SEARCH PRODUCERS OF POLYPHENOLS AND SOME PIGMENTS AMONG BASIDIOMYCETES

Directory of Open Access Journals (Sweden)

Fedotov О. V.

2014-02-01

Full Text Available General content of polyphenols, carotenoids and melanin in basidiomycetes carpophorus was determined. 50 species were studied, 27 of which belong to the Polyporales form and 23 are to the Agaricales form. In order to determine the total content of phenolic substances spectrophotometric methods were used. Polyphenols were studied in alcoholic extracts through the modified Folin-Chokalteu procedure; melanin — by alkaline hydrolysis and calculated using a calibration curve (by pyrocatechol, carotenoids were studied in acetone extracts and calculated by the Vetshteyn formula. Statistical and cluster analysis of the data enabled to identify species of basidiomycetes that are perspective for biotechnology. The most promising in terms of total polyphenols, carotenoids and melanins of poliporal basidiomycetes are species Fomes fomentarius, Ganoderma applanatum, Ganoderma lucidum and Laetiporus sulphureus, and among agarikal fungi — Fistulina hepatica, Flammulina velutipes, Pleurotus ostreatus, Stropharia rugosoannulata, Agrocybe cylindracea and Tricholoma flavovirens. These species of Basidiomycetes were isolated in pure mycelia culture to find out their biosynthetic activity.

The Neanderthal face is not cold adapted.

Science.gov (United States)

Rae, Todd C; Koppe, Thomas; Stringer, Chris B

2011-02-01

Many morphological features of the Pleistocene fossil hominin Homo neanderthalensis, including the reputed large size of its paranasal sinuses, have been interpreted as adaptations to extreme cold, as some Neanderthals lived in Europe during glacial periods. This interpretation of sinus evolution rests on two assumptions: that increased craniofacial pneumatization is an adaptation to lower ambient temperatures, and that Neanderthals have relatively large sinuses. Analysis of humans, other primates, and rodents, however, suggests that the first assumption is suspect; at least the maxillary sinus undergoes a significant reduction in volume in extreme cold, in both wild and laboratory conditions. The second assumption, that Neanderthal sinuses are large, extensive, or even 'hyperpneumatized,' has held sway since the first specimen was described and has been interpreted as the causal explanation for some of the distinctive aspects of Neanderthal facial form, but has never been evaluated with respect to scaling. To test the latter assumption, previously published measurements from two-dimensional (2D) X-rays and new three-dimensional (3D) data from computed tomography (CT) of Neanderthals and temperate-climate European Homo sapiens are regressed against cranial size to determine the relative size of their sinuses. The 2D data reveal a degree of craniofacial pneumatization in Neanderthals that is both commensurate with the size of the cranium and comparable in scale with that seen in temperate climate H. sapiens. The 3D analysis of CT data from a smaller sample supports this conclusion. These results suggest that the distinctive Neanderthal face cannot be interpreted as a direct result of increased pneumatization, nor is it likely to be an adaptation to resist cold stress; an alternative explanation is thus required. Copyright © 2010 Elsevier Ltd. All rights reserved.

Uncovering Mechanisms for Repair and Protection in Cold Environments Through Studies of Cold Adapted Archaea

Science.gov (United States)

2009-12-18

Cpn60) subunits is more abundant during growth at 4°C compared to 23°C. Consistent with this, cold shock studies in thermophilic archaea, and...helicases (Mbur_0245, Mbur_1950): These enzymes may be responsible for unwinding secondary structures in messenger RNA, and a role in cold adaptation in M...limiting step, it is unsurprising that these enzymes showed higher abundance at 4ºC. ParA protein (Mbur_2141): ParA ATPases are a ubiquitous

Multiple cold resistance loci confer the high cold tolerance adaptation of Dongxiang wild rice (Oryza rufipogon) to its high-latitude habitat.

Science.gov (United States)

Mao, Donghai; Yu, Li; Chen, Dazhou; Li, Lanying; Zhu, Yuxing; Xiao, Yeqing; Zhang, Dechun; Chen, Caiyan

2015-07-01

Dongxiang wild rice is phylogenetically close to temperate japonica and contains multiple cold resistance loci conferring its adaptation to high-latitude habitat. Understanding the nature of adaptation in wild populations will benefit crop breeding in the development of climate-resilient crop varieties. Dongxiang wild rice (DXWR), the northernmost common wild rice known, possesses a high degree of cold tolerance and can survive overwintering in its native habitat. However, to date, it is still unclear how DXWR evolved to cope with low-temperature environment, resulting in limited application of DXWR in rice breeding programs. In this study, we carried out both QTL mapping and phylogenetic analysis to discern the genetic mechanism underlying the strong cold resistance. Through a combination of interval mapping and single locus analysis in two genetic populations, at least 13 QTLs for seedling cold tolerance were identified in DXWR. A phylogenetic study using both genome-wide InDel markers and markers associated with cold tolerance loci reveals that DXWR belongs to the Or-III group, which is most closely related to cold-tolerant Japonica rice rather than to the Indica cultivars that are predominant in the habitat where DXWR grows. Our study paves the way toward an understanding of the nature of adaptation to a northern habitat in O. rufipogon. The QTLs identified in DXWR in this study will be useful for molecular breeding of cold-tolerant rice.

Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales.

Directory of Open Access Journals (Sweden)

Martin Vohník

remain undetected when subject to amplification by 'universal' primers. The lignocellulolytic assay suggests the basidiomycete may confer host adaptations distinct from those provisioned by the so far investigated ascomycetous ErM fungi.

Diversity and evolution of ABC proteins in basidiomycetes.

Science.gov (United States)

Kovalchuk, Andriy; Lee, Yong-Hwan; Asiegbu, Fred O

2013-01-01

ABC proteins constitute one of the largest families of proteins. They are implicated in wide variety of cellular processes ranging from ribosome biogenesis to multidrug resistance. With the advance of fungal genomics, the number of known fungal ABC proteins increases rapidly but the information on their biological functions remains scarce. In this work we extended the previous analysis of fungal ABC proteins to include recently sequenced species of basidiomycetes. We performed an identification and initial cataloging of ABC proteins from 23 fungal species representing 10 orders within class Agaricomycotina. We identified more than 1000 genes coding for ABC proteins. Comparison of sets of ABC proteins present in basidiomycetes and ascomycetes revealed the existence of two groups of ABC proteins specific for basidiomycetes. Results of survey should contribute to the better understanding of evolution of ABC proteins in fungi and support further experimental work on their characterization.

Basidiomycete fungal communities in Australian sclerophyll forest soil are altered by repeated prescribed burning.

Science.gov (United States)

Anderson, Ian C; Bastias, Brigitte A; Genney, David R; Parkin, Pamela I; Cairney, John W G

2007-04-01

Soil basidiomycetes play key roles in forest nutrient and carbon cycling processes, yet the diversity and structure of below ground basidiomycete communities remain poorly understood. Prescribed burning is a commonly used forest management practice and there is evidence that single fire events can have an impact on soil fungal communities but little is known about the effects of repeated prescribed burning. We have used internal transcribed spacer (ITS) terminal restriction fragment length polymorphism (T-RFLP) analysis to investigate the impacts of repeated prescribed burning every two or four years over a period of 30 years on soil basidiomycete communities in an Australian wet sclerophyll forest. Detrended correspondence analysis of ITS T-RFLP profiles separated basidiomycete communities in unburned control plots from those in burned plots, with those burned every two years being the most different from controls. Burning had no effect on basidiomycete species richness, thus these differences appear to be due to changes in community structure. Basidiomycete communities in the unburned control plots were vertically stratified in the upper 20 cm of soil, but no evidence was found for stratification in the burned plots, suggesting that repeated prescribed burning results in more uniform basidiomycete communities. Overall, the results demonstrate that repeated prescribed burning alters soil basidiomycete communities, with the effect being greater with more frequent burning.

Bacterial communities in the fruit bodies of ground basidiomycetes

Science.gov (United States)

Zagryadskaya, Yu. A.; Lysak, L. V.; Chernov, I. Yu.

2015-06-01

Fruit bodies of basidiomycetes at different stages of decomposition serve as specific habitats in forest biocenoses for bacteria and differ significantly with respect to the total bacterial population and abundance of particular bacterial genera. A significant increase in the total bacterial population estimated by the direct microscopic method with acridine orange staining and in the population of saprotrophic bacteria (inoculation of glucose peptone yeast agar) in fruit bodies of basidiomycetes Armillaria mellea and Coprinus comatus was recorded at the final stage of their decomposition in comparison with the initial stage. Gramnegative bacteria predominated in the tissues of fruit bodies at all the stages of decomposition and were represented at the final stage by the Aeromonas, Vibrio, and Pseudomonas genera (for fruit bodies of A. mellea) the Pseudomonas genus (for fruit bodies of C. comatus). The potential influence of bacterial communities in the fruit bodies of soil basidiomycetes on the formation of bacterial communities in the upper soil horizons in forest biocenoses is discussed. The loci connected with the development and decomposition of fruit bodies of basidiomycetes on the soil surface are promising for targeted search of Gram-negative bacteria, the important objects of biotechnology.

Phylogeny and comparative genome analysis of a Basidiomycete fungi

Energy Technology Data Exchange (ETDEWEB)

Riley, Robert W.; Salamov, Asaf; Grigoriev, Igor; Hibbett, David

2011-03-14

Fungi of the phylum Basidiomycota, make up some 37percent of the described fungi, and are important from the perspectives of forestry, agriculture, medicine, and bioenergy. This diverse phylum includes the mushrooms, wood rots, plant pathogenic rusts and smuts, and some human pathogens. To better understand these important fungi, we have undertaken a comparative genomic analysis of the Basidiomycetes with available sequenced genomes. We report a phylogeny that sheds light on previously unclear evolutionary relationships among the Basidiomycetes. We also define a `core proteome? based on protein families conserved in all Basidiomycetes. We identify key expansions and contractions in protein families that may be responsible for the degradation of plant biomass such as cellulose, hemicellulose, and lignin. Finally, we speculate as to the genomic changes that drove such expansions and contractions.

Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785

Science.gov (United States)

2010-01-01

Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1), lipid/biomass (68%) and lipid/glucose yields (16%). Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils. PMID:20863365

Single cell oils of the cold-adapted oleaginous yeast Rhodotorula glacialis DBVPG 4785

Directory of Open Access Journals (Sweden)

De Lucia Marzia

2010-09-01

Full Text Available Abstract Background The production of microbial lipids has attracted considerable interest during the past decade since they can be successfully used to produce biodiesel by catalyzed transesterification with short chain alcohols. Certain yeast species, including several psychrophilic isolates, are oleaginous and accumulate lipids from 20 to 70% of biomass under appropriate cultivation conditions. Among them, Rhodotorula glacialis is a psychrophilic basidiomycetous species capable to accumulate intracellular lipids. Results Rhodotorula glacialis DBVPG 4785 is an oleaginous psychrophilic yeast isolated from a glacial environment. Despite its origin, the strain abundantly grew and accumulated lipids between -3 to 20°C. The temperature did not influence the yield coefficients of both biomass and lipids production, but had positive effect on the growth rate and thus on volumetric productivity of lipid. In glucose-based media, cellular multiplication occurred first, while the lipogenic phase followed whenever the culture was limited by a nutrient other than glucose. The extent of the carbon excess had positive effects on triacylglycerols production, that was maximum with 120 g L-1 glucose, in terms of lipid concentration (19 g L-1, lipid/biomass (68% and lipid/glucose yields (16%. Both glucose concentration and growth temperature influenced the composition of fatty acids, whose unsaturation degree decreased when the temperature or glucose excess increased. Conclusions This study is the first proposed biotechnological application for Rhodotorula glacialis species, whose oleaginous biomass accumulates high amounts of lipids within a wide range of temperatures through appropriate cultivation C:N ratio. Although R. glacialis DBVPG 4785 is a cold adapted yeast, lipid production occurs over a broad range of temperatures and it can be considered an interesting microorganism for the production of single cell oils.

Lectins from Mycelia of Basidiomycetes

Directory of Open Access Journals (Sweden)

Valentina E. Nikitina

2017-06-01

Full Text Available Lectins are proteins of a nonimmunoglobulin nature that are capable of specific recognition of and reversible binding to the carbohydrate moieties of complex carbohydrates, without altering the covalent structure of any of the recognized glycosyl ligands. They have a broad range of biological activities important for the functioning of the cell and the whole organism and, owing to the high specificity of reversible binding to carbohydrates, are valuable tools used widely in biology and medicine. Lectins can be produced by many living organisms, including basidiomycetes. Whereas lectins from the fruit bodies of basidiomycetes have been studied sufficiently well, mycelial lectins remain relatively unexplored. Here, we review and comparatively analyze what is currently known about lectins isolated from the vegetative mycelium of macrobasidiomycetes, including their localization, properties, and carbohydrate specificities. Particular attention is given to the physiological role of mycelial lectins in fungal growth and development.

Functional evolution of leptin of Ochotona curzoniae in adaptive thermogenesis driven by cold environmental stress.

Directory of Open Access Journals (Sweden)

Jie Yang

Full Text Available BACKGROUND: Environmental stress can accelerate the directional selection and evolutionary rate of specific stress-response proteins to bring about new or altered functions, enhancing an organism's fitness to challenging environments. Plateau pika (Ochotona curzoniae, an endemic and keystone species on Qinghai-Tibetan Plateau, is a high hypoxia and low temperature tolerant mammal with high resting metabolic rate and non-shivering thermogenesis to cope in this harsh plateau environment. Leptin is a key hormone related to how these animals regulate energy homeostasis. Previous molecular evolutionary analysis helped to generate the hypothesis that adaptive evolution of plateau pika leptin may be driven by cold stress. METHODOLOGY/PRINCIPAL FINDINGS: To test the hypothesis, recombinant pika leptin was first purified. The thermogenic characteristics of C57BL/6J mice injected with pika leptin under warm (23±1°C and cold (5±1°C acclimation is investigated. Expression levels of genes regulating adaptive thermogenesis in brown adipose tissue and the hypothalamus are compared between pika leptin and human leptin treatment, suggesting that pika leptin has adaptively and functionally evolved. Our results show that pika leptin regulates energy homeostasis via reduced food intake and increased energy expenditure under both warm and cold conditions. Compared with human leptin, pika leptin demonstrates a superior induced capacity for adaptive thermogenesis, which is reflected in a more enhanced β-oxidation, mitochondrial biogenesis and heat production. Moreover, leptin treatment combined with cold stimulation has a significant synergistic effect on adaptive thermogenesis, more so than is observed with a single cold exposure or single leptin treatment. CONCLUSIONS/SIGNIFICANCE: These findings support the hypothesis that cold stress has driven the functional evolution of plateau pika leptin as an ecological adaptation to the Qinghai-Tibetan Plateau.

Thyroid transcriptome analysis reveals different adaptive responses to cold environmental conditions between two chicken breeds.

Science.gov (United States)

Xie, Shanshan; Yang, Xukai; Wang, Dehe; Zhu, Feng; Yang, Ning; Hou, Zhuocheng; Ning, Zhonghua

2018-01-01

Selection for cold tolerance in chickens is important for improving production performance and animal welfare. The identification of chicken breeds with higher cold tolerance and production performance will help to target candidates for the selection. The thyroid gland plays important roles in thermal adaptation, and its function is influenced by breed differences and transcriptional plasticity, both of which remain largely unknown in the chicken thyroid transcriptome. In this study, we subjected Bashang Long-tail (BS) and Rhode Island Red (RIR) chickens to either cold or warm environments for 21 weeks and investigated egg production performance, body weight changes, serum thyroid hormone concentrations, and thyroid gland transcriptome profiles. RIR chickens had higher egg production than BS chickens under warm conditions, but BS chickens produced more eggs than RIRs under cold conditions. Furthermore, BS chickens showed stable body weight gain under cold conditions while RIRs did not. These results suggested that BS breed is a preferable candidate for cold-tolerance selection and that the cold adaptability of RIRs should be improved in the future. BS chickens had higher serum thyroid hormone concentrations than RIRs under both environments. RNA-Seq generated 344.3 million paired-end reads from 16 sequencing libraries, and about 90% of the processed reads were concordantly mapped to the chicken reference genome. Differential expression analysis identified 46-1,211 genes in the respective comparisons. With regard to breed differences in the thyroid transcriptome, BS chickens showed higher cell replication and development, and immune response-related activity, while RIR chickens showed higher carbohydrate and protein metabolism activity. The cold environment reduced breed differences in the thyroid transcriptome compared with the warm environment. Transcriptional plasticity analysis revealed different adaptive responses in BS and RIR chickens to cope with the cold

Evidence for propagation of cold-adapted yeast in an ice core from a Siberian Altai glacier

Science.gov (United States)

Uetake, Jun; Kohshima, Shiro; Nakazawa, Fumio; Takeuchi, Nozomu; Fujita, Koji; Miyake, Takayuki; Narita, Hideki; Aizen, Vladimir; Nakawo, Masayoshi

2011-03-01

Cold environments, including glacier ice and snow, are known habitats for cold-adapted microorganisms. We investigated the potential for cold-adapted yeast to have propagated in the snow of the high-altitude Belukha glacier. We detected the presence of highly concentrated yeast (over 104 cells mL-1) in samples of both an ice core and firn snow. Increasing yeast cell concentrations in the same snow layer from July 2002 to July 2003 suggests that the yeast cells propagated in the glacier snow. A cold-adapted Rhodotorula sp. was isolated from the snow layer and found to be related to psychrophilic yeast previously found in other glacial environments (based on the D1/D2 26S rRNA domains). 26S rRNA clonal analysis directly amplified from meltwater within the ice core also revealed the presence of genus Rhodotorula. Analyses of the ice core showed that all peaks in yeast concentration corresponded to the peaks in indices of surface melting. These results support the hypothesis that occasional surface melting in an accumulation area is one of the major factors influencing cold-adapted yeast propagation.

Role of the circadian clock gene Per2 in adaptation to cold temperature.

Science.gov (United States)

Chappuis, Sylvie; Ripperger, Jürgen Alexander; Schnell, Anna; Rando, Gianpaolo; Jud, Corinne; Wahli, Walter; Albrecht, Urs

2013-01-01

Adaptive thermogenesis allows mammals to resist to cold. For instance, in brown adipose tissue (BAT) the facultative uncoupling of the proton gradient from ATP synthesis in mitochondria is used to generate systemic heat. However, this system necessitates an increase of the Uncoupling protein 1 (Ucp1) and its activation by free fatty acids. Here we show that mice without functional Period2 (Per2) were cold sensitive because their adaptive thermogenesis system was less efficient. Upon cold-exposure, Heat shock factor 1 (HSF1) induced Per2 in the BAT. Subsequently, PER2 as a co-activator of PPARα increased expression of Ucp1. PER2 also increased Fatty acid binding protein 3 (Fabp3), a protein important to transport free fatty acids from the plasma to mitochondria to activate UCP1. Hence, in BAT PER2 is important for the coordination of the molecular response of mice exposed to cold by synchronizing UCP1 expression and its activation.

Use of molecular markers for the study of wild fungus basidiomycetes

Directory of Open Access Journals (Sweden)

Blanca Estela Gómez Luna

2012-09-01

Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

Armillaria mellea: an ozonophilic basidiomycete

Energy Technology Data Exchange (ETDEWEB)

Berliner, M D

1963-01-19

Armillaria mellea, a luminescent basidiomycete grown in culture, had its light emission stimulated by high ozone concentrations and survived long ozone exposures without apparent lasting ill-effect. There is a strong possibility that a pigment acts as an ozone protecting substance by preventing the formation of free radicals and peroxides.

A highly conserved basidiomycete peptide synthetase produces a trimeric hydroxamate siderophore.

Science.gov (United States)

Brandenburger, Eileen; Gressler, Markus; Leonhardt, Robin; Lackner, Gerald; Habel, Andreas; Hertweck, Christian; Brock, Matthias; Hoffmeister, Dirk

2017-08-25

The model white-rot basidiomycete Ceriporiopsis ( Gelatoporia ) subvermispora B encodes putative natural product biosynthesis genes. Among them is the gene for the seven-domain nonribosomal peptide synthetase CsNPS2. It is a member of the as-yet uncharacterized fungal type VI siderophore synthetase family which is highly conserved and widely distributed among the basidiomycetes. These enzymes include only one adenylation (A) domain, i.e., one complete peptide synthetase module and two thiolation/condensation (T-C) di-domain partial modules which, together, constitute an AT 1 C 1 T 2 C 2 T 3 C 3 domain setup. The full-length CsNPS2 enzyme (274.5 kDa) was heterologously produced as polyhistidine fusion in Aspergillus niger as soluble and active protein. N 5 -acetyl- N 5 -hydroxy-l-ornithine (l-AHO) and N 5 - cis -anhydromevalonyl- N 5 -hydroxy-l-ornithine (l-AMHO) were accepted as substrates, as assessed in vitro using the substrate-dependent [ 32 P]ATP-pyrophosphate radioisotope exchange assay. Full-length holo -CsNPS2 catalyzed amide bond formation between three l-AHO molecules to release the linear l-AHO trimer, called basidioferrin, as product in vitro , which was verified by LC-HRESIMS. Phylogenetic analyses suggest that type VI family siderophore synthetases are widespread in mushrooms and have evolved in a common ancestor of basidiomycetes. Importance : The basidiomycete nonribosomal peptide synthetase CsNPS2 represents a member of a widely distributed but previously uninvestigated class (type VI) of fungal siderophore synthetases. Genes orthologous to CsNPS2 are highly conserved across various phylogenetic clades of the basidiomycetes. Hence, our work serves as a broadly applicable model for siderophore biosynthesis and iron metabolism in higher fungi. Also, our results on the amino acid substrate preference of CsNPS2 supports further understanding of the substrate selectivity of fungal adenylation domains. Methodologically, this report highlights the

Biotechnology of non-Saccharomyces yeasts-the basidiomycetes.

Science.gov (United States)

Johnson, Eric A

2013-09-01

Yeasts are the major producer of biotechnology products worldwide, exceeding production in capacity and economic revenues of other groups of industrial microorganisms. Yeasts have wide-ranging fundamental and industrial importance in scientific, food, medical, and agricultural disciplines (Fig. 1). Saccharomyces is the most important genus of yeast from fundamental and applied perspectives and has been expansively studied. Non-Saccharomyces yeasts (non-conventional yeasts) including members of the Ascomycetes and Basidiomycetes also have substantial current utility and potential applicability in biotechnology. In an earlier mini-review, "Biotechnology of non-Saccharomyces yeasts-the ascomycetes" (Johnson Appl Microb Biotechnol 97: 503-517, 2013), the extensive biotechnological utility and potential of ascomycetous yeasts are described. Ascomycetous yeasts are particularly important in food and ethanol formation, production of single-cell protein, feeds and fodder, heterologous production of proteins and enzymes, and as model and fundamental organisms for the delineation of genes and their function in mammalian and human metabolism and disease processes. In contrast, the roles of basidiomycetous yeasts in biotechnology have mainly been evaluated only in the past few decades and compared to the ascomycetous yeasts and currently have limited industrial utility. From a biotechnology perspective, the basidiomycetous yeasts are known mainly for the production of enzymes used in pharmaceutical and chemical synthesis, for production of certain classes of primary and secondary metabolites such as terpenoids and carotenoids, for aerobic catabolism of complex carbon sources, and for bioremediation of environmental pollutants and xenotoxicants. Notwithstanding, the basidiomycetous yeasts appear to have considerable potential in biotechnology owing to their catabolic utilities, formation of enzymes acting on recalcitrant substrates, and through the production of unique primary

Genome-wide analysis of cold adaptation in indigenous Siberian populations.

Directory of Open Access Journals (Sweden)

Alexia Cardona

Full Text Available Following the dispersal out of Africa, where hominins evolved in warm environments for millions of years, our species has colonised different climate zones of the world, including high latitudes and cold environments. The extent to which human habitation in (sub-Arctic regions has been enabled by cultural buffering, short-term acclimatization and genetic adaptations is not clearly understood. Present day indigenous populations of Siberia show a number of phenotypic features, such as increased basal metabolic rate, low serum lipid levels and increased blood pressure that have been attributed to adaptation to the extreme cold climate. In this study we introduce a dataset of 200 individuals from ten indigenous Siberian populations that were genotyped for 730,525 SNPs across the genome to identify genes and non-coding regions that have undergone unusually rapid allele frequency and long-range haplotype homozygosity change in the recent past. At least three distinct population clusters could be identified among the Siberians, each of which showed a number of unique signals of selection. A region on chromosome 11 (chr11:66-69 Mb contained the largest amount of clustering of significant signals and also the strongest signals in all the different selection tests performed. We present a list of candidate cold adaption genes that showed significant signals of positive selection with our strongest signals associated with genes involved in energy regulation and metabolism (CPT1A, LRP5, THADA and vascular smooth muscle contraction (PRKG1. By employing a new method that paints phased chromosome chunks by their ancestry we distinguish local Siberian-specific long-range haplotype signals from those introduced by admixture.

A simple and inexpensive method for determining cold sensitivity and adaptation in mice.

Science.gov (United States)

Brenner, Daniel S; Golden, Judith P; Vogt, Sherri K; Gereau, Robert W

2015-03-17

Cold hypersensitivity is a serious clinical problem, affecting a broad subset of patients and causing significant decreases in quality of life. The cold plantar assay allows the objective and inexpensive assessment of cold sensitivity in mice, and can quantify both analgesia and hypersensitivity. Mice are acclimated on a glass plate, and a compressed dry ice pellet is held against the glass surface underneath the hindpaw. The latency to withdrawal from the cooling glass is used as a measure of cold sensitivity. Cold sensation is also important for survival in regions with seasonal temperature shifts, and in order to maintain sensitivity animals must be able to adjust their thermal response thresholds to match the ambient temperature. The Cold Plantar Assay (CPA) also allows the study of adaptation to changes in ambient temperature by testing the cold sensitivity of mice at temperatures ranging from 30 °C to 5 °C. Mice are acclimated as described above, but the glass plate is cooled to the desired starting temperature using aluminum boxes (or aluminum foil packets) filled with hot water, wet ice, or dry ice. The temperature of the plate is measured at the center using a filament T-type thermocouple probe. Once the plate has reached the desired starting temperature, the animals are tested as described above. This assay allows testing of mice at temperatures ranging from innocuous to noxious. The CPA yields unambiguous and consistent behavioral responses in uninjured mice and can be used to quantify both hypersensitivity and analgesia. This protocol describes how to use the CPA to measure cold hypersensitivity, analgesia, and adaptation in mice.

People who live in a cold climate: thermal adaptation differences based on availability of heating.

Science.gov (United States)

Yu, J; Cao, G; Cui, W; Ouyang, Q; Zhu, Y

2013-08-01

Are there differences in thermal adaptation to cold indoor environments between people who are used to living in heating and non-heating regions in China? To answer this question, we measured thermal perceptions and physiological responses of young men from Beijing (where there are indoor space heating facilities in winter) and Shanghai (where there are not indoor space heating facilities in winter) during exposures to cold. Subjects were exposed to 12°C, 14°C, 16°C, 18°C, 20°C for 1 h. Subjects from Beijing complained of greater cold discomfort and demonstrated poorer physiological acclimatization to cold indoor environments than those from Shanghai. These findings indicate that people's chronic indoor thermal experience might be an important determinant of thermal adaptation. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Degradation of cellulose by basidiomycetous fungi

Czech Academy of Sciences Publication Activity Database

Baldrian, Petr; Valášková, Vendula

2008-01-01

Roč. 32, č. 3 (2008), s. 501-521 ISSN 0168-6445 R&D Projects: GA MŠk LC06066; GA MZe QH72216 Institutional research plan: CEZ:AV0Z50200510 Keywords : cellobiohydrolase * cellulose dehydrogenase * basidiomycetes Subject RIV: EE - Microbiology, Virology Impact factor: 7.963, year: 2008

RNA metabolism in Xylella fastidiosa during cold adaptation and survival responses

Science.gov (United States)

Fastidious plant pathogen Xylella fastidiosa has a reduced ability to adapt to cold temperatures, limiting persistence in perennial hosts, such as grapevine, growing in colder regions. RNA metabolism is an essential part of bacterial response to low temperature, including inducible expression of RNA...

Anti-biofilm activities from marine cold adapted bacteria against staphylococci and Pseudomonas aeruginosa

Directory of Open Access Journals (Sweden)

Rosanna ePapa

2015-12-01

Full Text Available Microbial biofilms have great negative impacts on the world’s economy and pose serious problems to industry, public health and medicine. The interest in the development of new approaches for the prevention and treatment of bacterial adhesion and biofilm formation has increased. Since, bacterial pathogens living in biofilm induce persistent chronic infections due to the resistance to antibiotics and host immune system. A viable approach should target adhesive properties without affecting bacterial vitality in order to avoid the appearance of resistant mutants. Many bacteria secrete anti-biofilm molecules that function in regulating biofilm architecture or mediating the release of cells from it during the dispersal stage of biofilm life cycle. Cold-adapted marine bacteria represent an untapped reservoir of biodiversity able to synthesize a broad range of bioactive compounds, including anti-biofilm molecules.The anti-biofilm activity of cell-free supernatants derived from sessile and planktonic cultures of cold-adapted bacteria belonging to Pseudoalteromonas, Psychrobacter and Psychromonas species were tested against Staphylococcus aureus, Staphylococcus epidermidis and Pseudomonas aeruginosa strains. Reported results demonstrate that we have selected supernatants, from cold-adapted marine bacteria, containing non-biocidal agents able to destabilize biofilm matrix of all tested pathogens without killing cells. A preliminary physico-chemical characterization of supernatants was also performed, and these analyses highlighted the presence of molecules of different nature that act by inhibiting biofilm formation. Some of them are also able to impair the initial attachment of the bacterial cells to the surface, thus likely containing molecules acting as anti-biofilm surfactant molecules.The described ability of cold-adapted bacteria to produce effective anti-biofilm molecules paves the way to further characterization of the most promising molecules

Oligomerization as a strategy for cold adaptation: Structure and dynamics of the GH1 β-glucosidase from Exiguobacterium antarcticum B7

Science.gov (United States)

Zanphorlin, Leticia Maria; de Giuseppe, Priscila Oliveira; Honorato, Rodrigo Vargas; Tonoli, Celisa Caldana Costa; Fattori, Juliana; Crespim, Elaine; de Oliveira, Paulo Sergio Lopes; Ruller, Roberto; Murakami, Mario Tyago

2016-03-01

Psychrophilic enzymes evolved from a plethora of structural scaffolds via multiple molecular pathways. Elucidating their adaptive strategies is instrumental to understand how life can thrive in cold ecosystems and to tailor enzymes for biotechnological applications at low temperatures. In this work, we used X-ray crystallography, in solution studies and molecular dynamics simulations to reveal the structural basis for cold adaptation of the GH1 β-glucosidase from Exiguobacterium antarcticum B7. We discovered that the selective pressure of low temperatures favored mutations that redesigned the protein surface, reduced the number of salt bridges, exposed more hydrophobic regions to the solvent and gave rise to a tetrameric arrangement not found in mesophilic and thermophilic homologues. As a result, some solvent-exposed regions became more flexible in the cold-adapted tetramer, likely contributing to enhance enzymatic activity at cold environments. The tetramer stabilizes the native conformation of the enzyme, leading to a 10-fold higher activity compared to the disassembled monomers. According to phylogenetic analysis, diverse adaptive strategies to cold environments emerged in the GH1 family, being tetramerization an alternative, not a rule. These findings reveal a novel strategy for enzyme cold adaptation and provide a framework for the semi-rational engineering of β-glucosidases aiming at cold industrial processes.

BIOTECHNOLOGICAL ASPECTS OF INTERFACIAL TENSIOMETRY AND RHEOMETRY OF XYLOTROPHIC BASIDIOMYCETES CULTURE FLUID

Directory of Open Access Journals (Sweden)

Chaika A. V.

2013-12-01

Full Text Available The tensio-rheometric characteristics of 63 strains belonging to 19 basidiomycetes species submerged culture filtrate were investigated by the axisymmetric pendent drop profile analysis. The method showed required high sensitivity with mycological material. It was found that the interfacial tensiometric and rheometric parameters depend significantly on culture species, hence it is proposed to use ones complex for systematic identification of cultures and as a selection criterion for biosurfactantsproducing strains of basidiomycetes. Correlations of tensio-rheometric characteristics both among themselves and with the culture growth and lipid peroxidation rates were found. This provides an integrated indicator of the submerged culture metabolic state. By the results of the study several strains of basidiomycetes — potential producers of biosurfactants with a high growth rate and intensity of lipid peroxidation were selected for biotechnological manufacture.

Recombinant cold-adapted attenuated influenza A vaccines for use in children: molecular genetic analysis of the cold-adapted donor and recombinants.

OpenAIRE

Ghendon, Y Z; Polezhaev, F I; Lisovskaya, K V; Medvedeva, T E; Alexandrova, G I; Klimov, A I

1984-01-01

A previously described cold-adapted attenuated virus, A/Leningrad/134/17/57 (H2N2), was further modified by 30 additional passages in chicken embryos at 25 degrees C. This virus had a distinct temperature-sensitive (ts) phenotype, grew well in chicken embryos at 25 degrees C, and failed to recombine with reference ts mutants of fowl plague virus containing ts lesions in five genes coding for non-glycosylated proteins (genes 1, 2, 5, 7, and 8). Recombination of A/Leningrad/134/47/57 with wild-...

Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

Science.gov (United States)

Ribera, Javier; Fink, Siegfried; Bas, Maria Del Carmen; Schwarze, Francis W M R

2017-01-01

The production of new generation of wood preservatives (without addition of a co-biocide) in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720) was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium). T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%). Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens previously exposed to T

Integrated control of wood destroying basidiomycetes combining Cu-based wood preservatives and Trichoderma spp.

Directory of Open Access Journals (Sweden)

Javier Ribera

Full Text Available The production of new generation of wood preservatives (without addition of a co-biocide in combination with an exchange of wood poles on identical sites with high fungal inoculum, has resulted in an increase of premature failures of wood utility poles in the last decades. Wood destroying basidiomycetes inhabiting sites where poles have been installed, have developed resistance against wood preservatives. The objective of the in vitro studies was to identify a Trichoderma spp. with a highly antagonistic potential against wood destroying basidiomycetes that is capable of colonizing Cu-rich environments. For this purpose, the activity of five Trichoderma spp. on Cu-rich medium was evaluated according to its growth and sporulation rates. The influence of the selected Trichoderma spp. on wood colonization and degradation by five wood destroying basidiomycetes was quantitatively analyzed by means of dry weight loss of wood specimens. Furthermore, the preventative effect of the selected Trichoderma spp. in combination with four Cu-based preservatives was also examined by mass loss and histological changes in the wood specimens. Trichoderma harzianum (T-720 was considered the biocontrol agent with higher antagonistic potential to colonize Cu-rich environments (up to 0.1% CuSO4 amended medium. T. harzianum demonstrated significant preventative effect on wood specimens against four wood destroying basidiomycetes. The combined effect of T. harzianum and Cu-based wood preservatives demonstrated that after 9 months incubation with two wood destroying basidiomycetes, wood specimens treated with 3.8 kg m-3 copper-chromium had weight losses between 55-65%, whereas containers previously treated with T. harzianum had significantly lower weight losses (0-25%. Histological studies on one of the wood destroying basidiomycetes revealed typical decomposition of wood cells by brown-rot fungi in Cu-impregnated samples, that were notably absent in wood specimens

[The structure of micromycete communities and their synecologic interactions with basidiomycetes during decomposition of plant debris].

Science.gov (United States)

Terekhova, V A; Semenova, T A

2005-01-01

We investigated the interactions between micromycetes and basidiomycete mycelium on plant substrates in the course of their 3-year incubation in the litter of ecologically intact spruce forests of the Central State Biosphere Forest Sanctuary (Nelidovo District, Tver oblast). Only 40-60% of the micromycetes were involved in direct antagonistic interactions with basidiomycetous fungi. In terms of the ratio between physiologically active strains and those which did not interact with basidiomycete mycelium, we revealed differences in the structure of micromycete communities developing on various types of substrates (xylem, bark, sphagnum, leaves, needles, litter, and cotton grass). The micromycetes tested belonged to 49 species. At the end of the observation period, the fraction of microscopic fungi that actively influenced basidiomycete mycelium was four times lower in the inactive litter fraction (lignin-containing xylem debris) than in the active fraction (grass substrates). The mechanisms of indirect regulation of the structure and functions of micromycete communities are discussed, which may be based on the accumulation of phenolic compounds in the medium and changes in the enzyme activities of basidiomycete mycelium.

Uncoupling protein and ATP/ADP carrier increase mitochondrial proton conductance after cold adaptation of king penguins.

Science.gov (United States)

Talbot, Darren A; Duchamp, Claude; Rey, Benjamin; Hanuise, Nicolas; Rouanet, Jean Louis; Sibille, Brigitte; Brand, Martin D

2004-07-01

Juvenile king penguins develop adaptive thermogenesis after repeated immersion in cold water. However, the mechanisms of such metabolic adaptation in birds are unknown, as they lack brown adipose tissue and uncoupling protein-1 (UCP1), which mediate adaptive non-shivering thermogenesis in mammals. We used three different groups of juvenile king penguins to investigate the mitochondrial basis of avian adaptive thermogenesis in vitro. Skeletal muscle mitochondria isolated from penguins that had never been immersed in cold water showed no superoxide-stimulated proton conductance, indicating no functional avian UCP. Skeletal muscle mitochondria from penguins that had been either experimentally immersed or naturally adapted to cold water did possess functional avian UCP, demonstrated by a superoxide-stimulated, GDP-inhibitable proton conductance across their inner membrane. This was associated with a markedly greater abundance of avian UCP mRNA. In the presence (but not the absence) of fatty acids, these mitochondria also showed a greater adenine nucleotide translocase-catalysed proton conductance than those from never-immersed penguins. This was due to an increase in the amount of adenine nucleotide translocase. Therefore, adaptive thermogenesis in juvenile king penguins is linked to two separate mechanisms of uncoupling of oxidative phosphorylation in skeletal muscle mitochondria: increased proton transport activity of avian UCP (dependent on superoxide and inhibited by GDP) and increased proton transport activity of the adenine nucleotide translocase (dependent on fatty acids and inhibited by carboxyatractylate).

Enhancement of the safety of live influenza vaccine by attenuating mutations from cold-adapted hemagglutinin

International Nuclear Information System (INIS)

Lee, Yoon Jae; Jang, Yo Han; Kim, Paul; Lee, Yun Ha; Lee, Young Jae; Byun, Young Ho; Lee, Kwang-Hee; Kim, Kyusik; Seong, Baik Lin

2016-01-01

In our previous study, X-31ca-based H5N1 LAIVs, in particular, became more virulent in mice than the X-31ca MDV, possibly by the introduction of the surface antigens of highly pathogenic H5N1 influenza virus, implying that additional attenuation is needed in this cases to increase the safety level of the vaccine. In this report we suggest an approach to further increase the safety of LAIV through additional cold-adapted mutations in the hemagglutinin. The cold-adaptation of X-31 virus resulted in four amino acid mutations in the HA. We generated a panel of 7:1 reassortant viruses each carrying the hemagglutinins with individual single amino acid mutations. We examined their phenotypes and found a major attenuating mutation, N81K. This attenuation marker conferred additional temperature-sensitive and attenuation phenotype to the LAIV. Our data indicate that the cold-adapted mutation in the HA confers additional attenuation to the LAIV strain, without compromising its productivity and immune response. - Highlights: • Cold-adaptation process induced four amino acid mutations in the HA of X-31 virus. • The four mutations in the HA also contributed to attenuation of the X-31ca virus • N81K mutation was the most significant marker for the attenuation of X-31ca virus. • Introduction of N81K mutation into H3N2 LAIV further attenuated the vaccine. • This approach provides a useful guideline for enhancing the safety of the LAIVs.

Enhancement of the safety of live influenza vaccine by attenuating mutations from cold-adapted hemagglutinin

Energy Technology Data Exchange (ETDEWEB)

Lee, Yoon Jae [Graduate Program in Biomaterials Science and Engineering, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Vaccine Translational Research Center, Yonsei University, Seoul (Korea, Republic of); Jang, Yo Han [Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Kim, Paul; Lee, Yun Ha; Lee, Young Jae [Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Vaccine Translational Research Center, Yonsei University, Seoul (Korea, Republic of); Byun, Young Ho; Lee, Kwang-Hee; Kim, Kyusik [Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Seong, Baik Lin, E-mail: blseong@yonsei.ac.kr [Graduate Program in Biomaterials Science and Engineering, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Laboratory of Molecular Medicine, Department of Biotechnology, College of Life Science and Biotechnology, Yonsei University, Seoul (Korea, Republic of); Vaccine Translational Research Center, Yonsei University, Seoul (Korea, Republic of)

2016-04-15

In our previous study, X-31ca-based H5N1 LAIVs, in particular, became more virulent in mice than the X-31ca MDV, possibly by the introduction of the surface antigens of highly pathogenic H5N1 influenza virus, implying that additional attenuation is needed in this cases to increase the safety level of the vaccine. In this report we suggest an approach to further increase the safety of LAIV through additional cold-adapted mutations in the hemagglutinin. The cold-adaptation of X-31 virus resulted in four amino acid mutations in the HA. We generated a panel of 7:1 reassortant viruses each carrying the hemagglutinins with individual single amino acid mutations. We examined their phenotypes and found a major attenuating mutation, N81K. This attenuation marker conferred additional temperature-sensitive and attenuation phenotype to the LAIV. Our data indicate that the cold-adapted mutation in the HA confers additional attenuation to the LAIV strain, without compromising its productivity and immune response. - Highlights: • Cold-adaptation process induced four amino acid mutations in the HA of X-31 virus. • The four mutations in the HA also contributed to attenuation of the X-31ca virus • N81K mutation was the most significant marker for the attenuation of X-31ca virus. • Introduction of N81K mutation into H3N2 LAIV further attenuated the vaccine. • This approach provides a useful guideline for enhancing the safety of the LAIVs.

Adaptation of the continuous cold-trap system of fluidized-bed to the fluoride volatility process

International Nuclear Information System (INIS)

1976-01-01

A continuous cold-trap system consisting of fluidized condensor and stripper has been evaluated with a view to adapt it to the Fluoride Volatility Process in establishing the continuous purification process without radiation decomposition of PuF 6 . Its feasibility is shown by the test with UF 6 -air. Necessary conditions for the cold trap, and performance of the 2-in.-dia. fluidized-bed cold-trap system are presented, and also a model of mist formation in the condensor

A bacterial acyl aminoacyl peptidase couples flexibility and stability as a result of cold adaptation.

Science.gov (United States)

Brocca, Stefania; Ferrari, Cristian; Barbiroli, Alberto; Pesce, Alessandra; Lotti, Marina; Nardini, Marco

2016-12-01

Life in cold environments requires an overall increase in the flexibility of macromolecular and supramolecular structures to allow biological processes to take place at low temperature. Conformational flexibility supports high catalytic rates of enzymes in the cold but in several cases is also a cause of instability. The three-dimensional structure of the psychrophilic acyl aminoacyl peptidase from Sporosarcina psychrophila (SpAAP) reported in this paper highlights adaptive molecular changes resulting in a fine-tuned trade-off between flexibility and stability. In its functional form SpAAP is a dimer, and an increase in flexibility is achieved through loosening of intersubunit hydrophobic interactions. The release of subunits from the quaternary structure is hindered by an 'arm exchange' mechanism, in which a tiny structural element at the N terminus of one subunit inserts into the other subunit. Mutants lacking the 'arm' are monomeric, inactive and highly prone to aggregation. Another feature of SpAAP cold adaptation is the enlargement of the tunnel connecting the exterior of the protein with the active site. Such a wide channel might compensate for the reduced molecular motions occurring in the cold and allow easy and direct access of substrates to the catalytic site, rendering transient movements between domains unnecessary. Thus, cold-adapted SpAAP has developed a molecular strategy unique within this group of proteins: it is able to enhance the flexibility of each functional unit while still preserving sufficient stability. Structural data are available in the Protein Data Bank under the accession number 5L8S. © 2016 Federation of European Biochemical Societies.

Comparative Analysis of 35 Basidiomycete Genomes Reveals Diversity and Uniqueness of the Phylum

Energy Technology Data Exchange (ETDEWEB)

Riley, Robert; Salamov, Asaf; Otillar, Robert; Fagnan, Kirsten; Boussau, Bastien; Brown, Daren; Henrissat, Bernard; Levasseur, Anthony; Held, Benjamin; Nagy, Laszlo; Floudas, Dimitris; Morin, Emmanuelle; Manning, Gerard; Baker, Scott; Martin, Francis; Blanchette, Robert; Hibbett, David; Grigoriev, Igor V.

2013-03-11

Fungi of the phylum Basidiomycota (basidiomycetes), make up some 37percent of the described fungi, and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprobes including wood decaying fungi. To better understand the diversity of this phylum we compared the genomes of 35 basidiomycete fungi including 6 newly sequenced genomes. The genomes of basidiomycetes span extremes of genome size, gene number, and repeat content. A phylogenetic tree of Basidiomycota was generated using the Phyldog software, which uses all available protein sequence data to simultaneously infer gene and species trees. Analysis of core genes reveals that some 48percent of basidiomycete proteins are unique to the phylum with nearly half of those (22percent) comprising proteins found in only one organism. Phylogenetic patterns of plant biomass-degrading genes suggest a continuum rather than a sharp dichotomy between the white rot and brown rot modes of wood decay among the members of Agaricomycotina subphylum. There is a correlation of the profile of certain gene families to nutritional mode in Agaricomycotina. Based on phylogenetically-informed PCA analysis of such profiles, we predict that that Botryobasidium botryosum and Jaapia argillacea have properties similar to white rot species, although neither has liginolytic class II fungal peroxidases. Furthermore, we find that both fungi exhibit wood decay with white rot-like characteristics in growth assays. Analysis of the rate of discovery of proteins with no or few homologs suggests the high value of continued sequencing of basidiomycete fungi.

Relationship between adaptation and cardiovascular response to tonic cold and heat pain Adaptability to tonic pain and cardiovascular responses.

Science.gov (United States)

Devoize, L; Chalaye, P; Lafrenaye, S; Marchand, S; Dallel, R

2016-05-01

The mechanisms of adaptation to tonic pain are not elucidated. We hypothesized that the adaptability to tonic pain is related to the cardiovascular system. Twenty-six subjects received over two sessions in a random order: tonic cold (7 ± 0.2 °C) and heat pain (47.5 ± 0.5 °C) on the hand for 5 min. Pain intensity, blood pressure (BP), and heart rate (HR) were continuously monitored. Pain experience during the heat (HIT) and cold (CIT) immersion tests exhibited different average time courses, being approximated with a linear and cubic function, respectively. In each test, two groups of participants could be identified based on the time course of their tonic thermal pain: one-third of participants were pain adaptive and two-thirds non adaptive. The adaptive group exhibited higher initial pain, lower last pain, and shorter latency to peak pain than the non-adaptive one. Interestingly, some participants were adaptive to both pain stimuli, most were not. HIT as well as CIT produced a stable elevation of BP. However, BP was higher during CIT than HIT (p = 0.034). HR was also increased during CIT and HIT, but the two tests differed with respect to the time course of responses. Finally, the intensity and time course of pain rating to both HIT and CIT correlated with neither BP nor HR responses. These results suggest that individual sensitivity and adaptability to tonic thermal pain is related to the intensity of initial pain rating and the latency to peak pain but not to cardiovascular responses. © 2015 European Pain Federation - EFIC®

Adaptation of the continuous cold trap system of fluidized-bed to the fluoride volatility process

International Nuclear Information System (INIS)

1976-02-01

A continuous cold trap system consisting of fluidized condenser and stripper has been evaluated with a view to adapt it to the Fluoride Volatility Process in establishing the continuous purification process without radiation decomposition of PuF 6 . Its feasibility is shown by the test with UF 6 -air. Necessary conditions for the cold trap, and performance of the two inch-dia. fluidized bed cold trap system are presented, and also a model of mist formation in the condenser. (auth.)

Molecular dynamics of mesophilic-like mutants of a cold-adapted enzyme: insights into distal effects induced by the mutations.

Directory of Open Access Journals (Sweden)

Elena Papaleo

Full Text Available Networks and clusters of intramolecular interactions, as well as their "communication" across the three-dimensional architecture have a prominent role in determining protein stability and function. Special attention has been dedicated to their role in thermal adaptation. In the present contribution, seven previously experimentally characterized mutants of a cold-adapted α-amylase, featuring mesophilic-like behavior, have been investigated by multiple molecular dynamics simulations, essential dynamics and analyses of correlated motions and electrostatic interactions. Our data elucidate the molecular mechanisms underlying the ability of single and multiple mutations to globally modulate dynamic properties of the cold-adapted α-amylase, including both local and complex unpredictable distal effects. Our investigation also shows, in agreement with the experimental data, that the conversion of the cold-adapted enzyme in a warm-adapted variant cannot be completely achieved by the introduction of few mutations, also providing the rationale behind these effects. Moreover, pivotal residues, which are likely to mediate the effects induced by the mutations, have been identified from our analyses, as well as a group of suitable candidates for protein engineering. In fact, a subset of residues here identified (as an isoleucine, or networks of mesophilic-like salt bridges in the proximity of the catalytic site should be considered, in experimental studies, to get a more efficient modification of the features of the cold-adapted enzyme.

An exceptionally cold-adapted alpha-amylase from a metagenomic library of a cold and alkaline environment

DEFF Research Database (Denmark)

Vester, Jan Kjølhede; Glaring, Mikkel Andreas; Stougaard, Peter

2015-01-01

A cold-active α-amylase, AmyI3C6, identified by a functional metagenomics approach was expressed in Escherichia coli and purified to homogeneity. Sequence analysis showed that the AmyI3C6 amylase was similar to α-amylases from the class Clostridia and revealed classical characteristics of cold......-adapted enzymes, as did comparison of the kinetic parameters Km and kcat to a mesophilic α-amylase. AmyI3C6 was shown to be heat-labile. Temperature optimum was at 10-15 °C, and more than 70 % of the relative activity was retained at 1 °C. The pH optimum of AmyI3C6 was at pH 8-9, and the enzyme displayed activity...... in two commercial detergents tested, suggesting that the AmyI3C6 α-amylase may be useful as a detergent enzyme in environmentally friendly, low-temperature laundry processes....

Environmental systems biology of cold-tolerant phenotype in Saccharomyces species adapted to grow at different temperatures.

Science.gov (United States)

Paget, Caroline Mary; Schwartz, Jean-Marc; Delneri, Daniela

2014-11-01

Temperature is one of the leading factors that drive adaptation of organisms and ecosystems. Remarkably, many closely related species share the same habitat because of their different temporal or micro-spatial thermal adaptation. In this study, we seek to find the underlying molecular mechanisms of the cold-tolerant phenotype of closely related yeast species adapted to grow at different temperatures, namely S. kudriavzevii CA111 (cryo-tolerant) and S. cerevisiae 96.2 (thermo-tolerant). Using two different systems approaches, i. thermodynamic-based analysis of a genome-scale metabolic model of S. cerevisiae and ii. large-scale competition experiment of the yeast heterozygote mutant collection, genes and pathways important for the growth at low temperature were identified. In particular, defects in lipid metabolism, oxidoreductase and vitamin pathways affected yeast fitness at cold. Combining the data from both studies, a list of candidate genes was generated and mutants for two predicted cold-favouring genes, GUT2 and ADH3, were created in two natural isolates. Compared with the parental strains, these mutants showed lower fitness at cold temperatures, with S. kudriavzevii displaying the strongest defect. Strikingly, in S. kudriavzevii, these mutations also significantly improve the growth at warm temperatures. In addition, overexpression of ADH3 in S. cerevisiae increased its fitness at cold. These results suggest that temperature-induced redox imbalances could be compensated by increased glycerol accumulation or production of cytosolic acetaldehyde through the deletion of GUT2 or ADH3, respectively. © 2014 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Purification and characterization of a novel cold-adapted phytase from Rhodotorula mucilaginosa strain JMUY14 isolated from Antarctic.

Science.gov (United States)

Yu, Peng; Wang, Xue-Ting; Liu, Jing-Wen

2015-08-01

A yeast producing a cold-adapted phytase was isolated from Antarctic deep-sea sediment and identified as a Rhodotorula mucilaginosa strain JMUY14 of basidiomycetous yeasts. It was cultured in fermentation optimized by a response surface methodology based on the Box-Behnken design. The maximum activity of phytase reached 205.447 U ml(-1), which was close to the predicted value of 201.948 U ml(-1) and approximately 3.4 times higher than its initial activity. The extracellular phytase was purified by 15.2-fold to homogeneity with a specific activity of 31,635 U mg(-1) by (NH4 )2 SO4 precipitation, and a combination of DEAE Sepharose Fast Flow, SP Sepharose Fast Flow, and Sephadex G-100. The molecular weight of the purified enzyme was estimated to be 63 kDa and its pI was 4.33. Its optimal temperature and pH were 50 °C and 5.0, respectively. Its activity was 85% at 37 °C, and showed good stability at pH 3.0 ∼ 7.0. When compared with mesophilic counterparts, the phytase not only exhibited a higher activity during 20 ∼ 30 °C but also had a low Km (247 µM) and high kcat (1394 s(-1)). The phytase activity was slightly stimulated in the presence of Mg(2+), Fe(2+), Fe(3+), K(+), Na(+), Ca(2+), EDTA, and EGTA and moderately inhibited by Cu(2+), Zn(2+), Mn(2+), Ag(+), PMSF, SDS, and phenylgloxal hydrate. It was resistant to both pepsin and trypsin. Since the phytase produced by the R. mucilaginosa JMUY14 showed a high specific activity, good pH stability, strong protease resistance, and high activity at low temperature, it has great potential for feed applications, especially in aquaculture. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Evolutionary genomics of the cold-adapted diatom Fragilariopsis cylindrus

KAUST Repository

Mock, Thomas

2017-01-17

The Southern Ocean houses a diverse and productive community of organisms. Unicellular eukaryotic diatoms are the main primary producers in this environment, where photosynthesis is limited by low concentrations of dissolved iron and large seasonal fluctuations in light, temperature and the extent of sea ice. How diatoms have adapted to this extreme environment is largely unknown. Here we present insights into the genome evolution of a cold-adapted diatom from the Southern Ocean, Fragilariopsis cylindrus, based on a comparison with temperate diatoms. We find that approximately 24.7 per cent of the diploid F. cylindrus genome consists of genetic loci with alleles that are highly divergent (15.1 megabases of the total genome size of 61.1 megabases). These divergent alleles were differentially expressed across environmental conditions, including darkness, low iron, freezing, elevated temperature and increased CO2. Alleles with the largest ratio of non-synonymous to synonymous nucleotide substitutions also show the most pronounced condition-dependent expression, suggesting a correlation between diversifying selection and allelic differentiation. Divergent alleles may be involved in adaptation to environmental fluctuations in the Southern Ocean.

Evolutionary genomics of the cold-adapted diatom Fragilariopsis cylindrus

KAUST Repository

Mock, Thomas; Otillar, Robert P.; Strauss, Jan; McMullan, Mark; Paajanen, Pirita; Schmutz, Jeremy; Salamov, Asaf; Sanges, Remo; Toseland, Andrew; Ward, Ben J.; Allen, Andrew E.; Dupont, Christopher L.; Frickenhaus, Stephan; Maumus, Florian; Veluchamy, Alaguraj; Wu, Taoyang; Barry, Kerrie W.; Falciatore, Angela; Ferrante, Maria I.; Fortunato, Antonio E.; Glö ckner, Gernot; Gruber, Ansgar; Hipkin, Rachel; Janech, Michael G.; Kroth, Peter G.; Leese, Florian; Lindquist, Erika A.; Lyon, Barbara R.; Martin, Joel; Mayer, Christoph; Parker, Micaela; Quesneville, Hadi; Raymond, James A.; Uhlig, Christiane; Valas, Ruben E.; Valentin, Klaus U.; Worden, Alexandra Z.; Armbrust, E. Virginia; Clark, Matthew D.; Bowler, Chris; Green, Beverley R.; Moulton, Vincent; Oosterhout, Cock van; Grigoriev, Igor V.

2017-01-01

The Southern Ocean houses a diverse and productive community of organisms. Unicellular eukaryotic diatoms are the main primary producers in this environment, where photosynthesis is limited by low concentrations of dissolved iron and large seasonal fluctuations in light, temperature and the extent of sea ice. How diatoms have adapted to this extreme environment is largely unknown. Here we present insights into the genome evolution of a cold-adapted diatom from the Southern Ocean, Fragilariopsis cylindrus, based on a comparison with temperate diatoms. We find that approximately 24.7 per cent of the diploid F. cylindrus genome consists of genetic loci with alleles that are highly divergent (15.1 megabases of the total genome size of 61.1 megabases). These divergent alleles were differentially expressed across environmental conditions, including darkness, low iron, freezing, elevated temperature and increased CO2. Alleles with the largest ratio of non-synonymous to synonymous nucleotide substitutions also show the most pronounced condition-dependent expression, suggesting a correlation between diversifying selection and allelic differentiation. Divergent alleles may be involved in adaptation to environmental fluctuations in the Southern Ocean.

Occurrence of indoor wood decay basidiomycetes in Europe

Czech Academy of Sciences Publication Activity Database

Gabriel, Jiří; Švec, Karel

2017-01-01

Roč. 31, č. 4 (2017), s. 212-217 ISSN 1749-4613 R&D Projects: GA ČR(CZ) GA17-05497S Institutional support: RVO:61388971 Keywords : Basidiomycetes * Fungi * Serpula lacrymans Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.231, year: 2016

Metabolic cold adaptation of polar fish based on measurements of aerobic oxygen consumption: fact or artefact? Artefact!

DEFF Research Database (Denmark)

Steffensen, John Fleng

2002-01-01

Whether metabolic cold adaptation in polar fish, based on measurements of aerobic standard metabolic rate, is a fact or an artefact has been a dispute since Holeton asked the question in 1974. So far polar fish had been considered to be metabolically cold adapted because they were reported to have...... a considerably elevated resting oxygen consumption, or standard metabolic rate, compared with oxygen consumption values of tropical or temperate fish extrapolated to similar low polar temperatures. Recent experiments on arctic and Antarctic fish, however, do not show elevated resting aerobic oxygen consumption...

Effects of thyroid status on cold-adaptive thermogenesis in Brandt's vole, Microtus brandti.

Science.gov (United States)

Liu, X T; LI, Q F; Huang, C X; Sun, R Y

1997-01-01

Hyper- and hypothyroidism were induced by subcutaneous injection of thyroxine and by oral administration of methimazol in Brandt's voles. The effects of the two treatments on metabolic thermogenesis at 25 degrees C and 4 degrees C were investigated. The level of resting metabolic rate was closely related to thyroid status: high in the hyperthyroid case and low in the hypothyroid case. However, no increase in resting metabolic rate occurred in either case during further cold acclimation. Hyperthyroidism resulted in an increased nonshivering thermogenesis, which was much enhanced by lower temperature, but hypothyroidism led to a suppressed nonshivering thermogenesis in the cold. The state-4 and state-3 respirations and the activities of cytochrome-c oxidase of liver mitochondria were elevated in hyperthyroid animals but attenuated in hypothyroid ones. However, these levels were scarcely changed after further cold acclimation. Both hyperthyroidism and cold acclimation induced the recruitment of brown adipose tissue, but brown adipose tissue was different biochemically in the two cases: in hyperthyroidism, the total protein was reduced, while fat content increased; in cold acclimation, the total and mitochondrial proteins were increased. However, in hypothyroid voles, the normal adaptive changes in brown adipose tissue were impaired in further cold acclimation. The activity of cytochromec oxidase in brown adipose tissue was increased by hyperthyroidism and enhanced in further cold. In contrast, its activity was inhibited in hypothyroid animals, though activated to some extent in cold. These results demonstrate that normal thyroid function is essential for the cold-induced increase of resting metabolic rate and nonshivering thermogenesis and that there is a synergism between thyroid hormone and cold acclimation in the regulation of nonshivering thermogenesis in Brandt's vole. In addition, the blunted response of brown adipocytes to the cold may be the cytological

Investigation of cold extrusion process using coupled thermo-mechanical FEM analysis and adaptive friction modeling

Science.gov (United States)

Görtan, Mehmet Okan

2017-10-01

Cold extrusion processes are known for their excellent material usage as well as high efficiency in the production of large batches. Although the process starts at room temperature, workpiece temperatures may rise above 200°C. Moreover, contact normal stresses can exceed 2500 MPa, whereas surface enlargement values can reach up to 30. These changes affects friction coefficients in cold extrusion processes. In the current study, friction coefficients between a plain carbon steel C4C (1.0303) and a tool steel (1.2379) are determined dependent on temperature and contact pressure using the sliding compression test (SCT). In order to represent contact normal stress and temperature effects on friction coefficients, an empirical adaptive friction model has been proposed. The validity of the model has been tested with experiments and finite element simulations for a cold forward extrusion process. By using the proposed adaptive friction model together with thermo-mechanical analysis, the deviation in the process loads between numerical simulations and model experiments could be reduced from 18.6% to 3.3%.

A highly self-adaptive cold plate for the single-phase mechanically pumped fluid loop for spacecraft thermal management

International Nuclear Information System (INIS)

Wang, Ji-Xiang; Li, Yun-Ze; Zhang, Hong-Sheng; Wang, Sheng-Nan; Liang, Yi-Hao; Guo, Wei; Liu, Yang; Tian, Shao-Ping

2016-01-01

Highlights: • A highly self-adaptive cold plate integrated with paraffin-based actuator is proposed. • Higher operating economy is attained due to an energy-efficient strategy. • A greater compatibility of the current space control system is obtained. • Model was entrenched theoretically to design the system efficiently. • A strong self-adaptability of the cold plate is observed experimentally. - Abstract: Aiming to improve the conventional single-phase mechanically pumped fluid loop applied in spacecraft thermal control system, a novel actively-pumped loop using distributed thermal control strategy was proposed. The flow control system for each branch consists primarily of a thermal control valve integrated with a paraffin-based actuator residing in the front part of each corresponding cold plate, where both coolant’s flow rate and the cold plate’s heat removal capability are well controlled sensitively according to the heat loaded upon the cold plate due to a conversion between thermal and mechanical energies. The operating economy enhances remarkably owing to no energy consumption in flow control process. Additionally, realizing the integration of the sensor, controller and actuator systems, it simplifies structure of the traditional mechanically pumped fluid loop as well. Revolving this novel scheme, mathematical model regarding design process of the highly specialized cold plate was entrenched theoretically. A validating system as a prototype was established on the basis of the design method and the scheduled objective of the controlled temperature (43 °C). Then temperature control performances of the highly self-adaptive cold plate under various operating conditions were tested experimentally. During almost all experiments, the controlled temperature remains within a range of ±2 °C around the set-point. Conclusions can be drawn that this self-driven control system is stable with sufficient fast transient responses and sufficient small steady

The ability of a cold-adapted Rhodotorula mucilaginosa strain from Tibet to control blue mold in pear fruit.

Science.gov (United States)

Hu, Hao; Yan, Fujie; Wilson, Charles; Shen, Qing; Zheng, Xiaodong

2015-12-01

Cold-adapted yeasts were isolated from soil samples collected in Tibet and evaluated as potential biocontrol agents against blue mold (Penicillium expansum) of pear fruit in cold storage. YC1, an isolate identified as Rhodotorula mucilaginosa, was found to exhibit the greatest biocontrol activity among the different isolates that were screened. A washed cell suspension of YC1 exhibited the best biocontrol activity among three different preparations that were used in the current study. A concentration of 10(8) cells/ml reduced the incidence of decay to 35 %, compared to the control where decay incidence was 100 %. A higher intracellular level of trehalose and a higher proportion of polyunsaturated acids present in YC1, was associated with increased the tolerance of this strain to low temperatures, relative to the other strains that were evaluated. The increased tolerance to low temperature allowed the YC1 strain of yeast to more effectively compete for nutrients and space in wounded pear fruit that had been inoculated with spores of P. expansum and placed in cold storage. The present study demonstrated the ability to select cold-adapted yeasts from cold climates and use them as biocontrol agents of postharvest diseases of fruit placed in cold storage.

Differences in cold adaptation of .i.Bacillus subtilis./i. under anaerobic and aerobic conditions

Czech Academy of Sciences Publication Activity Database

Beranová, J.; Mansilla, M.C.; de Mendoza, D.; Elhottová, Dana; Konopásek, I.

2010-01-01

Roč. 192, č. 16 (2010), s. 4164-4171 ISSN 0021-9193 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z60660521 Keywords : cold adaptation * Bacillus subtilis * anaerobiosis Subject RIV: EE - Microbiology, Virology Impact factor: 3.726, year: 2010

Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/brown rot paradigm for wood decay fungi

Science.gov (United States)

Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade ...

Production of β-ionone by combined expression of carotenogenic and plant CCD1 genes in Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Lopez, Javiera; Essus, Karen; Kim, Il-Kwon

2015-01-01

cells. The additional integration of the carotenoid cleavage dioxygenase gene from the plant Petunia hybrida (PhCCD1) let to the production of low amounts of beta-ionone (0.073 ± 0.01 mg/g DCW) and changed the color of the strain from orange to yellow. The expression of the crtYB gene from a high copy......, the carotenogenic crtYB, crtI genes and the plant PhCCD1 gene-the highest β-ionone concentration reported to date by a cell factory was achieved. This microbial cell factory represents a starting point for flavor production by a sustainable and efficient process that could replace current methods.......Background: Apocarotenoids, like the C13-norisoprenoids, are natural compounds that contribute to the flavor and/or aroma of flowers and foods. They are produced in aromatic plants-like raspberries and roses-by the enzymatic cleavage of carotenes. Due to their pleasant aroma and flavour...

