The results of Manly's tests indicate that body proportions and body mass are significantly correlated with latitude, and minimum and maximum temperatures while limb proportions were not significantly correlated with these climatic variables. Principal components plots separated "climatic zones:" tropical, temperate, and arctic populations. The indigenous Jomon showed cold-adapted body proportions and warm-adapted limb proportions. Kumejima showed cold-adapted body proportions and limbs. The Yayoi adhered to the Allen-Bergmann expectation of cold-adapted body and limb proportions. Relethford-Blangero analysis showed that Kumejima experienced gene flow indicated by high observed variances while Jomon experienced genetic drift indicated by low observed variances. The complex interaction of evolutionary forces and development/nutritional constraints are implicated in the mismatch of limb and body proportions. © 2017 Wiley Periodicals, Inc.

  9. Cold growth behaviour and genetic comparison of Canadian and Swiss Listeria monocytogenes strains associated with the food supply chain and human listeriosis cases.

    Science.gov (United States)

    Arguedas-Villa, Carolina; Kovacevic, Jovana; Allen, Kevin J; Stephan, Roger; Tasara, Taurai

    2014-06-01

    Sixty-two strains of Listeria monocytogenes isolated in Canada and Switzerland were investigated. Comparison based on molecular genotypes confirmed that strains in these two countries are genetically diverse. Interestingly strains from both countries displayed similar range of cold growth phenotypic profiles. Based on cold growth lag phase duration periods displayed in BHI at 4 °C, the strains were similarly divided into groups of fast, intermediate and slow cold adaptors. Overall Swiss strains had faster exponential cold growth rates compared to Canadian strains. However gene expression analysis revealed no significant differences between fast and slow cold adapting strains in the ability to induce nine cold adaptation genes (lmo0501, cspA, cspD, gbuA, lmo0688, pgpH, sigB, sigH and sigL) in response to cold stress exposure. Neither was the presence of Stress survival islet 1 (SSI-1) analysed by PCR associated with enhanced cold adaptation. Phylogeny based on the sigL gene subdivided strains from these two countries into two major and one minor cluster. Fast cold adaptors were more frequently in one of the major clusters (cluster A), whereas slow cold adaptors were mainly in the other (cluster B). Genetic differences between these two major clusters are associated with various amino acid substitutions in the predicted SigL proteins. Compared to the EGDe type strain and most slow cold adaptors, most fast cold adaptors exhibited five identical amino acid substitutions (M90L, S203A/S203T, S304N, S315N, and I383T) in their SigL proteins. We hypothesize that these amino acid changes might be associated with SigL protein structural and functional changes that may promote differences in cold growth behaviour between L. monocytogenes strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Lycopene overproduction in Saccharomyces cerevisiae through combining pathway engineering with host engineering.

    Science.gov (United States)

    Chen, Yan; Xiao, Wenhai; Wang, Ying; Liu, Hong; Li, Xia; Yuan, Yingjin

    2016-06-21

    Microbial production of lycopene, a commercially and medically important compound, has received increasing concern in recent years. Saccharomyces cerevisiae is regarded as a safer host for lycopene production than Escherichia coli. However, to date, the lycopene yield (mg/g DCW) in S. cerevisiae was lower than that in E. coli and did not facilitate downstream extraction process, which might be attributed to the incompatibility between host cell and heterologous pathway. Therefore, to achieve lycopene overproduction in S. cerevisiae, both host cell and heterologous pathway should be delicately engineered. In this study, lycopene biosynthesis pathway was constructed by integration of CrtE, CrtB and CrtI in S. cerevisiae CEN.PK2. When YPL062W, a distant genetic locus, was deleted, little acetate was accumulated and approximately 100 % increase in cytosolic acetyl-CoA pool was achieved relative to that in parental strain. Through screening CrtE, CrtB and CrtI from diverse species, an optimal carotenogenic enzyme combination was obtained, and CrtI from Blakeslea trispora (BtCrtI) was found to have excellent performance on lycopene production as well as lycopene proportion in carotenoid. Then, the expression level of BtCrtI was fine-tuned and the effect of cell mating types was also evaluated. Finally, potential distant genetic targets (YJL064W, ROX1, and DOS2) were deleted and a stress-responsive transcription factor INO2 was also up-regulated. Through the above modifications between host cell and carotenogenic pathway, lycopene yield was increased by approximately 22-fold (from 2.43 to 54.63 mg/g DCW). Eventually, in fed-batch fermentation, lycopene production reached 55.56 mg/g DCW, which is the highest reported yield in yeasts. Saccharomyces cerevisiae was engineered to produce lycopene in this study. Through combining host engineering (distant genetic loci and cell mating types) with pathway engineering (enzyme screening and gene fine-tuning), lycopene yield was

