Incomplete resistance to coffee leaf rust (Hemileia vastatrix)
Eskes, A.B.
1983-01-01
Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales
SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent
Directory of Open Access Journals (Sweden)
Lucas Mateus Rivero Rodrigues
Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.
James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John
2016-01-15
The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Toniutti, Lucile; Breitler, Jean-Christophe; Etienne, Hervé; Campa, Claudine; Doulbeau, Sylvie; Urban, Laurent; Lambot, Charles; Pinilla, Juan-Carlos H; Bertrand, Benoît
2017-01-01
Global warming is a major threat to agriculture worldwide. Between 2008 and 2013, some coffee producing countries in South and Central America suffered from severe epidemics of coffee leaf rust (CLR), resulting in high economic losses with social implications for coffee growers. The climatic events not only favored the development of the pathogen but also affected the physiological status of the coffee plant. The main objectives of the study were to evaluate how the physiological status of the coffee plant modified by different environmental conditions impact on the pathogenesis of CLR and to identify indicators of the physiological status able to predict rust incidence. Three rust susceptible genotypes (one inbred line and two hybrids) were grown in controlled conditions with a combination of thermal regime (TR), nitrogen and light intensity close to the field situation before being inoculated with the rust fungus Hemileia vastatrix . It has been demonstrated that a TR of 27-22°C resulted in 2000 times higher sporulation than with a TR of 23-18°C. It has been also shown that high light intensity combined with low nitrogen fertilization modified the CLR pathogenesis resulting in huge sporulation. CLR sporulation was significantly lower in the F1 hybrids than in the inbred line. The hybrid vigor may have reduced disease incidence. Among the many parameters studied, parameters related to photosystem II and photosynthetic electron transport chain components appeared as indicators of the physiological status of the coffee plant able to predict rust sporulation intensity. Taken together, these results show that CLR sporulation not only depends on the TR but also on the physiological status of the coffee plant, which itself depends on agronomic conditions. Our work suggests that vigorous varieties combined with a shaded system and appropriate nitrogen fertilization should be part of an agro-ecological approach to disease control.
B. M. R. Melo; F. B. S. Botelho; J. S. M. Silva; D. F. F. Lima; E. R. Moreira
2018-01-01
The coffee leaf miner and a rust are considered as major diseases that are able to reduce productivity in coffee plantations. These agents are influenced by abiotic factors, and their occurrence may suffer oscillation over the years. The objective of this study was to evaluate the seasonal fluctuation of the coffee leaf miner, incidence of coffee prediction and rust, correlated with abiotic factors. The study was performed IFSULDEMINAS-Campus Inconfidentes, in a coffee crop of the cultivar Ru...
Directory of Open Access Journals (Sweden)
B. M. R. Melo
2018-04-01
Full Text Available The coffee leaf miner and a rust are considered as major diseases that are able to reduce productivity in coffee plantations. These agents are influenced by abiotic factors, and their occurrence may suffer oscillation over the years. The objective of this study was to evaluate the seasonal fluctuation of the coffee leaf miner, incidence of coffee prediction and rust, correlated with abiotic factors. The study was performed IFSULDEMINAS-Campus Inconfidentes, in a coffee crop of the cultivar Rubi. A sample for a rust and a coffee leaf miner, in addition to the middle and upper third of the plants, totaling 42 plants in the study area. At the same sampling point, perform soil analysis to correlate nutrients as studied variables. The Pearson correlation of the biotic variables was performed with a precipitation and fertility, a rate of 1 and 5% probability. It was verified that the rust cycle alternated its incidence for the same period in different years and the miner showed behavior coincident to the driest periods of the year. Data not available on precipitation data and number of mines. These diseases had no significant correlation with the fertility parameter. The coffee leaf miner yielded higher rates of occurrence in June and December of 2014. It was concluded that the percentage of coffee leaf miner was higher in the months with lower rainfall indices or no longer summer period; What is it you want to know about the one-time development that may have been influenced by the nearby woods under study and the rust alternated the peaks of occurrence for the two autumners, correlating with a precipitation.
The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.
McCook, Stuart; Vandermeer, John
2015-09-01
Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.
IPR 107 – Dwarf arabic coffee cultivar with resistance to coffee leaf rust
Directory of Open Access Journals (Sweden)
Tumoru Sera
2013-01-01
Full Text Available ‘IPR 107’ was derived from a cross between ‘IAPAR 59’ and ‘Mundo Novo IAC 376-4’. ‘IPR 107’ is a dwarf medium sizeplant with medium precocity in ripening and with complete resistance to rust races in this time. This cultivar presents superior qualityand high yield in many coffee regions.
Stewart, I. T.; Bacon, C. M.; Sundstrom, W.
2015-12-01
Smallholder farmers in Nicaragua and throughout much of Central America preserve forest biodiversity and contribute to the sustainable production of coffee and other crops while, paradoxically, they themselves must cope with recurring periods of seasonal hunger. Smallholder food and water security in the region is affected by hurricanes, periodic drought events, climatic changes, an on-going outbreak of the coffee leaf rust, and fluctuations in food prices. Using regression analysis, our research examines what factors strengthened resilience to these hazards at the household level over the 1981 - 2014 time period. To this end, we integrate qualitative research on coping responses and local institutions, a participatory survey of 368 households, and an analysis of hydro-climatic data. Our results indicate that coping responses to the coffee leaf rust outbreak and the 2014 drought are comparable in severity to those used to endure Hurricane Mitch in 1998, and a severe 2009 drought. Higher smallholder resilience to stresses affecting food and water security is associated with larger farms, off-farm employment, more on-farm food production, higher numbers of fruit trees, and greater coffee harvests. Households that reported more severe coping responses to hazards earlier in the study period tended to be more strongly impacted by later hazards and reported generally greater seasonal hunger. Affiliation with local farmer-to-farmer institutions prioritizing either subsistence-oriented production or sales to international fair-trade markets did not correlate strongly with coping responses; however, subsistence-oriented institutions promote several resilience-enhancing practices. Lessons learned by adapting to past hazards may be used to develop adaptation and mitigation strategies for smallholders under continued climate variability and change.
Modelling coffee leaf rust risk in Colombia with climate reanalysis data.
Bebber, Daniel P; Castillo, Ángela Delgado; Gurr, Sarah J
2016-12-05
Many fungal plant diseases are strongly controlled by weather, and global climate change is thus likely to have affected fungal pathogen distributions and impacts. Modelling the response of plant diseases to climate change is hampered by the difficulty of estimating pathogen-relevant microclimatic variables from standard meteorological data. The availability of increasingly sophisticated high-resolution climate reanalyses may help overcome this challenge. We illustrate the use of climate reanalyses by testing the hypothesis that climate change increased the likelihood of the 2008-2011 outbreak of Coffee Leaf Rust (CLR, Hemileia vastatrix) in Colombia. We develop a model of germination and infection risk, and drive this model using estimates of leaf wetness duration and canopy temperature from the Japanese 55-Year Reanalysis (JRA-55). We model germination and infection as Weibull functions with different temperature optima, based upon existing experimental data. We find no evidence for an overall trend in disease risk in coffee-growing regions of Colombia from 1990 to 2015, therefore, we reject the climate change hypothesis. There was a significant elevation in predicted CLR infection risk from 2008 to 2011 compared with other years. JRA-55 data suggest a decrease in canopy surface water after 2008, which may have helped terminate the outbreak. The spatial resolution and accuracy of climate reanalyses are continually improving, increasing their utility for biological modelling. Confronting disease models with data requires not only accurate climate data, but also disease observations at high spatio-temporal resolution. Investment in monitoring, storage and accessibility of plant disease observation data are needed to match the quality of the climate data now available.This article is part of the themed issue 'Tackling emerging fungal threats to animal health, food security and ecosystem resilience'. © 2016 The Authors.
Weather and Climate Indicators for Coffee Rust Disease
Georgiou, S.; Imbach, P. A.; Avelino, J.; Anzueto, F.; del Carmen Calderón, G.
2014-12-01
Coffee rust is a disease that has significant impacts on the livelihoods of those who are dependent on the Central American coffee sector. Our investigation has focussed on the weather and climate indicators that favoured the high incidence of coffee rust disease in Central America in 2012 by assessing daily temperature and precipitation data available from 81 weather stations in the INSIVUMEH and ANACAFE networks located in Guatemala. The temperature data were interpolated to determine the corresponding daily data at 1250 farms located across Guatemala, between 400 and 1800 m elevation. Additionally, CHIRPS five day (pentad) data has been used to assess the anomalies between the 2012 and the climatological average precipitation data at farm locations. The weather conditions in 2012 displayed considerable variations from the climatological data. In general the minimum daily temperatures were higher than the corresponding climatology while the maximum temperatures were lower. As a result, the daily diurnal temperature range was generally lower than the corresponding climatological range, leading to an increased number of days where the temperatures fell within the optimal range for either influencing the susceptibility of the coffee plants to coffee rust development during the dry season, or for the development of lesions on the coffee leaves during the wet season. The coffee rust latency period was probably shortened as a result, and farms at high altitudes were impacted due to these increases in minimum temperature. Factors taken into consideration in developing indicators for coffee rust development include: the diurnal temperature range, altitude, the environmental lapse rate and the phenology. We will present the results of our study and discuss the potential for each of the derived weather and climatological indicators to be used within risk assessments and to eventually be considered for use within an early warning system for coffee rust disease.
Climate change impacts on coffee rust disease
Alfonsi, W. M. V.; Koga-Vicente, A.; Pinto, H. S.; Alfonsi, E. L., Sr.; Coltri, P. P.; Zullo, J., Jr.; Patricio, F. R.; Avila, A. M. H. D.; Gonçalves, R. R. D. V.
2016-12-01
Changes in climate conditions and in extreme weather events may affect the food security due to impacts in agricultural production. Despite several researches have been assessed the impacts of extremes in yield crops in climate change scenarios, there is the need to consider the effects in pests and diseases which increase losses in the sector. Coffee Arabica is an important commodity in world and plays a key role in Brazilian agricultural exports. Although the coffee crop has a world highlight, its yield is affected by several factors abiotic or biotic. The weather as well pests and diseases directly influence the development and coffee crop yield. These problems may cause serious damage with significant economic impacts. The coffee rust, caused by the fungus Hemileia vastarix,is among the diseases of greatest impact for the crop. The disease emerged in Brazil in the 70s and is widely spread in all producing regions of coffee in Brazil, and in the world. Regions with favorable weather conditions for the pathogen may exhibit losses ranging from 30% to 50% of the total grain production. The evaluation of extreme weather events of coffee rust disease in futures scenarios was carried out using the climatic data from CMIP5 models, data field of coffee rust disease incidence and, incubation period simulation data for Brazilian municipalities. Two Regional Climate Models were selected, Eta-HadGEM2-ES and Eta-MIROC5, and the Representative Concentration Pathways 8.5 w/m2 was adopted. The outcomes pointed out that in these scenarios the period of incubation tends to decrease affecting the coffee rust disease incidence, which tends to increase. Nevertheless, the changing in average trends tends to benefit the reproduction of the pathogen. Once the temperature threshold for the disease reaches the adverse conditions it may be unfavorable for the incidence.
Directory of Open Access Journals (Sweden)
Humberto Franco Shiomi
2006-02-01
Full Text Available Suppression of plant diseases due to the action of endophytic microorganisms has been demonstrated in several pathosystems. Experiments under controlled conditions involving endophytic bacteria isolated from leaves and branches of Coffea arabica L and Coffea robusta L were conducted with the objective of evaluating the inhibition of germination of Hemileia vastatrix Berk. & Br., race II, urediniospores and the control of coffee leaf rust development in tests with leaf discs, detached leaves, and on potted seedling of cv. Mundo Novo. The endophytic bacterial isolates tested proved to be effective in inhibiting urediniospore germination and/or rust development, with values above 50%, although the results obtained in urediniospore germination tests were inferior to the treatment with fungicide propiconazole. Endophytic isolates TG4-Ia, TF2-IIc, TF9-Ia, TG11-IIa, and TF7-IIa, demonstrated better coffee leaf rust control in leaf discs, detached leaves, and coffee plant tests. The endophytic isolates TG4-Ia and TF9-Ia were identified as Bacillus lentimorbus Dutky and Bacillus cereus Frank. & Frank., respectively. Some endophytic bacterial isolates were effective in controlling the coffee leaf rust, although some increased the severity of the disease. Even though a relatively small number of endophytic bacteria were tested, promising results were obtained regarding the efficiency of coffee leaf rust biocontrol. These selected agents appears to be an alternative for future replacement of chemical fungicide.Supressão de doenças de plantas por microrganismos endofíticos tem sido demonstrada em diversos patossistemas. Neste trabalho foram selecionados isolados de bactérias endofíticas de folhas e ramos de cafeeiro com potencial para o controle biológico da ferrugem do cafeeiro, pois é conhecido que esses microrganismos podem possuir essa característica. Bactérias endofíticas isoladas previamente de folhas e ramos de Coffea arabica L e Coffea
Vacacela Ajila, Henry E; Ferreira, João A M; Colares, Felipe; Oliveira, Cleber M; Bernardo, Ana Maria G; Venzon, Madelaine; Pallini, Angelo
2018-01-01
Ricoseius loxocheles (De Leon) (Acari: Phytoseiidae) is often found in coffee crops and is known to feed on coffee leaf rust, Hemileia vastatrix Berkeley and Broome (Uredinales). As the occurrence of coffee leaf rust is limited primarily to the rainy season, the mite may use other food sources to survive during the periods of low pathogen prevalence. It is well known that phytoseiid mites can survive on a variety of food sources, such as herbivorous mites, fungi and pollen. We evaluated the ability of R. loxocheles to survive and reproduce on a diet of Brevipalpus phoenicis Geijskes (Acari: Tenuipalpidae), cattail pollen (Typha spp.), clover rust (Puccinia oxalidis), bee pollen (Santa Bárbara ® dehydrated pollen, Santa Bárbara, MG, Brazil) and coffee leaf rust. Ricoseius loxocheles did not survive or reproduce on any B. phoenicis stages tested (egg, larva, adult). The survival and oviposition of R. loxocheles were directly affected by the presence of coffee rust urediniospores, but not by the presence of the prey. Survival and oviposition of the phytoseiid were similar when fed cattail pollen, clover rust and coffee leaf rust but was lower when fed bee pollen. Our results show that R. loxocheles is not a predator of B. phoenicis but it is able to utilize other resources besides coffee leaf rust.
Directory of Open Access Journals (Sweden)
Celso Henrique Costa Conceição
2005-01-01
Full Text Available A intensidade de infestação pelo bicho-mineiro, Leucoptera coffeella (Guérin-Méneville (Lepidoptera: Lyonetiidae foi investigada nas cultivares Obatã IAC 1669-20 e Tupi IAC 1669-33, com resistência à ferrugem das folhas do cafeeiro, Hemileia vastatrix Berk. et Br., e Ouro Verde Amarelo IAC 4397, suscetível à doença, em ensaios de campo, localizados em Campinas (SP, Brasil. A incidência de ferrugem e a ocorrência de inimigos naturais da praga, assim como o enfolhamento das plantas, foram também observados nas três cultivares. As curvas de flutuação populacional obtidas para Obatã IAC 1669-20 e Tupi IAC 1669-33 revelaram maior incidência do bicho-mineiro entre abril e novembro. Já na cultivar Ouro Verde Amarelo IAC 4397, observaram-se dois picos de infestação, sendo o primeiro em abril-maio e o segundo em agosto-setembro. No entanto, a elevada percentagem de folhas minadas nas cultivares Tupi IAC 1669-33 e Obatã IAC 1669-20 em relação à Ouro Verde Amarelo IAC 4397 não é evidência de maior suscetibilidade à praga, mas sim devido à maior retenção foliar dessas cultivares, em conseqüência da resistência à ferrugem das folhas observada em ambas. De maneira oposta, na cultivar Ouro Verde Amarelo IAC 4397, os sintomas de ataque do bicho-mineiro ocorreram em menor nível especialmente devido a maior queda de folhas. Com base nas diferenças observadas entre as cultivares, sugere-se a adoção de estratégias distintas de manejo da praga.The intensity of infestation of leaf-miner, Leucoptera coffeella (Guérin-Méneville was investigated in coffee cultivars Obatã IAC 1669-20 and Tupi IAC 1669-33, both resistant to the leaf rust agent, Hemileia vastatrix Berk. et Br., and Ouro Verde Amarelo IAC 4397, susceptible to this coffee disease, at field assays in Campinas, SP, Brazil. The incidence of coffee rust and presence of natural enemies, as well as the plant leafiness, were also observed. In Obatã IAC 1669-20 and Tupi
de Sousa, Leandro Pio de; da Silva, Marcio José da; Mondego, Jorge Maurício
2018-05-17
Coffee is one of the most valuable agricultural commodities and the plants' leaves are the primary site of infection for most coffee diseases, such as the devastating coffee leaf rust. Therefore, the use of bacterial microbiota that inhabits coffee leaves to fight infections could be an alternative agricultural method to protect against coffee diseases. Here, we report the leaf-associated bacteria in three coffee genotypes over the course of a year, with the aim to determine the diversity of bacterial microbiota. The results indicate a prevalence of Enterobacteriales in Coffea canephora, Pseudomonadales in C. arabica 'Obatã', and an intriguing lack of bacterial dominance in C. arabica 'Catuaí'. Using PERMANOVA analyses, we assessed the association between bacterial abundance in the coffee genotypes and environmental parameters such as temperature, precipitation, and mineral nutrients in the leaves. We detected a close relationship between the amount of Mn and the abundance of Pseudomonadales in 'Obatã' and the amount of Ca and the abundance of Enterobacteriales in C. canephora. We suggest that mineral nutrients can be key drivers that shape leaf microbial communities.
Directory of Open Access Journals (Sweden)
Pedro eTalhinhas
2014-03-01
Full Text Available Hemileia vastatrix is the causal agent of coffee leaf rust, the most important disease of coffee (Coffea arabica. In this work, a 454-pyrosequencing transcriptome analysis of H. vastatrix germinating urediniospores (gU and appressoria (Ap was performed and compared to previously published in planta haustoria-rich (H data. A total of 9234 transcripts were identified and annotated. Ca. 50% of these transcripts showed no significant homology to international databases. Only 784 sequences were shared by the three conditions, and 75% were exclusive of either gU (2146, Ap (1479 or H (3270. Relative transcript abundance and RT-qPCR analyses for a selection of genes indicated a particularly active metabolism, translational activity and production of new structures in the appressoria and intense signalling, transport, secretory activity and cellular multiplication in the germinating urediniospores, suggesting the onset of a plant-fungus dialogue as early as at the germ tube stage. Gene expression related to the production of carbohydrate-active enzymes and accumulation of glycerol in germinating urediniospores and appressoria suggests that combined lytic and physical mechanisms are involved in appressoria-mediated penetration. Besides contributing to the characterisation of molecular processes leading to appressoria-mediated infection by rust fungi, these results point towards the identification of new H. vastatrix candidate virulence factors, with 516 genes predicted to encode secreted proteins.
Directory of Open Access Journals (Sweden)
Leandro Pio de Sousa
2018-05-01
Full Text Available Abstract Coffee is one of the most valuable agricultural commodities and the plants’ leaves are the primary site of infection for most coffee diseases, such as the devastating coffee leaf rust. Therefore, the use of bacterial microbiota that inhabits coffee leaves to fight infections could be an alternative agricultural method to protect against coffee diseases. Here, we report the leaf-associated bacteria in three coffee genotypes over the course of a year, with the aim to determine the diversity of bacterial microbiota. The results indicate a prevalence of Enterobacteriales in Coffea canephora, Pseudomonadales in C. arabica ‘Obatã’, and an intriguing lack of bacterial dominance in C. arabica ‘Catuaí’. Using PERMANOVA analyses, we assessed the association between bacterial abundance in the coffee genotypes and environmental parameters such as temperature, precipitation, and mineral nutrients in the leaves. We detected a close relationship between the amount of Mn and the abundance of Pseudomonadales in ‘Obatã’ and the amount of Ca and the abundance of Enterobacteriales in C. canephora. We suggest that mineral nutrients can be key drivers that shape leaf microbial communities.
Leaf rust of cultivated barley: pathology and control.
Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder
2015-01-01
Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.
Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S
2014-11-01
In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and
Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis
2017-12-01
Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.
Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...
Directory of Open Access Journals (Sweden)
Marco Aurelio Cristancho
2014-10-01
Full Text Available Coffee leaf rust caused by the fungus Hemileia vastatrix is the most damaging disease to coffee worldwide. The pathogen has recently appeared in multiple outbreaks in coffee producing countries resulting in significant yield losses and increases in costs related to its control. New races/isolates are constantly emerging as evidenced by the presence of the fungus in plants that were previously resistant. Genomic studies are opening new avenues for the study of the evolution of pathogens, the detailed description of plant-pathogen interactions and the development of molecular techniques for the identification of individual isolates. For this purpose we sequenced 8 different H. vastatrix isolates using NGS technologies and gathered partial genome assemblies due to the large repetitive content in the coffee rust hybrid genome; 74.4% of the assembled contigs harbor repetitive sequences. A hybrid assembly of 333Mb was built based on the 8 isolates; this assembly was used for subsequent analyses.Analysis of the conserved gene space showed that the hybrid H. vastatrix genome, though highly fragmented, had a satisfactory level of completion with 91.94% of core protein-coding orthologous genes present. RNA-Seq from urediniospores was used to guide the de novo annotation of the H. vastatrix gene complement. In total, 14,445 genes organized in 3,921 families were uncovered; a considerable proportion of the predicted proteins (73.8% were homologous to other Pucciniales species genomes. Several gene families related to the fungal lifestyle were identified, particularly 483 predicted secreted proteins that represent candidate effector genes and will provide interesting hints to decipher virulence in the coffee rust fungus. The genome sequence of Hva will serve as a template to understand the molecular mechanisms used by this fungus to attack the coffee plant, to study the diversity of this species and for the development of molecular markers to distinguish
Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.
Tsilo, Toi J; Kolmer, James A; Anderson, James A
2014-08-01
Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.