Cold adaptation of the mononuclear molybdoenzyme periplasmic nitrate reductase from the Antarctic bacterium Shewanella gelidimarina

Energy Technology Data Exchange (ETDEWEB)

Simpson, Philippa J.L. [School of Chemistry, University of Sydney, New South Wales 2006 (Australia); Codd, Rachel, E-mail: rachel.codd@sydney.edu.au [School of Chemistry, University of Sydney, New South Wales 2006 (Australia); School of Medical Sciences (Pharmacology) and Bosch Institute, University of New South Wales, New South Wales 2006 (Australia)

2011-11-04

Highlights: Black-Right-Pointing-Pointer Cold-adapted phenotype of NapA from the Antarctic bacterium Shewanella gelidimarina. Black-Right-Pointing-Pointer Protein homology model of NapA from S. gelidimarina and mesophilic homologue. Black-Right-Pointing-Pointer Six amino acid residues identified as lead candidates governing NapA cold adaptation. Black-Right-Pointing-Pointer Molecular-level understanding of designing cool-temperature in situ oxyanion sensors. -- Abstract: The reduction of nitrate to nitrite is catalysed in bacteria by periplasmic nitrate reductase (Nap) which describes a system of variable protein subunits encoded by the nap operon. Nitrate reduction occurs in the NapA subunit, which contains a bis-molybdopterin guanine dinucleotide (Mo-MGD) cofactor and one [4Fe-4S] iron-sulfur cluster. The activity of periplasmic nitrate reductase (Nap) isolated as native protein from the cold-adapted (psychrophilic) Antarctic bacterium Shewanella gelidimarina (Nap{sub Sgel}) and middle-temperature adapted (mesophilic) Shewanella putrefaciens (Nap{sub Sput}) was examined at varied temperature. Irreversible deactivation of Nap{sub Sgel} and Nap{sub Sput} occurred at 54.5 and 65 Degree-Sign C, respectively. When Nap{sub Sgel} was preincubated at 21-70 Degree-Sign C for 30 min, the room-temperature nitrate reductase activity was maximal and invariant between 21 and 54 Degree-Sign C, which suggested that Nap{sub Sgel} was poised for optimal catalysis at modest temperatures and, unlike Nap{sub Sput}, did not benefit from thermally-induced refolding. At 20 Degree-Sign C, Nap{sub Sgel} reduced selenate at 16% of the rate of nitrate reduction. Nap{sub Sput} did not reduce selenate. Sequence alignment showed 46 amino acid residue substitutions in Nap{sub Sgel} that were conserved in NapA from mesophilic Shewanella, Rhodobacter and Escherichia species and could be associated with the Nap{sub Sgel} cold-adapted phenotype. Protein homology modeling of Nap{sub Sgel} using a

Cold adaptation of the mononuclear molybdoenzyme periplasmic nitrate reductase from the Antarctic bacterium Shewanella gelidimarina

International Nuclear Information System (INIS)

Simpson, Philippa J.L.; Codd, Rachel

2011-01-01

Highlights: ► Cold-adapted phenotype of NapA from the Antarctic bacterium Shewanella gelidimarina. ► Protein homology model of NapA from S. gelidimarina and mesophilic homologue. ► Six amino acid residues identified as lead candidates governing NapA cold adaptation. ► Molecular-level understanding of designing cool-temperature in situ oxyanion sensors. -- Abstract: The reduction of nitrate to nitrite is catalysed in bacteria by periplasmic nitrate reductase (Nap) which describes a system of variable protein subunits encoded by the nap operon. Nitrate reduction occurs in the NapA subunit, which contains a bis-molybdopterin guanine dinucleotide (Mo–MGD) cofactor and one [4Fe–4S] iron–sulfur cluster. The activity of periplasmic nitrate reductase (Nap) isolated as native protein from the cold-adapted (psychrophilic) Antarctic bacterium Shewanella gelidimarina (Nap Sgel ) and middle-temperature adapted (mesophilic) Shewanella putrefaciens (Nap Sput ) was examined at varied temperature. Irreversible deactivation of Nap Sgel and Nap Sput occurred at 54.5 and 65 °C, respectively. When Nap Sgel was preincubated at 21–70 °C for 30 min, the room-temperature nitrate reductase activity was maximal and invariant between 21 and 54 °C, which suggested that Nap Sgel was poised for optimal catalysis at modest temperatures and, unlike Nap Sput , did not benefit from thermally-induced refolding. At 20 °C, Nap Sgel reduced selenate at 16% of the rate of nitrate reduction. Nap Sput did not reduce selenate. Sequence alignment showed 46 amino acid residue substitutions in Nap Sgel that were conserved in NapA from mesophilic Shewanella, Rhodobacter and Escherichia species and could be associated with the Nap Sgel cold-adapted phenotype. Protein homology modeling of Nap Sgel using a mesophilic template with 66% amino acid identity showed the majority of substitutions occurred at the protein surface distal to the Mo–MGD cofactor. Two mesophilic ↔ psychrophilic

A cold-adapted endoglucanase from camel rumen with high catalytic activity at moderate and low temperatures: an anomaly of truly cold-adapted evolution in a mesophilic environment.

Science.gov (United States)

Khalili Ghadikolaei, Kamran; Gharechahi, Javad; Haghbeen, Kamahldin; Akbari Noghabi, Kambiz; Hosseini Salekdeh, Ghasem; Shahbani Zahiri, Hossein

2018-03-01

Endoglucanases are important enzymes in plant biomass degradation. They have current and potential applications in various industrial sectors including human and animal food processing, textile, paper, and renewable biofuel production. It is assumed that the cold-active endoglucanases, with high catalytic rates in moderate and cold temperatures, can improve the cost-effectiveness of industrial processes by lowering the need for heating and, thus, energy consumption. In this study, the endoglucanase CelCM3 was procured from a camel rumen metagenome via gene cloning and expression in Escherichia coli BL21 (DE3). The maximum activity of the enzyme on carboxymethyl cellulose (CMC) was obtained at pH 5 and 30 °C with a V max and K m of 339 U/mg and 2.57 mg/ml, respectively. The enzyme with an estimated low melting temperature of 45 °C and about 50% activity at 4 °C was identified to be cold-adapted. A thermodynamic analysis corroborated that CelCM3 with an activation energy (E a ), enthalpy of activation (ΔH), and Gibb's free energy (ΔG) of, respectively, 18.47 kJ mol -1 , 16.12 kJ mol -1 , and 56.09 kJ mol -1 is a cold-active endoglucanase. In addition, CelCM3 was tolerant of metal ions, non-ionic detergents, urea, and organic solvents. Given these interesting characteristics, CelCM3 shows promise to meet the requirements of industrial applications.

Recombinant cold-adapted attenuated influenza A vaccines for use in children: reactogenicity and antigenic activity of cold-adapted recombinants and analysis of isolates from the vaccinees.

OpenAIRE

Alexandrova, G I; Polezhaev, F I; Budilovsky, G N; Garmashova, L M; Topuria, N A; Egorov, A Y; Romejko-Gurko, Y R; Koval, T A; Lisovskaya, K V; Klimov, A I

1984-01-01

Reactogenicity and antigenic activity of recombinants obtained by crossing cold-adapted donor of attenuation A/Leningrad/134/47/57 with wild-type influenza virus strains A/Leningrad/322/79(H1N1) and A/Bangkok/1/79(H3N2) were studied. The recombinants were areactogenic when administered as an intranasal spray to children aged 3 to 15, including those who lacked or had only low titers of pre-existing anti-hemagglutinin and anti-neuraminidase antibody in their blood. After two administrations of...

Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

Science.gov (United States)

Robert Riley; Asaf A. Salamov; Daren W. Brown; Laszlo G. Nagy; Dimitrios Floudas; Benjamin W. Held; Anthony Levasseur; Vincent Lombard; Emmanuelle Morin; Robert Otillar; Erika A. Lindquist; Hui Sun; Kurt M. LaButti; Jeremy Schmutz; Dina Jabbour; Hong Luo; Scott E. Baker; Antonio G. Pisabarro; Jonathan D. Walton; Robert A. Blanchette; Bernard Henrissat; Francis Martin; Daniel Cullen; David S. Hibbett; Igor V. Grigoriev

2014-01-01

Basidiomycota (basidiomycetes) make up 32% of the described fungi and include most wood-decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic...

Comparative genomics of the marine bacterial genus Glaciecola reveals the high degree of genomic diversity and genomic characteristic for cold adaptation.

Science.gov (United States)

Qin, Qi-Long; Xie, Bin-Bin; Yu, Yong; Shu, Yan-Li; Rong, Jin-Cheng; Zhang, Yan-Jiao; Zhao, Dian-Li; Chen, Xiu-Lan; Zhang, Xi-Ying; Chen, Bo; Zhou, Bai-Cheng; Zhang, Yu-Zhong

2014-06-01

To what extent the genomes of different species belonging to one genus can be diverse and the relationship between genomic differentiation and environmental factor remain unclear for oceanic bacteria. With many new bacterial genera and species being isolated from marine environments, this question warrants attention. In this study, we sequenced all the type strains of the published species of Glaciecola, a recently defined cold-adapted genus with species from diverse marine locations, to study the genomic diversity and cold-adaptation strategy in this genus.The genome size diverged widely from 3.08 to 5.96 Mb, which can be explained by massive gene gain and loss events. Horizontal gene transfer and new gene emergence contributed substantially to the genome size expansion. The genus Glaciecola had an open pan-genome. Comparative genomic research indicated that species of the genus Glaciecola had high diversity in genome size, gene content and genetic relatedness. This may be prevalent in marine bacterial genera considering the dynamic and complex environments of the ocean. Species of Glaciecola had some common genomic features related to cold adaptation, which enable them to thrive and play a role in biogeochemical cycle in the cold marine environments.

Conversion of BAC Clones into Binary BAC (BIBAC) Vectors and Their Delivery into Basidiomycete Fungal Cells Using Agrobacterium tumefaciens

KAUST Repository

Ali, Shawkat

2014-09-19

The genetic transformation of certain organisms, required for gene function analysis or complementation, is often not very efficient, especially when dealing with large gene constructs or genomic fragments. We have adapted the natural DNA transfer mechanism from the soil pathogenic bacterium Agrobacterium tumefaciens, to deliver intact large DNA constructs to basidiomycete fungi of the genus Ustilago where they stably integrated into their genome. To this end, Bacterial Artificial Chromosome (BAC) clones containing large fungal genomic DNA fragments were converted via a Lambda phage-based recombineering step to Agrobacterium transfer-competent binary vectors (BIBACs) with a Ustilago-specific selection marker. The fungal genomic DNA fragment was subsequently successfully delivered as T-DNA through Agrobacterium-mediated transformation into Ustilago species where an intact copy stably integrated into the genome. By modifying the recombineering vector, this method can theoretically be adapted for many different fungi.

Assessment of wood-inhabiting Basidiomycetes for biokraft pulping of softwood chips

CSIR Research Space (South Africa)

Wolfaardt, F

2004-10-01

Full Text Available Wood-inhabiting Basidiomycetes have been screened for various applications in the pulp and paper industry and it is evident that different fungi need to be used to suit the specific requirements of each application. This study assessed...

Both brown adipose tissue and skeletal muscle thermogenesis processes are activated during mild to severe cold adaptation in mice.

Science.gov (United States)

Bal, Naresh C; Singh, Sushant; Reis, Felipe C G; Maurya, Santosh K; Pani, Sunil; Rowland, Leslie A; Periasamy, Muthu

2017-10-06

Thermogenesis is an important homeostatic mechanism essential for survival and normal physiological functions in mammals. Both brown adipose tissue (BAT) ( i.e. uncoupling protein 1 (UCP1)-based) and skeletal muscle ( i.e. sarcolipin (SLN)-based) thermogenesis processes play important roles in temperature homeostasis, but their relative contributions differ from small to large mammals. In this study, we investigated the functional interplay between skeletal muscle- and BAT-based thermogenesis under mild versus severe cold adaptation by employing UCP1 -/- and SLN -/- mice. Interestingly, adaptation of SLN -/- mice to mild cold conditions (16 °C) significantly increased UCP1 expression, suggesting increased reliance on BAT-based thermogenesis. This was also evident from structural alterations in BAT morphology, including mitochondrial architecture, increased expression of electron transport chain proteins, and depletion of fat droplets. Similarly, UCP1 -/- mice adapted to mild cold up-regulated muscle-based thermogenesis, indicated by increases in muscle succinate dehydrogenase activity, SLN expression, mitochondrial content, and neovascularization, compared with WT mice. These results further confirm that SLN-based thermogenesis is a key player in muscle non-shivering thermogenesis (NST) and can compensate for loss of BAT activity. We also present evidence that the increased reliance on BAT-based NST depends on increased autonomic input, as indicated by abundant levels of tyrosine hydroxylase and neuropeptide Y. Our findings demonstrate that both BAT and muscle-based NST are equally recruited during mild and severe cold adaptation and that loss of heat production from one thermogenic pathway leads to increased recruitment of the other, indicating a functional interplay between these two thermogenic processes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

DEGRADATION OF TEXTILE DYES BY WHITE ROT BASIDIOMYCETES

OpenAIRE

B.P. PARMAR, P.N. MERVANA B.R.M. VYAS*

2014-01-01

ABSTRACT: Dyes released by the textile industries pose a threat to environmental quality. Ligninolytic white-rot basidiomycetes can effectively degrade colored effluents and conventional dyes. White-rot fungi produce various isoforms of extracellular oxidases including laccase, Mn peroxidase and lignin peroxidase (LiP), which are involved in the degradation of lignin in their natural lignocellulosic substrates.  The textile industry, by far the most avid user of synthetic dyes, is in need...

Cold-adapted live attenuated influenza vaccines developed in Russia: Can they contribute to meeting the needs for influenza control in other countries?

International Nuclear Information System (INIS)

Kendal, Alan P.

1997-01-01

It is now more than 30 years since the first cold-adapted influenza viruses were developed in Russia as potential live, attenuated vaccines. In the past 15-20 years considerable experience has been gained from Russian and joint Russian-US laboratory and clinical studies with type A monovalent and bivalent vaccines prepared with genetic reassortant viruses derived from one of these cold-adapted viruses in particular, A/Leningrad/134/57. More recent experiences include use of trivalent cold-adapted vaccines with a type B component. The overall high level of safety of individual and combined vaccines in pre-school and school-aged children, with illness reductions in open field trials equivalent to that seen with inactivated vaccines, is such as to suggest that practical measures might now be justified to facilitate expansion of the use of these vaccines to other countries. It is proposed that further experimentation with the Russian cold-adapted live attenuated vaccines should be focused on issues that will relate to the public health perspective, i.e. selection of the single best candidate type A and B vaccines for intense study using as criteria their potential for meeting licensing requirements outside Russia, and documenting the clinical protective efficacy of a single vaccine dose compared to two doses as studied until now. Resolution of these issues is important to ensure that costs for future live vaccine production, control, and utilization will be kept at lowest levels so that expanded use of live vaccines will have maximum cost-benefit and affordability. To guide those interested in these issues, examples are given of populations for whom a licensed live cold-adapted vaccine might be considered, together with indications of extra data needed to fully validate each suggested use

Nectar sugars and bird visitation define a floral niche for basidiomycetous yeast on the Canary Islands.

Science.gov (United States)

Mittelbach, Moritz; Yurkov, Andrey M; Nocentini, Daniele; Nepi, Massimo; Weigend, Maximilian; Begerow, Dominik

2015-02-01

Studies on the diversity of yeasts in floral nectar were first carried out in the late 19th century. A narrow group of fermenting, osmophilous ascomycetes were regarded as exclusive specialists able to populate this unique and species poor environment. More recently, it became apparent that microorganisms might play an important role in the process of plant pollination. Despite the importance of these nectar dwelling yeasts, knowledge of the factors that drive their diversity and species composition is scarce. In this study, we linked the frequencies of yeast species in floral nectars from various host plants on the Canary Islands to nectar traits and flower visitors. We estimated the structuring impact of pollination syndromes (nectar volume, sugar concentration and sugar composition) on yeast diversity.The observed total yeast diversity was consistent with former studies, however, the present survey yielded additional basidiomycetous yeasts in unexpectedly high numbers. Our results show these basidiomycetes are significantly associated with ornithophilous flowers. Specialized ascomycetes inhabit sucrose-dominant nectars, but are surprisingly rare in nectar dominated by monosaccharides. There are two conclusions from this study: (i) a shift of floral visitors towards ornithophily alters the likelihood of yeast inoculation in flowers, and (ii) low concentrated hexose-dominant nectar promotes colonization of flowers by basidiomycetes. In the studied floral system, basidiomycete yeasts are acknowledged as regular members of nectar. This challenges the current understanding that nectar is an ecological niche solely occupied by ascomycetous yeasts.

Crystal structure of a cold-active protease (Pro21717) from the psychrophilic bacterium, Pseudoalteromonas arctica PAMC 21717, at 1.4 Å resolution: Structural adaptations to cold and functional analysis of a laundry detergent enzyme.

Science.gov (United States)

Park, Ha Ju; Lee, Chang Woo; Kim, Dockyu; Do, Hackwon; Han, Se Jong; Kim, Jung Eun; Koo, Bon-Hun; Lee, Jun Hyuck; Yim, Joung Han

2018-01-01

Enzymes isolated from organisms found in cold habitats generally exhibit higher catalytic activity at low temperatures than their mesophilic homologs and are therefore known as cold-active enzymes. Cold-active proteases are very useful in a variety of biotechnological applications, particularly as active ingredients in laundry and dishwashing detergents, where they provide strong protein-degrading activity in cold water. We identified a cold-active protease (Pro21717) from a psychrophilic bacterium, Pseudoalteromonas arctica PAMC 21717, and determined the crystal structure of its catalytic domain (CD) at a resolution of 1.4 Å. The Pro21717-CD structure shows a conserved subtilisin-like fold with a typical catalytic triad (Asp185, His244, and Ser425) and contains four calcium ions and three disulfide bonds. Interestingly, we observed an unexpected electron density at the substrate-binding site from a co-purified peptide. Although the sequence of this peptide is unknown, analysis of the peptide-complexed structure nonetheless provides some indication of the substrate recognition and binding mode of Pro21717. Moreover, various parameters, including a wide substrate pocket size, an abundant active-site loop content, and a flexible structure provide potential explanations for the cold-adapted properties of Pro21717. In conclusion, this is first structural characterization of a cold-adapted subtilisin-like protease, and these findings provide a structural and functional basis for industrial applications of Pro21717 as a cold-active laundry or dishwashing detergent enzyme.

Cold adaptation, ca2+ dependency and autolytic stability are related features in a highly active cold-adapted trypsin resistant to autoproteolysis engineered for biotechnological applications.

Directory of Open Access Journals (Sweden)

Alvaro Olivera-Nappa

Full Text Available Pig trypsin is routinely used as a biotechnological tool, due to its high specificity and ability to be stored as an inactive stable zymogen. However, it is not an optimum enzyme for conditions found in wound debriding for medical uses and trypsinization processes for protein analysis and animal cell culturing, where low Ca(2+ dependency, high activity in mild conditions and easy inactivation are crucial. We isolated and thermodynamically characterized a highly active cold-adapted trypsin for medical and laboratory use that is four times more active than pig trypsin at 10(° C and at least 50% more active than pig trypsin up to 50(° C. Contrary to pig trypsin, this enzyme has a broad optimum pH between 7 and 10 and is very insensitive to Ca(2+ concentration. The enzyme is only distantly related to previously described cryophilic trypsins. We built and studied molecular structure models of this trypsin and performed molecular dynamic calculations. Key residues and structures associated with calcium dependency and cryophilicity were identified. Experiments indicated that the protein is unstable and susceptible to autoproteolysis. Correlating experimental results and structural predictions, we designed mutations to improve the resistance to autoproteolysis and conserve activity for longer periods after activation. One single mutation provided around 25 times more proteolytic stability. Due to its cryophilic nature, this trypsin is easily inactivated by mild denaturation conditions, which is ideal for controlled proteolysis processes without requiring inhibitors or dilution. We clearly show that cold adaptation, Ca(2+ dependency and autolytic stability in trypsins are related phenomena that are linked to shared structural features and evolve in a concerted fashion. Hence, both structurally and evolutionarily they cannot be interpreted and studied separately as previously done.

PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans.

Science.gov (United States)

Svensk, Emma; Ståhlman, Marcus; Andersson, Carl-Henrik; Johansson, Maja; Borén, Jan; Pilon, Marc

2013-01-01

C. elegans PAQR-2 is homologous to the insulin-sensitizing adiponectin receptors in mammals, and essential for adaptation to growth at 15°C, a low but usually acceptable temperature for this organism. By screening for novel paqr-2 suppressors, we identified mutations in genes involved in phosphatidylcholine synthesis (cept-1, pcyt-1 and sams-1) and fatty acid metabolism (ech-7, hacd-1, mdt-15, nhr-49 and sbp-1). We then show genetic evidence that paqr-2, phosphatidylcholines, sbp-1 and Δ9-desaturases form a cold adaptation pathway that regulates the increase in unsaturated fatty acids necessary to retain membrane fluidity at low temperatures. This model is supported by the observations that the paqr-2 suppressors normalize the levels of saturated fatty acids, and that low concentrations of detergents that increase membrane fluidity can rescue the paqr-2 mutant.

[Optimization of fermentation conditions for cold-adapted amylase production by Micrococcus antarcticus and its enzymatic properties].

Science.gov (United States)

Fan, Hong-xi; Liu, Ying; Liu, Zhi-pei

2009-08-15

By single factor experiments, the fermentation conditions for cold-adapted amylase production from Micrococcus antarcticus were determined as follows(medium g/L): Na2 HPO4 2.0, KH2PO4 1.0, MgSO4 x 7H2O 0.1, NaCl 5.0, (NH4)2SO4 2.5, maltose 5.0, trace element solution 5.0 mL, pH 8.0, 100 mL/Erlenmeyer flask (500 mL); cultivation was in a rotating shaker at 12 degrees C and 160 r/min for 64 h.Under those conditions,the highest total enzyme activity (2.6 U/mL) was obtained and increased by 10.8 fold compared with the original value of 0.24 U/mL before optimization. This amylase was purified by concentration with ultrafiltration membrane module, Hitrap Q anion exchange chromatography and Superdex 200 gel filtration chromatography. The optimal temperature and pH for the purified amylase were 30 degrees C and 6.0, respectively.It still showed high activity at low temperature 10-15 degrees C. It was sensitive to high temperature but was stable at pH 6.0-10.0 with at least 70% activity remained. These results indicated that it was a typical cold-adapted enzyme. The enzyme activity was stimulated by Ca2+, Mn2+, Co2+ and Mg2+; but inhibited by Zn2+, Ba2+, Ag+, Cu2+, Al3+, Fe2, Fe3+, Hg2+, EDTA and citrate. This cold-adapted amylase showed resistance to inactivation of 0.1% nonionic surfactants such as Tween 80, TrintonX-100, etc. Its Km was 0.90 mg/mL.

A survey of domestic species of Basidiomycetes fungi for the presence of lectins inn their carpophores

Directory of Open Access Journals (Sweden)

Grażyna Końska

2014-01-01

Full Text Available Preliminary investigations were conducted to determine the presence of active lectins in carpophores of fungi from the class Basidiomycetes, collected from natural localities in southern and south-eastern Poland. The degree of agglutination activity (expressed as the titre of agglutination of aqueous extracts was determined at room temperature (18-20°C and at +4°C in respect to human and animal erythrocytes suspended in physiological saline, part of which were additionally treated with proteolytic enzymes. From among the 104 tested species, extracts from 41 of them showed agglutination activity, among which 18 were high. In six cases, specific activity against human ABH group antigens was found. Extracts from 5 species agglutinated only animal erythrocytes, with pigeon erythrocytes being exceptionally sensitive to the lectins. Extracts from two species had distinctly higher agglutination activity at 4°C, which suggests that lectins of the "cold" agglutinin type are present in these species. Analysis of extracts from caps and stems showed that caps had a higher lectin content.

Biological potential of extracts of the wild edible Basidiomycete mushroom Grifola frondosa

NARCIS (Netherlands)

Klaus, A.; Kozarski, M.; Vunduk, N.; Todorovic, N.; Jakovlejevic, D.; Zizak, Z.; Pavlovic, V.; Levic, S.; Niksic, M.; Griensven, van L.J.L.D.

2015-01-01

Partially purified polysaccharides (FP) and hot alkali extract (FNa) obtained from fruiting bodies of the wild basidiomycete Grifola frondosa were examined for their antimicrobial, antioxidant and cytotoxic activity. The structural properties of FP and FNa samples were investigated by FT-IR and high

Analysis of basidiomycete pigments in situ by Raman spectroscopy.

Science.gov (United States)

Tauber, James P; Matthäus, Christian; Lenz, Claudius; Hoffmeister, Dirk; Popp, Jürgen

2018-02-07

Basidiomycetes, that is, mushroom-type fungi, are known to produce pigments in response to environmental impacts. As antioxidants with a high level of unsaturation, these compounds can neutralize highly oxidative species. In the event of close contact with other microbes, the enzymatically controlled pigment production is triggered and pigment secretion is generated at the interaction zone. The identification and analysis of these pigments is important to understand the defense mechanism of fungi, which is essential to counteract an uncontrolled spread of harmful species. Usually, a detailed analysis of the pigments is time consuming as it depends on laborious sample preparation and isolation procedures. Furthermore, the applied protocols often influence the chemical integrity of the compound of interest. A possibility to noninvasively investigate the pigmentation is Raman microspectroscopy. The methodology has the potential to analyze the chemical composition of the sample spatially resolved at the interaction zone. After the acquisition of a representative spectroscopic library, the pigment production by basidiomycetes was monitored for during response to different fungi and bacteria. The presented results describe a very efficient noninvasive way of pigment analysis which can be applied with minimal sample preparation. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Adaptive Automatic Gauge Control of a Cold Strip Rolling Process

Directory of Open Access Journals (Sweden)

ROMAN, N.

2010-02-01

Full Text Available The paper tackles with thickness control structure of the cold rolled strips. This structure is based on the rolls position control of a reversible quarto rolling mill. The main feature of the system proposed in the paper consists in the compensation of the errors introduced by the deficient dynamics of the hydraulic servo-system used for the rolls positioning, by means of a dynamic compensator that approximates the inverse system of the servo-system. Because the servo-system is considered variant over time, an on-line identification of the servo-system and parameter adapting of the compensator are achieved. The results obtained by numerical simulation are presented together with the data taken from real process. These results illustrate the efficiency of the proposed solutions.

PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans.

Directory of Open Access Journals (Sweden)

Emma Svensk

Full Text Available C. elegans PAQR-2 is homologous to the insulin-sensitizing adiponectin receptors in mammals, and essential for adaptation to growth at 15°C, a low but usually acceptable temperature for this organism. By screening for novel paqr-2 suppressors, we identified mutations in genes involved in phosphatidylcholine synthesis (cept-1, pcyt-1 and sams-1 and fatty acid metabolism (ech-7, hacd-1, mdt-15, nhr-49 and sbp-1. We then show genetic evidence that paqr-2, phosphatidylcholines, sbp-1 and Δ9-desaturases form a cold adaptation pathway that regulates the increase in unsaturated fatty acids necessary to retain membrane fluidity at low temperatures. This model is supported by the observations that the paqr-2 suppressors normalize the levels of saturated fatty acids, and that low concentrations of detergents that increase membrane fluidity can rescue the paqr-2 mutant.

Cloning, expression and structural stability of a cold-adapted ß-Galactosidase from Rahnella sp.R3

Science.gov (United States)

A novel gene was isolated for the first time from a psychrophilic gram-negative bacterium Rahnella sp.R3. It encoded a cold-adapted ß-galactosidase (R-ß-Gal). Recombinant R-ß-Gal was expressed in Escherichia coli BL21 (DE3), purified, and characterized. R-ß-Gal belongs to the glycosyl hydrolase fami...

VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

Directory of Open Access Journals (Sweden)

Veligodska A. K.

2013-12-01

Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

[Oil degradation by basidiomycetes in soil and peat at low temperatures].

Science.gov (United States)

Kulikova, N A; Klein, O I; Pivchenko, D V; Landesman, E O; Pozdnyakova, N N; Turkovskaya, O V; Zaichik, B Ts; Ruzhitskii, A O; Koroleva, O V

2016-01-01

A total of 17 basidiomycete strains causing white rot and growing on oil-contaminated substrates have been screened. Three strains with high (Steccherinum murashkinskyi), average (Trametes maxima), and low (Pleurotus ostreatus) capacities for the colonization of oil-contaminated substrates have been selected. The potential for degrading crude oil hydrocarbons has been assessed with the use of fungi grown on nonsterile soil and peat at low temperatures. Candida sp. and Rhodococcus sp. commercial strains have been used as reference organisms with oil-degrading ability. All microorganisms introduced in oil-contaminated soil have proved to be ineffective, whereas the inoculation of peat with basidiomycetes and oil-degrading microorganisms accelerated the destruction of oil hydrocarbons. The greatest degradation potential of oil-aliphatic hydrocarbons has been found in S. murashlinskyi. T. maxima turned out to be the most successful in degrading aromatic hydrocarbons. It has been suggested that aboriginal microflora contributes importantly to the effectiveness of oil-destructing microorganisms. T. maxima and S. murashkinskyi strains are promising for further study as oil-oxidizing agents during bioremediation of oil-contaminated peat soil under conditions of low temperatures.

Cold injuries.

Science.gov (United States)

Kruse, R J

1995-01-01

There are two categories of cold injury. The first is hypothermia, which is a systemic injury to cold, and the second is frostbite, which is a local injury. Throughout history, entire armies, from George Washington to the Germans on the Russian Front in World War II, have fallen prey to prolonged cold exposure. Cold injury is common and can occur in all seasons if ambient temperature is lower than the core body temperature. In the 1985 Boston Marathon, even though it was 76 degrees and sunny, there were 75 runners treated for hypothermia. In general, humans adapt poorly to cold exposure. Children are at particular risk because of their relatively greater surface area/body mass ratio, causing them to cool even more rapidly than adults. Because of this, the human's best defense against cold injury is to limit his/her exposure to cold and to dress appropriately. If cold injury has occurred and is mild, often simple passive rewarming such as dry blankets and a warm room are sufficient treatment.

Potential of cold-adapted microorganisms for bioremediation of oil-polluted Alpine soils

International Nuclear Information System (INIS)

Margesin, R.

2000-01-01

The environmental contamination by organic pollutants is a widespread problem in all climates. The most widely distributed pollution can be attributed to oil contamination. Bioremediation methods can provide efficient, inexpensive and environmentally safe cleanup tools. The role of cold-adapted microorganisms for the bioremediation of experimentally and chronically oil-contaminated Alpine soils was evaluated in the studies described. The results demonstrated that there is a considerable potential for oil bioremediation in Alpine soils. Oil biodegradation can be significantly enhanced by biostimulation (inorganic nutrient supply), but a complete oil elimination is not possible by employing biological decontamination alone. (Author)

Antioxidative activities and chemical characterization of polysaccharides extracted from the basidiomycete Schizophyllum commune

NARCIS (Netherlands)

Klaus, A.; Kozarski, M.; Niksic, M.; Jakovljevic, D.; Todorovic, N.; Griensven, van L.J.L.D.

2011-01-01

Antioxidant properties of hot water extract (HWE), hot water extracted polysaccharides (HWP) and hot alkali extracted polysaccharides (HWAE) were obtained from fruiting bodies of the wild basidiomycete Schizophyllum commune. All extracts contained both a- and ß-glucans as determined by Megazyme

Hirsutane Sesquiterpenes from Cultures of the Basidiomycete Marasmiellus sp. BCC 22389

Directory of Open Access Journals (Sweden)

Masahiko Isaka

2016-08-01

Full Text Available Abstract Two new hirsutane sesquiterpenes, marasmiellins A (1 and B (2, were isolated from cultures of the basidiomycete Marasmiellus sp. BCC 22389. The structures were elucidated on the basis of NMR spectroscopic and mass spectrometry data. The absolute configuration of marasmiellin B was determined by application of the modified Mosher’s method. Graphical Abstract

Human Physiological Responses to Acute and Chronic Cold Exposure

Science.gov (United States)

Stocks, Jodie M.; Taylor, Nigel A. S.; Tipton, Michael J.; Greenleaf, John E.

2001-01-01

When inadequately protected humans are exposed to acute cold, excessive body heat is lost to the environment and unless heat production is increased and heat loss attenuated, body temperature will decrease. The primary physiological responses to counter the reduction in body temperature include marked cutaneous vasoconstriction and increased metabolism. These responses, and the hazards associated with such exposure, are mediated by a number of factors which contribute to heat production and loss. These include the severity and duration of the cold stimulus; exercise intensity; the magnitude of the metabolic response; and individual characteristics such as body composition, age, and gender. Chronic exposure to a cold environment, both natural and artificial, results in physiological alterations leading to adaptation. Three quite different, but not necessarily exclusive, patterns of human cold adaptation have been reported: metabolic, hypothermic, and insulative. Cold adaptation has also been associated with an habituation response, in which there is a desensitization, or damping, of the normal response to a cold stress. This review provides a comprehensive analysis of the human physiological and pathological responses to cold exposure. Particular attention is directed to the factors contributing to heat production and heat loss during acute cold stress, and the ability of humans to adapt to cold environments.

Effects of heat, cold, acid and bile salt adaptations on the stress tolerance and protein expression of kefir-isolated probiotic Lactobacillus kefiranofaciens M1.

Science.gov (United States)

Chen, Ming-Ju; Tang, Hsin-Yu; Chiang, Ming-Lun

2017-09-01

Lactobacillus kefiranofaciens M1 is a probiotic strain isolated from Taiwanese kefir grains. The present study evaluated the effects of heat, cold, acid and bile salt adaptations on the stress tolerance of L. kefiranofaciens M1. The regulation of protein expression of L. kefiranofaciens M1 under these adaptation conditions was also investigated. The results showed that adaptation of L. kefiranofaciens M1 to heat, cold, acid and bile salts induced homologous tolerance and cross-protection against heterologous challenge. The extent of induced tolerance varied depending on the type and condition of stress. Proteomic analysis revealed that 27 proteins exhibited differences in expression between non-adapted and stress-adapted L. kefiranofaciens M1 cells. Among these proteins, three proteins involved in carbohydrate metabolism (triosephosphate isomerase, enolase and NAD-dependent glycerol-3-phosphate dehydrogenase), two proteins involved in pH homeostasis (ATP synthase subunits AtpA and AtpB), two stress response proteins (chaperones DnaK and GroEL) and one translation-related protein (30S ribosomal protein S2) were up-regulated by three of the four adaptation treatments examined. The increased synthesis of these stress proteins might play a critical protective role in the cellular defense against heat, cold, acid and bile salt stresses. Copyright © 2017 Elsevier Ltd. All rights reserved.

Plasticity and stress tolerance override local adaptation in the responses of Mediterranean holm oak seedlings to drought and cold.

Science.gov (United States)

Gimeno, Teresa E; Pías, Beatriz; Lemos-Filho, José P; Valladares, Fernando

2009-01-01

Plant populations of widely distributed species experience a broad range of environmental conditions that can be faced by phenotypic plasticity or ecotypic differentiation and local adaptation. The strategy chosen will determine a population's ability to respond to climate change. To explore this, we grew Quercus ilex (L.) seedlings from acorns collected at six selected populations from climatically contrasting localities and evaluated their response to drought and late season cold events. Maximum photosynthetic rate (A(max)), instantaneous water use efficiency (iWUE), and thermal tolerance to freeze and heat (estimated from chlorophyll fluorescence versus temperature curves) were measured in 5-month-old seedlings in control (no stress), drought (water-stressed), and cold (low suboptimal temperature) conditions. The observed responses were similar for the six populations: drought decreased A(max) and increased iWUE, and cold reduced A(max) and iWUE. All the seedlings maintained photosynthetic activity under adverse conditions (drought and cold), and rapidly increased their iWUE by closing stomata when exposed to drought. Heat and freeze tolerances were similarly high for seedlings from all the populations, and they were significantly increased by drought and cold, respectively; and were positively related to each other. Differences in seedling performance across populations were primarily induced by maternal effects mediated by seed size and to a lesser extent by idiosyncratic physiologic responses to drought and low temperatures. Tolerance to multiple stresses together with the capacity to physiologically acclimate to heat waves and cold snaps may allow Q. ilex to cope with the increasingly stressful conditions imposed by climate change. Lack of evidence of physiologic seedling adaptation to local climate may reflect opposing selection pressures to complex, multidimensional environmental conditions operating within the distribution range of this species.

The Genome Sequence of the psychrophilic archaeon, Methanococcoides burtonii: the Role of Genome Evolution in Cold-adaptation

Energy Technology Data Exchange (ETDEWEB)

Allen, Michelle A.; Lauro, Federico M.; Williams, Timothy J.; Burg, Dominic; Siddiqui, Khawar S.; De Francisci, David; Chong, Kevin W.Y.; Pilak, Oliver; Chew, Hwee H.; De Maere, Matthew Z.; Ting, Lily; Katrib, Marilyn; Ng, Charmaine; Sowers, Kevin R.; Galperin, Michael Y.; Anderson, Iain J.; Ivanova, Natalia; Dalin, Eileen; Martinez, Michelle; Lapidus, Alla; Hauser, Loren; Land, Miriam; Thomas, Torsten; Cavicchioli, Ricardo

2009-04-01

Psychrophilic archaea are abundant and perform critical roles throughout the Earth's expansive cold biosphere. Here we report the first complete genome sequence for a psychrophilic methanogenic archaeon, Methanococcoides burtonii. The genome sequence was manually annotated including the use of a five tiered Evidence Rating system that ranked annotations from Evidence Rating (ER) 1 (gene product experimentally characterized from the parent organism) to ER5 (hypothetical gene product) to provide a rapid means of assessing the certainty of gene function predictions. The genome is characterized by a higher level of aberrant sequence composition (51%) than any other archaeon. In comparison to hyper/thermophilic archaea which are subject to selection of synonymous codon usage, M. burtonii has evolved cold adaptation through a genomic capacity to accommodate highly skewed amino acid content, while retaining codon usage in common with its mesophilic Methanosarcina cousins. Polysaccharide biosynthesis genes comprise at least 3.3% of protein coding genes in the genome, and Cell wall/membrane/envelope biogenesis COG genes are over-represented. Likewise, signal transduction (COG category T) genes are over-represented and M. burtonii has a high 'IQ' (a measure of adaptive potential) compared to many methanogens. Numerous genes in these two over-represented COG categories appear to have been acquired from {var_epsilon}- and {delta}-proteobacteria, as do specific genes involved in central metabolism such as a novel B form of aconitase. Transposases also distinguish M. burtonii from other archaea, and their genomic characteristics indicate they play an important role in evolving the M. burtonii genome. Our study reveals a capacity for this model psychrophile to evolve through genome plasticity (including nucleotide skew, horizontal gene transfer and transposase activity) that enables adaptation to the cold, and to the biological and physical changes that have

The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery

International Nuclear Information System (INIS)

Bayles, C.J.; Aist, J.R.; Berns, M.W.

1993-01-01

Bayles, C. J., Aist, J. R., and Berns, M. W. 1993. The mechanics of anaphase B in a basidiomycete as revealed by laser microbeam microsurgery. Experimental Mycology 17, 191-199. Cytoplasmic forces were found to be actively pulling on the spindle pole bodies during anaphase B in the dikaryotic, basidiomycete fungus, Helicobasidium mompa. When the spindle of one nucleus was severed with a laser microbeam at mid anaphase B, its two spindle pole bodies separated at a much faster rate than did those of the intact spindle in the other nucleus of the same cell. Since astral microtubule populations apparently reach their maximum during anaphase B in this fungus, we suggest that these microtubules may be involved in the cytoplasmic pulling forces. The spindle appears to act primarily as a governor, regulating the rate at which the spindle pole bodies are separated

Prospects for bioprocess development based on recent genome advances in lignocellulose degrading basidiomycetes

Science.gov (United States)

Chiaki Hori; Daniel Cullen

2016-01-01

Efficient and complete degradation of woody plant cell walls requires the concerted action of hydrolytic and oxidative systems possessed by a relatively small group of filamentous basidiomycetous fungi. Among these wood decay species, Phanerochaete chrysosporium was the first to be sequenced (Martinez et al. 2004). In...

A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

NARCIS (Netherlands)

Kreger-van Rij, N.J.W.; Veenhuis, M.

1971-01-01

The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

Biocontrol activity of a cold-adapted yeast from Tibet against gray mold in cherry tomato and its action mechanism.

Science.gov (United States)

Hu, Hao; Wisniewski, Michael E; Abdelfattah, Ahmed; Zheng, Xiaodong

2017-07-01

Cold-adapted biocontrol yeast was selected from four yeast isolates from Tibet against gray mold of cherry tomato in cold storage. The strain numbered LB2 showed the best biocontrol activity and identified as Cryptococcus laurentii. Competition for nutrient, space, and induced fruit resistance was also its antagonistic mechanism. Compared with C. laurentii from sea-level place, the reason why LB2 had a better biocontrol activity was studied. More trehalose and proline in cell of LB2 made it exhibit a better cellular activity at low temperature, such as higher population dynamics in the wounds of cherry tomato and more biocontrol-related enzyme secretion, chitinase and β-glucanase. The better oxidative stress tolerance was another characteristic of LB2. Maybe because of the ideal culture condition, there was no obvious difference between these two yeasts in the growth in vitro test at low temperature. Although the same phenomenon existed in the low pH stress test, LB2 still had higher cell concentration under this stress. Comparative transcriptomics method was also applied to analyze the cell activity of LB2 and C. laurentii at different temperatures. The results showed that more active response in the intracellular structure and intracellular metabolic process to cold temperature made LB2 had a better activity. The present study indicated a possibility to select cold-adapted biocontrol yeast from Tibet and also showed its primary action mechanism.

Correlation of polyunsaturated fatty acids with the cold adaptation of Rhodotorula glutinis.

Science.gov (United States)

He, Jing; Yang, Zhaojie; Hu, Binbin; Ji, Xiuling; Wei, Yunlin; Lin, Lianbing; Zhang, Qi

2015-11-01

This study aimed to investigate the correlation between the cold adaptation of Rhodotorula glutinis YM25079 and the membrane fluidity, content of polyunsaturated fatty acids and mRNA expression level of the Δ(12)-desaturase gene. The optimum temperature for YM25079 growth was analysed first, then the composition changes of membrane lipid in YM25079 were detected by GC-MS and membrane fluidity was evaluated by 1-anilinonaphthalene-8-sulphonate (ANS) fluorescence. Meanwhile, the encoding sequence of Δ(12)-fatty acid desaturase in YM25079 was cloned and further transformed into Saccharomyces cerevisiae INVScl for functional analysis. The mRNA expression levels of Δ(12)-fatty acid desaturase at 15°C and 25°C were analysed by real-time PCR. YM25079 could grow at 5-30°C, with the optimum temperature of 15°C. The membrane fluidity of YM25079 was not significantly reduced when the culture temperature decreased from 25°C to 15°C, but the content of polyunsaturated fatty acids (PUFAs), including linoleic acid and α-Linolenic acid increased significantly from 29.4% to 55.39%. Furthermore, a novel Δ(12)-fatty acid desaturase gene YM25079RGD12 from YM25079 was successfully identified and characterized, and the mRNA transcription level of the Δ(12)-desaturase gene was about five-fold higher in YM25079 cells grown at 15°C than that at 25°C. These results suggests that the cold adaptation of Rhodotorula glutinis YM25079 might result from higher expression of genes, especially the Δ(12)-fatty acid desaturase gene, during polyunsaturated fatty acids biosynthesis, which increased the content of PUFAs in the cell membrane and maintained the membrane fluidity at low temperature. Copyright © 2015 John Wiley & Sons, Ltd.

Characterization of a cold-adapted esterase and mutants from a psychotolerant Pseudomonas sp. strain.

Science.gov (United States)

Dong, Juan; Gasmalla, Mohammed A A; Zhao, Wei; Sun, Jingtao; Liu, Wenyu; Wang, Mingming; Han, Liang; Yang, Ruijin

2017-09-01

A cold-adapted esterase-producing strain named T1-39 was isolated from Glacier No. 1, Tianshan, People's Republic of China and identified as Pseudomonas sp. from 16S rRNA sequence analysis. The esterase (EstT1-39) secreted by this strain preferentially hydrolyzed esters of glycerol with short- and medium-chain fatty acids. Mutants of T1-39 were generated by the atmospheric and room temperature plasma method and screened for enhanced esterase activity. Among all the mutants, strain TB11 had 4.45-fold higher esterase productivity than T1-39, with high genetic stability over 10 generations of continuous cultivation. Maximum activity of EstT1-39 and EstTB11 was observed at 30 ℃, pH 9.0 and 25 ℃, pH 8.5, respectively. EstTB11 was thermally more stable (50 ℃ for 1 H) and active over a broader pH range than EstT1-39. EstTB11 also retained 38% of its maximal activity at 0 ℃ and was found to be able to hydrolyze milk fats into short- and medium-chain fatty acids at 4 ℃. The characteristics of EstT1-39 made it a cold-adapted enzyme and the EstTB11 from the mutant, with its higher activity at lower temperatures, may be suitable for the production of aromas and flavors in the dairy industry. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

OpenAIRE

Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.

2005-01-01

Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype i...

Diversity and decay ability of basidiomycetes isolated from lodgepole pines killed by the mountain pine beetle.

Science.gov (United States)

Son, E; Kim, J-J; Lim, Y W; Au-Yeung, T T; Yang, C Y H; Breuil, C

2011-01-01

When lodgepole pines (Pinus contorta Douglas ex Louden var. latifolia Engelm. ex S. Watson) that are killed by the mountain pine beetle (Dendroctonus ponderosae) and its fungal associates are not harvested, fungal decay can affect wood and fibre properties. Ophiostomatoids stain sapwood but do not affect the structural properties of wood. In contrast, white or brown decay basidiomycetes degrade wood. We isolated both staining and decay fungi from 300 lodgepole pine trees killed by mountain pine beetle at green, red, and grey stages at 10 sites across British Columbia. We retained 224 basidiomycete isolates that we classified into 34 species using morphological and physiological characteristics and rDNA large subunit sequences. The number of basidiomycete species varied from 4 to 14 species per site. We assessed the ability of these fungi to degrade both pine sapwood and heartwood using the soil jar decay test. The highest wood mass losses for both sapwood and heartwood were measured for the brown rot species Fomitopsis pinicola and the white rot Metulodontia and Ganoderma species. The sap rot species Trichaptum abietinum was more damaging for sapwood than for heartwood. A number of species caused more than 50% wood mass losses after 12 weeks at room temperature, suggesting that beetle-killed trees can rapidly lose market value due to degradation of wood structural components.

Molecular cloning, expression and biochemical characterisation of a cold-adapted novel recombinant chitinase from Glaciozyma antarctica PI12

Directory of Open Access Journals (Sweden)

Ramli Aizi

2011-11-01

Full Text Available Abstract Background Cold-adapted enzymes are proteins produced by psychrophilic organisms that display a high catalytic efficiency at extremely low temperatures. Chitin consists of the insoluble homopolysaccharide β-(1, 4-linked N-acetylglucosamine, which is the second most abundant biopolymer found in nature. Chitinases (EC 3.2.1.14 play an important role in chitin recycling in nature. Biodegradation of chitin by the action of cold-adapted chitinases offers significant advantages in industrial applications such as the treatment of chitin-rich waste at low temperatures, the biocontrol of phytopathogens in cold environments and the biocontrol of microbial spoilage of refrigerated food. Results A gene encoding a cold-adapted chitinase (CHI II from Glaciozyma antarctica PI12 was isolated using Rapid Amplification of cDNA Ends (RACE and RT-PCR techniques. The isolated gene was successfully expressed in the Pichia pastoris expression system. Analysis of the nucleotide sequence revealed the presence of an open reading frame of 1,215 bp, which encodes a 404 amino acid protein. The recombinant chitinase was secreted into the medium when induced with 1% methanol in BMMY medium at 25°C. The purified recombinant chitinase exhibited two bands, corresponding to the non-glycosylated and glycosylated proteins, by SDS-PAGE with molecular masses of approximately 39 and 50 kDa, respectively. The enzyme displayed an acidic pH characteristic with an optimum pH at 4.0 and an optimum temperature at 15°C. The enzyme was stable between pH 3.0-4.5 and was able to retain its activity from 5 to 25°C. The presence of K+, Mn2+ and Co2+ ions increased the enzyme activity up to 20%. Analysis of the insoluble substrates showed that the purified recombinant chitinase had a strong affinity towards colloidal chitin and little effect on glycol chitosan. CHI II recombinant chitinase exhibited higher Vmax and Kcat values toward colloidal chitin than other substrates at low

Plant plasma membrane proteomics for improving cold tolerance

Directory of Open Access Journals (Sweden)

Daisuke eTakahashi

2013-04-01

Full Text Available Plants are always exposed to various stresses. We have focused on freezing stress, which causes serious problems for agricultural management. When plants suffer freeze-induced damage, the plasma membrane is thought to be the primary site of injury because of its central role in regulation of various cellular processes. Cold tolerant species, however, adapt to such freezing conditions by modifying cellular components and functions (cold acclimation. One of the most important adaptation mechanisms to freezing is alteration of plasma membrane compositions and functions. Advanced proteomic technologies have succeeded in identification of many candidates that may play roles in adaptation of the plasma membrane to freezing stress. Proteomics results suggest that adaptations of plasma membrane functions to low temperature are associated with alterations of protein compositions during cold acclimation. Some of proteins identified by proteomic approaches have been verified their functional roles in freezing tolerance mechanisms further. Thus, accumulation of proteomic results in the plasma membrane is of importance for application to molecular breeding efforts to increase cold tolerance in crops.

Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity.

Science.gov (United States)

Casieri, Leonardo; Anastasi, Antonella; Prigione, Valeria; Varese, Giovanna Cristina

2010-11-01

Basidiomycetes are essential in forest ecology, being deeply involved in wood and litter decomposition, humification, and mineralization of soil organic matter. The fungal oxidoreductases involved in these processes are today the focus of much attention with a view to their applications. The ecological role and potential biotechnological applications of 300 isolates of Basidiomycetes were assessed, taking into account the degradation of model dyes in different culture conditions and the production of oxidoreductase enzymes. The tested isolates belong to different ecophysiological groups (wood-degrading, litter-degrading, ectomycorrhizal, and coprophilous fungi) and represent a broad systematic and functional biodiversity among Basidiomycetes occurring in deciduous and evergreen forests of northwest Italy (Piedmont Region). The high number of species tested and the use of different culture conditions allowed the investigation of the degradation activity of several novel species, neglected to date. Oxidative enzyme activities varied widely among all ecophysiological groups and laccases were the most commonly detected enzymes. A large number of isolates (86%), belonging to all ecophysiological groups, were found to be active against at least one model dye; the wood-degrading fungi represented the most efficient group. Noteworthily, also some isolates of litter-degrading and ectomycorrhizal fungi achieved good decolorization yield. The 25 best isolates were then tested against nine industrial dyes commonly employed in textile industries. Three isolates of Bjerkandera adusta efficiently decolorized the dyes on all media and can be considered important candidates for application in textile wastewater treatment.

The genome of the polar eukaryotic microalga Coccomyxa subellipsoidea reveals traits of cold adaptation

Energy Technology Data Exchange (ETDEWEB)

Blanc, Guillaume; Agarkova, Irina; Grimwood, Jane; Kuo, Alan; Brueggeman, Andrew; Dunigan, David D.; Gurnon, James; Ladunga, Istvan; Lindquist, Erika; Lucas, Susan; Pangilinan, Jasmyn; Proschold, Thomas; Salamov, Asaf; Schmutz, Jeremy; Weeks, Donald; Tamada, Takashi; Lomsadze, Alexandre; Borodovsky, Mark; Claverie, Jean-Michel; Grigoriev, Igor V.; Van Etten, James L.

2012-02-13

Background Little is known about the mechanisms of adaptation of life to the extreme environmental conditions encountered in polar regions. Here we present the genome sequence of a unicellular green alga from the division chlorophyta, Coccomyxa subellipsoidea C-169, which we will hereafter refer to as C-169. This is the first eukaryotic microorganism from a polar environment to have its genome sequenced. Results The 48.8 Mb genome contained in 20 chromosomes exhibits significant synteny conservation with the chromosomes of its relatives Chlorella variabilis and Chlamydomonas reinhardtii. The order of the genes is highly reshuffled within synteny blocks, suggesting that intra-chromosomal rearrangements were more prevalent than inter-chromosomal rearrangements. Remarkably, Zepp retrotransposons occur in clusters of nested elements with strictly one cluster per chromosome probably residing at the centromere. Several protein families overrepresented in C. subellipsoidae include proteins involved in lipid metabolism, transporters, cellulose synthases and short alcohol dehydrogenases. Conversely, C-169 lacks proteins that exist in all other sequenced chlorophytes, including components of the glycosyl phosphatidyl inositol anchoring system, pyruvate phosphate dikinase and the photosystem 1 reaction center subunit N (PsaN). Conclusions We suggest that some of these gene losses and gains could have contributed to adaptation to low temperatures. Comparison of these genomic features with the adaptive strategies of psychrophilic microbes suggests that prokaryotes and eukaryotes followed comparable evolutionary routes to adapt to cold environments.

Isolation and characterization of microsatellite loci from the ectomycorrhizal basidiomycete Suillus luteus

OpenAIRE

Muller, L.; LAMBAERTS, Marc; VANGRONSVELD, Jaco; COLPAERT, Jan

2006-01-01

Eight microsatellite loci were isolated from the ectomycorrhizal basidiomycete Suillus luteus using a dual-suppression-polymerase chain reaction (PCR) method. In a test sample of 40 isolates, the total number of alleles per locus and the expected heterozygosities ranged from five to 16 and from 0.532 to 0.811, respectively. These highly polymorphic markers allow an accurate description of the genetic diversity and structure of S. luteus populations.

De Novo Transcriptome Sequencing and the Hypothetical Cold Response Mode of Saussurea involucrata in Extreme Cold Environments.

Science.gov (United States)

Li, Jin; Liu, Hailiang; Xia, Wenwen; Mu, Jianqiang; Feng, Yujie; Liu, Ruina; Yan, Panyao; Wang, Aiying; Lin, Zhongping; Guo, Yong; Zhu, Jianbo; Chen, Xianfeng

2017-06-07

Saussurea involucrata grows in high mountain areas covered by snow throughout the year. The temperature of this habitat can change drastically in one day. To gain a better understanding of the cold response signaling pathways and molecular metabolic reactions involved in cold stress tolerance, genome-wide transcriptional analyses were performed using RNA-Seq technologies. A total of 199,758 transcripts were assembled, producing 138,540 unigenes with 46.8 Gb clean data. Overall, 184,416 (92.32%) transcripts were successfully annotated. The 365 transcription factors identified (292 unigenes) belonged to 49 transcription factor families associated with cold stress responses. A total of 343 transcripts on the signal transduction (132 upregulated and 212 downregulated in at least any one of the conditions) were strongly affected by cold temperature, such as the CBL-interacting serine/threonine-protein kinase ( CIPKs ), receptor-like protein kinases , and protein kinases . The circadian rhythm pathway was activated by cold adaptation, which was necessary to endure the severe temperature changes within a day. There were 346 differentially expressed genes (DEGs) related to transport, of which 138 were upregulated and 22 were downregulated in at least any one of the conditions. Under cold stress conditions, transcriptional regulation, molecular transport, and signal transduction were involved in the adaptation to low temperature in S. involucrata . These findings contribute to our understanding of the adaptation of plants to harsh environments and the survival traits of S. involucrata . In addition, the present study provides insight into the molecular mechanisms of chilling and freezing tolerance.

Nitrogen availability alters macrofungal basidiomycete Blackwell Publishing, Ltd. community structure in optimally fertilized loblolly pine forests

Science.gov (United States)

Ivan P. Edwards; Jennifer L. Cripliver; Andrew R. Gillespie; Kurt H. Johnsen; M. Scholler; Ronald F. Turco

2004-01-01

We investigated the effect of an optimal nutrition strategy designed to maximize loblolly pine (Pinus taeda) growth on the rank abundance structure and diversity of associated basidiomycete communities.We conducted both small- and large-scale below-ground surveys 10 years after the initiation of optimal...

Functional analysis of multiple carotenogenic genes from Lycium barbarum and Gentiana lutea L. for their effects on beta-carotene production in transgenic tobacco.

Science.gov (United States)

Ji, Jing; Wang, Gang; Wang, Jiehua; Wang, Ping

2009-02-01

Carotenoids are red, yellow and orange pigments, which are widely distributed in nature and are especially abundant in yellow-orange fruits and vegetables and dark green leafy vegetables. Carotenoids are essential for photosynthesis and photoprotection in plant life and also have different beneficial effects in humans and animals (van den Berg et al. 2000). For example, beta-carotene plays an essential role as the main dietary source of vitamin A. To obtain further insight into beta-carotene biosynthesis in two important economic plant species, Lycium barbarum and Gentiana lutea L., and to investigate and prioritize potential genetic engineering targets in the pathway, the effects of five carotenogenic genes from these two species, encoding proteins including geranylgeranyl diphosphate synthase, phytoene synthase and delta-carotene desaturase gene, lycopene beta-cyclase, lycopene epsilon-cyclase were functionally analyzed in transgenic tobacco (Nicotiana tabacum) plants. All transgenic tobacco plants constitutively expressing these genes showed enhanced beta-carotene contents in their leaves and flowers to different extents. The addictive effects of co-ordinate expression of double transgenes have also been investigated.

Mineralisation of 14C-labelled synthetic lignin and ligninolytic enzyme activities of litter-decomposing basidiomycetous fungi.

Science.gov (United States)

Steffen, K T; Hofrichter, M; Hatakka, A

2000-12-01

Within a screening program, 27 soil litter-decomposing basidiomycetes were tested for ligninolytic enzyme activities using agar-media containing 2,2'-azinobis(3-ethylbenzthiazoline-6-sulphonate), a humic acid or Mn2+ ions as indicator substrates. Most active species were found within the family Strophariaceae (Agrocybe praecox, Stropharia coronilla, S. rugosoannulata) and used for mineralisation experiments with a 14C-ring-labelled synthetic lignin (14C-DHP). The fungi mineralised around 25% of the lignin to 14CO2 within 12 weeks of incubation in a straw environment; about 20% of the lignin was converted to water-soluble fragments. Mn-peroxidase was found to be the predominant ligninolytic enzyme of all three fungi in liquid culture and its production was strongly enhanced in the presence of Mn2+ ions. The results of this study demonstrate that certain ubiquitous litter-decomposing basidiomycetes possess ligninolytic activities similar to the wood-decaying white-rot fungi, the most efficient lignin degraders in nature.

Genomic, Transcriptomic, and Proteomic Analysis Provide Insights Into the Cold Adaptation Mechanism of the Obligate Psychrophilic Fungus Mrakia psychrophila

Directory of Open Access Journals (Sweden)

Yao Su

2016-11-01

Full Text Available Mrakia psychrophila is an obligate psychrophilic fungus. The cold adaptation mechanism of psychrophilic fungi remains unknown. Comparative genomics analysis indicated that M. psychrophila had a specific codon usage preference, especially for codons of Gly and Arg and its major facilitator superfamily (MFS transporter gene family was expanded. Transcriptomic analysis revealed that genes involved in ribosome and energy metabolism were upregulated at 4°, while genes involved in unfolded protein binding, protein processing in the endoplasmic reticulum, proteasome, spliceosome, and mRNA surveillance were upregulated at 20°. In addition, genes related to unfolded protein binding were alternatively spliced. Consistent with other psychrophiles, desaturase and glycerol 3-phosphate dehydrogenase, which are involved in biosynthesis of unsaturated fatty acid and glycerol respectively, were upregulated at 4°. Cold adaptation of M. psychrophila is mediated by synthesizing unsaturated fatty acids to maintain membrane fluidity and accumulating glycerol as a cryoprotectant. The proteomic analysis indicated that the correlations between the dynamic patterns between transcript level changes and protein level changes for some pathways were positive at 4°, but negative at 20°. The death of M. psychrophila above 20° might be caused by an unfolded protein response.

Functional analysis of Steller’s sea cow (Hydrodamalis gigas) hemoglobin provides new insights to cold adaptation

DEFF Research Database (Denmark)

Signore, Anthony V.; Fago, Angela; Weber, Roy E.

sensitivity that can maintain adequate O2 delivery at low temperatures. This phenotype has primarily been attributed to the binding of additional allosteric effectors to the Hb moiety relative to those of non-cold adapted species. However, we find that Hb from the extinct Steller’s sea cow binds fewer...... paenungulate Hbs (woolly mammoth, Asian elephant, Steller’s sea cow, dugong, ancestral dugongid, and Florida manatee) in the presence of serially increasing Cl- and 2,3-diphosphoglycerate (DPG) concentrations at both 25 and 37C. Quantitation of effector binding revealed that the number of oxygenation...

Bioremediation of lignosulphonates by lignin-degrading basidiomycetous fungi.

Science.gov (United States)

Eugenio, M E; Carbajo, J M; Terrón, M C; González, A E; Villar, J C

2008-07-01

The capability of some ligninolytic fungi to degrade lignosulphonates has been studied. Three lignosulphonates concentrations, three culture media and seven different basidiomycetes in solid-cultures have been assayed to select the conditions for further experiments on submerged cultures. The best results of growth and lignosulphonate decolourization in solid-cultures were obtained with Pycnoporus sanguineus, Coriolus pubescens and Trametes sp. I-62 on Kirk's medium and 1% and 2% of lignosulphonate concentrations. In submerged cultures the lignosulphonate decolourization rate was generally higher when it was added on the 6th day, rather than when it was added from the beginning of the incubation and C. pubescens and P. sanguineus showed again the optimum results of decolourization. Extracellular laccase activity increased with lignosulphonate concentration in all assayed fungi, suggesting that lignosulphonate act as inductors of laccase activity.

Differential expression of carotenogenic genes, associated changes on astaxanthin production and photosynthesis features induced by JA in H. pluvialis.

Directory of Open Access Journals (Sweden)

Zhengquan Gao

Full Text Available Haematococcus pluvialis is an organism that under certain conditions can produce astaxanthin, an economically important carotenoid. In this study, the transcriptional expression patterns of eight carotenogenic genes of H. pluvialis in response to jasmonic acid (JA were evaluated using real-time PCR. Astaxanthin accumulation action and photosynthesis flourescence were monitored at the same time. The results showed all eight genes exhibited higher transcriptional expression significantly under JA treatments. JA25 (25 mg/L induction had greater effect (>10-fold up-regulation on the transcriptional expression of pds, crtR-B and lyc than on ipi-1, ipi-2, psy, bkt2, and crtO. JA50 (50 mg/L treatment had greater impact on the transcriptional expression of ipi-1, ipi-2, psy, crtR-B and crtO than on pds, lyc and bkt2. Astaxanthin biosynthesis in the presence of JA appeared to be up-regulated mainly by psy, pds, crtR-B, lyc, bkt2 and crtO at the transcriptional level and ipi-1, ipi-2 at both transcriptional and post-transcriptional levels. Under JA induction, the photosynthetic efficiency [Y (II] and the maximum quantum efficiency of PS II (Fv/Fm decreased significantly, but the non-photochemical quenching of chlorophyll fluorescence (NPQ increased drastically with the accumulation of astaxanthin.

Diversity and associations between Drosophilidae (Diptera species and Basidiomycetes in a Neotropical forest

Directory of Open Access Journals (Sweden)

FELIPE B. VALER

2016-01-01

Full Text Available ABSTRACT Drosophilidae is one of the most representative families of insects that occurs in fungal fruiting bodies of Basidiomycetes; however, the diversity and community structure of mycophagous Drosophilidae in the Neotropical region is poorly known. The aims of the present study were to describe the diversity of mycophagous Drosophilidae and to investigate its colonization of fungal hosts in a forest of southern Brazil. From 120 fungal samples (patches of mushrooms of 17 Basidiomycetes genera, flies were recorded emerging from 70 samples and collected in adult stages of 25 fungal samples, for a total of 4897 drosophilids belonging to 31 species and 5 genera. Drosophila Fallén was the most species-rich genus, whereas Hirtodrosophila Duda was the dominant genus. Studies performed in the Holarctic region indicate that mycophagous drosophilid have generalist habits; however, our results showed that most drosophilids use fewer than two fungal hosts, and most species of Hirtodrosophila and Leucophenga were restricted to abundant fungal species, suggesting a specialization for these resources. The most specialized fauna emerged from Auricularia, which was the most frequent fungal genus in our collection, and this result supports the assumption that specialization depends on the availability of fungal resources over time.

Differential stress-induced regulation of two quinone reductases in the brown rot Basidiomycete Gloeophyllum trabeum

Science.gov (United States)

Roni Cohen; Melissa R. Suzuki; Kenneth E. Hammel

2004-01-01

Quinone reductases (QRDs) have two important functions in the basidiomycete Gloeophyllum trabeum, which causes brown rot of wood. First, a QRD is required to generate biodegradative hydroxyl radicals via redox cycling between two G. trabeum extracellular metabolites, 2,5-dimethoxyhydroquinone (2,5-DMHQ) and 2,5-dimethoxy-1,4-benzoquinone (2,5- DMBQ). Second, because 2,...

ENDOGENOUS CYTOKININS IN MEDICINAL BASIDIOMYCETES MYCELIAL BIOMASS

Directory of Open Access Journals (Sweden)

N. P.

2016-02-01

Full Text Available The aim of the research was to study the cytokinins production by medicinal basidial mushrooms. Cytokinins were for the first time identified and quantified in mycelial biomass of six species (Ganoderma lucidum, Trametes versicolor, Fomitopsis officinalis, Pleurotus nebrodensis, Grifola frondosa, Sparassis crispa using HPLC. Trans- and cis-zeatin, zeatin riboside, zeatin-O-glucoside, isopentenyladenosine, isopentenyladenine were found but only one species (G. lucidum, strain 1900 contained all these substances. The greatest total cytokinin quantity was detected in F. officinalis, strain 5004. S. crispa, strain 314, and F. officinalis, strain 5004, mycelial biomass was revealed to have the highest level of cytokinin riboside forms (zeatin riboside and isopentenyladenosine. The possible connection between medicinal properties of investigated basidiomycetes and of cytokinins is discussed. S. crispa, strain 314, and F. officinalis, strain 5004, are regarded as promising species for developing biotechnological techniques to produce biologically active drugs from their mycelial biomass. As one of the potential technological approaches there is proposed fungal material drying.