  11. Dissimilar pigment regulation in Serpula lacrymans and Paxillus involutus during inter-kingdom interactions.

    Science.gov (United States)

    Tauber, James P; Gallegos-Monterrosa, Ramses; Kovács, Ákos T; Shelest, Ekaterina; Hoffmeister, Dirk

    2018-01-01

    Production of basidiomycete atromentin-derived pigments like variegatic acid (pulvinic acid-type) and involutin (diarylcyclopentenone) from the brown-rotter Serpula lacrymans and the ectomycorrhiza-forming Paxillus involutus, respectively, is induced by complex nutrition, and in the case of S. lacrymans, bacteria. Pigmentation in S. lacrymans was stimulated by 13 different bacteria and cell-wall-damaging enzymes (lytic enzymes and proteases), but not by lysozyme or mechanical damage. The use of protease inhibitors with Bacillus subtilis or heat-killed bacteria during co-culturing with S. lacrymans significantly reduced pigmentation indicating that enzymatic hyphal damage and/or released peptides, rather than mechanical injury, was the major cause of systemic pigment induction. Conversely, no significant pigmentation by bacteria was observed from P. involutus. We found additional putative transcriptional composite elements of atromentin synthetase genes in P. involutus and other ectomycorrhiza-forming species that were absent from S. lacrymans and other brown-rotters. Variegatic and its precursor xerocomic acid, but not involutin, in return inhibited swarming and colony biofilm spreading of Bacillus subtilis, but did not kill B. subtilis. We suggest that dissimilar pigment regulation by fungal lifestyle was a consequence of pigment bioactivity and additional promoter motifs. The focus on basidiomycete natural product gene induction and regulation will assist in future studies to determine global regulators, signalling pathways and associated transcription factors of basidiomycetes.

  12. Enzymatic saccharification of biologically pre-treated wheat straw with white-rot fungi.

    Science.gov (United States)

    Dias, Albino A; Freitas, Gil S; Marques, Guilhermina S M; Sampaio, Ana; Fraga, Irene S; Rodrigues, Miguel A M; Evtuguin, Dmitry V; Bezerra, Rui M F

    2010-08-01

    Wheat straw was submitted to a pre-treatment by the basidiomycetous fungi Euc-1 and Irpex lacteus, aiming to improve the accessibility of cellulose towards enzymatic hydrolysis via previous selective bio-delignification. This allowed the increase of substrate saccharification nearly four and three times while applying the basidiomycetes Euc-1 and I. lacteus, respectively. The cellulose/lignin ratio increased from 2.7 in the untreated wheat straw to 5.9 and 4.6 after the bio-treatment by the basidiomycetes Euc-1 and I. lacteus, respectively, thus evidencing the highly selective lignin biodegradation. The enzymatic profile of both fungi upon bio-treatment of wheat straw have been assessed including laccase, manganese-dependent peroxidase, lignin peroxidase, carboxymethylcellulase, xylanase, avicelase and feruloyl esterase activities. The difference in efficiency and selectivity of delignification within the two fungi treatments was interpreted in terms of specific lignolytic enzyme profiles and moderate xylanase and cellulolytic activities. (c) 2010 Elsevier Ltd. All rights reserved.

  13. Genetic transformation of the white-rot fungus Dichomitus squalens using a new commercial protoplasting cocktail.

    Science.gov (United States)

    Daly, Paul; Slaghek, Gillian G; Casado López, Sara; Wiebenga, Ad; Hilden, Kristiina S; de Vries, Ronald P; Mäkelä, Miia R

    2017-12-01

    D. squalens, a white-rot fungus that efficiently degrades lignocellulose in nature, can be used in various biotechnological applications and has several strains with sequenced and annotated genomes. Here we present a method for the transformation of this basidiomycete fungus, using a recently introduced commercial ascomycete protoplasting enzyme cocktail, Protoplast F. In protoplasting of D. squalens mycelia, Protoplast F outperformed two other cocktails while releasing similar amounts of protoplasts to a third cocktail. The protoplasts released using Protoplast F had a regeneration rate of 12.5% (±6 SE). Using Protoplast F, the D. squalens monokaryon CBS464.89 was conferred with resistance to the antibiotics hygromycin and G418 via polyethylene glycol mediated protoplast transformation with resistance cassettes expressing the hygromycin phosphotransferase (hph) and neomycin phosphotransferase (nptII) genes, respectively. The hph gene was expressed in D. squalens using heterologous promoters from genes encoding β-tubulin or glyceraldehyde 3-phosphate dehydrogenase. A Southern blot confirmed integration of a resistance cassette into the D. squalens genome. An average of six transformants (±2 SE) were obtained when at least several million protoplasts were used (a transformation efficiency of 0.8 (±0.3 SE) transformants per μg DNA). Transformation of D. squalens demonstrates the suitability of the Protoplast F cocktail for basidiomycete transformation and furthermore can facilitate understanding of basidiomycete gene function and development of improved strains for biotechnological applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    Directory of Open Access Journals (Sweden)