Hajian-Forooshani, Zachary; Rivera Salinas, Iris Saraeny; Jiménez-Soto, Estelí; Perfecto, Ivette; Vandermeer, John
2016-12-01
Recent theoretical work suggests that two ineffective control agents can provide effective biological control when coupled together. We explore the implications of this work with the system of coffee leaf rust (CLR), caused by the fungal agent Hemileiae vastatrix, and two of its natural enemies, a fungal pathogen (Lecanicillium lecanii) and a spore predator (Mycodiplosis hemileiae). Here we report on comparative surveys of the CLR and its two natural enemies in Mexico, where the CLR has been at epidemic status since 2012, and Puerto Rico, where the CLR is present but has not reached epidemic densities. We found that the densities of the two control agents per CLR lesion is higher in Puerto Rico than in Mexico, and we hypothesize that their joint presence at higher densities is contributing to the suppression of the CLR in Puerto Rico but not in Mexico. Furthermore, we found that the presence of Azteca sericeasur, a keystone ant species that occurs in Mexico but not Puerto Rico, significantly reduces the prevalence of M. hemileiae on coffee plants. Our work provides data that allows us to hypothesize that the joint presence of these two control agents may potentially provide control of the CLR and also highlights the importance of regionally specific communities within agroecosystems, and how variation in community composition may lead to varying outcomes for biological control. Additionally, this is the first report of the presence of a potentially important biological control agent, M. hemileiae, in Latin America and the Caribbean. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Effectiveness of carboxylic acids from Pichia membranifaciens against coffee rust
Directory of Open Access Journals (Sweden)
Rosa Laura Andrade Melchor
Full Text Available ABSTRACT Coffee rust is a fungal disease that has affected every coffee-producing region in the world. Given that the effectivity of the protectant and systemic fungicides applied routinely to control the spread of the causative agent of the disease (Hemileia vastatrix has gradually diminished, besides are harmful to mammals and ecosystems, the objective of this work was to search for a mixture of harmless natural compounds with the potential to be applied in the field. So, a yeast strain producing a battery of long-chain carboxylic acids (CA with fungicide properties was isolated from soil of coffee crop and identified as Pichia membranifaciens by ITS sequencing. Culture conditions of the yeast were optimized and the CA in the solution were characterized by Gas Chromatography-Mass Spectrometry (GC-MS as ethyl formate (55.5 g L-1, octadecenoic acid (3.5 g L-1, propionic acid (7.2 g L-1, 3-(octadecanoyl-propionic acid (7.2 g L-1 and methyl acetate (8.4 g L-1. Randomized field studies were conducted in three different locations in Chiapas, México. Five treatments were tested including three concentrations of the CA solution (389, 584 and 778 ppm and copper oxychloride (5 000 ppm as conventional control. The initial coffee rust incidence averages varied between sites: Maravillas (3-9%, Santo Domingo (10-16% and Búcaro (16-22%. The treatments of CA solution proved to be effective at slowing down the progress of the rust disease even for the sites where initial incidence was high. Likewise, the CA solution reduced the viability of H. vastatrix spores, as assessed by fluorescence microscopy.
Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...
African Journals Online (AJOL)
Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...
Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann
2014-09-01
We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.
Induced mutations for resistance to leaf rust in wheat
International Nuclear Information System (INIS)
Borojevic, K.
1983-01-01
Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)
International Nuclear Information System (INIS)
Khan, M.A.; Haider, M.M.; Hussain, M.; Ahmad, S.
2007-01-01
Wheat genotypes were screened against leaf rust to evaluate slow rusting response. Among one hundred and sixty varieties/lines, 86 showed response to leaf rust while all other remained immune or showed no response. The slow rusting, wheat varieties/ lines displayed 20-40% severity level and these were Maxi-Pak65, Blue silver, Pothohar, Punjab81, Faisalabd-83, Shalimar-88, Kohnoor-83, Pasban-90, Inqilab-91, Uqab-99-94105, Punjab-76, Parwaz-94, HD2169, HD2179, HD2204, HD2285, Lr27+31, LrB, LR17, Lr14A, Lr15 and Yr1-E-1 while the fast rusting varieties/lines that showed severity level up to 90% were WL-711, Morocco, PAK-1, Punjab-85 and Chakwal-86 SA42, SA75, Lr1, Lr2A, Lr2B. Lr23, Lr3KA, Lr3g, Lr10, Lr18, Lr21, Lr24, Yr2-E35 and 95153 respectively. Slow rusting genotypes exhibited low AUDPC (200-400) values while fast rusters displayed high AUDPC (400-1500) values. Leaf rust severity displayed significant correlation with maximum and minimum temperatures, rainfall and sunshine radiation. It was observed that with an increase of these environmental conditions a significant increase in disease severity was recorded
Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank
2018-01-01
The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.
International Nuclear Information System (INIS)
Sohail, Y.
2015-01-01
Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)
Crop protection strategies for major diseases of cocoa, coffee and ...
African Journals Online (AJOL)
In Nigeria, crop protection measures that are cheap, simple, cost-effective and sustainable are desirable to combat Phytophthora pod rot (black pod) and cocoa swollen shoot virus diseases of cocoa, coffee leaf rust and coffee berry diseases, inflorescence blight disease of cashew in order to make farming profitable and ...
Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus
2018-01-01
The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232
Directory of Open Access Journals (Sweden)
Thomas Vatter
Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.
Gortari, Fermín; Guiamet, Juan José; Graciano, Corina
2018-01-23
Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen
2016-12-01
A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.
Studies on stem and leaf rust resistance in wheat
International Nuclear Information System (INIS)
Knott, D.R.
1983-01-01
Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)
Leaf and stripe rust resistance among Ethiopian grown wheat ...
African Journals Online (AJOL)
The result indicated that 20 varieties and lines harbor resistance to the leaf rust and 26 to the stripe rust pathotypes showing infection types <2+. Twelve bread wheat varieties and lines (Et-13 A2, HAR 1407 [Tusie], HAR 1775 [Tura], HAR 1920, HAR 2192, HAR 2534, HAR 2536, HAR 2561, HAR 2563 and three durum lines ...
Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P
2015-03-01
Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.
Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis
2016-11-01
Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.
Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J
2014-06-01
Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.
Genetics and mapping of a new leaf rust resistance gene in Triticum ...
Indian Academy of Sciences (India)
Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...
Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S
2018-02-01
Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.
Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang
2016-01-01
It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464
Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang
2016-01-01
It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.
Introgression of a leaf rust resistance gene from Aegilops caudata to ...
Indian Academy of Sciences (India)
tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.
Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...
Indian Academy of Sciences (India)
Mona Singh
2017-12-08
Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.
Directory of Open Access Journals (Sweden)
Retno Hulupi
2012-08-01
Full Text Available One of the major diseases which limiting production in arabica coffee is the leaf rust caused by the fungus Hemileia vastatrix, B et Br. Selection and testing on thirteen promising arabica coffee clones were carried out at endemic area for leaf rust disease, Andungsari Research Station, for six fruiting times. The aims of these test were to find out superior planting material as clone with genetic resistance to leaf rust. As the beverage commodities, criterium selections for superiority clone besides resistant to leaf rust and yielding ability of more than 1,5 ton/ha also must be excellent in cup quality. Under this consideration, BP 416 A clone showed as the best high yielding ability i.e. 1,595 kg/ha and stable, besides resistant to leaf rust disease compared to the other clones tested. This clone had good cup quality, better than earlier released variety such as USDA 762 and S 795 although was not better than Andungsari 1 that were planted in the same location. The best physical bean characteristics was obtained on BP 513 A clone wich is derived from S 795 x Caturra red, having 89.2% of normal bean and 18.3% outurn characteristics. However, due to lower yielding and more susceptible to leaf rust, this clone could not be classified as superior clone.
Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster
Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...
Localising QTLs for leaf rust resistance and agronomic traits in barley (¤Hordeum vulgare¤ L.)
DEFF Research Database (Denmark)
Kicherer, S.; Backes, G.; Walther, U.
2000-01-01
to leaf rust by means of artificial infection, heading date, plant height and Kernel weight were assessed. For leaf rust resistance, 4 QTLs were localised, that explained 96.1% of the genetic variation. One QTL on chromosome 4H confirmed a position found in another genetic background and one mapped...
Directory of Open Access Journals (Sweden)
Florisvalda da Silva Santos
2008-07-01
spot and coffee rust was obtained by CP treatment (respectively 62 and 38% higher to control. The larger progress coincided with the increase in leaf potassium and decrease of calcium content in CP, compared to other nutrient sources, and it resulted in higher leaf drop and lower yield. CP+CBP and CP+SW reduced in 38% the brown eye spot incidence, and in 31 and 21%, respectively, the coffee rust incidence, and increased leaf calcium content during fruit filling, compared to CP. The better nutritional status of plants increased resistance to diseases and reduced the variation between 2004 and 2005 harvests.
Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...
Indian Academy of Sciences (India)
Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...
Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta
2016-11-01
A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.
Induced resistance and gene expression in wheat against leaf rust ...
African Journals Online (AJOL)
uvp
2013-05-15
May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.
Comparison of multi- and hyperspectral imaging data of leaf rust infected wheat plants
Franke, Jonas; Menz, Gunter; Oerke, Erich-Christian; Rascher, Uwe
2005-10-01
In the context of precision agriculture, several recent studies have focused on detecting crop stress caused by pathogenic fungi. For this purpose, several sensor systems have been used to develop in-field-detection systems or to test possible applications of remote sensing. The objective of this research was to evaluate the potential of different sensor systems for multitemporal monitoring of leaf rust (puccinia recondita) infected wheat crops, with the aim of early detection of infected stands. A comparison between a hyperspectral (120 spectral bands) and a multispectral (3 spectral bands) imaging system shows the benefits and limitations of each approach. Reflectance data of leaf rust infected and fungicide treated control wheat stand boxes (1sqm each) were collected before and until 17 days after inoculation. Plants were grown under controlled conditions in the greenhouse and measurements were taken under consistent illumination conditions. The results of mixture tuned matched filtering analysis showed the suitability of hyperspectral data for early discrimination of leaf rust infected wheat crops due to their higher spectral sensitivity. Five days after inoculation leaf rust infected leaves were detected, although only slight visual symptoms appeared. A clear discrimination between infected and control stands was possible. Multispectral data showed a higher sensitivity to external factors like illumination conditions, causing poor classification accuracy. Nevertheless, if these factors could get under control, even multispectral data may serve a good indicator for infection severity.
Scalon, João Domingos; Universidade Federal de Lavras; Freitas, Gabriela Alves; DEX/UFLA; Avelar, Maria Betania Lopes; DEX/UFLA; Zacarias, Mauricio Sérgio; EPAMIG/EcoCentro
2011-01-01
Coffee production has been one of the economy pillars of many tropical countries. Unfortunately, this crop is susceptible to infestation by the coffee-leaf-miner (Leucoptera coffeella (Guérin-Mèneville & Perrottet, 1842)) which causes severe damage to coffee plantations with losses that may reach 80% of the total production. In recent years, researchers have been trying to develop practices for minimizing the use of pesticides in the coffee-leaf-miner control. It is well known that the un...
Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman
2018-04-25
A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.
International Nuclear Information System (INIS)
Moreno Ruiz, German
2004-01-01
With the purpose of producing improved coffee varieties with resistance to the leaf rust (Hemileia vastatrix), the national federation of coffee growers of Colombia initiated in 1970 a research program, whose first results achieved in 1982 were the abstention of the Colombia coffee variety. The use of genetic variability as a strategy in plant breeding for a durable resistance is discussed. In addition, the breeding outline is described and the main features of the developed materials are presented
Directory of Open Access Journals (Sweden)
Albert Kertho
Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.
Brazil, was noted to have long lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat...
Directory of Open Access Journals (Sweden)
Yi Dai
2017-05-01
Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.
Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin
2017-01-01
Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.
Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat
Anker, C.C.
2001-01-01
In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the
Anonymous,
1986-01-01
This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust
Anonymous
1986-01-01
This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust (P. recondita).
Genetics and mapping of a new leaf rust resistance gene in Triticum ...
Indian Academy of Sciences (India)
AMIT KUMAR SINGH
seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single ... closely or distantly related species of wheat (McIntosh et al. 2013 ... An effort was also made to determine the chromo- ... Materials and methods.
Directory of Open Access Journals (Sweden)
Alexandre Sandri Capucho
2009-03-01
Full Text Available O objetivo deste trabalho foi caracterizar a herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro (Hemileia vastatrix. Para isso, a raça II e o patótipo 001 de ferrugem foram inoculados em 246 plantas da população F2, 115 plantas do retrocruzamento suscetível (RC S e 87 plantas do retrocruzamento resistente (RC R, originadas do cruzamento entre o genótipo suscetível cv. Catuaí Amarelo IAC 64 e a fonte de resistência Híbrido de Timor UFV 443-03. Para ambos os inóculos, a cv. Catuaí Amarelo IAC 64 foi suscetível, enquanto o Híbrido de Timor UFV 443-03, a planta representante da geração F1 e as plantas do RC R foram resistentes. As plantas F2, quando inoculadas com a raça II, apresentaram dois padrões de segregação significativos: 15:1 e 61:3. A herança da resistência foi confirmada pela inoculação das plantas do RC S, que segregaram na proporção de 3:1, padrão esperado para herança condicionada por dois genes. A hipótese de segregação 7:1 para três genes foi rejeitada. Resultados semelhantes foram obtidos para o patótipo 001. Dois genes dominantes e independentes conferem a resistência genética do Híbrido de Timor UFV 443-03 à raça II e ao patótipo 001 de H. vastatrix.The aim of this work was to characterize the resistance inheritance of the Timor Hybrid UFV 443-03 to coffee leaf rust (Hemileia vastatrix. For this, the race II and pathotype 001 of coffee leaf rust were inoculated in 246 F2 plants, 115 susceptible backcrossing (BCS plants, and 87 resistant backcrossing (BC R plants, derived from the crossing between the susceptible genotype 'Catuaí Amarelo' IAC 64 and the resistance source Timor Hybrid UFV 443-03. For both inoculums, the 'Catuaí Amarelo' IAC 64 was susceptible, while the Timor Hybrid, the plant representing F1 generation, and the BC R plants were resistant. The F2 plants inoculated with race II presented two significant segregation ratios: 15:1 and 61:3. The
Genetics and mapping of a new leaf rust resistance gene in Triticum ...
Indian Academy of Sciences (India)
AMIT KUMAR SINGH
Selection G12 carries a new gene for leaf rust resistance, tentatively named as LrSelG12. [Singh A. K. ..... long arm of chromosome 3B were found to be polymor- phic between ... due to the evolution of new virulent races in India (Tomar et al.
Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...
Directory of Open Access Journals (Sweden)
Doug William Jackson
2012-08-01
Full Text Available The fungus Lecanicillium lecanii attacks the green scale (Coccus viridis, a pest of coffee, and is also a hyperparasite of coffee rust (Hemileia vastatrix. Knowledge of the epizootiology of this fungus is potentially important for conservation biological control in coffee agroecosystems. The presence of viable propagules of L. lecanii in the soil, a possible environmental reservoir, was assessed using two baiting methods: the standard Galleria mellonella bait method and a C. viridis bait method. Infectious propagules of L. lecanii were detected in soil samples taken from a 45 ha study plot, both nearby and far from recent epizootics of L. lecanii. To test the potential for the transmission of L. lecanii conidia from the soil via rain splash or wind, coffee seedlings with populations of C. viridis were placed near L. lecanii-inoculated soil and then subjected to artificial rain and wind treatments. Rain splash was shown to be a potential transmission mechanism. Dispersal of L. lecanii conidia by the ant Azteca instabilis was tested using field and laboratory ant-exclusion experiments. Azteca instabilis was shown to transport conidia of L. lecanii; however, dispersal by A. instabilis may not be important under field conditions.
Genetics and mapping of a new leaf rust resistance gene in Triticum ...
Indian Academy of Sciences (India)
A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen, Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant stages.
Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal
2017-01-01
Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust
Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi
2018-01-01
Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in
Gaya Hidup Minum Kopi Konsumen Di the Coffee Bean & Tea Leaf Plasa Tunjungan Surabaya
suisa, Kelvianto; febrilia, veronica; santoso, thomas
2014-01-01
Penelitian ini bertujuan untuk mengetahui gaya hidup minum kopi konsumen di The Coffee Bean & Tea Leaf Plasa Tunjungan Surabaya. Penelitian ini menggunakan analisis deskriptif kuantitatif terhadap 100 responden sebagai sampel. Berdasarkan hasil penelitian menunjukkan bahwa gaya hidup minum kopi konsumen di The Coffee Bean & Tea Leaf Plasa Tunjungan Surabaya didominasi oleh responden berjenis kelamin laki-laki, berusia 21-30 tahun, mempunyai pendidikan terakhir diploma/S1, berprofesi s...
First report of leaf rust of blueberry caused by Thekopsora minima in Mexico
Blueberry (Vaccinium corymbosum L.) is becoming an important crop in the states of Jalisco and Michoacan in Mexico. As the area under blueberry cultivation increases, new diseases causing severe losses are appearing. Leaf rust is one of the most destructive diseases of blueberry in Mexico. Sori on t...
Echeverria-Beirute, Fabian; Murray, Seth C; Klein, Patricia; Kerth, Chris; Miller, Rhonda; Bertrand, Benoit
2018-05-30
Beverage quality is a complex attribute of coffee ( Coffea arabica L.). Genotype (G), environment (E), management (M), postharvest processing, and roasting are all involved. However, little is known about how G × M interactions influence beverage quality. We investigated how yield and coffee leaf rust (CLR) disease (caused by Hemileia vastatrix Berk. et Br.) management affect cup quality and plant performance, in two coffee cultivars. Sensory and chemical analyses revealed that 10 of 70 attributes and 18 of 154 chemical volatile compounds were significantly affected by G and M. Remarkably, acetaminophen was found for the first time in roasted coffee and in higher concentrations under more stressful conditions. A principal component analysis described 87% of the variation in quality and plant overall performance. This study is a first step in understanding the complexity of the physiological, metabolic, and molecular changes in coffee production, which will be useful for the improvement of coffee cultivars.
Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K
2017-12-01
Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.
Influência do zinco na incidência de doenças do cafeeiro Zinc influence on coffee diseases
Directory of Open Access Journals (Sweden)
Vicente Luiz de Carvalho
2008-06-01
Full Text Available Em cafeeiros, poucos estudos foram feitos relacionando aumento ou diminuição da resistência das plantas às doenças, com alteração dos níveis de nutrientes utilizados. Com este trabalho, objetivou-se estudar os efeitos do sulfato de zinco aplicado isoladamente, e associado com fungicidas e cloreto de potássio sobre a ferrugem, cercosporiose e manchas foliares do cafeeiro. O trabalho foi desenvolvido em uma lavoura de café em produção, onde foram testados oxicloreto de cobre, tebuconazole, sulfato de zinco + cloreto de potássio e sulfato de zinco e nas subparcelas foram realizadas diferentes concentrações de sulfato de zinco: ausência, 0,3 %, 0,6 % e 1,2 %. Verificou-se que os tratamentos com oxicloreto de cobre e tebuconazole reduziram a incidência e severidade de ferrugem, a incidência de cercosporiose, de manchas foliares (phoma e ascochyta e a desfolha, independente das concentrações de sulfato de zinco utilizadas. Concentrações de sulfato de zinco na faixa de 0,6 % - 0,75 % apresentaram menor severidade da ferrugem e o aumento nas concentrações de sulfato de zinco aumentou a incidência de cercosporiose, manchas foliares e a desfolha dos cafeeiros.The are few studies have been done related to the increase or decrease of disease resistance in coffee plants, with alteration from plant nutrient levels. The ain of this work was to verify the effect of zinc sulfate, applied either alone or in association with fungicides, and the effect of potassium chloride on coffee leaf rust, brown-eyes and leaf stains in coffee plants. Copper oxichloride, tebuconazole, sulfate of zinc + potassium chloride and sulfate of zinc were applied on plots and concentrations of zinc sulfate (0,0 %, 0,3 %, 0,6 % and 1,2 % were applied on sub plot. Treatments with copper and tebuconazole reduced the incidence and severity of rust, the incidence of brown-eyes and stains leaf (phoma and ascochyta and the defoliate independent of the zinc sulfate
Determination of rust resistance genes in pakistani bread wheats
International Nuclear Information System (INIS)
Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.
2014-01-01
Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)
Dutta, Summi; Kumar, Dhananjay; Jha, Shailendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal
2017-11-01
A novel leaf rust responsive ta-siRNA-producing locus was identified in wheat showing similarity to 28S rRNA and generated four differentially expressing ta-siRNAs by phasing which targeted stress responsive genes. Trans-acting-small interfering RNAs (Ta-siRNAs) are plant specific molecules generally involved in development and are also stress responsive. Ta-siRNAs identified in wheat till date are all responsive to abiotic stress only. Wheat cultivation is severely affected by rusts and leaf rust particularly affects grain filling. This study reports a novel ta-siRNA producing locus (TAS) in wheat which is a segment of 28S ribosomal RNA but shows differential expression during leaf rust infestation. Four small RNA libraries prepared from wheat Near Isogenic Lines were treated with leaf rust pathogen and compared with untreated controls. A TAS with the ability to generate four ta-siRNAs by phasing events was identified along with the microRNA TamiR16 as the phase initiator. The targets of the ta-siRNAs included α-gliadin, leucine rich repeat, trans-membrane proteins, glutathione-S-transferase, and fatty acid desaturase among others, which are either stress responsive genes or are essential for normal growth and development of plants. Expression of the TAS, its generated ta-siRNAs, and their target genes were profiled at five different time points after pathogen inoculation of susceptible and resistant wheat isolines and compared with mock-inoculated controls. Comparative analysis of expression unveiled differential and reciprocal relationship as well as discrete patterns between susceptible and resistant isolines. The expression profiles of the target genes of the identified ta-siRNAs advocate more towards effector triggered susceptibility favouring pathogenesis. The study helps in discerning the functions of wheat genes regulated by ta-siRNAs in response to leaf rust.
Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling
2018-04-19
Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.
Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip
2017-02-01
Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.
The genome sequence and effector complement of the flax rust pathogen Melampsora lini
Directory of Open Access Journals (Sweden)
Adnane eNemri
2014-03-01
Full Text Available Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp. Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimise parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analysed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote
The genome sequence and effector complement of the flax rust pathogen Melampsora lini.
Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N
2014-01-01
Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their
Molecular and genetic study of wheat rusts | Le Maitre | African ...
African Journals Online (AJOL)
Microsatellite markers were used to differentiate P. triticina and P. striiformis pathotypes. Amplified fragment length polymorphisms (AFLP) were used to differentiate stem rust P. graminis pathotypes. Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of leaf, stem and yellow rust were collected ...
Peng, Fred Y; Yang, Rong-Cai
2017-06-20
The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for
Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.
2014-01-01
Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941
Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147
International Nuclear Information System (INIS)
Reddy, V.R.K.; Viswanathan, P.
1999-01-01
By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations
Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.
Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E
2017-07-01
Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.