Cold-Chain Adaptability During Introduction of Inactivated Polio Vaccine in Bangladesh, 2015.

Science.gov (United States)

Billah, Mallick M; Zaman, K; Estivariz, Concepcion F; Snider, Cynthia J; Anand, Abhijeet; Hampton, Lee M; Bari, Tajul I A; Russell, Kevin L; Chai, Shua J

2017-07-01

Introduction of inactivated polio vaccine creates challenges in maintaining the cold chain for vaccine storage and distribution. We evaluated the cold chain in 23 health facilities and 36 outreach vaccination sessions in 8 districts and cities of Bangladesh, using purposive sampling during August-October 2015. We interviewed immunization and cold-chain staff, assessed equipment, and recorded temperatures during vaccine storage and transportation. All health facilities had functioning refrigerators, and 96% had freezers. Temperature monitors were observed in all refrigerators and freezers but in only 14 of 66 vaccine transporters (21%). Recorders detected temperatures >8°C for >60 minutes in 5 of 23 refrigerators (22%), 3 of 6 cold boxes (50%) transporting vaccines from national to subnational depots, and 8 of 48 vaccine carriers (17%) used in outreach vaccination sites. Temperatures cold boxes (21%) transporting vaccine from subnational depots to health facilities and 14 of 48 vaccine carriers (29%). Bangladesh has substantial cold-chain storage and transportation capacity after inactivated polio vaccine introduction, but temperature fluctuations during vaccine transport could cause vaccine potency loss that could go undetected. Bangladesh and other countries should strive to ensure consistent and sufficient cold-chain storage and monitor the cold chain during vaccine transportation at all levels. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

Adaptation to seasonality and the winter freeze

Directory of Open Access Journals (Sweden)

Jill Christine Preston

2013-06-01

Full Text Available Flowering plants initially diversified during the Mesozoic era at least 140 million years ago in regions of the world where temperate seasonal environments were not encountered. Since then several cooling events resulted in the contraction of warm and wet environments and the establishment of novel temperate zones in both hemispheres. In response, less than half of modern angiosperm families have members that evolved specific adaptations to cold seasonal climates, including cold acclimation, freezing tolerance, endodormancy, and vernalization responsiveness. Despite compelling evidence for multiple independent origins, the level of genetic constraint on the evolution of adaptations to seasonal cold is not well understood. However, the recent increase in molecular genetic studies examining the response of model and crop species to seasonal cold offers new insight into the evolutionary lability of these traits. This insight has major implications for our understanding of complex trait evolution, and the potential role of local adaptation in response to past and future climate change. In this review, we discuss the biochemical, morphological, and developmental basis of adaptations to seasonal cold, and synthesize recent literature on the genetic basis of these traits in a phylogenomic context. We find evidence for multiple genetic links between distinct physiological responses to cold, possibly reinforcing the coordinated expression of these traits. Furthermore, repeated recruitment of the same or similar ancestral pathways suggests that land plants might be somewhat pre-adapted to dealing with temperature stress, perhaps making inducible cold traits relatively easy to evolve.

Development of an Agrobacterium-mediated transformation system for the cold-adapted fungi Pseudogymnoascus destructans and P. pannorum.

Science.gov (United States)

Zhang, Tao; Ren, Ping; Chaturvedi, Vishnu; Chaturvedi, Sudha

2015-08-01

The mechanisms of cold adaptation by fungi remain unknown. This topic is of high interest due to the emergence of white-nose syndrome (WNS), a skin infection of hibernating bats caused by Pseudogymnoascus destructans (Pd). Recent studies indicated that apart from Pd, there is an abundance of other Pseudogymnoascus species in the hibernacula soil. We developed an Agrobacterium tumefaciens-mediated transformation (ATMT) system for Pd and a related fungus Pseudogymnoascus pannorum (Pp) to advance experimental studies. URE1 gene encoding the enzyme urease was used as an easy to screen marker to facilitate molecular genetic analyses. A Uracil-Specific Excision Reagent (USER) Friendly pRF-HU2 vector containing Pd or Pp ure1::hygromycin (HYG) disruption cassette was introduced into A. tumefaciens AGL-1 cells by electroporation and the resulting strains were co-cultivated with conidia of Pd or Pp for various durations and temperatures to optimize the ATMT system. Overall, 680 Pd (0.006%) and 1800 Pp (0.018%) transformants were obtained from plating of 10(7) conidia; their recoveries were strongly correlated with the length of the incubation period (96h for Pd; 72h for Pp) and with temperature (15-18°C for Pd; 25°C for Pp). The homologous recombination in transformants was 3.1% for Pd and 16.7% for Pp. The availability of a standardized ATMT system would allow future molecular genetic analyses of Pd and related cold-adapted fungi. Copyright © 2015. Published by Elsevier Inc.

Adaption of the LHC cold mass cooling system to the requirements of the Future Circular Collider (FCC)

Science.gov (United States)

Kotnig, C.; Tavian, L.; Brenn, G.

2017-12-01

The cooling of the superconducting magnet cold masses with superfluid helium (He II) is a well-established concept successfully in operation for years in the LHC. Consequently, its application for the cooling of FCC magnets is an obvious option. The 12-kW heat loads distributed over 10-km long sectors not only require an adaption of the magnet bayonet heat exchangers but also present new challenges to the cryogenic plants, the distribution system and the control strategy. This paper recalls the basic LHC cooling concept with superfluid helium and defines the main parameters for the adaption to the FCC requirements. Pressure drop and hydrostatic head are developed in the distribution and pumping systems; their impact on the magnet temperature profile and the corresponding cooling efficiency is presented and compared for different distribution and pumping schemes.

Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white-rot/brown-rot paradigm for wood decay fungi

Science.gov (United States)

Fungi of the phylum Basidiomycota (basidiomycetes) make up some 37% of the described fungi and are important in forestry, agriculture, medicine, and bioenergy. This diverse phylum includes symbionts, pathogens, and saprotrophs including the majority of wood decaying and ectomycorrhizal species. To b...

Expert Cold Structure Development

Science.gov (United States)

Atkins, T.; Demuysere, P.

2011-05-01

The EXPERT Program is funded by ESA. The objective of the EXPERT mission is to perform a sub-orbital flight during which measurements of critical aero- thermodynamic phenomena will be obtained by using state-of-the-art instrumentation. As part of the EXPERT Flight Segment, the responsibility of the Cold Structure Development Design, Manufacturing and Validation was committed to the Belgian industrial team SONACA/SABCA. The EXPERT Cold Structure includes the Launcher Adapter, the Bottom Panel, the Upper Panel, two Cross Panels and the Parachute Bay. An additional Launcher Adapter was manufactured for the separation tests. The selected assembly definition and manufacturing technologies ( machined parts and sandwich panels) were dictated classically by the mass and stiffness, but also by the CoG location and the sensitive separation interface. Used as support for the various on-board equipment, the Cold Structure is fixed to but thermally uncoupled from the PM 1000 thermal shield. It is protect on its bottom panel by a thermal blanket. As it is a protoflight, analysis was the main tool for the verification. Low level stiffness and modal analysis tests have also been performed on the Cold Structure equipped with its ballast. It allowed to complete its qualification and to prepare SONACA/SABCA support for the system dynamic tests foreseen in 2011. The structure was finally coated with a thermal control black painting and delivered on time to Thales Alenia Space-Italy end of March 201.

Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

Energy Technology Data Exchange (ETDEWEB)

Nakamura, Tomofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Fukuoka Institute of Health and Environmental Sciences, 39 Mukaizano, Dazaifu-shi, Fukuoka 818-0135 (Japan); Ichinose, Hirofumi [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Wariishi, Hiroyuki, E-mail: hirowari@agr.kyushu-u.ac.jp [Faculty of Agriculture, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Bio-Architecture Center, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

2010-04-09

We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD{sup +}-binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

Cloning and heterologous expression of two aryl-aldehyde dehydrogenases from the white-rot basidiomycete Phanerochaete chrysosporium

International Nuclear Information System (INIS)

Nakamura, Tomofumi; Ichinose, Hirofumi; Wariishi, Hiroyuki

2010-01-01

We identified two aryl-aldehyde dehydrogenase proteins (PcALDH1 and PcALDH2) from the white-rot basidiomycete Phanerochaete chrysosporium. Both PcALDHs were translationally up-regulated in response to exogenous addition of vanillin, one of the key aromatic compounds in the pathway of lignin degradation by basidiomycetes. To clarify the catalytic functions of PcALDHs, we isolated full-length cDNAs encoding these proteins and heterologously expressed the recombinant enzymes using a pET/Escherichia coli system. The open reading frames of both PcALDH1 and PcALDH2 consisted of 1503 nucleotides. The deduced amino acid sequences of both proteins showed high homologies with aryl-aldehyde dehydrogenases from other organisms and contained ten conserved domains of ALDHs. Moreover, a novel glycine-rich motif 'GxGxxxG' was located at the NAD + -binding site. The recombinant PcALDHs catalyzed dehydrogenation reactions of several aryl-aldehyde compounds, including vanillin, to their corresponding aromatic acids. These results strongly suggested that PcALDHs metabolize aryl-aldehyde compounds generated during fungal degradation of lignin and various aromatic xenobiotics.

Comparison of the Diversity of Basidiomycetes from Dead Wood of the Manchurian fir (Abies holophylla) as Evaluated by Fruiting Body Collection, Mycelial Isolation, and 454 Sequencing.

Science.gov (United States)

Jang, Yeongseon; Jang, Seokyoon; Min, Mihee; Hong, Joo-Hyun; Lee, Hanbyul; Lee, Hwanhwi; Lim, Young Woon; Kim, Jae-Jin

2015-10-01

In this study, three different methods (fruiting body collection, mycelial isolation, and 454 sequencing) were implemented to determine the diversity of wood-inhabiting basidiomycetes from dead Manchurian fir (Abies holophylla). The three methods recovered similar species richness (26 species from fruiting bodies, 32 species from mycelia, and 32 species from 454 sequencing), but Fisher's alpha, Shannon-Wiener, Simpson's diversity indices of fungal communities indicated fruiting body collection and mycelial isolation displayed higher diversity compared with 454 sequencing. In total, 75 wood-inhabiting basidiomycetes were detected. The most frequently observed species were Heterobasidion orientale (fruiting body collection), Bjerkandera adusta (mycelial isolation), and Trichaptum fusco-violaceum (454 sequencing). Only two species, Hymenochaete yasudae and Hypochnicium karstenii, were detected by all three methods. This result indicated that Manchurian fir harbors a diverse basidiomycetous fungal community and for complete estimation of fungal diversity, multiple methods should be used. Further studies are required to understand their ecology in the context of forest ecosystems.

Extensive sampling of basidiomycete genomes demonstrates inadequacy of the white rot/ brown rot paradigm for wood decay fungi

Energy Technology Data Exchange (ETDEWEB)

Riley, Robert; Salamov, Asaf; Brown, Daren W.; Nagy, Laszlo G.; Floudas, Dimitris; Held, Benjamin; Levasseur, Anthony; Lombard, Vincent; Morin, Emmanuelle; Otillar, Robert; Lindquist, Erika; Sun, Hui; LaButti, Kurt; Schmutz, Jeremy; Jabbour, Dina; Luo, Hong; Baker, Scott E.; Pisabarro, Antonio; Walton, Jonathan D.; Blanchette, Robert; Henrissat, Bernard; Martin, Francis; Cullen, Dan; Hibbett, David; Grigoriev, Igor V.

2014-03-14

Basidiomycota (basidiomycetes) make up 32percent of the described fungi and include most wood decaying species, as well as pathogens and mutualistic symbionts. Wood-decaying basidiomycetes have typically been classified as either white rot or brown rot, based on the ability (in white rot only) to degrade lignin along with cellulose and hemicellulose. Prior genomic comparisons suggested that the two decay modes can be distinguished based on the presence or absence of ligninolytic class II peroxidases (PODs), as well as the abundance of enzymes acting directly on crystalline cellulose (reduced in brown rot). To assess the generality of the white rot/brown rot classification paradigm we compared the genomes of 33 basidiomycetes, including four newly sequenced wood decayers, and performed phylogenetically-informed Principal Components Analysis (PCA) of a broad range of gene families encoding plant biomass-degrading enzymes. The newly sequenced Botryobasidium botryosum and Jaapia argillacea genomes lack PODs, but possess diverse enzymes acting on crystalline cellulose, and they group close to the model white rot species Phanerochaete chrysosporium in the PCA. Furthermore, laboratory assays showed that both B. botryosum and J. argillacea can degrade all polymeric components of woody plant cell walls, a characteristic of white rot. We also found expansions in reducing polyketide synthase genes specific to the brown rot fungi. Our results suggest a continuum rather than a dichotomy between the white rot and brown rot modes of wood decay. A more nuanced categorization of rot types is needed, based on an improved understanding of the genomics and biochemistry of wood decay.

The Role of Epibionts of Bacteria of the Genus Pseudoalteromonas and Cellular Proteasomes in the Adaptive Plasticity of Marine Cold-Water Sponges.

Science.gov (United States)

Kravchuk, O I; Lavrov, A I; Finoshin, A D; Gornostaev, N G; Georgiev, A A; Abaturova, S B; Mikhailov, V S; Lyupina, Yu V

2018-03-01

It was found that cells of different color morphs of the cold-water marine sponges Halichondria panicea (Pallas, 1766) of the class Demospongiae differ in the content of epibionts of bacteria of the genus Pseudoalteromonas. The sponge cells with elevated levels of epibionts of bacteria of the genus Pseudoalteromonas showed an increased expression of Hsp70 proteins but had a reduced level of the proteasomal catalytic beta 5 subunit, which was accompanied by a change in their activity. Probably, epibionts of bacteria of the genus Pseudoalteromonas may affect the ubiquitin-proteasome system in the cells of cold-water marine sponges and, thereby, ensure their adaptive plasticity.

Gamma-ray induced delay of fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum

International Nuclear Information System (INIS)

Takimoto, K.

1980-01-01

The effect of gamma-radiation on fruiting body initiation in a basidiomycete, Hebeloma vinosophyllum, was investigated. Fruiting of this fungus is induced by visible light, but irradiation of the mycelium before or after light treatment delayed fruiting body initiation. The time required for fruiting body initiation increased with the radiation dose. The induction of fruiting bodies had two gamma-radiation sensitive stages, one immediately before fruiting body initiation and the other 15 to 20 h after the start of photoinduction. (author)

Examination of food chain-derived Listeria monocytogenes strains of different serotypes reveals considerable diversity in inlA genotypes, mutability, and adaptation to cold temperatures.

Science.gov (United States)

Kovacevic, Jovana; Arguedas-Villa, Carolina; Wozniak, Anna; Tasara, Taurai; Allen, Kevin J

2013-03-01

Listeria monocytogenes strains belonging to serotypes 1/2a and 4b are frequently linked to listeriosis. While inlA mutations leading to premature stop codons (PMSCs) and attenuated virulence are common in 1/2a, they are rare in serotype 4b. We observed PMSCs in 35% of L. monocytogenes isolates (n = 54) recovered from the British Columbia food supply, including serotypes 1/2a (30%), 1/2c (100%), and 3a (100%), and a 3-codon deletion (amino acid positions 738 to 740) seen in 57% of 4b isolates from fish-processing facilities. Caco-2 invasion assays showed that two isolates with the deletion were significantly more invasive than EGD-SmR (P cold temperature following a downshift from 37°C to 4°C. Overall, three distinct cold-adapting groups (CAG) were observed: 46% were fast (200 h) adaptors. Intermediate CAG strains (70%) more frequently possessed inlA PMSCs than did fast (20%) and slow (10%) CAGs; in contrast, 87% of fast adaptors lacked inlA PMSCs. In conclusion, we report food chain-derived 1/2a and 4b serotypes with a 3-codon deletion possessing invasive behavior and the novel association of inlA genotypes encoding a full-length InlA with fast cold-adaptation phenotypes.

Effect of long-term preservation of basidiomycetes on perlite in liquid nitrogen on their growth, morphological, enzymatic and genetic Characteristics

Czech Academy of Sciences Publication Activity Database

Homolka, Ladislav; Lisá, Ludmila; Eichlerová, Ivana; Valášková, Vendula; Baldrian, Petr

2010-01-01

Roč. 114, 11-12 (2010), s. 929-935 ISSN 1878-6146 R&D Projects: GA MŠk LC06066 Institutional research plan: CEZ:AV0Z50200510 Keywords : Basidiomycetes * Cryopreservation * Enzymes Subject RIV: EE - Microbiology, Virology

The Genome of the Basidiomycetous Yeast and Human Pathogen Cryptococcus neoformans

Science.gov (United States)

Loftus, Brendan J.; Fung, Eula; Roncaglia, Paola; Rowley, Don; Amedeo, Paolo; Bruno, Dan; Vamathevan, Jessica; Miranda, Molly; Anderson, Iain J.; Fraser, James A.; Allen, Jonathan E.; Bosdet, Ian E.; Brent, Michael R.; Chiu, Readman; Doering, Tamara L.; Donlin, Maureen J.; D’Souza, Cletus A.; Fox, Deborah S.; Grinberg, Viktoriya; Fu, Jianmin; Fukushima, Marilyn; Haas, Brian J.; Huang, James C.; Janbon, Guilhem; Jones, Steven J. M.; Koo, Hean L.; Krzywinski, Martin I.; Kwon-Chung, June K.; Lengeler, Klaus B.; Maiti, Rama; Marra, Marco A.; Marra, Robert E.; Mathewson, Carrie A.; Mitchell, Thomas G.; Pertea, Mihaela; Riggs, Florenta R.; Salzberg, Steven L.; Schein, Jacqueline E.; Shvartsbeyn, Alla; Shin, Heesun; Shumway, Martin; Specht, Charles A.; Suh, Bernard B.; Tenney, Aaron; Utterback, Terry R.; Wickes, Brian L.; Wortman, Jennifer R.; Wye, Natasja H.; Kronstad, James W.; Lodge, Jennifer K.; Heitman, Joseph; Davis, Ronald W.; Fraser, Claire M.; Hyman, Richard W.

2012-01-01

Cryptococcus neoformans is a basidiomycetous yeast ubiquitous in the environment, a model for fungal pathogenesis, and an opportunistic human pathogen of global importance. We have sequenced its ~20-megabase genome, which contains ~6500 intron-rich gene structures and encodes a transcriptome abundant in alternatively spliced and antisense messages. The genome is rich in transposons, many of which cluster at candidate centromeric regions. The presence of these transposons may drive karyotype instability and phenotypic variation. C. neoformans encodes unique genes that may contribute to its unusual virulence properties, and comparison of two phenotypically distinct strains reveals variation in gene content in addition to sequence polymorphisms between the genomes. PMID:15653466

Cold temperatures increase cold hardiness in the next generation Ophraella communa beetles.

Directory of Open Access Journals (Sweden)

Zhong-Shi Zhou

Full Text Available The leaf beetle, Ophraella communa, has been introduced to control the spread of the common ragweed, Ambrosia artemisiifolia, in China. We hypothesized that the beetle, to be able to track host-range expansion into colder climates, can phenotypically adapt to cold temperatures across generations. Therefore, we questioned whether parental experience of colder temperatures increases cold tolerance of the progeny. Specifically, we studied the demography, including development, fecundity, and survival, as well as physiological traits, including supercooling point (SCP, water content, and glycerol content of O. communa progeny whose parents were maintained at different temperature regimes. Overall, the entire immature stage decreased survival of about 0.2%-4.2% when parents experienced cold temperatures compared to control individuals obtained from parents raised at room temperature. However, intrinsic capacity for increase (r, net reproductive rate (R 0 and finite rate of increase (λ of progeny O. communa were maximum when parents experienced cold temperatures. Glycerol contents of both female and male in progeny was significantly higher when maternal and paternal adults were cold acclimated as compared to other treatments. This resulted in the supercooling point of the progeny adults being significantly lower compared to beetles emerging from parents that experienced room temperatures. These results suggest that cold hardiness of O. communa can be promoted by cold acclimation in previous generation, and it might counter-balance reduced survival in the next generation, especially when insects are tracking their host-plants into colder climates.

Metabolites from nematophagous fungi and nematicidal natural products from fungi as alternatives for biological control. Part II: metabolites from nematophagous basidiomycetes and non-nematophagous fungi.

Science.gov (United States)

Degenkolb, Thomas; Vilcinskas, Andreas

2016-05-01

In this second section of a two-part mini-review article, we introduce 101 further nematicidal and non-nematicidal secondary metabolites biosynthesized by nematophagous basidiomycetes or non-nematophagous ascomycetes and basidiomycetes. Several of these compounds have promising nematicidal activity and deserve further and more detailed analysis. Thermolides A and B, omphalotins, ophiobolins, bursaphelocides A and B, illinitone A, pseudohalonectrins A and B, dichomitin B, and caryopsomycins A-C are excellent candidates or lead compounds for the development of biocontrol strategies for phytopathogenic nematodes. Paraherquamides, clonostachydiol, and nafuredins offer promising leads for the development of formulations against the intestinal nematodes of ruminants.

Rational Engineering of a Cold-Adapted α-Amylase from the Antarctic Ciliate Euplotes focardii for Simultaneous Improvement of Thermostability and Catalytic Activity.

Science.gov (United States)

Yang, Guang; Yao, Hua; Mozzicafreddo, Matteo; Ballarini, Patrizia; Pucciarelli, Sandra; Miceli, Cristina

2017-07-01

The α-amylases are endo-acting enzymes that hydrolyze starch by randomly cleaving the 1,4-α-d-glucosidic linkages between the adjacent glucose units in a linear amylose chain. They have significant advantages in a wide range of applications, particularly in the food industry. The eukaryotic α-amylase isolated from the Antarctic ciliated protozoon Euplotes focardii ( Ef Amy) is an alkaline enzyme, different from most of the α-amylases characterized so far. Furthermore, Ef Amy has the characteristics of a psychrophilic α-amylase, such as the highest hydrolytic activity at a low temperature and high thermolability, which is the major drawback of cold-active enzymes in industrial applications. In this work, we applied site-directed mutagenesis combined with rational design to generate a cold-active Ef Amy with improved thermostability and catalytic efficiency at low temperatures. We engineered two Ef Amy mutants. In one mutant, we introduced Pro residues on the A and B domains in surface loops. In the second mutant, we changed Val residues to Thr close to the catalytic site. The aim of these substitutions was to rigidify the molecular structure of the enzyme. Furthermore, we also analyzed mutants containing these combined substitutions. Biochemical enzymatic assays of engineered versions of Ef Amy revealed that the combination of mutations at the surface loops increased the thermostability and catalytic efficiency of the enzyme. The possible mechanisms responsible for the changes in the biochemical properties are discussed by analyzing the three-dimensional structural model. IMPORTANCE Cold-adapted enzymes have high specific activity at low and moderate temperatures, a property that can be extremely useful in various applications as it implies a reduction in energy consumption during the catalyzed reaction. However, the concurrent high thermolability of cold-adapted enzymes often limits their applications in industrial processes. The α-amylase from the

Adaptation of model proteins from cold to hot environments involves continuous and small adjustments of average parameters related to amino acid composition.

Science.gov (United States)

De Vendittis, Emmanuele; Castellano, Immacolata; Cotugno, Roberta; Ruocco, Maria Rosaria; Raimo, Gennaro; Masullo, Mariorosario

2008-01-07

The growth temperature adaptation of six model proteins has been studied in 42 microorganisms belonging to eubacterial and archaeal kingdoms, covering optimum growth temperatures from 7 to 103 degrees C. The selected proteins include three elongation factors involved in translation, the enzymes glyceraldehyde-3-phosphate dehydrogenase and superoxide dismutase, the cell division protein FtsZ. The common strategy of protein adaptation from cold to hot environments implies the occurrence of small changes in the amino acid composition, without altering the overall structure of the macromolecule. These continuous adjustments were investigated through parameters related to the amino acid composition of each protein. The average value per residue of mass, volume and accessible surface area allowed an evaluation of the usage of bulky residues, whereas the average hydrophobicity reflected that of hydrophobic residues. The specific proportion of bulky and hydrophobic residues in each protein almost linearly increased with the temperature of the host microorganism. This finding agrees with the structural and functional properties exhibited by proteins in differently adapted sources, thus explaining the great compactness or the high flexibility exhibited by (hyper)thermophilic or psychrophilic proteins, respectively. Indeed, heat-adapted proteins incline toward the usage of heavier-size and more hydrophobic residues with respect to mesophiles, whereas the cold-adapted macromolecules show the opposite behavior with a certain preference for smaller-size and less hydrophobic residues. An investigation on the different increase of bulky residues along with the growth temperature observed in the six model proteins suggests the relevance of the possible different role and/or structure organization played by protein domains. The significance of the linear correlations between growth temperature and parameters related to the amino acid composition improved when the analysis was

SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

Directory of Open Access Journals (Sweden)

A. K. Veligodska

2015-11-01

Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

BASIDIOMYCETE-BASED METHOD FOR BIOCONTROL OF PHYTOPATHOGENIC NEMATODES

Directory of Open Access Journals (Sweden)

Tiberius BALAEŞ

2015-12-01

Full Text Available Phytopathogenic nematodes represent one of the most important groups of pathogens in crops. The use of chemical to control the nematodes attack in crops is decreasing every year due to the concern of the toxicity and side effects of such compounds. In the course for finding alternatives to the use of chemicals, biological control of nematodes is gaining much attention. Some saprotrophic fungi are able to feed on invertebrates, thus becoming efficient agents of control. In this study, three species of basidiomycetes were analyzed for their potential to be used as control agents of phytopathogenic nematodes. Through on in vitro investigation of these potential, one strain – Gymnopilus junonius was further selected for a pot test against Meloidogyne incognita, a very important phytopathogenic species of nematodes. The fungal treatment strongly decreased the M. incognita population on the tested pots, proving the potential of G. junonius strain to be used in biocontrol.

Purification and characterization of cold-adapted beta-agarase from an Antarctic psychrophilic strain

Directory of Open Access Journals (Sweden)

Jiang Li

2015-09-01

Full Text Available An extracellular β-agarase was purified from Pseudoalteromonas sp. NJ21, a Psychrophilic agar-degrading bacterium isolated from Antarctic Prydz Bay sediments. The purified agarase (Aga21 revealed a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, with an apparent molecular weight of 80 kDa. The optimum pH and temperature of the agarase were 8.0 and 30 °C, respectively. However, it maintained as much as 85% of the maximum activities at 10 °C. Significant activation of the agarase was observed in the presence of Mg2+, Mn2+, K+; Ca2+, Na+, Ba2+, Zn2+, Cu2+, Co2+, Fe2+, Sr2+ and EDTA inhibited the enzyme activity. The enzymatic hydrolyzed product of agar was characterized as neoagarobiose. Furthermore, this work is the first evidence of cold-adapted agarase in Antarctic psychrophilic bacteria and these results indicate the potential for the Antarctic agarase as a catalyst in medicine, food and cosmetic industries.

Novel root-fungus symbiosis in Ericaceae: sheathed ericoid mycorrhiza formed by a hitherto undescribed basidiomycete with affinities to Trechisporales

Czech Academy of Sciences Publication Activity Database

Vohník, Martin; Sadowsky, J. J.; Kohout, Petr; Lhotáková, Z.; Nestby, R.; Kolařík, Miroslav

2012-01-01

Roč. 7, č. 6 (2012), e39524 E-ISSN 1932-6203 R&D Projects: GA ČR GP206/09/P340 Institutional support: RVO:67985939 ; RVO:61388971 Keywords : ericoid mycorrhiza * Ericaceae * Basidiomycetes Subject RIV: EF - Botanics; EE - Microbiology, Virology (MBU-M) Impact factor: 3.730, year: 2012

Implementation of Optical Meanders in the Temperature Measurement of the Extermination of Basidiomycete Serpula Lacrymans Using Microwave Heating

Directory of Open Access Journals (Sweden)

Andrej Liner

2013-01-01

Full Text Available The dry rot basidiomycete Serpula lacrymans is the most common and destructive wood decay fungus, which attacks and damages houses and other wooden construction worldwide [1], [2]. Effective chemicals have been developed for remediation and treatment of dry rot outbreaks and for wood preservation against dry rot, but in most cases, control is most economically achieved by environmental management to avoid creating favourable growth conditions for the fungus [3]. Thermal treatment using microwaves represents one of possible approaches in fungal growth control and refurbishment of damaged wooden constructions. One of the possibilities, how to monitor this whole process seems to be the use of Optical fiber DTS (Distribution Temperature Systems. The Optical fiber DTS are unique distributed temperature systems using optical fiber as a sensor. Due to the electromagnetic resistance is this system suitable for the monitoring of these processes. This article deals with application of optical meanders in the temperature measurement during the extermination of basidiomycete Serpula lacrymans using microwave heating. Because of the adverse effect of microwave radiation on all other types of temperature sensors.

A comparative study of cold- and warm-adapted Endonucleases A using sequence analyses and molecular dynamics simulations.

Directory of Open Access Journals (Sweden)

Davide Michetti

Full Text Available The psychrophilic and mesophilic endonucleases A (EndA from Aliivibrio salmonicida (VsEndA and Vibrio cholera (VcEndA have been studied experimentally in terms of the biophysical properties related to thermal adaptation. The analyses of their static X-ray structures was no sufficient to rationalize the determinants of their adaptive traits at the molecular level. Thus, we used Molecular Dynamics (MD simulations to compare the two proteins and unveil their structural and dynamical differences. Our simulations did not show a substantial increase in flexibility in the cold-adapted variant on the nanosecond time scale. The only exception is a more rigid C-terminal region in VcEndA, which is ascribable to a cluster of electrostatic interactions and hydrogen bonds, as also supported by MD simulations of the VsEndA mutant variant where the cluster of interactions was introduced. Moreover, we identified three additional amino acidic substitutions through multiple sequence alignment and the analyses of MD-based protein structure networks. In particular, T120V occurs in the proximity of the catalytic residue H80 and alters the interaction with the residue Y43, which belongs to the second coordination sphere of the Mg2+ ion. This makes T120V an amenable candidate for future experimental mutagenesis.

Parasitic macrofungi (Basidiomycetes on fruit shrubs and trees in the Tarnów town (S Poland

Directory of Open Access Journals (Sweden)

Marcin Piątek

2014-08-01

Full Text Available Results of 6 years of research carried out in the Tarnów town, southern Poland, are presented. Total number of 27 species of Basidiomycetes were recorded on 7 species of fruit shrubs and trees. Some of them were found on hosts new for Poland, on Malus domestica - Abortiporus biennis, Ganoderma australe, Meripilus giganteus, Stereum hirsutum and Volvariella bombycina; on Juglans regia - Ganoderma applanalum and Hineola auricula-judae.

DNA quantification of basidiomycetous fungi during storage of logging residues

Directory of Open Access Journals (Sweden)

Isabella Børja

2015-04-01

Full Text Available The demand for bioenergy caused an increased use of logging residues, branches and treetops that were previously left on the ground after harvesting. Residues are stored outdoors in piles and it is unclear to what extent fungi transform this material. Our objective was to quantify the amount of wood degrading fungi during storage using quantitative real-time PCR (qPCR to detect basidiomycetous DNA in logging residues, a novel approach in this field. We found that the qPCR method was accurate in quantifying the fungal DNA during storage. As the moisture content of the piled logging residues decreased during the storage period, the fungal DNA content also decreased. Scots pine residues contained more fungal DNA than residues from Norway spruce. Loose piles had generally more fungal DNA than bundled ones.

Cloning, expression and characterization of a cold-adapted endo-1, 4-β-glucanase from Citrobacter farmeri A1, a symbiotic bacterium of Reticulitermes labralis

Directory of Open Access Journals (Sweden)

Xi Bai

2016-11-01

Full Text Available Background Many biotechnological and industrial applications can benefit from cold-adapted EglCs through increased efficiency of catalytic processes at low temperature. In our previous study, Citrobacter farmeri A1 which was isolated from a wood-inhabiting termite Reticulitermes labralis could secrete a cold-adapted EglC. However, its EglC was difficult to purify for enzymatic properties detection because of its low activity (0.8 U/ml. The objective of the present study was to clone and express the C. farmeri EglC gene in Escherichia coli to improve production level and determine the enzymatic properties of the recombinant enzyme. Methods The EglC gene was cloned from C. farmeri A1 by thermal asymmetric interlaced PCR. EglC was transformed into vector pET22b and functionally expressed in E. coli. The recombination protein EglC22b was purified for properties detection. Results SDS-PAGE revealed that the molecular mass of the recombinant endoglucanase was approximately 42 kDa. The activity of the E. coli pET22b-EglC crude extract was 9.5 U/ml. Additionally, it was active at pH 6.5–8.0 with an optimum pH of 7.0. The recombinant enzyme had an optimal temperature of 30–40 °C and exhibited >50% relative activity even at 5 °C, whereas it lost approximately 90% of its activity after incubation at 60 °C for 30 min. Its activity was enhanced by Co2+ and Fe3+, but inhibited by Cd2+, Zn2+, Li+, Triton X-100, DMSO, acetonitrile, Tween 80, SDS, and EDTA. Conclusion These biochemical properties indicate that the recombinant enzyme is a cold-adapted endoglucanase that can be used for various industrial applications.

Mild cold induced thermogenesis: are BAT and skeletal muscle synergistic partners?

Science.gov (United States)

Bal, Naresh C; Maurya, Santosh K; Pani, Sunil; Sethy, Chinmayee; Banerjee, Ananya; Das, Sarita; Patnaik, Srinivas; Kundu, Chanakya N

2017-10-31

There are two well-described thermogenic sites; brown adipose tissue (BAT) and skeletal muscle, which utilize distinct mechanisms of heat production. In BAT, mitochondrial metabolism is the molecular basis of heat generation, while it serves only a secondary role in supplying energy for thermogenesis in muscle. Here, we wanted to document changes in mitochondrial ultrastructure in these two tissue types based upon adaptation to mild (16°C) and severe (4°C) cold in mice. When reared at thermoneutrality (29°C), mitochondria in both tissues were loosely packed with irregular cristae. Interestingly, adaptation to even mild cold initiated ultrastructural remodeling of mitochondria including acquisition of more elaborate cristae structure in both thermogenic sites. The shape of mitochondria in the BAT remained mostly circular, whereas the intermyofibrilar mitochondria in the skeletal muscle became more elongated and tubular. The most dramatic remodeling of mitochondrial architecture was observed upon adaptation to severe cold. In addition, we report cold-induced alteration in levels of humoral factors: fibroblast growth factor 21 (FGF21), IL1α, peptide YY (PYY), tumor necrosis factor α (TNFα), and interleukin 6 (IL6) were all induced whereas both insulin and leptin were down-regulated. In summary, adaptation to cold leads to enhanced cristae formation in mitochondria in skeletal muscle as well as the BAT. Further, the present study indicates that circulating cytokines might play an important role in the synergistic recruitment of the thermogenic program including cross-talk between muscle and BAT. © 2017 The Author(s).

Cold stress and immunity: Do chickens adapt to cold by trading-off immunity for thermoregulation?

NARCIS (Netherlands)

Hangalapura, B.N.

2006-01-01

Future animal husbandry aims at enhanced animal welfare, with minimal use of preventive medical treatments. These husbandry conditions will resemble more natural or ecological conditions. Under such farming systems, animals will experience various kinds of stressors such as environmental (e.g. cold,

Arabidopsis COLD SHOCK DOMAIN PROTEIN2 is a RNA chaperone that is regulated by cold and developmental signals

International Nuclear Information System (INIS)

Sasaki, Kentaro; Kim, Myung-Hee; Imai, Ryozo

2007-01-01

Bacterial cold shock proteins (CSPs) are RNA chaperones that unwind RNA secondary structures. Arabidopsis COLD SHOCK DOMAIN PROTEIN2 (AtCSP2) contains a domain that is shared with bacterial CSPs. Here we showed that AtCSP2 binds to RNA and unwinds nucleic acid duplex. Heterologous expression of AtCSP2 complemented cold sensitivity of an Escherichia coli csp quadruple mutant, indicating that AtCSP2 function as a RNA chaperone in E. coli. AtCSP2 mRNA and protein levels increased during cold acclimation, but the protein accumulation was most prominent after 10 days of cold treatment. AtCSP2 promoter::GUS transgenic plants revealed that AtCSP2 is expressed only in root and shoot apical regions during vegetative growth but is expressed in reproductive organs such as pollens, ovules and embryos. These data indicated that AtCSP2 is involved in developmental processes as well as cold adaptation. Localization of AtCSP2::GFP in nucleolus and cytoplasm suggested different nuclear and cytosolic RNA targets

Thermoregulation and thermal perception in the cold and heat before and after intermittent heat adaptation

Science.gov (United States)

Issing, K.; Fuhr, E.

1986-09-01

Students wearing swim suits were exposed for 30 min to neutral room temperature (TR=28‡C). During the following 60 min they were subjected to gradual decreases or increases of room temperature reaching 12‡C or 45‡C, respectively. Static thermal stimuli were applied to the palms of the right (38‡C) and left (25‡C) hands. Hands and feet of all subjects were thermally isolated at 22‡C ambient temperature. General thermal comfort (GTC), local thermal comfort (LTC), skin blood flow (which is proportional to heat transport index λ) several body temperatures, oxygen-consumption(dot V_{O_2 } ), and sweat rate (S), were measured. After moderate intermittent heat exposures (7 times for 1h at TR=42.5‡C) the experiments started again. From GTC, LTC, or λ as functions of TR, no new knowledge about thermoregulatory or adaptive mechanisms was available. The high λ in the cold stimulated left hand, however, and the oscillatory thresholds (λOSC) for rhythmic vasomotion indicated the peripheral influence of skin temperature, as well as local, mean skin temperature (¯Ts) and core temperature. When exposed to moderate temperature decreases or increases the body seems to react only with increasing thermal resistance by vasoconstriction or an increase of sweat rate, respectively. Moderate heat adaptation is only able to raise sweat rate, but not the thresholds and gain of the S-function. We assume that functional studies of adaptive modifications in humans must be conducted at temperatures greatly beyond those used in these experiments.

Cold-water immersion after training sessions: Effects on fiber type-specific adaptations in muscle K+ transport proteins to sprint-interval training in men.

Science.gov (United States)

Christiansen, Danny; Bishop, David John; Broatch, James R; Bangsbo, Jens; McKenna, Michael John; Murphy, Robyn M

2018-05-10

Effects of regular use of cold-water immersion (CWI) on fiber type-specific adaptations in muscle K + transport proteins to intense training, along with their relationship to changes in mRNA levels after the first training session, were investigated in humans. Nineteen recreationally-active men (24{plus minus}6 y, 79.5{plus minus}10.8 kg, 44.6{plus minus}5.8 mL∙kg -1 ∙min -1 ) completed six weeks of sprint-interval cycling either without (passive rest; CON) or with training sessions followed by CWI (15 min at 10{degree sign}C; COLD). Muscle biopsies were obtained before and after training to determine abundance of Na + ,K + -ATPase isoforms (α 1-3 , β 1-3 ) and FXYD1, and after recovery treatments (+0h and +3h) on the first day of training to measure mRNA content. Training increased (ptraining (p>0.05). CWI after each session did not influence responses to training (p>0.05). However, α 2 mRNA increased after the first session in COLD (+0h, p0.05). In both conditions, α 1 and β 3 mRNA increased (+3h; p 0.05) after the first session. In summary, Na + ,K + -ATPase isoforms are differently regulated in type I and II muscle fibers by sprint-interval training in humans, which for most isoforms do not associate with changes in mRNA levels after the first training session. CWI neither impairs nor improves protein adaptations to intense training of importance for muscle K + regulation.

Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

Science.gov (United States)

Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

2014-05-10

Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

International Nuclear Information System (INIS)

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

2005-01-01

Monoclinic (P2 1 ) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2 1 , with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

Energy Technology Data Exchange (ETDEWEB)

Riise, Ellen Kristin [The Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø (Norway); Lorentzen, Marit Sjo [Department of Molecular Biotechnology, Institute of Medical Biology, Faculty of Medicine, University of Tromsø, N-9037 Tromsø (Norway); Helland, Ronny [The Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø (Norway); Willassen, Nils Peder, E-mail: nilspw@fagmed.uit.no [The Norwegian Structural Biology Centre, Faculty of Science, University of Tromsø, N-9037 Tromsø (Norway); Department of Molecular Biotechnology, Institute of Medical Biology, Faculty of Medicine, University of Tromsø, N-9037 Tromsø (Norway)

2006-01-01

Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.

New isocoumarins from a cold-adapted fungal strain mucor sp. and their developmental toxicity to zebrafish embryos.

Science.gov (United States)

Feng, Chun-Chi; Chen, Guo-Dong; Zhao, Yan-Qiu; Xin, Sheng-Chang; Li, Song; Tang, Jin-Shan; Li, Xiao-Xia; Hu, Dan; Liu, Xing-Zhong; Gao, Hao

2014-07-01

Three new isocoumarin derivatives, mucorisocoumarins A-C (1-3, resp.), together with seven known compounds, 4-10, were isolated from the cold-adapted fungal strain Mucor sp. (No. XJ07027-5). The structures of the new compounds were identified by detailed IR, MS, and 1D- and 2D-NMR analyses. It was noteworthy that compounds 1, 2, 4, and 5 were successfully resolved by chiral HPLC, indicating that 1-7 should exist as enantiomers. In an embryonic developmental toxicity assay using a zebrafish model, compound 3 produced developmental abnormalities in the zebrafish embryos. This is the first report of isocoumarins with developmental toxicity to zebrafish embryos. Copyright © 2014 Verlag Helvetica Chimica Acta AG, Zürich.

Purification and characterization of a cold-adapted lipase from Oceanobacillus strain PT-11.

Directory of Open Access Journals (Sweden)

Tian Jiewei

Full Text Available We isolated a moderately halophilic lipase-producing bacterium from the saline soil. Based on the morphological, physiological, chemotaxonomic and phylogenetic analysis, the isolate PT-11 was postulated to be a novel species identified as Oceanobacillus rekensis PT-11. The lipase was purified 2.50-fold by Q-Sepharose FF and SP-Sepharose FF chromatography and its molecular mass was estimated to be 23.5 kDa by SDS-PAGE. It was highly active over the broad temperature ranging from 10 to 35°C and showed up to 80% of the maximum activity at 10°C indicating the lipase to be a typical cold-adapted enzyme. The enzyme activity was slightly enhanced by Na+, Li+ and K+. Incubation with detergents, such as Tween-20 and Tween-80, slightly inhibited the enzyme activity; while Triton X-100decreased the enzyme activity. The enzyme was fairly stable in the presence of long-chain alcohols but was highly denatured in hydrophilic solvents such as acetone or short-chain alcohols (C1-C3.

Nicosulfuron Biodegradation by a Novel Cold-Adapted Strain Oceanisphaera psychrotolerans LAM-WHM-ZC.

Science.gov (United States)

Zhou, Shan; Song, Jinlong; Dong, Weiwei; Mu, Yingchun; Zhang, Qi; Fan, Ziwen; Wang, Yanwei; Kong, Delong; Zhou, Yiqing; Jiang, Xu; Zhao, Bin; Han, Gang; Ruan, Zhiyong

2017-11-29

Nicosulfuron is a common environmental pollutant, posing a great threat to aquatic systems and causing significant damage to crops. This study reported a cold-adapted strain Oceanisphaera psychrotolerans LAM-WHM-ZC, which efficiently degrades nicosulfuron over a wide range of temperatures (5 to 40 °C). The Box-Behnken design method was used to optimize the degradation conditions. O. psychrotolerans LAM-WHM-ZC can degrade 92.4% and 74.6% of initially supplemented 100 mg/L nicosulfuron under the optimum and low temperature of 18.1 and 5 °C, respectively, within 7 days. O. psychrotolerans LAM-WHM-ZC was found to be highly efficient in degrading cinosulfuron, chlorsulfuron, rimsulfuron, bensulfuron methyl, and ethametsulfuron methyl. Metabolites from nicosulfuron degradation were identified by UPLC-MS, and a possible degradation pathway was proposed. Furthermore, O. psychrotolerans LAM-WHM-ZC can also degrade nicosulfuron in soil; 78.6% and 67.4% of the initial nicosulfuron supplemented at 50 mg/kg were removed at 18.1 and 5 °C, respectively, within 15 days.

Cloning and characterization of a new cold-adapted and thermo-tolerant ι-carrageenase from marine bacterium Flavobacterium sp. YS-80-122.

Science.gov (United States)

Li, Shangyong; Hao, Jianhua; Sun, Mi

2017-09-01

ι-Carrageenases play a role in marine ι-carrageenan degradation, and their enzymatic hydrolysates are thought to be excellent antioxidants. In this study, we identified a new ι-carrageenase, encoded by cgiF, in psychrophilic bacterium Flavobacterium sp. YS-80-122. The deduced ι-carrageenase, CgiF, belongs to glycoside hydrolase family 82 and shows less than 40% amino acid identity with characterized ι-carrageenases. The activity of recombinant CgiF peaked at 30°C (1,207.8U/mg). Notably, CgiF is a cold-adapted ι-carrageenase, which showed 36.5% and 57% of the maximum activity at 10°C and 15°C, respectively. In addition, it is a thermo-tolerant enzyme that recovered 58.2% of its initial activity after heat shock. Furthermore, although the activity of CgiF was enhanced by NaCl, the enzyme is active in absence of NaCl. This study also shows that CgiF is an endo-type ι-carrageenase that hydrolyzes β-1,4-linkages of ι-carrageenan, yielding neo-ι-carratetraose as the main product. Its cold-adaptation, thermo-tolerance, NaCl independence and high neo-ι-carratetraose yield make CgiF an excellent candidate for industrial applications in production of ι-carrageen oligosaccharides from seaweed polysaccharides. Copyright © 2017. Published by Elsevier B.V.

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Science.gov (United States)

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

Peripheral cold acclimatization in Antarctic scuba divers.

Science.gov (United States)

Bridgman, S A

1991-08-01

Peripheral acclimatization to cold in scuba divers stationed at the British Antarctic Survey's Signy Station was investigated during a year in Antarctica. Five divers and five non-diver controls underwent monthly laboratory tests of index finger immersion in cold water for 30 min. Index finger pulp temperature and time of onset of cold-induced vasodilatation (CIVD) were measured. Pain was recorded with verbal and numerical psychophysical subjective pain ratings. Average finger temperatures and median finger pain from 6-30 min of immersion, maximum finger temperatures during the first CIVD cycle, and finger temperatures at the onset of CIVD were calculated. Comparison of the variables recorded from divers and non-divers were performed with analysis of variance. No significant differences were found among the variables recorded from divers and non-divers. From a review of the literature, divers have responses typical of non-cold-adapted Caucasians. There is, therefore, no evidence that Signy divers peripherally acclimatized to cold. We suggest that these findings occur because either the whole body cooling which divers undergo inhibits peripheral acclimatization or because of insufficiently frequent or severe cold exposure while diving. Further basic studies on the duration, frequency and severity of cold exposure necessary to induce peripheral cold acclimatization are required before this question can be satisfactorily answered.

Cultural adaptations to the differential threats posed by hot versus cold climates.

Science.gov (United States)

Murray, Damian R

2013-10-01

Hot and cold climates have posed differential threats to human survival throughout history. Cold temperatures can pose direct threats to survival in themselves, whereas hot temperatures may pose threats indirectly through higher prevalence of infectious disease. These differential threats yield convergent predictions for the relationship between more demanding climates and freedom of expression, but divergent predictions for freedom from discrimination.

Purification, characterisation and expression in Saccharomyces cerevisiae of LipG7 an enantioselective, cold-adapted lipase from the Antarctic filamentous fungus Geomyces sp. P7 with unusual thermostability characteristics.

Science.gov (United States)

Florczak, Tomasz; Daroch, Maurycy; Wilkinson, Mark Charles; Białkowska, Aneta; Bates, Andrew Derek; Turkiewicz, Marianna; Iwanejko, Lesley Ann

2013-06-10

A lipase, LipG7, has been purified from the Antarctic filamentous fungus Geomyces sp. P7 which was found to be cold-adapted and able to retain/regain its activity after heat denaturation. The LipG7 exhibits 100% residual activity following 1h incubation at 100°C whilst simultaneously showing kinetic adaptations to cold temperatures. LipG7 was also found to have industrial potential as an enantioselective biocatalyst as it is able to effectively catalyse the enantioselective transesterification of a secondary alcohol. The LipG7 coding sequence has been identified and cloned using 454 pyrosequencing of the transcriptome and inverse PCR. The LipG7 protein has been heterologously expressed in Saccharomyces cerevisiae BJ5465 and shown to exhibit the same characteristics as the native protein. Copyright © 2013 Elsevier Inc. All rights reserved.

Comparison of structure, function and regulation of plant cold shock domain proteins to bacterial and animal cold shock domain proteins.

Science.gov (United States)

Chaikam, Vijay; Karlson, Dale T

2010-01-01

The cold shock domain (CSD) is among the most ancient and well conserved nucleic acid binding domains from bacteria to higher animals and plants. The CSD facilitates binding to RNA, ssDNA and dsDNA and most functions attributed to cold shock domain proteins are mediated by this nucleic acid binding activity. In prokaryotes, cold shock domain proteins only contain a single CSD and are termed cold shock proteins (Csps). In animal model systems, various auxiliary domains are present in addition to the CSD and are commonly named Y-box proteins. Similar to animal CSPs, plant CSPs contain auxiliary C-terminal domains in addition to their N-terminal CSD. Cold shock domain proteins have been shown to play important roles in development and stress adaptation in wide variety of organisms. In this review, the structure, function and regulation of plant CSPs are compared and contrasted to the characteristics of bacterial and animal CSPs. [BMB reports 2010; 43(1): 1-8].

In vivo assessment of cold adaptation in insect larvae by magnetic resonance imaging and magnetic resonance spectroscopy.

Directory of Open Access Journals (Sweden)

Daniel Mietchen

Full Text Available Temperatures below the freezing point of water and the ensuing ice crystal formation pose serious challenges to cell structure and function. Consequently, species living in seasonally cold environments have evolved a multitude of strategies to reorganize their cellular architecture and metabolism, and the underlying mechanisms are crucial to our understanding of life. In multicellular organisms, and poikilotherm animals in particular, our knowledge about these processes is almost exclusively due to invasive studies, thereby limiting the range of conclusions that can be drawn about intact living systems.Given that non-destructive techniques like (1H Magnetic Resonance (MR imaging and spectroscopy have proven useful for in vivo investigations of a wide range of biological systems, we aimed at evaluating their potential to observe cold adaptations in living insect larvae. Specifically, we chose two cold-hardy insect species that frequently serve as cryobiological model systems--the freeze-avoiding gall moth Epiblema scudderiana and the freeze-tolerant gall fly Eurosta solidaginis.In vivo MR images were acquired from autumn-collected larvae at temperatures between 0 degrees C and about -70 degrees C and at spatial resolutions down to 27 microm. These images revealed three-dimensional (3D larval anatomy at a level of detail currently not in reach of other in vivo techniques. Furthermore, they allowed visualization of the 3D distribution of the remaining liquid water and of the endogenous cryoprotectants at subzero temperatures, and temperature-weighted images of these distributions could be derived. Finally, individual fat body cells and their nuclei could be identified in intact frozen Eurosta larvae.These findings suggest that high resolution MR techniques provide for interesting methodological options in comparative cryobiological investigations, especially in vivo.

Cell physiology of plants growing in cold environments.

Science.gov (United States)

Lütz, Cornelius

2010-08-01

The life of plants growing in cold extreme environments has been well investigated in terms of morphological, anatomical, and ecophysiological adaptations. In contrast, long-term cellular or metabolic studies have been performed by only a few groups. Moreover, a number of single reports exist, which often represent just a glimpse of plant behavior. The review draws together the literature which has focused on tissue and cellular adaptations mainly to low temperatures and high light. Most studies have been done with European alpine plants; comparably well studied are only two phanerogams found in the coastal Antarctic. Plant adaptation in northern polar regions has always been of interest in terms of ecophysiology and plant propagation, but nowadays, this interest extends to the effects of global warming. More recently, metabolic and cellular investigations have included cold and UV resistance mechanisms. Low-temperature stress resistance in plants from cold environments reflects the climate conditions at the growth sites. It is now a matter of molecular analyses to find the induced genes and their products such as chaperones or dehydrins responsible for this resistance. Development of plants under snow or pollen tube growth at 0 degrees C shows that cell biology is needed to explain the stability and function of the cytoskeleton. Many results in this field are based on laboratory studies, but several publications show that it is not difficult to study cellular mechanisms with the plants adapted to a natural stress. Studies on high light and UV loads may be split in two parts. Many reports describe natural UV as harmful for the plants, but these studies were mainly conducted by shielding off natural UV (as controls). Other experiments apply additional UV in the field and have had practically no negative impact on metabolism. The latter group is supported by the observations that green overwintering plants increase their flavonoids under snow even in the absence of

ENZIME ACTIVITY OF HIGHER BASIDIOMYCETES MUSHROOM GRIFOLA FRONDOSA

Directory of Open Access Journals (Sweden)

А. Бухало

2011-02-01

Full Text Available The purpose of this work was a revelation and evaluation of spectrum and activity of hydrolytic enzymes of higher basidiomycetes  Grifola frondosa in a surface and submerged culture. 8 strains of  Gf. frondosa,  mushrooms from culture collection of mushrooms at the M.G. Kholodny Institute of  Вotany National  Academy of Sciences of the Ukraine were object of investigation. Researches were conducted by standard microbiological, biochemical and biotechnological methods. All strains  on agar mediums were shown the  following enzymes: amylase, caseinase, polygalacturonase, pectattranselyminase, glucosidase, urease,  xylanase, lipase  and endoglucanase. The demonstration of oxidizing enzymes of laccase and tyrosinase  depended on a culture and did not depend on composition of medium. The estimation of presence and level of activity of hydrolytic enzymes at submerged cultivation indicate primary influence of components of complex nourishing medium on enzyme activity of Gr. frondosa. Strains biochemical features show up in the case of  oxidizing enzymes on agar mediums and for endo-1,4-β-glucanase on liquid mediums with glucose and molasses.

Adaptation to the deep-sea hydrothermal vents and cold seeps: Insights from the transcriptomes of Alvinocaris longirostris in both environments

Science.gov (United States)

Hui, Min; Cheng, Jiao; Sha, Zhongli

2018-05-01

Alvinocaris longirostris Kikuchi and Ohta, 1995 is one of the few species co-distributed in deep-sea hydrothermal vent and cold seep environments. We performed the transcriptome analysis for A. longirostris and identified differentially expressed genes (DEGs) between samples from the Iheya North hydrothermal vent (HV) and a methane seep in the South China Sea (MS). From the 57,801 annotated unigenes, multi-copies of enzyme family members for eliminating toxic xenobiotics were isolated and seven putatively duplicated gene clusters of cytochrome P450s were discovered, which may contribute to adaptation to the harsh conditions. Eight single amino acid substitutions of a Rhodopsin gene with low expression in two deep-sea alvinocaridid species were positively selected when compared with shallow water shrimps, which may be the result of adaptation to the dim-light environment in deep sea. 408 DEGs were identified with 53 and 355 up-regulated in HV and MS, respectively. Various genes associated with sulfur metabolism, detoxification and mitochondria were included, revealing different mechanisms of adaptation to the two types of extreme environments. All results are expected to serve as important basis for the further study.

Effects of heat and cold on health, with special reference to Finnish sauna bathing.

Science.gov (United States)

Heinonen, Ilkka; Laukkanen, Jari A

2018-05-01

Environmental stress such as extremely warm or cold temperature is often considered a challenge to human health and body homeostasis. However, the human body can adapt relatively well to heat and cold environments, and recent studies have also elucidated that particularly heat stress might be even highly beneficial for human health. Consequently, the aim of the present brief review is first to discuss general cardiovascular and other responses to acute heat stress, followed by a review of beneficial effects of Finnish sauna bathing on general and cardiovascular health and mortality as well as dementia and Alzheimer's disease risk. Plausible mechanisms included are improved endothelial and microvascular function, reduced blood pressure and arterial stiffness, and possibly increased angiogenesis in humans, which are likely to mediate the health benefits of sauna bathing. In addition to heat exposure with physiological adaptations, cold stress-induced physiological responses and brown fat activation on health are also discussed. This is important to take into consideration, as sauna bathing is frequently associated with cooling periods in cold(er) environments, but their combination remains poorly investigated. We finally propose, therefore, that possible additive effects of heat- and cold-stress-induced adaptations and effects on health would be worthy of further investigation.

Finger cold-induced vasodilation of older Korean female divers, haenyeo: effects of chronic cold exposure and aging

Science.gov (United States)

Lee, Joo-Young; Park, Joonhee; Koh, Eunsook; Cha, Seongwon

2017-07-01

The aim of the present study was to evaluate the local cold tolerance of older Korean female divers, haenyeo ( N = 22) in terms of cold acclimatization and ageing. As control groups, older non-diving females ( N = 25) and young females from a rural area ( N = 15) and an urban area ( N = 51) participated in this study. To evaluate local cold tolerance, finger cold-induced vasodilation (CIVD) during finger immersion of 4 °C water was examined. As a result, older haenyeos showed greater minimum finger temperature and recovery finger temperature than older non-diving females ( P < 0.05), but similar responses in onset time, peak time, maximum finger temperature, frequency of CIVD, heart rate, blood pressure, and thermal and pain sensations as those of older non-diving females. Another novel finding was that young urban females showed more vulnerable responses to local cold in CIVD variables and subjective sensations when compared to older females, whereas young rural females had the most excellent cold tolerance in terms of maximum temperature and frequency of CIVD among the four groups ( P < 0.05). The present results imply that older haenyeos still retain cold acclimatized features on the periphery even though they changed their cotton diving suits to wet suits in the early 1980s. However, cardiovascular responses and subjective sensations to cold reflect aging effects. In addition, we suggest that young people who have been adapted to highly insulated clothing and indoor heating systems in winter should be distinguished from young people who were exposed to less modern conveniences when compared to the aged in terms of cold tolerance.

A temporal-omic study of Propionibacterium freudenreichii CIRM-BIA1 adaptation strategies in conditions mimicking cheese ripening in the cold.

Directory of Open Access Journals (Sweden)

Marion Dalmasso

Full Text Available Propionibacterium freudenreichii is used as a ripening culture in Swiss cheese manufacture. It grows when cheeses are ripened in a warm room (about 24°C. Cheeses with an acceptable eye formation level are transferred to a cold room (about 4°C, inducing a marked slowdown of propionic fermentation, but P. freudenreichii remains active in the cold. To investigate the P. freudenreichii strategies of adaptation and survival in the cold, we performed the first global gene expression profile for this species. The time-course transcriptomic response of P. freudenreichii CIRM-BIA1(T strain was analyzed at five times of incubation, during growth at 30°C then for 9 days at 4°C, under conditions preventing nutrient starvation. Gene expression was also confirmed by RT-qPCR for 28 genes. In addition, proteomic experiments were carried out and the main metabolites were quantified. Microarray analysis revealed that 565 genes (25% of the protein-coding sequences of P. freudenreichii genome were differentially expressed during transition from 30°C to 4°C (P1. At 4°C, a general slowing down was observed for genes implicated in the cell machinery. On the contrary, P. freudenreichii CIRM-BIA1(T strain over-expressed genes involved in lactate, alanine and serine conversion to pyruvate, in gluconeogenesis, and in glycogen synthesis. Interestingly, the expression of different genes involved in the formation of important cheese flavor compounds, remained unchanged at 4°C. This could explain the contribution of P. freudenreichii to cheese ripening even in the cold. In conclusion, P. freudenreichii remains metabolically active at 4°C and induces pathways to maintain its long-term survival.

Bioactive metabolites from the mycelia of the basidiomycete Hericium erinaceum.

Science.gov (United States)

Lu, Qiang-Qiang; Tian, Jun-Mian; Wei, Jing; Gao, Jin-Ming

2014-01-01

Seven known compounds, three diketopiperazine alkaloids, 12β-hydroxyverruculogen TR-2 (1), fumitremorgin C (2) and methylthiogliotoxin (5), two hetero-spirocyclic γ-lactam alkaloids, pseurotin A (3) and FD-838 (4), and cerevisterol (6) and herierin IV (7), were isolated from the mycelia of the basidiomycete Hericium erinaceum and identified by spectroscopic analyses. The antioxidant and antifungal activities of compounds 1-6 were evaluated. The results indicated that compounds 1, 3 and 6 exhibited potential antioxidant activity against DPPH (2, 2-diphenyl-1-picrylhydrazyl) radical with their IC50 data of ca. 12 μM, compared with positive control tertiary butylhydroquinone. In addition, compound 4 significantly inhibited the growth of two plant fungal pathogens Botrytis cinerea and Glomerella cingulata with an minimum inhibitory concentration of 6.25 μM for each, similar to that of the positive fungicide, carbendazim. Compounds 1-5 were isolated from the genus Hericium for the first time.

The High Flux Isotope Reactor (HFIR) cold source project at ORNL

International Nuclear Information System (INIS)

Selby, D.

1998-01-01

The scope of this project includes the development, design, procurement/fabrication, testing, and installation of all of the components necessary to produce a working cold source within an existing HFIR beam tube hole in the pressure vessel. All aspects of the cold source design will be based on demonstrated technology adapted to the HFIR design and operating conditions

Cold adaptive traits revealed by comparative genomic analysis of the eurypsychrophile Rhodococcus sp. JG3 isolated from high elevation McMurdo Dry Valley permafrost, Antarctica.

Science.gov (United States)

Goordial, Jacqueline; Raymond-Bouchard, Isabelle; Zolotarov, Yevgen; de Bethencourt, Luis; Ronholm, Jennifer; Shapiro, Nicole; Woyke, Tanja; Stromvik, Martina; Greer, Charles W; Bakermans, Corien; Whyte, Lyle

2016-02-01

The permafrost soils of the high elevation McMurdo Dry Valleys are the most cold, desiccating and oligotrophic on Earth. Rhodococcus sp. JG3 is one of very few bacterial isolates from Antarctic Dry Valley permafrost, and displays subzero growth down to -5°C. To understand how Rhodococcus sp. JG3 is able to survive extreme permafrost conditions and be metabolically active at subzero temperatures, we sequenced its genome and compared it to the genomes of 14 mesophilic rhodococci. Rhodococcus sp. JG3 possessed a higher copy number of genes for general stress response, UV protection and protection from cold shock, osmotic stress and oxidative stress. We characterized genome wide molecular adaptations to cold, and identified genes that had amino acid compositions favourable for increased flexibility and functionality at low temperatures. Rhodococcus sp. JG3 possesses multiple complimentary strategies which may enable its survival in some of the harshest permafrost on Earth. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Functional annotation of the mesophilic-like character of mutants in a cold-adapted enzyme by self-organising map analysis of their molecular dynamics.

Science.gov (United States)

Fraccalvieri, Domenico; Tiberti, Matteo; Pandini, Alessandro; Bonati, Laura; Papaleo, Elena

2012-10-01

Multiple comparison of the Molecular Dynamics (MD) trajectories of mutants in a cold-adapted α-amylase (AHA) could be used to elucidate functional features required to restore mesophilic-like activity. Unfortunately it is challenging to identify the different dynamic behaviors and correctly relate them to functional activity by routine analysis. We here employed a previously developed and robust two-stage approach that combines Self-Organising Maps (SOMs) and hierarchical clustering to compare conformational ensembles of proteins. Moreover, we designed a novel strategy to identify the specific mutations that more efficiently convert the dynamic signature of the psychrophilic enzyme (AHA) to that of the mesophilic counterpart (PPA). The SOM trained on AHA and its variants was used to classify a PPA MD ensemble and successfully highlighted the relationships between the flexibilities of the target enzyme and of the different mutants. Moreover the local features of the mutants that mostly influence their global flexibility in a mesophilic-like direction were detected. It turns out that mutations of the cold-adapted enzyme to hydrophobic and aromatic residues are the most effective in restoring the PPA dynamic features and could guide the design of more mesophilic-like mutants. In conclusion, our strategy can efficiently extract specific dynamic signatures related to function from multiple comparisons of MD conformational ensembles. Therefore, it can be a promising tool for protein engineering.

Gene cloning and characterization of a cold-adapted β-glucosidase belonging to glycosyl hydrolase family 1 from a psychrotolerant bacterium Micrococcus antarcticus.

Science.gov (United States)

Fan, Hong-Xia; Miao, Li-Li; Liu, Ying; Liu, Hong-Can; Liu, Zhi-Pei

2011-06-10

The gene bglU encoding a cold-adapted β-glucosidase (BglU) was cloned from Micrococcus antarcticus. Sequence analysis revealed that the bglU contained an open reading frame of 1419 bp and encoded a protein of 472 amino acid residues. Based on its putative catalytic domains, BglU was classified as a member of the glycosyl hydrolase family 1 (GH1). BglU possessed lower arginine content and Arg/(Arg+Lys) ratio than mesophilic GH1 β-glucosidases. Recombinant BglU was purified with Ni2+ affinity chromatography and subjected to enzymatic characterization. SDS-PAGE and native staining showed that it was a monomeric protein with an apparent molecular mass of 48 kDa. BglU was particularly thermolabile since its half-life time was only 30 min at 30°C and it exhibited maximal activity at 25°C and pH 6.5. Recombinant BglU could hydrolyze a wide range of aryl-β-glucosides and β-linked oligosaccharides with highest activity towards cellobiose and then p-nitrophenyl-β-d-glucopyranoside (pNPG). Under the optimal conditions with pNPG as substrate, the K(m) and k(cat) were 7 mmol/L and 7.85 × 103/s, respectively. This is the first report of cloning and characterization of a cold-adapted β-glucosidase belonging to GH1 from a psychrotolerant bacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

Laser-Free Cold-Atom Gymnastics

Science.gov (United States)

Gould, Harvey; Feinberg, Benedict; Munger, Charles T., Jr.; Nishimura, Hiroshi

2017-01-01

We have performed beam transport simulations on ultra cold (2 μK) and cold (130 μK) neutral Cs atoms in the F = M = + 4 (magnetic weak-field seeking) ground state. We use inhomogeneous magnetic fields to focus and accelerate the atoms. Acceleration of neutral atoms by an inhomogeneous magnetic field was demonstrated by Stern and Gerlach in 1922. In the simulations, a two mm diameter cloud of atoms is released to fall under gravity. A magnetic coil focuses the falling atoms. After falling 41 cm, the atoms are reflected in the magnetic fringe field of a solenoid. They return to their starting height, about 0.7 s later, having passed a second time through the focusing coil. The simulations show that > 98 % of ultra cold Cs atoms and > 70 % of cold Cs atoms will survive at least 15 round trips (assuming perfect vacuum). More than 100 simulations were run to optimize coil currents and focusing coil diameter and height. Simulations also show that atoms can be launched into a fountain. An experimental apparatus to test the simulations, is being constructed. This technique may find application in atomic fountain clocks, interferometers, and gravitometers, and may be adaptable for use in microgravity. It may also work with Bose-Einstein condensates of paramagnetic atoms.