    Evelyne Coppin

    Full Text Available Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  15. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    Science.gov (United States)

    Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

    2012-01-01

    Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  16. Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

    Directory of Open Access Journals (Sweden)

    Cheng-Siang Wong

    2013-09-01

    Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

  17. Antifungal susceptibility profiles of 1698 yeast reference strains revealing potential emerging human pathogens.

    Directory of Open Access Journals (Sweden)

    Marie Desnos-Ollivier

    Full Text Available New molecular identification techniques and the increased number of patients with various immune defects or underlying conditions lead to the emergence and/or the description of novel species of human and animal fungal opportunistic pathogens. Antifungal susceptibility provides important information for ecological, epidemiological and therapeutic issues. The aim of this study was to assess the potential risk of the various species based on their antifungal drug resistance, keeping in mind the methodological limitations. Antifungal susceptibility profiles to the five classes of antifungal drugs (polyens, azoles, echinocandins, allylamines and antimetabolites were determined for 1698 yeast reference strains belonging to 992 species (634 Ascomycetes and 358 Basidiomycetes. Interestingly, geometric mean minimum inhibitory concentrations (MICs of all antifungal drugs tested were significantly higher for Basidiomycetes compared to Ascomycetes (p<0.001. Twenty four strains belonging to 23 species of which 19 were Basidiomycetes seem to be intrinsically "resistant" to all drugs. Comparison of the antifungal susceptibility profiles of the 4240 clinical isolates and the 315 reference strains belonging to 53 shared species showed similar results. Even in the absence of demonstrated in vitro/in vivo correlation, knowing the in vitro susceptibility to systemic antifungal agents and the putative intrinsic resistance of yeast species present in the environment is important because they could become opportunistic pathogens.

  18. The microbial ecology of permafrost

    DEFF Research Database (Denmark)

    Jansson, Janet; Tas, Neslihan

    2014-01-01

    Permafrost constitutes a major portion of the terrestrial cryosphere of the Earth and is a unique ecological niche for cold-adapted microorganisms. There is a relatively high microbial diversity in permafrost, although there is some variation in community composition across different permafrost......-gas emissions. This Review describes new data on the microbial ecology of permafrost and provides a platform for understanding microbial life strategies in frozen soil as well as the impact of climate change on permafrost microorganisms and their functional roles....

  19. Activity of oxidizing processes in introduced plants under low hardening temperature

    Directory of Open Access Journals (Sweden)

    I. O. Zaitseva

    2011-10-01

    Full Text Available The peculiarities of oxidative enzymes’ activity at the dormancy phenological stage under conditions of low positive temperature were studied. Most effective methods (NPK, zircon growth regulator for enhancing the cold tolerance of the Swida, Deutzia, Buddleja and Hibiscus species have been determined. It has been established that activity of catalase and peroxidase depends on the cold adaptation of introduced arbo-real plants of different winter-resistance. The possibility to use the ratio of enzymatic activities Acold./Anorm. as a test-parameter in forecasting the winter-resistance of plants is displayed.

  20. Complete genome sequence of Pseudomonas antarctica PAMC 27494, a bacteriocin-producing psychrophile isolated from Antarctica.

    Science.gov (United States)

    Lee, Jaejin; Cho, Yong-Joon; Yang, Jae Young; Jung, You-Jung; Hong, Soon Gyu; Kim, Ok-Sun

    2017-10-10

    Antimicrobial-producing, cold-adapted microorganisms have great potential for biotechnological applications in food, pharmaceutical, and cosmetic industries. Pseudomonas antarctica PAMC 27494, a psychrophile exhibiting antimicrobial activity, was isolated from an Antarctic freshwater sample. Here we report the complete genome of P. antarctica PAMC 27494. The strain contains a gene cluster encoding microcin B which inhibits DNA regulations by targeting the DNA gyrase. PAMC 27494 may produce R-type pyocins and also contains a complete set of proteins for the biosynthesis of adenosylcobalamin and possibly induces plant growth by supplying pyrroloquinoline quionone molecules. Copyright © 2017 Elsevier B.V. All rights reserved.