Directory of Open Access Journals (Sweden)
Gustavo Hiroshi Sera
2010-01-01
Full Text Available As cultivares de café IPR 99 ("Sarchimor" e IPR 107 ('IAPAR 59' x 'Mundo Novo IAC 376-4' eram no passado resistentes à ferrugem (Hemileia vastatrix. Os objetivos deste estudo foram: a Identificar progênies dessas duas cultivares com resistência à ferrugem; b Identificar progênies com resistência incompleta; c Verificar a eficiência dos cruzamentos testes na seleção dessas cultivares. A avaliação da resistência em campo foi realizada em cafeeiros adultos expostos à população local de raças presentes no IAPAR. Foram avaliados 23 cruzamentos testes com progênies F3 de 'IPR 107' e 5 com progênies F4 de 'IPR 99'. Além disso, foram avaliadas 11 progênies F4 de 'IPR 107' e 5 progênies F5 de 'IPR 99', provenientes de autofecundação. Várias progênies das cultivares IPR 99 e 107 apresentaram alta freqüência de plantas com resistência completa e são portadoras de mais genes de resistência não quebrados pelas raças de ferrugem. Progênies das cultivares IPR 99 e IPR 107 com a resistência quebrada apresentaram resistência incompleta à população local de raças. Cruzamentos testes foram eficientes na seleção de progênies de café com mais genes de resistência não quebrados.All plants of the coffee cultivars IPR 99 ("Sarchimor" and IPR 107 ('IAPAR 59' x 'Mundo Novo IAC 376-4' were resistant to rust (Hemileia vastatrix in the past. Currently, susceptible plants were observed in the two cultivars due to the breakdown of resistance by new rust races. The aims of this study were: a to identify coffee (Coffea arabica L. progenies of the two cultivars with resistance to rust; b to identify progenies with incomplete resistance; c to investigate the efficiency of test-crosses for selection from these cultivars. Evaluation for field resistance was carried out in adult plants subjected to natural infection by the local leaf rust population at IAPAR. Twenty-three test-crosses with F3 progenies of 'IPR 107' and five with F4
International Nuclear Information System (INIS)
Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.
2009-01-01
A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.
Directory of Open Access Journals (Sweden)
M. SERENIUS
2008-12-01
Full Text Available Disease infection in relation to sowing time of winter rye (Secale cereale was studied in southern Finland in order to compare overwintering capacity of modern rye varieties and to give recommendations for rye cultivation. This was done by using three sowing times and four rye varieties in field trials conducted at three locations in 19992001. The early sown rye (beginning of August was severely affected by diseases caused by Puccinia recondita and Microdochium nivale, whereas postponing sowing for two weeks after the recommended sowing time resulted in considerably less infection. The infection levels of diseases differed among rye varieties. Finnish rye varieties Anna and Bor 7068 were more resistant to snow mould and more winter hardy than the Polish variety Amilo, or the German hybrid varieties Picasso and Esprit. However, Amilo was the most resistant to leaf rust. In the first year snow mould appeared to be the primary cause of winter damage, but in the second year the winter damage was positively correlated with leaf rust. No significant correlation between frit fly infestation and winter damage or disease incidence of snow mould or leaf rust was established. The late sowing of rye (in the beginning of September is recommended in Finland, particularly with hybrid varieties, to minimize the need for chemical plant protection in autumn.;
Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie
2018-01-01
Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.
Qamar, Maqsood; Niks, R.E.
2007-01-01
Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of
Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P
2017-01-01
Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.
Weinstein, L. H.; Osmeloski, J. F.; Wettlaufer, S. H.; Galston, A. W.
1987-01-01
In higher plants, polyamines arise from arginine by one of two pathways: via ornithine and ornithine decarboxylase or via agmatine and arginine decarboxylase but in fungi, only the ornithine decarboxylase pathway is present. Since polyamines are required for normal growth of microorganisms and plants and since the ornithine pathway can be irreversibly blocked by alpha-difluoromethylornithine (DFMO) which has no effect on arginine decarboxylase, fungal infection of green plants might be controlled by the site-directed use of such a specific metabolic inhibitor. DFMO at relatively low concentrations provided effective control of the three biotrophic fungal pathogens studied, Puccinia recondita (leaf rust), P. graminis f. sp. tritici (stem rust), and Erysiphe graminis (powdery mildew) on wheat (Triticum aestivum L.) Effective control of infection by leaf or stem rust fungi was obtained with sprays of DFMO that ranged from about 0.01 to 0.20 mM in experiments where the inhibitor was applied after spore inoculation. The powdery mildew fungus was somewhat more tolerant of DFMO, but good control of the pathogen was obtained at less than 1.0 mM. In general, application of DFMO after spore inoculation was more effective than application before inoculation. Less control was obtained following treatment with alpha-difluoromethylarginine (DFMA) but the relatively high degree of control obtained raises the possibility of a DFMA to DFMO conversion by arginase.
LEAF WHORL INOCULATION METHOD FOR SCREENING SUGARCANE RUST RESISTANCE
Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...
Han, Jae Woo; Shim, Sang Hee; Jang, Kyoung Soo; Choi, Yong Ho; Dang, Quang Le; Kim, Hun; Choi, Gyung Ja
2018-02-01
As an alternative to synthetic pesticides, natural materials such as plant extracts and microbes have been considered to control plant diseases. In this study, methanol extracts of 120 plants were explored for in vivo antifungal activity against Rhizoctonia solani, Botrytis cinerea, Phytophthora infestans, Puccinia triticina, and Blumeria graminis f. sp. hordei. Of the 120 plant extracts, eight plant extracts exhibited a disease control efficacy of more than 90% against at least one of five plant diseases. In particular, a methanol extract of Curcuma zedoaria rhizomes exhibited strong activity against wheat leaf rust caused by P. triticina. When the C. zedoaria methanol extracts were partitioned with various solvents, the layers of n-hexane, methylene chloride, and ethyl acetate showed disease control values of 100, 80, and 43%, respectively, against wheat leaf rust. From the C. zedoaria rhizome extracts, an antifungal substance was isolated and identified as a sesquiterpene ketolactone based on the mass and nuclear magnetic resonance spectral data. The active compound controlled the development of rice sheath blight, wheat leaf rust, and tomato late blight. Considering the in vivo antifungal activities of the sesquiterpene ketolactone and the C. zedoaria extracts, these results suggest that C. zedoaria can be used as a potent fungicide in organic agriculture.
Genetic analysis of rust resistance genes in global wheat cultivars: an overview
International Nuclear Information System (INIS)
Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod
2017-01-01
Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding
Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat
International Nuclear Information System (INIS)
Chopra, V.L.; Sawhney, R.N.; Kumar, R.
1983-01-01
A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)
Abnormal germling development by brown rust and powdery mildew on cer barley mutants
Rubiales, D.; Ramirez, M.C.; Carver, T.L.W.; Niks, R.E.
2001-01-01
The barley leaf rust fungus forms appressoria over host leaf stomata and penetrates via the stomatal pore. High levels of avoidance to leaf rust fungi have been described in some wild accessions of Hordeum species where a prominent wax layer on the stomata inhibits triggering of fungal appressorium
Collections of Puccinia triticina, the wheat leaf rust pathogen, were obtained from Pakistan in 2008, 2010, 2011, 2013, and 2014. Collections were also obtained from Bhutan in 2013. Single uredinial isolates were derived and tested for virulence phenotype to 20 lines of Thatcher wheat that differ fo...
Calcium and potassium contents in nutrient solution on Phoma leaf spot intensity in coffee seedlings
Directory of Open Access Journals (Sweden)
Aricléia de Moraes Catarino
Full Text Available ABSTRACT Coffee is one of the main export commodities of Brazilian agribusiness. Phoma leaf spot [Phoma tarda (Stewart Boerema & Bollen] is one of the most important coffee fungal diseases in Brazil. Therefore, this study aimed to evaluate the intensity of Phoma leaf spot in coffee seedlings supplied with different rates of Ca+2 and K+. The study was conducted under controlled conditions in a growth chamber, at the Department of Phytopathology - UFLA, from February 2010 to December 2011. The assay was repeated twice under the same conditions. The nutrient solutions consisted of five concentrations of K+ (3, 4, 5, 6, 7 mmol L-1 and Ca+2 (2, 4, 6, 8 and 10 mmol L-1. The experiment was arranged in a randomized block design, with 25 treatments and three replicates, with two plants per plot. The areas under incidence progress curve (AUIPC and severity (AUSPC were calculated. At the lowest rate of Ca2+ (2 mmol L-1 and highest K+ (6 and 7 mmol L-1, approximately, the AUIPC was the smallest. For the AUSPC, the lowest rates of Ca+2 and K+ resulted in the lowest severities. Supply of Ca+2 and K+ in nutrient solution reduced AUIPC and AUSPC of Phoma leaf spot, and these nutrients can be recommended for the management of the disease.
'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...
Rahmatov, Mahbubjon
2016-01-01
Bread wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most important food crops world-wide, but is attacked by many diseases and pests that cause significant yield losses. Globally, stem rust (Sr) (Puccinia graminis f. sp. tritici Erikss & E. Henning), stripe rust (Yr) (Puccinia striiformis Westend. f. sp. tritici Eriks) and leaf rust (Lr) (Puccinia triticina Eriks) are a great threat to wheat production. The majority of the Sr, Yr and Lr resistance genes are already defeated...
Cheng, Yulin; Yao, Juanni; Zhang, Hongchang; Huang, Lili; Kang, Zhensheng
2015-07-01
Cereal powdery mildews caused by Blumeria graminis and cereal rusts caused by Puccinia spp. are constant disease threats that limit the production of almost all important cereal crops. Rice is an intensively grown agricultural cereal that is atypical because of its immunity to all powdery mildew and rust fungi. We analyzed the nonhost interactions between rice and the wheat powdery mildew fungus B. graminis f. sp. tritici (Bgt) and the wheat leaf rust fungus Puccinia triticina (Ptr) to identify the basis of nonhost resistance (NHR) in rice against cereal powdery mildew and rust fungi at cytological and molecular levels. No visible symptoms were observed on rice leaves inoculated with Bgt or Ptr. Microscopic observations showed that both pathogens exhibited aberrant differentiation and significantly reduced penetration frequencies on rice compared to wheat. The development of Bgt and Ptr was also completely arrested at early infection stages in cases of successful penetration into rice leaves. Attempted infection of rice by Bgt and Ptr induced similar defense responses, including callose deposition, accumulation of reactive oxygen species, and hypersensitive response in rice epidermal and mesophyll cells, respectively. Furthermore, a set of defense-related genes were upregulated in rice against Bgt and Ptr infection. Rice is an excellent monocot model for genetic and molecular studies. Therefore, our results demonstrate that rice is a useful model to study the mechanisms of NHR to cereal powdery mildew and rust fungi, which provides useful information for the development of novel and durable strategies to control these important pathogens.
Directory of Open Access Journals (Sweden)
Albano Silva da Conceição
2005-01-01
porte baixo portando o gene SH3 de resistência ao agente da ferrugem.The present work evaluated 36 arabic coffee (Coffea arabica L. F3 progenies, originated from crosses among cultivars Catuaí Vermelho IAC 46 and Catuaí Vermelho IAC 81 and access IAC 1110 (BA-10. This last cultivar came from India and exhibits SH2 and SH3 rust resistance genes. The experiment was installed in 1988 at the Experimental Center of the Agronomic Institute (IAC/APTA, in Campinas, using random blocks design with six repetitions and two plants per plot. Field evaluations included yield (average of seven annual harvests, vegetative vigor, resistance to leaf rust, plant size, color of young leaves and complete fruit maturation period. Based on these evaluations, plants exhibiting high yield, good vegetative vigor, low height, and resistance to the leaf rust agent Hemileia vastatrix were selected. Fruit yield of selected plants was calculated and seeds were characterized according to type (flat, peaberry and elephant, outturn and grain size. A total of 11 optimal F3 progenies were identified as rust resistant. By further classifications, 39 plants out from these progenies were selected, along with 15 plants from other 25 evaluated progenies. Laboratory analyses lead to a final selection of 18 coffee trees, all exhibiting leaf rust resistance, high yield and low height. Also, F4 progenies of selected plants had been evaluated regarding height and leaf rust resistance, at seedling stage, in greenhouse conditions. Eighteen plants were selected for further analysis and move forward from F3 to F4 generation in the coffee breeding program developed by IAC.
Molecular and genetic study of wheat rusts | Le Maitre | African ...
African Journals Online (AJOL)
Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...
Reaction of Rust on Some Bread Wheat Varieties in Çukurova Region
AY, Hasan
2013-01-01
This study was conducted with 126 varieties of wheat between 2009-2010 years in Adana. There has not been artificially inoculated yellow, leaf and stem rusts. Races of rust in natural were evaluated in both years. Between 2009-2010 this study was conducted in Adana, with 126 varieties of bread wheat. In both years, only the natural environment leaf rust races inoculated for assessments reactions of bread wheat. According to results, 49 bread wheat varieties were found resistant, 6 bread wheat...
Directory of Open Access Journals (Sweden)
Ricardo Borges Pereira
2012-02-01
Full Text Available Rust is considered the most important disease in coffee because it causes severe defoliation in plants and, consequently, reduction in productivity. This study evaluated the in vitro effect of essential oils of cinnamon, citronella, lemongrass, clove, tea tree, thyme, neem and eucalyptus on the germination of urediniospores of Hemileia vastatrix; the effectiveness of these oils to control rust on seedlings of coffee cultivars Catucaí 2SL, Catuaí IAC 62 and Mundo Novo 379/19 in the greenhouse; and the effect of more promising oils on urediniospores of H. vastatrix by transmission electron microscopy (TEM. All the essential oils inhibited the germination of urediniospores with increasing concentrations. All oils promoted partial control of the disease in the greenhouse. However, the oils of thyme, clove and citronella, at a concentration of 1000 µL L-1, were most effective in controlling the disease on cultivars Catucaí 2SL, Catuaí IAC 62 and Mundo Novo 379/19, respectively. The images generated in TEM showed that urediniospores exposed to oils of clove, citronella and thyme promoted cellular disorganization and cytoplasmic vacuolization, which was more pronounced in urediniospores exposed to citronella oil. The oils of thyme, clove and citronella are promising for the control of rust in coffee.A ferrugem é considerada a doença de maior importância no cafeeiro, pois causa acentuada desfolha nas plantas e, consequentemente, redução na produtividade. Este trabalho avaliou o efeito in vitro de óleos essenciais de canela, citronela, capim-limão, cravo-da-índia, árvore-de-chá, tomilho, nim e eucalipto na germinação de urediniósporos de Hemileia vastatrix; a eficácia desses óleos no controle da ferrugem em mudas de cafeeiro das cultivares Catucaí 2SL, Catuaí IAC 62 e Mundo Novo 379/19 em casa de vegetação; e o efeito dos óleos mais promissores sobre urediniósporos de H. vastatrix por meio de microscopia eletrônica de transmiss
Mapping of stripe rust resistance gene in an Aegilops caudata ...
Indian Academy of Sciences (India)
PUNEET INDER TOOR
A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...
Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans
2016-11-01
Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.
Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K
2017-08-01
Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
2011-01-01
Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt), we have generated Expressed Sequence Tags (ESTs) by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores) and asexual (germinated urediniospores) stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum), 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs). Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt) and stripe rust, P. striiformis f. sp. tritici (Pst), and poplar
Directory of Open Access Journals (Sweden)
Wynhoven Brian
2011-03-01
Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp
Energy Technology Data Exchange (ETDEWEB)
Katiyar, K. P.; Ferrer, F. [Inter-American Institute of Agricultural Sciences of the OAS Training and Research Center, Turrialba (Costa Rica)
1968-06-15
For two years the authors studied the feasibility of controlling the coffee leaf miner Leucoptera coffeella Guer. by the radiation sterilization technique. During this period a technique for raising large numbers of tills insect on potted coffee plants in the laboratory was devised. The optimal range for the development of egg, larval and pupal stages of the coffee leaf miner was between 20 and 30 Degree-Sign C. The pupal stage of female insects was slightly shorter than that of the male. The laying of fertile eggs began during the first night following emergence. During an oviposition period of 16 days the average fecundity was 68 eggs. The maximum oviposition by a single female was 131 eggs over the life span while as many as 34 eggs were laid during a single day of oviposition. To investigate the best stage to induce radiation sterilization, pupal and adult insects were irradiated with {sup 60}CO gamma rays. Seven-day pupae (close to emergence) showed 88% lethality in males when given 60 krad; the survivors retained some fertility. Adult females receiving 70 krad were 100% sterile while males given 90 krad showed 0.02% fertility. Doses as high as 90 krad given to newly emerged adults did not reduce longevity. Studies are continuing to determine if sterilizing doses impair sexual vigour and mating competitiveness of the treated males. (author)
Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A
2017-08-01
Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.
Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons
International Nuclear Information System (INIS)
Skorda, E.A.
1977-01-01
Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)
Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus
2018-05-01
Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Farmer awareness, coping mechanisms and economic implications ...
African Journals Online (AJOL)
Coffee leaf rust (CLR) still remains a serious threat to the economics of coffee farming in Uganda. The disease is more severe on Arabica coffee (Coffea arabica) at mid and low altitude (1500 m and below) where crop losses is up to 50%. The objective of this study was to document farmers' knowledge about the disease, ...
Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal
2017-07-01
NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.
Directory of Open Access Journals (Sweden)
Larissa de Oliveira Fassio
2016-01-01
Full Text Available Considering the importance of the chemical compounds in Arabica coffee beans in the definition of the drink sensory quality and authentication of coffee regions, the aim of this study was to evaluate, from principal component analysis—PCA—if there is a relation between the caffeine, trigonelline, and chlorogenic acid (5-CQA content and the sensory attributes of the drink, and in this context, enabling the differentiation of cultivars in two coffee-producing regions of Brazil. We evaluated seven rust-resistant Coffea arabica cultivars, and two rust-susceptible cultivars in two cultivation environments: Lavras, in the southern region of Minas Gerais state, and Patrocinio in the Cerrado region of Minas Gerais. The flavor and acidity were determinant for differentiation of the cultivars and their interaction with the evaluated environments. Cultivars Araponga MG1, Catigua MG2, and Catigua MG1 are the most suitable for the production of specialty coffee in the state of Minas Gerais. A poor correlation was found between caffeine, trigonelline, 5-CQA contents, and fragrance, flavor, acidity, body, and final score attributes. However, these compounds enabled the differentiation of the environments. The PCA indicated superiority in the sensory quality of cultivars resistant to rust, compared to the control, Bourbon Amarelo, and Topázio MG1190.
Brown leaf rust in sugarcane is caused by Puccinia melanocephala (Syd. & P. Syd.), which is major cause of cultivar withdrawal. We attempted to analyze the RAPD diversity of two discrete phenotypic classes i.e. rust resistant (R) and rust susceptible (S) of six commercially available sugarcane elite...
Marker-assisted pyramiding of Thinopyrumderived leaf rust ...
Indian Academy of Sciences (India)
2017-03-20
Mar 20, 2017 ... resistance genes Lr19 and Lr24 using marker assisted foreground .... is linked with stem rust resistance gene Sr24(McIntosh et al. 1976). .... Received 29 July 2016, in final revised form 3 March 2017; accepted 16 March 2017.
Directory of Open Access Journals (Sweden)
D.S. Alves
2013-01-01
Full Text Available Aiming to contribute to the development of alternative control methods of the coffee leaf miner, Leucoptera coffeella (Guérin-Mèneville & Perrottet, 1842 (Lepidoptera: Lyonetiidae, a search for plants able to produce active substances against this insect was carried out, with species collected during different periods of time in the Alto Rio Grande region, (Lavras, Minas Gerais, Brazil. Coffee leaves containing L. coffeella mines were joined with 106 extracts from 77 plant species and, after 48 hours, the dead and alive caterpillars were counted. The extracts from Achillea millefolium, Citrus limon, Glechoma hederacea, Malva sylvestris, Mangifera indica, Mentha spicata, Mirabilis jalapa, Musa sapientum, Ocimum basiculum, Petiveria alliaceae, Porophyllum ruderale, Psidium guajava, Rosmarinus officinalis, Roupala montana, Sambucus nigra and Tropaeolum majus showed the highest mortality rates.
Florez, Juan Carlos; Mofatto, Luciana Souto; do Livramento Freitas-Lopes, Rejane; Ferreira, Sávio Siqueira; Zambolim, Eunize Maciel; Carazzolle, Marcelo Falsarella; Zambolim, Laércio; Caixeta, Eveline Teixeira
2017-12-01
We provide a transcriptional profile of coffee rust interaction and identified putative up regulated resistant genes Coffee rust disease, caused by the fungus Hemileia vastatrix, is one of the major diseases in coffee throughout the world. The use of resistant cultivars is considered to be the most effective control strategy for this disease. To identify candidate genes related to different mechanism defense in coffee, we present a time-course comparative gene expression profile of Caturra (susceptible) and Híbrido de Timor (HdT, resistant) in response to H. vastatrix race XXXIII infection. The main objectives were to obtain a global overview of transcriptome in both interaction, compatible and incompatible, and, specially, analyze up-regulated HdT specific genes with inducible resistant and defense signaling pathways. Using both Coffea canephora as a reference genome and de novo assembly, we obtained 43,159 transcripts. At early infection events (12 and 24 h after infection), HdT responded to the attack of H. vastatrix with a larger number of up-regulated genes than Caturra, which was related to prehaustorial resistance. The genes found in HdT at early hours were involved in receptor-like kinases, response ion fluxes, production of reactive oxygen species, protein phosphorylation, ethylene biosynthesis and callose deposition. We selected 13 up-regulated HdT-exclusive genes to validate by real-time qPCR, which most of them confirmed their higher expression in HdT than in Caturra at early stage of infection. These genes have the potential to assist the development of new coffee rust control strategies. Collectively, our results provide understanding of expression profiles in coffee-H. vastatrix interaction over a time course in susceptible and resistant coffee plants.
Directory of Open Access Journals (Sweden)
Peipei Zhang
2017-05-01
Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.
Contribution of the genetic improvement to the development of the cultivation of Colombian coffee
International Nuclear Information System (INIS)
Moreno Ruiz, German
1994-01-01
After several years of study trying to obtain a variety of resistant coffee to the Rust, the variety Colombia was obtained, which is considered as the contribution more important that has made the genetic improvement to the cultivation of Colombian coffee and consequently to optimize the cultivations and to improve the environment
Microclimate and development of 'Conilon' coffee intercropped with rubber trees
Directory of Open Access Journals (Sweden)
Fábio Luiz Partelli
2014-11-01
Full Text Available The objective of this work was to evaluate the influence of intercropping 'Conilon' coffee (Coffea canephora with rubber trees on coffee tree microclimate, nutrition, growth, and yield. Rubber trees were planted in two double rows 33 m apart, with 4x2.3 m spacing between plants. Treatments consisted of the distances from the coffee plants to the rubber trees: 3, 6, 9, 12, and 15 m. Measurements of atmospheric variables (temperature, irradiance, and relative humidity, leaf nutrient concentration, internode length of plagiotropic and orthotropic branches, individual leaf area, chlorophyll content, and yield were performed. Intercropping promotes changes in the microclimatic conditions of coffee plants close to rubber trees, with reduction of temperature and irradiance level and increase in air relative humidity. The proximity of the coffee tree to the rubber trees promotes the elongation of the plagiotropic and orthotropic branches and increases the individual leaf area; however, it does not affect leaf concentrations of N, K, Mg, Fe, Zn, and B in 'Conilon' coffee and does not have a negative impact on yield.