Chilled in Translation: Adapting to Bacterial Climate Change.

Science.gov (United States)

Gottesman, Susan

2018-04-19

Cold-shocked bacteria transiently shut down protein translation, but the mechanisms whereby they adaptively restore translation were incompletely understood. Zhang et al. (2018) demonstrate a global increase in mRNA structure after cold shock and that, as structured RNA decreases, translation returns, dependent upon ribonuclease RNase R and cold shock protein CspA and its homologs. Published by Elsevier Inc.

Comparison of the interleukin-1β-inducing potency of allergenic spores from higher fungi (Basidiomycetes) in a cryopreserved human whole blood system

Science.gov (United States)

Rivera-Mariani, Félix E.; Vysyaraju, Kranthi; Negherbon, Jesse; Levetin, Estelle; Horner, W. Elliot; Hartung, Thomas; Breysse, Patrick N.

2014-01-01

Background Spores from basidiomycete fungi (basidiospores) are highly prevalent in the atmosphere of urban and rural settings. Studies have confirmed their potential to affect human health as allergens. Less is known about their potential to serve as stimuli of the innate immune system and induce pro-inflammatory reactions. Methods In this study, we evaluated the pro-inflammatory potential of spores from 11 allergenic gilled (Pleurotus ostreatus, Oudemansiella radicata, Armillaria tabescens, Coprinus micaceus, Pluteus cervinus, Chlorophyllum molybdites) and non-gilled (Pisolithus arhizus, Merulius tremullosus, Calvatia cyathiformis, Lycoperdon pyriforme, Boletus bicolor) basidiomycetes fungi based on their potency to induce the release of the pro-inflammatory cytokine interleukin (IL)-1β in a cryopreserved human whole blood system. In addition, the role of morphological features of the spores (surface area, shape, and pigmentation) were examined for their role in the spores’ interleukin (IL)-1β-including potency. Peripheral blood from healthy volunteers was collected, pooled, and cryopreserved. After stimulating the cryopreserved pooled blood with 106 to 103 basidiospores/ml, the concentration of IL-1β in culture supernatants was determined with ELISA. Results Basidiospores manifested concentration-dependent IL-1β-inducing potency, which was more noteworthy among basidiospores from gilled basidiomycetes. At higher concentrations of basidiospores, the IL-1β-inducing potency was able to be differentiated in the cryopreserved human whole blood system. Morphological features did not correlate with the IL-1β-inducing potency of the basidiospores, suggesting that non-morphological properties modulate the IL-1β-inducing potency. Conclusion Our data provides evidence of the pro-inflammatory potential of basidiospores, and the utility of cryopreserved human whole blood as a human-based in-vitro system to study the immune reactivity of allergenic basidiospores. PMID

Flexibility of cold- and heat-adapted subtilisin-like serine proteinases evaluated with fluorescence quenching and molecular dynamics

DEFF Research Database (Denmark)

Sigtryggsdóttir, Asta Rós; Papaleo, Elena; Thorbjarnardóttir, Sigríður H.

2014-01-01

activity of cold adapted enzymes when compared to homologues from thermophiles, reflects their higher molecular flexibility. To assess a potential difference in molecular flexibility between the two homologous proteinases, we have measured their Trp fluorescence quenching by acrylamide at different......The subtilisin-like serine proteinases, VPR, from a psychrotrophic Vibrio species and aqualysin I (AQUI) from the thermophile Thermus aquaticus, are structural homologues, but differ significantly with respect to stability and catalytic properties. It has been postulated that the higher catalytic...... to Trp (Y191W). A lower quenching effect of acrylamide on the intrinsic fluorescence of the thermophilic AQUI_Y191W was observed at all temperatures measured (10-55°C), suggesting that it possesses a more rigid structure than VPR. The MD analysis (Cα rmsf profiles) showed that even though VPR and AQUI...

Fatty Acid Composition of Fourteen Wood-decaying Basidiomycete Species Growing in Permafrost Conditions

Directory of Open Access Journals (Sweden)

Daniil N. Olennikov

2014-03-01

Full Text Available The fatty acid (FA compositions of 14 wild wood-decaying basidiomycete species (Bjerkandera adusta, Daedaleopsis septentrionalis, Dichomitus squalens, Inonotus hispidus, I.radiatus, Irpex lacteus, Fomitopsis cajanderi, F.pinicola, F. rosea, Gloeophyllum protractum, Lenzites betulina, Phellinus pini, Trametes gibbosa, T. ochracea growing in permafrost conditions in Katanga region (Russian Federation were investigated using GC-MS. Generally, C18:2 ω 6 (linoleic acid, C18:1 ω 9 (oleic acid, C16:0 (palmitic acid and C20:0 (arachinic acid were found to be the major FA in fungal species. Data about chemical components of Daedaleopsis septentrionalis , Fomitopsis cajanderi and Gloeophyllum protractum were obtained at the first time. Increased level of degree of FA unsaturation was probably a result of extreme environmental conditions.

Setting parameters in the cold chain

Directory of Open Access Journals (Sweden)

Victoria Rodríguez

2011-12-01

Full Text Available Breaks in the cold chain are important economic losses in food and pharmaceutical companies. Many of the failures in the cold chain are due to improper adjustment of equipment parameters such as setting the parameters for theoretical conditions, without a corresponding check in normal operation. The companies that transport refrigeratedproducts must be able to adjust the parameters of the equipment in an easy and quick to adapt their functioning to changing environmental conditions. This article presents the results of a study carried out with a food distribution company. The main objective of the study is to verify the effectiveness of Six Sigma as a methodological toolto adjust the equipment in the cold chain. The second objective is more speciÞ c and is to study the impact of: reducing the volume of storage in the truck, the initial temperature of the storage areain the truck and the frequency of defrost in the transport of refrigerated products.

Rhodotorula portillonensis sp. nov., a basidiomycetous yeast isolated from Antarctic shallow-water marine sediment.

Science.gov (United States)

Laich, Federico; Vaca, Inmaculada; Chávez, Renato

2013-10-01

During the characterization of the mycobiota associated with shallow-water marine environments from Antarctic sea, a novel pink yeast species was isolated. Sequence analysis of the D1/D2 domain of the LSU rDNA gene and 5.8S-ITS regions revealed that the isolated yeast was closely related to Rhodotorula pallida CBS 320(T) and Rhodotorula benthica CBS 9124(T). On the basis of morphological, biochemical and physiological characterization and phylogenetic analyses, a novel basidiomycetous yeast species, Rhodotorula portillonensis sp. nov., is proposed. The type strain is Pi2(T) ( = CBS 12733(T)  = CECT 13081(T)) which was isolated from shallow-water marine sediment in Fildes Bay, King George Island, Antarctica.

Possible stimulation of anti-tumor immunity using repeated cold stress: a hypothesis

Directory of Open Access Journals (Sweden)

Radoja Sasa

2007-11-01

Full Text Available Abstract Background The phenomenon of hormesis, whereby small amounts of seemingly harmful or stressful agents can be beneficial for the health and lifespan of laboratory animals has been reported in literature. In particular, there is accumulating evidence that daily brief cold stress can increase both numbers and activity of peripheral cytotoxic T lymphocytes and natural killer cells, the major effectors of adaptive and innate tumor immunity, respectively. This type of regimen (for 8 days has been shown to improve survival of mice infected with intracellular parasite Toxoplasma gondii, which would also be consistent with enhanced cell-mediated immunity. Presentation of the hypothesis This paper hypothesizes that brief cold-water stress repeated daily over many months could enhance anti-tumor immunity and improve survival rate of a non-lymphoid cancer. The possible mechanism of the non-specific stimulation of cellular immunity by repeated cold stress appears to involve transient activation of the sympathetic nervous system, hypothalamic-pituitary-adrenal and hypothalamic-pituitary-thyroid axes, as described in more detail in the text. Daily moderate cold hydrotherapy is known to reduce pain and does not appear to have noticeable adverse effects on normal test subjects, although some studies have shown that it can cause transient arrhythmias in patients with heart problems and can also inhibit humoral immunity. Sudden immersion in ice-cold water can cause transient pulmonary edema and increase permeability of the blood-brain barrier, thereby increasing mortality of neurovirulent infections. Testing the hypothesis The proposed procedure is an adapted cold swim (5–7 minutes at 20 degrees Celsius, includes gradual adaptation to be tested on a mouse tumor model. Mortality, tumor size, and measurements of cellular immunity (numbers and activity of peripheral CD8+ T lymphocytes and natural killer cells of the cold-exposed group would be compared to

Analysis of Stress-Responsive Gene Expression in Cultivated and Weedy Rice Differing in Cold Stress Tolerance.

Directory of Open Access Journals (Sweden)

Caroline Borges Bevilacqua

Full Text Available Rice (Oryza sativa L. cultivars show impairment of growth in response to environmental stresses such as cold at the early seedling stage. Locally adapted weedy rice is able to survive under adverse environmental conditions, and can emerge in fields from greater soil depth. Cold-tolerant weedy rice can be a good genetic source for developing cold-tolerant, weed-competitive rice cultivars. An in-depth analysis is presented here of diverse indica and japonica rice genotypes, mostly weedy rice, for cold stress response to provide an understanding of different stress adaptive mechanisms towards improvement of the rice crop performance in the field. We have tested a collection of weedy rice genotypes to: 1 classify the subspecies (ssp. grouping (japonica or indica of 21 accessions; 2 evaluate their sensitivity to cold stress; and 3 analyze the expression of stress-responsive genes under cold stress and a combination of cold and depth stress. Seeds were germinated at 25°C at 1.5- and 10-cm sowing depth for 10d. Seedlings were then exposed to cold stress at 10°C for 6, 24 and 96h, and the expression of cold-, anoxia-, and submergence-inducible genes was analyzed. Control plants were seeded at 1.5cm depth and kept at 25°C. The analysis revealed that cold stress signaling in indica genotypes is more complex than that of japonica as it operates via both the CBF-dependent and CBF-independent pathways, implicated through induction of transcription factors including OsNAC2, OsMYB46 and OsF-BOX28. When plants were exposed to cold + sowing depth stress, a complex signaling network was induced that involved cross talk between stresses mediated by CBF-dependent and CBF-independent pathways to circumvent the detrimental effects of stresses. The experiments revealed the importance of the CBF regulon for tolerance to both stresses in japonica and indica ssp. The mechanisms for cold tolerance differed among weedy indica genotypes and also between weedy indica and

Cold adaptive thermogenesis following consumption of certain pungent spice principles: A validation study.

Science.gov (United States)

Pandit, Chaitanya; Anilakumar, K R

2017-02-01

Identifying a means to activate or potentiate thermogenic mechanisms through ingestion of dietary compounds have important implications in cold endurance and survival. Although many reports discuss the thermogenic potential of spices, it is surprising that none of the studies verify whether consumption of spices can improve cold endurance. In this study, we have attempted to evaluate if ingestion of certain spices can activate heat-generating mechanisms in the body such that a fall in. core body temperature (CBT) can be delayed or prevented when faced with a cold challenge. Ten commonly used spices in the Indian cuisine were chosen and 70% ethanol extract of the spices were fed orally to male Wistar rats at a dose of 250mg/kg for a period of 7 days. A change in CBT during cold exposure was recorded before and after treatment. At the end of the experiment, plasma norepinephrine and serum free fatty acid levels were estimated. We observed that among the ten spices, treatment with cinnamon and pepper extracts showed significant improvement in comparison to the control group. Based on evidence in literature and the HPLC-MS analysis from our lab, we hypothesized that the effects of the pepper and cinnamon extracts might be due to their piperine and cinnamaldehyde content respectively. However, no improved endurance was observed when they were administered alone. Poor endurance following depletion of endogenous norepinephrine levels using reserpine indicated its involvement in mediating the heat generating processes. However, it is noteworthy that green tea and spice treated animals exhibited a fall in CBT which was lower than their initial fall. In conclusion, our findings provide experimental evidence that ingestion of spices, viz., pepper and cinnamon, might elicit thermogenic responses such that hypothermia can be delayed or prevented upon cold exposure. Copyright © 2016 Elsevier Ltd. All rights reserved.

Detection of cold pain, cold allodynia and cold hyperalgesia in freely behaving rats

Directory of Open Access Journals (Sweden)

Woolf Clifford J

2005-12-01

Full Text Available Abstract Background Pain is elicited by cold, and a major feature of many neuropathic pain states is that normally innocuous cool stimuli begin to produce pain (cold allodynia. To expand our understanding of cold induced pain states we have studied cold pain behaviors over a range of temperatures in several animal models of chronic pain. Results We demonstrate that a Peltier-cooled cold plate with ± 1°C sensitivity enables quantitative measurement of a detection withdrawal response to cold stimuli in unrestrained rats. In naïve rats the threshold for eliciting cold pain behavior is 5°C. The withdrawal threshold for cold allodynia is 15°C in both the spared nerve injury and spinal nerve ligation models of neuropathic pain. Cold hyperalgesia is present in the spared nerve injury model animals, manifesting as a reduced latency of withdrawal response threshold at temperatures that elicit cold pain in naïve rats. We also show that following the peripheral inflammation produced by intraplantar injection of complete Freund's adjuvant, a hypersensitivity to cold occurs. Conclusion The peltier-cooled provides an effective means of assaying cold sensitivity in unrestrained rats. Behavioral testing of cold allodynia, hyperalgesia and pain will greatly facilitate the study of the neurobiological mechanisms involved in cold/cool sensations and enable measurement of the efficacy of pharmacological treatments to reduce these symptoms.

The evolution of high summit metabolism and cold tolerance in birds and its impact on present-day distributions.

Science.gov (United States)

Swanson, David L; Garland, Theodore

2009-01-01

Summit metabolic rate (M(sum), maximum cold-induced metabolic rate) is positively correlated with cold tolerance in birds, suggesting that high M(sum) is important for residency in cold climates. However, the phylogenetic distribution of high M(sum) among birds and the impact of its evolution on current distributions are not well understood. Two potential adaptive hypotheses might explain the phylogenetic distribution of high M(sum) among birds. The cold adaptation hypothesis contends that species wintering in cold climates should have higher M(sum) than species wintering in warmer climates. The flight adaptation hypothesis suggests that volant birds might be capable of generating high M(sum) as a byproduct of their muscular capacity for flight; thus, variation in M(sum) should be associated with capacity for sustained flight, one indicator of which is migration. We collected M(sum) data from the literature for 44 bird species and conducted both conventional and phylogenetically informed statistical analyses to examine the predictors of M(sum) variation. Significant phylogenetic signal was present for log body mass, log mass-adjusted M(sum), and average temperature in the winter range. In multiple regression models, log body mass, winter temperature, and clade were significant predictors of log M(sum). These results are consistent with a role for climate in determining M(sum) in birds, but also indicate that phylogenetic signal remains even after accounting for associations indicative of adaptation to winter temperature. Migratory strategy was never a significant predictor of log M(sum) in multiple regressions, a result that is not consistent with the flight adaptation hypothesis.

Enzymatic formation of gold nanoparticles by submerged culture of the basidiomycete Lentinus edodes.

Science.gov (United States)

Vetchinkina, Elena P; Loshchinina, Ekaterina A; Burov, Andrey M; Dykman, Lev A; Nikitina, Valentina E

2014-07-20

We report for the first time that the medicinal basidiomycete Lentinus edodes can reduce Au(III) from chloroauric acid (HAuCl4) to elemental Au [Au(0)], forming nanoparticles. Several methods, including transmission electron microscopy, electron energy loss spectroscopy, X-ray fluorescence, and dynamic light scattering, were used to show that when the fungus was grown submerged, colloidal gold accumulated on the surface of and inside the mycelial hyphae as electron-dense particles mostly spherical in shape, with sizes ranging from 5 to 50nm. Homogeneous proteins (the fungal enzymes laccase, tyrosinase, and Mn-peroxidase) were found for the first time to be involved in the reduction of Au(III) to Au(0) from HAuCl4. A possible mechanism forming Au nanoparticles is discussed. Copyright © 2014 Elsevier B.V. All rights reserved.

Inducing Cold-Sensitivity in the Frigophilic Fly Drosophila montana by RNAi.

Directory of Open Access Journals (Sweden)

Felipe M Vigoder

Full Text Available Cold acclimation is a critical physiological adaptation for coping with seasonal cold. By increasing their cold tolerance individuals can remain active for longer at the onset of winter and can recover more quickly from a cold shock. In insects, despite many physiological studies, little is known about the genetic basis of cold acclimation. Recently, transcriptomic analyses in Drosophila virilis and D. montana revealed candidate genes for cold acclimation by identifying genes upregulated during exposure to cold. Here, we test the role of myo-inositol-1-phosphate synthase (Inos, in cold tolerance in D. montana using an RNAi approach. D. montana has a circumpolar distribution and overwinters as an adult in northern latitudes with extreme cold. We assessed cold tolerance of dsRNA knock-down flies using two metrics: chill-coma recovery time (CCRT and mortality rate after cold acclimation. Injection of dsRNAInos did not alter CCRT, either overall or in interaction with the cold treatment, however it did induced cold-specific mortality, with high levels of mortality observed in injected flies acclimated at 5°C but not at 19°C. Overall, injection with dsRNAInos induced a temperature-sensitive mortality rate of over 60% in this normally cold-tolerant species. qPCR analysis confirmed that dsRNA injection successfully reduced gene expression of Inos. Thus, our results demonstrate the involvement of Inos in increasing cold tolerance in D. montana. The potential mechanisms involved by which Inos increases cold tolerance are also discussed.

Increased Adhesion of Listeria monocytogenes Strains to Abiotic Surfaces under Cold Stress

Directory of Open Access Journals (Sweden)

Bo-Hyung Lee

2017-11-01

Full Text Available Food contamination by Listeria monocytogenes remains a major concern for some food processing chains, particularly for ready-to-eat foods, including processed foods. Bacterial adhesion on both biotic and abiotic surfaces is a source of contamination by pathogens that have become more tolerant or even persistent in food processing environments, including in the presence of adverse conditions such as cold and dehydration. The most distinct challenge that bacteria confront upon entry into food processing environments is the sudden downshift in temperature, and the resulting phenotypic effects are of interest. Crystal violet staining and the BioFilm Ring Test® were applied to assess the adhesion and biofilm formation of 22 listerial strains from different serogroups and origins under cold-stressed and cold-adapted conditions. The physicochemical properties of the bacterial surface were studied using the microbial adhesion to solvent technique. Scanning electron microscopy was performed to visualize cell morphology and biofilm structure. The results showed that adhesion to stainless-steel and polystyrene was increased by cold stress, whereas cold-adapted cells remained primarily in planktonic form. Bacterial cell surfaces exhibited electron-donating properties regardless of incubation temperature and became more hydrophilic as temperature decreased from 37 to 4°C. Moreover, the adhesion of cells grown at 4°C correlated with affinity for ethyl acetate, indicating the role of cell surface properties in adhesion.

Pre-cold stress increases acid stress resistance and induces amino ...

African Journals Online (AJOL)

pre-adapted to cold stress revealed induction of amino acid homeostasis and energy ... substrate, thereby reducing yeast and mould ..... spontaneous mutation of llmg_1816 (gdpp) induced by .... species to UV-B-induced damage in bacteria. J.

Induction and catabolite repression of cellulase and xylanase synthesis in the selected white-rot basidiomycetes

Directory of Open Access Journals (Sweden)

Aza Kobakhidze

2016-09-01

Full Text Available This paper reports regulation of endoglucanase (EC 3.2.1.4 and xylanase (EC 3.2.1.8 production in submerged cultivation of four white-rot basidiomycetes. Among carbon sources tested, the Avicel-based medium provided the highest levels of both hydrolases activities in all fungal cultures. However, the maximum endoglucanase and xylanase activities of the tested basidiomycetes varied from 3.9 U/ml and 7.4 U/ml in Fomes fomentarius to 34.2 U/ml and 29.5 U/ml in Pseudotrametes gibbosa, respectively (P. gibbosa specific cellulase and xylanase activities achieved 8.55 and 7.38 U/mg, respectively. Replacement of Avicel in the medium with carboxymethyl cellulose or xylan significantly lowered the enzyme yield of the tested fungi. Moreover, xylan did not ensure high xylanase activity of these fungi. Lignocellulosic substrates used as a carbon source provided poorer productivity (the specific CMCase activity was 1.12–3.62 U/mg and the specific xylanase activity was 1.95–3.32 U/mg. Expression of endoglucanase and xylanase synthesis in Panus lecometei and P. gibbosa was inducible; supplementation of the glycerol-containing medium with Avicel accompanied with a sharp increase of the fungal specific CMCase and xylanase activities from 0.02–0.04 U/mg to 1.30–8.55 U/mg. Supplementation of the Avicel-induced cultures with glucose or glycerol caused a catabolite repression of the cellulase and xylanase formation by P. gibbosa and P. lecometei. The enzyme synthesis resumed only after depletion of easily metabolizable carbon source, glucose or glycerol, from the medium. The data received suggest that in the tested fungi endoglucanase and xylanase synthesis is under control by a common regulatory mechanism.

Altered Phenotypes in Saccharomyces cerevisiae by Heterologous Expression of Basidiomycete Moniliophthora perniciosa SOD2 Gene

Directory of Open Access Journals (Sweden)

Sônia C. Melo

2015-06-01

Full Text Available Heterologous expression of a putative manganese superoxide dismutase gene (SOD2 of the basidiomycete Moniliophthora perniciosa complemented the phenotypes of a Saccharomyces cerevisiae sod2Δ mutant. Sequence analysis of the cloned M. perniciosa cDNA revealed an open reading frame (ORF coding for a 176 amino acid polypeptide with the typical metal-binding motifs of a SOD2 gene, named MpSOD2. Phylogenetic comparison with known manganese superoxide dismutases (MnSODs located the protein of M. perniciosa (MpSod2p in a clade with the basidiomycete fungi Coprinopsis cinerea and Laccaria bicolor. Haploid wild-type yeast transformants containing a single copy of MpSOD2 showed increased resistance phenotypes against oxidative stress-inducing hydrogen peroxide and paraquat, but had unaltered phenotype against ultraviolet–C (UVC radiation. The same transformants exhibited high sensitivity against treatment with the pro-mutagen diethylnitrosamine (DEN that requires oxidation to become an active mutagen/carcinogen. Absence of MpSOD2 in the yeast sod2Δ mutant led to DEN hyper-resistance while introduction of a single copy of this gene restored the yeast wild-type phenotype. The haploid yeast wild-type transformant containing two SOD2 gene copies, one from M. perniciosa and one from its own, exhibited DEN super-sensitivity. This transformant also showed enhanced growth at 37 °C on the non-fermentable carbon source lactate, indicating functional expression of MpSod2p. The pro-mutagen dihydroethidium (DHE-based fluorescence assay monitored basal level of yeast cell oxidative stress. Compared to the wild type, the yeast sod2Δ mutant had a much higher level of intrinsic oxidative stress, which was reduced to wild type (WT level by introduction of one copy of the MpSOD2 gene. Taken together our data indicates functional expression of MpSod2 protein in the yeast S. cerevisiae.

Aerobic methanotrophic bacteria of cold ecosystems.

Science.gov (United States)

Trotsenko, Yuri A; Khmelenina, Valentina N

2005-06-01

This review summarizes the recent advances in understanding the ecophysiological role and structure-function features of methanotrophic bacteria living in various cold ecosystems. The occurrence of methanotrophs in a majority of psychrosphere sites was verified by direct measurement of their methane-utilizing activity, by electron microscopy and immunofluorescent observations, and analyses of specific signatures in cellular phospholipids and total DNAs extracted from environmental samples. Surprisingly, the phenotypic and genotypic markers of virtually all extant methanotrophs were detected in various cold habitats, such as underground waters, Northern taiga and tundra soils, polar lakes and permafrost sediments. Also, recent findings indicated that even after long-term storage in permafrost, some methanotrophs can oxidize and assimilate methane not only at positive but also at subzero temperatures. Pure cultures of psychrophilic and psychrotolerant methanotrophs were isolated and characterized as new genera and species: Methylobacter psychrophilus, Methylosphaera hansonii, Methylocella palustris, Methylocella silvestris, Methylocella tundrae, Methylocapsa acidiphila and Methylomonas scandinavica. However, our knowledge about their adaptive mechanisms and survival in cold ecosystems remains limited and needs to be established using both traditional and molecular microbiological methods.

Homeoviscous adaptation and the regulation of membrane lipids

DEFF Research Database (Denmark)

Ernst, Robert; Ejsing, Christer S; Antonny, Bruno

2016-01-01

Biological membranes are complex and dynamic assemblies of lipids and proteins. Poikilothermic organisms including bacteria, fungi, reptiles, and fish do not control their body temperature and must adapt their membrane lipid composition in order to maintain membrane fluidity in the cold. This ada......Biological membranes are complex and dynamic assemblies of lipids and proteins. Poikilothermic organisms including bacteria, fungi, reptiles, and fish do not control their body temperature and must adapt their membrane lipid composition in order to maintain membrane fluidity in the cold....... This adaptive response was termed homeoviscous adaptation and has been frequently studied with a specific focus on the acyl chain composition of membrane lipids. Massspectrometry-based lipidomics can nowadays provide more comprehensive insights into the complexity of lipid remodeling during adaptive responses...... such as neurons maintain unique lipid compositions with specific physicochemical properties. To date little is known about the sensory mechanisms regulating the acyl chain profile in such specialized cells or during adaptive responses. Here we summarize our current understanding of lipid metabolic networks...

Fructan metabolism and changes in fructan composition during cold acclimation in perennial ryegrass

DEFF Research Database (Denmark)

Abeynayake, Shamila; Etzerodt, Thomas; Jonavičienė, Kristina

2015-01-01

. The ecotype ‘Falster’, adapted to cold climates, increased total fructan content and produced more fructans (DP˃7) in the roots than the variety ‘Veyo’, adapted to warmer climates suggesting that accumulation of fructans in roots, especially the high-DP fructans as an adaptive trait for plant recovery after......Perennial ryegrass (Lolium perenne L.) produces high levels of fructans as a mixture of oligomers with different degrees of polymerization (DP). The present study describes the analysis of the compositional changes in the full spectrum of fructan oligomers, fructan distribution between above ground...... biomass (top) and the roots, and the transcription of candidate genes involved in fructan metabolism during cold acclimation in perennial ryegrass variety ‘Veyo’ and ecotype ‘Falster’ from distinct geographical origins. We observed changes in fructan composition and induction of low-DP fructans...

A study about business sustainability in cold storage agroindustry

Directory of Open Access Journals (Sweden)

Geraldino Carneiro de Araújo

2009-05-01

Full Text Available Industrial organizations are adapting to the concept of business sustainability in which companies develop social actions not losing the focus of financial and economic returns. In this context, the beef production sector, which has the cold storage agroindustry as the official coordinator of the chain, is important because of the socio-environmental actions. The objective of this research, characterized as descriptive and exploratory, with a qualitative approach, is to describe the measures adopted for business sustainability of agroindustry. Data analysis was the methodology of Grounded Theory. The results show the involvement of the cold storage studied in the three dimensions of sustainability (environmental, economic and social, and conclude that the cold storage agroindustry has incorporated the concept of sustainability of the business requirements of exporters.

Going Green and Cold: Biosurfactants from Low-Temperature Environments to Biotechnology Applications.

Science.gov (United States)

Perfumo, Amedea; Banat, Ibrahim M; Marchant, Roger

2018-03-01

Approximately 80% of the Earth's biosphere is cold, at an average temperature of 5°C, and is populated by a diversity of microorganisms that are a precious source of molecules with high biotechnological potential. Biosurfactants from cold-adapted organisms can interact with multiple physical phases - water, ice, hydrophobic compounds, and gases - at low and freezing temperatures and be used in sustainable (green) and low-energy-impact (cold) products and processes. We review the biodiversity of microbial biosurfactants produced in cold habitats and provide a perspective on the most promising future applications in environmental and industrial technologies. Finally, we encourage exploring the cryosphere for novel types of biosurfactants via both culture screening and functional metagenomics. Copyright © 2017 Elsevier Ltd. All rights reserved.

Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains

Directory of Open Access Journals (Sweden)

R.L. Arakaki

2013-12-01

Full Text Available Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L-1 of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

Halotolerance, ligninase production and herbicide degradation ability of basidiomycetes strains.

Science.gov (United States)

Arakaki, R L; Monteiro, D A; Boscolo, M; Dasilva, R; Gomes, E

2013-12-01

Fungi have been recently recognized as organisms able to grow in presence of high salt concentration with halophilic and halotolerance properties and their ligninolytic enzyme complex have an unspecific action enabling their use to degradation of a number of xenobiotic compounds. In this work, both the effect of salt and polyols on growth of the basidiomycetes strains, on their ability to produce ligninolytic enzyme and diuron degradation were evaluated. Results showed that the presence of NaCl in the culture medium affected fungal specimens in different ways. Seven out of ten tested strains had growth inhibited by salt while Dacryopinax elegans SXS323, Polyporus sp MCA128 and Datronia stereoides MCA167 fungi exhibited higher biomass production in medium containing 0.5 and 0.6 mol.L(-1) of NaCl, suggesting to be halotolerant. Polyols such as glycerol and mannitol added into the culture media improved the biomass and ligninases production by D. elegans but the fungus did not reveal consumption of these polyols from media. This fungus degraded diuron in medium control, in presence of NaCl as well as polyols, produced MnP, LiP and laccase.

Wind energy under cold climate conditions

Energy Technology Data Exchange (ETDEWEB)

Maribo Pedersen, B.

1999-03-01

There is an increasing interest in wind energy production under different climatic conditions, among them cold climate and icing conditions. More and more wind turbines are being installed in cold climates and even adapted technology has been developed for that environment. Various national activities are going on in at least Finland, Canada, Italy, Sweden, etc. and international collaboration has been carried out within the European Union's Non-nuclear energy programme. Wind turbine operation is affected by both the cold temperatures and the formation of ice on the blades and the supporting structure. Cold temperatures can be handled by material selections known in other technical fields but to prevent icing, new techniques have to be - and have been - developed. Icing affects the reliability of anemometers, which concerns both turbine control and resource estimation, and changes the aerodynamics of the blades, which eventually stops the turbine. In addition, occasional icing events can locally affect public safety. The development of applied technology has entered some different paths and different solutions are tried out. As the applications are entering a commercial phase, these is a request to gather the experiences and monitor the reliability in a form that can be utilised by developers, manufactureres, consultants and other tenderers. The Topical Experts Meeting will focus on site classification, operational experiences, modelling and mesurements of ice induced loads and safety aspects. (EHS)

Occupants' adaptive responses and perception of thermal environment in naturally conditioned university classrooms

Energy Technology Data Exchange (ETDEWEB)

Yao, Runming [The School of Construction Management and Engineering, The University of Reading, Whiteknights, PO Box 219, Reading RG6 6AW (United Kingdom); The Faculty of Urban Construction and Environmental Engineering, Chongqing University, Chongqing 400042 (China); Liu, Jing [The School of Construction Management and Engineering, The University of Reading, Whiteknights, PO Box 219, Reading RG6 6AW (United Kingdom); Li, Baizhan [The Faculty of Urban Construction and Environmental Engineering, Chongqing University, Chongqing 400042 (China); Key Laboratory of the Three Gorges Reservoir Region' s Eco-Environment (Ministry of Education), Chongqing University, Chongqing 400042 (China)

2010-03-15

A year-long field study of the thermal environment in university classrooms was conducted from March 2005 to May 2006 in Chongqing, China. This paper presents the occupants' thermal sensation votes and discusses the occupants' adaptive response and perception of the thermal environment in a naturally conditioned space. Comparisons between the Actual Mean Vote (AMV) and Predicted Mean Vote (PMV) have been made as well as between the Actual Percentage of Dissatisfied (APD) and Predicted Percentage of Dissatisfied (PPD). The adaptive thermal comfort zone for the naturally conditioned space for Chongqing, which has hot summer and cold winter climatic characteristics, has been proposed based on the field study results. The Chongqing adaptive comfort range is broader than that of the ASHRAE Standard 55-2004 in general, but in the extreme cold and hot months, it is narrower. The thermal conditions in classrooms in Chongqing in summer and winter are severe. Behavioural adaptation such as changing clothing, adjusting indoor air velocity, taking hot/cold drinks, etc., as well as psychological adaptation, has played a role in adapting to the thermal environment. (author)

Citric acid production from partly deproteinized whey under non-sterile culture conditions using immobilized cells of lactose-positive and cold-adapted Yarrowia lipolytica B9.

Science.gov (United States)

Arslan, Nazli Pinar; Aydogan, Mehmet Nuri; Taskin, Mesut

2016-08-10

The present study was performed to produce citric acid (CA) from partly deproteinized cheese whey (DPCW) under non-sterile culture conditions using immobilized cells of the cold-adapted and lactose-positive yeast Yarrowia lipolytica B9. DPCW was prepared using the temperature treatment of 90°C for 15min. Sodium alginate was used as entrapping agent for cell immobilization. Optimum conditions for the maximum CA production (33.3g/L) in non-sterile DPCW medium were the temperature of 20°C, pH 5.5, additional lactose concentration of 20g/L, sodium alginate concentration of 2%, number of 150 beads/100mL and incubation time of 120h. Similarly, maximum citric acid/isocitric acid (CA/ICA) ratio (6.79) could be reached under these optimal conditions. Additional nitrogen and phosphorus sources decreased CA concentration and CA/ICA ratio. Immobilized cells were reused in three continuous reaction cycles without any loss in the maximum CA concentration. The unique combination of low pH and temperature values as well as cell immobilization procedure could prevent undesired microbial contaminants during CA production. This is the first work on CA production by cold-adapted microorganisms under non-sterile culture conditions. Besides, CA production using a lactose-positive strain of the yeast Y. lipolytica was investigated for the first time in the present study. Copyright © 2016 Elsevier B.V. All rights reserved.

Cold-Adapted Viral Attenuation (CAVA): Highly Temperature Sensitive Polioviruses as Novel Vaccine Strains for a Next Generation Inactivated Poliovirus Vaccine.

Science.gov (United States)

Sanders, Barbara P; de Los Rios Oakes, Isabel; van Hoek, Vladimir; Bockstal, Viki; Kamphuis, Tobias; Uil, Taco G; Song, Yutong; Cooper, Gillian; Crawt, Laura E; Martín, Javier; Zahn, Roland; Lewis, John; Wimmer, Eckard; Custers, Jerome H H V; Schuitemaker, Hanneke; Cello, Jeronimo; Edo-Matas, Diana

2016-03-01

The poliovirus vaccine field is moving towards novel vaccination strategies. Withdrawal of the Oral Poliovirus Vaccine and implementation of the conventional Inactivated Poliovirus Vaccine (cIPV) is imminent. Moreover, replacement of the virulent poliovirus strains currently used for cIPV with attenuated strains is preferred. We generated Cold-Adapted Viral Attenuation (CAVA) poliovirus strains by serial passage at low temperature and subsequent genetic engineering, which contain the capsid sequences of cIPV strains combined with a set of mutations identified during cold-adaptation. These viruses displayed a highly temperature sensitive phenotype with no signs of productive infection at 37°C as visualized by electron microscopy. Furthermore, decreases in infectious titers, viral RNA, and protein levels were measured during infection at 37°C, suggesting a block in the viral replication cycle at RNA replication, protein translation, or earlier. However, at 30°C, they could be propagated to high titers (9.4-9.9 Log10TCID50/ml) on the PER.C6 cell culture platform. We identified 14 mutations in the IRES and non-structural regions, which in combination induced the temperature sensitive phenotype, also when transferred to the genomes of other wild-type and attenuated polioviruses. The temperature sensitivity translated to complete absence of neurovirulence in CD155 transgenic mice. Attenuation was also confirmed after extended in vitro passage at small scale using conditions (MOI, cell density, temperature) anticipated for vaccine production. The inability of CAVA strains to replicate at 37°C makes reversion to a neurovirulent phenotype in vivo highly unlikely, therefore, these strains can be considered safe for the manufacture of IPV. The CAVA strains were immunogenic in the Wistar rat potency model for cIPV, inducing high neutralizing antibody titers in a dose-dependent manner in response to D-antigen doses used for cIPV. In combination with the highly productive

How cold is cold dark matter?

International Nuclear Information System (INIS)

Armendariz-Picon, Cristian; Neelakanta, Jayanth T.

2014-01-01

If cold dark matter consists of particles, these must be non-interacting and non-relativistic by definition. In most cold dark matter models however, dark matter particles inherit a non-vanishing velocity dispersion from interactions in the early universe, a velocity that redshifts with cosmic expansion but certainly remains non-zero. In this article, we place model-independent constraints on the dark matter temperature to mass ratio, whose square root determines the dark matter velocity dispersion. We only assume that dark matter particles decoupled kinetically while non-relativistic, when galactic scales had not entered the horizon yet, and that their momentum distribution has been Maxwellian since that time. Under these assumptions, using cosmic microwave background and matter power spectrum observations, we place upper limits on the temperature to mass ratio of cold dark matter today (away from collapsed structures). These limits imply that the present cold dark matter velocity dispersion has to be smaller than 54 m/s. Cold dark matter has to be quite cold, indeed

Cold Antimatter Plasmas, and Aspirations for Cold Antihydrogen

Science.gov (United States)

2002-06-24

UNCLASSIFIED Defense Technical Information Center Compilation Part Notice ADP012494 TITLE: Cold Antimatter Plasmas, and Aspirations for Cold...part numbers comprise the compilation report: ADP012489 thru ADP012577 UNCLASSIFIED Cold Antimatter Plasmas, and Aspirations for Cold Antihydrogen G...and positrons. The antiprotons come initially from the new Antiproton Decel- erator facility at CERN. Good control of such cold antimatter plasmas is

Cold growth behaviour and genetic comparison of Canadian and Swiss Listeria monocytogenes strains associated with the food supply chain and human listeriosis cases.

Science.gov (United States)

Arguedas-Villa, Carolina; Kovacevic, Jovana; Allen, Kevin J; Stephan, Roger; Tasara, Taurai

2014-06-01

Sixty-two strains of Listeria monocytogenes isolated in Canada and Switzerland were investigated. Comparison based on molecular genotypes confirmed that strains in these two countries are genetically diverse. Interestingly strains from both countries displayed similar range of cold growth phenotypic profiles. Based on cold growth lag phase duration periods displayed in BHI at 4 °C, the strains were similarly divided into groups of fast, intermediate and slow cold adaptors. Overall Swiss strains had faster exponential cold growth rates compared to Canadian strains. However gene expression analysis revealed no significant differences between fast and slow cold adapting strains in the ability to induce nine cold adaptation genes (lmo0501, cspA, cspD, gbuA, lmo0688, pgpH, sigB, sigH and sigL) in response to cold stress exposure. Neither was the presence of Stress survival islet 1 (SSI-1) analysed by PCR associated with enhanced cold adaptation. Phylogeny based on the sigL gene subdivided strains from these two countries into two major and one minor cluster. Fast cold adaptors were more frequently in one of the major clusters (cluster A), whereas slow cold adaptors were mainly in the other (cluster B). Genetic differences between these two major clusters are associated with various amino acid substitutions in the predicted SigL proteins. Compared to the EGDe type strain and most slow cold adaptors, most fast cold adaptors exhibited five identical amino acid substitutions (M90L, S203A/S203T, S304N, S315N, and I383T) in their SigL proteins. We hypothesize that these amino acid changes might be associated with SigL protein structural and functional changes that may promote differences in cold growth behaviour between L. monocytogenes strains. Copyright © 2014 Elsevier Ltd. All rights reserved.

Fruit and seed heteromorphism in the cold desert annual ephemeral Diptychocarpus strictus (Brassicaceae) and possible adaptive significance.

Science.gov (United States)

Lu, Juanjuan; Tan, Dunyan; Baskin, Jerry M; Baskin, Carol C

2010-06-01

Diptychocarpus strictus is an annual ephemeral in the cold desert of northwest China that produces heteromorphic fruits and seeds. The primary aims of this study were to characterize the morphology and anatomy of fruits and seeds of this species and compare the role of fruit and seed heteromorphism in dispersal and germination. Shape, size, mass and dispersal of siliques and seeds and the thickness of the mucilage layer on seeds were measured, and the anatomy of siliques and seeds, the role of seed mucilage in water absorption/dehydration, germination and adherence of seeds to soil particles, the role of pericarp of lower siliques in seed dormancy and seed after-ripening and germination phenology were studied using standard procedures. Plants produce dehiscent upper siliques with a thin pericarp containing seeds with large wings and a thick mucilage layer and indehiscent lower siliques with a thick pericarp containing nearly wingless seeds with a thin mucilage layer. The dispersal ability of seeds from the upper siliques was much greater than that of intact lower siliques. Mucilage increased the amount of water absorbed by seeds and decreased the rate of dehydration. Seeds with a thick mucilage layer adhered to soil particles much better than those with a thin mucilage layer or those from which mucilage had been removed. Fresh seeds were physiologically dormant and after-ripened during summer. Non-dormant seeds germinated to high percentages in light and in darkness. Germination of seeds from upper siliques is delayed until spring primarily by drought in summer and autumn, whereas the thick, indehiscent pericarp prevents germination for >1 year of seeds retained in lower siliques. The life cycle of D. strictus is morphologically and physiologically adapted to the cold desert environment in time and space via a combination of characters associated with fruit and seed heteromorphism.

Brown Fat AKT2 Is a Cold-Induced Kinase that Stimulates ChREBP-Mediated De Novo Lipogenesis to Optimize Fuel Storage and Thermogenesis

DEFF Research Database (Denmark)

Sanchez-Gurmaches, Joan; Tang, Yuefeng; Jespersen, Naja Zenius

2018-01-01

Brown adipose tissue (BAT) is a therapeutic target for metabolic diseases; thus, understanding its metabolic circuitry is clinically important. Many studies of BAT compare rodents mildly cold to those severely cold. Here, we compared BAT remodeling between thermoneutral and mild-cold-adapted mice...

Adaptation of the spore discharge mechanism in the basidiomycota.

Directory of Open Access Journals (Sweden)

Jessica L Stolze-Rybczynski

Full Text Available Spore discharge in the majority of the 30,000 described species of Basidiomycota is powered by the rapid motion of a fluid droplet, called Buller's drop, over the spore surface. In basidiomycete yeasts, and phytopathogenic rusts and smuts, spores are discharged directly into the airflow around the fungal colony. Maximum discharge distances of 1-2 mm have been reported for these fungi. In mushroom-forming species, however, spores are propelled over much shorter ranges. In gilled mushrooms, for example, discharge distances of <0.1 mm ensure that spores do not collide with opposing gill surfaces. The way in which the range of the mechanism is controlled has not been studied previously.In this study, we report high-speed video analysis of spore discharge in selected basidiomycetes ranging from yeasts to wood-decay fungi with poroid fruiting bodies. Analysis of these video data and mathematical modeling show that discharge distance is determined by both spore size and the size of the Buller's drop. Furthermore, because the size of Buller's drop is controlled by spore shape, these experiments suggest that seemingly minor changes in spore morphology exert major effects upon discharge distance.This biomechanical analysis of spore discharge mechanisms in mushroom-forming fungi and their relatives is the first of its kind and provides a novel view of the incredible variety of spore morphology that has been catalogued by traditional taxonomists for more than 200 years. Rather than representing non-selected variations in micromorphology, the new experiments show that changes in spore architecture have adaptive significance because they control the distance that the spores are shot through air. For this reason, evolutionary modifications to fruiting body architecture, including changes in gill separation and tube diameter in mushrooms, must be tightly linked to alterations in spore morphology.

Cold Stress

Science.gov (United States)

... Publications and Products Programs Contact NIOSH NIOSH COLD STRESS Recommend on Facebook Tweet Share Compartir Workers who ... cold environments may be at risk of cold stress. Extreme cold weather is a dangerous situation that ...

Nasal variation in relation to high-altitude adaptations among Tibetans and Andeans.

Science.gov (United States)

Butaric, Lauren N; Klocke, Ross P

2018-05-01

High-altitude (>2500 m) populations face several pressures, including hypoxia and cold-dry air, resulting in greater respiratory demand to obtain more oxygen and condition inspired air. While cardiovascular and pulmonary adaptations to high-altitude hypoxia have been extensively studied, adaptations of upper-respiratory structures, e.g., nasal cavity, remain untested. This study investigates whether nasal morphology presents adaptations to hypoxic (larger noses) and/or cold-dry (tall/narrow noses) conditions among high-altitude samples. CT scans of two high- and four low-altitude samples from diverse climates were collected (n = 130): high-altitude Tibetans and Peruvians; low-altitude Peruvians, Southern Chinese (temperate), Mongolian-Buriats (cold-dry), and Southeast Asians (hot-wet). Facial and nasal distances were calculated from 3D landmarks placed on digitally-modeled crania. Temperature, precipitation, and barometric pressure data were also obtained. Principal components analysis and analyses of variance primarily indicate size-related differences among the cold-dry (Mongolian-Buriats) and hot-wet (Southeast Asians) adapted groups. Two-block partial least squares (PLS) analysis show weak relationships between size-standardized nasal dimensions and environmental variables. However, among PLS1 (85.90% of covariance), Tibetans display relatively larger nasal cavities related to lower temperatures and barometric pressure; regression analyses also indicate high-altitude Tibetans possess relatively larger internal nasal breadths and heights for their facial size. Overall, nasal differences relate to climate among the cold-dry and hot-wet groups. Specific nasal adaptations were not identified among either Peruvian group, perhaps due to their relatively recent migration history and population structure. However, high-altitude Tibetans seem to exhibit a compromise in nasal morphology, serving in increased oxygen uptake, and air-conditioning processes. © 2018

Transient receptor potential cation channel, subfamily C, member 5 (TRPC5) is a cold-transducer in the peripheral nervous system.

Science.gov (United States)

Zimmermann, Katharina; Lennerz, Jochen K; Hein, Alexander; Link, Andrea S; Kaczmarek, J Stefan; Delling, Markus; Uysal, Serdar; Pfeifer, John D; Riccio, Antonio; Clapham, David E

2011-11-01

Detection and adaptation to cold temperature is crucial to survival. Cold sensing in the innocuous range of cold (>10-15 °C) in the mammalian peripheral nervous system is thought to rely primarily on transient receptor potential (TRP) ion channels, most notably the menthol receptor, TRPM8. Here we report that TRP cation channel, subfamily C member 5 (TRPC5), but not TRPC1/TRPC5 heteromeric channels, are highly cold sensitive in the temperature range 37-25 °C. We found that TRPC5 is present in mouse and human sensory neurons of dorsal root ganglia, a substantial number of peripheral nerves including intraepithelial endings, and in the dorsal lamina of the spinal cord that receives sensory input from the skin, consistent with a potential TRPC5 function as an innocuous cold transducer in nociceptive and thermosensory nerve endings. Although deletion of TRPC5 in 129S1/SvImJ mice resulted in no temperature-sensitive behavioral changes, TRPM8 and/or other menthol-sensitive channels appear to underpin a much larger component of noxious cold sensing after TRPC5 deletion and a shift in mechanosensitive C-fiber subtypes. These findings demonstrate that highly cold-sensitive TRPC5 channels are a molecular component for detection and regional adaptation to cold temperatures in the peripheral nervous system that is distinct from noxious cold sensing.

Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

Energy Technology Data Exchange (ETDEWEB)

Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

1995-12-01

It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

A compendium and functional characterization of mammalian genes involved in adaptation to Arctic or Antarctic environments.

Science.gov (United States)

Yudin, Nikolay S; Larkin, Denis M; Ignatieva, Elena V

2017-12-28

Many mammals are well adapted to surviving in extremely cold environments. These species have likely accumulated genetic changes that help them efficiently cope with low temperatures. It is not known whether the same genes related to cold adaptation in one species would be under selection in another species. The aims of this study therefore were: to create a compendium of mammalian genes related to adaptations to a low temperature environment; to identify genes related to cold tolerance that have been subjected to independent positive selection in several species; to determine promising candidate genes/pathways/organs for further empirical research on cold adaptation in mammals. After a search for publications containing keywords: "whole genome", "transcriptome or exome sequencing data", and "genome-wide genotyping array data" authors looked for information related to genetic signatures ascribable to positive selection in Arctic or Antarctic mammalian species. Publications related to Human, Arctic fox, Yakut horse, Mammoth, Polar bear, and Minke whale were chosen. The compendium of genes that potentially underwent positive selection in >1 of these six species consisted of 416 genes. Twelve of them showed traces of positive selection in three species. Gene ontology term enrichment analysis of 416 genes from the compendium has revealed 13 terms relevant to the scope of this study. We found that enriched terms were relevant to three major groups: terms associated with collagen proteins and the extracellular matrix; terms associated with the anatomy and physiology of cilium; terms associated with docking. We further revealed that genes from compendium were over-represented in the lists of genes expressed in the lung and liver. A compendium combining mammalian genes involved in adaptation to cold environment was designed, based on the intersection of positively selected genes from six Arctic and Antarctic species. The compendium contained 416 genes that have been

Temporal Changes in Mortality Related to Extreme Temperatures for 15 Cities in Northeast Asia: Adaptation to Heat and Maladaptation to Cold.

Science.gov (United States)

Chung, Yeonseung; Noh, Heesang; Honda, Yasushi; Hashizume, Masahiro; Bell, Michelle L; Guo, Yue-Liang Leon; Kim, Ho

2017-05-15

Understanding how the temperature-mortality association worldwide changes over time is crucial to addressing questions of human adaptation under climate change. Previous studies investigated the temporal changes in the association over a few discrete time frames or assumed a linear change. Also, most studies focused on attenuation of heat-related mortality and studied the United States or Europe. This research examined continuous temporal changes (potentially nonlinear) in mortality related to extreme temperature (both heat and cold) for 15 cities in Northeast Asia (1972-2009). We used a generalized linear model with splines to simultaneously capture 2 types of nonlinearity: nonlinear association between temperature and mortality and nonlinear change over time in the association. We combined city-specific results to generate country-specific results using Bayesian hierarchical modeling. Cold-related mortality remained roughly constant over decades and slightly increased in the late 2000s, with a larger increase for cardiorespiratory deaths than for deaths from other causes. Heat-related mortality rates have decreased continuously over time, with more substantial decrease in earlier decades, for older populations and for cardiorespiratory deaths. Our findings suggest that future assessment of health effects of climate change should account for the continuous changes in temperature-related health risk and variations by factors such as age, cause of death, and location. © Crown copyright 2017.

RNA-Seq and Mass-Spectrometry-Based Lipidomics Reveal Extensive Changes of Glycerolipid Pathways in Brown Adipose Tissue in Response to Cold

DEFF Research Database (Denmark)

Marcher, Ann-Britt; Loft, Anne; Nielsen, Ronni

2015-01-01

involved in glycerophospholipid synthesis and fatty acid elongation. This is accompanied by significant changes in the acyl chain composition of triacylglycerols (TAGs) as well as subspecies-selective changes of acyl chains in glycerophospholipids. These results indicate that cold adaptation of BAT......Cold exposure greatly alters brown adipose tissue (BAT) gene expression and metabolism to increase thermogenic capacity. Here, we used RNA sequencing and mass-spectrometry-based lipidomics to provide a comprehensive resource describing the molecular signature of cold adaptation at the level...... of the transcriptome and lipidome. We show that short-term (3-day) cold exposure leads to a robust increase in expression of several brown adipocyte genes related to thermogenesis as well as the gene encoding the hormone irisin. However, pathway analysis shows that the most significantly induced genes are those...

Ligninolytic basidiomycetes as promising organisms for the mycoremediation of PAH-contaminated Environments

Science.gov (United States)

Pozdnyakova, N. N.; Balandina, S. A.; Dubrovskaya, E. V.; Golubev, C. N.; Turkovskaya, O. V.

2018-01-01

Primary screening of ligninolytic fungi belonging to wood- and soil-inhabiting basidiomycetes revealed their ability to degrade three-ringed PAHs with formation of quinone metabolites at the first stage. The degradative activity was both species and strain specific, and some differences in the “chances” for the formed quinones were found. They were the main end metabolites in the degradation of PAHs by Stropharia rugosoannulata and Agaricus bisporus. During PAH degradation by strains of Trametes versicolor, Pleurotus ostreatus, Schizophyllum commune, and Bjerkandera adusta similar metabolites were detected during the cultivation, but they were utilized further. The results supported the hypothesis that the degree of PAH degradation may depend on the composition of the extracellular ligninolytic complex of the fungi: in the presence of a single ligninolytic enzyme, laccase, the accumulation of quinone metabolites takes place; their further utilization is possible with the participation of ligninolytic peroxidases. The data obtained showed the necessity not only to identify the metabolites formed, but also to study the activity of the basic ligninolytic enzymes. It is important for the correct selection of fungal strains for mycoremediation.

Cellular origins of cold-induced brown adipocytes in adult mice.

Science.gov (United States)

Lee, Yun-Hee; Petkova, Anelia P; Konkar, Anish A; Granneman, James G

2015-01-01

This work investigated how cold stress induces the appearance of brown adipocytes (BAs) in brown and white adipose tissues (WATs) of adult mice. In interscapular brown adipose tissue (iBAT), cold exposure increased proliferation of endothelial cells and interstitial cells expressing platelet-derived growth factor receptor, α polypeptide (PDGFRα) by 3- to 4-fold. Surprisingly, brown adipogenesis and angiogenesis were largely restricted to the dorsal edge of iBAT. Although cold stress did not increase proliferation in inguinal white adipose tissue (ingWAT), the percentage of BAs, defined as multilocular adipocytes that express uncoupling protein 1, rose from undetectable to 30% of total adipocytes. To trace the origins of cold-induced BAs, we genetically tagged PDGFRα(+) cells and adipocytes prior to cold exposure, using Pdgfra-Cre recombinase estrogen receptor T2 fusion protein (CreER(T2)) and adiponectin-CreER(T2), respectively. In iBAT, cold stress triggered the proliferation and differentiation of PDGFRα(+) cells into BAs. In contrast, all newly observed BAs in ingWAT (5207 out of 5207) were derived from unilocular adipocytes tagged by adiponectin-CreER(T2)-mediated recombination. Surgical denervation of iBAT reduced cold-induced brown adipogenesis by >85%, whereas infusion of norepinephrine (NE) mimicked the effects of cold in warm-adapted mice. NE-induced de novo brown adipogenesis in iBAT was eliminated in mice lacking β1-adrenergic receptors. These observations identify a novel tissue niche for brown adipogenesis in iBAT and further define depot-specific mechanisms of BA recruitment. © FASEB.

Adaptation of psychrophilic and psychrotrophic sulfate-reducing bacteria to permanently cold marine environments

DEFF Research Database (Denmark)

Isaksen, MF; Jørgensen, BB

1996-01-01

degrees C. The rates of sulfate reduction were measured by the (SO42-)-S-35 tracer technique at different experimental temperatures in sediment slurries, In sediment slurries from Mariager Fjord, sulfate reduction showed a mesophilic temperature response which was comparable to that of other temperate...... environments, In sediment slurries from Antarctica, the metabolic activity of psychrotrophic bacteria was observed with a respiration optimum at 18 to 19 degrees C during short-term incubations, However, over a 1-week incubation, the highest respiration rate was observed at 12.5 degrees C. Growth......The potential for sulfate reduction at low temperatures was examined in two different cold marine sediments, Mariager Fjord (Denmark), which is permanently cold (3 to 6 degrees C) but surrounded by seasonally warmer environments, and the Weddell Sea (Antarctica), which is permanently below 0...

Influence of Xylella fastidiosa cold shock proteins on pathogenesis in grapevine.

Science.gov (United States)

Cold shock proteins (CSPs), a family of nucleic acid binding proteins are an essential part of microbial adaptation to temperature changes. Bacterial CSPs are often expressed in a temperature-dependent manner, and act as chaperones, facilitating translation at low temperature by stabilizing mRNA. In...

[An overview on the physiological and ecological adaptation mechanisms of the overwinter ticks].

Science.gov (United States)

Yu, Zhi-jun; Yang, Xiao-long; Chen, Jie; Liu, Jing-ze

2014-10-01

The current paper introduces the recent research and development on the cryobiology of ticks, based on their overwinter behavior strategy and biochemical and physiological adaptation mechanisms, and provides detail information on the cold hardiness, biochemical and physiological mechanisms, the relationship between cold hardiness and diapause, which will give theoretical clues for subsequent research on the molecular regulation of cold hardiness of ticks.

SCREENING OF CONTENT AND DYNAMIC OF ACCUMULATION OF POLYPHENOLS IN SOME BASIDIOMYCETES SPECIES

Directory of Open Access Journals (Sweden)

Veligodska A. K.

2015-12-01

Full Text Available The aim of the study was to investigate the total content of polyphenolic substances in Basidiomycetes carpophores from 50 species, of which 27 belong to the order Polyporales and 23 to the order Agaricales. Introduced 23 strains of 8 species of Basidiomycetes. Methods. Gathered wild carpophores dried and crushed to a particle size of 0,1 till 0,01 mm and searching strains were cultured in Erlenmeyyers flasks by surface method on standard glucose-peptone culture medium. Determination of total content of polyphenolic compounds was carried out in ethanol extracts of mycological material by a modified method of Folin-Chokalteu. Completely dry biomass of carpophores and mycelium was determined gravimetrically. Results. There was identified the species of polyporal fungi Ganoderma applanatum, Ganoderma lucidum, Laetiporus sulphureus and Fomes fomentarius and types of agarical mushrooms Stropharia rugosoannulata, Agrocybe cylindracea, Tricholoma flavovirens, Flammulina velutipes, Pleurotus ostreatus and Fistulina hepatica high in polyphenolic compounds. It was determined the content of polyphenols ranging from more than 60 mg / g completely dry biomass. For introduced strains established dynamics of growth and accumulation of polyphenolic compounds in the mycelium and culture filtrate during fermentation on glucose-peptone medium. All cultures reach a maximum accumulation of biomass on the 12th day of growth. Shizophyllum commune Sc-1101 and 10 and F. velutipes F-202 have been identified as the most productive strains. The lowest accumulation of absolutely dry biomass was recorded for strain P. ostreatus P-192 and strain F. fomentarius Ff-09. Cultures have investigated individual value growth such as biomass accumulation in the applied cultivation conditions, which probably reflects the suitability of the medium for their growth and genotypic characteristics. Strains are overwhelmingly able to accumulate polyphenolic compounds in both mycelium and

Cold-rolled steel strip X-ray thickness gauge

International Nuclear Information System (INIS)

Tong Jianmin; Cong Peng; Li Litao

2010-01-01

This paper introduces a cold-rolled steel strip X-ray thickness gauge. This gauge uses two-detector construction including penetrating ionization chamber and measuring ionization chamber. Standard magazine box is composed of three rotating plates driving by stepper motor, including 13 pieces of standard sample to build up 154 thickness value, obtaining standard sample curve covering thickness range of 0.1 mm to 5 mm. Automation system include Siemens S7-200 PLC as key controlling unit, embedded controlling system for data acquisition and computing, and PC as man-machine interface, and employ Ethernet (TCP/IP) or RS485/232 as communication protocol. Reversing Cold mill AGC closed-loop control operation test demonstrates that the gauge can adapt to the severe production environment, operate stably and reliably, measurement precision can reached to ±0.19%, reproducibility to ±0.09%, and stability to ±0.06%, response time range from 4 ms to 200 ms and be adjustable. So it can meet the high demanding of cold-rolled plate/strip production. (authors)

Genome-Wide Identification of circRNAs in Pathogenic Basidiomycetous Yeast Cryptococcus neoformans Suggests Conserved circRNA Host Genes over Kingdoms

Directory of Open Access Journals (Sweden)

Liang Huo

2018-02-01

Full Text Available Circular RNAs (circRNAs, a novel class of ubiquitous and intriguing noncoding RNA, have been found in a number of eukaryotes but not yet basidiomycetes. In this study, we identified 73 circRNAs from 39.28 million filtered RNA reads from the basidiomycete Cryptococcus neoformans JEC21 using next-generation sequencing (NGS and the bioinformatics tool circular RNA identification (CIRI. Furthermore, mapping of newly found circRNAs to the genome showed that 73.97% of the circRNAs originated from exonic regions, whereas 20.55% were from intergenic regions and 5.48% were from intronic regions. Enrichment analysis of circRNA host genes was conducted based on the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway databases. The results reveal that host genes are mainly responsible for primary metabolism and, interestingly, ribosomal protein production. Furthermore, we uncovered a high-level circRNA that was a transcript from the guanosine triphosphate (GTPase gene CNM01190 (gene ID: 3255052 in our yeast. Coincidentally, YPT5, CNM01190′s ortholog of the GTPase in Schizosaccharomyces pombe, protists, and humans, has already been proven to generate circRNAs. Additionally, overexpression of RNA debranching enzyme DBR1 had varied influence on the expression of circRNAs, indicating that multiple circRNA biosynthesis pathways exist in C. neoformans. Our study provides evidence for the existence of stable circRNAs in the opportunistic human pathogen C. neoformans and raises a question regarding their role related to pathogenesis in this yeast.

Fructan metabolism and changes in fructan composition during cold acclimation in perennial ryegrass

Science.gov (United States)

Abeynayake, Shamila W.; Etzerodt, Thomas P.; Jonavičienė, Kristina; Byrne, Stephen; Asp, Torben; Boelt, Birte

2015-01-01

Perennial ryegrass (Lolium perenne L.) produces high levels of fructans as a mixture of oligosaccharides and polysaccharides with different degrees of polymerization (DP). The present study describes the analysis of the compositional changes in the full spectrum of fructans, fructan distribution between above ground biomass (top) and the roots, and the transcription of candidate genes involved in fructan metabolism during cold acclimation in perennial ryegrass variety “Veyo” and ecotype “Falster” from distinct geographical origins. We observed changes in fructan composition and induction of low-DP fructans, especially DP = 4, in both the top and the roots of “Veyo” and “Falster” in response to low-temperature stress. The accumulation of DP > 50 fructans was only apparent in the top tissues where the Lp1-FFT expression is higher compared to the roots in both “Veyo” and “Falster.” Our results also show the accumulation and depolymerization of fructans with different DP, together with the induction of genes encoding fructosyltransferases and fructan exohydrolases in both “Veyo” and “Falster” during cold acclimation, supporting the hypothesis that fructan synthesis and depolymerization occurring simultaneously. The ecotype “Falster,” adapted to cold climates, increased total fructan content and produced more DP > 7 fructans in the roots than the variety “Veyo,” adapted to warmer climates. This indicates that high-DP fructan accumulation in roots may be an adaptive trait for plant recovery after abiotic stresses. PMID:26029229

Effective Climate Refugia for Cold-water Fishes

Science.gov (United States)

Ebersole, J. L.; Morelli, T. L.; Torgersen, C.; Isaak, D.; Keenan, D.; Labiosa, R.; Fullerton, A.; Massie, J.

2015-12-01

Climate change threatens to create fundamental shifts in in the distributions and abundances of endothermic organisms such as cold-water salmon and trout species (salmonids). Recently published projected declines in mid-latitude salmonid distributions under future climates range from modest to severe, depending on modeling approaches, assumptions, and spatial context of analyses. Given these projected losses, increased emphasis on management for ecosystem resilience to help buffer cold-water fish populations and their habitats against climate change is emerging. Using terms such as "climate-proofing", "climate-ready", and "climate refugia", such efforts stake a claim for an adaptive, anticipatory planning response to the climate change threat. To be effective, such approaches will need to address critical uncertainties in both the physical basis for projected landscape changes in water temperature and streamflow, as well as the biological responses of organisms. Recent efforts define future potential climate refugia based on projected streamflows, air temperatures, and associated water temperature changes. These efforts reflect the relatively strong conceptual foundation for linkages between regional climate change and local hydrological responses and thermal dynamics. Yet important questions remain. Drawing on case studies throughout the Pacific Northwest, we illustrate some key uncertainties in the responses of salmonids and their habitats to altered hydro-climatic regimes currently not well addressed by physical or ecological models. Key uncertainties include biotic interactions, organismal adaptive capacity, local climate decoupling due to groundwater-surface water interactions, the influence of human engineering responses, and synergies between climatic and other stressors. These uncertainties need not delay anticipatory planning, but rather highlight the need for identification and communication of actions with high probabilities of success, and targeted

Discovery of novel enzymes with industrial potential from a cold and alkaline environment by a combination of functional metagenomics and culturing

DEFF Research Database (Denmark)

Vester, Jan Kjølhede; Glaring, Mikkel Andreas; Stougaard, Peter

2014-01-01

Background: The use of cold-active enzymes has many advantages, including reduced energy consumption and easy inactivation. The ikaite columns of SW Greenland are permanently cold (4-6°C) and alkaline (above pH 10), and the microorganisms living there and their enzymes are adapted to these condit......Background: The use of cold-active enzymes has many advantages, including reduced energy consumption and easy inactivation. The ikaite columns of SW Greenland are permanently cold (4-6°C) and alkaline (above pH 10), and the microorganisms living there and their enzymes are adapted...... to these conditions. Since only a small fraction of the total microbial diversity can be cultured in the laboratory, a combined approach involving functional screening of a strain collection and a metagenomic library was undertaken for discovery of novel enzymes from the ikaite columns.Results: A strain collection...... complemented each other by targeting different microbial communities, highlighting the usefulness of combining methods for bioprospecting. Finally, we document here that ikaite columns constitute an important source of cold- and/or alkaline-active enzymes with industrial application potential....

Transcriptomic analysis of (group I Clostridium botulinum ATCC 3502 cold shock response.

Directory of Open Access Journals (Sweden)

Elias Dahlsten

Full Text Available Profound understanding of the mechanisms foodborne pathogenic bacteria utilize in adaptation to the environmental stress they encounter during food processing and storage is of paramount importance in design of control measures. Chill temperature is a central control measure applied in minimally processed foods; however, data on the mechanisms the foodborne pathogen Clostridium botulinum activates upon cold stress are scarce. Transcriptomic analysis on the C. botulinum ATCC 3502 strain upon temperature downshift from 37°C to 15°C was performed to identify the cold-responsive gene set of this organism. Significant up- or down-regulation of 16 and 11 genes, respectively, was observed 1 h after the cold shock. At 5 h after the temperature downshift, 199 and 210 genes were up- or down-regulated, respectively. Thus, the relatively small gene set affected initially indicated a targeted acute response to cold shock, whereas extensive metabolic remodeling appeared to take place after prolonged exposure to cold. Genes related to fatty acid biosynthesis, oxidative stress response, and iron uptake and storage were induced, in addition to mechanisms previously characterized as cold-tolerance related in bacteria. Furthermore, several uncharacterized DNA-binding transcriptional regulator-encoding genes were induced, suggesting involvement of novel regulatory mechanisms in the cold shock response of C. botulinum. The role of such regulators, CBO0477 and CBO0558A, in cold tolerance of C. botulinum ATCC 3502 was demonstrated by deteriorated growth of related mutants at 17°C.

A detailed view of Listeria monocytogenes’ adaptation and survival under cold temperature stress

DEFF Research Database (Denmark)

Hingston, P.; Hansen, Lisbeth Truelstrup; Wang, S.

The human pathogen Listeria monocytogenes (Lm) continues to be a challenge for the food industry where it is known to contaminate ready-to-eat foods and grow during refrigerated storage. In order to gain increased control of Lm in the food-supply-chain, an improved understanding of low temperature...... expression occured in Lm cells during late SP at 4°C, the most relevant physiological state to Lm’s survival in chilled food products. Common among all time points was the upregulation of nine genes required for branched-chain fatty acid (BCFA) synthesis, which was supported by an increase in membrane BCFAs...... from 77% at T1-4°C to 93%at T5-4°C. Putative cold stress regulatory mechanisms could be observed through negatively correlated expression levels of sense and antisense RNA. This research highlights Lm’s response to cold stress and provides deeper insight into how refrigerated storage conditions...

Fuzzy Control of Cold Storage Refrigeration System with Dynamic Coupling Compensation

Directory of Open Access Journals (Sweden)

Xiliang Ma

2018-01-01

Full Text Available Cold storage refrigeration systems possess the characteristics of multiple input and output and strong coupling, which brings challenges to the optimize control. To reduce the adverse effects of the coupling and improve the overall control performance of cold storage refrigeration systems, a control strategy with dynamic coupling compensation was studied. First, dynamic model of a cold storage refrigeration system was established based on the requirements of the control system. At the same time, the coupling between the components was studied. Second, to reduce the adverse effects of the coupling, a fuzzy controller with dynamic coupling compensation was designed. As for the fuzzy controller, a self-tuning fuzzy controller was served as the primary controller, and an adaptive neural network was adopted to compensate the dynamic coupling. Finally, the proposed control strategy was employed to the cold storage refrigeration system, and simulations were carried out in the condition of start-up, variable load, and variable degree of superheat, respectively. The simulation results verify the effectiveness of the fuzzy control method with dynamic coupling compensation.

Enzyme activity, hormone concentration in tree shrew (Tupaia belangeri during cold acclimation

Directory of Open Access Journals (Sweden)

Lin Zhang

2012-08-01

Full Text Available Environmental factors play an important role in the seasonal adaptation of body mass and thermogenesis in wild small mammals. The tree shrew (Tupaia belangeri, is a unique species of small mammals which is origin of island in the Oriental realm. The present study was to test the hypothesis that ambient temperature was a cue to induce adjustments in body mass, energy intake, metabolism, uncoupling protein 1 (UCP1 in brown adipose tissue (BAT, and other biochemical characters of T. belangeri during cold exposure about 21 days. Our data demonstrate that cold acclimation induced a remarkable increase in body mass, a significant increase in energy intake and metabolic rate, and high expression of UCP1 in BAT of T. belangeri. Cold acclimation induced an increase in cytochrome c oxidase (COX and Thyroidhormones (T3/T4. These data supported that T. belangeri increased the body mass and increased energy intake and expenditure under cold acclimation. Increased expression of UCP1 was potentially involved in the regulation of energy metabolism and thermogenic capacity following cold acclimation. And it through changes in enzyme activity and hormone concentration under cold acclimation, and suggested temperature changes play an important role in the regulation of thermogenic capacity in tree shrew.

Adapting Playware to Rehabilitation Practices

DEFF Research Database (Denmark)

Nielsen, Camilla Balslev; Lund, Henrik Hautop

2012-01-01

We describe how playware and games may become adaptive to the interaction of the individual user and how therapists use this adaptation property to apply modular interactive tiles in rehabilitation practices that demand highly individualized training. Therapists may use the interactive modular......’s lung (COLD) patients and stroke patients in hospitals and in the private homes of patients and elderly. Through a qualitative research methodology of the new practice with the tiles, we find that therapists are using the modular aspect of the tiles for personalized training of a vast variety of elderly...

Increasing the Adaptability of DoD Forces and Organizations

National Research Council Canada - National Science Library

Gorman, David

2001-01-01

The post-Cold War world demands increased adaptability. Since the accelerating pace of technological change reduces DoD ability to forecast threat characteristics, DOD force planning methodology is undermined...

Cold plate

Energy Technology Data Exchange (ETDEWEB)

Marroquin, Christopher M.; O' Connell, Kevin M.; Schultz, Mark D.; Tian, Shurong

2018-02-13

A cold plate, an electronic assembly including a cold plate, and a method for forming a cold plate are provided. The cold plate includes an interface plate and an opposing plate that form a plenum. The cold plate includes a plurality of active areas arranged for alignment over respective heat generating portions of an electronic assembly, and non-active areas between the active areas. A cooling fluid flows through the plenum. The plenum, at the non-active areas, has a reduced width and/or reduced height relative to the plenum at the active areas. The reduced width and/or height of the plenum, and exterior dimensions of cold plate, at the non-active areas allow the non-active areas to flex to accommodate surface variations of the electronics assembly. The reduced width and/or height non-active areas can be specifically shaped to fit between physical features of the electronics assembly.

Molecular characterization of elongase of very long-chain fatty acids 6 (elovl6) genes in Misgurnus anguillicaudatus and their potential roles in adaptation to cold temperature.

Science.gov (United States)

Chen, Jingwen; Cui, Yun; Yan, Jie; Jiang, Jimin; Cao, Xiaojuan; Gao, Jian

2018-08-05

Elongase of very long-chain fatty acids 6 (ELOVL6) is a rate-limiting enzyme catalyzing elongation of saturated and monounsaturated long-chain fatty acid. Although functional characteristics of Elovl6 have been demonstrated in mammal, the role of elovl6 in fish remains unclear. In this study, we firstly cloned three isoforms of elovl6 (elovl6a, elovl6b and elovl6-like) from loach (Misgurnus anguillicaudatus). Molecular characterizations of the three elovl6 isoforms in loach and their expressions of early life stages and different tissues were then determined. We also functionally characterized the three elovl6 isoforms using heterologous expression in baker's yeast. Results obtained here showed the three elovl6 proteins in loach can elongate C16:0 and C16:1 to C18:0 and C18:1, respectively. At last, to confirm the role of three loach elovl6 isoforms for elongation of fatty acids in adaption to cold stress, differences in skin histological structures, body fatty acid compositions, expressions of four hepatic lipogenesis or lipolysis related genes, and expressions of the three elovl6 isoforms and their related gene uncoupling protein 1 (ucp1) in different tissues were investigated in the loach reared in two different water temperatures (28 °C and 4 °C) for ten days. Cold stress increased ratios of C18/C16 and C20:5n-3/C18:3n-3 in loach body, and induced expressions of hepatic acyl-CoA delta-9 desaturase 1 (scd1), sterol-regulator element-binding protein 1 (srebp1), carnitine palmitoyltransferase 1 (cpt1) and fatty acid synthase (fas). Meanwhile, significant differences were found in expressions of the three elovl6 isoforms in different tissues between 28 °C and 4 °C groups. Overall, this study suggests that the three elovl6 isoforms in loach have ability to elongate C16 to C18, and elovl6 proteins in loach may play a role in adaptation to cold stress. Copyright © 2018 Elsevier B.V. All rights reserved.

Australia's arid-adapted butcherbirds experienced range expansions during Pleistocene glacial maxima.

Science.gov (United States)

Kearns, Anna M; Joseph, Leo; Toon, Alicia; Cook, Lyn G

2014-05-30

A model of range expansions during glacial maxima (GM) for cold-adapted species is generally accepted for the Northern Hemisphere. Given that GM in Australia largely resulted in the expansion of arid zones, rather than glaciation, it could be expected that arid-adapted species might have had expanded ranges at GM, as cold-adapted species did in the Northern Hemisphere. For Australian biota, however, it remains paradigmatic that arid-adapted species contracted to refugia at GM. Here we use multilocus data and ecological niche models (ENMs) to test alternative GM models for butcherbirds. ENMs, mtDNA and estimates of nuclear introgression and past population sizes support a model of GM expansion in the arid-tolerant Grey Butcherbird that resulted in secondary contact with its close relative--the savanna-inhabiting Silver-backed Butcherbird--whose contemporary distribution is widely separated. Together, these data reject the universal use of a GM contraction model for Australia's dry woodland and arid biota.

UV and cold tolerance of a pigment-producing Antarctic Janthinobacterium sp. Ant5-2

KAUST Repository

Mojib, Nazia; Farhoomand, Amin; Andersen, Dale T.; Bej, Asim K.

2013-01-01

In this paper, we describe the UV and cold tolerance of a purple violet pigment (PVP)-producing Antarctic bacterium, Janthinobacterium sp. Ant5-2 (PVP+) and compared its physiological adaptations with a pigmentless mutant strain (PVP-). A

Fructan accumulation and transcription of candidate genes during cold acclimation in three varieties of Poa pratensis

DEFF Research Database (Denmark)

Rao, R Shyama Prasad; Andersen, Jeppe Reitan; Dionisio, Giuseppe

2011-01-01

Poa pratensis, a type species for the grass family (Poaceae), is an important cool season grass that accumulates fructans as a polysaccharide reserve. We studied fructan contents and expression of candidate fructan metabolism genes during cold acclimation in three varieties of P. pratensis adapted...... to different environments: Northern Norway, Denmark, and the Netherlands. Fructan content increased significantly during cold acclimation and varieties showed significant differences in the level of fructan accumulation. cDNA sequences of putative fructosyltransferase (FT), fructan exohydrolase (FEH), and cold...... acclimation protein (CAP) genes were identified and cloned. In agreement with a function in fructan biosynthesis, transcription of a putative sucrose:fructan 6-fructosyltransferase (Pp6-SFT) gene was induced during cold acclimation and fructan accumulation in all three P. pratensis varieties. Transcription...

Effects of glucose on the Reactive Black 5 (RB5 decolorization by two white rot basidiomycetes

Directory of Open Access Journals (Sweden)

Tony Hadibarata

2011-11-01

Full Text Available The capacities of glucose in the decolorization process of an azo dye, Reactive Black 5 (RB5, by two white rot basidiomycetes, Pleurotus sp. F019 and Trametes sp. F054 were investigated. The results indicated that the dye degradation by the two fungi was extremely correlated with the presence of glucose in the culture and the process of fungi growth. Decolorization of 200 mg dye/l was increased from 62% and 69% to 100% within 20–25 h with the increase of glucose from 5 to 15 g/l, and the activity of manganese dependent peroxidase (MnP increased by 2–9 fold in this case. Hydrogen peroxide of 0.55 mg/l and 0.43 mg/l were detected in 10 h in Pleurotus sp. F019 and Trametes sp. F054 cultures.

Conceptualizing Cold Disasters

DEFF Research Database (Denmark)

Lauta, Kristian Cedervall; Dahlberg, Rasmus; Vendelø, Morten Thanning

2017-01-01

In the present article, we explore in more depth the particular circumstances and characteristics of governing what we call ‘cold disasters’, and thereby, the paper sets out to investigate how disasters in cold contexts distinguish themselves from other disasters, and what the implications hereof...... are for the conceptualization and governance of cold disasters. Hence, the paper can also be viewed as a response to Alexander’s (2012a) recent call for new theory in the field of disaster risk reduction. The article is structured in four overall parts. The first part, Cold Context, provides an overview of the specific...... conditions in a cold context, exemplified by the Arctic, and zooms in on Greenland to provide more specific background for the paper. The second part, Disasters in Cold Contexts, discusses “cold disasters” in relation to disaster theory, in order to, elucidate how cold disasters challenge existing...

Proteomic analysis of Mortierella isabellina M6-22 during cold stress.

Science.gov (United States)

Hu, Binbin; Luo, Minzhou; Ji, Xiuling; Lin, Lianbing; Wei, Yunlin; Zhang, Qi

2016-11-01

We aimed to gain a better understanding of cold adaption in Mortierella isabellina M6-22 by using proteomics approaches. The temperature range and optimal temperature for M6-22 growth were investigated, and composition changes in fatty acids were analyzed. Accompanied with the 2-D gel electrophoresis, MALDI-TOF/TOF-MS analysis was conducted to characterize alterations in protein profiling in M6-22 cultured at 30 °C for 24 h and 15 °C for another 24 h when compared with those cultured at 30 °C for 48 h. Gene Ontology (GO) cluster analysis was finally conducted for successfully identified proteins. M6-22 cells could grow well at temperatures ranging from 15 to 30 °C. As temperature decreased from 30 to 15 °C, LA and GLA significantly increased from 11.63 to 17.85 % and from 9.12 to 13.19 %, respectively, while oleic acid significantly decreased from 47.25 to 36.53 %. Proteomics analyses revealed 111 differentially expressed protein spots, among which 5 unique proteins (A38, A40, A47, A49 and A58), 29 up-regulated proteins and 10 down-regulated proteins were identified by MALDI-TOF/TOF-MS. GO enrichment analysis demonstrated that these proteins mainly involved in glycolytic pathway (A34 and A50), electron transport (A28), ATP production (A35 and B39) and protein modification (A38). A total of 44 differentially expressed proteins have been successfully identified in M. isabellina M6-22 cultured at 15 °C. These proteins may play important roles in cold adaption via regulation of ATP synthesis, activation of cold-adaptive proteins, degradation of needless protein, accumulation of PUFAs, etc.

Saccharomyces cerevisiae glycerol/H+ symporter Stl1p is essential for cold/near-freeze and freeze stress adaptation. A simple recipe with high biotechnological potential is given

Directory of Open Access Journals (Sweden)

Ferreira Célia

2010-11-01

Full Text Available Abstract Background Freezing is an increasingly important means of preservation and storage of microbial strains used for many types of industrial applications including food processing. However, the yeast mechanisms of tolerance and sensitivity to freeze or near-freeze stress are still poorly understood. More knowledge on this regard would improve their biotechnological potential. Glycerol, in particular intracellular glycerol, has been assigned as a cryoprotectant, also important for cold/near-freeze stress adaptation. The S. cerevisiae glycerol active transporter Stl1p plays an important role on the fast accumulation of glycerol. This gene is expressed under gluconeogenic conditions, under osmotic shock and stress, as well as under high temperatures. Results We found that cells grown on STL1 induction medium (YPGE and subjected to cold/near-freeze stress, displayed an extremely high expression of this gene, also visible at glycerol/H+ symporter activity level. Under the same conditions, the strains harbouring this transporter accumulated more than 400 mM glycerol, whereas the glycerol/H+ symporter mutant presented less than 1 mM. Consistently, the strains able to accumulate glycerol survive 25-50% more than the stl1Δ mutant. Conclusions In this work, we report the contribution of the glycerol/H+ symporter Stl1p for the accumulation and maintenance of glycerol intracellular levels, and consequently cell survival at cold/near-freeze and freeze temperatures. These findings have a high biotechnological impact, as they show that any S. cerevisiae strain already in use can become more resistant to cold/freeze-thaw stress just by simply adding glycerol to the broth. The combination of low temperatures with extracellular glycerol will induce the transporter Stl1p. This solution avoids the use of transgenic strains, in particular in food industry.

EXPERIMENTAL KETOSIS IN MAN. ’COLD KETOSIS’ COMPARED WITH POST-EXERCISE KETOSIS AND NUTRITIONAL KETOSIS.

Science.gov (United States)

This investigation was designed to answer three questions: (1) Does repetition of a ketosis following a 10 mile walk cause adaptive responses; (2...Does repeated exposure to cold result in a diminished ketotic response; (3) Do women show a post-exercise ketosis like men. Protocols for the three...exercise ketosis similar to that shown by men, despite much individual variability. Prolonged moderate exercise, exposure to cold and starvation all produce similar metabolic effects. (Author)

Engineered disulfide bonds increase active-site local stability and reduce catalytic activity of a cold-adapted alkaline phosphatase.

Science.gov (United States)

Asgeirsson, Bjarni; Adalbjörnsson, Björn Vidar; Gylfason, Gudjón Andri

2007-06-01

Alkaline phosphatase is an extracellular enzyme that is membrane-bound in eukaryotes but resides in the periplasmic space of bacteria. It normally carries four cysteine residues that form two disulfide bonds, for instance in the APs of Escherichia coli and vertebrates. An AP variant from a Vibrio sp. has only one cysteine residue. This cysteine is second next to the nucleophilic serine in the active site. We have individually modified seven residues to cysteine that are on two loops predicted to be within a 5 A radius. Four of them formed a disulfide bond to the endogenous cysteine. Thermal stability was monitored by circular dichroism and activity measurements. Global stability was similar to the wild-type enzyme. However, a significant increase in heat-stability was observed for the disulfide-containing variants using activity as a measure, together with a large reduction in catalytic rates (k(cat)) and a general decrease in Km values. The results suggest that a high degree of mobility near the active site and in the helix carrying the endogenous cysteine is essential for full catalytic efficiency in the cold-adapted AP.

Influence of soil fungi (basidiomycetes) on the migration of Cs 134 + 137 and Sr 90 in coniferous forest soils

International Nuclear Information System (INIS)

Roemmelt, R.; Hiersche, L.; Schaller, G.; Wirth, E.

1990-01-01

During the first three years after the Chernobyl event high Cs 134 + 137 activities in fruitbodies of basidiomycetes have been measured. A decline of activities with time has not yet been observed. The activities are considerably higher compared to agricultural products from the same area. In order to study the movement of radiocesium in coniferous forest sites, the activities in soil, fungi, and plants have been measured. Based on these results a model to describe the cesium cycling in coniferous forest ecosystems is proposed with special emphasis on the influence of soil fungi and plants on the migration of cesium. As measurements of Sr 90 in forest ecosystems are rare this nuclide has been included in the investigations. (author)

Cold urticaria. Dissociation of cold-evoked histamine release and urticara following cold challenge.

Science.gov (United States)

Keahey, T M; Greaves, M W

1980-02-01

Nine patients with acquired cold urticaria were studied to assess the effects of beta-adrenergic agents, xanthines, and corticosteroids on cold-evoked histamine release from skin in vivo. The patients, in all of whom an immediate urticarial response developed after cooling of the forearm, demonstrated release of histamine into the venous blood draining that forearm. Following treatment with aminophylline and albuterol in combination or prednisone alone, suppression of histamine release occurred in all but one patient. In some patients, this was accompanied by a subjective diminution in pruritus or buring, but there was no significant improvement in the ensuing edema or erythema. In one patient, total suppression of histamine release was achieved without any effect on whealing and erythema in response to cold challenge. Our results suggest that histamine is not central to the pathogenesis of vascular changes in acquired cold urticaria.

Changes in cold tolerance due to a 14-day stay in the Canadian Arctic

Science.gov (United States)

Livingstone, S. D.; Romet, T.; Keefe, A. A.; Nolan, R. W.

1996-12-01

Responses to cold exposure tests both locally and of the whole body were examined in subjects who stayed in the Arctic (average maximum and minimum temperatures -11 and -21° C respectively) for 14 days of skiing and sleeping in tents. These changes were compared to responses in subjects living working in Ottawa, Canada (average max. and min. temperatures -5 and -11° C respectively). The tests were done before the stay in the Arctic (Pre), immediately after the return (Post 1) and approximately 32 days after the return (Post 2). For the whole-body cold exposure each subject, wearing only shorts and lying on a rope mesh cot, was exposed to an ambient temperature of 10° C. There was no consistent response in the changes of metabolic or body temperature to this exposure in either of groups and, in addition, the changes over time were variable. Cold induced vasodilatation (CIVD) was determined by measuring temperature changes in the middle finger of the nondominant hand upon immersion in ice water for 30 min. CIVD was depressed after the Arctic exposure whilst during the Post 2 testing, although variable, did not return to the Pre values; the responses of the control group were similar. These results indicate that normal seasonal changes may be as important in adaptation as a stay in the Arctic. Caution is advised in the separation of seasonal effects when examining the changes in adaptation after exposure to a cold environment.

Proteomics investigation reveals cell death-associated proteins of basidiomycete fungus Trametes versicolor treated with Ferruginol.

Science.gov (United States)

Chen, Yu-Han; Yeh, Ting-Feng; Chu, Fang-Hua; Hsu, Fu-Lan; Chang, Shang-Tzen

2015-01-14

Ferruginol has antifungal activity against wood-rot fungi (basidiomycetes). However, specific research on the antifungal mechanisms of ferruginol is scarce. Two-dimensional gel electrophoresis and fluorescent image analysis were employed to evaluate the differential protein expression of wood-rot fungus Trametes versicolor treated with or without ferruginol. Results from protein identification of tryptic peptides via liquid chromatography–electrospray ionization tandem mass spectrometry (LC–ESI-MS/MS) analyses revealed 17 protein assignments with differential expression. Downregulation of cytoskeleton β-tubulin 3 indicates that ferruginol has potential to be used as a microtubule-disrupting agent. Downregulation of major facilitator superfamily (MFS)–multiple drug resistance (MDR) transporter and peroxiredoxin TSA1 were observed, suggesting reduction in self-defensive capabilities of T. versicolor. In addition, the proteins involved in polypeptide sorting and DNA repair were also downregulated, while heat shock proteins and autophagy-related protein 7 were upregulated. These observations reveal that such cellular dysfunction and damage caused by ferruginol lead to growth inhibition and autophagic cell death of fungi.

Characteristics of mutants designed to incorporate a new ion pair into the structure of a cold adapted subtilisin-like serine proteinase.

Science.gov (United States)

Sigurdardóttir, Anna Gudný; Arnórsdóttir, Jóhanna; Thorbjarnardóttir, Sigrídur H; Eggertsson, Gudmundur; Suhre, Karsten; Kristjánsson, Magnús M

2009-03-01

Structural comparisons of VPR, a subtilisin-like serine proteinase from a psychrotrophic Vibrio species and a thermophilic homologue, aqualysin I, have led us to hypothesize about the roles of different residues in the temperature adaptation of the enzymes. Some of these hypotheses are now being examined by analysis of mutants of the enzymes. The selected substitutions are believed to increase the stability of the cold adapted enzyme based on structural analysis of the thermostable structure. We report here on mutants, which were designed to incorporate an ion pair into the structure of VPR. The residues Asp17 and Arg259 are assumed to form an ion pair in aqualysin I. The cold adapted VPR contains Asn (Asn15) and Lys (Lys257) at corresponding sites in its structure. In VPR, Asn 15 is located on a surface loop with its side group pointing towards the side chain of Lys257. By substituting Asn15 by Asp (N15D) it was considered feasible that a salt bridge would form between the oppositely charged groups. To mimic further the putative salt bridge from the thermophile enzyme the corresponding double mutant (N15D/K257R) was also produced. The N15D mutation increased the thermal stability of VPR by approximately 3 degrees C, both in T(50%) and T(m). Addition of the K257R mutation did not however, increase the stability of the double mutant any further. Despite this stabilization of the VPR mutants the catalytic activity (k(cat)) against the substrate Suc-AAPF-NH-Np was increased in the mutants. Molecular dynamics simulations on wild type and the two mutant proteins suggested that indeed a salt bridge was formed in both cases. Furthermore, a truncated form of the N15D mutant (N15DDeltaC) was produced, lacking a 15 residue long C-terminal extended sequence not present in the thermophilic enzyme. In wild type VPR this supposedly moveable, negatively charged arm on the protein molecule might interfere with the new salt bridge introduced as a result of the N15D mutation

Temporal characteristics of cold pain perception.

Science.gov (United States)

Frölich, Michael A; Bolding, Mark S; Cutter, Gary R; Ness, Timothy J; Zhang, Kui

2010-08-09

Adaptation to a sustained stimulus is an important phenomenon in psychophysical experiments. When studying the response to an experimental task, the investigator has to account for the change in perceived stimulus intensity with repeated stimulus application and, if the stimulus is sustained, for the change in intensity during the presentation. An example of a sustained stimulus is the cold pressor task (CPT). The task has been used both as an experimental pain task and to study cardiovascular physiology. In functional imaging research, the CPT has been used to evaluate cognitive processing of a noxious stimulus. Investigators typically model the stimulus in a block design as a categorical (on-off) stimulus and do not account for a temporal change in stimulus perception. If the perceived stimulus changes over time, the results may be misleading. Therefore, we characterized the time course of cold pain in human volunteers and developed a model of the temporal characteristics of perceived cold pain. Fifteen healthy participants underwent cold pain testing by immersing their right foot into a container filled with ice water (2 degrees C) for 30s alternating with a 30s immersion into a container filled with tepid water 32 degrees C (control). Participants rated the pain intensity using an electronic slide algometer. Using a mixed general linear model (effectively a polynomial regression model), we determined that pain ratings follow a crescendo-decrescendo pattern that can be described well using a quadratic model. We conclude that the time course of quantitative perception differs fundamentally from the time course of stimulus presentation. This may be important when looking for the physiological correlates of perception as opposed to the presence of a stimulus per se. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

Relationships of self-identified cold tolerance and cold-induced vasodilatation in the finger

Science.gov (United States)

Park, Joonhee; Lee, Joo-Young

2016-04-01

This study was conducted to investigate relationships of self-identified cold tolerance and cold-induced vasodilatation (CIVD) in the finger. Nine males and 34 females participated in the following 2 tests: a CIVD test and a self-reported survey. The CIVD test was conducted 30-min cold-water immersion (3.8 ± 0.3 °C) of the middle finger at an air temperature of 27.9 ± 0.1 °C. The self-reported questionnaire consisted of 28 questions about whole and local body cold and heat tolerances. By a cluster analysis on the survey results, the participants were divided into two groups: high self-identified cold tolerance (HSCT, n = 25) and low self-identified cold tolerance (LSCT, n = 18). LSCT had lower self-identified cold tolerance ( P cold or heat tolerance had relationships with cold tolerance index, T max, and amplitude ( P cold tolerance classified through a standardized survey could be a good index to predict physiological cold tolerance.

Chilling- and Freezing-Induced Alterations in Cytosine Methylation and Its Association with the Cold Tolerance of an Alpine Subnival Plant, Chorispora bungeana.

Directory of Open Access Journals (Sweden)

Yuan Song

Full Text Available Chilling (0-18°C and freezing (<0°C are two distinct types of cold stresses. Epigenetic regulation can play an important role in plant adaptation to abiotic stresses. However, it is not yet clear whether and how epigenetic modification (i.e., DNA methylation mediates the adaptation to cold stresses in nature (e.g., in alpine regions. Especially, whether the adaptation to chilling and freezing is involved in differential epigenetic regulations in plants is largely unknown. Chorispora bungeana is an alpine subnival plant that is distributed in the freeze-thaw tundra in Asia, where chilling and freezing frequently fluctuate daily (24 h. To disentangle how C. bungeana copes with these intricate cold stresses through epigenetic modifications, plants of C. bungeana were treated at 4°C (chilling and -4°C (freezing over five periods of time (0-24 h. Methylation-sensitive amplified fragment-length polymorphism markers were used to investigate the variation in DNA methylation of C. bungeana in response to chilling and freezing. It was found that the alterations in DNA methylation of C. bungeana largely occurred over the period of chilling and freezing. Moreover, chilling and freezing appeared to gradually induce distinct DNA methylation variations, as the treatment went on (e.g., after 12 h. Forty-three cold-induced polymorphic fragments were randomly selected and further analyzed, and three of the cloned fragments were homologous to genes encoding alcohol dehydrogenase, UDP-glucosyltransferase and polygalacturonase-inhibiting protein. These candidate genes verified the existence of different expressive patterns between chilling and freezing. Our results showed that C. bungeana responded to cold stresses rapidly through the alterations of DNA methylation, and that chilling and freezing induced different DNA methylation changes. Therefore, we conclude that epigenetic modifications can potentially serve as a rapid and flexible mechanism for C. bungeana

Studies on the enzymes produced by Basidiomycetes. Part 1. The production of crude enzymes

Energy Technology Data Exchange (ETDEWEB)

Hong, J. S.; Kim, D.H.

1981-01-01

Cellulase, protease, and xylanase, formation by the basidiomycetes, Pleurotus ostreatus 301 and Lentinus edodes 3-1 in growth on rice straw medium were studied. Cultural conditions adequate for enzyme production and effects of various materials and inorganic salts added to the rice straw media were investigated. Lentinus edodes 3-1 was an excellent producer of cellulase and xylanase, and Pleurotus ostreatus 301 of protease. The optimum conditions for enzyme production were 30 degrees for cellulase production and at 25 degrees for xylanase and protease production, with 75% moisture content and initial pH of 5.0-6.0. The appropriate incubation times for enzyme production were 30 days and 35 days for Pleurotus ostreatus 301 and Lentinus edodes 3-1, respectively. Among the various materials added, defatted soybean, defatted rape seed, or defatted sesame were all effective in enzyme production but reduced mycelial growth. Rice bran was also effective, particularly at a 30% concentration. The addition of inorganic salts enhanced enzyme production. Among inorganic salts, the optimum concentration of CaCO3 was 5%, and that of CaSO4 was 2%.

Seizing market shaping opportunities for vaccine cold chain equipment.

Science.gov (United States)

Azimi, Tara; Franzel, Lauren; Probst, Nina

2017-04-19

Gavi, the Vaccine Alliance, supports immunisation programmes in eligible countries to reach children with lifesaving vaccines. Dramatic improvement in the scale and performance of current cold chain systems is required to extend the reach of immunisation services - especially for children living in remote locations - to advance progress towards full vaccine coverage. Achieving these improvements will require a healthier market for cold chain equipment where the products meet user needs, are sustainably priced, and are available in sufficient quantities to meet demand. Yet evidence suggests that the cold chain market has suffered from several failures including limited demand visibility, fragmented procurement, and insufficient information exchange between manufacturers and buyers on needs and equipment performance. One of Gavi's strategic goals is to shape markets for vaccines and other immunisation products, including cold chain equipment and in 2015, Gavi created a new mechanism - the Cold Chain Equipment (CCE) Optimisation Platform - to strengthen country cold chain systems by offering financial support and incentives for higher performing CCE. The main objective of the CCE Platform is to get more equipment that is efficient, sustainable, and better performing deployed to every health facility where it is required at an affordable price. To achieve these objectives, Gavi is putting in place tested market shaping approaches and tools adapted for the CCE market: the development of market strategies or 'roadmaps'; improvement of product performance through the development of target product profiles (TPPs); strategic engagement with CCE manufacturers and countries to enhance information sharing; and tailoring procurement tactics to the CCE market. These approaches and tools will allow for increased demand and supply of higher-performing, cost-effective and quality products. By strengthening immunisation systems with improved cold chain equipment, Gavi countries can

Cold-induced vasoconstriction at forearm and hand skin sites: the effect of age

NARCIS (Netherlands)

Kingma, B.R.M.; Frijns, A.J.H.; Saris, W.H.M.; Steenhoven, van A.A.; Marken Lichtenbelt, van W.D.

2010-01-01

During mild cold exposure, elderly are at risk of hypothermia. In humans, glabrous skin at the hands is well adapted as a heat exchanger. Evidence exists that elderly show equal vasoconstriction due to local cooling at the ventral forearm, yet no age effects on vasoconstriction at hand skin have

The influence of short-term cold stress on the metabolism of non-structural carbohydrates in polar grasses

OpenAIRE

Łopieńska-Biernat Elżbieta; Pastorczyk Marta; Giełwanowska Irena; Żółtowska Krystyna; Stryiński Robert; Zaobidna Ewa

2017-01-01

Plants adapt to extremely low temperatures in polar regions by maximizing their photosynthetic efficiency and accumulating cryoprotective and osmoprotective compounds. Flowering plants of the family Poaceae growing in the Arctic and in the Antarctic were investigated. Their responses to cold stress were analyzed under laboratory conditions. Samples were collected after 24 h and 48 h of cold treatment. Quantitative and qualitative changes of sugars are found among different species, but they c...

Burning Cold: Involvement of TRPA1 in Noxious Cold Sensation

OpenAIRE

Kwan, Kelvin Y.; Corey, David P.

2009-01-01

Soon after its discovery ten years ago, the ion channel TRPA1 was proposed as a sensor of noxious cold. Evidence for its activation by painfully cold temperatures (below ~15° C) has been mixed, however. Some groups found that cold elicits a nonselective conductance in cells expressing TRPA1; others found no activation, or argued that activation is an indirect effect of elevated \\(Ca^{ 2+}\\) . Sensory cells from the trigeminal and dorsal root ganglia that are activated by cold were sometimes c...

Transcriptomic Response of Chinese Yew (Taxus chinensis to Cold Stress

Directory of Open Access Journals (Sweden)

Xianghua Yu

2017-04-01

Full Text Available Taxus chinensis is a rare and endangered shrub, highly sensitive to temperature changes and widely known for its potential in cancer treatment. How gene expression of T. chinensis responds to low temperature is still unknown. To investigate cold response of the genus Taxus, we obtained the transcriptome profiles of T. chinensis grown under normal and low temperature (cold stress, 0°C conditions using Illumina Miseq sequencing. A transcriptome including 83,963 transcripts and 62,654 genes were assembled from 4.16 Gb of reads data. Comparative transcriptomic analysis identified 2,025 differently expressed (DE isoforms at p < 0.05, of which 1,437 were up-regulated by cold stress and 588 were down-regulated. Annotation of DE isoforms indicated that transcription factors (TFs in the MAPK signaling pathway and TF families of NAC, WRKY, bZIP, MYB, and ERF were transcriptionally activated. This might have been caused by the accumulation of secondary messengers, such as reactive oxygen species (ROS and Ca2+. While accumulation of ROS will have caused damages to cells, our results indicated that to adapt to low temperatures T. chinensis employed a series of mechanisms to minimize these damages. The mechanisms included: (i cold-enhanced expression of ROS deoxidant systems, such as peroxidase and phospholipid hydroperoxide glutathione peroxidase, to remove ROS. This was further confirmed by analyses showing increased activity of POD, SOD, and CAT under cold stress. (ii Activation of starch and sucrose metabolism, thiamine metabolism, and purine metabolism by cold-stress to produce metabolites which either protect cell organelles or lower the ROS content in cells. These processes are regulated by ROS signaling, as the “feedback” toward ROS accumulation.

Alteration in the ultrastructural morphology of mycelial hyphae and the dynamics of transcriptional activity of lytic enzyme genes during basidiomycete morphogenesis.

Science.gov (United States)

Vetchinkina, Elena; Kupryashina, Maria; Gorshkov, Vladimir; Ageeva, Marina; Gogolev, Yuri; Nikitina, Valentina

2017-04-01

The morphogenesis of macromycetes is a complex multilevel process resulting in a set of molecular-genetic, physiological-biochemical, and morphological-ultrastructural changes in the cells. When the xylotrophic basidiomycetes Lentinus edodes, Grifola frondosa, and Ganoderma lucidum were grown on wood waste as the substrate, the ultrastructural morphology of the mycelial hyphal cell walls differed considerably between mycelium and morphostructures. As the macromycetes passed from vegetative to generative development, the expression of the tyr1, tyr2, chi1, chi2, exg1, exg2, and exg3 genes was activated. These genes encode enzymes such as tyrosinase, chitinase, and glucanase, which play essential roles in cell wall growth and morphogenesis.

Cold-Hearted or Cool-Headed: Physical Coldness Promotes Utilitarian Moral Judgment

Directory of Open Access Journals (Sweden)

Hiroko eNakamura

2014-10-01

Full Text Available In the current study, we examine the effect of physical coldness on personal moral dilemma judgment. Previous studies have indicated that utilitarian moral judgment—sacrificing a few people to achieve the greater good for others—was facilitated when: (1 participants suppressed an initial emotional response and deliberately thought about the utility of outcomes; (2 participants had a high-level construal mindset and focused on abstract goals (e.g., save many; or (3 there was a decreasing emotional response to sacrificing a few. In two experiments, we exposed participants to extreme cold or typical room temperature and then asked them to make personal moral dilemma judgments. The results of Experiment 1 indicated that coldness prompted utilitarian judgment, but the effect of coldness was independent from deliberate thought or abstract high-level construal mindset. As Experiment 2 revealed, coldness facilitated utilitarian judgment via reduced empathic feelings. Therefore, physical coldness did not affect the cool-headed deliberate process or the abstract high-level construal mindset. Rather, coldness biased people toward being cold-hearted, reduced empathetic concern about a sacrificed victim, and facilitated utilitarian moral judgments.

Mapping and validation of QTLs for cold tolerance at seedling stage in rice from an indica cultivar Habiganj Boro VI (Hbj.BVI).

Science.gov (United States)

Biswas, Partha S; Khatun, Hasina; Das, Nomita; Sarker, Md Mahathir; Anisuzzaman, M

2017-12-01

Yellowing, stunting, and seedling death associated with cold stress is a common problem in many Asian countries for winter rice cultivation. Improvement of cultivars through marker-assisted selection of QTLs for cold tolerance at seedling stage from locally adapted germplasm/cultivar is the most effective and sustainable strategy to resolve this problem. A study was undertaken to map QTLs from 151 F 2:3 progenies of a cross between a cold susceptible variety, BR1 and a locally adapted traditional indica cultivar, Hbj.BVI. A total of six significant QTLs were identified for two cold tolerance indices-cold-induced leaf discoloration and survival rate after a recovery period of seven days on chromosomes 6, 8, 11, and 12. Among these QTLs, qCTSL - 8 - 1 and qCTSS - 8 - 1 being co-localized into RM7027-RM339 on chromosome 8 and qCTSL - 12 - 1 and qCTSS - 12 - 1 into RM247-RM2529 on chromosome 12 showed 12.78 and 14.96% contribution, respectively, to the total phenotypic variation for cold tolerance. Validation of QTL effect in BC 1 F 3 population derived a cross between a cold susceptible BRRI dhan28 and Hbj.BVI showed dominating effect of qCTSL - 12 - 1 on cold tolerance at seedling stage and it became stronger when one or more other QTLs were co-segregated with it. These results suggest that the QTLs identified in this study are stable and effective on other genetic background also, which warrant the use of these QTLs for further study aiming to cultivar development for seedling stage cold tolerance.

Cold Shock Proteins: a Minireview with Special Emphasis on Csp-family of Enteropathogenic Yersinia

Directory of Open Access Journals (Sweden)

Riikka Keto-Timonen

2016-07-01

Full Text Available Bacteria have evolved a number of mechanisms for coping with stress and adapting to changing environmental conditions. Many bacteria produce small cold shock proteins (Csp as a response to rapid temperature downshift (cold shock. During cold shock, the cell membrane fluidity and enzyme activity decrease, and the efficiency of transcription and translation is reduced due to stabilization of nucleic acid secondary structures. Moreover, protein folding is inefficient and ribosome function is hampered. Csps are thought to counteract these harmful effects by serving as nucleic acid chaperons that may prevent the formation of secondary structures in mRNA at low temperature and thus facilitate the initiation of translation. However, some Csps are non-cold inducible and they are reported to be involved in various cellular processes to promote normal growth and stress adaptation responses. Csps have been shown to contribute to osmotic, oxidative, starvation, pH and ethanol stress tolerance as well as to host cell invasion. Therefore, Csps seem to have a wider role in stress tolerance of bacteria than previously assumed. Yersinia enterocolitica and Yersinia pseudotuberculosis are enteropathogens that can spread through foodstuffs and cause an enteric infection called yersiniosis. Enteropathogenic Yersinia are psychrotrophs that are able to grow at temperatures close to 0ºC and thus they set great challenges for the modern food industry. To be able to efficiently control psychrotrophic Yersinia during food production and storage, it is essential to understand the functions and roles of Csps in stress response of enteropathogenic Yersinia.

Grooved cold moderator tests

International Nuclear Information System (INIS)

Inoue, K.; Kiyanagi, Y.; Iwasa, H.; Watanabe, N.; Ikeda, S.; Carpenter, J.M.; Ishikawa, Y.

1983-01-01

We performed some grooved cold moderator experiments for methane at 20 K by using the Hokkaido University linac to obtain information to be used in the planning of the KENS-I' project. Cold neutron gains, spatial distribution of emitted beams and time distribution of the neutrons in the grooved cold moderator were measured. Furthermore, we assessed the effects of the grooved cold moderator on the performances of the spectrometers presently installed at the KENS-I cold source. We concluded that the grooved cold moderator benefited appreciably the performances of the spectrometers

Constructing and Screening a Metagenomic Library of a Cold and Alkaline Extreme Environment.

Science.gov (United States)

Glaring, Mikkel A; Vester, Jan K; Stougaard, Peter

2017-01-01

Natural cold or alkaline environments are common on Earth. A rare combination of these two extremes is found in the permanently cold (less than 6 °C) and alkaline (pH above 10) ikaite columns in the Ikka Fjord in Southern Greenland. Bioprospecting efforts have established the ikaite columns as a source of bacteria and enzymes adapted to these conditions. They have also highlighted the limitations of cultivation-based methods in this extreme environment and metagenomic approaches may provide access to novel extremophilic enzymes from the uncultured majority of bacteria. Here, we describe the construction and screening of a metagenomic library of the prokaryotic community inhabiting the ikaite columns.

Cold plasma decontamination using flexible jet arrays

Science.gov (United States)

Konesky, Gregory

2010-04-01

Arrays of atmospheric discharge cold plasma jets have been used to decontaminate surfaces of a wide range of microorganisms quickly, yet not damage that surface. Its effectiveness in decomposing simulated chemical warfare agents has also been demonstrated, and may also find use in assisting in the cleanup of radiological weapons. Large area jet arrays, with short dwell times, are necessary for practical applications. Realistic situations will also require jet arrays that are flexible to adapt to contoured or irregular surfaces. Various large area jet array prototypes, both planar and flexible, are described, as is the application to atmospheric decontamination.

Legionella species diversity and dynamics from surface reservoir to tap water: from cold adaptation to thermophily.

Science.gov (United States)

Lesnik, René; Brettar, Ingrid; Höfle, Manfred G

2016-05-01

Water samples of the Drinking Water Supply System (DWSS) of the city of Braunschweig were analysed for its Legionella species composition using genus-specific PCR amplicons and single-strand conformation polymorphism (SSCP) fingerprint analyses based on 16S rRNA genes. These analyses comprised the whole supply chain including raw water, treatment process and large-scale storage, and a seasonal study of finished drinking water sampled monthly from cold and hot tap water. Treatment of raw water had a major impact on Legionella species by reducing their diversity and abundances. The Legionella species composition of the tap water was highly distinct from that of both source waters. In cold water, 8-14 different phylotypes of Legionella (PTLs) were observed per sample with relative abundances ranging from >1% to 53%. In hot water, L. pneumophila was present during all seasons at high relative abundances (8-40%) accompanied by 5-14 other PTLs of which 6 PTLs were in common with cold water. This thermophilic Legionella community, including L. pneumophila, was able to grow in the hot water above 50 °C. Such thermophilic Legionella populations are of general relevance for drinking water management and public health, but also for the ecology and evolution of the genus Legionella.

Cold acclimation increases cold tolerance independently of diapause programing in the bean bug, Riptortus pedestris.

Science.gov (United States)

Rozsypal, J; Moos, M; Goto, S G

2017-10-17

The bean bug (Riptortus pedestris) is a pest of soybeans and other legumes in Japan and other Asian countries. It enters a facultative adult diapause on exposure to short days. While photoperiodism and diapause are well understood in R. pedestris, knowledge of cold tolerance is very limited, as is information on the effect of diapause on cold tolerance. We examined the effect of photoperiod, cold acclimation, and feeding status on cold tolerance in R. pedestris. We found that cold acclimation significantly increased survival at -10°C in both long- and short-day adult R. pedestris. Since the difference in cold survival between long- and short-day cold-acclimated groups was only marginal, we conclude that entering diapause is not crucial for R. pedestris to successfully pass through cold acclimation and become cold tolerant. We observed similar effects in 5th instar nymphs, with both long- and short-day cold-acclimated groups surviving longer cold exposures compared with non-acclimated groups. Starvation, which was tested only in adult bugs, had only a negligible and negative impact on cold survival. Although cold tolerance significantly increased with cold acclimation in adult bugs, supercooling capacity unexpectedly decreased. Our results suggest that changes in supercooling capacity as well as in water content are unrelated to cold tolerance in R. pedestris. An analysis of metabolites revealed differences between the treatments, and while several metabolites markedly increased with cold acclimation, their concentrations were too low to have a significant effect on cold tolerance.

Substantial production of drosophilin A methyl ether (tetrachloro-1,4-dimethoxybenzene) by the lignicolous basidiomycete Phellinus badius in the heartwood of mesquite ( Prosopis juliflora) trees

Science.gov (United States)

Garvie, Laurence A. J.; Wilkens, Barry; Groy, Thomas L.; Glaeser, Jessie A.

2015-04-01

Toxic organohalogen pollutants produced as by-products of industrial processes, such as chloroform and polychlorinated dibenzo- p-dioxins, also have significant natural sources. A substantial terrestrial source of halogenated organics originates from fungal decay of wood and leaf litter. Here we show that the lignicolous basidiomycete Phellinus badius deposits up to 30,000 mg of the halogenated metabolite drosophilin A methyl ether (DAME, tetrachloro-1,4-dimethoxybenzene) per kilogram of decayed heartwood in the mesquite Prosopis juliflora. DAME occurs as clusters of glassy crystals up to 1 mm long within the decayed heartwood. In addition, the Phellinus badius basidiocarps contain an average of 24,000 mg DAME/kg dried fruiting body, testifying to the significant translocation and accumulation of Cl accompanied by DAME biosynthesis. The high DAME concentrations attest to the substantial Cl content of the heartwood, which averages near 5,000 ppm, with Cl/K near 1:1, consistent with an inorganic chloride precursor. Phellinus badius has a circumglobal distribution in the tropics and subtropics, where it is widely distributed on hardwoods and commonly associated with decay of mesquite. There is the potential for extensive DAME formation within decayed heartwood worldwide given the extensive range of Phellinus badius and its propensity to form DAME within mesquites. Further, DAME production is not limited to Phellinus badius but occurs in a range of lignicolous basidiomycetes, suggesting a significant natural reservoir for this chloroaromatic with potential environmental implications.

Survival strategies of freshwater insects in cold environments

Directory of Open Access Journals (Sweden)

Valeria LENCIONI

2004-09-01

Full Text Available At high latitudes and altitudes, ice formation is a major variable affecting survival of freshwater fauna and hence the abundance and composition of invertebrate communities. Freezing, but also desiccation and anoxia, are lethal threats to all life stages of aquatic insects, from the eggs to the adults. During cold periods, the aquatic stages commonly remain in or move to a portion of the water body that will not freeze or dry (e.g., deep waters of lakes, springs and hyporheic zone where they can remain active. Less frequently they migrate to habitats that will freeze at the onset of winter. Insects have developed a complex of strategies to survive at their physiological temperature minimum, comprising (a morphological (melanism, reduction in size, hairiness/pubescence, brachyptery and aptery, (b behavioural (basking in the sun, changes in feeding and mating habit, parthenogenesis, polyploidy, ovoviviparity, habitat selection and cocoon building, (c ecological (extension of development to several years by quiescence or diapause and reduction of the number of generations per year, (d physiological and biochemical (freezing tolerance and freezing avoidance adaptations. Most species develop a combination of these survival strategies that can be different in the aquatic and terrestrial phase. Freezing avoidance and freezing tolerance may be accompanied by diapause. Both cold hardiness and diapause manifest during the unfavourable season and: (i involve storage of food resources (commonly glycogen and lipids; (ii are under hormonal control (ecdysone and juvenile hormone; (iii involve a depression or suppression of the oxidative metabolism with mitochondrial degradation. However, where the growing season is reduced to a few weeks, insects may develop cold hardiness without entering diapause, maintaining in the haemolymph a high concentration of Thermal Hysteris Proteins (THPs for the entire year and a slow but continuous growth. A synthesis of

Molecular Structural Basis for the Cold Adaptedness of the Psychrophilic β-Glucosidase BglU in Micrococcus antarcticus.

Science.gov (United States)

Miao, Li-Li; Hou, Yan-Jie; Fan, Hong-Xia; Qu, Jie; Qi, Chao; Liu, Ying; Li, De-Feng; Liu, Zhi-Pei

2016-01-22

Psychrophilic enzymes play crucial roles in cold adaptation of microbes and provide useful models for studies of protein evolution, folding, and dynamic properties. We examined the crystal structure (2.2-Å resolution) of the psychrophilic β-glucosidase BglU, a member of the glycosyl hydrolase 1 (GH1) enzyme family found in the cold-adapted bacterium Micrococcus antarcticus. Structural comparison and sequence alignment between BglU and its mesophilic and thermophilic counterpart enzymes (BglB and GlyTn, respectively) revealed two notable features distinct to BglU: (i) a unique long-loop L3 (35 versus 7 amino acids in others) involved in substrate binding and (ii) a unique amino acid, His299 (Tyr in others), involved in the stabilization of an ordered water molecule chain. Shortening of loop L3 to 25 amino acids reduced low-temperature catalytic activity, substrate-binding ability, the optimal temperature, and the melting temperature (Tm). Mutation of His299 to Tyr increased the optimal temperature, the Tm, and the catalytic activity. Conversely, mutation of Tyr301 to His in BglB caused a reduction in catalytic activity, thermostability, and the optimal temperature (45 to 35°C). Loop L3 shortening and H299Y substitution jointly restored enzyme activity to the level of BglU, but at moderate temperatures. Our findings indicate that loop L3 controls the level of catalytic activity at low temperatures, residue His299 is responsible for thermolability (particularly heat lability of the active center), and long-loop L3 and His299 are jointly responsible for the psychrophilic properties. The described structural basis for the cold adaptedness of BglU will be helpful for structure-based engineering of new cold-adapted enzymes and for the production of mutants useful in a variety of industrial processes at different temperatures. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Wound healing activity of an aqueous extract of the Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes).

Science.gov (United States)

Gupta, Asheesh; Kirar, Vandana; Keshri, Gaurav Kr; Gola, Shefali; Yadav, Anju; Negi, Prem Singh; Misra, Kshipra

2014-01-01

The Lingzhi or Reishi medicinal mushroom Ganoderma lucidum (higher Basidiomycetes) is popular because of its health-promoting properties. The effects of G. lucidum extract on cancer, hypertension, hypercholesterolemia, and hepatitis have been reported by many researchers. This investigation was undertaken to evaluate the healing efficacy of an aqueous lyophilized extract of G. lucidum from the Indian Himalayan region on dermal excision wound in experimental rats. The extract used in the study was found to be rich in total polyphenol and flavonoid contents. The healing efficacy was comparatively assessed with a reference povidone-iodine ointment. The G. lucidum extract showed significant enhanced healing activity, evidenced by an increase in wound contraction, collagen accumulation (hydroxyproline), hexosamine, and total protein contents. Histopathological findings further supported the biochemical indices. The results suggest that aqueous lyophilized extract of G. lucidum possesses significant wound-healing activity.

Carotenoid accumulation in orange-pigmented Capsicum annuum fruit, regulated at multiple levels

Science.gov (United States)

Rodriguez-Uribe, Laura; Guzman, Ivette; Rajapakse, Wathsala; Richins, Richard D.; O’Connell, Mary A.

2012-01-01

The pericarp of Capsicum fruit is a rich dietary source of carotenoids. Accumulation of these compounds may be controlled, in part, by gene transcription of biosynthetic enzymes. The carotenoid composition in a number of orange-coloured C. annuum cultivars was determined using HPLC and compared with transcript abundances for four carotenogenic enzymes, Psy, LcyB, CrtZ-2, and Ccs determined by qRT-PCR. There were unique carotenoid profiles as well as distinct patterns of transcription of carotenogenic enzymes within the seven orange-coloured cultivars. In one cultivar, ‘Fogo’, carrying the mutant ccs-3 allele, transcripts were detected for this gene, but no CCS protein accumulated. The premature stop termination in ccs-3 prevented expression of the biosynthetic activity to synthesize the capsanthin and capsorubin forms of carotenoids. In two other orange-coloured cultivars, ‘Orange Grande’ and ‘Oriole’, both with wild-type versions of all four carotenogenic enzymes, no transcripts for Ccs were detected and no red pigments accumulated. Finally, in a third case, the orange-coloured cultivar, Canary, transcripts for all four of the wild-type carotenogenic enzymes were readily detected yet no CCS protein appeared to accumulate and no red carotenoids were synthesized. In the past, mutations in Psy and Ccs have been identified as the loci controlling colour in the fruit. Now there is evidence that a non-structural gene may control colour development in Capsicum. PMID:21948863

Conserved TRAM Domain Functions as an Archaeal Cold Shock Protein via RNA Chaperone Activity

Directory of Open Access Journals (Sweden)

Bo Zhang

2017-08-01

Full Text Available Cold shock proteins (Csps enable organisms to acclimate to and survive in cold environments and the bacterial CspA family exerts the cold protection via its RNA chaperone activity. However, most Archaea do not contain orthologs to the bacterial csp. TRAM, a conserved domain among RNA modification proteins ubiquitously distributed in organisms, occurs as an individual protein in most archaeal phyla and has a structural similarity to Csp proteins, yet its biological functions remain unknown. Through physiological and biochemical studies on four TRAM proteins from a cold adaptive archaeon Methanolobus psychrophilus R15, this work demonstrated that TRAM is an archaeal Csp and exhibits RNA chaperone activity. Three TRAM encoding genes (Mpsy_0643, Mpsy_3043, and Mpsy_3066 exhibited remarkable cold-shock induced transcription and were preferentially translated at lower temperature (18°C, while the fourth (Mpsy_2002 was constitutively expressed. They were all able to complement the cspABGE mutant of Escherichia coli BX04 that does not grow in cold temperatures and showed transcriptional antitermination. TRAM3066 (gene product of Mpsy_3066 and TRAM2002 (gene product of Mpsy_2002 displayed sequence-non-specific RNA but not DNA binding activity, and TRAM3066 assisted RNases in degradation of structured RNA, thus validating the RNA chaperone activity of TRAMs. Given the chaperone activity, TRAM is predicted to function beyond a Csp.

The influence of short-term cold stress on the metabolism of non-structural carbohydrates in polar grasses

Directory of Open Access Journals (Sweden)

Łopieńska-Biernat Elżbieta

2017-06-01

Full Text Available Plants adapt to extremely low temperatures in polar regions by maximizing their photosynthetic efficiency and accumulating cryoprotective and osmoprotective compounds. Flowering plants of the family Poaceae growing in the Arctic and in the Antarctic were investigated. Their responses to cold stress were analyzed under laboratory conditions. Samples were collected after 24 h and 48 h of cold treatment. Quantitative and qualitative changes of sugars are found among different species, but they can differ within a genus of the family Poaceae. The values of the investigated parameters in Poa annua differed considerably depending to the biogeographic origin of plants. At the beginning of the experiment, Antarctic plants were acclimatized in greenhouse characterized by significantly higher content of sugars, including storage reserves, sucrose and starch, but lower total protein content. After 24 h of exposure to cold stress, much smaller changes in the examined parameters were noted in Antarctic plants than in locally grown specimens. Total sugar content and sucrose, starch and glucose levels were nearly constant in P. annua, but they varied significantly. Those changes are responsible for the high adaptability of P. annua to survive and develop in highly unsupportive environments and colonize new regions.

Hedonic "adaptation"

Directory of Open Access Journals (Sweden)

Paul Rozin

2008-02-01

Full Text Available People live in a world in which they are surrounded by potential disgust elicitors such as ``used'' chairs, air, silverware, and money as well as excretory activities. People function in this world by ignoring most of these, by active avoidance, reframing, or adaptation. The issue is particularly striking for professions, such as morticians, surgeons, or sanitation workers, in which there is frequent contact with major disgust elicitors. In this study, we study the ``adaptation'' process to dead bodies as disgust elicitors, by measuring specific types of disgust sensitivity in medical students before and after they have spent a few months dissecting a cadaver. Using the Disgust Scale, we find a significant reduction in disgust responses to death and body envelope violation elicitors, but no significant change in any other specific type of disgust. There is a clear reduction in discomfort at touching a cold dead body, but not in touching a human body which is still warm after death.

Cold formability of steels

International Nuclear Information System (INIS)

Lafond, G.; Leclerq, G.; Moliexe, F.; Namdar, R.; Roesch, L.; Sanz, G.

1977-01-01

This work was essentially aimed to the study of the following three questions. Is it possible to assess the cold formability of steels using simple material properties as criteria. What values of mechanical properties can one expect to reach in cold formed parts. Are there simple ways of characterizing the speroidization treatments carried out on steels before cold forming operations. The present report describes the results obtained during this investigation. It is logically divided into three separate parts. Experimental study of cold formability in wire drawing. Influence of metallurgical variables on mechanical properties of high carbon cold drawn wires. Contribution to the study of characterization methods of cold forming steels subjected to a spheroidization heat treatment

De novo synthesis and decomposition of veratryl alcohol by a lignin-degrading basidiomycete

Energy Technology Data Exchange (ETDEWEB)

Lundquist, K; Kirk, T K

1978-01-01

In studies of the metabolism of lignin-related aromatics by the ligninolytic basidiomycete Phanerochaete chrysosporium (strain ME-446), a compound was consistently found (TLC) in chloroform extracts of cultures. The substance, identified as veratryl alcohol (1), was first suspected to be a non-metabilizable degradation product of the aromatics studied, which included various guaiacyl- and veratryl-type compounds. Veratryl alcohol itself, in fact, was included in the first experiments. Further investigation with cultures containing /sup 14/C-glucose as growth substrate revealed that 1 is synthesized de novo from glucose. Although the culture medium contained in addition to glucose 0.01 M phthalate or aconitate (buffers), and 0.6 mM L-asparagine (nutrient nitrogen), glucose was the sole source of veratryl alcohol carbon. Introduction of the purified biosynthetic /sup 14/C-veratryl alcohol into fresh cultures resulted in 40% decomposition to /sup 14/CO/sub 2/ in 20 days, showing that the fungus not only makes the compound, it also degrades it. Russell et al. found veratryl alcohol and veratraldehyde in cultures of a ligninolytic fungus (Polystictus versicolor), but considered them to be degradation products of the lignin-related aromatics or wood meal present in the cultures. Reports of synthesis or decomposition of veratryl alcohol by microorganisms were not found.

The impact of cold spells on mortality and effect modification by cold spell characteristics

Science.gov (United States)

Wang, Lijun; Liu, Tao; Hu, Mengjue; Zeng, Weilin; Zhang, Yonghui; Rutherford, Shannon; Lin, Hualiang; Xiao, Jianpeng; Yin, Peng; Liu, Jiangmei; Chu, Cordia; Tong, Shilu; Ma, Wenjun; Zhou, Maigeng

2016-12-01

In China, the health impact of cold weather has received little attention, which limits our understanding of the health impacts of climate change. We collected daily mortality and meteorological data in 66 communities across China from 2006 to 2011. Within each community, we estimated the effect of cold spell exposure on mortality using a Distributed Lag Nonlinear Model (DLNM). We also examined the modification effect of cold spell characteristics (intensity, duration, and timing) and individual-specific factors (causes of death, age, gender and education). Meta-analysis method was finally used to estimate the overall effects. The overall cumulative excess risk (CER) of non-accidental mortality during cold spell days was 28.2% (95% CI: 21.4%, 35.3%) compared with non-cold spell days. There was a significant increase in mortality when the cold spell duration and intensity increased or occurred earlier in the season. Cold spell effects and effect modification by cold spell characteristics were more pronounced in south China. The elderly, people with low education level and those with respiratory diseases were generally more vulnerable to cold spells. Cold spells statistically significantly increase mortality risk in China, with greater effects in southern China. This effect is modified by cold spell characteristics and individual-level factors.

Lignin-modifying enzymes of the white rot basidiomycete Ganoderma lucidum

Energy Technology Data Exchange (ETDEWEB)

D/Souza, T.M.; Merritt, C.S.; Reddy, C.A.

1999-12-01

Ganoderma lucidum, a white rot basidiomycete widely distributed worldwide, was studied for the production of the lignin-modifying enzymes laccase, manganese-dependent peroxidase (MnP), and lignin peroxidase (LiP). Laccase levels observed in high-nitrogen shaken cultures were much greater than those seen in low-nitrogen, malt extract, or wool-grown cultures and those reported for most other white rot fungi to date. Laccase production was readily seen in cultures grown with pine or poplar as the sole carbon and energy source. Cultures containing both pine and poplar showed 5- to 10-fold-higher levels of laccase than cultures containing pine or poplar alone. Since syringyl units are structural components important in poplar lignin and other hardwoods but much less so in pine lignin and other softwoods, pine cultures were supplemented with syringic acid, and this resulted in laccase levels comparable to those seen in pine-plus-poplar cultures. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of concentrated extracellular culture fluid from HM cultures showed two laccase activity bands, where as isoelectric focusing revealed five major laccase activity bands with estimated pIs of 3.0, 4.25, 4.5, and 5.1. Low levels of MnP activity were detected in poplar-grown cultures but not in cultures grown with pine, with pine plus syringic acid, or in HN medium. No LiP activity was seen in any of the media tested; however, probing the genomic DNA with the LiP cDNA (CLG4) from the white rot fungus Phanerochaete chrysosporium showed distinct hybridization bands suggesting the presence of lip-like sequences in G. lucidum.

Quantification and assessment of heat and cold waves in Novi Sad, Northern Serbia

Science.gov (United States)

Basarin, Biljana; Lukić, Tin; Matzarakis, Andreas

2016-01-01

Physiologically equivalent temperature (PET) has been applied to the analysis of heat and cold waves and human thermal conditions in Novi Sad, Serbia. A series of daily minimum and maximum air temperature, relative humidity, wind, and cloud cover was used to calculate PET for the investigated period 1949-2012. The heat and cold wave analysis was carried out on days with PET values exceeding defined thresholds. Additionally, the acclimatization approach was introduced to evaluate human adaptation to interannual thermal perception. Trend analysis has revealed the presence of increasing trend in summer PET anomalies, number of days above defined threshold, number of heat waves, and average duration of heat waves per year since 1981. Moreover, winter PET anomaly as well as the number of days below certain threshold and number of cold waves per year until 1980 was decreasing, but the decrease was not statistically significant. The highest number of heat waves during summer was registered in the last two decades, but also in the first decade of the investigated period. On the other hand, the number of cold waves during six decades is quite similar and the differences are very small.

Climate adaption and post-fire restoration of a foundational perennial in cold desert: Insights from intraspecific variation in response to weather

Science.gov (United States)

Brabec, Martha M.; Germino, Matthew; Richardson, Bryce A.

2017-01-01

1.The loss of foundational but fire-intolerant perennials such as sagebrush due to increases in fire size and frequency in semiarid regions has motivated efforts to restore them, often with mixed or even no success. Seeds of sagebrush Artemisia tridentata and related species must be moved considerable distances from seed source to planting sites, but such transfers have not been guided by an understanding of local climate adaptation. Initial seedling establishment and its response to weather are a key demographic bottleneck that likely varies among subspecies and populations of sagebrush. 2.We assessed differences in survival, growth, and physiological responses of sagebrush to weather among eleven seed sources that varied in subspecies, cytotype, and climates-of-origin over 18 months following outplanting. Diploid or polyploid populations of mountain, Wyoming, and basin big sagebrush (A.tridentata ssp. vaseyana, A.tridentata ssp. wyomingensis, and A.tridentata ssp. tridentata, respectively) were planted onto five burned sites that normally support A.t.wyomingensis with some A.t.tridentata. 3.A.t.wyomingensis had the most growth and survival, and tetraploid populations had greater survival and height than diploids. Seasonal timing of mortality varied among the subspecies/cytotypes and was more closely related to minimum temperatures than water deficit. 4.Temperatures required to induce ice formation were up to 6°C more negative in 4n-A.t.tridentata and A.t.wyomingensis than other subspecies/cytotypes, indicating greater freezing avoidance. In contrast, freezing resistance of photosynthesis varied only 1°C among subspecies/cytotypes, being greatest in A.t.wyomingensis and least in the subspecies normally considered most cold-adapted,A.t.vaseyana. A large spectrum of reliance on freezing-avoidance vs. freezing-tolerance was observed and corresponded to differences in post-fire survivorship among subspecies/cytotypes. Differences in water deficit

Cold-induced vasodilation comparison between Bangladeshi and Japanese natives.

Science.gov (United States)

Khatun, Aklima; Ashikaga, Sakura; Nagano, Hisaho; Hasib, Md Abdul; Taimura, Akihiro

2016-05-03

The human thermoregulation system responds to changes in environmental temperature, so humans can self-adapt to a wide range of climates. People from tropical and temperate areas have different cold tolerance. This study compared the tolerance of Bangladeshi (tropical) and Japanese (temperate) people to local cold exposure on cold-induced vasodilation (CIVD). Eight Bangladeshi males (now residing in Japan) and 14 Japanese males (residing in Japan) participated in this study. All are sedentary, regular university students. The Bangladeshi subject's duration of stay in Japan was 2.50 ± 2.52 years. The subject's left hand middle finger was immersed in 5 °C water for 20 min to assess their CIVD response (the experiment was conducted in an artificial climate chamber controlled at 25 °C with 50% RH). Compared with the Bangladeshi (BD) group, the Japanese (JP) group displayed some differences. There were significant differences between the BD and JP groups in temperature before immersion (TBI), which were 33.04 ± 1.98 and 34.62 ± 0.94 °C, and time of temperature rise (TTR), which were 5.35 ± 0.82 and 3.72 ± 0.68 min, respectively. There was also a significant difference in the time of sensation rise (TSR) of 8.69 ± 6.49 and 3.26 ± 0.97 min between the BD and JP groups, respectively (P cold exposure than the Bangladeshi group (tropical) evaluated by the CIVD test.