Molecular and genetic study of wheat rusts
African Journals Online (AJOL)
Nicholas Le Maitre
Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.
Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael
2017-07-01
The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.
Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S
2014-04-01
We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.
Genetic and environmental variation in rust frequency on mature mountain birch trees
Energy Technology Data Exchange (ETDEWEB)
Elamo, Pirjo; Saloniemi, Irma; Helander, M.L.; Neuvonen, Seppo [Turku Univ. (Finland). Dept. of Biology) and (Kevo Subarctic Research Inst., Turku (Finland)
2000-07-01
This study investigated genetic and environmental variation in the frequency of birch rust, the most important leaf disease of birch species, The same half-sib families of mature mountain birch trees were studied in two areas corresponding to their natural growing habitats over 3 yrs. The frequency of birch rust was examined both in the field and from detached leaves inoculated in the laboratory. The frequency of birch rust varied among the mountain birch families. However, the heritability of birch rust resistance was found to be fairly low, with the heritability of naturally occurring birch rust varying between 0.27 and 0.41. The frequency of birch rust varied highly between the two study areas and among study years. Nevertheless, the relative frequency of birch rust among tree individuals and tree families remained similar and as a result no notable genotype x environment interaction was observed. The field and in vitro results differed with respect to the ranking of birch families by birch rust resistance.
Directory of Open Access Journals (Sweden)
Bruno Grandi Salgado
2007-08-01
Full Text Available Com o presente trabalho, objetivou-se avaliar a incidência da ferrugem e da cercosporiose do cafeeiro em diferentes sistemas de cultivo, agroflorestais e a pleno sol, através da curva de progresso dessas doenças. Utilizou-se o delineamento inteiramente casualizado, com três tratamentos e sete repetições. Os tratamentos foram compostos por cafeeiros consorciados com ingazeiro, cafeeiros consorciados com grevílea e cafeeiros cultivados convencionalmente a pleno sol. As avaliações foram realizadas mensalmente no período de abril de 2001 a março de 2003. Realizou-se o cálculo da área abaixo da curva de progresso da doença (AACPD, a qual foi submetida à análise de variância. Para a incidência da ferrugem do cafeeiro o consórcio cafeeiro x ingazeiro mostrou-se com maiores índices da doença, sendo que os tratamentos consórcio cafeeiro x grevílea e cafeeiro a pleno sol não diferiram entre si e apresentaram menores incidências da doença. Diminuição na luz solar direta e maior umidade podem ter favorecido a ferrugem no sistema cafeeiro x ingazeiro. Para a incidência de cercosporiose, os cafeeiros a pleno sol obtiveram maiores valores de incidência da doença, seguidos por cafeeiros x grevílea, e menores taxas da doença foram observadas no consórcio cafeeiros x ingazeiro. A incidência de radiação solar direta pode ter favorecido a maior incidência de cercosporiose nos cafeeiros a pleno sol.The present work aimed to evaluate the incidence of rust and coffee plant cercosporiose in different systems of agroforest cultivation and in the full sunshine through the progress curve of those diseases. The completely randomized design with three treatments and seven replicates was utilized. The treatments were made up of coffee plants mixed with ingazeiro, coffee plants mixed with grevílea and coffee plants cultivated conventionally in the full sunshine. The evaluations were performed monthly during the period of April 2001 to
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
HOW COFFEE COMPANIES CAN STAY COMPETITIVE
RALUCA DANIELA RIZEA; ROXANA SARBU; ELENA CONDREA
2014-01-01
The coffee shop industry in the U.S. includes 20,000 stores with combined annual revenue of about $11 billion. Major companies include Starbucks, Dunkin’ Donuts, Caribou, Coffee Bean and Tea Leaf, and Diedrich (Gloria Jean’s). The industry is highly concentrated at the top and fragmented at the bottom: the top 50 companies have over 70 percent of industry sales. Coffee is one of the world’s largest commodities. The top green coffee producing countries are Brazil, Colombia, and Vietnam. Many...
Directory of Open Access Journals (Sweden)
Wanli Du
Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.
Fofana, Bourlaye; Banks, Travis W.; McCallum, Brent; Strelkov, Stephen E.; Cloutier, Sylvie
2007-01-01
In this study, we detail the construction of a custom cDNA spotted microarray containing 7728 wheat ESTs and the use of the array to identify host genes that are differentially expressed upon challenges with leaf rust fungal pathogens. Wheat cultivar RL6003 (Thatcher Lr1) was inoculated with Puccinia triticina virulence phenotypes BBB (incompatible) or TJB (7-2) (compatible) and sampled at four different time points (3, 6, 12, and 24 hours) after inoculation. Transcript expression levels rela...
African Journals Online (AJOL)
Items 1 - 50 of 171 ... Vol 4, No 2 (2010), Coffee Leaf Rust Epidemics (Hemileia vastatrix) ... Study on Wind Power using Meteorological Data and Wind Turbine ... Conservation Structures in Adama District, Oromia Region, Ethiopia, Abstract PDF.
Influence of yellow rust infextion on 32P transport in detached barley leaves
International Nuclear Information System (INIS)
Schubert, J.
1982-01-01
Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of 32 P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general. (author)
Directory of Open Access Journals (Sweden)
CONSUELO MONTES R.
2012-06-01
ça de Broca e a cercosporiose, e dez para avaliar a presença de ferrugem. Foram registrados os valores de temperatura, precipitação, humidade, e brilho solar objetivando determinar a relação entre o clima e a presença de doenças. O nivel máximo aceitável de infestação na plantação é do 5%. O promedio de infestação no periodo avaliado foi de 14,7% para a ferrugem, 4,7% para a Broca e 4,8 para a cercosporiose. Temperatura e precipitação foram as que apresentaram maior relação com a presença das doenças. Altas temperaturas estão relacionadas com maior apresentação de ferrugem e Broca, principalmente nos meses de junhio e setembro, pelo contrario, a cercosporiose, altamente correlacionada com a presença de chuvas, ocorre principalmente nos meses de marzo e maio. Estes resultados alertan sobre a presença destas pragas nas plantações da região.The epidemiological study was carried out on three Colombian coffee production limiting pests, i.e. Coffee borer (Hypothenemus hampei Ferrari, Coffee rust (Hemileia vastatrix and Iron spot disease (Cercospora coffeicola of four municipalities of the Cauca department. Eight sensoring localities were selected and sampled monthly in order to obtain the infestation and incidence of each pest during 2006 and 2007(from March and December. Sampling was done according to the process established by Cenicafé, 30 Coffee shrubs were taken for the Coffee borer and the Iron spot disease evaluation, and 10 for coffee rust evaluation per hectare respectively, the corresponding infestation and incidence percentages were obtained by grain and leaves counting. Temperature, precipitation, relative humidity and solar bright data were obtained from neighboring climatological stations, in order to relate the pests behavior with climate. The plagues infestation and incidence in most cases exceeded the 5% economical damage threshold; the mean incidence and infestation during the evaluation period was 14,7% for Rust, 4,7% for
Yun, Yeo Hong; Ahn, Geum Ran; Yoon, Seong Kwon; Kim, Hoo Hyun; Son, Seung Yeol; Kim, Seong Hwan
2016-12-01
During the growing season of 2015, leaf specimens with yellow rust spots were collected from Salix koreensis Andersson, known as Korean willow, in riverine areas in Cheonan, Korea. The fungus on S. koreensis was identified as the rust species, Melampsora yezoensis , based on the morphology of urediniospores observed by light and scanning electron microscopy, and the molecular properties of the internal transcribed spacer rDNA region. Pathogenicity tests confirmed that the urediniospores are the causal agent of the rust symptoms on the leaves and young stems of S. koreensis . Here, we report a new rust disease of S. koreensis caused by the rust fungus, M. yezoensis , a previously unrecorded rust pathogen in Korea.
Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars
International Nuclear Information System (INIS)
Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)
1977-01-01
Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)
Determination of dew absorption by coffee plant through deuterium concentrations in leaf water
Energy Technology Data Exchange (ETDEWEB)
Leopoldo, P R [Faculdade de Ciencias Medicas e Biologicas de Botucatu (Brazil); Salati, E; Matsui, E [Centro de Energia Nuclear na Agricultura, Piracicaba (Brazil)
1975-12-01
The effect of dew falling on leaves on the water metabolism of the coffee plant (Coffea arabica) is examined. The use of natural stable isotopes variations in plant physiological studies is demonstrated. Water extracted from leaf samples is analysed by mass spectrometry. Analyses of deuterium concentrations in water extracted from plant leaves, dew and nutrient solutions are made. Determination of changes in deuterium concentration in the water of leaves from plants exposed to dew, compared with leaves not exposed to dew, is carried out. Results show that during daytime there is an enrichment in deuterium in water contained in the leaves, while at night the opposite occurs.
Determination of dew absorption by coffee plant through deuterium concentrations in leaf water
International Nuclear Information System (INIS)
Leopoldo, P.R.; Salati, E.; Matsui, E.
1975-01-01
The effect of dew falling on leaves on the water metabolism of the coffee plant (Coffea arabica) is examined. The use of natural stable isotopes variations in plant physiological studies is demonstrated. Water extracted from leaf samples is analysed by mass spectrometry. Analyses of deuterium concentrations in water extracted from plant leaves, dew and nutrient solutions are made. Determination of changes in deuterium concentration in the water of leaves from plants exposed to dew, compared with leaves not exposed to dew, is carried out. Results show that during daytime there is an enrichment in deuterium in water contained in the leaves, while at night the opposite occurs [pt
Estimation of leaf area in coffee leaves (Coffea arabica L. of the Castillo® variety
Directory of Open Access Journals (Sweden)
Carlos Andrés Unigarro-Muñoz
2015-01-01
Full Text Available Allometric models based on measurements of single leaf dimensions or a combination there are useful tools for determining individual leaf area (LA because they are non-destructive, precise, simple and economical methods. The present study was carried out at the Central Station Naranjal of Cenicafé, located in the Department of Caldas (Colombia, four models were defined using the variables length (L and/or width (W to estimate LA in coffee leaves of the Castillo® variety (Coffea arabica L.. Estimation of regression coefficients was performed using information recorded from 6,441 leaves (group 1, and their validation was performed using records from another 992 leaves (group 2. Leaves were collected from all strata of the canopy and ranged from 0.76 to 140 cm2 in LA. In addition to exhibiting coefficients of variation differing from zero based on t-tests at 1%, the evaluated models possess coefficients of determination between 0.93 and 0.99. Four expressions have developed and adjusted to estimate leaf area in individual leaves, based on the measurement of simple variables and non-destructive.
Influence of yellow rust infection on /sup 32/P transport in detached barley leaves
Energy Technology Data Exchange (ETDEWEB)
Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)
1982-01-01
Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of /sup 32/P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general.
Vaz Patto, M.C.; Aardse, A.; Buntjer, J.; Rubiales, D.; Martin, A.; Niks, R.E.
2001-01-01
In Hordeum chilense Roem. & Schult., a high variation in the level of avoidance to infection of barley leaf rust (Puccinia hordei Otth) occurs. Probably resulting from the properties of the stomata, the rust germ tube overgrows stomata, and the infection process fails in an early stage. In the
Physiological measurements of coffee young plants coexisting with sourgrass
Directory of Open Access Journals (Sweden)
Pedro Luis da Costa Aguiar Alves
2012-03-01
Full Text Available Coffee is an important crop planted in Brazil and commonly infested by sourgrass plants. Crescent densities of sourgrass growing with coffee young plants were maintained up to weed full flowering when physiological measurements were performed in the crop to evaluate photosynthetic coffee plant responses to increasing of weed competition. Experiments were arranged in a completely randomized design with seven replicates. The concentration of CO2 within the leaf, the leaf transpiration, the stomatal conductance, the CO2 assimilation rate, and the ratio Fv/Fm of coffee plants were not affected by increasing of sourgrass density. On the other hand, relative content of total chlorophyll was reduced by 13.9% in the density of 8 sourgrass plants. Gas exchange and fluorescence of chlorophyll of young coffee plants were not dependent on increasing of the intensity of competition while an opposite response occurred for chlorophyll content.
SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD
Directory of Open Access Journals (Sweden)
Mehmet AYBEKE
2015-12-01
Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.
Nonhost resistance to rust pathogens - a continuation of continua.
Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J
2014-01-01
The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.
Honorato Júnior, J; Zambolim, L; Aucique-Pérez, C E; Resende, R S; Rodrigues, F A
2015-09-01
Coffee leaf rust (CLR), caused by Hemileia vastatrix, is a major disease affecting coffee production worldwide. In this study, an in-depth analysis of the photosynthetic performance of coffee leaves challenged or not with H. vastatrix and sprayed with either epoxiconazole (EPO) or pyraclostrobin (PYR) was performed by combining chlorophyll a fluorescence images, photosynthetic pigment pools and the activities of chitinase (CHI), β-1,3-glucanase (GLU), peroxidase (POX) and catalase (CAT). The CLR severity was higher in the control plants, but reduced in plants sprayed with both PYR and EPO. Also, the CLR severity was reduced in plants sprayed with PYR compared with plants sprayed with EPO. Plants sprayed with either EPO or PYR showed maximal photosystem II quantum efficiency (Fv/Fm) values ranging from 0.78 to 0.80, which were quite similar to those obtained with inoculated plants (values ranging from 0.74 to 0.77). The decreases in the Fv/Fm ratio values and parallel increases in the F0 values in the inoculated plants, which were not observed in the control plants (sprayed with water) and were confirmed by images of the initial fluorescence (F0) and Fv/Fm parameters in the regions of the leaf tissue containing pustules and in the asymptomatic leaf tissue, indicated that photosynthesis was negatively impacted. When effective photosystem II quantum yield (Y(II)) values approached zero with a high photosynthetic photon flux density, high values of quantum yield of regulated energy dissipation (Y(NPQ)) in association with a high carotenoid concentration were noted in the inoculated plants sprayed either with PYR or EPO. The increased CLR severity in inoculated plants in contrast to inoculated plants sprayed with either PYR or EPO was associated with greater POX activity and a reduced photosynthetic pigment concentration. POX and CAT activities were increased in inoculated plants sprayed with either EPO or PYR when compared with control plants. CHI and GLU activities
Nonhost resistance to rust pathogens – a continuation of continua
Directory of Open Access Journals (Sweden)
Jan eBettgenhaeuser
2014-12-01
Full Text Available The rust fungi (order: Pucciniales are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina, which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1 the majority of accessions of a species being resistant to the rust or (2 the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host to complete immunity within a species (nonhost. In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.
Nonhost resistance to rust pathogens – a continuation of continua
Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J.
2014-01-01
The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant–pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens. PMID:25566270
Soil phosphorus dynamics and availability and irrigated coffee yield
Directory of Open Access Journals (Sweden)
Thiago Henrique Pereira Reis
2011-04-01
Full Text Available Research data have demonstrated that the P demand of coffee (Coffea arabica L. is similar to that of short-cycle crops. In this context, the objective of this study was to evaluate the influence of annual P fertilization on the soil P status by the quantification of labile, moderately labile, low-labile, and total P fractions, associating them to coffee yield. The experiment was installed in a typical dystrophic Red Latosol (Oxisol cultivated with irrigated coffee annually fertilized with triple superphosphate at rates of 0, 50, 100, 200, and 400 kg ha-1 P2O5. Phosphorus fractions were determined in two soil layers: 0-10 and 10-20 cm. The P leaf contents and coffee yield in 2008 were also evaluated. The irrigated coffee responded to phosphate fertilization in the production phase with gains of up to 138 % in coffee yield by the application of 400 kg ha-1 P2O5. Coffee leaf P contents increased with P applications and stabilized around 1.98 g kg-1, at rates of 270 kg ha-1 P2O5 and higher. Soil P application caused, in general, an increase in bioavailable P fractions, which constitute the main soil P reservoir.
Directory of Open Access Journals (Sweden)
Bernardo Reis Teixeira Lacerda Paiva
2011-02-01
Full Text Available Objetivou-se, no presente trabalho, avaliar o efeito de diferentes critérios para manejo da irrigação em quatro densidades de plantio, sob sistema de gotejamento na incidência e severidade da ferrugem do cafeeiro e avaliar a influência do enfolhamento na curva de progresso dessa doença. Conduziu-se, o experimento, em área experimental da Universidade Federal de Lavras MG, utilizando a cultivar Rubi MG-1192 com seis anos. O delineamento experimental foi em blocos ao acaso com quatro repetições. Os tratamentos foram constituídos por quatro parcelas representadas pelas densidades de plantio (convencionais e adensados: 2500 (4,0x1,0 m, 3333 (3,0x1,0 m, 5000 (2,0x1,0 m, 10000 (2,0x0,5 m plantas ha-1, quatro subparcelas sendo: irrigações quando a tensão da água no solo atingiu valores de 20 e 60kPa; irrigações utilizando o manejo do balanço hídrico (calculado através do software IRRIPLUS, com turnos de irrigação fixos de três dias por semana e uma testemunha sem irrigação, perfazendo um total de 16 tratamentos. Cada subparcela foi constituída por 10 plantas, sendo consideradas como plantas úteis as seis centrais. Foram avaliadas a incidência e severidade da ferrugem e a porcentagem de enfolhamento das plantas de cafeeiros. Após análise estatística, os dados foram convertidos em área abaixo da curva de progresso da doença e do crescimento. Verificou-se que os critérios para manejo da irrigação influenciaram a curva de progresso do crescimento, porém, não interferiu na curva de progresso da incidência e da severidade da ferrugem. Os sistemas de plantios adensados favoreceram a incidência da ferrugem. Mas as densidades de plantio não interferiram no enfolhamento.The objective of this study was to evaluate the effect of different irrigation controls implemented in four planting densities on a system of drip on the incidence and severity of rust and to assess the influence of leaf growth on the progress curve of this
Avelino, Jacques; Cabut, Sandrine; Barboza, Bernardo; Barquero, Miguel; Alfaro, Ronny; Esquivel, César; Durand, Jean-François; Cilas, Christian
2007-12-01
ABSTRACT We monitored the development of American leaf spot of coffee, a disease caused by the gemmiferous fungus Mycena citricolor, in 57 plots in Costa Rica for 1 or 2 years in order to gain a clearer understanding of conditions conducive to the disease and improve its control. During the investigation, characteristics of the coffee trees, crop management, and the environment were recorded. For the analyses, we used partial least-squares regression via the spline functions (PLSS), which is a nonlinear extension to partial least-squares regression (PLS). The fungus developed well in areas located between approximately 1,100 and 1,550 m above sea level. Slopes were conducive to its development, but eastern-facing slopes were less affected than the others, probably because they were more exposed to sunlight, especially in the rainy season. The distance between planting rows, the shade percentage, coffee tree height, the type of shade, and the pruning system explained disease intensity due to their effects on coffee tree shading and, possibly, on the humidity conditions in the plot. Forest trees and fruit trees intercropped with coffee provided particularly propitious conditions. Apparently, fertilization was unfavorable for the disease, probably due to dilution phenomena associated with faster coffee tree growth. Finally, series of wet spells interspersed with dry spells, which were frequent in the middle of the rainy season, were critical for the disease, probably because they affected the production and release of gemmae and their viability. These results could be used to draw up a map of epidemic risks taking topographical factors into account. To reduce those risks and improve chemical control, our results suggested that farmers should space planting rows further apart, maintain light shading in the plantation, and prune their coffee trees.
Directory of Open Access Journals (Sweden)
M. Kathryn Turner
2018-03-01
Full Text Available New crops with greater capacity for delivering ecosystem services are needed to increase agricultural sustainability. However, even in these crops, seed yield is usually the main criteria for grain domestication. This focus on yield can cause unintended structural and functional changes. Leaves of selected plants tend to be more vulnerable to infection, which can reduce performance, assimilates, and ultimately yield. Our objectives were to determine the impact of rust (caused by Puccinia silphii on yield and leaf function in selected Silphium integrifolium (Asteraceae plants. We tested the effect of a fungicide treatment on rust severity and yield, compared the rust infection of individuals in a population selected for yield, and related this to chemical changes at the leaf level. We also estimated heritability for rust resistance. We found that productivity indicators (head number and weight, leaf weight and leaf processes (photosynthetic capacity, water use efficiency were reduced when silphium leaves and stems were more heavily infected by P. silphii. Leaf resin content increased when susceptible plants were infected. Fungicide treatments were effective at reducing rust infection severity, but were ineffective at preventing yield losses. We propose that disease resistance should be included early in the selection process of new perennial crops.
African Journal of Biotechnology - Vol 7, No 18 (2008)
African Journals Online (AJOL)
AFLP analysis among Ethiopian arabica coffee genotypes · EMAIL FREE FULL TEXT ... Quantitative trait loci (QTLs) for resistance to gray leaf spot and common rust diseases ... Response of common bean (Phaseolus vulgaris L.) cultivars to foliar and soil ... Effect of ultraviolet B irradiation on accumulation of catechins in tea ...
Impact of coffee crop renewal program on small producers in department Cundinamarca (Colombia
Directory of Open Access Journals (Sweden)
Guarín N. Carlos Andrés
2012-04-01
Full Text Available
The modernization of crops through renewal is a vital option for the restoration of the productivity and competitiveness of the coffee crop. The Federación Nacional de Cafeteros (National Federation of Coffee is banking on a strategy that promotes renewal by providing resources to stimulate growers. As a result of the implementation of the program, it is hoped that it will reverse the aging process of coffee crops, consolidate a productive and competitive market, provide appropriate ages and densities and promote the use of coffee rust resistant varieties. Similarly, it is expected that small producers, who constitute the majority of farmers and who presumably suffer major limitations to independent renewal, will be the main beneficiaries.
Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust
International Nuclear Information System (INIS)
Kiraly, Z.; Barabas, Z.