Cold adaptation and replicable microbial community development during long-term low-temperature anaerobic digestion treatment of synthetic sewage.

Science.gov (United States)

Keating, C; Hughes, D; Mahony, T; Cysneiros, D; Ijaz, U Z; Smith, C J; O'Flaherty, V

2018-07-01

The development and activity of a cold-adapting microbial community was monitored during low-temperature anaerobic digestion (LtAD) treatment of wastewater. Two replicate hybrid anaerobic sludge bed-fixed-film reactors treated a synthetic sewage wastewater at 12°C, at organic loading rates of 0.25-1.0 kg chemical oxygen demand (COD) m-3 d-1, over 889 days. The inoculum was obtained from a full-scale anaerobic digestion reactor, which was operated at 37°C. Both LtAD reactors readily degraded the influent with COD removal efficiencies regularly exceeding 78% for both the total and soluble COD fractions. The biomass from both reactors was sampled temporally and tested for activity against hydrolytic and methanogenic substrates at 12°C and 37°C. Data indicated that significantly enhanced low-temperature hydrolytic and methanogenic activity developed in both systems. For example, the hydrolysis rate constant (k) at 12°C had increased 20-30-fold by comparison to the inoculum by day 500. Substrate affinity also increased for hydrolytic substrates at low temperature. Next generation sequencing demonstrated that a shift in a community structure occurred over the trial, involving a 1-log-fold change in 25 SEQS (OTU-free approach) from the inoculum. Microbial community structure changes and process performance were replicable in the LtAD reactors.

Genomic and exoproteomic analyses of cold- and alkaline-adapted bacteria reveal an abundance of secreted subtilisin-like proteases.

Science.gov (United States)

Lylloff, Jeanette E; Hansen, Lea B S; Jepsen, Morten; Sanggaard, Kristian W; Vester, Jan K; Enghild, Jan J; Sørensen, Søren J; Stougaard, Peter; Glaring, Mikkel A

2016-03-01

Proteases active at low temperature or high pH are used in many commercial applications, including the detergent, food and feed industries, and bacteria specifically adapted to these conditions are a potential source of novel proteases. Environments combining these two extremes are very rare, but offer the promise of proteases ideally suited to work at both high pH and low temperature. In this report, bacteria from two cold and alkaline environments, the ikaite columns in Greenland and alkaline ponds in the McMurdo Dry Valley region, Antarctica, were screened for extracellular protease activity. Two isolates, Arsukibacterium ikkense from Greenland and a related strain, Arsukibacterium sp. MJ3, from Antarctica, were further characterized with respect to protease production. Genome sequencing identified a range of potential extracellular proteases including a number of putative secreted subtilisins. An extensive liquid chromatography-tandem mass spectrometry analysis of proteins secreted by A. ikkense identified six subtilisin-like proteases as abundant components of the exoproteome in addition to other peptidases potentially involved in complete degradation of extracellular protein. Screening of Arsukibacterium genome libraries in Escherichia coli identified two orthologous secreted subtilisins active at pH 10 and 20 °C, which were also present in the A. ikkense exoproteome. Recombinant production of both proteases confirmed the observed activity. © 2016 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Cold/menthol TRPM8 receptors initiate the cold-shock response and protect germ cells from cold-shock-induced oxidation.

Science.gov (United States)

Borowiec, Anne-Sophie; Sion, Benoit; Chalmel, Frédéric; D Rolland, Antoine; Lemonnier, Loïc; De Clerck, Tatiana; Bokhobza, Alexandre; Derouiche, Sandra; Dewailly, Etienne; Slomianny, Christian; Mauduit, Claire; Benahmed, Mohamed; Roudbaraki, Morad; Jégou, Bernard; Prevarskaya, Natalia; Bidaux, Gabriel

2016-09-01

Testes of most male mammals present the particularity of being externalized from the body and are consequently slightly cooler than core body temperature (4-8°C below). Although, hypothermia of the testis is known to increase germ cells apoptosis, little is known about the underlying molecular mechanisms, including cold sensors, transduction pathways, and apoptosis triggers. In this study, using a functional knockout mouse model of the cold and menthol receptors, dubbed transient receptor potential melastatine 8 (TRPM8) channels, we found that TRPM8 initiated the cold-shock response by differentially modulating cold- and heat-shock proteins. Besides, apoptosis of germ cells increased in proportion to the cooling level in control mice but was independent of temperature in knockout mice. We also observed that the rate of germ cell death correlated positively with the reactive oxygen species level and negatively with the expression of the detoxifying enzymes. This result suggests that the TRPM8 sensor is a key determinant of germ cell fate under hypothermic stimulation.-Borowiec, A.-S., Sion, B., Chalmel, F., Rolland, A. D., Lemonnier, L., De Clerck, T., Bokhobza, A., Derouiche, S., Dewailly, E., Slomianny, C., Mauduit, C., Benahmed, M., Roudbaraki, M., Jégou, B., Prevarskaya, N., Bidaux, G. Cold/menthol TRPM8 receptors initiate the cold-shock response and protect germ cells from cold-shock-induced oxidation. © The Author(s).

Protein Adaptations in Archaeal Extremophiles

Directory of Open Access Journals (Sweden)

Christopher J. Reed

2013-01-01

Full Text Available Extremophiles, especially those in Archaea, have a myriad of adaptations that keep their cellular proteins stable and active under the extreme conditions in which they live. Rather than having one basic set of adaptations that works for all environments, Archaea have evolved separate protein features that are customized for each environment. We categorized the Archaea into three general groups to describe what is known about their protein adaptations: thermophilic, psychrophilic, and halophilic. Thermophilic proteins tend to have a prominent hydrophobic core and increased electrostatic interactions to maintain activity at high temperatures. Psychrophilic proteins have a reduced hydrophobic core and a less charged protein surface to maintain flexibility and activity under cold temperatures. Halophilic proteins are characterized by increased negative surface charge due to increased acidic amino acid content and peptide insertions, which compensates for the extreme ionic conditions. While acidophiles, alkaliphiles, and piezophiles are their own class of Archaea, their protein adaptations toward pH and pressure are less discernible. By understanding the protein adaptations used by archaeal extremophiles, we hope to be able to engineer and utilize proteins for industrial, environmental, and biotechnological applications where function in extreme conditions is required for activity.

Protein Adaptations in Archaeal Extremophiles

Science.gov (United States)

Reed, Christopher J.; Lewis, Hunter; Trejo, Eric; Winston, Vern; Evilia, Caryn

2013-01-01

Extremophiles, especially those in Archaea, have a myriad of adaptations that keep their cellular proteins stable and active under the extreme conditions in which they live. Rather than having one basic set of adaptations that works for all environments, Archaea have evolved separate protein features that are customized for each environment. We categorized the Archaea into three general groups to describe what is known about their protein adaptations: thermophilic, psychrophilic, and halophilic. Thermophilic proteins tend to have a prominent hydrophobic core and increased electrostatic interactions to maintain activity at high temperatures. Psychrophilic proteins have a reduced hydrophobic core and a less charged protein surface to maintain flexibility and activity under cold temperatures. Halophilic proteins are characterized by increased negative surface charge due to increased acidic amino acid content and peptide insertions, which compensates for the extreme ionic conditions. While acidophiles, alkaliphiles, and piezophiles are their own class of Archaea, their protein adaptations toward pH and pressure are less discernible. By understanding the protein adaptations used by archaeal extremophiles, we hope to be able to engineer and utilize proteins for industrial, environmental, and biotechnological applications where function in extreme conditions is required for activity. PMID:24151449

Cold stress alters transcription in meiotic anthers of cold tolerant chickpea (Cicer arietinum L.).

Science.gov (United States)

Sharma, Kamal Dev; Nayyar, Harsh

2014-10-11

Cold stress at reproductive phase in susceptible chickpea (Cicer arietinum L.) leads to pollen sterility induced flower abortion. The tolerant genotypes, on the other hand, produce viable pollen and set seed under cold stress. Genomic information on pollen development in cold-tolerant chickpea under cold stress is currently unavailable. DDRT-PCR analysis was carried out to identify anther genes involved in cold tolerance in chickpea genotype ICC16349 (cold-tolerant). A total of 9205 EST bands were analyzed. Cold stress altered expression of 127 ESTs (90 up-regulated, 37 down-regulated) in anthers, more than two third (92) of which were novel with unknown protein identity and function. Remaining about one third (35) belonged to several functional categories such as pollen development, signal transduction, ion transport, transcription, carbohydrate metabolism, translation, energy and cell division. The categories with more number of transcripts were carbohydrate/triacylglycerol metabolism, signal transduction, pollen development and transport. All but two transcripts in these categories were up-regulated under cold stress. To identify time of regulation after stress and organ specificity, expression levels of 25 differentially regulated transcripts were also studied in anthers at six time points and in four organs (anthers, gynoecium, leaves and roots) at four time points. Limited number of genes were involved in regulating cold tolerance in chickpea anthers. Moreover, the cold tolerance was manifested by up-regulation of majority of the differentially expressed transcripts. The anthers appeared to employ dual cold tolerance mechanism based on their protection from cold by enhancing triacylglycerol and carbohydrate metabolism; and maintenance of normal pollen development by regulating pollen development genes. Functional characterization of about two third of the novel genes is needed to have precise understanding of the cold tolerance mechanisms in chickpea anthers.

Cough & Cold Medicine Abuse

Science.gov (United States)

... Videos for Educators Search English Español Cough & Cold Medicine Abuse KidsHealth / For Teens / Cough & Cold Medicine Abuse ... resfriado Why Do People Use Cough and Cold Medicines to Get High? There's an ingredient in many ...

Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.

Science.gov (United States)

Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas

2015-02-01

Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.

Exploring the Antarctic soil metagenome as a source of novel cold-adapted enzymes and genetic mobile elements

Directory of Open Access Journals (Sweden)

Renaud Berlemont

2011-06-01

Full Text Available Metagenomic library PP1 was obtained from Antarctic soil samples. Both functional and genotypic metagenomic screening were used for the isolation of novel cold-adapted enzymes with potential applications, and for the detection of genetic elements associated with gene mobilization, respectively. Fourteen lipase/esterase-, 14 amylase-, 3 protease-, and 11 cellulase-producing clones were detected by activity-driven screening, with apparent maximum activities around 35 °C for both amylolytic and lipolytic enzymes, and 35-55 °C for cellulases, as observed for other cold-adapted enzymes. However, the behavior of at least one of the studied cellulases is more compatible to that observed for mesophilic enzymes. These enzymes are usually still active at temperatures above 60 °C, probably resulting in a psychrotolerant behavior in Antarctic soils. Metagenomics allows to access novel genes encoding for enzymatic and biophysic properties from almost every environment with potential benefits for biotechnological and industrial applications. Only intI- and tnp-like genes were detected by PCR, encoding for proteins with 58-86 %, and 58-73 % amino acid identity with known entries, respectively. Two clones, BAC 27A-9 and BAC 14A-5, seem to present unique syntenic organizations, suggesting the occurrence of gene rearrangements that were probably due to evolutionary divergences within the genus or facilitated by the association with transposable elements. The evidence for genetic elements related to recruitment and mobilization of genes (transposons/integrons in an extreme environment like Antarctica reinforces the hypothesis of the origin of some of the genes disseminated by mobile elements among "human-associated" microorganisms.A partir de muestras de suelo antártico se obtuvo la metagenoteca PP1. Esta fue sometida a análisis funcionales y genotípicos para el aislamiento de nuevas enzimas adaptadas al frío con potenciales aplicaciones, y para la detecci

Lipid-induced thermogenesis is up-regulated by the first cold-water immersions in juvenile penguins.

Science.gov (United States)

Teulier, Loïc; Rey, Benjamin; Tornos, Jérémy; Le Coadic, Marion; Monternier, Pierre-Axel; Bourguignon, Aurore; Dolmazon, Virginie; Romestaing, Caroline; Rouanet, Jean-Louis; Duchamp, Claude; Roussel, Damien

2016-07-01

The passage from shore to marine life is a critical step in the development of juvenile penguins and is characterized by a fuel selection towards lipid oxidation concomitant to an enhancement of lipid-induced thermogenesis. However, mechanisms of such thermogenic improvement at fledging remain undefined. We used two different groups of pre-fledging king penguins (Aptenodytes patagonicus) to investigate the specific contribution of cold exposure during water immersion to lipid metabolism. Terrestrial penguins that had never been immersed in cold water were compared with experimentally cold-water immersed juveniles. Experimentally immersed penguins underwent ten successive immersions at approximately 9-10 °C for 5 h over 3 weeks. We evaluated adaptive thermogenesis by measuring body temperature, metabolic rate and shivering activity in fully immersed penguins exposed to water temperatures ranging from 12 to 29 °C. Both never-immersed and experimentally immersed penguins were able to maintain their homeothermy in cold water, exhibiting similar thermogenic activity. In vivo, perfusion of lipid emulsion at thermoneutrality induced a twofold larger calorigenic response in experimentally immersed than in never-immersed birds. In vitro, the respiratory rates and the oxidative phosphorylation efficiency of isolated muscle mitochondria were not improved with cold-water immersions. The present study shows that acclimation to cold water only partially reproduced the fuel selection towards lipid oxidation that characterizes penguin acclimatization to marine life.

Tolerance to multiple climate stressors: A case study of Douglas-fir drought and cold hardiness

Science.gov (United States)

Bansal, Sheel; Harrington, Constance A; St. Clair, John Bradley

2016-01-01

Summary: 1. Drought and freeze events are two of the most common forms of climate extremes which result in tree damage or death, and the frequency and intensity of both stressors may increase with climate change. Few studies have examined natural covariation in stress tolerance traits to cope with multiple stressors among wild plant populations. 2. We assessed the capacity of coastal Douglas-fir (Pseudotsuga menziesii var. menziesii), an ecologically and economically important species in the northwestern USA, to tolerate both drought and cold stress on 35 populations grown in common gardens. We used principal components analysis to combine drought and cold hardiness trait data into generalized stress hardiness traits to model geographic variation in hardiness as a function of climate across the Douglas-fir range. 3. Drought and cold hardiness converged among populations along winter temperature gradients and diverged along summer precipitation gradients. Populations originating in regions with cold winters had relatively high tolerance to both drought and cold stress, which is likely due to overlapping adaptations for coping with winter desiccation. Populations from regions with dry summers had increased drought hardiness but reduced cold hardiness, suggesting a trade-off in tolerance mechanisms. 4. Our findings highlight the necessity to look beyond bivariate trait–climate relationships and instead consider multiple traits and climate variables to effectively model and manage for the impacts of climate change on widespread species.

Prefoldins Negatively Regulate Cold Acclimation in Arabidopsis thaliana by Promoting Nuclear Proteasome-Mediated HY5 Degradation.

Science.gov (United States)

Perea-Resa, Carlos; Rodríguez-Milla, Miguel A; Iniesto, Elisa; Rubio, Vicente; Salinas, Julio

2017-06-05

The process of cold acclimation is an important adaptive response whereby many plants from temperate regions increase their freezing tolerance after being exposed to low non-freezing temperatures. The correct development of this response relies on proper accumulation of a number of transcription factors that regulate expression patterns of cold-responsive genes. Multiple studies have revealed a variety of molecular mechanisms involved in promoting the accumulation of these transcription factors. Interestingly, however, the mechanisms implicated in controlling such accumulation to ensure their adequate levels remain largely unknown. In this work, we demonstrate that prefoldins (PFDs) control the levels of HY5, an Arabidopsis transcription factor with a key role in cold acclimation by activating anthocyanin biosynthesis, in response to low temperature. Our results show that, under cold conditions, PFDs accumulate into the nucleus through a DELLA-dependent mechanism, where they interact with HY5, triggering its ubiquitination and subsequent degradation. The degradation of HY5 would result, in turn, in anthocyanin biosynthesis attenuation, ensuring the accurate development of cold acclimation. These findings uncover an unanticipated nuclear function for PFDs in plant responses to abiotic stresses. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

Safety, immunogencity, and efficacy of a cold-adapted A/Ann Arbor/6/60 (H2N2) vaccine in mice and ferrets

International Nuclear Information System (INIS)

Chen, Grace L.; Lamirande, Elaine W.; Jin Hong; Kemble, George; Subbarao, Kanta

2010-01-01

We studied the attenuation, immunogenicity and efficacy of the cold-adapted A/Ann Arbor/6/60 (AA ca) (H2N2) virus in mice and ferrets to evaluate its use in the event of an H2 influenza pandemic. The AA ca virus was restricted in replication in the respiratory tract of mice and ferrets. In mice, 2 doses of vaccine elicited a > 4-fold rise in hemagglutination-inhibition (HAI) titer and resulted in complete inhibition of viral replication following lethal homologous wild-type virus challenge. In ferrets, a single dose of the vaccine elicited a > 4-fold rise in HAI titer and conferred complete protection against homologous wild-type virus challenge in the upper respiratory tract. In both mice and ferrets, the AA ca virus provided significant protection from challenge with heterologous H2 virus challenge in the respiratory tract. The AA ca vaccine is safe, immunogenic, and efficacious against homologous and heterologous challenge in mice and ferrets, supporting the evaluation of this vaccine in clinical trials.

Performance differences of Rhode Island Red, Bashang Long-tail Chicken, and their reciprocal crossbreds under natural cold stress.

Science.gov (United States)

Xie, Shanshan; Yang, Xukai; Gao, Yahui; Jiao, Wenjie; Li, Xinghua; Li, Yajie; Ning, Zhonghua

2017-10-01

The Bashang Long-tail chicken (BS), an indigenous Chinese breed, is considered cold tolerant. We selected BS, the Rhode Island Red (RIR), and their reciprocal crossbreds for the present study. The objectives were: i) to validate whether BS is cold tolerant and whether egg production and cold tolerance of crossbreds could be improved; and ii) to determine the physiological characteristics that underlie cold tolerance and favorable egg production performance in cold environments. A total of 916 chickens were reared in warm and natural cold environments (daily mean ambient temperature varied from 7.4°C to 26.5°C in the warm environment and from -17.5°C to 27.0°C in the cold environment). To investigate their adaptability to the cold environment, the egg production performance and body weight were monitored and compared between breeds and environments. The cloacal temperature and serum biochemical parameters were monitored to reveal the physiological characteristics underlie cold tolerance and favorable egg production performance in the cold environment. The warm environment experiment showed that RIR had the highest egg production performance, and that the reciprocal crossbreds had a higher egg production performance than BS. While in the cold environment RIR had the lowest egg production performance, and the reciprocal crossbreds had a higher egg production performance than BS. In the cold environment BS and reciprocal crossbreds had higher triiodothyronine, tetraiodothyronine levels than RIR. At 35 and 39 wk of age, when the ambient temperature was extremely low (varied from -20°C to 0°C), serum glucose, follicle-stimulating hormone, luteinizing hormone, estradiol of BS and crossbreds were higher than RIR. Bashang Long-tail chicken has a favorable cold tolerance ability. Crossbreeding with RIR and BS is an effective way to develop cold tolerant chickens with improved egg production performance.

SU-F-J-68: Deformable Dose Accumulation for Voxel-Based Dose Tracking of PTV Cold Spots for Adaptive Radiotherapy of the Head and Neck

Energy Technology Data Exchange (ETDEWEB)

Liu, C; Chetty, I; Mao, W; Kumarasiri, A; Zhong, H; Brown, S; Siddiqui, F [Henry Ford Health System, Detroit, MI (United States)

2016-06-15

Purpose: To utilize deformable dose accumulation (DDA) to determine how cold spots within the PTV change over the course of fractionated head and neck (H&N) radiotherapy. Methods: Voxel-based dose was tracked using a DDA platform. The DDA process consisted of B-spline-based deformable image registration (DIR) and dose accumulation between planning CT’s and daily cone-beam CT’s for 10 H&N cancer patients. Cold spots within the PTV (regions receiving less than the prescription, 70 Gy) were contoured on the cumulative dose distribution. These cold spots were mapped to each fraction, starting from the first fraction to determine how they changed. Spatial correlation between cold spot regions over each fraction, relative to the last fraction, was computed using the Jaccard index Jk (Mk,N), where N is the cold spot within the PTV at the end of the treatment, and Mk the same region for fraction k. Results: Figure 1 shows good spatial correlation between cold spots, and highlights expansion of the cold spot region over the course of treatment, as a result of setup uncertainties, and anatomical changes. Figure 2 shows a plot of Jk versus fraction number k averaged over 10 patients. This confirms the good spatial correlation between cold spots over the course of treatment. On average, Jk reaches ∼90% at fraction 22, suggesting that possible intervention (e.g. reoptimization) may mitigate the cold spot region. The cold spot, D99, averaged over 10 patients corresponded to a dose of ∼65 Gy, relative to the prescription dose of 70 Gy. Conclusion: DDA-based tracking provides spatial dose information, which can be used to monitor dose in different regions of the treatment plan, thereby enabling appropriate mid-treatment interventions. This work is supported in part by Varian Medical Systems, Palo Alto, CA.

Climate, invasive species and land use drive population dynamics of a cold-water specialist

Science.gov (United States)

Kovach, Ryan P.; Al-Chokhachy, Robert K.; Whited, Diane C.; Schmetterling, David A.; Dux, Andrew M; Muhlfeld, Clint C.

2017-01-01

Climate change is an additional stressor in a complex suite of threats facing freshwater biodiversity, particularly for cold-water fishes. Research addressing the consequences of climate change on cold-water fish has generally focused on temperature limits defining spatial distributions, largely ignoring how climatic variation influences population dynamics in the context of other existing stressors.We used long-term data from 92 populations of bull trout Salvelinus confluentus – one of North America's most cold-adapted fishes – to quantify additive and interactive effects of climate, invasive species and land use on population dynamics (abundance, variability and growth rate).Populations were generally depressed, more variable and declining where spawning and rearing stream habitat was limited, invasive species and land use were prevalent and stream temperatures were highest. Increasing stream temperature acted additively and independently, whereas land use and invasive species had additive and interactive effects (i.e. the impact of one stressor depended on exposure to the other stressor).Most (58%–78%) of the explained variation in population dynamics was attributed to the presence of invasive species, differences in life history and management actions in foraging habitats in rivers, lakes and reservoirs. Although invasive fishes had strong negative effects on populations in foraging habitats, proactive control programmes appeared to effectively temper their negative impact.Synthesis and applications. Long-term demographic data emphasize that climate warming will exacerbate imperilment of cold-water specialists like bull trout, yet other stressors – especially invasive fishes – are immediate threats that can be addressed by proactive management actions. Therefore, climate-adaptation strategies for freshwater biodiversity should consider existing abiotic and biotic stressors, some of which provide potential and realized opportunity for conservation

Germplasm enhancement for adaptation to climate changes

Directory of Open Access Journals (Sweden)

Marcelo J Carena

2011-01-01

Full Text Available Billions of dollars and crops are being lost to drying high moisture grain; drought, cold, and salt susceptibility; andto processing poor quality grain. Maize is a model crop for adaptation to climate changes. Breeding for adaptation is best doneunder challenging environmental conditions where strengths and weaknesses are quickly identified and most stable genotypes areselected. The North Dakota State University (NDSU maize breeding program is strategically located to develop products underextreme weather. It currently exploits northern U.S. environments that allow screening for adaptation traits that are as important asyield. The program focuses on germplasm adaptation and its integration into cultivar development, particularly those carryingunique alleles not present in the B73 and NAM genomes. There is a need for projects that are vital to agricultural research and willmeet present and future demands of superior genotypes tolerant to climate changes in the U.S. and abroad.

Man in the Cold Environment. A Bibliography with Informative Abstracts. Updated Version,

Science.gov (United States)

1982-09-01

of the breathing regulator to malfunction due to cold. Two-hose regu- lators cause less trouble than single-hose regulators. Rubber "arctic cups ...by 5’-guanilyl imido- diphosphate was significantly decreased in rats adapted to both environmental changes. 304. MENSE , S. Effects of temperature on...Acclimatization mechanisms are the same. Women generally have lower sweat rates, an appropriate adjustment to lesser cooling needs. The menstrual cycle

Transcriptomic Analysis of (Group I) Clostridium botulinum ATCC 3502 Cold Shock Response

OpenAIRE

Dahlsten, Elias; Isokallio, Marita; Somervuo, Panu; Lindström, Miia; Korkeala, Hannu

2014-01-01

Profound understanding of the mechanisms foodborne pathogenic bacteria utilize in adaptation to the environmental stress they encounter during food processing and storage is of paramount importance in design of control measures. Chill temperature is a central control measure applied in minimally processed foods; however, data on the mechanisms the foodborne pathogen Clostridium botulinum activates upon cold stress are scarce. Transcriptomic analysis on the C. botulinum ATCC 3502 strain upon t...

Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

Directory of Open Access Journals (Sweden)

Olga A. Glazunova

2018-04-01

Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

Commemoration of a cold war

DEFF Research Database (Denmark)

Farbøl, Rosanna

2015-01-01

This article brings together the fields of Cold War studies and memory studies. In Denmark, a remarkable institutionalisation of Cold War memory has taken place in the midst of a heated ideological battle over the past and whether to remember the Cold War as a ‘war’. Using Danish Cold War museums...... and heritage sites as case studies, this article sheds new light on the politics of history involved in Cold War commemoration. It suggests that the Cold War is commemorated as a war, yet this war memory is of a particular kind: it is a war memory without victims....

Possible use of repeated cold stress for reducing fatigue in Chronic Fatigue Syndrome: a hypothesis

Directory of Open Access Journals (Sweden)

Shevchuk Nikolai A

2007-10-01

the hypothesis To test the hypothesis, a treatment is proposed that consists of adapted cold showers (20 degrees Celsius, 3 minutes, preceded by a 5-minute gradual adaptation to make the procedure more comfortable used twice daily. Implications of the hypothesis If testing supports the proposed hypothesis, this could advance our understanding of the mechanisms of fatigue in CFS.

Cold thermal injury from cold caps used for the prevention of chemotherapy-induced alopecia.

Science.gov (United States)

Belum, Viswanath Reddy; de Barros Silva, Giselle; Laloni, Mariana Tosello; Ciccolini, Kathryn; Goldfarb, Shari B; Norton, Larry; Sklarin, Nancy T; Lacouture, Mario E

2016-06-01

The use of scalp cooling for the prevention of chemotherapy-induced alopecia (CIA) is increasing. Cold caps are placed onto the hair-bearing areas of the scalp for varying time periods before, during, and after cytotoxic chemotherapy. Although not yet reported, improper application procedures could result in adverse events (AEs). At present, there are no evidence-based scalp cooling protocols, and there is no regulatory oversight of their use. To report the occurrence of cold thermal injury (frostbite) on the scalp, following the use of cold caps for the prevention of CIA. We identified four patients who developed cold thermal injuries on the scalp following the application of cold caps. Medical records were analyzed to retrieve the demographic and clinical characteristics. The cold thermal injuries in our patients were grade 1/2 in severity and improved with topical interventions and interruption of cold cap use, although grade 1 persistent alopecia ensued in 3 patients. The true incidence of such injuries in this setting, however, remains unknown. Cold thermal injuries are likely infrequent and preventable AEs that may result from improper device application procedures during cold cap use. Although these untoward events are usually mild to moderate in severity, the potential occurrence of long-term sequelae (e.g., permanent alopecia and scarring) or the need to discontinue cold cap use, are not known. Prospective studies are needed to further elucidate the risk and standardize healthcare delivery methods, and to improve patient/supportive/healthcare provider education.

Experimental facility and methodology for systematic studies of cold startability in direct injection Diesel engines

Science.gov (United States)

Pastor, J. V.; García-Oliver, J. M.; Pastor, J. M.; Ramírez-Hernández, J. G.

2009-09-01

Cold start at low temperatures in current direct injection (DI) Diesel engines is a problem which has not yet been properly solved and it becomes particularly critical with the current trend to reduce the engine compression ratio. Although it is clear that there are some key factors whose control leads to a proper cold start process, their individual relevance and relationships are not clearly understood. Thus, efforts on optimization of the cold start process are mainly based on a trial-and-error procedure in climatic chambers at low ambient temperature, with serious limitations in terms of measurement reliability during such a transient process, low repeatability and experimental cost. This paper presents a novel approach for an experimental facility capable of simulating real engine cold start, at room temperature and under well-controlled low speed and low temperature conditions. It is based on an optical single cylinder engine adapted to reproduce in-cylinder conditions representative of those of a real engine during start at cold ambient temperatures (of the order of -20 °C). Such conditions must be realistic, controlled and repeatable in order to perform systematic studies in the borderline between ignition success and misfiring. An analysis methodology, combining optical techniques and heat release analysis of individual cycles, has been applied.

Experimental facility and methodology for systematic studies of cold startability in direct injection Diesel engines

International Nuclear Information System (INIS)

Pastor, J V; García-Oliver, J M; Pastor, J M; Ramírez-Hernández, J G

2009-01-01

Cold start at low temperatures in current direct injection (DI) Diesel engines is a problem which has not yet been properly solved and it becomes particularly critical with the current trend to reduce the engine compression ratio. Although it is clear that there are some key factors whose control leads to a proper cold start process, their individual relevance and relationships are not clearly understood. Thus, efforts on optimization of the cold start process are mainly based on a trial-and-error procedure in climatic chambers at low ambient temperature, with serious limitations in terms of measurement reliability during such a transient process, low repeatability and experimental cost. This paper presents a novel approach for an experimental facility capable of simulating real engine cold start, at room temperature and under well-controlled low speed and low temperature conditions. It is based on an optical single cylinder engine adapted to reproduce in-cylinder conditions representative of those of a real engine during start at cold ambient temperatures (of the order of −20 °C). Such conditions must be realistic, controlled and repeatable in order to perform systematic studies in the borderline between ignition success and misfiring. An analysis methodology, combining optical techniques and heat release analysis of individual cycles, has been applied

The Role of Cold Work in Eddy Current Residual Stress Measurements in Shot-Peened Nickel-Base Superalloys

International Nuclear Information System (INIS)

Yu, F.; Nagy, P. B.

2006-01-01

Recently, it was shown that eddy current methods can be adapted to residual stress measurement in shot-peened nickel-base superalloys. However, experimental evidence indicates that the piezoresistivity effect is simply not high enough to account for the observed apparent eddy current conductivity (AECC) increase. At the same time, X-ray diffraction data indicates that 'cold work' lingers even when the residual stress is fully relaxed and the excess AECC is completely gone. It is impossible to account for both observations with a single coherent explanation unless we assume that instead of a single 'cold work' effect, there are two varieties of cold work; type-A and type-B. Type-A cold work (e.g., changes in the microscopic homogeneity of the material) is not detected by X-ray diffraction as it does not significantly affect the beam width, but causes substantial conductivity change and exhibits strong thermal relaxation. Type-B cold work (e.g., dislocations) is detected by X-ray, but causes little or no conductivity change and exhibits weak thermal relaxation. Based on the assumption of two separate cold-work variables and that X-ray diffraction results indicate the presence of type-B, but not type-A, all observed phenomena can be explained. If this working hypothesis is proven right, the separation of residual stress and type-A cold work is less critical because they both relax much earlier and much faster than type-B cold work

Polycyclic aromatic hydrocarbons degradation by marine-derived basidiomycetes: optimization of the degradation process.

Science.gov (United States)

Vieira, Gabriela A L; Magrini, Mariana Juventina; Bonugli-Santos, Rafaella C; Rodrigues, Marili V N; Sette, Lara D

2018-05-03

Pyrene and benzo[a]pyrene (BaP) are high molecular weight polycyclic aromatic hydrocarbons (PAHs) recalcitrant to microbial attack. Although studies related to the microbial degradation of PAHs have been carried out in the last decades, little is known about degradation of these environmental pollutants by fungi from marine origin. Therefore, this study aimed to select one PAHs degrader among three marine-derived basidiomycete fungi and to study its pyrene detoxification/degradation. Marasmiellus sp. CBMAI 1062 showed higher levels of pyrene and BaP degradation and was subjected to studies related to pyrene degradation optimization using experimental design, acute toxicity, organic carbon removal (TOC), and metabolite evaluation. The experimental design resulted in an efficient pyrene degradation, reducing the experiment time while the PAH concentration applied in the assays was increased. The selected fungus was able to degrade almost 100% of pyrene (0.08mgmL -1 ) after 48h of incubation under saline condition, without generating toxic compounds and with a TOC reduction of 17%. Intermediate metabolites of pyrene degradation were identified, suggesting that the fungus degraded the compound via the cytochrome P450 system and epoxide hydrolases. These results highlight the relevance of marine-derived fungi in the field of PAH bioremediation, adding value to the blue biotechnology. Copyright © 2018. Published by Elsevier Editora Ltda.

Adaptive plasma for cancer therapy: physics, mechanism and applications

Science.gov (United States)

Keidar, Michael

2017-10-01

One of the most promising applications of cold atmospheric plasma (CAP) is the cancer therapy. The uniqueness of plasma is in its ability to change composition in situ. Plasma self-organization could lead to formation of coherent plasma structures. These coherent structures tend to modulate plasma chemistry and composition, including reactive species, the electric field and charged particles. Formation of coherent plasma structures allows the plasma to adapt to external boundary conditions, such as different cells types and their contextual tissues. In this talk we will explore possibilities and opportunities that the adaptive plasma therapeutic system might offer. We shall define such an adaptive system as a plasma device that is able to adjust the plasma composition to obtain optimal desirable outcomes through its interaction with cells and tissues. The efficacy of cold plasma in a pre-clinical model of various cancer types such as lung, bladder, breast, head, neck, brain and skin has been demonstrated. Both in-vitro and in-vivo studies revealed that cold plasmas selectively kill cancer cells. Recently mechanism of plasma selectivity based on aquaporin hypothesis has been proposed. Aquaporins (AQPs) are the confirmed membrane channels of H2O2 and other large molecules. We have demonstrated that the anti-cancer capacity of plasma could be inhibited by silencing the expression of AQPs. Additional possible cell feedback mechanism was recently discovered. It is associated with production of reactive species during direct CAP treatment by cancer cells. Selective production of hydrogen peroxide by different cells can lead to adaptation of chemistry at the plasma-cell interface based on the cellular input. In particular we have found that the discharge voltage is an important factor affecting the ratio of reactive oxygen species to reactive nitrogen species in the gas phase and this correlates well with effect of hydrogen peroxide production by cells. This work was

Global analysis of transcriptome responses and gene expression profiles to cold stress of Jatropha curcas L.

Science.gov (United States)

Wang, Haibo; Zou, Zhurong; Wang, Shasha; Gong, Ming

2013-01-01

Jatropha curcas L., also called the Physic nut, is an oil-rich shrub with multiple uses, including biodiesel production, and is currently exploited as a renewable energy resource in many countries. Nevertheless, because of its origin from the tropical MidAmerican zone, J. curcas confers an inherent but undesirable characteristic (low cold resistance) that may seriously restrict its large-scale popularization. This adaptive flaw can be genetically improved by elucidating the mechanisms underlying plant tolerance to cold temperatures. The newly developed Illumina Hiseq™ 2000 RNA-seq and Digital Gene Expression (DGE) are deep high-throughput approaches for gene expression analysis at the transcriptome level, using which we carefully investigated the gene expression profiles in response to cold stress to gain insight into the molecular mechanisms of cold response in J. curcas. In total, 45,251 unigenes were obtained by assembly of clean data generated by RNA-seq analysis of the J. curcas transcriptome. A total of 33,363 and 912 complete or partial coding sequences (CDSs) were determined by protein database alignments and ESTScan prediction, respectively. Among these unigenes, more than 41.52% were involved in approximately 128 known metabolic or signaling pathways, and 4,185 were possibly associated with cold resistance. DGE analysis was used to assess the changes in gene expression when exposed to cold condition (12°C) for 12, 24, and 48 h. The results showed that 3,178 genes were significantly upregulated and 1,244 were downregulated under cold stress. These genes were then functionally annotated based on the transcriptome data from RNA-seq analysis. This study provides a global view of transcriptome response and gene expression profiling of J. curcas in response to cold stress. The results can help improve our current understanding of the mechanisms underlying plant cold resistance and favor the screening of crucial genes for genetically enhancing cold resistance

Cold urticaria: inhibition of cold-induced histamine release by doxantrazole.

Science.gov (United States)

Bentley-Phillips, C B; Eady, R A; Greaves, M W

1978-10-01

Thirteen patients with cold urticaria were studied to assess the effect of the systemic drug doxantrazole, which has actions resembling disodium cromoglycate, on cold evoked histamine release. The patients, all of whom developed an immediate local whealing response after cooling of the forearm, demonstrated release of histamine into venous blood draining that forearm. Following doxantrazole treatment, significant suppression of histamine release occurred. In some but not all patients this was accompanied by diminution of urtication in response to cooling. A double-blind study was carried out in 3 subjects, all of whom showed diminished cold-stimulated histamine release after doxantrazole. Two of these showed clinical improvement. Doxantrazole had no effect on erythema due to intradermal histamine, but did suppress the erythematous reaction to intradermal injection of compound 48/80. Our results suggest that doxantrazole or related anti-allergic agents might be useful in the treatment of cold urticaria.

Range shifts or extinction? Ancient DNA and distribution modelling reveal past and future responses to climate warming in cold-adapted birds.

Science.gov (United States)

Lagerholm, Vendela K; Sandoval-Castellanos, Edson; Vaniscotte, Amélie; Potapova, Olga R; Tomek, Teresa; Bochenski, Zbigniew M; Shepherd, Paul; Barton, Nick; Van Dyck, Marie-Claire; Miller, Rebecca; Höglund, Jacob; Yoccoz, Nigel G; Dalén, Love; Stewart, John R

2017-04-01

Global warming is predicted to cause substantial habitat rearrangements, with the most severe effects expected to occur in high-latitude biomes. However, one major uncertainty is whether species will be able to shift their ranges to keep pace with climate-driven environmental changes. Many recent studies on mammals have shown that past range contractions have been associated with local extinctions rather than survival by habitat tracking. Here, we have used an interdisciplinary approach that combines ancient DNA techniques, coalescent simulations and species distribution modelling, to investigate how two common cold-adapted bird species, willow and rock ptarmigan (Lagopus lagopus and Lagopus muta), respond to long-term climate warming. Contrary to previous findings in mammals, we demonstrate a genetic continuity in Europe over the last 20 millennia. Results from back-casted species distribution models suggest that this continuity may have been facilitated by uninterrupted habitat availability and potentially also the greater dispersal ability of birds. However, our predictions show that in the near future, some isolated regions will have little suitable habitat left, implying a future decrease in local populations at a scale unprecedented since the last glacial maximum. © 2016 John Wiley & Sons Ltd.

Heterologous production of cellobiose dehydrogenases from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina and their effect on saccharification of wheat straw.

Science.gov (United States)

Turbe-Doan, Annick; Arfi, Yonathan; Record, Eric; Estrada-Alvarado, Isabel; Levasseur, Anthony

2013-06-01

Cellobiose dehydrogenases (CDHs) are extracellular glycosylated haemoflavoenzymes produced by many different wood-degrading and phytopathogenic fungi. Putative cellobiose dehydrogenase genes are recurrently discovered by genome sequencing projects in various phylogenetically distinct fungi. The genomes from the basidiomycete Coprinopsis cinerea and the ascomycete Podospora anserina were screened for candidate cdh genes, and one and three putative gene models were evidenced, respectively. Two putative cdh genes were selected and successfully expressed for the first time in Aspergillus niger. CDH activity was measured for both constructions (CDHcc and CDHpa), and both recombinant CDHs were purified to homogeneity and subsequently characterised. Kinetic constants were determined for several carbohydrates including β-1,4-linked di- and oligosaccharides. Optimal temperature and pH were 60 °C and 5 for CDHcc and 65-70 °C and 6 for CDHpa. Both CDHs showed a broad range of pH stability between 4 and 8. The effect of both CDHs on saccharification of micronized wheat straw by an industrial Trichoderma reesei secretome was determined. The addition of each CDH systematically decreased the release of total reducing sugars, but to different extents and according to the CDH concentration. Analytical methods were carried out to quantify the release of glucose, xylose and gluconic acid. An increase of glucose and xylose was measured at a low CDHcc concentration. At moderated and high CDHcc and CDHpa concentrations, glucose was severely reduced with a concomitant increase of gluconic acid. In conclusion, these results give new insights into the physical and chemical parameters and diversity of basidiomycetous and ascomycetous CDHs. These findings also demonstrated that CDH drastically influenced the saccharification on a natural substrate, and thus, CDH origin, concentration and potential enzymatic partners should be carefully considered in future artificial secretomes for

Directional selection on cold tolerance does not constrain plastic capacity in a butterfly.

Science.gov (United States)

Franke, Kristin; Dierks, Anneke; Fischer, Klaus

2012-12-05

Organisms may respond to environmental change by means of genetic adaptation, phenotypic plasticity or both, which may result in genotype-environment interactions (G x E) if genotypes differ in their phenotypic response. We here specifically target the latter source of variation (i.e. G x E) by comparing plastic responses among lines of the tropical butterfly Bicyclus anynana that had been selected for increased cold tolerance and according controls. Our main aim here was to test the hypothesis that directional selection on cold tolerance will interfere with plastic capacities. Plastic responses to temperature and feeding treatments were strong, with e.g. higher compared to lower temperatures reducing cold tolerance, longevity, pupal mass, and development time. We report a number of statistically significant genotype-environment interactions (i.e. interactions between selection regime and environmental variables), but most of these were not consistent across treatment groups. We found some evidence though for larger plastic responses to different rearing temperatures in the selection compared to the control lines, while plastic responses to different adult temperatures and feeding treatments were overall very similar across selection regimes. Our results indicate that plastic capacities are not always constrained by directional selection (on cold tolerance) and therefore genetic changes in trait means, but may operate independently.

77 FR 43117 - Meeting of the Cold War Advisory Committee for the Cold War Theme Study

Science.gov (United States)

2012-07-23

... the Cold War Advisory Committee for the Cold War Theme Study AGENCY: National Park Service, Interior... Committee Act, 5 U.S.C. Appendix, that the Cold War Advisory Committee for the Cold War Theme Study will... National Park Service (NPS) concerning the Cold War Theme Study. DATES: The teleconference meeting will be...

The need to be cold : cold warriors

Energy Technology Data Exchange (ETDEWEB)

Gregoire, L.

2008-10-15

This article discussed the changing climate of Ellesmere Island and the adaptation of the Inuit in response to the climate change, with particular reference to Canada's most northern community of Grise Fiord. Because of the changing climate, the vast northern landscape that the Inuit navigated for centuries by reading its subtle signs is becoming warmer, softer, and unpredictable. The geographic history and demographics of Grise Fiord were described. The community's main water supply comes from a glacier which is sinking. The negative impacts of ice shrinkage on this northern community and on the environment were presented. These included more international shipping through the Arctic, more resource exploration, a greater risk of environmental contamination, and reduced habitat for the polar bears and seals that eat, mate, and reproduce on the ice. Climate change impacts on the sea and sea ice were also discussed. Several photographs illustrating the changing climate were presented. The article noted that climate change could destroy the Inuit culture, making climate change an issue of human rights, notably the right to live connected to the land and the right to be cold. It was concluded that in one generation, Inuit were swept up by both a social and an economic upheaval. In one more generation, they will undergo an environmental shift. 13 figs.

Development of Cold Neutron Activation Station at HANARO Cold Neutron Source

International Nuclear Information System (INIS)

Sun, G. M.; Hoang, S. M. T.; Moon, J. H.; Chung, Y. S.; Cho, S. J.; Lee, K. H.; Park, B. G.; Choi, H. D.

2012-01-01

A new cold neutron source at the HANARO Research Reactor had been constructed in the framework of a five-year project, and ended in 2009. It has seven neutron guides, among which five guides were already allocated for a number of neutron scattering instruments. A new two-year project to develop a Cold Neutron Activation Station (CONAS) was carried out at the two neutron guides since May 2010, which was supported by the program of the Ministry of Education, Science and Technology, Korea. Fig. 1 shows the location of CONAS. CONAS is a complex facility including several radioanalytical instruments utilizing neutron capture reaction to analyze elements in a sample. It was designed to include three instruments like a CN-PGAA (Cold Neutron - Prompt Gamma Activation Analysis), a CN-NIPS (Cold Neutron - Neutron Induced Pair Spectrometer), and a CN-NDP (Cold Neutron - Neutron-induced prompt charged particle Depth Profiling). Fig. 2 shows the conceptual configuration of the CONAS concrete bioshield and the instruments. CN-PGAA and CN-NIPS measure the gamma-rays promptly emitted from the sample after neutron capture, whereas CN-NDP is a probe to measure the charged particles emitted from the sample surface after neutron capture. For this, we constructed two cold neutron guides called CG1 and CG2B guides from the CNS

Support for cold neutron utilization

International Nuclear Information System (INIS)

Lee, Kye Hong; Han, Young Soo; Choi, Sungmin; Choi, Yong; Kwon, Hoon; Lee, Kwang Hee

2012-06-01

- Support for experiments by users of cold neutron scattering instrument - Short-term training of current and potential users of cold neutron scattering instrument for their effective use of the instrument - International collaboration for advanced utilization of cold neutron scattering instruments - Selection and training of qualified instrument scientists for vigorous research endeavors and outstanding achievements in experiments with cold neutron - Research on nano/bio materials using cold neutron scattering instruments - Bulk nano structure measurement using small angle neutron scattering and development of analysis technique

Effects of chronic environmental cold on growth, health, and select metabolic and immunologic responses of preruminant calves.

Science.gov (United States)

Nonnecke, B J; Foote, M R; Miller, B L; Fowler, M; Johnson, T E; Horst, R L

2009-12-01

The physiological response of the preruminant calf to sustained exposure to moderate cold has not been studied extensively. Effects of cold on growth performance and health of preruminant calves as well as functional measures of energy metabolism, fat-soluble vitamin, and immune responsiveness were evaluated in the present study. Calves, 3 to 10 d of age, were assigned randomly to cold (n = 14) or warm (n = 15) indoor environments. Temperatures in the cold environment averaged 4.7 degrees C during the study. Frequent wetting of the environment and the calves was used to augment effects of the cold environment. Temperatures in the warm environment averaged 15.5 degrees C during the study. There was no attempt to increase the humidity in the warm environment. Preventative medications or vaccinations that might influence disease resistance were not administered. Nonmedicated milk replacer (20% crude protein and 20% fat fed at 0.45 kg/d) and a nonmedicated starter grain fed ad libitum were fed to all calves. Relative humidity was, on average, almost 10% higher in the cold environment. Warm-environment calves were moderately healthier (i.e., lower respiratory scores) and required less antibiotics. Scour scores, days scouring, and electrolyte costs, however, were unaffected by environmental temperature. Growth rates were comparable in warm and cold environments, although cold-environment calves consumed more starter grain and had lower blood glucose and higher blood nonesterified fatty acid concentrations. The nonesterified fatty acid and glucose values for cold-stressed calves, however, did not differ sufficiently from normal values to categorize these calves as being in a state of negative-energy balance. Levels of fat-soluble vitamin, antibody, tumor necrosis factor-alpha, and haptoglobin were unaffected by sustained exposure to moderate cold. These results support the contention that successful adaptation of the dairy calf to cold is dependent upon the availability

The Nav1.9 Channel Is a Key Determinant of Cold Pain Sensation and Cold Allodynia

Directory of Open Access Journals (Sweden)

Stéphane Lolignier

2015-05-01

Full Text Available Cold-triggered pain is essential to avoid prolonged exposure to harmfully low temperatures. However, the molecular basis of noxious cold sensing in mammals is still not completely understood. Here, we show that the voltage-gated Nav1.9 sodium channel is important for the perception of pain in response to noxious cold. Nav1.9 activity is upregulated in a subpopulation of damage-sensing sensory neurons responding to cooling, which allows the channel to amplify subthreshold depolarizations generated by the activation of cold transducers. Consequently, cold-triggered firing is impaired in Nav1.9−/− neurons, and Nav1.9 null mice and knockdown rats show increased cold pain thresholds. Disrupting Nav1.9 expression in rodents also alleviates cold pain hypersensitivity induced by the antineoplastic agent oxaliplatin. We conclude that Nav1.9 acts as a subthreshold amplifier in cold-sensitive nociceptive neurons and is required for the perception of cold pain under normal and pathological conditions.

Substitutions in woolly mammoth hemoglobin confer biochemical properties adaptive for cold tolerance

DEFF Research Database (Denmark)

Campbell, Kevin L.; Roberts, Jason E.E.; Watson, Laura N.

2010-01-01

We have genetically retrieved, resurrected and performed detailed structure-function analyses on authentic woolly mammoth hemoglobin to reveal for the first time both the evolutionary origins and the structural underpinnings of a key adaptive physiochemical trait in an extinct species. Hemoglobin...... binds and carries O2; however, its ability to offload O2 to respiring cells is hampered at low temperatures, as heme deoxygenation is inherently endothermic (that is, hemoglobin-O2 affinity increases as temperature decreases). We identify amino acid substitutions with large phenotypic effect...... the Pleistocene period. This powerful new approach to directly analyze the genetic and structural basis of physiological adaptations in an extinct species adds an important new dimension to the study of natural selection....

Reduced Cortisol and Metabolic Responses of Thin Ewes to an Acute Cold Challenge in Mid-Pregnancy: Implications for Animal Physiology and Welfare

Science.gov (United States)

Verbeek, Else; Oliver, Mark Hope; Waas, Joseph Rupert; McLeay, Lance Maxwell; Blache, Dominique; Matthews, Lindsay Ross

2012-01-01

Background Low food availability leading to reductions in Body Condition Score (BCS; 0 indicates emaciation and 5 obesity) in sheep often coincides with low temperatures associated with the onset of winter in New Zealand. The ability to adapt to reductions in environmental temperature may be impaired in animals with low BCS, in particular during pregnancy when metabolic demand is higher. Here we assess whether BCS affects a pregnant animal's ability to cope with cold challenges. Methods Eighteen pregnant ewes with a BCS of 2.7±0.1 were fed to attain low (LBC: BCS2.3±0.1), medium (MBC: BCS3.2±0.2) or high BCS (HBC: BCS3.6±0.2). Shorn ewes were exposed to a 6-h acute cold challenge in a climate-controlled room (wet and windy conditions, 4.4±0.1°C) in mid-pregnancy. Blood samples were collected during the BCS change phase, acute cold challenge and recovery phase. Results During the BCS change phase, plasma glucose and leptin concentrations declined while free fatty acids (FFA) increased in LBC compared to MBC (Pewes (Pewes (Pewes (Pewes while remaining unchanged in LBC ewes (Pewes (Pewes (Pewes were able to increase Tcore and mobilize glucose, low BCS animals had considerably reduced cortisol and metabolic responses to a cold challenge in mid-pregnancy, suggesting that their ability to adapt to cold challenges through some of the expected pathways was reduced. PMID:22662144

Deep Super-SAGE transcriptomic analysis of cold acclimation in lentil (Lens culinaris Medik.).

Science.gov (United States)

Barrios, Abel; Caminero, Constantino; García, Pedro; Krezdorn, Nicolas; Hoffmeier, Klaus; Winter, Peter; Pérez de la Vega, Marcelino

2017-06-30

Frost is one of the main abiotic stresses limiting plant distribution and crop production. To cope with the stress, plants evolved adaptations known as cold acclimation or chilling tolerance to maximize frost tolerance. Cold acclimation is a progressive acquisition of freezing tolerance by plants subjected to low non-freezing temperatures which subsequently allows them to survive exposure to frost. Lentil is a cool season grain legume that is challenged by winter frost in some areas of its cultivation. To better understand the genetic base of frost tolerance differential gene expression in response to cold acclimation was investigated. Recombinant inbred lines (RILs) from the cross Precoz x WA8649041 were first classified as cold tolerant or cold susceptible according to their response to temperatures between -3 to -15 °C. Then, RILs from both extremes of the response curve were cold acclimated and the leaf transcriptomes of two bulks each of eight frost tolerant and seven cold susceptible RILs were investigated by Deep Super-SAGE transcriptome profiling. Thus, four RNA bulks were analysed: the acclimated susceptible, the acclimated tolerant and the respective controls (non-acclimated susceptible and non-acclimated tolerant). Approximately 16.5 million 26 nucleotide long Super-SAGE tags were sequenced in the four sets (between ~3 and 5.4 millions). In total, 133,077 different unitags, each representing a particular transcript isoform, were identified in these four sets. Tags which showed a significantly different abundance in any of the bulks (fold change ≥4.0 and a significant p-value <0.001) were selected and used to identify the corresponding lentil gene sequence. Three hundred of such lentil sequences were identified. Most of their known homologs coded for glycine-rich, cold and drought-regulated proteins, dormancy-associated proteins, proline-rich proteins (PRPs) and other membrane proteins. These were generally but not exclusively over-expressed in the

PHYSIOLOGICAL AND LEUKOCYTE SUBSET RESPONSES TO EXERCISE AND COLD EXPOSURE IN COLD-ACCLIMATIZED SKATERS

Directory of Open Access Journals (Sweden)

K. Kim

2014-07-01

Full Text Available We investigated physiological responses and changes in circulating immune cells following exercise in cold and thermoneutral conditions. Participants were short track skaters (n=9 who were acclimatized to cold conditions, and inline skaters (n=10 who were not acclimatized. All skaters were young, and skating at a recreational level three days per week for at least one year. Using a cross-over design, study variables were measured during 60 min of submaximal cycling (65% ·VO2max in cold (ambient temperature: 5±1°C, relative humidity: 41±9% and thermoneutral conditions (ambient temperature: 21±1°C, relative humidity: 35±5%. Heart rate, blood lactate and tympanic temperature were measured at rest, during exercise and recovery. Plasma cortisol, calprotectin and circulating blood cell numbers were measured before and after 60 min of cold or thermoneutral conditions, and during recovery from exercise. Heart rate was lower in both groups during exercise in cold versus thermoneutral conditions (P<0.05. The increase in total leukocytes during recovery was primarily due to an increase in neutrophils in both groups. The cold-acclimatized group activated neutrophils after exercise in cold exposure, whereas the non-acclimatized group activated lymphocyte and cortisol after exercise in cold exposure. Lymphocyte subsets significantly changed in both groups over time during recovery as compared to rest. Immediately after exercise in both groups, CD16+ and CD69+ cells were elevated compared to rest or before exercise in both conditions. Acclimatization to exercise in the cold does not appear to influence exercise-induced immune changes in cold conditions, with the possible exception of neutrophils, lymphocytes and cortisol concentration.

Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study

Science.gov (United States)

Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.

2015-01-01

The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

Investigating trehalose synthesis genes after cold acclimation in the Antarctic nematode Panagrolaimus sp. DAW1

Directory of Open Access Journals (Sweden)

Anna C. Seybold

2017-12-01

Full Text Available Panagrolaimus sp. DAW1 is a freeze-tolerant Antarctic nematode which survives extensive intracellular ice formation. The molecular mechanisms of this extreme adaptation are still poorly understood. We recently showed that desiccation-enhanced RNA interference (RNAi soaking can be used in conjunction with quantitative polymerase chain reaction (qPCR to screen for phenotypes associated with reduced expression of candidate genes in Panagrolaimus sp. DAW1. Here, we present the use of this approach to investigate the role of trehalose synthesis genes in this remarkable organism. Previous studies have shown that acclimating Panagrolaimus sp. DAW1 at 5°C before freezing or desiccation substantially enhances survival. In this study, the expression of tps-2 and other genes associated with trehalose metabolism, as well as lea-1, hsp-70 and gpx-1, in cold-acclimated and non-acclimated nematodes was analyzed using qPCR. Pd-tps-2 and Pd-lea-1 were significantly upregulated after cold acclimation, indicating an inducible expression in the cold adaptation of Panagrolaimus sp. DAW1. The role of trehalose synthesis genes in Panagrolaimus sp. DAW1 was further investigated by RNAi. Compared to the controls, Pd-tps-2a(RNAi-treated and cold-acclimated nematodes showed a significant decrease in mRNA, but no change in trehalose content or freezing survival. The involvement of two other trehalose synthesis genes (tps-2b and gob-1 was also investigated. These findings provide the first functional genomic investigation of trehalose synthesis genes in the non-model organism Panagrolaimus sp. DAW1. The presence of several trehalose synthesis genes with different RNAi sensitivities suggests the existence of multiple backup systems in Panagrolaimus sp. DAW1, underlining the importance of this sugar in preparation for freezing.

Cold fusion, Alchemist's dream

International Nuclear Information System (INIS)

Clayton, E.D.

1989-09-01

In this report the following topics relating to cold fusion are discussed: muon catalysed cold fusion; piezonuclear fusion; sundry explanations pertaining to cold fusion; cosmic ray muon catalysed cold fusion; vibrational mechanisms in excited states of D 2 molecules; barrier penetration probabilities within the hydrogenated metal lattice/piezonuclear fusion; branching ratios of D 2 fusion at low energies; fusion of deuterons into 4 He; secondary D+T fusion within the hydrogenated metal lattice; 3 He to 4 He ratio within the metal lattice; shock induced fusion; and anomalously high isotopic ratios of 3 He/ 4 He

Cold neutron production and application

International Nuclear Information System (INIS)

Inoue, Kazuhiko; Watanabe, Noboru.

1976-01-01

The first part gives general introduction to cold neutrons, namely the definition and the role as a probe in basic science and technology. The second part reviews various methods of cold neutron production. Some physical characteristics required for cold moderators are presented, and a list summarizes a number of cold moderators and their reactor physics constants. The definition of flux gain factor and the measured values for liquid light- and heavy-hydrogen are also given. The cold neutron spectra in methane and liquid hydrogen measured by LINAC time-of-flight method are presented to show the advantage of solid methane. The cold neutron sources using experimental reactors or linear accelerators are explained along with the examples of existing facilities. Two Japanese programs, the one is the use of a high flux reactor and the other is the use of a LINAC, are also presented. The third part of this report reviews the application areas of cold neutrons. (Aoki, K.)

Effects of cold temperatures on the excitability of rat trigeminal ganglion neurons that are not for cold-sensing

Science.gov (United States)

Kanda, Hirosato; Gu, Jianguo G.

2016-01-01

Except a small population of primary afferent neurons for sensing cold to generate the sensations of innocuous and noxious cold, it is generally believed that cold temperatures suppress the excitability of other primary afferent neurons that are not for cold-sensing. These not-for-cold-sensing neurons include the majority of non-nociceptive and nociceptive afferent neurons. In the present study we have found that not-for-cold-sensing neurons of rat trigeminal ganglia (TG) change their excitability in several ways at cooling temperatures. In nearly 70% of not-for-cold-sensing TG neurons, the cooling temperature of 15°C increases their membrane excitability. We regard these neurons as cold-active neurons. For the remaining 30% of not-for-cold-sensing TG neurons, the cooling temperature of 15°C either has no effect (regarded as cold-ineffective neurons) or suppress (regarded as cold-suppressive neurons) their membrane excitability. For cold-active neurons, the cold temperature of 15°C increases their excitability as is evidenced by the increases in action potential (AP) firing numbers and/or reduction of AP rheobase when these neurons are depolarized electrically. The cold temperature of 15°C significantly inhibits M-currents and increases membrane input resistance of cold-active neurons. Retigabine, an M-current activator, abolishes the effect of cold temperatures on AP firing but not the effect of cold temperature on AP rheobase levels. The inhibition of M-currents and the increases of membrane input resistance are likely two mechanisms by which cooling temperatures increase the excitability of not-for-cold-sensing TG neurons. PMID:26709732

The Nav1.9 channel is a key determinant of cold pain sensation and cold allodynia.

Science.gov (United States)

Lolignier, Stéphane; Bonnet, Caroline; Gaudioso, Christelle; Noël, Jacques; Ruel, Jérôme; Amsalem, Muriel; Ferrier, Jérémy; Rodat-Despoix, Lise; Bouvier, Valentine; Aissouni, Youssef; Prival, Laetitia; Chapuy, Eric; Padilla, Françoise; Eschalier, Alain; Delmas, Patrick; Busserolles, Jérôme

2015-05-19

Cold-triggered pain is essential to avoid prolonged exposure to harmfully low temperatures. However, the molecular basis of noxious cold sensing in mammals is still not completely understood. Here, we show that the voltage-gated Nav1.9 sodium channel is important for the perception of pain in response to noxious cold. Nav1.9 activity is upregulated in a subpopulation of damage-sensing sensory neurons responding to cooling, which allows the channel to amplify subthreshold depolarizations generated by the activation of cold transducers. Consequently, cold-triggered firing is impaired in Nav1.9(-/-) neurons, and Nav1.9 null mice and knockdown rats show increased cold pain thresholds. Disrupting Nav1.9 expression in rodents also alleviates cold pain hypersensitivity induced by the antineoplastic agent oxaliplatin. We conclude that Nav1.9 acts as a subthreshold amplifier in cold-sensitive nociceptive neurons and is required for the perception of cold pain under normal and pathological conditions. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Cold-Weather Sports

Science.gov (United States)

... Videos for Educators Search English Español Cold-Weather Sports KidsHealth / For Teens / Cold-Weather Sports What's in this article? What to Do? Classes ... weather. What better time to be outdoors? Winter sports can help you burn calories, increase your cardiovascular ...

Electric foot shock stress adaptation: Does it exist or not?

Science.gov (United States)

Bali, Anjana; Jaggi, Amteshwar Singh

2015-06-01

Stress adaptation is a protective phenomenon against repeated stress exposure and is characterized by a decreased responsiveness to a repeated stress stimulus. The adaptation is associated with a complex cascade of events, including the changes in behavior, neurotransmitter and gene expression levels. The non-adaptation or maladaptation to stress may underlie the affective disorders, such as anxiety, depression and post-traumatic stress disorder (PTSD). Electric foot shock is a complex stressor, which includes both physical and emotional components. Unlike immobilization, restraint and cold immersion stress, the phenomenon of stress adaptation is not very well defined in response to electric foot shock. A number of preclinical studies have reported the development of adaptation to electric foot shock stress. However, evidence also reveals the non-adaptive behavior in response to foot shocks. The distinct adaptive/non-adaptive responses may be possibly influenced by the type, intensity, and duration of the stress. The present review discusses the existence or non-existence of adaptation to electric foot shock stress along with possible mechanism. Copyright © 2015 Elsevier Inc. All rights reserved.

Nonshivering thermogenesis and adaptation to fasting in king penguin chicks.

Science.gov (United States)

Duchamp, C; Barre, H; Delage, D; Rouanet, J L; Cohen-Adad, F; Minaire, Y

1989-10-01

The ability to develop nonshivering thermogenesis (NST) and the effect of fasting on thermogenic response to cold were studied in winter-acclimatized king penguin chicks. Metabolic rate (MR) and integrated electrical muscle activity were measured at different ambient temperatures. In cold-acclimatized (5 degrees C) fed chicks, shivering threshold temperature (STT) was 9.4 degrees C lower than lower critical temperature (LCT), indicating that NST (0.7 W/kg) occurs at moderate cold, whereas in control chicks fed and reared at 25 degrees C for 3 wk, LCT and STT were similar. Chicks reared in the cold and fasting for 3 wk or 4-5 mo (natural winter fast) developed an NST of 0.8 and 2.4 W/kg, respectively, despite the fast. In fasting chicks, the intercept of the metabolic curve with the abscissa at zero MR was far below body temperature, contrasting with the classic model for heat loss. Their low LCT indicates the capacity of a large reduction in convective conductance characteristic of diving animals and allows energy sparing in moderate cold. Below LCT, conductance reincreases progressively, leading to a steeper than expected slope of the metabolic curve and allowing preservation of a threshold temperature in the shell. These results show for the first time in a wild young bird the development of NST after cold acclimatization. Further, at the temperature of cold acclimatization, an energy-sparing mechanism is shown in response to long-term fast adaptation.

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

Energy Technology Data Exchange (ETDEWEB)

C.A.Reddy, PI

2005-06-30

and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

Solid-state fermentation of cornmeal with the basidiomycete Hericium erinaceum for degrading starch and upgrading nutritional value.

Science.gov (United States)

Han, Jianrong

2003-01-15

The ability of the basidiomycete Hericium erinaceum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation was studied. On the basal medium which consisted of cornmeal and salt solution, H. erinaceum produced a strong alpha-amylase on the 15th day after inoculation, which resulted in a 52% degradation of the starch. By supplementation with 5-15 g soybean meal per 100 g cornmeal the alpha-amylase activity and degradation rate of starch was raised significantly (P cornmeal, the starch content in the product decreased from 63% to 22% (P < 0.001) and protein content increased from 12% to 17% (P < 0.01). In the protein in the product, the lysine content was increased from 36 to 56 mg/ g and tryptophan from 9 to 13 mg/g. Using egg protein as a standard, an evaluation on the protein quality of the fermented product showed that it was superior to that of the nonfermented control and to other cereals, was close to that of soybean and chicken, but was inferior to that of milk and red meats.

Physiological response and microRNA expression profiles in head kidney of genetically improved farmed tilapia (GIFT, Oreochromis niloticus) exposed to acute cold stress.

Science.gov (United States)

Qiang, Jun; Cui, Yan T; Tao, Fan Y; Bao, Wen J; He, Jie; Li, Xia H; Xu, Pao; Sun, Lan Y

2018-01-09

Cold stress has a serious impact on the overwintering survival and yield of genetically improved farmed tilapia (GIFT, Oreochromis niloticus). Understanding the physiological and molecular regulation mechanisms of low-temperature adaptation is necessary to help breed new tolerant strains. The semi-lethal low temperature of juvenile GIFT at 96 h was determined as 9.4 °C. We constructed and sequenced two small RNA libraries from head kidney tissues, one for the control (CO) group and one for the 9.4 °C-stressed (LTS) group, and identified 1736 and 1481 known microRNAs (miRNAs), and 164 and 152 novel miRNAs in the CO and LTS libraries, respectively. We verify the expression of nine up-regulated miRNAs and eight down-regulation miRNAs by qRT-PCR, and found their expression patterns were consistent with the sequencing results. We found that cold stress may have produced dysregulation of free radical and lipid metabolism, decreased superoxide dismutase activity, reduced respiratory burst and phagocytic activity of macrophages, increased malondialdehyde content, and adversely affected the physiological adaptation of GIFT, eventually leading to death. This study revealed interactions among miRNAs and signal regulated pathways in GIFT under cold stress that may help to understand the pathways involved in cold resistance.

Cold fusion

International Nuclear Information System (INIS)

Koster, J.

1989-01-01

In this contribution the author the phenomenom of so-called cold fusion, inspired by the memorable lecture of Moshe Gai on his own search for this effect. Thus much of what follows was presented by Dr. Gai; the rest is from independent reading. What is referred to as cold fusion is of course the observation of possible products of deuteron-deuteron (d-d) fusion within deuterium-loaded (dentended) electrodes. The debate over the two vanguard cold fusion experiments has raged under far more public attention than usually accorded new scientific phenomena. The clamor commenced with the press conference of M. Fleishmann and S. Pons on March 23, 1989 and the nearly simultaneous wide circulation of a preprint of S. Jones and collaborators. The majority of work attempting to confirm these observations has at the time of this writing yet to appear in published form, but contributions to conferences and electronic mail over computer networks were certainly filled with preliminary results. To keep what follows to a reasonable length the author limit this discussion to the searches for neutron (suggested by ref. 2) or for excessive heat production (suggested by ref. 1), following a synopsis of the hypotheses of cold fusion

Adaptation of lodgepole pine and interior spruce to climate: implications for reforestation in a warming world.

Science.gov (United States)

Liepe, Katharina J; Hamann, Andreas; Smets, Pia; Fitzpatrick, Connor R; Aitken, Sally N

2016-02-01

We investigated adaptation to climate in populations of two widespread tree species across a range of contrasting environments in western Canada. In a series of common garden experiments, bud phenology, cold hardiness, and seedling growth traits were assessed for 254 populations in the interior spruce complex (Picea glauca, P. engelmannii, and their hybrids) and for 281 populations of lodgepole pine (Pinus contorta). Complex multitrait adaptations to different ecological regions such as boreal, montane, coastal, and arid environments accounted for 15-20% of the total variance. This population differentiation could be directly linked to climate variables through multivariate regression tree analysis. Our results suggest that adaptation to climate does not always correspond linearly to temperature gradients. For example, opposite trait values (e.g., early versus late budbreak) may be found in response to apparently similar cold environments (e.g., boreal and montane). Climate change adaptation strategies may therefore not always be possible through a simple shift of seed sources along environmental gradients. For the two species in this study, we identified a relatively small number of uniquely adapted populations (11 for interior spruce and nine for lodgepole pine) that may be used to manage adaptive variation under current and expected future climates.

Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi

Energy Technology Data Exchange (ETDEWEB)

Steffen, K T; Hatakka, A [Dept. of Applied Chemistry and Microbiology, Univ. of Helsinki (Finland); Hofrichter, M [Unit of Environmental Biotechnology, International Graduate School Zittau, Zittau (Germany)

2003-07-01

Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l{sup -1}) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 {mu}M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l{sup -1} in the absence of Mn(II) to 320 U l{sup -1} in Mn(II)-supplemented cultures. The latter degraded about 6% of a {sup 14}C-labeled BaP into {sup 14}CO{sub 2} whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of {sup 14}C-labeled BaP within 12 weeks. (orig.)

Removal and mineralization of polycyclic aromatic hydrocarbons by litter-decomposing basidiomycetous fungi.

Science.gov (United States)

Steffen, K T; Hatakka, A; Hofrichter, M

2002-10-01

Nine strains of litter-decomposing fungi, representing eight species of agaric basidiomycetes, were tested for their ability to remove a mixture of three polycyclic aromatic hydrocarbons (PAHs) (total 60 mg l(-1)) comprising anthracene, pyrene and benzo(a)pyrene (BaP) in liquid culture. All strains were able to convert this mixture to some extent, but considerable differences in degradative activity were observed depending on the species, the Mn(II) concentration, and the particular PAH. Stropharia rugosoannulata was the most efficient degrader, removing or transforming BaP almost completely and about 95% of anthracene and 85% of pyrene, in cultures supplemented with 200 micro M Mn(II), within 6 weeks. In contrast less than 40, 18, and 50% BaP, anthracene and pyrene, respectively, were degraded in the absence of supplemental Mn(II). In the case of Stropharia coronilla, the presence of Mn(II) led to a 20-fold increase of anthracene conversion. The effect of manganese could be attributed to the stimulation of manganese peroxidase (MnP). The maximum activity of MnP increased in S. rugosoannulata cultures from 10 U l(-1) in the absence of Mn(II) to 320 U l(-1) in Mn(II)-supplemented cultures. The latter degraded about 6% of a (14)C-labeled BaP into (14)CO(2) whereas only 0.7% was mineralized in the absence of Mn(II). In solid-state straw cultures, S. rugosoannulata, S. coronilla and Agrocybe praecox mineralized between 4 and 6% of (14)C-labeled BaP within 12 weeks.

Cold acclimation and cognitive performance: A review.

Science.gov (United States)

Jones, Douglas M; Bailey, Stephen P; Roelands, Bart; Buono, Michael J; Meeusen, Romain

2017-12-01

Athletes, occupational workers, and military personnel experience cold temperatures through cold air exposure or cold water immersion, both of which impair cognitive performance. Prior work has shown that neurophysiological pathways may be sensitive to the effects of temperature acclimation and, therefore, cold acclimation may be a potential strategy to attenuate cold-induced cognitive impairments for populations that are frequently exposed to cold environments. This review provides an overview of studies that examine repeated cold stress, cold acclimation, and measurements of cognitive performance to determine whether or not cold acclimation provides beneficial protection against cold-induced cognitive performance decrements. Studies included in this review assessed cognitive measures of reaction time, attention, logical reasoning, information processing, and memory. Repeated cold stress, with or without evidence of cold acclimation, appears to offer no added benefit of improving cognitive performance. However, research in this area is greatly lacking and, therefore, it is difficult to draw any definitive conclusions regarding the use of cold acclimation to improve cognitive performance during subsequent cold exposures. Given the current state of minimal knowledge on this topic, athletes, occupational workers, and military commands looking to specifically enhance cognitive performance in cold environments would likely not be advised to spend the time and effort required to become acclimated to cold. However, as more knowledge becomes available in this area, recommendations may change. Copyright © 2017 Elsevier B.V. All rights reserved.

Intra-Specific Variation Reveals Potential for Adaptation to Ocean Acidification in a Cold-Water Coral from the Gulf of Mexico

Directory of Open Access Journals (Sweden)

Melissa D. Kurman

2017-05-01

Full Text Available Ocean acidification, the decrease in seawater pH due to the absorption of atmospheric CO2, profoundly threatens the survival of a large number of marine species. Cold-water corals are considered to be among the most vulnerable organisms to ocean acidification because they are already exposed to relatively low pH and corresponding low calcium carbonate saturation states (Ω. Lophelia pertusa is a globally distributed cold-water scleractinian coral that provides critical three-dimensional habitat for many ecologically and economically significant species. In this study, four different genotypes of L. pertusa were exposed to three pH treatments (pH = 7.60, 7.75, and 7.90 over a short (2-week experimental period, and six genotypes were exposed to two pH treatments (pH = 7.60 and 7.90 over a long (6-month experimental period. Their physiological response was measured as net calcification rate and the activity of carbonic anhydrase, a key enzyme in the calcification pathway. In the short-term experiment, net calcification rates did not significantly change with pH, although they were highly variable in the low pH treatment, including some genotypes that maintained positive net calcification in undersaturated conditions. In the 6-month experiment, average net calcification was significantly reduced at low pH, with corals exhibiting net dissolution of skeleton. However, one of the same genotypes that maintained positive net calcification (+0.04% day−1 under the low pH treatment in the short-term experiment also maintained positive net calcification longer than the other genotypes in the long-term experiment, although none of the corals maintained positive calcification for the entire 6 months. Average carbonic anhydrase activity was not affected by pH, although some genotypes exhibited small, insignificant, increases in activity after the sixth month. Our results suggest that while net calcification in L. pertusa is adversely affected by ocean

What is the best clothing to prevent heat and cold stress? Experiences with thermal manikin.

Science.gov (United States)

Magyar, Z; Tamas, R

2013-02-01

The present study summarizes the current knowledge of the heat and cold stress which might significantly affect military activities and might also occur among travellers who are not well adapted to weather variations during their journey. The selection of the best clothing is a very important factor in preserving thermal comfort. Our experiences with thermal manikin are also represented in this paper.

Influence of Adaptive Comfort Models on Energy Improvement for Housing in Cold Areas

Directory of Open Access Journals (Sweden)

Alexis Pérez-Fargallo

2018-03-01

Full Text Available The evaluation of construction standards using adaptive thermal comfort models has a great impact on energy consumption. The analysis of a user’s climate adaptation must be one of the first steps in the search for nearly/net Zero Energy Buildings (nZEB. The goal of this work is to analyze the standards recommended by the Chile’s Construction with Sustainability Criteria for the building of housing, applying the ASHRAE 55-2017 and EN 15251:2007 adaptive comfort models in social housing. The study produces concrete recommendations associated with construction strategies, to increase the number of hours the user finds themselves with acceptable thermal comfort levels, without repercussions for energy consumption. Sixteen parametric series were evaluated with a dynamic simulation of the most common prototype of social housing in the Bio-Bio Region. The study shows that thermal comfort conditions can be increased through a combination of improvement measures compared to the ECCS standard (Construction Standards with Sustainability Criteria: 27.52% in the case of applying EN 15251:2007 and 24.04% in the case of ASHRAE 55-2017.

Characterisation of the transcriptomes of genetically diverse Listeria monocytogenes exposed to hyperosmotic and low temperature conditions reveal global stress-adaptation mechanisms.

Directory of Open Access Journals (Sweden)

Juliana Durack

Full Text Available The ability of Listeria monocytogenes to adapt to various food and food- processing environments has been attributed to its robustness, persistence and prevalence in the food supply chain. To improve the present understanding of molecular mechanisms involved in hyperosmotic and low-temperature stress adaptation of L. monocytogenes, we undertook transcriptomics analysis on three strains adapted to sub-lethal levels of these stress stimuli and assessed functional gene response. Adaptation to hyperosmotic and cold-temperature stress has revealed many parallels in terms of gene expression profiles in strains possessing different levels of stress tolerance. Gene sets associated with ribosomes and translation, transcription, cell division as well as fatty acid biosynthesis and peptide transport showed activation in cells adapted to either cold or hyperosmotic stress. Repression of genes associated with carbohydrate metabolism and transport as well as flagella was evident in stressed cells, likely linked to activation of CodY regulon and consequential cellular energy conservation.

Spectroscopy with cold and ultra-cold neutrons

Directory of Open Access Journals (Sweden)

Abele Hartmut

2015-01-01

Full Text Available We present two new types of spectroscopy methods for cold and ultra-cold neutrons. The first method, which uses the R×B drift effect to disperse charged particles in a uniformly curved magnetic field, allows to study neutron β-decay. We aim for a precision on the 10−4 level. The second method that we refer to as gravity resonance spectroscopy (GRS allows to test Newton’s gravity law at short distances. At the level of precision we are able to provide constraints on any possible gravity-like interaction. In particular, limits on dark energy chameleon fields are improved by several orders of magnitude.

Cold recovery during regasification of LNG part one: Cold utilization far from the regasification facility

International Nuclear Information System (INIS)

La Rocca, Vincenzo

2010-01-01

The paper deals with cold recovery during LNG regasification. The applications analyzed pertain to the use in deep freezing agro food industry and in space air conditioning facilities in commercial sector (Supermarkets and Hypermarkets) of cold recovered from the regasification process. A modular LNG regasification unit is proposed having the regasification capacity of 2 BCM/year of gas and it is based on use of a Power Cycle working with Ethane, this unit allows operation of cold energy transfer, contained in LNG to be regasified, in a range of temperatures suitable for multipurpose use of cold, reducing regasification process irreversibility. Some electric energy is produced by the Power Cycle, but the purpose of the modular unit is to deliver cold suitable for industrial and commercial use in the proper temperature range utilizing Carbon dioxide as secondary fluid to transfer cold from regasification site to far end users. The subject is divided in two papers: this paper deals with facilities delivering cold released during LNG regasification and related pipeline facilities to transfer cold at far end users while the other paper pertains to analysis of end users applications. Results of a detailed thermodynamic and economic analysis demonstrate the suitability of the proposal.

[First report of Montagnea arenaria (D.C.) Zeller (Agaricales) in Chile].

Science.gov (United States)

Madrid Lorca, Hugo; Muñoz, Mélica

2006-06-01

Montagnea arenaria (D.C.) Zeller (Agaricales), an interesting basidiomycete adapted to arid environments is recorded for the first time from a sample collected on sandy soil in the northern zone of Chile. Its mature fruiting body is described. Taxonomic and ecological comments are also addressed.

Global analysis of transcriptome responses and gene expression profiles to cold stress of Jatropha curcas L.

Directory of Open Access Journals (Sweden)

Haibo Wang

Full Text Available BACKGROUND: Jatropha curcas L., also called the Physic nut, is an oil-rich shrub with multiple uses, including biodiesel production, and is currently exploited as a renewable energy resource in many countries. Nevertheless, because of its origin from the tropical MidAmerican zone, J. curcas confers an inherent but undesirable characteristic (low cold resistance that may seriously restrict its large-scale popularization. This adaptive flaw can be genetically improved by elucidating the mechanisms underlying plant tolerance to cold temperatures. The newly developed Illumina Hiseq™ 2000 RNA-seq and Digital Gene Expression (DGE are deep high-throughput approaches for gene expression analysis at the transcriptome level, using which we carefully investigated the gene expression profiles in response to cold stress to gain insight into the molecular mechanisms of cold response in J. curcas. RESULTS: In total, 45,251 unigenes were obtained by assembly of clean data generated by RNA-seq analysis of the J. curcas transcriptome. A total of 33,363 and 912 complete or partial coding sequences (CDSs were determined by protein database alignments and ESTScan prediction, respectively. Among these unigenes, more than 41.52% were involved in approximately 128 known metabolic or signaling pathways, and 4,185 were possibly associated with cold resistance. DGE analysis was used to assess the changes in gene expression when exposed to cold condition (12°C for 12, 24, and 48 h. The results showed that 3,178 genes were significantly upregulated and 1,244 were downregulated under cold stress. These genes were then functionally annotated based on the transcriptome data from RNA-seq analysis. CONCLUSIONS: This study provides a global view of transcriptome response and gene expression profiling of J. curcas in response to cold stress. The results can help improve our current understanding of the mechanisms underlying plant cold resistance and favor the screening of

Use of intraspecific variation in thermal responses for estimating an elevational cline in the timing of cold hardening in a sub-boreal conifer.

Science.gov (United States)

Ishizuka, W; Ono, K; Hara, T; Goto, S

2015-01-01

To avoid winter frost damage, evergreen coniferous species develop cold hardiness with suitable phenology for the local climate regime. Along the elevational gradient, a genetic cline in autumn phenology is often recognised among coniferous populations, but further quantification of evolutionary adaptation related to the local environment and its responsible signals generating the phenological variation are poorly understood. We evaluated the timing of cold hardening among populations of Abies sachalinensis, based on time series freezing tests using trees derived from four seed source populations × three planting sites. Furthermore, we constructed a model to estimate the development of hardening from field temperatures and the intraspecific variations occurring during this process. An elevational cline was detected such that high-elevation populations developed cold hardiness earlier than low-elevation populations, representing significant genetic control. Because development occurred earlier at high-elevation planting sites, the genetic trend across elevation overlapped with the environmental trend. Based on the trade-off between later hardening to lengthen the active growth period and earlier hardening to avoid frost damage, this genetic cline would be adaptive to the local climate. Our modelling approach estimated intraspecific variation in two model components: the threshold temperature, which was the criterion for determining whether the trees accumulated the thermal value, and the chilling requirement for trees to achieve adequate cold hardiness. A higher threshold temperature and a lower chilling requirement could be responsible for the earlier phenology of the high-elevation population. These thermal responses may be one of the important factors driving the elevation-dependent adaptation of A. sachalinensis. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Cold-adapted influenza and recombinant adenovirus vaccines induce cross-protective immunity against pH1N1 challenge in mice.

Directory of Open Access Journals (Sweden)

Mark R Soboleski

Full Text Available The rapid spread of the 2009 H1N1 pandemic influenza virus (pH1N1 highlighted problems associated with relying on strain-matched vaccines. A lengthy process of strain identification, manufacture, and testing is required for current strain-matched vaccines and delays vaccine availability. Vaccines inducing immunity to conserved viral proteins could be manufactured and tested in advance and provide cross-protection against novel influenza viruses until strain-matched vaccines became available. Here we test two prototype vaccines for cross-protection against the recent pandemic virus.BALB/c and C57BL/6 mice were intranasally immunized with a single dose of cold-adapted (ca influenza viruses from 1977 or recombinant adenoviruses (rAd expressing 1934 nucleoprotein (NP and consensus matrix 2 (M2 (NP+M2-rAd. Antibodies against the M2 ectodomain (M2e were seen in NP+M2-rAd immunized BALB/c but not C57BL/6 mice, and cross-reacted with pH1N1 M2e. The ca-immunized mice did not develop antibodies against M2e. Despite sequence differences between vaccine and challenge virus NP and M2e epitopes, extensive cross-reactivity of lung T cells with pH1N1 peptides was detected following immunization. Both ca and NP+M2-rAd immunization protected BALB/c and C57BL/6 mice against challenge with a mouse-adapted pH1N1 virus.Cross-protective vaccines such as NP+M2-rAd and ca virus are effective against pH1N1 challenge within 3 weeks of immunization. Protection was not dependent on recognition of the highly variable external viral proteins and could be achieved with a single vaccine dose. The rAd vaccine was superior to the ca vaccine by certain measures, justifying continued investigation of this experimental vaccine even though ca vaccine is already available. This study highlights the potential for cross-protective vaccines as a public health option early in an influenza pandemic.

Partitioning of Multivariate Phenotypes using Regression Trees Reveals Complex Patterns of Adaptation to Climate across the Range of Black Cottonwood (Populus trichocarpa

Directory of Open Access Journals (Sweden)

Regis Wendpouire Oubida

2015-03-01

Full Text Available Local adaptation to climate in temperate forest trees involves the integration of multiple physiological, morphological, and phenological traits. Latitudinal clines are frequently observed for these traits, but environmental constraints also track longitude and altitude. We combined extensive phenotyping of 12 candidate adaptive traits, multivariate regression trees, quantitative genetics, and a genome-wide panel of SNP markers to better understand the interplay among geography, climate, and adaptation to abiotic factors in Populus trichocarpa. Heritabilities were low to moderate (0.13 to 0.32 and population differentiation for many traits exceeded the 99th percentile of the genome-wide distribution of FST, suggesting local adaptation. When climate variables were taken as predictors and the 12 traits as response variables in a multivariate regression tree analysis, evapotranspiration (Eref explained the most variation, with subsequent splits related to mean temperature of the warmest month, frost-free period (FFP, and mean annual precipitation (MAP. These grouping matched relatively well the splits using geographic variables as predictors: the northernmost groups (short FFP and low Eref had the lowest growth, and lowest cold injury index; the southern British Columbia group (low Eref and intermediate temperatures had average growth and cold injury index; the group from the coast of California and Oregon (high Eref and FFP had the highest growth performance and the highest cold injury index; and the southernmost, high-altitude group (with high Eref and low FFP performed poorly, had high cold injury index, and lower water use efficiency. Taken together, these results suggest variation in both temperature and water availability across the range shape multivariate adaptive traits in poplar.

Amplification and quantification of cold-associated microRNAs in the Colorado potato beetle (Leptinotarsa decemlineata) agricultural pest.

Science.gov (United States)

Morin, M D; Frigault, J J; Lyons, P J; Crapoulet, N; Boquel, S; Storey, K B; Morin, P Jr

2017-10-01

The Colorado potato beetle [Leptinotarsa decemlineata (Say)] is an important insect pest that can inflict considerable damage to potato plants. This insect can survive extended periods of cold exposure, and yet the molecular switches underlying this phenomenon have not been fully elucidated. A better characterization of this process would highlight novel vulnerabilities associated with L. decemlineata that could serve as targets for the management of this devastating pest. Using high-throughput sequencing, the current work reveals a cold-associated signature group of microRNAs (miRNAs) in control (15 °C) and -5 °C-exposed L. decemlineata. The results show 42 differentially expressed miRNAs following cold exposure including miR-9a-3p, miR-210-3p, miR-276-5p and miR-277-3p. Functional analysis of predicted targets associated with these cold-responsive miRNAs notably linked these changes with vital metabolic and cellular processes. Overall, this study highlights the miRNAs probably responsible for facilitating cold adaptation in L. decemlineata and implicates miRNAs as a key molecular target to consider in the development of novel pest management strategies against these insects. © 2017 The Royal Entomological Society.

Cold Exposure Induces Proliferation of Mature Brown Adipocyte in a ß3-Adrenergic Receptor-Mediated Pathway.

Science.gov (United States)

Fukano, Keigo; Okamatsu-Ogura, Yuko; Tsubota, Ayumi; Nio-Kobayashi, Junko; Kimura, Kazuhiro

2016-01-01

Hyperplasia of brown adipose tissue (BAT) is a fundamental mechanism for adaptation to survive in the cold environment in rodents. To determine which cell types comprising BAT contribute to tissue hyperplasia, immunohistochemical analysis using a proliferative marker Ki67 was performed on the BAT from 6-week-old C57BL/6J mice housed at 23°C (control) or 10°C (cold) for 5 days. Interestingly, in the control group, the cell proliferative marker Ki67 was detected in the nuclei of uncoupling protein 1-positive mature brown adipocytes (7.2% ± 0.4% of brown adipocyte), as well as in the non-adipocyte stromal-vascular (SV) cells (19.6% ± 2.3% of SV cells), which include preadiopocytes. The percentage of Ki67-positive brown adipocytes increased to 25.6% ± 1.8% at Day 1 after cold exposure and was significantly higher than the non-cold acclimated control until Day 5 (21.8% ± 1.7%). On the other hand, the percentage of Ki67-positive SV cells gradually increased by a cold exposure and peaked to 42.1% ± 8.3% at Day 5. Injection of a ß3-adrenergic receptor (ß3-AR) agonist for continuous 5 days increased the number of Ki67-positive brown adipocytes even at Day 1 but not that of SV cells. In addition, the ß3-AR antagonist, but not ß1-AR antagonist, attenuated the cold exposure-induced increase in the number of Ki67-positive brown adipocytes. These results suggest that mature brown adipocytes proliferate immediately after cold exposure in a ß3-AR-mediated pathway. Thus, proliferation of mature brown adipocytes as well as preadipocytes in SV cells may contribute to cold exposure-induced BAT hyperplasia.

Contemporary temperature-driven divergence in a Nordic freshwater fish under conditions commonly thought to hinder adaptation

Directory of Open Access Journals (Sweden)

Gregersen Finn

2010-11-01

Full Text Available Abstract Background Evaluating the limits of adaptation to temperature is important given the IPCC-predicted rise in global temperatures. The rate and scope of evolutionary adaptation can be limited by low genetic diversity, gene flow, and costs associated with adaptive change. Freshwater organisms are physically confined to lakes and rivers, and must therefore deal directly with climate variation and change. In this study, we take advantage of a system characterised by low genetic variation, small population size, gene flow and between-trait trade-offs to study how such conditions affect the ability of a freshwater fish to adapt to climate change. We test for genetically-based differences in developmental traits indicating local adaptation, by conducting a common-garden experiment using embryos and larvae from replicate pairs of sympatric grayling demes that spawn and develop in natural cold and warm water, respectively. These demes have common ancestors from a colonization event 22 generations ago. Consequently, we explore if diversification may occur under severely constraining conditions. Results We found evidence for divergence in ontogenetic rates. The divergence pattern followed adaptation predictions as cold-deme individuals displayed higher growth rates and yolk conversion efficiency than warm-deme individuals at the same temperature. The cold-deme embryos had a higher rate of muscle mass development. Most of the growth- and development differences occurred prior to hatch. The divergence was probably not caused by genetic drift as there was a strong degree of parallelism in the divergence pattern and because phenotypic differentiation (QST was larger than estimated genetic drift levels (microsatellite FST between demes from different temperature groups. We also document that these particular grayling populations cannot develop successfully at temperatures above 12°C, whereas other European populations can, and that increasing the

Age and Ethnic Differences in Cold Weather and Contagion Theories of Colds and Flu

Science.gov (United States)

Sigelman, Carol K.

2012-01-01

Age and ethnic group differences in cold weather and contagion or germ theories of infectious disease were explored in two studies. A cold weather theory was frequently invoked to explain colds and to a lesser extent flu but became less prominent with age as children gained command of a germ theory of disease. Explanations of how contact with…

Cold knife cone biopsy

Science.gov (United States)

... biopsy; Pap smear - cone biopsy; HPV - cone biopsy; Human papilloma virus - cone biopsy; Cervix - cone biopsy; Colposcopy - cone biopsy Images Female reproductive anatomy Cold cone biopsy Cold cone removal References Baggish ...

Cold water injection nozzles

International Nuclear Information System (INIS)

Kura, Masaaki; Maeda, Masamitsu; Endo, Takio.

1979-01-01

Purpose: To inject cold water in a reactor without applying heat cycles to a reactor container and to the inner wall of a feedwater nozzle by securing a perforated plate at the outlet of the cold water injection nozzle. Constitution: A disc-like cap is secured to the final end of a return nozzle of a control rod drive. The cap prevents the flow of a high temperature water flowing downward in the reactor from entering into the nozzle. The cap is perforated with a plurality of bore holes for injecting cold water into the reactor. The cap is made to about 100 mm in thickness so that the cold water passing through the bore holes is heated by the heat conduction in the cap. Accordingly, the flow of high temperature water flowing downwardly in the reactor is inhibited by the cap from backward flowing into the nozzle. Moreover, the flow of the cold water in the nozzle is controlled and rectified when passed through the bore holes in the cap and then injected into the reactor. (Yoshino, Y.)

Development of cold neutron spectrometers

International Nuclear Information System (INIS)

Lee, Changhee; Lee, C. H.; So, J. Y.; Park, S.; Han, Y. S.; Cho, S. J.; Moon, M. K.; Choi, Y. H.; Sun, G. M.

2012-03-01

□ Cold Neutron Triple Axsis Spectrometer (Cold-TAS) Development Ο Fabrication and Installation of the Major Cold-TAS Components Ο Performance Test of the Cold-TAS □ Cold Neutron Time-of-Flight Spectrometer(DC-TOF) Development Ο Fabrication of the Major DC-TOF Components Ο Development DC-TOF Data Reduction Software □ Expected Contribution The two world-class inelastic neutron scattering instruments measure atomic or molecular scale dynamics of meV energy range. This unprecedented measurement capability in the country will enable domestic and international scientists to observe new phenomena in their materials research to obtain world class results. Especially those who work in the fields of magnetic properties of superconductors and multiferroics, molecular dynamics, etc. will get more benefit from these two instruments

Cold perception and gene expression differ in Olea europaea seed coat and embryo during drupe cold acclimation.

Science.gov (United States)

D'Angeli, S; Falasca, G; Matteucci, M; Altamura, M M

2013-01-01

FAD2 and FAD7 desaturases are involved in cold acclimation of olive (Olea europaea) mesocarp. There is no research information available on cold acclimation of seeds during mesocarp cold acclimation or on differences in the cold response of the seed coat and embryo. How FAD2 and FAD7 affect seed coat and embryo cold responses is unknown. Osmotin positively affects cold acclimation in olive tree vegetative organs, but its role in the seeds requires investigation. OeFAD2.1, OeFAD2.2, OeFAD7 and Oeosmotin were investigated before and after mesocarp acclimation by transcriptomic, lipidomic and immunolabelling analyses, and cytosolic calcium concentration ([Ca(2+)](cyt)) signalling, F-actin changes and seed development were investigated by epifluorescence/histological analyses. Transient [Ca(2+)](cyt) rises and F-actin disassembly were found in cold-shocked protoplasts from the seed coat, but not from the embryo. The thickness of the outer endosperm cuticle increased during drupe exposure to lowering of temperature, whereas the embryo protoderm always lacked cuticle. OeFAD2 transcription increased in both the embryo and seed coat in the cold-acclimated drupe, but linoleic acid (i.e. the product of FAD2 activity) increased solely in the seed coat. Osmotin was immunodetected in the seed coat and endosperm of the cold-acclimated drupe, and not in the embryo. The results show cold responsiveness in the seed coat and cold tolerance in the embryo. We propose a role for the seed coat in maintaining embryo cold tolerance by increasing endosperm cutinization through FAD2 and osmotin activities. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Cold fusion research

International Nuclear Information System (INIS)

1989-11-01

I am pleased to forward to you the Final Report of the Cold Fusion Panel. This report reviews the current status of cold fusion and includes major chapters on Calorimetry and Excess Heat, Fusion Products and Materials Characterization. In addition, the report makes a number of conclusions and recommendations, as requested by the Secretary of Energy

COLD-WORKED HARDWARE

Directory of Open Access Journals (Sweden)

N. M. Strizhak

2007-01-01

Full Text Available The different types of cold-worked accessory are examined in the article. The necessity of development of such type of accessory in the Republic of Belarus due to requirements of market is shown. High emphasis is placed on the methods of increase of plasticity of cold-worked accessory from usual mill of RUP and CIS countries.

Correlation between Low Temperature Adaptation and Oxidative Stress in Saccharomyces cerevisiae

Directory of Open Access Journals (Sweden)

Estéfani García-Rios

2016-08-01

Full Text Available Many factors, such as must composition, juice clarification, fermentation temperature or inoculated yeast strain, strongly affect the alcoholic fermentation and aromatic profile of wine. As fermentation temperature is effectively controlled by the wine industry, low-temperature fermentation (10-15 ºC is becoming more prevalent in order to produce white and rosé wines with more pronounced aromatic profiles. Elucidating the response to cold in Saccharomyces cerevisiae is of paramount importance for the selection or genetic improvement of wine strains. Previous research has shown the strong implication of oxidative stress response in adaptation to low temperature during the fermentation process. Here we aimed first to quantify the correlation between recovery after shock with different oxidants and cold, and then to detect the key genes involved in cold adaptation that belong to sulfur assimilation, peroxiredoxins, glutathione-glutaredoxins and thioredoxins pathways. To do so, we analyzed the growth of knockouts from the EUROSCARF collection S. cerevisiae BY4743 strain at low and optimal temperatures. The growth rate of these knockouts, compared with the control, enabled us to identify the genes involved, which were also deleted and validated as key genes in the background of two commercial wine strains with a divergent phenotype in their low-temperature growth. We identified three genes, AHP1, MUP1 and URM1, whose deletion strongly impaired low-temperature growth.

Working in the Cold

Centers for Disease Control (CDC) Podcasts

During the winter, many workers are outdoors, working in cold, wet, icy, or snowy conditions. Learn how to identify symptoms that tell you there may be a problem and protect yourself from cold stress.

Dioszegia antarctica sp. nov. and Dioszegia cryoxerica sp. nov., psychrophilic basidiomycetous yeasts from polar desert soils in Antarctica

Science.gov (United States)

Rodriguez, Russell J.; Connell, L.; Redman, R.; Barrett, A.; Iszard, M.; Fonseca, A.

2010-01-01

During a survey of the culturable soil fungal population in samples collected in Taylor Valley, South Victoria Land, Antarctica, 13 basidiomycetous yeast strains with orange-coloured colonies were isolated. Phylogenetic analyses of internal transcribed spacer (ITS) and partial LSU rRNA gene sequences showed that the strains belong to the Dioszegia clade of the Tremellales (Tremellomycetes, Agaricomycotina), but did not correspond to any of the hitherto recognized species. Two novel species, Dioszegia antarctica sp. nov. (type strain ANT-03-116T =CBS 10920T =PYCC 5970T) and Dioszegia cryoxerica sp. nov. (type strain ANT-03-071T =CBS 10919T =PYCC 5967T), are described to accommodate ten and three of these strains, respectively. Analysis of ITS sequences demonstrated intrastrain sequence heterogeneity in D. cryoxerica. The latter species is also notable for producing true hyphae with clamp connections and haustoria. However, no sexual structures were observed. The two novel species can be considered obligate psychrophiles, since they failed to grow above 20 °C and grew best between 10 and 15 °C.

Major differences observed in transcript profiles of blueberry during cold acclimation under field and cold room conditions.

Science.gov (United States)

Dhanaraj, Anik L; Alkharouf, Nadim W; Beard, Hunter S; Chouikha, Imed B; Matthews, Benjamin F; Wei, Hui; Arora, Rajeev; Rowland, Lisa J

2007-02-01

Our laboratory has been working toward increasing our understanding of the genetic control of cold hardiness in blueberry (Vaccinium section Cyanococcus) to ultimately use this information to develop more cold hardy cultivars for the industry. Here, we report using cDNA microarrays to monitor changes in gene expression at multiple times during cold acclimation under field and cold room conditions. Microarrays contained over 2,500 cDNA inserts, approximately half of which had been picked and single-pass sequenced from each of two cDNA libraries that were constructed from cold acclimated floral buds and non-acclimated floral buds of the fairly cold hardy cv. Bluecrop (Vaccinium corymbosum L.). Two biological samples were examined at each time point. Microarray data were analyzed statistically using t tests, ANOVA, clustering algorithms, and online analytical processing (OLAP). Interestingly, more transcripts were found to be upregulated under cold room conditions than under field conditions. Many of the genes induced only under cold room conditions could be divided into three major types: (1) genes associated with stress tolerance; (2) those that encode glycolytic and TCA cycle enzymes, and (3) those associated with protein synthesis machinery. A few of the genes induced only under field conditions appear to be related to light stress. Possible explanations for these differences are discussed in physiological context. Although many similarities exist in how plants respond during cold acclimation in the cold room and in the field environment, there are major differences suggesting caution should be taken in interpreting results based only on artificial, cold room conditions.

Fungi Sailing the Arctic Ocean: Speciose Communities in North Atlantic Driftwood as Revealed by High-Throughput Amplicon Sequencing.

Science.gov (United States)

Rämä, Teppo; Davey, Marie L; Nordén, Jenni; Halvorsen, Rune; Blaalid, Rakel; Mathiassen, Geir H; Alsos, Inger G; Kauserud, Håvard

2016-08-01

High amounts of driftwood sail across the oceans and provide habitat for organisms tolerating the rough and saline environment. Fungi have adapted to the extremely cold and saline conditions which driftwood faces in the high north. For the first time, we applied high-throughput sequencing to fungi residing in driftwood to reveal their taxonomic richness, community composition, and ecology in the North Atlantic. Using pyrosequencing of ITS2 amplicons obtained from 49 marine logs, we found 807 fungal operational taxonomic units (OTUs) based on clustering at 97 % sequence similarity cut-off level. The phylum Ascomycota comprised 74 % of the OTUs and 20 % belonged to Basidiomycota. The richness of basidiomycetes decreased with prolonged submersion in the sea, supporting the general view of ascomycetes being more extremotolerant. However, more than one fourth of the fungal OTUs remained unassigned to any fungal class, emphasising the need for better DNA reference data from the marine habitat. Different fungal communities were detected in coniferous and deciduous logs. Our results highlight that driftwood hosts a considerably higher fungal diversity than currently known. The driftwood fungal community is not a terrestrial relic but a speciose assemblage of fungi adapted to the stressful marine environment and different kinds of wooden substrates found in it.

Time-of-Day Effects on Metabolic and Clock-Related Adjustments to Cold

Directory of Open Access Journals (Sweden)

Frederico Sander Mansur Machado

2018-04-01

Full Text Available BackgroundDaily cyclic changes in environmental conditions are key signals for anticipatory and adaptive adjustments of most living species, including mammals. Lower ambient temperature stimulates the thermogenic activity of brown adipose tissue (BAT and skeletal muscle. Given that the molecular components of the endogenous biological clock interact with thermal and metabolic mechanisms directly involved in the defense of body temperature, the present study evaluated the differential homeostatic responses to a cold stimulus at distinct time-windows of the light/dark-cycle.MethodsMale Wistar rats were subjected to a single episode of 3 h cold ambient temperature (4°C at one of 6 time-points starting at Zeitgeber Times 3, 7, 11, 15, 19, and 23. Metabolic rate, core body temperature, locomotor activity (LA, feeding, and drinking behaviors were recorded during control and cold conditions at each time-point. Immediately after the stimulus, rats were euthanized and both the soleus and BAT were collected for real-time PCR.ResultsDuring the light phase (i.e., inactive phase, cold exposure resulted in a slight hyperthermia (p < 0.001. Light phase cold exposure also increased metabolic rate and LA (p < 0.001. In addition, the prevalence of fat oxidative metabolism was attenuated during the inactive phase (p < 0.001. These metabolic changes were accompanied by time-of-day and tissue-specific changes in core clock gene expression, such as DBP (p < 0.0001 and REV-ERBα (p < 0.01 in the BAT and CLOCK (p < 0.05, PER2 (p < 0.05, CRY1 (p < 0.05, CRY2 (p < 0.01, and REV-ERBα (p < 0.05 in the soleus skeletal muscle. Moreover, genes involved in substrate oxidation and thermogenesis were affected in a time-of-day and tissue-specific manner by cold exposure.ConclusionThe time-of-day modulation of substrate mobilization and oxidation during cold exposure provides a clear example of the circadian modulation of physiological

Effects of cold temperatures on the excitability of rat trigeminal ganglion neurons that are not for cold sensing.

Science.gov (United States)

Kanda, Hirosato; Gu, Jianguo G

2017-05-01

Aside from a small population of primary afferent neurons for sensing cold, which generate sensations of innocuous and noxious cold, it is generally believed that cold temperatures suppress the excitability of primary afferent neurons not responsible for cold sensing. These not-for-cold-sensing neurons include the majority of non-nociceptive and nociceptive afferent neurons. In this study we have found that the not-for-cold-sensing neurons of rat trigeminal ganglia (TG) change their excitability in several ways at cooling temperatures. In nearly 70% of not-for-cold-sensing TG neurons, a cooling temperature of 15°C increases their membrane excitability. We regard these neurons as cold-active neurons. For the remaining 30% of not-for-cold-sensing TG neurons, the cooling temperature of 15°C either has no effect (cold-ineffective neurons) or suppress their membrane excitability (cold-suppressive neurons). For cold-active neurons, the cold temperature of 15°C increases their excitability as is evidenced by increases in action potential (AP) firing numbers and/or the reduction in AP rheobase when these neurons are depolarized electrically. The cold temperature of 15°C significantly inhibits M-currents and increases membrane input resistance of cold-active neurons. Retigabine, an M-current activator, abolishes the effect of cold temperatures on AP firing, but not the effect of cold temperature on AP rheobase levels. The inhibition of M-currents and the increases of membrane input resistance are likely two mechanisms by which cooling temperatures increase the excitability of not-for-cold-sensing TG neurons. This article is part of the special article series "Pain". © 2015 International Society for Neurochemistry.

Impairment of exercise performance following cold water immersion is not attenuated after 7 days of cold acclimation.

Science.gov (United States)

Jones, Douglas M; Roelands, Bart; Bailey, Stephen P; Buono, Michael J; Meeusen, Romain

2018-03-19

It is well-documented that severe cold stress impairs exercise performance. Repeated immersion in cold water induces an insulative type of cold acclimation, wherein enhanced vasoconstriction leads to greater body heat retention, which may attenuate cold-induced exercise impairments. The purpose of this study, therefore, was to investigate changes in exercise performance during a 7-day insulative type of cold acclimation. Twelve healthy participants consisting of eight males and four females (mean ± SD age: 25.6 ± 5.2 years, height: 174.0 ± 8.9 cm, weight: 75.6 ± 13.1 kg) performed a 20 min self-paced cycling test in 23 °C, 40% humidity without prior cold exposure. Twenty-four hours later they began a 7-day cold acclimation protocol (daily 90 min immersion in 10 °C water). On days one, four, and seven of cold acclimation, participants completed the same cycling test. Measurements of work completed, core and skin temperatures, heart rate, skin blood flow, perceived exertion, and thermal sensation were measured during each cycling test. Successful insulative cold acclimation was observed. Work produced during the baseline cycling test (220 ± 70 kJ) was greater (p immersions (195 ± 58, 197 ± 60, and 194 ± 62 kJ) despite similar ratings of perceived exertion during each test, suggesting that cold exposure impaired cycling performance. This impairment, however, was not attenuated over the cold acclimation period. Results suggest that insulative cold acclimation does not attenuate impairments in exercise performance that were observed following acute cold water immersion.

Analysis of cold resistance and identification of SSR markers linked to cold resistance genes in Brassica rapa L.

Science.gov (United States)

Huang, Zhen; Zhang, Xuexian; Jiang, Shouhua; Qin, Mengfan; Zhao, Na; Lang, Lina; Liu, Yaping; Tian, Zhengshu; Liu, Xia; Wang, Yang; Zhang, Binbin; Xu, Aixia

2017-06-01

Currently, cold temperatures are one of the main factors threatening rapeseed production worldwide; thus, it is imperative to identify cold-resistant germplasm and to cultivate cold-resistant rapeseed varieties. In this study, the cold resistance of four Brassica rapa varieties was analyzed. The cold resistance of Longyou6 and Longyou7 was better than that of Tianyou2 and Tianyou4. Thus, an F 2 population derived from Longyou6 and Tianyou4 was used to study the correlation of cold resistance and physiological indexes. Our results showed that the degree of frost damage was related to the relative conductivity and MDA content (r1 = 0.558 and r2 = 0.447, respectively). In order to identify the markers related to cold resistance, 504 pairs of SSR (simple sequence repeats) primers were used to screen the two parents and F 2 population. Four and five SSR markers had highly significant positive correlation to relative conductivity and MDA, respectively. In addition, three of these SSR markers had a highly significant positive correlation to both of these two indexes. These three SSR markers were subsequently confirmed to be used to distinguish between cold-resistant and non-cold-resistant varieties. The results of this study will lay a solid foundation for the mapping of cold-resistant genes and molecular markers assisted selection for the cold-resistance.

Colds and the Flu

Science.gov (United States)

... disease (COPD). What medicines can I give my child? There is no cure for the cold or the flu, and antibiotics do not work against the viruses that cause colds and the flu. Pain relievers such as ...

Beam-transport optimization for cold-neutron spectrometer

Directory of Open Access Journals (Sweden)

Nakajima Kenji

2015-01-01

Full Text Available We report the design of the beam-transport system (especially the vertical geometry for a cold-neutron disk-chopper spectrometer AMATERAS at J-PARC. Based on the elliptical shape, which is one of the most effective geometries for a ballistic mirror, the design was optimized to obtain, at the sample position, a neutron beam with high flux without serious degrading in divergence and spacial homogeneity within the boundary conditions required from actual spectrometer construction. The optimum focal point was examined. An ideal elliptical shape was modified to reduce its height without serious loss of transmission. The final result was adapted to the construction requirements of AMATERAS. Although the ideas studied in this paper are considered for the AMATERAS case, they can be useful also to other spectrometers in similar situations.

Cold neutron interferometry and its application. 2. Coherency and cold neutron spin interferometry

International Nuclear Information System (INIS)

Achiwa, Norio; Ebisawa, Toru

1998-03-01

The second workshop entitled 'Interference studies and cold neutron spin interferometry' was held on 10 and 11 March 1998 at KUR (Kyoto University Research Reactor Institute, Kumatori). Cold neutron spin interferometry is a new field. So it is very important for its development to learn the studies of X-ray and neutron optics which are rapidly developing with long history. In the workshop, the issues related to interference were reviewed such as experimental studies on cold neutron spin interferometry, theoretical and experimental approach on tunneling time, interference experiments by neutrons and its application, interference studies using synchrotron radiation, topics on silicon interferometry and quantum measurement problem and cold neutron interference experiment related to quantum measurement problem. The 8 of the presented papers are indexed individually. (J.P.N.)

Cold moderators at ORNL

International Nuclear Information System (INIS)

Lucas, A. T.

1997-09-01

The Advanced Neutron Source (ANS) cold moderators were not an 'Oak Ridge first', but would have been the largest both physically and in terms of cold neutron flux. Two cold moderators were planned each 410 mm in diameter and containing about 30L of liquid deuterium. They were to be completely independent of each other. A modular system design was used to provide greater reliability and serviceability. When the ANS was terminated, upgrading of the resident High Flux Isotope Reactor (HFIR) was examined and an initial study was made into the feasibility of adding a cold source. Because the ANS design was modular, it was possible to use many identical design features. Sub-cooled liquid at 4 bar abs was initially chosen for the HFIR design concept, but this was subsequently changed to 15 bar abs to operate above the critical pressure. As in the ANS, the hydrogen will operate at a constant pressure throughout the temperature range and a completely closed loop with secondary containment was adopted. The heat load of 2 kW made the heat flux comparable with that of the ANS. Subsequent studies into the construction of cryogenic moderators for the proposed new Synchrotron Neutron source indicated that again many of the same design concepts could be used. By connecting the two cold sources together in series, the total heat load of 2 kW is very close to that of the HFIR allowing a very similar supercritical hydrogen system to be configured. The two hydrogen moderators of the SNS provide a comparable heat load to the HFIR moderator. It is subsequently planned to connect the two in series and operate from a single cold loop system, once again using supercritical hydrogen. The spallation source also provided an opportunity to re-examine a cold pellet solid methane moderator operating at 20K.

IMPROVED, FAVORABLE FOR ENVIRONMENT POLYURETHANE COLD-BOX-PROCESS (COLD BOX «HUTTENES-ALBERTUS» .

Directory of Open Access Journals (Sweden)

A. Sergini

2005-01-01

Full Text Available The results of the laboratory and industrial investigations, the purpose of which is improvement of the classical Cold-box-process, i.e. the process of the slugs hardening in cold boxes, are presented.

Effects of Dăoyĭn Qìgōng in postpolio syndrome patients with cold intolerance

Directory of Open Access Journals (Sweden)

Paulo Eduardo Ramos

2012-09-01

Full Text Available Postpolio syndrome (PPS is characterized by progressive muscle weakness due to former infection with poliomyelitis and can be associated with other symptoms such as cold intolerance (CI. Dăoyĭn Qìgōng (DQ is a technique in Traditional Chinese Medicine that impacts the circulation of energy and blood. OBJECTIVE: It was to verify the effects of DQ in PPS patients complaining of cold intolerance. METHODS: Ten PPS patients were assessed using the visual analogue scale (VAS adapted for CI before and after intervention with DQ; patients practiced it in a sitting position for 40 minutes, 3 times per week over 3 consecutive months. Patients were reassessed three months after ceasing DQ. RESULTS: There was a statistically significant difference in local and systemic VAS-Cold both at the end of DQ training and three months past the end of this. CONCLUSION: The DQ technique ameliorated CI complaints in patients with PPS.

Cold medicines and children

Science.gov (United States)

... ingredient. Avoid giving more than one OTC cold medicine to your child. It may cause an overdose with severe side ... the dosage instructions strictly while giving an OTC medicine to your child. When giving OTC cold medicines to your child: ...

On cold spots in tumor subvolumes

International Nuclear Information System (INIS)

Tome, Wolfgang A.; Fowler, Jack F.

2002-01-01

Losses in tumor control are estimated for cold spots of various 'sizes' and degrees of 'cold dose'. This question is important in the context of intensity modulated radiotherapy where differential dose-volume histograms (DVHs) for targets that abut a critical structure often exhibit a cold dose tail. This can be detrimental to tumor control probability (TCP) for fractions of cold volumes even as small as 1%, if the cold dose is lower than the prescribed dose by substantially more than 10%. The Niemierko-Goitein linear-quadratic algorithm with γ 50 slope 1-3 was used to study the effect of cold spots of various degrees (dose deficit below the prescription dose) and size (fractional volume of the cold dose). A two-bin model DVH has been constructed in which the cold dose bin is allowed to vary from a dose deficit of 1%-50% below prescription dose and to have volumes varying from 1% to 90%. In order to study and quantify the effect of a small volume of cold dose on TCP and effective uniform dose (EUD), a four-bin DVH model has been constructed in which the lowest dose bin, which has a fractional volume of 1%, is allowed to vary from 10% to 45% dose deficit below prescription dose. The highest dose bin represents a simultaneous boost. For fixed size of the cold spot the calculated values of TCP decreased rapidly with increasing degrees of cold dose for any size of the cold spot, even as small as 1% fractional volume. For the four-subvolume model, in which the highest dose bin has a fractional volume of 80% and is set at a boost dose of 10% above prescription dose, it is found that the loss in TCP and EUD is moderate as long as the cold 1% subvolume has a deficit less than approximately 20%. However, as the dose deficit in the 1% subvolume bin increases further it drives TCP and EUD rapidly down and can lead to a serious loss in TCP and EUD. Since a dose deficit to a 1% volume of the target that is larger than 20% of the prescription dose may lead to serious loss of

A transcription factor for cold sensation!

Directory of Open Access Journals (Sweden)

Milbrandt Jeffrey

2005-03-01

Full Text Available Abstract The ability to feel hot and cold is critical for animals and human beings to survive in the natural environment. Unlike other sensations, the physiology of cold sensation is mostly unknown. In the present study, we use genetically modified mice that do not express nerve growth factor-inducible B (NGFIB to investigate the possible role of NGFIB in cold sensation. We found that genetic deletion of NGFIB selectively affected behavioral responses to cold stimuli while behavioral responses to noxious heat or mechanical stimuli were normal. Furthermore, behavioral responses remained reduced or blocked in NGFIB knockout mice even after repetitive application of cold stimuli. Our results provide strong evidence that the first transcription factor NGFIB determines the ability of animals to respond to cold stimulation.

De Novo Transcriptome Sequencing in Passiflora edulis Sims to Identify Genes and Signaling Pathways Involved in Cold Tolerance

Directory of Open Access Journals (Sweden)

Sian Liu

2017-11-01

Full Text Available The passion fruit (Passiflora edulis Sims, also known as the purple granadilla, is widely cultivated as the new darling of the fruit market throughout southern China. This exotic and perennial climber is adapted to warm and humid climates, and thus is generally intolerant of cold. There is limited information about gene regulation and signaling pathways related to the cold stress response in this species. In this study, two transcriptome libraries (KEDU_AP vs. GX_AP were constructed from the aerial parts of cold-tolerant and cold-susceptible varieties of P. edulis, respectively. Overall, 126,284,018 clean reads were obtained, and 86,880 unigenes with a mean size of 1449 bp were assembled. Of these, there were 64,067 (73.74% unigenes with significant similarity to publicly available plant protein sequences. Expression profiles were generated, and 3045 genes were found to be significantly differentially expressed between the KEDU_AP and GX_AP libraries, including 1075 (35.3% up-regulated and 1970 (64.7% down-regulated. These included 36 genes in enriched pathways of plant hormone signal transduction, and 56 genes encoding putative transcription factors. Six genes involved in the ICE1–CBF–COR pathway were induced in the cold-tolerant variety, and their expression levels were further verified using quantitative real-time PCR. This report is the first to identify genes and signaling pathways involved in cold tolerance using high-throughput transcriptome sequencing in P. edulis. These findings may provide useful insights into the molecular mechanisms regulating cold tolerance and genetic breeding in Passiflora spp.

Herbivore grazing—or trampling? Trampling effects by a large ungulate in cold high- latitude ecosystems

OpenAIRE

Heggenes, Jan; Odland, Arvid; Chevalier, Tomas; Ahlberg, Jörgen; Berg, Amanda; Larsson, Håkan; Bjerketvedt, Dag Kjartan

2017-01-01

Mammalian herbivores have important top-down effects on ecological processes and landscapes by generating vegetation changes through grazing and trampling. For free-ranging herbivores on large landscapes, trampling is an important ecological factor. However, whereas grazing is widely studied, low-intensity trampling is rarely studied and quantified. The cold-adapted northern tundra reindeer (Rangifer tarandus) is a wide-ranging keystone herbivore in large open alpine and Arctic ecosystems. Re...

Herbivore grazing?or trampling? Trampling effects by a large ungulate in cold high?latitude ecosystems

OpenAIRE

Heggenes, Jan; Odland, Arvid; Chevalier, Tomas; Ahlberg, J?rgen; Berg, Amanda; Larsson, H?kan; Bjerketvedt, Dag K.

2017-01-01

Mammalian herbivores have important top-down effects on ecological processes and landscapes by generating vegetation changes through grazing and trampling. For free-ranging herbivores on large landscapes, trampling is an important ecological factor. However, whereas grazing is widely studied, low-intensity trampling is rarely studied and quantified. The cold-adapted northern tundra reindeer (Rangifer tarandus) is a wide-ranging keystone herbivore in large open alpine and Arctic ecosystems. Re...

Long-distance dispersal or postglacial contraction? Insights into disjunction between Himalaya-Hengduan Mountains and Taiwan in a cold-adapted herbaceous genus, Triplostegia.

Science.gov (United States)

Niu, Yan-Ting; Ye, Jian-Fei; Zhang, Jin-Long; Wan, Ji-Zhong; Yang, Tuo; Wei, Xiao-Xin; Lu, Li-Min; Li, Jian-Hua; Chen, Zhi-Duan

2018-01-01

Current disjunct patterns can result from long-distance dispersal or postglacial contraction. We herein investigate the evolutionary history of Triplostegia to elucidate the disjunction between the Himalaya-Hengduan Mountain region (HHM) and Taiwan (TW). Genetic structure of Triplostegia was investigated for 48 populations using sequences from five chloroplast loci and the ribosomal nuclear internal transcribed spacer. Divergence time estimation, ancestral area reconstruction, and species distribution modeling (SDM) were employed to examine the biogeographic history of Triplostegia . Substantial genetic differentiation among populations from southwestern China (SW), Central China (CC), and TW was detected. Triplostegia was inferred to have originated in SW, and diversification began during the late Miocene; CC was colonized in the mid-Pliocene, and TW was finally colonized in the early Pleistocene. SDM suggested an expansion of climatically suitable areas during the Last Glacial Maximum and range contraction during the Last interglacial in Triplostegia . Disjunction between HHM and TW in Triplostegia is most likely the consequence of topographic isolation and postglacial contraction. The potential climatic suitability areas for Triplostegia by 2070s (2061-2080) are predicted to slightly shrink and move northward. With continued global warming and human-induced deforestation, extinction risk may increase for the cold-adapted species, and appropriate strategies should be employed for ecosystem conservation.

RNA-Seq-based analysis of the physiologic cold shock-induced changes in Moraxella catarrhalis gene expression.

Directory of Open Access Journals (Sweden)

Violeta Spaniol

Full Text Available BACKGROUND: Moraxella catarrhalis, a major nasopharyngeal pathogen of the human respiratory tract, is exposed to rapid downshifts of environmental temperature when humans breathe cold air. The prevalence of pharyngeal colonization and respiratory tract infections caused by M. catarrhalis is greatest in winter. We investigated how M. catarrhalis uses the physiologic exposure to cold air to regulate pivotal survival systems that may contribute to M. catarrhalis virulence. RESULTS: In this study we used the RNA-seq techniques to quantitatively catalogue the transcriptome of M. catarrhalis exposed to a 26 °C cold shock or to continuous growth at 37 °C. Validation of RNA-seq data using quantitative RT-PCR analysis demonstrated the RNA-seq results to be highly reliable. We observed that a 26 °C cold shock induces the expression of genes that in other bacteria have been related to virulence a strong induction was observed for genes involved in high affinity phosphate transport and iron acquisition, indicating that M. catarrhalis makes a better use of both phosphate and iron resources after exposure to cold shock. We detected the induction of genes involved in nitrogen metabolism, as well as several outer membrane proteins, including ompA, m35-like porin and multidrug efflux pump (acrAB indicating that M. catarrhalis remodels its membrane components in response to downshift of temperature. Furthermore, we demonstrate that a 26 °C cold shock enhances the induction of genes encoding the type IV pili that are essential for natural transformation, and increases the genetic competence of M. catarrhalis, which may facilitate the rapid spread and acquisition of novel virulence-associated genes. CONCLUSION: Cold shock at a physiologically relevant temperature of 26 °C induces in M. catarrhalis a complex of adaptive mechanisms that could convey novel pathogenic functions and may contribute to enhanced colonization and virulence.

Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

Science.gov (United States)

Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

2009-03-01

Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

Cold-induced vasoconstriction at forearm and hand skin sites: the effect of age

OpenAIRE

Kingma, B.R.M.; Frijns, A.J.H.; Saris, W.H.M.; Steenhoven, van, A.A.; Marken Lichtenbelt, van, W.D.

2010-01-01

During mild cold exposure, elderly are at risk of hypothermia. In humans, glabrous skin at the hands is well adapted as a heat exchanger. Evidence exists that elderly show equal vasoconstriction due to local cooling at the ventral forearm, yet no age effects on vasoconstriction at hand skin have been studied. Here, we tested the hypotheses that at hand sites (a) elderly show equal vasoconstriction due to local cooling and (b) elderly show reduced response to noradrenergic stimuli. Skin perfus...

Cold hardiness increases with age in juvenile Rhododendron populations

Directory of Open Access Journals (Sweden)

Rajeev eArora

2014-10-01

Full Text Available Winter survival in woody plants is controlled by environmental and genetic factors that affect the plant's ability to cold acclimate. Because woody perennials are long-lived and often have a prolonged juvenile (pre-flowering phase, it is conceivable that both chronological and physiological age factors influence adaptive traits such as stress tolerance. This study investigated annual cold hardiness (CH changes in several hybrid Rhododendron populations based on Tmax, an estimate of the maximum rate of freezing injury (ion leakage in cold-acclimated leaves from juvenile progeny. Data from F2 and backcross populations derived from R. catawbiense and R. fortunei parents indicated significant annual increases in Tmax ranging from 3.7 to to 6.4 C as the seedlings aged from 3 to 5 years old. A similar yearly increase (6.7° C was observed in comparisons of 1- and 2-year-old F1 progenies from a R. catawbiense x R. dichroanthum cross. In contrast, CH of the mature parent plants (> 10 years old did not change significantly over the same evaluation period. In leaf samples from a natural population of R. maximum, CH evaluations over two years resulted in an average Tmax value for juvenile 2- to 3- year- old plants that was 9.2 C lower than the average for mature (~30 years old plants. . A reduction in CH was also observed in three hybrid rhododendron cultivars clonally propagated by rooted cuttings (ramets - Tmax of 4-year-old ramets was significantly lower than the Tmax estimates for the 30- to 40-year-old source plants (ortets. In both the wild R. maximum population and the hybrid cultivar group, higher accumulation of a cold-acclimation responsive 25kDa leaf dehydrin was associated with older plants and higher CH. The feasibility of identifying hardy phenotypes at juvenile period and research implications of age-dependent changes in CH are discussed.

Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

Science.gov (United States)

Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

2016-01-01

The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

Liquid metal cold trap

International Nuclear Information System (INIS)

Hundal, R.

1976-01-01

A cold trap assembly for removing impurities from a liquid metal is described. A hole between the incoming impure liquid metal and purified outgoing liquid metal acts as a continuous bleed means and thus prevents the accumulation of cover gases within the cold trap assembly

Cold-formed steel design

CERN Document Server

Yu, Wei-Wen

2010-01-01

The definitive text in the field, thoroughly updated and expanded Hailed by professionals around the world as the definitive text on the subject, Cold-Formed Steel Design is an indispensable resource for all who design for and work with cold-formed steel. No other book provides such exhaustive coverage of both the theory and practice of cold-formed steel construction. Updated and expanded to reflect all the important developments that have occurred in the field over the past decade, this Fourth Edition of the classic text provides you with more of the detailed, up-to-the-minute techni

Workshop on cold-blanket research

International Nuclear Information System (INIS)

1977-05-01

The objective of the workshop was to identify and discuss cold-plasma blanket systems. In order to minimize the bombardment of the walls by hot neutrals the plasma should be impermeable. This requires a density edge-thickness product of nΔ > 10 15 cm -2 . An impermeable cold plasma-gas blanket surrounding a hot plasma core reduces the plasma wall/limiter interaction. Accumulation of impurities in this blanket can be expected. Fuelling from a blanket may be possible as shown by experimental results, though not fully explained by classical transport of neutrals. Refuelling of a reacting plasma had to be ensured by inward diffusion. Experimental studies of a cold impermeable plasma have been done on the tokamak-like Ringboog device. Simulation calculations for the next generation of large tokamaks using a particular transport model, indicate that the plasma edge profile can be controlled to reduce the production of sputtered impurities to an acceptable level. Impurity control requires a small fraction of the radial space to accomodate the cold-plasma layer. The problem of exhaust is, however, more complicated. If the cold-blanket scheme works as predicted in the model calculations, then α-particles generated by fusion will be transported to the cold outside layer. The Communities' experimental programme of research has been discussed in terms of the tokamaks which are available and planned. Two options present themselves for the continuation of cold-blanket research

Catching a Cold When It's Warm

Science.gov (United States)

... Print this issue Catching a Cold When It’s Warm What’s the Deal with Summertime Sniffles? En español ... more unfair than catching a cold when it’s warm? How can cold symptoms arise when it’s not ...

Large reptiles and cold temperatures: Do extreme cold spells set distributional limits for tropical reptiles in Florida?

Science.gov (United States)

Mazzotti, Frank J.; Cherkiss, Michael S.; Parry, Mark; Beauchamp, Jeff; Rochford, Mike; Smith, Brian J.; Hart, Kristen M.; Brandt, Laura A.

2016-01-01

Distributional limits of many tropical species in Florida are ultimately determined by tolerance to low temperature. An unprecedented cold spell during 2–11 January 2010, in South Florida provided an opportunity to compare the responses of tropical American crocodiles with warm-temperate American alligators and to compare the responses of nonnative Burmese pythons with native warm-temperate snakes exposed to prolonged cold temperatures. After the January 2010 cold spell, a record number of American crocodiles (n = 151) and Burmese pythons (n = 36) were found dead. In contrast, no American alligators and no native snakes were found dead. American alligators and American crocodiles behaved differently during the cold spell. American alligators stopped basking and retreated to warmer water. American crocodiles apparently continued to bask during extreme cold temperatures resulting in lethal body temperatures. The mortality of Burmese pythons compared to the absence of mortality for native snakes suggests that the current population of Burmese pythons in the Everglades is less tolerant of cold temperatures than native snakes. Burmese pythons introduced from other parts of their native range may be more tolerant of cold temperatures. We documented the direct effects of cold temperatures on crocodiles and pythons; however, evidence of long-term effects of cold temperature on their populations within their established ranges remains lacking. Mortality of crocodiles and pythons outside of their current established range may be more important in setting distributional limits.

Tip model of cold fission

International Nuclear Information System (INIS)

Goennenwein, F.; Boersig, B.

1991-01-01

Cold fission is defined to be the limiting case of nuclear fission where virtually all of the available energy is converted into the total kinetic energy of the fragments. The fragments have, therefore, to be born in or at least close to their respective ground states. Starting from the viewpoint that cold fission corresponds to most compact scission configurations, energy constraints have been exploited to calculate minimum tip distances between the two nascent fragments in binary fission. Crucial input parameters to this tip model of cold fission are the ground-state deformations of fragment nuclei. It is shown that the minimum tip distances being compatible with energy conservation vary strongly with both the mass and charge fragmentation of the fission prone nucleus. The tip distances refer to nuclei with equivalent sharp surfaces. In keeping with the size of the surface width of leptodermous nuclei, only configurations where the tip distances are smaller than a few fm may be considered as valid scission configurations. From a comparison with experimental data on cold fission this critical tip distance appears to be 3.0 fm for the model parameters chosen. Whenever the model calculation yields tip distances being smaller than the critical value, a necessary condition for attaining cold fission is considered to be fulfilled. It is shown that this criterion allows to understand in fair agreement with experiment which mass fragmentations are susceptible to lead to cold fission and which fragment-charge divisions are the most favored in each isobaric mass chain. Being based merely on energy arguments, the model cannot aim at predicting fragment yields in cold fission. However, the tip model proposed appears well suited to delineate the phase space where cold fission phenomena may come into sight. (orig.)

Cold moderators for pulsed neutron sources

International Nuclear Information System (INIS)

Carpenter, J.M.

1990-01-01

This paper reviews cold moderators in pulsed neutron sources and provides details of the performance of different cold moderator materials and configurations. Analytical forms are presented which describe wavelength spectra and emission time distributions. Several types of cooling arrangements used in pulsed source moderators are described. Choices of materials are surveyed. The author examines some of the radiation damage effects in cold moderators, including the phenomenon of ''burping'' in irradiated cold solid methane. 9 refs., 15 figs., 4 tabs

A transcription factor for cold sensation!

OpenAIRE

Kim, Susan J; Qu, Zhican; Milbrandt, Jeffrey; Zhuo, Min

2005-01-01

Abstract The ability to feel hot and cold is critical for animals and human beings to survive in the natural environment. Unlike other sensations, the physiology of cold sensation is mostly unknown. In the present study, we use genetically modified mice that do not express nerve growth factor-inducible B (NGFIB) to investigate the possible role of NGFIB in cold sensation. We found that genetic deletion of NGFIB selectively affected behavioral responses to cold stimuli while behavioral respons...