1983-01-01
Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)
Directory of Open Access Journals (Sweden)
Summi Dutta
2017-10-01
Full Text Available Bread wheat, a type of grass under genus Triticum and species aestivum covers the largest land area when production of cereal crops is considered. Being an allohexaploid (2n=6x=42; AABBDD, its genome is contributed by three progenitors and is evolutionarily rich. Rust in leaves, caused by Puccinia triticina, severely affects grain quality. MicroRNAs are considered as major components of gene silencing and so have deep role to play during stress. Post transcriptional modification of miRNAs which generates isomiRNAs significantly affects target specificity especially when the modification occurs in 5′end. A total of four small RNA libraries were prepared through next-generation Illumina sequencing techniques from leaves of two wheat Near Isogenic Lines (NILs, HD2329 (susceptible and HD2329 + LR24 (resistant. Prior to this, one set of the two NILs was mock inoculated and considered as control (with sRNA library code named SM-mi and RM-mi while other was treated with urediniospores of leaf rust fungus (with sRNA library code named SPI-mi and RPI-mi. Clean reads in all four libraries were previously used for prediction of 559 novel miRNAs and in the current study it was used to detect isoforms of these miRNAs. A total of 237 isoforms were detected for 41 miRNAs. These isoforms included both 5′ and 3′ modifications of miRNAs. There were 27 miRNAs with 5′ modifications and five miRNAs with 3′ modifications while nine miRNAs showed both types of modifications.
Wheat Rust Toolbox Related to New Initiatives on Yellow Rust
DEFF Research Database (Denmark)
Hansen, Jens Grønbech; Lassen, Poul
://www.fao.org/agriculture/crops/rust/stem/rust-report/en/). The Wheat rust toolbox is one of several International research platforms hosted by Aarhus University, and it uses the same ICT framework and databases as EuroWheat (www.eurowheat.org) and EuroBlight (www.EuroBlight.net). The Wheat Rust Toolbox will also serve the Global Rust Reference Centre (GRRC) as well...... – 2009), and as soon as possible this will be expanded to cover all global yellow rust data available via the GRRC. The presentation will focus on experiences from the previous work on global databases and web based information systems, as well as propose ideas how the toolbox can be helpful regarding...
Simple Sequence Repeat Analysis of Selected NSIC-registered Coffee Varieties in the Philippines
Directory of Open Access Journals (Sweden)
Daisy May C. Santos
2016-06-01
Full Text Available Coffee (Coffea sp. is an important commercial crop worldwide. Three species of coffee are used as beverage, namely Coffea arabica, C. canephora, and C. liberica. Coffea arabica L. is the most cultivated among the three coffee species due to its taste quality, rich aroma, and low caffeine content. Despite its inferior taste and aroma, C. canephora Pierre ex A. Froehner, which has the highest caffeine content, is the second most widely cultivated because of its resistance to coffee diseases. On the other hand, C. liberica W.Bull ex Hierncomes is characterized by its very strong taste and flavor. The Philippines used to be a leading exporter of coffee until coffee rust destroyed the farms in Batangas, home of the famous Kapeng Barako. The country has been attempting to revive the coffee industry by focusing on the production of specialty coffee with registered varieties on the National Seed Industry Council (NSIC. Correct identification and isolation of pure coffee beans are the main factors that determine coffee’s market value. Local farms usually misidentify and mix coffee beans of different varieties, leading to the depreciation of their value. This study used simple sequence repeat (SSR markers to evaluate and distinguish Philippine NSIC-registered coffee species and varieties. The neighbor-joining tree generated using PAUP showed high bootstrap support, separating C. arabica, C. canephora, and C. liberica from each other. Among the twenty primer pairs used, seven were able to distinguish C. arabica, nine for C. liberica, and one for C. canephora.
Occurrence of barley leaf disease and control strategies in Denmark
DEFF Research Database (Denmark)
Jørgensen, Lise Nistrup; Ørum, Jens Erik; Heick, Thies Marten
Barley (Hordeum vulgare) is one of the major crops in Denmark and of special importance for malting and for pig feed. In 2016, the crop was grown covering a total area of 700,000 ha; approximately 25% of arable area in Denmark. To ensure high yield of around 60 dt ha-1, disease-tolerant cultivars...... have proven to be quite effective against all leaf diseases, aside from brown rust and mildew. Denmark has a national record system for pesticide usages. All farmers upload their fungicide use by crop, creating a good basis for assessing the differences in use pattern across different regions...... and fungicide treatments are required. Each year, barley cultivars are assessed for susceptibility towards leaf diseases in national observation plots. The most predominant fungal leaf diseases in Denmark are barley scald (Rhynchosporium secalis), net blotch (Pyrenophora teres), brown rust (Puccinia hordei...
Directory of Open Access Journals (Sweden)
Fellers John P
2013-01-01
Full Text Available Abstract Background Wheat leaf rust (Puccinia triticina Eriks; Pt and stem rust fungi (P. graminis f.sp. tritici; Pgt are significant economic pathogens having similar host ranges and life cycles, but different alternate hosts. The Pt genome, currently estimated at 135 Mb, is significantly larger than Pgt, at 88 Mb, but the reason for the expansion is unknown. Three genomic loci of Pt conserved proteins were characterized to gain insight into gene content, genome complexity and expansion. Results A bacterial artificial chromosome (BAC library was made from P. triticina race 1, BBBD and probed with Pt homologs of genes encoding two predicted Pgt secreted effectors and a DNA marker mapping to a region of avirulence. Three BACs, 103 Kb, 112 Kb, and 166 Kb, were sequenced, assembled, and open reading frames were identified. Orthologous genes were identified in Pgt and local conservation of gene order (microsynteny was observed. Pairwise protein identities ranged from 26 to 99%. One Pt BAC, containing a RAD18 ortholog, shares syntenic regions with two Pgt scaffolds, which could represent both haplotypes of Pgt. Gene sequence is diverged between the species as well as within the two haplotypes. In all three BAC clones, gene order is locally conserved, however, gene shuffling has occurred relative to Pgt. These regions are further diverged by differing insertion loci of LTR-retrotransposon, Gypsy, Copia, Mutator, and Harbinger mobile elements. Uncharacterized Pt open reading frames were also found; these proteins are high in lysine and similar to multiple proteins in Pgt. Conclusions The three Pt loci are conserved in gene order, with a range of gene sequence divergence. Conservation of predicted haustoria expressed secreted protein genes between Pt and Pgt is extended to the more distant poplar rust, Melampsora larici-populina. The loci also reveal that genome expansion in Pt is in part due to higher occurrence of repeat-elements in this species.
Barbieri, M.; Marcel, T.C.; Niks, R.E.
2011-01-01
Purple false brome grass (Brachypodium distachyon) has recently emerged as a model system for temperate grasses and is also a potential model plant to investigate plant interactions with economically important pathogens such as rust fungi. We determined the host status of five Brachypodium species
In situ hybridization for the detection of rust fungi in paraffin embedded plant tissue sections.
Ellison, Mitchell A; McMahon, Michael B; Bonde, Morris R; Palmer, Cristi L; Luster, Douglas G
2016-01-01
Rust fungi are obligate pathogens with multiple life stages often including different spore types and multiple plant hosts. While individual rust pathogens are often associated with specific plants, a wide range of plant species are infected with rust fungi. To study the interactions between these important pathogenic fungi and their host plants, one must be able to differentiate fungal tissue from plant tissue. This can be accomplished using the In situ hybridization (ISH) protocol described here. To validate reproducibility using the ISH protocol, samples of Chrysanthemum × morifolium infected with Puccinia horiana, Gladiolus × hortulanus infected with Uromyces transversalis and Glycine max infected with Phakopsora pachyrhizi were tested alongside uninfected leaf tissue samples. The results of these tests show that this technique clearly distinguishes between rust pathogens and their respective host plant tissues. This ISH protocol is applicable to rust fungi and potentially other plant pathogenic fungi as well. It has been shown here that this protocol can be applied to pathogens from different genera of rust fungi with no background staining of plant tissue. We encourage the use of this protocol for the study of plant pathogenic fungi in paraffin embedded sections of host plant tissue.
Verstraete, Brecht; Janssens, Steven; Rønsted, Nina
2017-08-01
Every plant species on Earth interacts in some way or another with microorganisms and it is well known that certain forms of symbiosis between different organisms can drive evolution. Within some clades of Rubiaceae (coffee family), a specific plant-bacteria interaction exists in which non-pathological endophytes are present in the leaves of their hosts. It is hypothesized that the bacterial endophytes, either alone or by interacting with the host, provide chemical protection against herbivory or pathogens by producing toxic or otherwise advantageous secondary metabolites. If the bacteria indeed have a direct beneficial influence on their hosts, it is reasonable to assume that the endophytes may increase the fitness of their hosts and therefore it is probable that their presence also has an influence on the long-term evolution of the particular plant lineages. In this study, the possible origin in time of non-nodulated bacterial leaf symbiosis in the Vanguerieae tribe of Rubiaceae is elucidated and dissimilarities in evolutionary dynamics between species with endophytes versus species without are investigated. Bacterial leaf symbiosis is shown to have most probably originated in the Late Miocene, a period when the savannah habitat is believed to have expanded on the African continent and herbivore pressure increased. The presence of bacterial leaf endophytes appears to be restricted to Old World lineages so far. Plant lineages with leaf endophytes show a significantly higher speciation rate than plant lineages without endophytes, while there is only a small difference in extinction rate. The transition rate shows that evolving towards having endophytes is twice as fast as evolving towards not having endophytes, suggesting that leaf symbiosis must be beneficial for the host plants. We conclude that the presence of bacterial leaf endophytes may also be an important driver for speciation of host plants. Copyright © 2017 Elsevier Inc. All rights reserved.
Protecting steel from rusting by rust. The mechanism of rust formation and its control
International Nuclear Information System (INIS)
Kimura, Masao
2008-01-01
Weathering steel, when exposed outdoors for a few years, forms a protective layer resulting in reduction of the corrosion rate. The state of rusts is fundamental for understanding its mechanisms, but the structure and its relationship with the mechanism have not been understood. In this study, a new crystallographic approach was applied to reveal nano-structure of rusts with using of X-ray synchrotron radiation. It has been shown that additional elements alter the corrosion process in its early stage, resulting in formation of protective rusts. (author)
ÖZERDEM, Mehmet Siraç; ACAR, Emrullah
2011-01-01
Crop diseases can affect yield and/or quality of the harvested commodity. This can influence profitability and raise the risks of farming. When the diseases are estimated early, the yield will increase by taking measures thanks to farmers. The rust disease is one of the most major crop diseases that affect crop yield. Rust disease can be defined as a fungus; it makes the crops weak by blocking food to the roots and leaves. It is named “rust” disease, since the spots on the leaves look like gr...
International Nuclear Information System (INIS)
Riaz, F.; Rizvi, Z.H.; Arshad, K.
2008-01-01
The present work evaluates the anti corrosive properties of a tannin based rust converter applied on the pre rusted steel coupons as compared with the grit blasted bare metal and pre rusted steel coupons. The mechanism and the corrosion control behaviour of the rust converter are characterized and monitored using EIS technique. The result suggested that when the tannin based rust converter applied on the pre rusted/corroded coupon, the protection properties of the mild steel coupon clearly improved because of the more compact conversion layer being formed on the coupon. It is inferred that the rust converter can be applied on the pre rusted samples as an alternative technique to the surface preparation for protection purpose. (author)
Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun
2009-03-01
Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.
HOW COFFEE COMPANIES CAN STAY COMPETITIVE
Directory of Open Access Journals (Sweden)
RALUCA DANIELA RIZEA
2014-04-01
Full Text Available The coffee shop industry in the U.S. includes 20,000 stores with combined annual revenue of about $11 billion. Major companies include Starbucks, Dunkin’ Donuts, Caribou, Coffee Bean and Tea Leaf, and Diedrich (Gloria Jean’s. The industry is highly concentrated at the top and fragmented at the bottom: the top 50 companies have over 70 percent of industry sales. Coffee is one of the world’s largest commodities. The top green coffee producing countries are Brazil, Colombia, and Vietnam. Many grower countries are small, poor developing nations that depend on coffee to sustain local economies. The U.S. is the world’s largest importer of green coffee beans and the largest consumer of coffee. The main objective of this study is to investigate the competitive strategies that U.S. coffee franchise companies adopt considering customers’ expectations and industry best practices. In order to achieve this objective, a best practice benchmarking analysis was performed taking into account the top U.S. coffee companies This analysis showed that product and service innovation are necessary in order to stay competitive in the market and attract new or to keep existing customers successfully. Many customers focus on the special atmosphere each store has and which is characterized by the location, music, interior design, seating or whether internet access is provided. Particularly for specialty coffee shops it is important not to sell only the beverage but the whole experience. Coffee shops have to establish a unique image that prevents customers from buying products from another shop or use home-brewing systems which are also on the rise in American households. In addressing the increased level of competition, every company’s focus should be on differentiating from the rest of the market in every possible business segment (products, atmosphere, location, image etc..
Directory of Open Access Journals (Sweden)
Edison Martins Paulo
2010-12-01
Full Text Available Coffee (Coffea Arabica L. plantations using adapted cultivars to regional environmental conditions with optimal plant population density and adequate nutrition are expected to show high yield responses. The triennial production and leaf macronutrient concentrations of four coffee cultivars were studied under different plant population densities. Catuaí Amarelo (IAC 47, Obatã (IAC 1669-20, Acaiá (IAC 474-19 and Icatu Amarelo (IAC 2944 were planted in densities of 2,500; 5,000; 7,519; and 10,000 plants ha-1 with one plant per hole and two plants per hole in the 2,500 plant ha-1. Plants were homogeneously fertilized without liming. As the population density increased the triennial coffee productivity increased, the yield per plant decreased, and leaf concentrations of phosphorus (P, potassium (K and sulfur (S increased. Coffee plants under dense systems presented equal or higher leaf macronutrient concentrations compared to the plants under conventional population. Taller cultivars presented the highest nutrient concentration values, and Obatã, a dwarf cultivar, the lowest values. Higher coffee yields and lower leaf P, Ca and S concentrations were observed in plots with one plant compared to the plots with two plants. In general, the coffee cultivars had leaf N and S concentrations above the reference limits reported in the literature, but leaf concentrations of other macronutrients were within adequate ranges.Cultivares de cafeeiro (Coffea Arabica L. adaptadas às regiões de cultivo, com população de plantas otimizada e adequado estado nutricional são premissas para a obtenção de produções elevadas de café. Estudou-se a produção trienal de café e o teor foliar de macronutrientes de cultivares de cafeeiro em função das densidades de plantio. Foram utilizados os cultivares Catuaí Amarelo (IAC 47, Obatã (IAC 1669-20, Acaiá (IAC 474-19 e Icatu Amarelo (IAC 2944 nas populações de 2.500 plantas ha-1 com duas plantas por cova; e, 5
Directory of Open Access Journals (Sweden)
Ki Woo Kim
2015-09-01
Full Text Available Interaction of the the rust fungus Puccinia miscanthi with the biofuel plant Miscanthus sinensis during the teliospore phase was investigated by light and electron microscopy. P. miscanthi telia were oval-shaped and present on both the adaxial and abaxial leaf surfaces. Teliospores were brown, one-septate (two-celled, and had pedicels attached to one end. Transmission electron microscopy revealed numerous electron-translucent lipid globules in the cytoplasm of teliospores. Extensive cell wall dissolution around hyphae was not observed in the host tissues beneath the telia. Hyphae were found between mesophyll cells in the leaf tissues as well as in host cells. Intracellular hyphae, possibly haustoria, possessed electron-dense fungal cell walls encased by an electron-transparent fibrillar extrahaustorial sheath that had an electron-dense extrahaustorial membrane. The infected host cells appeared to maintain their membrane-bound structures such as nuclei and chloroplasts. These results suggest that the rust fungus maintains its biotrophic phase with most mesophyll cells of M. sinensis. Such a nutritional mode would permit the rust fungus to obtain food reserves for transient growth in the course of host alteration.
Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean
Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.
2005-01-01
Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...
Uptake and movement of 14C-lindane in coffee plants
International Nuclear Information System (INIS)
Ruegg, E.F.; Lord, K.A.; Mesquita, T.B.
1977-01-01
Several types of experiments were performed to investigate the uptake and distribution of lindane in coffee plants using 14 C-labelled insecticide. The investigations showed that the insecticide taken from nutrient solution is concentrated in the roots and then moves to other parts of the plant. Experiments using macerated plant tissue showed that concentration of lindane in the roots occurs probably by a passive physical process. In another series of tests, leaf tretments of coffee plants grown in pots or in solution indicated that in a few hours about 90% of lindane may be lost from treated leaf as vapor. Some lindane, however, has been detected in other parts of the plant indicating leaf transllocation or migration of the insecticide through the air. The latter hypothesis has been proved by closed and open system comparative experiments using gas chromatographic techniques. This does not exclude a slower and possibly smaller translocation within the plant, suggested by the experiments using radioactivity,. (author) [pt
Directory of Open Access Journals (Sweden)
Cipta Ginting
2014-08-01
Full Text Available Preliminary test on the effect of water extract from plants on rust incidence on coffee leaf disks at the latroratory. The objective of this study was to determine the influence of several water extract from plants on rust incidence on coffee leaf disk a laboratory condition. The study was done from March to June 2003. Treatments were arranged in a randomized complete block design with four replications, One experimental unit consisted of eight leaf disks with 2 cm in diameter. To prepare water extract, 1 00 g of plant or its part was homogenized with 100 ml sterilized distilled water. After being passed through four layers of sterilized cheesecloth, the mixture was defined as the aliquot. Ten percent of the aliquot was sparyed on leaf disks before inoculation. As inoculum, uredospores developed on leaves under field condition were taken with sterilized scalpel and placed in sterilized distilled water and counted with hemacyometer to get suspension (4x105 uredospores per ml spores per ml. Data on disease incidence were analyzed with ANOVA and Duncan test. The results showed that disease incidence was significantly reduced by water extract processed from the leaves of Piper betle, Azadirachta indica, and Eugeni aromatica, the rhizomes of Zingiber afficinale and Curcumq longa, stem of Cymbopogon citratus, Allium ascalonium, A.sativa, and copper fungicide. Disease was not significantly reduced in leaf disks sprayed with extract prepares from the leaves of Piper retrofractum, P. nigrum, the rhizomes of Imperata cylindrica and Alpina galanga, A. cepa,Ageratum comysoides, and Elephantopus scaber.
International Nuclear Information System (INIS)
Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.
2014-01-01
The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)
Sources of resistance to yellow rust and stem rust in wheat-alien introgressions
Rahmatov, Mahbubjon
2013-01-01
Wheat is the staple food and the main source of caloric intake in most developing countries, and thereby an important source in order to maintain food security for the growing populations in those countries. Stem rust Puccinia graminis f. sp. tritici, and yellow rust P. striiformis f. sp. tritici of wheat continues to cause severe damage locally and globally, thereby contributing to food insecurity. In this paper biology and taxonomy of stem rust and yellow rust, breeding for resistance, util...
Directory of Open Access Journals (Sweden)
Nédio Rodrigo Tormen
2013-02-01
Full Text Available Com o objetivo de avaliar a reação de cultivares de trigo à ferrugem da folha, causada por Puccinia triticina, e mancha amarela, causada por Drechslera tritici-repentis, e sua responsividade ao controle químico com fungicidas, foi conduzido experimento de campo durante os invernos de 2009 e 2010, Itaara-RS. As cultivares avaliadas foram 'FCEP 51', 'FCEP 52', 'CD 114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' e 'OR Pampeano'; na safra 2010, a cultivar 'CD 114' foi substituída pela OR Quartzo. Os tratamentos avaliados foram: P1 - testemunha sem aplicação de fungicida; P2 - fempropimorfe (560g ha-1 de i.a.; P3 - azoxistrobina + ciproconazol (60+24g ha-1 de i.a.; e P4 - piraclostrobina + metconazol (60+97,5g ha-1 de i.a.. Após a segunda aplicação, efetuaram-se avaliações semanais de severidade das doenças, cujos dados foram utilizados para o cálculo da Área Abaixo da Curva de Progresso da Doença (AACPD. Também foram determinados a produtividade e o peso do hectolitro. No que se refere à suscetibilidade às doenças, as cultivares estudadas apresentaram respostas distintas de um ano para o outro. Para ferrugem, o comportamento mostrou-se similar em ambos os anos, enquanto que, para mancha amarela, houve variação. Quanto à resposta ao controle químico, ocorreram variações de acordo com o patógeno e com o grau de suscetibilidade das cultivares. O uso integrado de resistência genética e controle químico mostrou-se mais efetivo para ferrugem da folha.Aiming to evaluate the susceptibility of wheat cultivars to leaf rust and yellow spot and their responsiveness to chemical fungicides, two field trials were carried out, during 2009 and 2010 winter's. The cultivars evaluated were: 'FCEP 51', 'FCEP 52', 'CD114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' and 'OR Pampeano'. In 2010, the 'CD 114' cultivar was replaced by Quartzo
Vaz Patto, M.C.; Rubiales, D.; Martin, A.; Hernandez, P.; Lindhout, W.H.; Niks, R.E.; Stam, P.
2003-01-01
In cereals, rust fungi are among the most harmful pathogens. Breeders usually rely on short-lived hypersensitivity resistance. As an alternative, "avoidance" may be a more durable defence mechanism to protect plants to rust fungi. In Hordeum chilense avoidance is based on extensive wax covering of
Litrenta, Jody; Tornetta, Paul; Mehta, Samir; Jones, Clifford; OʼToole, Robert V; Bhandari, Mohit; Kottmeier, Stephen; Ostrum, Robert; Egol, Kenneth; Ricci, William; Schemitsch, Emil; Horwitz, Daniel
2015-11-01
To determine the reliability of the Radiographic Union Scale for Tibia (RUST) score and a new modified RUST score in quantifying healing and to define a value for radiographic union in a large series of metadiaphyseal fractures treated with plates or intramedullary nails. Healing was evaluated using 2 methods: (1) evaluation of interrater agreement in a series of radiographs and (2) analysis of prospectively gathered data from 2 previous large multicenter trials to define thresholds for radiographic union. Part 1: 12 orthopedic trauma surgeons evaluated a series of radiographs of 27 distal femur fractures treated with either plate or retrograde nail fixation at various stages of healing in random order using a modified RUST score. For each radiographic set, the reviewer indicated if the fracture was radiographically healed. Part 2: The radiographic results of 2 multicenter randomized trials comparing plate versus nail fixation of 81 distal femur and 46 proximal tibia fractures were reviewed. Orthopaedic surgeons at 24 trauma centers scored radiographs at 3, 6, and 12 months postoperatively using the modified RUST score above. Additionally, investigators indicated if the fracture was healed or not healed. The intraclass correlation coefficient (ICC) with 95% confidence intervals was determined for each cortex, the standard and modified RUST score, and the assignment of union for part 1 data. The RUST and modified RUST that defined "union" were determined for both parts of the study. ICC: The modified RUST score demonstrated slightly higher ICCs than the standard RUST (0.68 vs. 0.63). Nails had substantial agreement, whereas plates had moderate agreement using both modified and standard RUST (0.74 and 0.67 vs. 0.59 and 0.53). The average standard and modified RUST at union among all fractures was 8.5 and 11.4. Nails had higher standard and modified RUST scores than plates at union. The ICC for union was 0.53 (nails: 0.58; plates: 0.51), which indicates moderate
International Nuclear Information System (INIS)
Frey, K.J.; Browning, J.A.; Simons, M.D.
1976-01-01
Attempts have been made to test the relative effectiveness of EMS treatment for inducing tolerance to crown rust among oat strains Clintland-60 of different ploidy levels. One strain of diploid and one of tetraploid oats were treated with EMS. These two strains are as susceptible to damage from crown rust as are cultivars of hexaploid oats. Multiline cultivars of oats have been shown to provide adequate protection from economic loss due to crown-rust disease in Iowa. Since 1968, eleven multiline cultivars of oats have been released from the Iowa station for use in commercial production in the midwestern USA. During the past two winter seasons, the effectiveness of multiline oat cultivars against crown-rust disease has been researched in Texas, USA, which has a ''long rust season'' of about four months, not an Iowa ''short rust season''. The protection against crown rust afforded by the multiline cultivars appeared equally good in Texas and Iowa. The seasonal productions of crown-rust spores relative to completely resistant and susceptible checks were nearly identical in both environments. Fifteen new isolines of oats have been developed for use in multiline varieties, with seed supplies sufficiently large for immediate use
Directory of Open Access Journals (Sweden)
Diane G O Saunders
Full Text Available Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i contain a secretion signal, (ii are encoded by in planta induced genes, (iii have similarity to haustorial proteins, (iv are small and cysteine rich, (v contain a known effector motif or a nuclear localization signal, (vi are encoded by genes with long intergenic regions, (vii contain internal repeats, and (viii do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.
Effector proteins of rust fungi.
Petre, Benjamin; Joly, David L; Duplessis, Sébastien
2014-01-01
Rust fungi include many species that are devastating crop pathogens. To develop resistant plants, a better understanding of rust virulence factors, or effector proteins, is needed. Thus far, only six rust effector proteins have been described: AvrP123, AvrP4, AvrL567, AvrM, RTP1, and PGTAUSPE-10-1. Although some are well established model proteins used to investigate mechanisms of immune receptor activation (avirulence activities) or entry into plant cells, how they work inside host tissues to promote fungal growth remains unknown. The genome sequences of four rust fungi (two Melampsoraceae and two Pucciniaceae) have been analyzed so far. Genome-wide analyses of these species, as well as transcriptomics performed on a broader range of rust fungi, revealed hundreds of small secreted proteins considered as rust candidate secreted effector proteins (CSEPs). The rust community now needs high-throughput approaches (effectoromics) to accelerate effector discovery/characterization and to better understand how they function in planta. However, this task is challenging due to the non-amenability of rust pathosystems (obligate biotrophs infecting crop plants) to traditional molecular genetic approaches mainly due to difficulties in culturing these species in vitro. The use of heterologous approaches should be promoted in the future.
Directory of Open Access Journals (Sweden)
Cipta Ginting .
2012-02-01
Full Text Available Germination of Hemileia vastatrix uredospores on crude water extracts of zinger and turmeric rhizome and clove and Piper betle leaves. Coffee leaf rust caused by H. vastatrix especially on Arabica coffee is one of most important diseases in coffee and conventional control methods of leaf coffee rust is still unsatisfactory. The objective of this study was to determine the effect of crude water extract on the germination of H. vastatrix uredospores. The study was conducted from January to September 2004 in the Laboratory of Plant Pathology at Unila. In each test, treatments were arranged in a randomized complete block design with four replications. Crude water extract was prepared by homogenizing 100 g of material in 100 ml sterilized distilled water. After being passed through four layers of sterilized cheesecloth, the mixture was defined as the aliquot (100% extract and dilutions were made with sterile distilled water to obtain concentrations of 2.5 to 10%. Each of four materials (zinger, turmeric, clove, and Piper betle was tested separately in five aliquot concentration levels. One ml of each extract was mixed with 0.25 ml of uredospora suspension (4 x 105 per ml, and 0.2 ml of the mixture was incubated. The variable was germinated uredospora (% that was determined under a mikroscope. The results show that significant reduction in spore germination occurred by turmeric, clove, and P. betle extracts at > 2.5% and by zinger extract at > 5%. Some uredospora exposed to plant extract germinated abnormally: germ tubes shorten, swollen, or malform.
Plant Breeding and Genetics Newsletter, No. 32, January 2014
International Nuclear Information System (INIS)
2014-01-01
in-kind support. Please be reminded that these Laboratories are your laboratories, belonging to and serving the Member States. Initiation of mutation breeding in coffee: coffee is one of the world's largest export commodities and in terms of monetary value is only exceeded by crude oil. Statistical figures suggest that the income of 1 in 70 people in the world is directly or indirectly dependent upon coffee production (Cocoa Research Institute of Nigeria, CRIN). Coffee is a neglected crop in terms of plant mutation breeding, partly because no protocols for mutation induction in coffee are available. The CRIN is interested in developing mutation breeding of coffee to combat problems in the crop, such as biennial fruiting, low yield, high caffeine content and disease resistance, especially coffee leaf rust. This is a prime example of Member States driving our adaptive R and D. Recently Guatemala and Mexico joined with a request to combat coffee leaf rust using mutation techniques
FLUXAPYROXAD IN THE ASIAN SOYBEAN RUST CONTROL IN THE CERRADO BIOME
Directory of Open Access Journals (Sweden)
RAFAEL MENEZES SILVA DE FREITAS
2016-01-01
Full Text Available The etiologic agent of the Asian soybean rust is the Phakopsora pachyrhizi, which causes a reduction in the photosynthetic leaf area and, consequently, in the crop yield. Chemical control is one of the main measures for its management. The objective of this work was to evaluate the efficacy and selectivity of the fluxapyroxad fungicide on controlling the Asian soybean rust, under the edaphoclimatic conditions of the Cerrado biome. The experiment was conducted in an area under no-tillage system, in the Agricultural Research Center, Rio Verde, Goias, Brazil, during the 2012/2013 crop season, using the cultivar NA7337. A randomized block experimental design was used, with twelve treatments and four replications. The treatments consisted of applications of fluxapyroxad (FX, pyraclostrobin (PT, epoxiconazole (EX and metconazole (MZ. The average severity of the disease in the plants reached 37% in the Control. All treatments with fungicides differed from the Control. Treatments 9, 10, 11 and 12 provided the greatest rates of soybean rust control. The treatments 10, 11 and 12 had the highest thousand grain weights, and the yields of the treatments 2, 3 and 11, despite higher than the Control, were lower than the treatments 4, 5, 6, 7, 8, 9, 10 and 12, which had statistically equal yields. The increasing in yield, compared to the Control, ranged from 10.05% (pyraclostrobin, epoxiconazole + pyraclostrobin + mineral oil to 30.55% (pyraclostrobin, pyraclostrobin + fluxapyroxad + mineral oil and pyraclostrobin + metconazole + mineral oil. The highest rates of soybean rust control were presented by fungicides containing fluxapyroxad.
Effect of greenhouse conditions on the leaf apoplastic proteome of Coffea arabica plants.
Guerra-Guimarães, Leonor; Vieira, Ana; Chaves, Inês; Pinheiro, Carla; Queiroz, Vagner; Renaut, Jenny; Ricardo, Cândido P
2014-06-02
This work describes the coffee leaf apoplastic proteome and its modulation by the greenhouse conditions. The apoplastic fluid (APF) was obtained by leaf vacuum infiltration, and the recovered proteins were separated by 2-DE and subsequently identified by matrix assisted laser desorption/ionization time of flight-mass spectrometry, followed by homology search in EST coffee databases. Prediction tools revealed that the majority of the 195 identified proteins are involved in cell wall metabolism and in stress/defense responses. Although most of the proteins follow the classical secretory mechanism, a low percentage of them seem to result from unconventional secretion (leaderless secreted proteins). Principal components analysis revealed that the APF samples formed two distinct groups, with the temperature amplitude mostly contributing for this separation (higher or lower than 10°C, respectively). Sixty one polypeptide spots allowed defining these two groups and 28 proteins were identified, belonging to carbohydrate metabolism, cell wall modification and proteolysis. Interestingly stress/defense proteins appeared as more abundant in Group I which is associated with a higher temperature amplitude. It seems that the proteins in the coffee leaf APF might be implicated in structural modifications in the extracellular space that are crucial for plant development/adaptation to the conditions of the prevailing environment. This is the first detailed proteomic study of the coffee leaf apoplastic fluid (APF) and of its modulation by the greenhouse conditions. The comprehensive overview of the most abundant proteins present in the extra-cellular compartment is particularly important for the understanding of coffee responses to abiotic/biotic stress. This article is part of a Special Issue entitled: Environmental and structural proteomics. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ricardo Borges Pereira
2012-08-01
Full Text Available The rust and brown eye spot are the main coffee diseases. The losses are due to intense defoliation of plants, which has reduced its production and longevity. The brown eye spot also occurs in fruits, with negative effects on the beverage quality. Some essential oils have presented promising results in the control of plant diseases, as an alternative to the use of fungicides. The objective of this study was to evaluate citronella essential oil in the control of rust and brown eye spot and in the activation of coffee plants defense responses. Twelve-month-old plants were sprayed with citronella oil 1000 µL L-1, acibenzolar-S-methyl 200 mg L-1 and tebuconazole fungicide 200 mg L-1. Plants were inoculated with Hemileia vastatrix and Cercospora coffeicola seven days later. The application was repeated after 30 days. Plants with five months were sprayed with the same treatments to assess the induced defense responses. Citronella oil controlled rust and brown eye spot with efficiencies of 47.2% and 29.7%, respectively, while tebuconazole presented control of 96.5% and 90.5%, respectively. Acibenzolar-S-methyl reduced brown eye spot by 55.9% and showed no significant control of rust. Citronella oil increased peroxidase and chitinase activities in five months coffee plants 336, and 24 and 336 hours after spraying, respectively. Acibenzolar-S-methyl increased peroxidase, chitinase and ββ-1,3-glucanase activities 192, 288 and 336; 24 and; 240 hours after spraying, respectively. The treatments did not increase accumulation of phenols, but a significant increase in lignin was observed in plants sprayed with citronella oil.A ferrugem e a cercosporiose são as principais doenças de cafeeiro. Os prejuízos se devem a intensa desfolha das plantas que têm sua produção e longevidade reduzidas. A cercosporiose também ocorre nos frutos, com reflexos negativos na qualidade da bebida. Alguns óleos essenciais têm apresentado resultados promissores no
Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.
2016-01-01
A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031
Directory of Open Access Journals (Sweden)
Sundeep Kumar
Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.
Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C
2016-01-01
A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.
DIRECT AND INDIRECT SOMATIC EMBRYOGENESIS ON ARABICA COFFEE (Coffea arabica
Directory of Open Access Journals (Sweden)
Meynarti Sari Dewi Ibrahim
2013-10-01
Full Text Available Propagation of Coffea arabica L. through direct and indirect somatic embryogenesis technique is promising for producing large number of coffee seedlings. The objectives of the research were to evaluate methods for direct and indirect somatic embryo-genesis induction of C. arabica var. Kartika. The explants were the youngest fully expanded leaves of arabica coffee. The evalu-ated medium was modified Murashige and Skoog (MS medium supplemented with a combination of 2.26 µM 2,4-D + 4.54 or 9.08 µM thidiazuron; 4.52 µM 2,4-D + 4.54 or 9.08 µM thidiazuron; or 9.04 µM 2,4-D + 9.08 µM thidiazuron. Both calli (100 mg and pre-embryos developed from the edge of leaf explants were subcultured into regeneration medium (half strength MS with modified vitamin, supplemented with kinetine 9.30 µM and adenine sulfate 40 mg L-1. The results showed coffee leaf explant cultured on medium containing 2.26 µM 2,4-D + 4.54 or 9.08 µM thidiazuron to induce direct somatic embriogenesis from explant, while that of 4.52 or 9.04 µM 2,4-D + 9.08 µM thidiazuron to induced indirect somatic embrio-genesis. The medium for calli induction from coffee by explants was medium supplemented with 4.52 or 9.04 µM 2,4-D in combination with 9.08 µM thidiazuron. On the other hand, the best medium for activation of induction of somatic embryos was MS medium supplemented with 9.04 µM 2,4-D + 9.08 µM thidiazuron. Based on this results, the first step for developing micropropagation for coffee has been resolved. The subsequent studies will be directed to evaluate agronomic performance of the derived planting materials.
Losert, Dominik; Maurer, Hans Peter; Leiser, Willmar L; Würschum, Tobias
2017-04-01
Genome-wide association mapping of resistance against the novel, aggressive 'Warrior' race of yellow rust in triticale revealed a genetic architecture with some medium-effect QTL and a quantitative component, which in combination confer high levels of resistance on both leaves and ears. Yellow rust is an important destructive fungal disease in small grain cereals and the exotic 'Warrior' race has recently conquered Europe. The aim of this study was to investigate the genetic architecture of yellow rust resistance in hexaploid winter triticale as the basis for a successful resistance breeding. To this end, a diverse panel of 919 genotypes was evaluated for yellow rust infection on leaves and ears in multi-location field trials and genotyped by genotyping-by-sequencing as well as for known Yr resistance loci. Genome-wide association mapping identified ten quantitative trait loci (QTL) for yellow rust resistance on the leaves and seven of these also for ear resistance. The total genotypic variance explained by the QTL amounted to 44.0% for leaf and 26.0% for ear resistance. The same three medium-effect QTL were identified for both traits on chromosomes 1B, 2B, and 7B. Interestingly, plants pyramiding the resistance allele of all three medium-effect QTL were generally most resistant, but constitute less than 5% of the investigated triticale breeding material. Nevertheless, a genome-wide prediction yielded a higher predictive ability than prediction based on these three QTL. Taken together, our results show that yellow rust resistance in winter triticale is genetically complex, including both medium-effect QTL as well as a quantitative resistance component. Resistance to the novel 'Warrior' race of this fungal pathogen is consequently best achieved by recurrent selection in the field based on identified resistant lines and can potentially be assisted by genomic approaches.
Application of quantitative variables in the sampling method to evaluate the sugarcane rust brown
Directory of Open Access Journals (Sweden)
Joaquín Montalván Delgado
2017-01-01
Full Text Available To develop a system that increase the precision in the resistance evaluations to sugarcane brown rust disease through the use of the quantitative sampling, six cultivars of differential behavior versus the disease (PR980, My5514, Ja60-5, C334-64, C323-68 and B4362 were studied. A random block experimental design with three replications was used in a heavy infections conditions obtained from the cultivar highly susceptible B4362. The evaluations were done at three and five months of age, in the three-thirds: bottom, half and top of the +1, +3 and +5 sugarcane plant leaves of 10 plants for replica. The variable total leaf area affected of the leaf and in each third was analyzed. In 2 cm2 were observed the long and wide of the biggest and more frequent pustule, the total of pustule and the area of the biggest and more frequent pustule, and the area percentage occupied by the most frequent pustule by each cm2 were determined. Variance analysis and Tukey tests as well as confidence intervals analysis to determine the coefficient to use as constant of the pustule width, due to the little variation of this parameter were realized. The +3 leaf represented the half infection of the incidence of the brown rust, constituting for it the most appropriate to carry out the observations and the half third. An equation was also obtained to calculate the area occupied by pustules with a high level of confidence.
Tully, Katherine L; Lawrence, Deborah
2012-06-01
In a coffee agroforest, the crop is cultivated under the shade of fruit-bearing and nitrogen (N)-fixing trees. These trees are periodically pruned to promote flowering and fruiting as well as to make nutrients stored in tree biomass available to plants. We investigated the effect of canopy composition and substrate quality on decomposition rates and patterns of nutrient release from pruning residues in a coffee agroforest located in Costa Rica's Central Valley. Initial phosphorus (P) release was enhanced under a canopy composed solely of N-fixing, Erythrina poeppigiana compared to a mixed canopy of Erythrina and Musa acuminata (banana). Both initial and final N release were similar under the two canopy types. However, after five months of decomposition, a higher proportion of initial N had been released under the single canopy. Although patterns of decomposition and nutrient release were not predicted by initial substrate quality, mass loss in leaf mixtures rates were well predicted by mean mass loss of their component species. This study identifies specific pruning regimes that may regulate N and P release during crucial growth periods, and it suggests that strategic pruning can enhance nutrient availability. For example, during the onset of rapid fruit growth, a two-species mixture may release more P than a three-species mixture. However, by the time of the harvest, the two- and three-species mixtures have released roughly the same amount of N and P. These nutrients do not always follow the same pattern, as N release can be maximized in single-species substrates, while P release is often facilitated in species mixtures. Our study indicates the importance of management practices in mediating patterns of nutrient release. Future research should investigate how canopy composition and farm management can also mediate on-farm nutrient losses.
DEFF Research Database (Denmark)
Strøbæk, Pernille Solveig
2015-01-01
The chapter explores how coffee is an integral part of our daily life. Focusing on coffee drinking at home, at work, and on the go I show that coffee consumption is a social practice. The chapter illustrates through everyday examples that coffee is more than a caffeine drug. Coffee, with or without...... caffeine, is a social lubricant. We talk to each other and share emotions with one another as we share a cup of coffee. Coffee makes conversation and we embrace coffee, to stay or to go, in the daily rhythm of our busy and global social existence. The practice and sociality of coffee consumption provide...... the coffee industry with the opportunity to make money on our coffee preferences – indeed, also for those of us who actually dislike the taste of coffee. Would you prefer coffee mixed and stirred with non-coffee products such as salt, caramel and licorice? Then you are one of us in the modern age of coffee...
International Nuclear Information System (INIS)
Starosvetsky, J.; Kamari, R.; Farber, Y.; Bilanović, D.; Armon, R.
2016-01-01
Highlights: • The present study demonstrated the high reductive capacity of both strains: the collection S. oneidensis and the wild strain Geobacter spp. (soil isolate). • The experimental strains were successful in Fe 3+ reduction for both states: soluble and crystalline (originally prepared from rust). • Rust dissolution can be improved by: addition of AFC at low concentration (0.2 g/l), increasing bacterial initial inoculum and rust reactive surface. • Both experimental IRB strains were able to completely remove previously formed rust on carbon steel coupons. • Additional results (not showed) revealed that culture S. oneidensis and the environmental isolate Geobacter spp., apparently have a different mechanism of iron reduction that requires further study. - Abstract: Iron reducing bacteria (IRB), to be used in rust dissolution and removal, have been isolated and enriched from different environmental sources. Comparative measurements revealed that a soil isolate (Geobacter sulfurreducens sp.) had the highest reductive activity equivalent to Shewanella oneidensis (strain CIP 106686, pure culture). Both reductive microorganisms can use Fe 3+ ions as electron acceptors from soluble as well as from crystalline sources. In nutrient medium containing soluble Fe 3+ , the highest reductive activity obtained for G. sulfurreducens sp. and S. oneidensis was 93 and 97% respectively. Successful removal of rust from carbon steel coupons has been achieved with both experimental bacteria.
Effects of Variety and Fungicidal Rate on Cercospora Leaf Spots ...
African Journals Online (AJOL)
Singh, V.R., Pandes, A.K., Reddy, P.M. and. Pao P.V. (1995). Resistance to Rust and Late leaf Spot of Groundnut. ICRISAT. Information Bulletin. No.47, Patancheru,. 502, 324, Andra Pradesh, India. P.24. Thapar, S., Bhusham, R. and Mathur, R.P.. (1995). Degradation of organophosphorus and carbamate pesticides in soils- ...
Directory of Open Access Journals (Sweden)
Stuart Mccook
2008-06-01
Full Text Available As epidemias agrícolas fornecem um ponto de vista privilegiado para a história ambiental global e transnacional de commodities. A epidemia da ferrugem, causada pelo fungo Hemileia nastatrix, é uma das mais sérias doenças que têm atingido a indústria global de café. No século XIX, ela devastou as plantações de café no Velho Mundo. Também reduziu agudamente a produção de café do tipo arábica na África, Ásia e no Pacífico. Esse foi um dos fatores que permitiu aos países da Américas dominarem a produção global no século XX. Essa epidemia foi detectada nas Américas pela primeira vez na década de 1970. A sua história nas Américas, e as tentativas de seu controle lançam luzes sobre dois paradigmas maiores que moldaram a história ambiental do café no final do século XX. São eles: o paradigma tecnicista, dominante entre meados do século XX até o início dos anos 1990; e o paradigma da sustentabilidade, cujo domínio emergiu em meados dos anos 1980 e se mantém até o presente.Crop epidemics provide a portal into the global and transnational environmental history of commodities. The coffee rust epidemic, caused by the fungus Hemileia vastatrix, is one of the most serious diseases to have afflicted the global coffee industry. In the nineteenth century, it devastated the coffee plantations in the Old World. It sharply curtailed arabica coffee production in Africa, Asia, and the Pacific. This was one of the factors that allowed the Americas do dominate global coffee production in the twentieth century. The coffee rust epidemic was first detected in the Americas in the 1970s. The history of the rust epidemic in the Americas, and attempts to control it, shed light on two major paradigms that shaped the environmental history of coffee in the late twentieth century. The paradigm of technification, which dominated from the mid-20th century to the early 1990s; and the paradigm of sustainability, which dominated emerged in the
Structure of titanium-doped goethite rust
International Nuclear Information System (INIS)
Nakayama, Takenori; Ishikawa, Tatsuo; Konno, Toyohiko J.
2005-01-01
To investigate the influence of titanium addition on the formation and structure of goethite (α-FeOOH) rust which is one of main corrosion products of weathering steel, the artificially synthesized α-FeOOH rusts were prepared by hydrolysis of aqueous solutions of Fe(III) containing Ti(IV) at different atomic ratios (Ti/Fe) in the range 0-0.1. The obtained rusts particles were observed by TEM. Characterization by XRD, N 2 absorption, Moessbauer spectroscopy was also done. TEM observation revealed that the α-FeOOH rust particle size increased with the increase of Ti/Fe, and that Ti-enriched poorly crystalline particles were formed around the rust particles. XRD confirmed that the crystallite size increased with the increase of Ti/Fe, while the XRD peaks decreased in intensity. Specific surface area obtained by N 2 absorption increased with the increase of Ti/Fe. It is deduced from the obtained results that the addition of Ti(IV) increases the crystallite size of α-FeOOH, and produces double domain particles consisting of the particle core and a porous poorly crystalline shell. It is thought that such unique rust structure produced by titanium addition contributes to the protective properties of rust layer of the weathering steel
Strategies for improving rust resistance in oats
International Nuclear Information System (INIS)
Harder, D.E.; McKenzie, R.I.H.; Martens, J.W.; Brown, P.D.