Quantitative Proteomic Analysis Reveals that Antioxidation Mechanisms Contribute to Cold Tolerance in Plantain (Musa paradisiaca L.; ABB Group) Seedlings*

Science.gov (United States)

Yang, Qiao-Song; Wu, Jun-Hua; Li, Chun-Yu; Wei, Yue-Rong; Sheng, Ou; Hu, Chun-Hua; Kuang, Rui-Bin; Huang, Yong-Hong; Peng, Xin-Xiang; McCardle, James A.; Chen, Wei; Yang, Yong; Rose, Jocelyn K. C.; Zhang, Sheng; Yi, Gan-Jun

2012-01-01

Banana and its close relative, plantain are globally important crops and there is considerable interest in optimizing their cultivation. Plantain has superior cold tolerance compared with banana and a thorough understanding of the molecular mechanisms and responses of plantain to cold stress has great potential value for developing cold tolerant banana cultivars. In this study, we used iTRAQ-based comparative proteomic analysis to investigate the temporal responses of plantain to cold stress. Plantain seedlings were exposed for 0, 6, and 24 h of cold stress at 8 °C and subsequently allowed to recover for 24 h at 28 °C. A total of 3477 plantain proteins were identified, of which 809 showed differential expression from the three treatments. The majority of differentially expressed proteins were predicted to be involved in oxidation-reduction, including oxylipin biosynthesis, whereas others were associated with photosynthesis, photorespiration, and several primary metabolic processes, such as carbohydrate metabolic process and fatty acid beta-oxidation. Western blot analysis and enzyme activity assays were performed on seven differentially expressed, cold-response candidate plantain proteins to validate the proteomics data. Similar analyses of the seven candidate proteins were performed in cold-sensitive banana to examine possible functional conservation, and to compare the results to equivalent responses between the two species. Consistent results were achieved by Western blot and enzyme activity assays, demonstrating that the quantitative proteomics data collected in this study are reliable. Our results suggest that an increase of antioxidant capacity through adapted ROS scavenging capability, reduced production of ROS, and decreased lipid peroxidation contribute to molecular mechanisms for the increased cold tolerance in plantain. To the best of our knowledge, this is the first report of a global investigation on molecular responses of plantain to cold stress by

Quantitative proteomic analysis reveals that antioxidation mechanisms contribute to cold tolerance in plantain (Musa paradisiaca L.; ABB Group) seedlings.

Science.gov (United States)

Yang, Qiao-Song; Wu, Jun-Hua; Li, Chun-Yu; Wei, Yue-Rong; Sheng, Ou; Hu, Chun-Hua; Kuang, Rui-Bin; Huang, Yong-Hong; Peng, Xin-Xiang; McCardle, James A; Chen, Wei; Yang, Yong; Rose, Jocelyn K C; Zhang, Sheng; Yi, Gan-Jun

2012-12-01

Banana and its close relative, plantain are globally important crops and there is considerable interest in optimizing their cultivation. Plantain has superior cold tolerance compared with banana and a thorough understanding of the molecular mechanisms and responses of plantain to cold stress has great potential value for developing cold tolerant banana cultivars. In this study, we used iTRAQ-based comparative proteomic analysis to investigate the temporal responses of plantain to cold stress. Plantain seedlings were exposed for 0, 6, and 24 h of cold stress at 8 °C and subsequently allowed to recover for 24 h at 28 °C. A total of 3477 plantain proteins were identified, of which 809 showed differential expression from the three treatments. The majority of differentially expressed proteins were predicted to be involved in oxidation-reduction, including oxylipin biosynthesis, whereas others were associated with photosynthesis, photorespiration, and several primary metabolic processes, such as carbohydrate metabolic process and fatty acid beta-oxidation. Western blot analysis and enzyme activity assays were performed on seven differentially expressed, cold-response candidate plantain proteins to validate the proteomics data. Similar analyses of the seven candidate proteins were performed in cold-sensitive banana to examine possible functional conservation, and to compare the results to equivalent responses between the two species. Consistent results were achieved by Western blot and enzyme activity assays, demonstrating that the quantitative proteomics data collected in this study are reliable. Our results suggest that an increase of antioxidant capacity through adapted ROS scavenging capability, reduced production of ROS, and decreased lipid peroxidation contribute to molecular mechanisms for the increased cold tolerance in plantain. To the best of our knowledge, this is the first report of a global investigation on molecular responses of plantain to cold stress by

International workshop on cold neutron sources

Energy Technology Data Exchange (ETDEWEB)

Russell, G.J.; West, C.D. (comps.) (Los Alamos National Lab., NM (United States))

1991-08-01

The first meeting devoted to cold neutron sources was held at the Los Alamos National Laboratory on March 5--8, 1990. Cosponsored by Los Alamos and Oak Ridge National Laboratories, the meeting was organized as an International Workshop on Cold Neutron Sources and brought together experts in the field of cold-neutron-source design for reactors and spallation sources. Eighty-four people from seven countries attended. Because the meeting was the first of its kind in over forty years, much time was spent acquainting participants with past and planned activities at reactor and spallation facilities worldwide. As a result, the meeting had more of a conference flavor than one of a workshop. The general topics covered at the workshop included: Criteria for cold source design; neutronic predictions and performance; energy deposition and removal; engineering design, fabrication, and operation; material properties; radiation damage; instrumentation; safety; existing cold sources; and future cold sources.

International workshop on cold neutron sources

International Nuclear Information System (INIS)

Russell, G.J.; West, C.D.

1991-08-01

The first meeting devoted to cold neutron sources was held at the Los Alamos National Laboratory on March 5--8, 1990. Cosponsored by Los Alamos and Oak Ridge National Laboratories, the meeting was organized as an International Workshop on Cold Neutron Sources and brought together experts in the field of cold-neutron-source design for reactors and spallation sources. Eighty-four people from seven countries attended. Because the meeting was the first of its kind in over forty years, much time was spent acquainting participants with past and planned activities at reactor and spallation facilities worldwide. As a result, the meeting had more of a conference flavor than one of a workshop. The general topics covered at the workshop included: Criteria for cold source design; neutronic predictions and performance; energy deposition and removal; engineering design, fabrication, and operation; material properties; radiation damage; instrumentation; safety; existing cold sources; and future cold sources

Cold trap disposed within a tank

International Nuclear Information System (INIS)

Kanbe, Mitsuru.

1983-01-01

Purpose: To improve the reliability and the durability of cold traps by simplifying the structure and recycling liquid metals without using electromagnetic pumps. Constitution: The reactor container is partitioned by an intermediate container enhousing primary recycling pumps and cold traps. The inlet and the exit for the liquid metal of each cold trap are opened to the outside and the inside of the intermediate container respectively. In such a structure, the pressure difference between the inside and the outside of the intermediate container is exerted on the cold traps due to the exhaust pressure of the recycling pumps in which the liquid metal flowing into the cold traps is purified through filters, cooled and then discharged from the exit to the cold plenum. In this way, liquid metal can be recycled without using an electromagnetic pump whose reliability has not yet been established. (Kamimura, M.)

Gene-expression analysis of cold-stress response in the sexually transmitted protist Trichomonas vaginalis.

Science.gov (United States)

Fang, Yi-Kai; Huang, Kuo-Yang; Huang, Po-Jung; Lin, Rose; Chao, Mei; Tang, Petrus

2015-12-01

Trichomonas vaginalis is the etiologic agent of trichomoniasis, the most common nonviral sexually transmitted disease in the world. This infection affects millions of individuals worldwide annually. Although direct sexual contact is the most common mode of transmission, increasing evidence indicates that T. vaginalis can survive in the external environment and can be transmitted by contaminated utensils. We found that the growth of T. vaginalis under cold conditions is greatly inhibited, but recovers after placing these stressed cells at the normal cultivation temperature of 37 °C. However, the mechanisms by which T. vaginalis regulates this adaptive process are unclear. An expressed sequence tag (EST) database generated from a complementary DNA library of T. vaginalis messenger RNAs expressed under cold-culture conditions (4 °C, TvC) was compared with a previously published normal-cultured EST library (37 °C, TvE) to assess the cold-stress responses of T. vaginalis. A total of 9780 clones were sequenced from the TvC library and were mapped to 2934 genes in the T. vaginalis genome. A total of 1254 genes were expressed in both the TvE and TvC libraries, and 1680 genes were only found in the TvC library. A functional analysis showed that cold temperature has effects on many cellular mechanisms, including increased H2O2 tolerance, activation of the ubiquitin-proteasome system, induction of iron-sulfur cluster assembly, and reduced energy metabolism and enzyme expression. The current study is the first large-scale transcriptomic analysis in cold-stressed T. vaginalis and the results enhance our understanding of this important protist. Copyright © 2014. Published by Elsevier B.V.

Cold War Paradigms and the Post-Cold War High School History Curriculum.

Science.gov (United States)

McAninch, Stuart A.

1995-01-01

Discusses how Cold War ideological models provide a way to examine the U.S. role in world affairs. Discusses and compares on the writings of Paul Gagnon and Noam Chomsky on this topic. Concludes that students should stand outside both models to develop a meaningful perspective on the U.S. role during the Cold War. (CFR)

Dence Cold Matter

Directory of Open Access Journals (Sweden)

Stavinskiy Alexey

2014-04-01

Full Text Available Possible way to create dense cold baryonic matter in the laboratory is discussed. The density of this matter is comparable or even larger than the density of neutron star core. The properties of this matter can be controlled by trigger conditions. Experimental program for the study of properties of dense cold matter for light and heavy ion collisions at initial energy range √sNN~2-3GeV is proposed..

Thyroid Allostasis–Adaptive Responses of Thyrotropic Feedback Control to Conditions of Strain, Stress, and Developmental Programming

OpenAIRE

Apostolos Chatzitomaris; Rudolf Hoermann; John E. Midgley; Steffen Hering; Aline Urban; Barbara Dietrich; Assjana Abood; Harald H. Klein; Harald H. Klein; Johannes W. Dietrich; Johannes W. Dietrich

2017-01-01

The hypothalamus–pituitary–thyroid feedback control is a dynamic, adaptive system. In situations of illness and deprivation of energy representing type 1 allostasis, the stress response operates to alter both its set point and peripheral transfer parameters. In contrast, type 2 allostatic load, typically effective in psychosocial stress, pregnancy, metabolic syndrome, and adaptation to cold, produces a nearly opposite phenotype of predictive plasticity. The non-thyroidal illness syndrome (NTI...

Gymnodinium corollarium sp. nov. (Dinophyceae) - a new cold-water dinoflagellate responsible for cyst sedimentation events in the Baltic Sea

DEFF Research Database (Denmark)

Sundström, Annica; Kremp, Anke; Daugbjerg, Niels

2009-01-01

revealed a preference of G. corollarium for low salinities and temperatures, confirming it to be a cold-water species well adapted to the brackish water conditions in the Baltic Sea. At nitrogen-deplete conditions, G. corollarium cultures produced small, slightly oval cysts resembling a previously...

Cold-Adapted Influenza and Recombinant Adenovirus Vaccines Induce Cross-Protective Immunity against pH1N1 Challenge in Mice

Science.gov (United States)

Soboleski, Mark R.; Gabbard, Jon D.; Price, Graeme E.; Misplon, Julia A.; Lo, Chia-Yun; Perez, Daniel R.; Ye, Jianqiang; Tompkins, S. Mark; Epstein, Suzanne L.

2011-01-01

Background The rapid spread of the 2009 H1N1 pandemic influenza virus (pH1N1) highlighted problems associated with relying on strain-matched vaccines. A lengthy process of strain identification, manufacture, and testing is required for current strain-matched vaccines and delays vaccine availability. Vaccines inducing immunity to conserved viral proteins could be manufactured and tested in advance and provide cross-protection against novel influenza viruses until strain-matched vaccines became available. Here we test two prototype vaccines for cross-protection against the recent pandemic virus. Methodology/Principal Findings BALB/c and C57BL/6 mice were intranasally immunized with a single dose of cold-adapted (ca) influenza viruses from 1977 or recombinant adenoviruses (rAd) expressing 1934 nucleoprotein (NP) and consensus matrix 2 (M2) (NP+M2-rAd). Antibodies against the M2 ectodomain (M2e) were seen in NP+M2-rAd immunized BALB/c but not C57BL/6 mice, and cross-reacted with pH1N1 M2e. The ca-immunized mice did not develop antibodies against M2e. Despite sequence differences between vaccine and challenge virus NP and M2e epitopes, extensive cross-reactivity of lung T cells with pH1N1 peptides was detected following immunization. Both ca and NP+M2-rAd immunization protected BALB/c and C57BL/6 mice against challenge with a mouse-adapted pH1N1 virus. Conclusion/Significance Cross-protective vaccines such as NP+M2-rAd and ca virus are effective against pH1N1 challenge within 3 weeks of immunization. Protection was not dependent on recognition of the highly variable external viral proteins and could be achieved with a single vaccine dose. The rAd vaccine was superior to the ca vaccine by certain measures, justifying continued investigation of this experimental vaccine even though ca vaccine is already available. This study highlights the potential for cross-protective vaccines as a public health option early in an influenza pandemic. PMID:21789196

Body temperature and cold sensation during and following exercise under temperate room conditions in cold-sensitive young trained females.

Science.gov (United States)

Fujii, Naoto; Aoki-Murakami, Erii; Tsuji, Bun; Kenny, Glen P; Nagashima, Kei; Kondo, Narihiko; Nishiyasu, Takeshi

2017-11-01

We evaluated cold sensation at rest and in response to exercise-induced changes in core and skin temperatures in cold-sensitive exercise trained females. Fifty-eight trained young females were screened by a questionnaire, selecting cold-sensitive (Cold-sensitive, n  = 7) and non-cold-sensitive (Control, n  = 7) individuals. Participants rested in a room at 29.5°C for ~100 min after which ambient temperature was reduced to 23.5°C where they remained resting for 60 min. Participants then performed 30-min of moderate intensity cycling (50% peak oxygen uptake) followed by a 60-min recovery. Core and mean skin temperatures and cold sensation over the whole-body and extremities (fingers and toes) were assessed throughout. Resting core temperature was lower in the Cold-sensitive relative to Control group (36.4 ± 0.3 vs. 36.7 ± 0.2°C). Core temperature increased to similar levels at end-exercise (~37.2°C) and gradually returned to near preexercise rest levels at the end of recovery (>36.6°C). Whole-body cold sensation was greater in the Cold-sensitive relative to Control group during resting at a room temperature of 23.5°C only without a difference in mean skin temperature between groups. In contrast, cold sensation of the extremities was greater in the Cold-sensitive group prior to, during and following exercise albeit this was not paralleled by differences in mean extremity skin temperature. We show that young trained females who are sensitive to cold exhibit augmented whole-body cold sensation during rest under temperate ambient conditions. However, this response is diminished during and following exercise. In contrast, cold sensation of extremities is augmented during resting that persists during and following exercise. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

Testing times: A nuclear weapons laboratory at the end of the Cold War

International Nuclear Information System (INIS)

Gusterson, H.

1992-01-01

This dissertation focuses on the role of discursive and other practices in the construction of two alternative regimes of truth in regard to nuclear weapons, and in the cultural production of persons at the Livermore Laboratory and in the local anti-nuclear movement. In the 1980s the scientists' regime of truth was challenged by a heterogeneous anti-nuclear movement recruited largely from the humanistic middle class - a class fragment profoundly hostile to the policies of the Reagan Administration. The movement attacked the Laboratory in a number of ways, ranging from local ballot initiatives and lobbying in Washington to civil disobedience at the Laboratory. By the end of the 1980s this movement, in combination with Gorbachev's reforms in the Soviet Union and a decade of internal scandals at the Laboratory, left the Laboratory weakened - though Laboratory scientists and managers are currently working to adapt the system of ideas and practices evolved during the Cold War to legitimate continued weapons work in a post-Cold War environment

Evidence for adaptive evolution of low-temperature stress response genes in a Pooideae grass ancestor

DEFF Research Database (Denmark)

Vigeland, Magnus D; Spannagl, Manuel; Asp, Torben

2013-01-01

Adaptation to temperate environments is common in the grass subfamily Pooideae, suggesting an ancestral origin of cold climate adaptation. Here, we investigated substitution rates of genes involved in low-temperature-induced (LTI) stress responses to test the hypothesis that adaptive molecular...... evolution of LTI pathway genes was important for Pooideae evolution. Substitution rates and signatures of positive selection were analyzed using 4330 gene trees including three warm climate-adapted species (maize (Zea mays), sorghum (Sorghum bicolor), and rice (Oryza sativa)) and five temperate Pooideae...... species (Brachypodium distachyon, wheat (Triticum aestivum), barley (Hordeum vulgare), Lolium perenne and Festuca pratensis). Nonsynonymous substitution rate differences between Pooideae and warm habitat-adapted species were elevated in LTI trees compared with all trees. Furthermore, signatures...

Imaging with cold neutrons

International Nuclear Information System (INIS)

Lehmann, E.H.; Kaestner, A.; Josic, L.; Hartmann, S.; Mannes, D.

2011-01-01

Neutrons for imaging purposes are provided mainly from thermal beam lines at suitable facilities around the world. The access to cold neutrons is presently limited to very few places only. However, many challenging options for imaging with cold neutrons have been found out, given by the interaction behavior of the observed materials with neutrons in the cold energy range (3-10 A). For absorbing materials, the interaction probability increases proportionally with the wavelength with the consequence of more contrast but less transmission with cold neutrons. Many materials are predominantly scattering neutrons, in particular most of crystalline structural materials. In these cases, cold neutrons play an important role by covering the energy range of the most important Bragg edges given by the lattice planes of the crystallites. This particular behavior can be used for at least two important aspects-choosing the right energy of the initial beam enables to have a material more or less transparent, and a direct macroscopic visualization of the crystalline structure and its change in a manufacturing process. Since 2006, PSI operates its second beam line for neutron imaging, where cold neutrons are provided from a liquid deuterium cold source (operated at 25 K). It has been designed to cover the most current aspects in neutron imaging research with the help of high flexibility. This has been done with changeable inlet apertures, a turbine based velocity selector, two beam positions and variable detector systems, satisfying the demands of the individual investigation. The most important detection system was found to be a micro-tomography system that enables studies in the presently best spatial resolution. In this case, the high contrast from the sample interaction process and the high detection probability for the cold neutrons combines in an ideal combination for the best possible performance. Recently, it was found out that the energy selective studies might become a

Military cold injury during the war in the Falkland Islands 1982: an evaluation of possible risk factors.

Science.gov (United States)

Craig, R P

2007-01-01

Throughout the history of war, there have been many instances when the cold has ravaged armies more effectively than their enemies. Delineated risk factors are restricted to negro origins, previous cold injury, moderate but not heavy smoking and the possession of blood group O. No attention has been directed to the possibility that abnormal blood constituents could feasibly predispose to the development of local cold injury. This study considers this possibility and investigates the potential contribution of certain components of the circulating blood which might do so. Three groups of soldiers from two of the battalions who served during the war in the Falklands Islands in 1982 were investigated. The risk factors which were sought included the presence or absence of asymptomatic cryoglobulinaemia, abnormal total protein, albumin, individual gamma globulin or complement C3 or C4 levels, plasma hyperviscosity or evidence of chronic alcoholism manifesting as high haemoglobin, PCV, RBC, MCV or gamma glutamyl transpeptidase (GGT). No cases of cryoglobulinaemia were isolated and there was no haematological evidence to suggest that any of those men who had developed cold injury, one year before this study was performed, had abnormal circulating proteins, plasma hyperviscosity or indicators of alcohol abuse. Individual blood groups were not incriminated as a predisposing factor although the small numbers of negroes in this series fared badly. Although this investigation has excluded a range of potential risk factors which could contribute to the development of cold injury, the problem persists. Two areas of further study are needed: the first involves research into the production of better protective clothing in the form of effective cold weather boots and gloves and the second requires the delineation of those dietary and ethnic factors which allow certain communities to adapt successfully to the cold. A review of the literature in this latter area is presented.

Cold-water acclimation does not modify whole-body fluid regulation during subsequent cold-water immersion.

Science.gov (United States)

Stocks, J M; Patterson, M J; Hyde, D E; Jenkins, A B; Mittleman, K D; Taylor, N A S

2004-06-01

We investigated the impact of cold-water acclimation on whole-body fluid regulation using tracer-dilution methods to differentiate between the intracellular and extracellular fluid compartments. Seven euhydrated males [age 24.7 (8.7) years, mass 74.4 (6.4) kg, height 176.8 (7.8) cm, sum of eight skinfolds 107.4 (20.4) mm; mean (SD)] participated in a 14-day cold-water acclimation protocol, with 60-min resting cold-water stress tests [CWST; 18.1 (0.1) degrees C] on days 1, 8 and 15, and 90-min resting cold-water immersions [18.4 (0.4) degrees C] on intervening days. Subjects were immersed to the 4th intercostal space. Intracellular and extracellular fluid compartments, and plasma protein, electrolyte and hormone concentrations were investigated. During the first CWST, the intracellular fluid (5.5%) and plasma volumes were reduced (6.1%), while the interstitial fluid volume was simultaneously expanded (5.4%). This pattern was replicated on days 8 and 15, but did not differ significantly among test days. Acclimation did not produce significant changes in the pre-immersion distribution of total body water, or changes in plasma osmolality, total protein, electrolyte, atrial natriuretic peptide or aldosterone concentrations. Furthermore, a 14-day cold-water acclimation regimen did not elicit significant changes in body-fluid distribution, urine production, or the concentrations of plasma protein, electrolytes or the fluid-regulatory hormones. While acclimation trends were not evident, we have confirmed that fluid from extravascular cells is displaced into the interstitium during acute cold-water immersion, both before and after cold acclimation.

Deep-sea fungi: Occurrence and adaptations

Digital Repository Service at National Institute of Oceanography (India)

Damare, S.R.

) Digitatispora marina n.g., n.sp., Basidiomycet marin. C. R. Hebd. Séances Acad. Sci., 254: 4336-8. Domsch KH, Gams W, Anderson TH (1980) Compendium of Soil Fungi. Academic Press, London . Durieu de Maisonneuve C, Montagne JFC (1869) Pyrenomycetes... and the absorbance was read at 260 nm. y = 0.0076x + 0.1259 R 2 = 0.9972 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 2040608010120 DNA concentration µg mL -1 A b so r b an c e 2 60 n m A-5 A – III. Protocol for the intracellular...

Behaviorally Mediated, Warm Adaptation: A Physiological Strategy When Mice Are Allowed to Behaviorally Thermoregulate

Science.gov (United States)

Laboratory mice housed under standard vivarium conditions with an ambient temperature (Ta) of -22°C are likely to be cold stressed because this Ta is below their thermoneutral zone (TNZ). Mice raised at Tas within the TNZ adapt to the warmer temperatures, developing smaller int...

The molecular and cellular basis of cold sensation.

Science.gov (United States)

McKemy, David D

2013-02-20

Of somatosensory modalities, cold is one of the more ambiguous percepts, evoking the pleasant sensation of cooling, the stinging bite of cold pain, and welcome relief from chronic pain. Moreover, unlike the precipitous thermal thresholds for heat activation of thermosensitive afferent neurons, thresholds for cold fibers are across a range of cool to cold temperatures that spans over 30 °C. Until recently, how cold produces this myriad of biological effects has been poorly studied, yet new advances in our understanding of cold mechanisms may portend a better understanding of sensory perception as well as provide novel therapeutic approaches. Chief among these was the identification of a number of ion channels that either serve as the initial detectors of cold as a stimulus in the peripheral nervous system, or are part of rather sophisticated differential expression patterns of channels that conduct electrical signals, thereby endowing select neurons with properties that are amenable to electrical signaling in the cold. This review highlights the current understanding of the channels involved in cold transduction as well as presents a hypothetical model to account for the broad range of cold thermal thresholds and distinct functions of cold fibers in perception, pain, and analgesia.

Characterization and Identification of the Basidiomycetous Fungus Associated with 'hoya de malvón' Grapevine Disease in Argentina

Directory of Open Access Journals (Sweden)

S. Lupo

2006-04-01

Full Text Available Inocutis jamaicensis (Murrill Gottlieb, J.E. Wright & Moncalvo was identified as the basidiomycetous species associated with ‘hoja de malvón’ grapevine disease in Argentina. Macro and micro-morphological characteristics of fruit bodies corresponded to those described for the white-rotting fungus associated with native plant species and Eucalyptus globulus Labill. planted in Uruguay. Monokariotic isolates were obtained from basidiospores produced by fruit bodies of I. jamaicensis collected from Vitis vinifera L. and E. globulus. Dikaryons and fruit bodies produced by pairing monokaryotic mycelium suggest that all these isolates belong to the same species. The analysis of RFLP of the dikaryon produced by pairing monokaryons derived from V. vinifera and E. globulus revealed fragments that corresponded to each monokaryon, confirming that isolates from Vitis mated with those from Eucalyptus. In order to compare grapevine and Uruguayan isolates, RFLPs from ITS region generated by restriction digestion with Alu I, Hae III, Hha I, Msp I and Taq I were performed. Differences found in some restriction pattern could reflect a certain degree of variability between dikariotic isolates, probably related with a particular lifestyle, host specificity or geographic origin.

Frequent extreme cold exposure and brown fat and cold-induced thermogenesis: A study in a monozygotic twin

NARCIS (Netherlands)

M.J. Vosselman (Maarten J.); G.H.E.J. Vijgen (Guy H. E. J.); B.R.M. Kingma (Boris R. M.); B. Brans (Boudewijn); W.D. Van Marken Lichtenbelt (Wouter D.)

2014-01-01

textabstractIntroduction: Mild cold acclimation is known to increase brown adipose tissue (BAT) activity and cold-induced thermogenesis (CIT) in humans. We here tested the effect of a lifestyle with frequent exposure to extreme cold on BAT and CIT in a Dutch man known as 'the Iceman', who has

Adaptive Thermal Comfort in Learning Spaces: A Study of the Cold Period in Ensenada, Baja California

Directory of Open Access Journals (Sweden)

Julio Rincón

2017-12-01

Full Text Available Environmental thermal conditions decisively influence people’s performance, comfort, well-being and mood. In closed spaces, where people spend 80% of their time, thermal perception is a phenomenon studied from a multidisciplinary methodological approach. In Mexico, thermal comfort has been studied in isolation in different cities in the country, specifically at sites with warm, temperate or semi-cold bioclimate. The thermal estimates presented in this paper are the result of a thermal comfort study carried out during the cold period in the city of Ensenada, Baja California, which has a dry temperate bioclimate. The study was carried out from January 30th to March 3rd 2017 and consisted of the application of a questionnaire and the simultaneous recording of temperature, relative humidity and wind speed. The questionnaire was designed based on the subjective assessment scale suggested in ISO 10551 and ANSI/ASHRAE 55, while the instruments for measuring and recording environmental variables were selected and used based on ISO 7726. A database with 983 observations was created, and the data were processed using the Averages Intervals Thermal Sensation method. The thermal comfort range estimated for indoor spaces was 16.8 °C to 23.8 °C, with an ideal neutral temperature of 20.3 °C. The percentage of satisfaction vote with these results was 91%.

Post-exercise cold water immersion attenuates acute anabolic signalling and long-term adaptations in muscle to strength training.

Science.gov (United States)

Roberts, Llion A; Raastad, Truls; Markworth, James F; Figueiredo, Vandre C; Egner, Ingrid M; Shield, Anthony; Cameron-Smith, David; Coombes, Jeff S; Peake, Jonathan M

2015-09-15

We investigated functional, morphological and molecular adaptations to strength training exercise and cold water immersion (CWI) through two separate studies. In one study, 21 physically active men strength trained for 12 weeks (2 days per week), with either 10 min of CWI or active recovery (ACT) after each training session. Strength and muscle mass increased more in the ACT group than in the CWI group (P work (19%), type II muscle fibre cross-sectional area (17%) and the number of myonuclei per fibre (26%) increased in the ACT group (all P < 0.05), but not the CWI group. In another study, nine active men performed a bout of single-leg strength exercises on separate days, followed by CWI or ACT. Muscle biopsies were collected before and 2, 24 and 48 h after exercise. The number of satellite cells expressing neural cell adhesion molecule (NCAM) (10-30%) and paired box protein (Pax7) (20-50%) increased 24-48 h after exercise with ACT. The number of NCAM(+) satellite cells increased 48 h after exercise with CWI. NCAM(+) - and Pax7(+) -positive satellite cell numbers were greater after ACT than after CWI (P < 0.05). Phosphorylation of p70S6 kinase(Thr421/Ser424) increased after exercise in both conditions but was greater after ACT (P < 0.05). These data suggest that CWI attenuates the acute changes in satellite cell numbers and activity of kinases that regulate muscle hypertrophy, which may translate to smaller long-term training gains in muscle strength and hypertrophy. The use of CWI as a regular post-exercise recovery strategy should be reconsidered. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

A live attenuated cold-adapted influenza A H7N3 virus vaccine provides protection against homologous and heterologous H7 viruses in mice and ferrets

International Nuclear Information System (INIS)

Joseph, Tomy; McAuliffe, Josephine; Lu, Bin; Vogel, Leatrice; Swayne, David; Jin, Hong; Kemble, George; Subbarao, Kanta

2008-01-01

The appearance of human infections caused by avian influenza A H7 subtype viruses underscores their pandemic potential and the need to develop vaccines to protect humans from viruses of this subtype. A live attenuated H7N3 virus vaccine was generated by reverse genetics using the HA and NA genes of a low pathogenicity A/chicken/BC/CN-6/04 (H7N3) virus and the six internal protein genes of the cold-adapted A/Ann Arbor/6/60 ca (H2N2) virus. The reassortant H7N3 BC 04 ca vaccine virus was temperature sensitive and showed attenuation in mice and ferrets. Intranasal immunization with one dose of the vaccine protected mice and ferrets when challenged with homologous and heterologous H7 viruses. The reassortant H7N3 BC 04 ca vaccine virus showed comparable levels of attenuation, immunogenicity and efficacy in mice and ferret models. The safety, immunogenicity, and efficacy of this vaccine in mice and ferrets support the evaluation of this vaccine in clinical trials

Preservation of potassium balance is strongly associated with insect cold tolerance in the field: a seasonal study of Drosophila subobscura.

Science.gov (United States)

MacMillan, Heath A; Schou, Mads F; Kristensen, Torsten N; Overgaard, Johannes

2016-05-01

There is interest in pinpointing genes and physiological mechanisms explaining intra- and interspecific variations in cold tolerance, because thermal tolerance phenotypes strongly impact the distribution and abundance of wild animals. Laboratory studies have highlighted that the capacity to preserve water and ion homeostasis is linked to low temperature survival in insects. It remains unknown, however, whether adaptive seasonal acclimatization in free-ranging insects is governed by the same physiological mechanisms. Here, we test whether cold tolerance in field-caught Drosophila subobscura is high in early spring and lower during summer and whether this transition is associated with seasonal changes in the capacity of flies to preserve water and ion balance during cold stress. Indeed, flies caught during summer were less cold tolerant, and exposure of these flies to sub-zero temperatures caused a loss of haemolymph water and increased the concentration of K(+) in the haemolymph (as in laboratory-reared insects). This pattern of ion and water balance disruption was not observed in more cold-tolerant flies caught in early spring. Thus, we here provide a field verification of hypotheses based on laboratory studies and conclude that the ability to maintain ion homeostasis is important for the ability of free-ranging insects to cope with chilling. © 2016 The Author(s).

Working in the Cold

Centers for Disease Control (CDC) Podcasts

2016-02-08

During the winter, many workers are outdoors, working in cold, wet, icy, or snowy conditions. Learn how to identify symptoms that tell you there may be a problem and protect yourself from cold stress.  Created: 2/8/2016 by National Institute for Occupational Safety and Health (NIOSH).   Date Released: 2/8/2016.

Herpes Simplex Virus (Cold Sores)

Science.gov (United States)

... Print Share Cold Sores in Children: About the Herpes Simplex Virus Page Content ​A child's toddler and ... Cold sores (also called fever blisters or oral herpes) start as small blisters that form around the ...

Functional characterization of the Hyles euphorbiae hawkmoth transcriptome reveals strong expression of phorbol ester detoxification and seasonal cold hardiness genes.

Science.gov (United States)

Barth, M Benjamin; Buchwalder, Katja; Kawahara, Akito Y; Zhou, Xin; Liu, Shanlin; Krezdorn, Nicolas; Rotter, Björn; Horres, Ralf; Hundsdoerfer, Anna K

2018-01-01

The European spurge hawkmoth, Hyles euphorbiae (Lepidoptera, Sphingidae), has been intensively studied as a model organism for insect chemical ecology, cold hardiness and evolution of species delineation. To understand species isolation mechanisms at a molecular level, this study aims at determining genetic factors underlying two adaptive ecological trait candidates, phorbol ester (TPA) detoxification and seasonal cold acclimation. A draft transcriptome of H. euphorbiae was generated using Illumina sequencing, providing the first genomic resource for the hawkmoth subfamily Macroglossinae. RNA expression levels in tissues of experimental TPA feeding larvae and cooled pupae was compared to levels in control larvae and pupae using 26 bp RNA sequence tag libraries (DeepSuperSAGE). Differential gene expression was assessed by homology searches of the tags in the transcriptome. In total, 389 and 605 differentially expressed transcripts for detoxification and cold hardiness, respectively, could be identified and annotated with proteins. The majority (22 of 28) of differentially expressed detox transcripts of the four 'drug metabolism' enzyme groups (cytochrome P450 (CYP), carboxylesterases (CES), glutathione S-transferases (GST) and lipases) are up-regulated. Triacylglycerol lipase was significantly over proportionally annotated among up-regulated detox transcripts. We record several up-regulated lipases, GSTe2, two CESs, CYP9A21, CYP6BD6 and CYP9A17 as candidate genes for further H. euphorbiae TPA detoxification analyses. Differential gene expression of the cold acclimation treatment is marked by metabolic depression with enriched Gene Ontology terms among down-regulated transcripts almost exclusively comprising metabolism, aerobic respiration and dissimilative functions. Down-regulated transcripts include energy expensive respiratory proteins like NADH dehydrogenase, cytochrome oxidase and ATP synthase. Gene expression patterns show shifts in carbohydrate

Flu and Colds: In Depth

Science.gov (United States)

... to prevent colds or relieve cold symptoms. Andrographis (Andrographis paniculata) Chinese herbal medicines Green tea Guided imagery Hydrotherapy ... measurements (VAS) to assess the effectiveness of standardized Andrographis paniculata extract SHA-10 in reducing the symptoms of ...

Solid-state fermentation of cornmeal with the basidiomycete Ganoderma lucidum for degrading starch and upgrading nutritional value.

Science.gov (United States)

Han, J R; An, C H; Yuan, J M

2005-01-01

The objective of this research was to study the ability of the basidiomycete Ganoderma lucidum to degrade starch and upgrade nutritional value of cornmeal during solid-state fermentation (SSF). On the basal medium that consisted of cornmeal and salt solution, alpha-amylase activity of G. lucidum reached its maximum value of 267 U g(-1) of culture on day 20 after inoculation. Prolongation of fermentation time from 10 to 25 days increased significantly the degradation rate of starch and ergosterol yield (a kind of physiologically active substances of G. lucidum, also as an indicator of mycelial biomass) (P cornmeal, ground to 30-mesh powder, moistened with 67 ml of nutrient salt solution supplemented with 3 g yeast extract and 7.5 g glucose per litre. Under the optimum culture condition, the degradation rate of starch reached its maximum values of 70.4%; the starch content of the fermented product decreased from 64.5 to 25.3%, while the reducing sugar content increased from 4.2 to 20.6%. SSF also produced a significant increase (P cornmeal was strikingly increased and some active substances originated from G. lucidum remained in the fermented product. This implied that cornmeal could be processed into many kinds of special functional foods by SSF of G. lucidum.

Camphor induces cold and warm sensations with increases in skin and muscle blood flow in human.

Science.gov (United States)

Kotaka, Tomohiko; Kimura, Shoji; Kashiwayanagi, Makoto; Iwamoto, Jun

2014-01-01

Application of camphor to the skin has been empirically thought to improve blood circulation. However, camphor's effects on blood circulation to the skin and on thermal sensation have not been well elucidated. In this study, we examined its effects on the quality of sensation as well as on skin and muscle blood flow in human. Nine adults (average age 37±9.4 years) participated in the study. Petroleum jelly containing 5%, 10%, 20% camphor, or 2% menthol was separately applied to the skin on the medial side of one forearm of each subject. Just after the application, camphor at each concentration induced a cold sensation in a dose-dependent manner. Within 10 min, each subject reported that the cold sensation had faded, after which it was replaced by a warm sensation. As reported previously, a cold sensation was induced by application of 2% menthol, but the subjects did not adapt to that sensation. In addition, menthol did not induce a warm sensation at all. Application of menthol has been shown to increase blood flow in the skin. Finally, we measured blood flow in skin and muscle after the application of camphor or menthol. Application of camphor or menthol separately induced increases in local blood flow in the skin and muscle. The present results indicate that camphor induces both cold and warm sensations and improves blood circulation.

Effects of mild cold stress on the survival of seawater-adapted mallard ducks (Anas platyrhynchos) maintained on food contaminated with petroleum

Science.gov (United States)

Holmes, W.N.; Gorsline, J.; Cronshaw, J.

1979-01-01

(1) Seawater-adapted Mallard ducks maintained in the laboratory will freely consume food that has been contaminated with either any one of a variety of crude oils or a petroleum derivative such as No. 2 fuel oil. (2) During a 100-day experimental period total masses of petroleum equivalent to 50% of the mean body weight were consumed by some birds and many showed no apparent symptoms of distress. (3) The consumption of petroleum-contaminated food was frequently accompanied by a persistent hyperphagia but no clear patterns of change in body weight were associated with this condition. (4) Among those birds that survived the 100-day experimental period only small changes in mean body weight were observed between successive weighings and in most instances these represented less than 10% of the previously recorded weight. (5) In all groups, including those maintained on uncontaminated food, most of the mortality occurred following exposure to continuous mild cold stress. The total number of deaths in the groups given petroleum-contaminated food, however, was always higher than that among birds given uncontaminated food. (6) The spate of mortality that occurred in groups given petroleum-contaminated food usually occurred earlier, lasted longer, and involved more birds than it did among groups fed uncontaminated food. (7) The pattern of each episode of mortality was sometimes quantitatively related to the concentration of petroleum in the food and a striking range of relative toxicities were observed among the crude oils from different geographic regions. (8) Throughout the experiment, the mean body weight of the birds that died was always significantly less than that of the survivors in the same group; in all instances most of the loss in weight occurred during the 2 weeks preceding death. (9) Autopsy revealed that adrenal hypertrophy and lymphoepithelial involution were characteristic in all of the birds that died, suggesting that a high level of adrenocortical

Microbiological and physicochemical analysis of pumpkin juice fermentation by the basidiomycetous fungus Ganoderma lucidum.

Science.gov (United States)

Zhao, Jing; Liu, Wei; Chen, Dong; Zhou, Chunli; Song, Yi; Zhang, Yuyu; Ni, Yuanying; Li, Quanhong

2015-02-01

A new protocol for processing of pumpkin juice was set up which included fermentation by the basidiomycete Ganoderma lucidum at 28 °C for 7 d. The growth curve of G. lucidum in pumpkin juice was successfully (R(2)  = 0.99) fitted by a 4-parameter logistic model and the ideal highest biomass was estimated to be 4.79 g/L. G. lucidum was found to have a significant acidification effect on pumpkin juice. The lowest pH (4.05 ± 0.05) and highest total titratable acidity (14.31 ± 0.16 mL 0.1 M NaOH/100 mL) were found on the 4th day during fermentation. Sugars in pumpkin juice fermented with G. lucidum showed a significant decrease, especially glucose and fructose. On the contrary, the release of exo-polysaccharides and free amino acids greatly enriched the pumpkin juice. The variation of color index and viscosity also mirrored the above behavior. Based on headspace solid phase microextraction and gas chromatography-mass spectrometry, 68 volatile compounds were identified, including 17 esters, 14 alcohols, 13 phenyl compounds, 11 aldehydes, 8 ketones, 3 acids, 1 furan, and 1 benzothiazole. The pumpkin juices fermented for different days were markedly differentiated with principal component analysis and the fermentation process was tentatively divided into 3 periods: the booming (from the 1st to 4th day), steady (from the 5th to 6th day), and decline (the 7th day) period. © 2014 Institute of Food Technologists®

Evaporative cooling enhanced cold storage system

Science.gov (United States)

Carr, P.

1991-10-15

The invention provides an evaporatively enhanced cold storage system wherein a warm air stream is cooled and the cooled air stream is thereafter passed into contact with a cold storage unit. Moisture is added to the cooled air stream prior to or during contact of the cooled air stream with the cold storage unit to effect enhanced cooling of the cold storage unit due to evaporation of all or a portion of the added moisture. Preferably at least a portion of the added moisture comprises water condensed during the cooling of the warm air stream. 3 figures.

Review on Cold-Formed Steel Connections

Science.gov (United States)

Tan, Cher Siang; Mohammad, Shahrin; Md Tahir, Mahmood; Shek, Poi Ngian

2014-01-01

The concept of cold-formed light steel framing construction has been widespread after understanding its structural characteristics with massive research works over the years. Connection serves as one of the important elements for light steel framing in order to achieve its structural stability. Compared to hot-rolled steel sections, cold-formed steel connections perform dissimilarity due to the thin-walled behaviour. This paper aims to review current researches on cold-formed steel connections, particularly for screw connections, storage rack connections, welded connections, and bolted connections. The performance of these connections in the design of cold-formed steel structures is discussed. PMID:24688448

Chlorophyll fluorescence emission can screen cold tolerance of cold acclimated Arabidopsis thaliana accessions

Czech Academy of Sciences Publication Activity Database

Mishra, Anamika; Heyer, A. G.; Mishra, Kumud

2014-01-01

Roč. 10, č. 38 (2014) ISSN 1746-4811 R&D Projects: GA MŠk EE2.3.20.0246; GA MŠk 7E12047 Institutional support: RVO:67179843 Keywords : high-throughput screening * chlorophyll a fluorescence transients * cold tolerance * cold acclimation * whole plant * Arabidopsis thaliana Subject RIV: EH - Ecology, Behaviour Impact factor: 3.102, year: 2014

Steel weldability. Underbead cold cracking

International Nuclear Information System (INIS)

Marquet, F.; Defourny, J.; Bragard, A.

1977-01-01

The problem of underbead cold cracking has been studied by the implant technique. This approach allows to take into account in a quantitative manner the different factors acting on the cold cracking phenomenon: structure under the weld bead, level of restraint, hydrogen content in the molten metal. The influence of the metallurgical factors depending from the chemical composition of the steel has been examined. It appeared that carbon equivalent is an important factor to explain cold cracking sensitivity but that it is not sufficient to characterize the steel. The results have shown that vanadium may have a deleterious effect on the resistance to cold cracking when the hydrogen content is high and that small silicon additions are beneficient. The influence of the diffusible hydrogen content has been checked and the important action of pre- and postheating has been shown. These treatments allow the hydrogen to escape from the weld before the metal has been damaged. Some inclusions (sulphides) may also decrease the influence of hydrogen. A method based on the implant tests has been proposed which allows to choose and to control safe welding conditions regarding cold cracking

The process and risk of the CPR1000 cold function test in the cold area

International Nuclear Information System (INIS)

Liu Tinghao; Zhang Jian; Ji Dapeng; Shi Quanjian; Tian Kuo

2014-01-01

Hong yanhe nuclear power station is the first CPR1000 reactor which is under construction in the cold area of north China. It is also the first time to carry out the cold functional test (CFT) in the winter of north China. The preparation and process of CFT are described in the paper. According to the experience feedback of CFT of Unit 1, the risk and solution which are significance for the CFT of the other NPS in the cold area are analysed. (authors)

Cold water recovery reduces anaerobic performance.

Science.gov (United States)

Crowe, M J; O'Connor, D; Rudd, D

2007-12-01

This study investigated the effects of cold water immersion on recovery from anaerobic cycling. Seventeen (13 male, 4 female) active subjects underwent a crossover, randomised design involving two testing sessions 2 - 6 d apart. Testing involved two 30-s maximal cycling efforts separated by a one-hour recovery period of 10-min cycling warm-down followed by either passive rest or 15-min cold water immersion (13 - 14 degrees C) with passive rest. Peak power, total work and postexercise blood lactate were significantly reduced following cold water immersion compared to the first exercise test and the control condition. These variables did not differ significantly between the control tests. Peak exercise heart rate was significantly lower after cold water immersion compared to the control. Time to peak power, rating of perceived exertion, and blood pH were not affected by cold water immersion compared to the control. Core temperature rose significantly (0.3 degrees C) during ice bath immersion but a similar increase also occurred in the control condition. Therefore, cold water immersion caused a significant decrease in sprint cycling performance with one-hour recovery between tests.

Actively controlling coolant-cooled cold plate configuration

Science.gov (United States)

Chainer, Timothy J.; Parida, Pritish R.

2015-07-28

A method is provided to facilitate active control of thermal and fluid dynamic performance of a coolant-cooled cold plate. The method includes: monitoring a variable associated with at least one of the coolant-cooled cold plate or one or more electronic components being cooled by the cold plate; and dynamically varying, based on the monitored variable, a physical configuration of the cold plate. By dynamically varying the physical configuration, the thermal and fluid dynamic performance of the cold plate are adjusted to, for example, optimally cool the one or more electronic components, and at the same time, reduce cooling power consumption used in cooling the electronic component(s). The physical configuration can be adjusted by providing one or more adjustable plates within the coolant-cooled cold plate, the positioning of which may be adjusted based on the monitored variable.

RNA-Seq-based analysis of cold shock response in Thermoanaerobacter tengcongensis, a bacterium harboring a single cold shock protein encoding gene.

Directory of Open Access Journals (Sweden)

Bo Liu

Full Text Available BACKGROUND: Although cold shock responses and the roles of cold shock proteins in microorganisms containing multiple cold shock protein genes have been well characterized, related studies on bacteria possessing a single cold shock protein gene have not been reported. Thermoanaerobacter tengcongensis MB4, a thermophile harboring only one known cold shock protein gene (TtescpC, can survive from 50° to 80 °C, but has poor natural competence under cold shock at 50 °C. We therefore examined cold shock responses and their effect on natural competence in this bacterium. RESULTS: The transcriptomes of T. tengcongensis before and after cold shock were analyzed by RNA-seq and over 1200 differentially expressed genes were successfully identified. These genes were involved in a wide range of biological processes, including modulation of DNA replication, recombination, and repair; energy metabolism; production of cold shock protein; synthesis of branched amino acids and branched-chain fatty acids; and sporulation. RNA-seq analysis also suggested that T. tengcongensis initiates cell wall and membrane remodeling processes, flagellar assembly, and sporulation in response to low temperature. Expression profiles of TtecspC and failed attempts to produce a TtecspC knockout strain confirmed the essential role of TteCspC in the cold shock response, and also suggested a role of this protein in survival at optimum growth temperature. Repression of genes encoding ComEA and ComEC and low energy metabolism levels in cold-shocked cells are the likely basis of poor natural competence at low temperature. CONCLUSION: Our study demonstrated changes in global gene expression under cold shock and identified several candidate genes related to cold shock in T. tengcongensis. At the same time, the relationship between cold shock response and poor natural competence at low temperature was preliminarily elucidated. These findings provide a foundation for future studies on genetic

How cold is it? TRPM8 and TRPA1 in the molecular logic of cold sensation

Directory of Open Access Journals (Sweden)

McKemy David D

2005-04-01

Full Text Available Abstract Recognition of temperature is a critical element of sensory perception and allows us to evaluate both our external and internal environments. In vertebrates, the somatosensory system can discriminate discrete changes in ambient temperature, which activate nerve endings of primary afferent fibers. These thermosensitive nerves can be further segregated into those that detect either innocuous or noxious (painful temperatures; the latter neurons being nociceptors. We now know that thermosensitive afferents express ion channels of the transient receptor potential (TRP family that respond at distinct temperature thresholds, thus establishing the molecular basis for thermosensation. Much is known of those channels mediating the perception of noxious heat; however, those proposed to be involved in cool to noxious cold sensation, TRPM8 and TRPA1, have only recently been described. The former channel is a receptor for menthol, and links the sensations provided by this and other cooling compounds to temperature perception. While TRPM8 almost certainly performs a critical role in cold signaling, its part in nociception is still at issue. The latter channel, TRPA1, is activated by the pungent ingredients in mustard and cinnamon, but has also been postulated to mediate our perception of noxious cold temperatures. However, a number of conflicting reports have suggested that the role of this channel in cold sensation needs to be confirmed. Thus, the molecular logic for the perception of cold-evoked pain remains enigmatic. This review is intended to summarize our current understanding of these cold thermoreceptors, as well as address the current controversy regarding TRPA1 and cold signaling.

Social science in the Cold War.

Science.gov (United States)

Engerman, David C

2010-06-01

This essay examines ways in which American social science in the late twentieth century was--and was not--a creature of the Cold War. It identifies important work by historians that calls into question the assumption that all social science during the Cold War amounts to "Cold War social science." These historians attribute significant agency to social scientists, showing how they were enmeshed in both long-running disciplinary discussions and new institutional environments. Key trends in this scholarship include a broadening historical perspective to see social scientists in the Cold War as responding to the ideas of their scholarly predecessors; identifying the institutional legacies of World War II; and examining in close detail the products of extramural--especially governmental--funding. The result is a view of social science in the Cold War in which national security concerns are relevant, but with varied and often unexpected impacts on intellectual life.

Cold-inducible RNA-binding protein mediates cold air inducible airway mucin production through TLR4/NF-κB signaling pathway.

Science.gov (United States)

Chen, Lingxiu; Ran, Danhua; Xie, Wenyue; Xu, Qing; Zhou, Xiangdong

2016-10-01

Mucus overproduction is an important feature in patients with chronic inflammatory airway diseases and cold air stimulation has been shown to be associated with the severity of these diseases. However, the regulatory mechanisms that mediate excessive mucin production under cold stress remain elusive. Recently, the cold-inducible RNA-binding protein (CIRP) has been shown to be markedly induced after exposure to cold air. In this study, we sought to explore the expression of CIRP within bronchial biopsy specimens, the effect on mucin5AC (MUC5AC) production in chronic inflammatory airway diseases and the potential signaling pathways involved in cold air stimulation process. We found that CIRP protein expression was significantly increased in patients with COPD and in mice treated with cold air. Moreover, cold air stimulation induced MUC5AC expression in wild-type mice but not in CIRP(-/-) mice. In vitro, cold air stress significantly elevated the transcriptional and protein expression levels of MUC5AC in human bronchial epithelial cells. CIRP, toll-like receptor 4 (TLR4) and phosphorylated NF-κB p65 (p-p65) increased significantly in response to cold stress and CIRP siRNA, TLR4 - neutralizing Ab and a specific inhibitor of NF-κB could attenuated cold stress inducible MUC5AC expression. In addition, CIRP siRNA could hindered the expression levels of TLR4 and p-p65 both induced by cold stress. Taken together, these results suggest that airway epithelial cells constitutively express CIRP in vitro and in vivo. CIRP is responsible for cold-inducible MUC5AC expression by activating TLR4/NF-κB signaling pathway. Copyright © 2016 Elsevier B.V. All rights reserved.

Accelerator-based pulsed cold neutron source

International Nuclear Information System (INIS)

Inoue, Kazuhiko; Iwasa, Hirokatsu; Kiyanagi, Yoshiaki

1979-01-01

An accelerator-based pulsed cold neutron source was constructed. The accelerator is a 35 MeV electron linear accelerator with 1 kW average beam power. The cold neutron beam intensity at a specimen is equivalent to that of a research reactor of 10 14 n/cm 2 .s thermal flux in the case of the quasi-elastic neutron scattering measurements. In spite of some limitations to the universal uses, it has been demonstrated by this facility that the modest capacity accelerator-based pulsed cold neutron source is a highly efficient cold neutron source with low capital investment. Design philosophy, construction details, performance and some operational experiences are described. (author)

Heat and cold accumulators in vehicles

Energy Technology Data Exchange (ETDEWEB)

Kauranen, P.; Wikstroem, L. (VTT Technical Research Centre of Finland, Advanced Materials, Tampere (Finland)); Heikkinen, J. (VTT Technical Research Centre of Finland, Building Services and Indoor Environment, Espoo (Finland)); Laurikko, J.; Elonen, T. (VTT Technical Research Centre of Finland, Emission Control, Espoo (Finland)); Seppaelae, A. (Helsinki Univ. of Technology, Applied Thermodynamics, Espoo (Finland)). Email: ari.seppala@tkk.fi

2009-07-01

Phase Change Material (PCM) based heat and cold accumulators have been tailored for transport applications including a mail delivery van as well as the cold chains of foodstuff and blood products. The PCMs can store relative large amount of thermal energy in a narrow temperature interval as latent heat of fusion of their melting and crystallization processes. Compact heat and cold accumulators can be designed using PCMs. The aim of the project has been to reduce the exhaust gas and noise emissions and improve the fuel economy of the transport systems and to improve the reliability of the cold chains studied by storing thermal energy in PCM accumulators. (orig.)

Viable cold-tolerant iron-reducing microorganisms in geographically diverse subglacial environments

Science.gov (United States)

Nixon, Sophie L.; Telling, Jon P.; Wadham, Jemma L.; Cockell, Charles S.

2017-03-01

Subglacial environments are known to harbour metabolically diverse microbial communities. These microbial communities drive chemical weathering of underlying bedrock and influence the geochemistry of glacial meltwater. Despite its importance in weathering reactions, the microbial cycling of iron in subglacial environments, in particular the role of microbial iron reduction, is poorly understood. In this study we address the prevalence of viable iron-reducing microorganisms in subglacial sediments from five geographically isolated glaciers. Iron-reducing enrichment cultures were established with sediment from beneath Engabreen (Norway), Finsterwalderbreen (Svalbard), Leverett and Russell glaciers (Greenland), and Lower Wright Glacier (Antarctica). Rates of iron reduction were higher at 4 °C compared with 15 °C in all but one duplicated second-generation enrichment culture, indicative of cold-tolerant and perhaps cold-adapted iron reducers. Analysis of bacterial 16S rRNA genes indicates Desulfosporosinus were the dominant iron-reducing microorganisms in low-temperature Engabreen, Finsterwalderbreen and Lower Wright Glacier enrichments, and Geobacter dominated in Russell and Leverett enrichments. Results from this study suggest microbial iron reduction is widespread in subglacial environments and may have important implications for global biogeochemical iron cycling and export to marine ecosystems.

Cold suppresses agonist-induced activation of TRPV1.

Science.gov (United States)

Chung, M-K; Wang, S

2011-09-01

Cold therapy is frequently used to reduce pain and edema following acute injury or surgery such as tooth extraction. However, the neurobiological mechanisms of cold therapy are not completely understood. Transient receptor potential vanilloid 1 (TRPV1) is a capsaicin- and heat-gated nociceptive ion channel implicated in thermosensation and pathological pain under conditions of inflammation or injury. Although capsaicin-induced nociception, neuropeptide release, and ionic currents are suppressed by cold, it is not known if cold suppresses agonist-induced activation of recombinant TRPV1. We demonstrate that cold strongly suppressed the activation of recombinant TRPV1 by multiple agonists and capsaicin-evoked currents in trigeminal ganglia neurons under normal and phosphorylated conditions. Cold-induced suppression was partially impaired in a TRPV1 mutant that lacked heat-mediated activation and potentiation. These results suggest that cold-induced suppression of TRPV1 may share a common molecular basis with heat-induced potentiation, and that allosteric inhibition may contribute, in part, to the cold-induced suppression. We also show that combination of cold and a specific antagonist of TRPV1 can produce an additive suppression. Our results provide a mechanistic basis for cold therapy and may enhance anti-nociceptive approaches that target TRPV1 for managing pain under inflammation and tissue injury, including that from tooth extraction.

Facts about the Common Cold

Science.gov (United States)

... different viruses. Rhinovirus is the most common cause, accounting for 10 to 40 percent of colds. Other common cold viruses include coronavirus and ... RSS | Terms Of Use | Privacy | Sitemap Our Family Of Sites ... Introduction Risk Factors Screening Symptoms Tumor Testing Summary '; var ...

Cold Gas-Sprayed Deposition of Metallic Coatings onto Ceramic Substrates Using Laser Surface Texturing Pre-treatment

Science.gov (United States)

Kromer, R.; Danlos, Y.; Costil, S.

2018-04-01

Cold spraying enables a variety of metals dense coatings onto metal surfaces. Supersonic gas jet accelerates particles which undergo with the substrate plastic deformation. Different bonding mechanisms can be created depending on the materials. The particle-substrate contact time, contact temperature and contact area upon impact are the parameters influencing physicochemical and mechanical bonds. The resultant bonding arose from plastic deformation of the particle and substrate and temperature increasing at the interface. The objective was to create specific topography to enable metallic particle adhesion onto ceramic substrates. Ceramic did not demonstrate deformation during the impact which minimized the intimate bonds. Laser surface texturing was hence used as prior surface treatment to create specific topography and to enable mechanical anchoring. Particle compressive states were necessary to build up coating. The coating deposition efficiency and adhesion strength were evaluated. Textured surface is required to obtain strong adhesion of metallic coatings onto ceramic substrates. Consequently, cold spray coating parameters depend on the target material and a methodology was established with particle parameters (diameters, velocities, temperatures) and particle/substrate properties to adapt the surface topography. Laser surface texturing is a promising tool to increase the cold spraying applications.

Phonon forces and cold denaturatio

DEFF Research Database (Denmark)

Bohr, Jakob

2003-01-01

Protein unfolds upon temperature reduction as Well as upon In increase in temperature, These phenomena are called cold denaturation and hot denaturation, respectively. The contribution from quantum mode forces to denaturation is estimated using a simple phenomenological model describing the molec......Protein unfolds upon temperature reduction as Well as upon In increase in temperature, These phenomena are called cold denaturation and hot denaturation, respectively. The contribution from quantum mode forces to denaturation is estimated using a simple phenomenological model describing...... the molecule Is a continuum. The frequencies of the vibrational modes depend on the molecular dimensionality; hence, the zero-point energies for the folded and the denatured protein are estimated to differ by several electron volts. For a biomolecule such an energy is significant and may contribute to cold...... denaturing. This is consistent with the empirical observation that cold denaturation is exothermic anti hot denaturation endothermic....

Numerical modeling of axi-symmetrical cold forging process by ``Pseudo Inverse Approach''

Science.gov (United States)

Halouani, A.; Li, Y. M.; Abbes, B.; Guo, Y. Q.

2011-05-01

The incremental approach is widely used for the forging process modeling, it gives good strain and stress estimation, but it is time consuming. A fast Inverse Approach (IA) has been developed for the axi-symmetric cold forging modeling [1-2]. This approach exploits maximum the knowledge of the final part's shape and the assumptions of proportional loading and simplified tool actions make the IA simulation very fast. The IA is proved very useful for the tool design and optimization because of its rapidity and good strain estimation. However, the assumptions mentioned above cannot provide good stress estimation because of neglecting the loading history. A new approach called "Pseudo Inverse Approach" (PIA) was proposed by Batoz, Guo et al.. [3] for the sheet forming modeling, which keeps the IA's advantages but gives good stress estimation by taking into consideration the loading history. Our aim is to adapt the PIA for the cold forging modeling in this paper. The main developments in PIA are resumed as follows: A few intermediate configurations are generated for the given tools' positions to consider the deformation history; the strain increment is calculated by the inverse method between the previous and actual configurations. An incremental algorithm of the plastic integration is used in PIA instead of the total constitutive law used in the IA. An example is used to show the effectiveness and limitations of the PIA for the cold forging process modeling.

Cold gelation of globular proteins

NARCIS (Netherlands)

Alting, A.C.

2003-01-01

Keywords : globular proteins, whey protein, ovalbumin, cold gelation, disulfide bonds, texture, gel hardnessProtein gelation in food products is important to obtain desirable sensory and textural properties. Cold gelation is a novel method to produce protein-based gels. It is a two step process in

Monitoring the vaccine cold chain.

OpenAIRE

Cheriyan, E

1993-01-01

Maintaining the vaccine cold chain is an essential part of a successful immunisation programme. A continuous electronic temperature monitor helped to identify breaks in the cold chain in the community and the study led to the issue of proper guidelines and replacement of faulty equipment.

Costs of Adapting to Climate Change for Human Health in Developing Countries

OpenAIRE

Pandey, Kiran

2010-01-01

This paper is one component of a global study on the Economics of Adaptation to Climate Change (EACC) in developing countries; the focus in this paper is human health. The main human health impacts of climate change are increased incidence of vector-borne disease (malaria), water-borne disease (diarrhea), cardio respiratory diseases, heat- and cold-related deaths, injuries and deaths from ...

Frequent extreme cold exposure and brown fat and cold-induced thermogenesis: a study in a monozygotic twin.

Directory of Open Access Journals (Sweden)

Maarten J Vosselman

Full Text Available INTRODUCTION: Mild cold acclimation is known to increase brown adipose tissue (BAT activity and cold-induced thermogenesis (CIT in humans. We here tested the effect of a lifestyle with frequent exposure to extreme cold on BAT and CIT in a Dutch man known as 'the Iceman', who has multiple world records in withstanding extreme cold challenges. Furthermore, his monozygotic twin brother who has a 'normal' sedentary lifestyle without extreme cold exposures was measured. METHODS: The Iceman (subject A and his brother (subject B were studied during mild cold (13°C and thermoneutral conditions (31°C. Measurements included BAT activity and respiratory muscle activity by [18F]FDG-PET/CT imaging and energy expenditure through indirect calorimetry. In addition, body temperatures, cardiovascular parameters, skin perfusion, and thermal sensation and comfort were measured. Finally, we determined polymorphisms for uncoupling protein-1 and β3-adrenergic receptor. RESULTS: Subjects had comparable BAT activity (A: 1144 SUVtotal and B: 1325 SUVtotal, within the range previously observed in young adult men. They were genotyped with the polymorphism for uncoupling protein-1 (G/G. CIT was relatively high (A: 40.1% and B: 41.9%, but unlike during our previous cold exposure tests in young adult men, here both subjects practiced a g-Tummo like breathing technique, which involves vigorous respiratory muscle activity. This was confirmed by high [18F]FDG-uptake in respiratory muscle. CONCLUSION: No significant differences were found between the two subjects, indicating that a lifestyle with frequent exposures to extreme cold does not seem to affect BAT activity and CIT. In both subjects, BAT was not higher compared to earlier observations, whereas CIT was very high, suggesting that g-Tummo like breathing during cold exposure may cause additional heat production by vigorous isometric respiratory muscle contraction. The results must be interpreted with caution given the

Properties of cold components of symbiotic stars

International Nuclear Information System (INIS)

Luud, L.; Leehdyarv, L.

1986-01-01

Using the Blackwell-Shallis method the luminosities, temperatures and radii for cold components of symbiotic stars and for a sample of field red giants have been determined by means of infrared photometric observations. It turned out that the cold components of symbiotic stars do not differ from the normal red giants of the asymptotic branch. The masses of cold components of symbiotic stars have been found to be close to 3 M* (M* is the solar mass).The cold components of symbiotic stars do not fill their Roche lobes. About 10 times more carbon stars than the normal value in the vicinity of the Sun have been found among the cold components of symbiotic stars

Assessing Reliability of Cold Spray Sputter Targets in Photovoltaic Manufacturing

Science.gov (United States)

Hardikar, Kedar; Vlcek, Johannes; Bheemreddy, Venkata; Juliano, Daniel

2017-10-01

Cold spray has been used to manufacture more than 800 Cu-In-Ga (CIG) sputter targets for deposition of high-efficiency photovoltaic thin films. It is a preferred technique since it enables high deposit purity and transfer of non-equilibrium alloy states to the target material. In this work, an integrated approach to reliability assessment of such targets with deposit weight in excess of 50 lb. is undertaken, involving thermal-mechanical characterization of the material in as-deposited condition, characterization of the interface adhesion on cylindrical substrate in as-deposited condition, and developing means to assess target integrity under thermal-mechanical loads during the physical vapor deposition (PVD) sputtering process. Mechanical characterization of cold spray deposited CIG alloy is accomplished through the use of indentation testing and adaptation of Brazilian disk test. A custom lever test was developed to characterize adhesion along the cylindrical interface between the CIG deposit and cylindrical substrate, overcoming limitations of current standards. A cohesive zone model for crack initiation and propagation at the deposit interface is developed and validated using the lever test and later used to simulate the potential catastrophic target failure in the PVD process. It is shown that this approach enables reliability assessment of sputter targets and improves robustness.

Biosynthesis of nanoparticles of metals and metalloids by basidiomycetes. Preparation of gold nanoparticles by using purified fungal phenol oxidases.

Science.gov (United States)

Vetchinkina, Elena P; Loshchinina, Ekaterina A; Vodolazov, Ilya R; Kursky, Viktor F; Dykman, Lev A; Nikitina, Valentina E

2017-02-01

The work shows the ability of cultured Basidiomycetes of different taxonomic groups-Lentinus edodes, Pleurotus ostreatus, Ganoderma lucidum, and Grifola frondosa-to recover gold, silver, selenium, and silicon, to elemental state with nanoparticles formation. It examines the effect of these metal and metalloid compounds on the parameters of growth and accumulation of biomass; the optimal cultivation conditions and concentrations of the studied ion-containing compounds for recovery of nanoparticles have been identified. Using the techniques of transmission electron microscopy, dynamic light scattering, X-ray fluorescence and X-ray phase analysis, the degrees of oxidation of the bioreduced elements, the ζ-potential of colloidal solutions uniformity, size, shape, and location of the nanoparticles in the culture fluid, as well as on the surface and the inside of filamentous hyphae have been determined. The study has found the part played by homogeneous chromatographically pure fungal phenol-oxidizing enzymes (laccases, tyrosinases, and Mn-peroxidases) in the recovery mechanism with formation of electrostatically stabilized colloidal solutions. A hypothetical mechanism of gold(III) reduction from HAuCl 4 to gold(0) by phenol oxidases with gold nanoparticles formation of different shapes and sizes has been introduced.

Nonfreezing Cold-Induced Injuries

Science.gov (United States)

2012-01-01

cold injury. ( Modi - fi ed from Jia J, Pollock M: The pathogenesis of non-freezing cold nerve injury: Observations in the rat, Brain 120:631, 1997...myelitis and sinus development ( Figures 7-17 to 7-19 ). Appearance and behavior of the neuropathic foot have many similarities to those of the diabetic ...foot. In the diabetic foot, infections tend to be polymicrobial with Staphylococcus aureus, Staphylococcus epidermidis, and Enterococcus and

Cold fusion anomalies more perplexing than ever

International Nuclear Information System (INIS)

Dagani, R.

1989-01-01

This article addresses the debate over research on cold fusion. Analysis is made of the research efforts that have taken place since cold fusion was first thought to have been discovered in Utah. Research in the Soviet Union on the cold fusion phenomenon is also discussed