1977-01-01
During the history of breeding oats for rust resistance in Canada the known sources of resistance proved inadequate to counter the virulence potential of both stem rust (Puccinia graminis avenae) and crown rust (P. coronata avenae). A major programme to overcome the rust problem was undertaken at Winnipeg, involving four alternate approaches: (1) A search for new resistance in wild oat species, particularly Avena sterilis, has provided a wealth of good resistance to crown rust, but less to stem rust. Much of the A. sterilis-derived crown rust resistance is now being used world-wide; (2) Efforts at synthesizing new resistance by mutation breeding methods have not been successful. Of about seven million plants examined, only one showed significant new resistance, but this was associated with poor plant type; (3) Resistance with low levels of expression but which appears broadly effective has been observed against both stem and crown rusts. It appears that numbers of these low-level genes exist, and that they can be accumulated to provide increasingly effective resistance. Problems in using this type of resistance in a practical way are discussed; (4) Excellent rust resistance has been found in lower ploidy species such as A. barbata, but it was not previously possible to stabilize this resistance in hexaploid species. By using mutagenic treatments attempts have been made to translocate smaller portions of the A. barbata chromosome carrying the resistance to the hexaploid cultivar Rodney. In conclusion, mutation breeding methods at present appear to have limited application in synthesizing new rust-resistant genotypes in oats. The search for already existing genetic resistance and its synthesis into multi-genic resistant lines appears to be the most effective way at present of resolving the rust problem in oats. (author)
Energy Technology Data Exchange (ETDEWEB)
Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.
2016-11-01
Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)
Cercosporiose progression in the agroforestry consortium coffee-rubber trees
Directory of Open Access Journals (Sweden)
Humberto Godoy Androcioli
2015-12-01
Full Text Available Cercospora coffeicola is one of the primary diseases that affect coffee plants. Studies indicate that shaded coffee plants reduce the incidence of this disease and that the management of trees and coffee plants arrangement influence in the dissemination of cercospora. The objective of this study was to evaluate the incidence and severity of C. coffeicola at different distances from double rows of rubber trees (Hevea brasiliensis muell. arg. at two different sunlight exposures (north and south. This study was conducted in Londrina, Parana, between 2008 and 2010, with adult plants of the IAPAR 59 cultivar (Coffea arabica L. grown at a spacing of 2.5 m x 1.0 m. The distances between the double rows of rubber trees were 13, 16 and 22 m, compared to plants grown under full sun. The disease incidence was assessed monthly by using a non-destructive method. This analysis was conducted on coffee leaves from the third and fourth pairs of two plagiotropic branches, on eight plants per plot, with five replications. These data were used to calculate the area under the curve for the incidence of the brown eye spot. The highest disease incidence occurred in the coffee plants grown under full sun, whereas lowest disease occurred on plants located at up to two meters away from double rows of rubber trees. The incidence of Cercospora leaf spot increased with the distance from the double rows of rubber trees. The results demonstrate that the mapping of cercospora incidence in shaded coffee plants is essential to determinate the best spacing and plants arrangement.
Nitrogen fertilization of coffee: organic compost and Crotalaria juncea L.
Directory of Open Access Journals (Sweden)
João Batista Silva Araujo
2013-12-01
Full Text Available Information concerning the response of coffee to organic fertilizers is scarce. This study evaluates the effect of different doses of compost and Crotalaria juncea L. on growth, production and nitrogen nutrition of coffee trees. The treatments consisted of compost at rates of 25, 50, 75 and 100% of the recommended fertilization, with or without the aerial part of C. juncea. C. juncea was grown with NH4-N (2% 15N and applied to coffee. The use of C. juncea increased growth in height and diameter of the coffee canopy. In the first year, the percentage of N derived from C. juncea reached 8.5% at seven months and 4.1% at fifteen months after fertilization. In the second year, the percentage of N derived from C. juncea reached 17.9% N at the early harvest, five months after fertilization. Increased rates of compost increased pH , P , K , Ca , Mg , sum of bases , effective CEC, base saturation and organic matter and reduced potential acidity. 15N allowed the identification of the N contribution from C. juncea with percentage of leaf N derived from Crotalaria juncea from 9.2 to 17.9%.
Directory of Open Access Journals (Sweden)
Luís García-Barrios
2017-06-01
Full Text Available Small-scale coffee farmers understand certain complex ecological processes, and successfully navigate some of the challenges emerging from the ecological complexity on their farms. It is generally thought that scientific knowledge is able to complement farmers' knowledge. However, for this collaboration to be fruitful, the gap between the knowledge frameworks of both farmers and scientists will need to be closed. We report on the learning results of 14 workshops held in Chiapas, Mexico during 2015 in which 117 small-scale coffee farmers of all genders (30% women and ages who had little schooling were exposed by researchers to a natural history narrative, a multispecies network representation, a board game, and a series of graphical quizzes, all related to a nine-species complex ecological network with potential for autonomous control of the ongoing and devastating coffee rust epidemic that was affecting them. Farmers' retention and understanding of direct and indirect bilateral interactions among organisms was assessed with different methods to elucidate the effect of adding Azteca Chess gaming sessions to a detailed and very graphical lecture. Evaluation methods that were better adapted to farmers' conditions improved learning scores and showed statistically significant age effect (players older than 40 had lower retention scores and gaming effect (lower retention of interactions included in the lecture but not in the game. The combination of lecture and game sessions helped participants better understand cascades of trait-mediated interactions. Participants' debriefings confirmed qualitatively that they learned that beneficial organisms and interactions occur on their farms, and that gaming was enjoyable, motivating, and critical to grasp complex interactions. Many of the farmers concluded that the outcome of these interactions is not unique and not always in favor of rust control but is context dependent. Many concluded that there are
Screening oat populations for rust resistant mutants
International Nuclear Information System (INIS)
McKenzie, R.I.H.; Martens, J.W.; Harder, D.E.; Brown, P.D.
1976-01-01
In 1972 a two million M 2 plants were grown at Morden, Manitoba. Thirteen plants which were thought to have possible resistance to race CI0 of oat stem rust were harvested. After extensive seedling and adult plant rust tests the best of the selected plant progenies was crossed and backcrossed to Rodney 0, a stem rust susceptible oat. The resistance in this line M-72-6 was found to be controlled by a single gene. In 1973 another two million M 2 plants were examined for rust resistance at Morden and 38 were harvested. None of the M 2 plants selected in 1973 appeared to have any seedling or adult resistance when examined more thoroughly in the greenhouse and again in the field in 1974. In 1974 one million M 2 plants were examined for resistance and 73 selected. None appeared to have any resistance when tested further. The strain CI3034 which was good adult plant stem rust resistance associated with weak straw and a light green plant colour was treated with gamma radiation and EMS in 1973 and the M 2 grown in the C10 rust nursery at Morden in 1974. A considerable number of dark green plants were present in all treatments but unfortunately all were found to be stem rust susceptible. Thus it would appear to be difficult if not impossible to separate the rust resistance in CI3034 from the undesirable characters, weak straw and light green plant colour. (author)
Induced resistance to rust disease in lentil
International Nuclear Information System (INIS)
Paul, Amitava; Singh, D.P.
2006-01-01
Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)
Muleta, Kebede T; Rouse, Matthew N; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G; Pumphrey, Michael O
2017-08-04
The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90 K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations. Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons, and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust in all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three loci on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel. Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in
Inheritance of resistance to orange rust in sugarcane
Orange rust, caused by Puccinia kuehnii, is an economically important disease in the Florida sugarcane industry. In this study, orange rust reactions of seedlings in progenies originating from 12 crosses between female and male parents with differing resistance to orange rust (three of each categor...
Directory of Open Access Journals (Sweden)
Liliana M Cano
Full Text Available Pucciniamonoica is a spectacular plant parasitic rust fungus that triggers the formation of flower-like structures (pseudoflowers in its Brassicaceae host plant Boecherastricta. Pseudoflowers mimic in shape, color, nectar and scent co-occurring and unrelated flowers such as buttercups. They act to attract insects thereby aiding spore dispersal and sexual reproduction of the rust fungus. Although much ecological research has been performed on P. monoica-induced pseudoflowers, this system has yet to be investigated at the molecular or genomic level. To date, the molecular alterations underlying the development of pseudoflowers and the genes involved have not been described. To address this, we performed gene expression profiling to reveal 256 plant biological processes that are significantly altered in pseudoflowers. Among these biological processes, plant genes involved in cell fate specification, regulation of transcription, reproduction, floral organ development, anthocyanin (major floral pigments and terpenoid biosynthesis (major floral volatile compounds were down-regulated in pseudoflowers. In contrast, plant genes involved in shoot, cotyledon and leaf development, carbohydrate transport, wax biosynthesis, cutin transport and L-phenylalanine metabolism (pathway that results in phenylethanol and phenylacetaldehyde volatile production were up-regulated. These findings point to an extensive reprogramming of host genes by the rust pathogen to induce floral mimicry. We also highlight 31 differentially regulated plant genes that are enriched in the biological processes mentioned above, and are potentially involved in the formation of pseudoflowers. This work illustrates the complex perturbations induced by rust pathogens in their host plants, and provides a starting point for understanding the molecular mechanisms of pathogen-induced floral mimicry.
Radiation disinfestation of tobacco leaves and coffee beans
International Nuclear Information System (INIS)
Soemartaputra, M.H.; Rosalina, S.H.; Rahayu, A.; Harsojo; Kardha, S.
1985-01-01
The most important insects found on coffee and tobacco in storage are A. fasciculatus and L. serricorne, respectively. Some genera of mold, such as Rhyzopus, Aspergillus, Penicillium and Mucor, were found on stored coffee. A preliminary study of radiation disinfestation of coffee beans was carried out using 24 bags (each l.5 kg) of Arabica coffee. Each bag was infested with l00 adults of l-day-old to 8-day old A. fasciculatus. One month after infestation, the bags were divided into 6 groups (4 bags each). Five groups were irradiated with doses of 0, 0.05, 0.l0, 0.20, and 0.40 kGy, while the sixth group was fumigated with about 3 g phosphine-m/sup 3/. The work is still in progress. The preliminary data (insect density, percentage weight loss of coffee beans, and mold infestation) from l0 observation periods during 20 weeks of storage after treatment was reported. Radiation disinfestation of tobacco was done on 36 export-size bales (each l00 x 75 x 40 cm in size and about k00 kg in weight) of tobacco. Each bale was infested with larvae, pupae, and adults of L. serricorne. One week after infestation, the bales were divided into 3 groups, the first group kept untreated as controls, the second group irradiated at a dose range of 0.30 to 0.60 kGy, and the third group fumigated with about 3 g phosphine/m/sup 3/. Insect density, leaf moisture content and mold infestation will be observed after 0, 2, 4, and 6 months of storage. The work was begun in October l983 and data presently are being collected
Directory of Open Access Journals (Sweden)
Rotimi Rufus Ipinmoroti
2014-06-01
Full Text Available A study was conducted to assess nutrient dynamics of soils under old and young cocoa, coffee and cashew plantations and the leaf nutrient contents of the crops at Uhonmora, Edo State, Nigeria for proper cultural and soil fertility management of the plantations. Soil and crop leaf samples were collected from each plantation using a random sampling technique. The samples were analyzed using standard procedures for sand, silt, clay, pH (H2O, electrical conductivity (EC, total N, available P, K, Ca, Mg, Na, and Effective Cation Exchange Capacity (ECEC. Leaf samples were analyzed for N, P, K, Ca, Mg and Na. Data were compared with the corresponding soil and foliar critical nutrient values for each crop. Results indicated that the soils were texturally sandy clay loam and acidic. The soils varied in their nutrient contents, with soil P for the old cocoa, young coffee and cashew plantations far below critical values. The young cashew plot was low in N content but adequate for other plots. However, the soil ECEC increased with the increasing of calcium contents. Leaf N was below critical for all the crops. Leaf K was low for cocoa and coffee plants, leaf Ca was low for the young cashew plants, while leaf Mg was low for the young cocoa and old cashew. The high soil Mg/K ratio of 8.7- 22.3 as against the established value of 2.0 might have resulted in gross nutrient imbalance which must have affected the absorption and utilization of other nutrients. Hence, adequate soil N did not translate the same availability to the crops. The ECEC showed that the soil needs to be improved upon for sustainable productivity. Soil nutrient content variation across the plantations with age of establishment will necessitate the need for consistent routine soil nutrient assessment for proper and balanced soil nutrient supply to the crops, for healthy crop growth and optimum yield. Management practices of soil surface mulching using organic wastes and cover crops under
Ion beam analysis of ground coffee and roasted coffee beans
International Nuclear Information System (INIS)
Debastiani, R.; Santos, C.E.I. dos; Yoneama, M.L.; Amaral, L.; Dias, J.F.
2014-01-01
The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans
Ion beam analysis of ground coffee and roasted coffee beans
Energy Technology Data Exchange (ETDEWEB)
Debastiani, R., E-mail: rafa_debas@yahoo.com.br; Santos, C.E.I. dos; Yoneama, M.L.; Amaral, L.; Dias, J.F.
2014-01-01
The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans.
Induced resistance and gene expression in wheat against leaf rust ...
African Journals Online (AJOL)
uvp
2013-05-15
associated molecular .... Total RNA was extracted from approximately 0.1 g ground leaf tissue harvested at 0, 24, 48, 72, 96 and ... The RNA was finally dissolved in 100 µl 0.1% (v/v) DMPC treated water. Residual DNA was eliminated ...
Cornelis, Marilyn C
2012-01-01
Coffee is one of the most widely consumed beverages in the world. Its widespread popularity and availability has fostered public health concerns of the potential health consequences of regular coffee consumption. Epidemiological studies of coffee intake and certain health outcomes have been inconsistent. The precise component of coffee potentially contributing to development of these conditions also remains unclear. One step toward addressing the challenges in studying the impact coffee has on health is a better understanding of the factors contributing to its consumption and physiological effects. This chapter focuses on those factors that are genetically determined and briefly summarizes progress in applying this knowledge to epidemiological studies of coffee and disease. Copyright © 2012 Elsevier Inc. All rights reserved.
Yellow Rust Resistance in Advanced Lines and Commercial ...
African Journals Online (AJOL)
The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines that differed ...
Loope, Lloyd; La Rosa, Anne Marie
2010-01-01
In April 2005, the rust fungus Puccinia psidii (most widely known as guava rust or eucalyptus rust) was found in Hawai'i. This was the first time this rust had been found outside the Neotropics (broadly-defined, including subtropical Florida, where the rust first established in the 1970s). First detected on a nursery-grown 'ohi'a plant, it became known as ''ohi'a rust'in Hawai'i. The rust spread rapidly and by August 2005 had been found throughout the main Hawaiian Islands. The rust probably reached Hawai'i via the live plant trade or via the foliage trade. In Hawai'i, the rust has infected three native plant species and at least eight non-native species. Effects have been substantial on the endangered endemic plant Eugenia koolauensis and the introduced rose apple, Syzygium jambos. Billions of yellow, asexual urediniospores are produced on rose apple, but a complete life cycle (involving sexual reproduction) has not yet been observed. The rust is autoecious (no alternate host known) on Myrtaceae. The strain introduced into Hawai'i is found sparingly on 'ohi'a (Metrosideros polymorpha), the dominant tree of Hawai'i's forests, with sporadic damage detected to date. The introduction of a rust strain that causes widespread damage to 'ohi'a would be catastrophic for Hawai'i's native biodiversity. Most imports of material potentially contaminated with rust are shipped to Hawai'i from Florida and California (from which P. psidii was reported in late 2005 by Mellano, 2006). Florida is known to have multiple strains. The identity of the strain or strains in California is unclear, but one of them is known to infect myrtle, Myrtus communis, a species commonly imported into Hawai'i. It is important to ecosystem conservation and commercial forestry that additional rust strains or genotypes be prevented from establishing in Hawai'i. The purpose of this analysis of risk is to evaluate the need for an interim rule by the Hawai'i Department of Agriculture to regulate plant
Trevisan, Maria Teresa Salles; Owen, Robert Wyn; Calatayud-Vernich, Pau; Breuer, Andrea; Picó, Yolanda
2017-08-25
An analytical method using a quick, easy, cheap, effective, rugged and safe (QuEChERS) procedure for multi-residue determination of 52 pesticides in coffee leaf extractshas been developed and validated according to SANTE/11945/2015 guidelines. Different sorbent combinations for dispersive solid phase extraction (d-SPE) clean-up as well as dispersive liquid-liquid microextraction (DLLME) were tested. The relative standard deviations (RSDs) for the recovery of 87-94% of pesticides added to coffee leaf extracts,was ≤20% for samples spiked at concentrations up to 50ng*g -1 depending on the clean-up procedures. However, samples spiked with a 100ng*g -1 pesticide mixture gave RSDs>20% for most pesticides when d-SPE was carried out adding Supelclean ENVI-Carb 120/400. To explain this fact,the secondary metabolic profile was analyzed in all the extraction and clean-up procedures. Only in the clean-up procedure with the addition of Supel QuE Z-Sep+, does caffeine show a constant adsorption between blank and spiked samples. In other clean-up procedures, the amount of caffeine was higher in those samples spiked with pesticides. This indicates competition between caffeine and pesticides for adsorption to the sorbent. Addition of Supel QuE Z-Sep+ to the procedure revealed only a 32% matrix effect, whereas using PSA+ C18 the matrix effect was close to 97%. The process efficiency is up to 54% with the addition of Supel QuE Z-Sep+ and just up to 7% for the other clean-up procedures. The method was successfully tested in coffee leaves from different types of cultivars. Pesticides were not detected in organic coffee leaf extracts, but thiametoxan was clearly detected in 50% of coffee leaf extracts harvested from coffee trees grown under traditional conditions as determined by UHPLC-TOFMSLC/QqTOF-MS/MS. Copyright © 2017 Elsevier B.V. All rights reserved.
Historic Rust College: Fulfilling a Mission.
Hoffman, Carl
1989-01-01
Describes Rust College, a Mississippi college dedicated to educating Blacks from economically and educationally impoverished backgrounds. Discusses the college's financial management, recent fund-raising efforts, building program, and academic programs. Examines the role of the predominantly Black college and Rust's mission to help students…
Assessment of Cellular Mutagenicity of Americano Coffees from Popular Coffee Chains.
Liu, Zhen-Shu; Chen, Po-Wen; Wang, Jung-Yu; Kuo, Tai-Chen
2017-09-01
Coffee is a popular beverage worldwide, but coffee beans can be contaminated with carcinogens. The Ames Salmonella mutagenicity test is often used for analysis of carcinogens for mutagenicity. However, previous studies have provided controversial data about the direct mutagenicity of coffee beans based on Ames test results. This study was conducted to determine the mutagenicity of popular Americano coffee based on results from the Ames test. Coffee samples without additives that were served by five international coffee chain restaurants were subjected to the analysis using Salmonella Typhimurium tester strains TA98, TA100, and TA1535. The levels of bacterial revertants in samples from coffee chains were lower than the twofold criterion of the control sets, and no significant dose-response effect was observed with or without rat liver enzyme activation. These data indicate that Americano coffees from the selected coffee chains possessed no direct mutagenic activity with or without enzyme activation. These findings suggest a low mutagenic risk from Americano coffees served by the selected coffee chains and support the use of other methods to confirm the nonmutagenicity of coffee products. These results are consistent with most recent epidemiological reports.
29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...
African Journals Online (AJOL)
rust pathogen. The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines ...
Murekezi, Abdoul Karim; Loveridge, Scott
2009-01-01
Low prices in the international coffee markets have worsened the economic well-being among coffee farmers. In the face of this situation, the Government of Rwanda has introduced coffee sector reforms that aimed to transform the sector in a way that targets the high quality market and moves away from the bulk coffee market. The high quality coffee market has shown consistent growth over time and exhibits price premiums in international market. If these high prices are passed on to farmers who ...
Hudson, Alex
2013-01-01
Brew the perfect code with CoffeeScript If you're familiar with JavaScript and the often-frustrating process of creating complex applications, a nice cup of CoffeeScript can help. CoffeeScript is a programming language that compiles into JavaScript and simplifies the entire development process. Now you can tap the full power of CoffeeScript with Smashing CoffeeScript. This full-color, practical book explains CoffeeScript language, syntax, and processes, and will soon have you producing concise and quality code. Ultimately, you'll create RIAs and mobile apps faster, with less
Shaded Coffee: A way to Increase Sustainability in Brazilian Organic Coffee plantations
Moreira, Cassio Franco; De Nadai Fernandes, Elisabete A.; Tagliaferro, Fábio Sileno
2008-01-01
Consumption of specialty coffee, mainly organic coffee, increases worldwide following the tendency of consuming social and ecological sustainable products. Brazil is the world largest coffee producer, with an average of 2,300,000 tons of green coffee in the last 5 years. Cultivation of organic coffee and shaded coffee are common in Central America, while in Brazil both conventional and organic coffee are cultivated in the full sun system. The full sun system is criticized due to the lack of b...
2004-01-01
The rust color of the Martian landscape is apparent in this low-resolution thumbnail image taken by the panoramic camera on the Mars Exploration Rover Spirit. This image is part of a larger image currently stored onboard the rover in its memory.
Development of RAPD based markers for wheat rust resistance ...
African Journals Online (AJOL)
Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...
Survey the Effect of Mycorrhiza and Azospirillum of Wheat Cultivars Resistance in Yellow Rust
Directory of Open Access Journals (Sweden)
M. Jiriaie
2017-01-01
-levels (non-inoculated seeds and inoculated seed and wheat cultivars in three levels, Chamran (bread wheat, Dena and Behrang (durum wheat varieties. In this experiment evaluated, to yellow rust disease, the intensity of infection, the average coefficient of infection, type of infection and area under disease progress curve (AUDPC. Infection type and disease severity were also recorded at flag leaf stage using modified Cobb’s scale. First symptoms of yellow rust were observed in middle January of 2013. Analysis of variance was performed using PROC ANOVA of SAS (version 9.1.3, 2004The comparison of the means was done by Duncan test at a probability level of 5 percent. Results and Discussion: Survey on the resistance to yellow rust in wheat cultivars treated with Mycorrhiza and Azospirillum showed that seed inoculation with Azospirillum traits reduced between 10 percent to 13 percent and the use strains of Mycorrhiza fungi intensity of infection 45-51 percent, the average coefficient of infection and AUDPC 74-85 percent respectively for G. intraradices and G. mosseae strains have been reduced compared with control and Chamran cultivar between 40-70 percent showed more Sensitivity to disease from durum varieties. Generally, the lowest of infection intensity (18.33 was obtained from inoculation of C.V Dena seeds with Azospirillum and G. mosseae strain. According to the result, we found yellow rust in all experiment field also the incidence varied between 10-70 percent. Therefore, it is concluded that, given the climatic conditions favorable to the spread of yellow rust, the incidence of yellow rust in the region that have a high degree of pathogenicity. In general the results of this test, mycorrhiza application has a significant role in enhancing wheat resistance to yellow rust. The seed inoculation with Azospirillum although did not have significant role in disease control, but increased at an acceptable level resistance to wheat rust. But the important point was the combined
Characterization of stem rust resistance gene Sr2 in Indian wheat ...
African Journals Online (AJOL)
Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...
Spices Coffee : Innovation Strategy To Increase Quality On Powder Coffee Farmers
Amir, I. T.; Indah, P. N.; Widayanti, S.
2018-01-01
The purpose of the study is a) to analyze the condition of internal environment industry spices coffee, b) to analyze the condition of the external environment industry spices coffee, and c) to determine the technological innovation strategy spices coffee in order to improve the competitiveness of the coffee people. Most of the coffee grown in Tutur district is cultivated by smallholder farms, resulting in low quality. The strategy of coffee spice agro-industry aims to increase the added value of the products so that farmers obtain higher coffee prices. Activities include the provision of raw materials, processing, supply of final products, and marketing.The results showed that the internal environmental conditions that have the highest value is the strengthen factors. The highest score of strengthen factors is the availability of coffee, availability of labor and communications group. The highest score of opportunity factors is technological assistance from the government and other government support for the development of people’s coffee industry and high market potential. The development of agrotourism should improve as well as expand the network to seize market. The strategy should be applied in the development of spices coffee industry is to support aggressive growth (Growth-oriented strategy).
Physiological aspects of seedling development of coffee grown under colored screens
International Nuclear Information System (INIS)
Henrique, Paola de Castro; Alves, Jose Donizeti; Livramento, Darlan Einstein do; Goulart, Patricia de Fatima Pereira
2011-01-01
The objective of this work was to evaluate the physiological aspects of the development of coffee seedlings grown under colored screens with different spectral characteristics. Seedlings of Catucai Amarelo 2SL, in the stage known as 'orelha de onca', were arranged in a randomized block design, with five replicates, under structures individually covered with blue, white, gray, black or red screens with 50% shade. Four months after, evaluations were done for seedling growth, pigment content of the leaves, total soluble sugars and starch contents of the leaves and roots. The red screen was the most effective in promoting growth in four out of the seven studied traits: plant height, leaf area and leaf dry weight and total dry matter. For the other characteristics, there was no difference among the screens. The pigment analysis showed that, except for the gray screen, the other ones did not differ for this trait. In leaves, the red screen promoted higher levels of carbohydrates and starch. At the root, carbohydrate contents were higher under the red and black screens. Among the five screen colors, the red one was the most efficient in the production of coffee seedlings with higher vigor and quality, with outstanding carbohydrate contents and biomass. (author)
Analysis of acrylamide in coffee and dietary exposure to acrylamide from coffee
DEFF Research Database (Denmark)
Granby, Kit; Fagt, Sisse
2004-01-01
An analytical method for analysing acrylamide in coffee was validated. The analysis of prepared coffee includes a comprehensive clean-up using multimode solid-phase extraction (SPE) by automatic SPE equipment and detection by liquid chromatography tandem mass spectrometry using electrospray...... in the positive mode. The recoveries of acrylamide in ready-to-drink coffee spiked with 5 and 10 mug l(-1) were 96 +/- 14% and 100 +/- 8%, respectively. Within laboratory reproducibility for the same spiking levels were 14% and 9%, respectively. Coffee samples (n = 25) prepared twice by coffee machines and twice...... by a French Press Cafetiere coffee maker contained 8 +/- 3 mug l(-1) and 9 +/- 3 mug l(-1) acrylamide. Five ready-to-drink instant coffee prepared twice contained 8 +/- 2 mug l(-1). Hence, the results do not show significant differences in the acrylamide contents in ready-to-drink coffee prepared by coffee...
The effect of dewaxing of green coffee on the coffee brew
Stegen, G.H.D. van der
1979-01-01
The two commercially most important mild treatments for green coffee are the steam treatment and the dewaxing process. In the former treatment the green coffee is just steamed. In the dewaxing process the waxy layer is extracted from the green coffee with an organic solvent, after which this coffee
Wheat Rust Information Resources - Integrated tools and data for improved decision making
DEFF Research Database (Denmark)
Hodson, David; Hansen, Jens Grønbech; Lassen, Poul
giving access to an unprecedented set of data for rust surveys, alternate hosts (barberry), rust pathotypes, trap nurseries and resistant cultivars. Standardized protocols for data collection have permitted the development of a comprehensive data management system, named the Wheat Rust Toolbox....... Integration of the CIMMYT Wheat Atlas and the Genetic Resources Information System (GRIS) databases provides a rich resource on wheat cultivars and their resistance to important rust races. Data access is facilitated via dedicated web portals such as Rust Tracker (www.rusttracker.org) and the Global Rust...
Contribution to Kinetics of Formation of White Rust on Galvanized Steel
International Nuclear Information System (INIS)
Han, D. J.; Pyun, Su Il; Hahn, Y. D.
1981-01-01
Kinetics of formation of white rust on galvanized steel coated with various chromating solutions was studied. White rust occurs as a mixture of zinc oxide and zinc hydroxide. White rust formation rate was measured with a salt spray test as related to Cr 3+ ion amount, ratio of Cr 3+ to Cr 6+ ion(by weight) and surface roughness of the chromate film. Incubation time of white rust formation increased as the ratio of Cr 3+ to Cr 6+ ion in the chromate film increased. White rust propagation rate decreased as the amount of Cr 3+ ion increased. Surface roughness had no detectable relationship with incubation time and white rust propagation rate. Experimental results showed that kinetics of white rust formation was as follows: chromate film consists of insoluble Cr 3+ ion and soluble Cr 6+ ion, the latter act: as a corrosion inhibitor. Leaching rate of Cr 6+ ion from the film decreases with an increase of the ratio of Cr 3+ to Cr 6+ ion in the chromate film. When Cr 6+ ion is leached from the film, a bare zine layer is exposed to air and discontinuities occur in the film where white rust formation is initiated. Further white rust formation occurs due to destruction of the chromate film by chlorine ion. It is concluded that two stages of white rust formation are present and can be ascribed to Cr 6+ ion leaching and destruction of the chromate film by chlorine ion
Swindells, Steve; Burcikova, Mila
2013-01-01
Articulated as a practice of design-couture, conceptualized as a project that seeks a sense \\ud of social engagement through research, design and making of everyday ‘common couture’, \\ud Rusted puts craft action in a very close relation with daily (political) or practical life. Rusted \\ud designs collage pre-used fabric and clothing (found, bought or gifted) with new cloth, thus \\ud using items of fabric and clothing from different times, countries and with variety of social \\ud histories. Th...
Balbaert, Ivo
2015-01-01
This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.
DEVELOPMENT OF COFFEE MARKET AND CHANGES IN COFFEE CONSUMPTION AMONG POLES
Directory of Open Access Journals (Sweden)
Sylwia Chudy
2014-12-01
Full Text Available The paper presents results of a survey concerning coffee consumption together with results of visual and instrumental coffee analyses. The investigations focused on the type of additives used when preparing coffee. Based on the survey it was found that 58.3% respondents use sweeteners and 92.7% coffee whiteners (mainly milk with 3.2% fat content.
Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a leaf rust resistant gene present in the durum wheat cv. Creso and its derivative Colosseo is one of the best characterized leaf rust resistance sources presently deployed in durum wheat breed...
The performances of coffee processors and coffee market in the Republic of Serbia
Directory of Open Access Journals (Sweden)
Nuševa Daniela
2017-01-01
Full Text Available The main aim of this paper is to investigate the performances of coffee processors and coffee market in Serbia based on the market concentration analysis, profitability analysis, and profitability determinants analysis. The research was based on the sample of 40 observations of coffee processing companies divided into two groups: large and small coffee processors. The results indicate that two large coffee processors have dominant market share. Even though the Serbian coffee market is an oligopolistic, profitability analysis indicates that small coffee processors have a significant better profitability ratio than large coffee processors. Furthermore, results show that profitability ratio is positively related to the inventory turnover and negatively related to the market share.
Tanggap Genotipe Kacang Tanah Terhadap Penyakit Bercak Daun Cercospora dan Karat Daun Puccinia
Directory of Open Access Journals (Sweden)
Alfi Inayati
2016-03-01
Full Text Available Leaf spot and rust are two important diseases on groundnut. Both diseases are frequently found at the same time that influence the growth and reduce the yield of groundnut. This study was conducted to evaluate thirteen groundnut genotypes resistance to leaf spot and rust disease. The experiment was conducted using a split plot design and three replications, with inoculated and uninoculated treatment as main plot, and groundnut genotypes as the sub plot. Disease assessment was conducted by counting number of pustules per leaf, the number of spots per leaf, rust disease intensity, the intensity of leaf spot disease, and leaf area index. Yield components including stover weight, number of pods per plant, number of empty pods, number of chipo pods, and weight of pods per plant were recorded for both inoculated and uninoculated plants. The result showed that leaf spot disease developed earlier than rust disease. Only one genotype was susceptible to rust and the other 12 genotypes were very susceptible, whereas all genotypes tested were very susceptible to leaf spot. The intensity of rust and leaf spot diseases was negatively correlated with yield (r = - 0.1 – (0.4. Rust and leaf spot diseases reduced the yield components including stover weight (73.2%, number of pods (68%, and weight of pods (72.5%. The number of empty pods and chipo pods were increase to 81% and 56.4% respectively.
Two distinct classes of QTL determine rust resistance in sorghum.
Wang, Xuemin; Mace, Emma; Hunt, Colleen; Cruickshank, Alan; Henzell, Robert; Parkes, Heidi; Jordan, David
2014-12-31
Agriculture is facing enormous challenges to feed a growing population in the face of rapidly evolving pests and pathogens. The rusts, in particular, are a major pathogen of cereal crops with the potential to cause large reductions in yield. Improving stable disease resistance is an on-going major and challenging focus for many plant breeding programs, due to the rapidly evolving nature of the pathogen. Sorghum is a major summer cereal crop that is also a host for a rust pathogen Puccinia purpurea, which occurs in almost all sorghum growing areas of the world, causing direct and indirect yield losses in sorghum worldwide, however knowledge about its genetic control is still limited. In order to further investigate this issue, QTL and association mapping methods were implemented to study rust resistance in three bi-parental populations and an association mapping set of elite breeding lines in different environments. In total, 64 significant or highly significant QTL and 21 suggestive rust resistance QTL were identified representing 55 unique genomic regions. Comparisons across populations within the current study and with rust QTL identified previously in both sorghum and maize revealed a high degree of correspondence in QTL location. Negative phenotypic correlations were observed between rust, maturity and height, indicating a trend for both early maturing and shorter genotypes to be more susceptible to rust. The significant amount of QTL co-location across traits, in addition to the consistency in the direction of QTL allele effects, has provided evidence to support pleiotropic QTL action across rust, height, maturity and stay-green, supporting the role of carbon stress in susceptibility to rust. Classical rust resistance QTL regions that did not co-locate with height, maturity or stay-green QTL were found to be significantly enriched for the defence-related NBS-encoding gene family, in contrast to the lack of defence-related gene enrichment in multi-trait effect
Production of Flammulina velutipes on coffee husk and coffee spent-ground
Directory of Open Access Journals (Sweden)
Leifa Fan
2001-01-01
Full Text Available Solid state cultivation (SSC was carried out to evaluate the feasibility of using coffee husk and spent-ground as substrates for the production of edible mushroom Flammulina under different conditions of moisture and spawn rate. The strain of F. velutipes LPB 01 was adapted for a coffee husk extract medium. Best results were obtained with 25% spawn rate, though there was not much difference when lower spawn rates (10-20% were used. Ideal moisture content for mycelial growth was 60% and 55% for coffee husk and spent-ground, respectively. With coffee husk as substrate, first fructification occurred after 25 days of inoculation and the biological efficiency reached about 56% with two flushes after 40 days. With spent-ground as substrate, first fructification occurred 21 days after inoculation and the biological efficiency reached about 78% in 40 days. There was decrease in the caffeine and tannins contents (10.2 and 20.4%, respectively in coffee husk after 40 days. In coffee spent-ground, the tannin contents decreased by 28% after 40 days. These decrease was attributed to the degradation of caffeine or tannins by the culture because these were not adsorbed in the fungal mycelia. Results showed the feasibility of using coffee husk and coffee spent-ground as substrate without any nutritional supplementation for cultivation of edible fungus in SSC. Spent ground appeared better than coffee husk.
Painting rusted steel: The role of aluminum phosphosilicate
International Nuclear Information System (INIS)
Roselli, S.N.; Amo, B. del; Carbonari, R.O.; Di Sarli, A.R.; Romagnoli, R.
2013-01-01
Highlights: •Aluminum phosphosilicate is an acid pigment which could act as mild phosphating agent. •Aluminum phosphosilicate can phosphatize iron oxides on rusted surfaces. •Aluminum phosphosilicate is compatible with acid binders. •Aluminum phosphosilicate could replace chromate in complete painting schemes. •Aluminum phosphosilicate primers improve paints adhesion on rusted surfaces. -- Abstract: Surface preparation is a key factor for the adequate performance of a paint system. The aim of this investigation is to employ a wash-primer to accomplish the chemical conversion of rusted surface when current cleaning operations are difficult to carry out. The active component of the wash-primer was aluminum phosphosilicate whose electrochemical behavior and the composition of the generated protective layer, both, were studied by electrochemical techniques and scanning electron microscopy (SEM), respectively. Primed rusted steel panels were coated with an alkyd system to perform accelerated tests in the salt spray chamber and electrochemical impedance measurements (EIS). These tests were conducted in parallel with a chromate wash primer and the same alkyd system. Results showed that the wash-primer containing aluminum phosphosilicate could be used satisfactorily to paint rusted steel exhibiting a similar performance to the chromate primer
Relationship between sugarcane rust severity and soil properties in louisiana.
Johnson, Richard M; Grisham, Michael P; Richard, Edward P
2007-06-01
ABSTRACT The extent of spatial and temporal variability of sugarcane rust (Puccinia melanocephala) infestation was related to variation in soil properties in five commercial fields of sugarcane (interspecific hybrids of Saccharum spp., cv. LCP 85-384) in southern Louisiana. Sugarcane fields were grid-soil sampled at several intensities and rust ratings were collected at each point over 6 to 7 weeks. Soil properties exhibited significant variability (coefficients of variation = 9 to 70.1%) and were spatially correlated in 39 of 40 cases with a range of spatial correlation varying from 39 to 201 m. Rust ratings were spatially correlated in 32 of 33 cases, with a range varying from 29 to 241 m. Rust ratings were correlated with several soil properties, most notably soil phosphorus (r = 0.40 to 0.81) and soil sulfur (r = 0.36 to 0.68). Multiple linear regression analysis resulted in coefficients of determination that ranged from 0.22 to 0.73, and discriminant analysis further improved the overall predictive ability of rust models. Finally, contour plots of soil properties and rust levels clearly suggested a link between these two parameters. These combined data suggest that sugarcane growers that apply fertilizer in excess of plant requirements will increase the incidence and severity of rust infestations in their fields.
Host jumps shaped the diversity of extant rust fungi (Pucciniales).
McTaggart, Alistair R; Shivas, Roger G; van der Nest, Magriet A; Roux, Jolanda; Wingfield, Brenda D; Wingfield, Michael J
2016-02-01
The aim of this study was to determine the evolutionary time line for rust fungi and date key speciation events using a molecular clock. Evidence is provided that supports a contemporary view for a recent origin of rust fungi, with a common ancestor on a flowering plant. Divergence times for > 20 genera of rust fungi were studied with Bayesian evolutionary analyses. A relaxed molecular clock was applied to ribosomal and mitochondrial genes, calibrated against estimated divergence times for the hosts of rust fungi, such as Acacia (Fabaceae), angiosperms and the cupressophytes. Results showed that rust fungi shared a most recent common ancestor with a mean age between 113 and 115 million yr. This dates rust fungi to the Cretaceous period, which is much younger than previous estimations. Host jumps, whether taxonomically large or between host genera in the same family, most probably shaped the diversity of rust genera. Likewise, species diversified by host shifts (through coevolution) or via subsequent host jumps. This is in contrast to strict coevolution with their hosts. Puccinia psidii was recovered in Sphaerophragmiaceae, a family distinct from Raveneliaceae, which were regarded as confamilial in previous studies. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Evaluation of Local Wheat Cultivars Susceptibility to infection with Black Stem Rust
International Nuclear Information System (INIS)
Batta, Y.A.
2007-01-01
The present study was conducted to assess the susceptibility of seven local wheat cultivars from Palestine to infection with black stem rust caused by Puccinia graminis f. sp. tritici. Two techniques of disease inoculation were applied during bioassays: global inoculation of entire wheat plants with urediospores and localized inoculation with urediospores and localized inoculation with urediospores on wheat leaf-pieces incubated under humid conditions. Susceptibility of tested cultivars was evaluated according to disease scale based on number and size of typical unredial pustules that appeared after inoculation on entire plants or leaf pieces. Results obtained on bioassay of susceptibility and disease rating on entire plants indicated that Anbar, Kamata and Hetiya safra cultivars were the least susceptible to P. g. tritici infection, whereas Debiya beda cultivar was the most susceptible. The other tested cultivars such as Nab-El-Jama, sawda and Senf 870 were moderately susceptible. On leaf-pieces, Anbar and Kamatat were the least susceptible cultivars, whereas Debiya beda and Nab-El-Jamal were the most susceptible cultivars. The other tested cultivars such as Debiya swada, Senf 870 and Hetiya safra were moderately susceptible. Significant reductions were obtained for the size of unredial postules formed on leaf-pieces when inoculated in an unwounded state compared to the wounded indicating the importance of wounds during inoculation. The global results indicated the possibility of using above method of disease inoculating, scaling and rating for evaluation of wheat cultivars susceptibility for the eventual use in breeding program for resistant varieties in Palestine. (author)
Orange rust in sugarcane: molecular identification in Rio de Janeiro State
Directory of Open Access Journals (Sweden)
Carla Vanessa Borges Castro
2013-09-01
Full Text Available Sugarcane (Saccharum spp. cultivation is one of the major agricultural activities in the Brazilian states. This study aimed to molecularly identify the pathogen associated with rust in sugarcane cultivars in the state of Rio de Janeiro and to suggest a control strategy. Among the 14 PCR-tested cultivars, Puccinia kuehnii infection was identified for RB947520, RB92606, RB835486, RB72454, SP89-11I5, SP83-2847, both from infected leaf sample and from urediniospores. Puccinia kuehnii was not detected by PCR for the cultivars RB955971, RB951541, RB92579, RB867515, RB855536, SP91-1049, SP80-3280, SP80-1816. This is the first molecular detection of this fungus in the state of Rio de Janeiro for six of the 14 analyzed cultivars.
development of wheat germplasm for stem rust resistance in eastern ...
African Journals Online (AJOL)
ACSS
Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...
Development of wheat germplasm for stem rust resistance in eastern ...
African Journals Online (AJOL)
Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...
2010-01-01
... INDUSTRIES § 23.10 Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust resistant,” etc. (a) It is unfair or deceptive to: (1) Use the terms “corrosion proof,” “noncorrosive... the product will be immune from rust and other forms of corrosion during the life expectancy of the...
Frequency of comandra blister rust infection episodes on lodgepole pine
William R. Jacobi; Brian W. Geils; Jane E. Taylor
2002-01-01
Comandra blister rust is a damaging canker disease of lodgepole pine in the Central Rocky Mountains. Our knowledge of previous blister rust outbreaks and the effects of weather and climate on rust epidemiology has not been sufficient to explain the frequency and severity of disease outbreaks. Thus, we sought to describe the seasonal and annual frequency and duration of...
75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties
2010-07-30
...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... direct final rule notified the public of our intention to amend the black stem rust quarantine and...
Water use efficiency by coffee arabica after glyphosate application
Directory of Open Access Journals (Sweden)
Felipe Paolinelli de Carvalho
2014-07-01
Full Text Available Many coffee growers apply glyphosate in directed applications, but some phytotoxicity has been noted. It is believed some herbicides can exert a direct or indirect negative effect on photosynthesis by reducing the metabolic rate in a way that can affect the water use efficiency. The objective of this study was to investigate the variables related to water use among coffee cultivars subjected to the application of glyphosate and the effects of each dose. The experiment was conducted in a greenhouse using three varieties of coffee (Coffea arabica, Acaiá (MG-6851, Catucaí Amarelo (2SL and Topázio (MG-1190, and three doses of glyphosate (0.0, 115.2 and 460.8 g acid equivalent ha-1, in a factorial 3 x 3 design. At 15 days after application, a reduction in stomatal conductance was observed, and smaller transpiration rate and water use efficiency were found in the fourth leaf at 15 days after application. There was a decrease in the transpiration rate at 45 DAA, with the Acaiá cultivar showing reductions with 115.2 g ha-1. There was transitory reduction in water use efficiency with glyphosate application, but can affect the growth and production. The Acaiá cultivar showed the highest tolerance to glyphosate because the water use efficiency after herbicide application.
76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties
2011-01-19
...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... notified the public of our intention to amend the black stem rust quarantine and regulations by adding four...
Wake up and smell the coffee. Caffeine, coffee, and the medical consequences.
Chou, T
1992-11-01
Caffeine is a methylxanthine whose primary biologic effect is antagonism of the adenosine receptor. Its presence in coffee, tea, soda beverages, chocolate, and many prescription and over-the-counter drugs makes it the most commonly consumed stimulant drug. Initially caffeine increases blood pressure, plasma catecholamine levels, plasma renin activity, serum free fatty acid levels, urine production, and gastric acid secretion. Its long-term effects have been more difficult to substantiate. Most of the caffeine consumed in the United States is in coffee, which contains many other chemicals that may have other biologic actions. The consumption of coffee is a self-reinforcing behavior, and caffeine dependence and addiction are common. Coffee and caffeine intake have been linked to many illnesses, but definitive correlations have been difficult to substantiate. Initial trials showing coffee's association with coronary disease and myocardial infarction have been difficult to reproduce and have many confounding variables. Recent studies showing a larger effect over long follow-up periods and with heavy coffee consumption have again brought the question of the role of coffee in disease states to the fore. Caffeine in average dosages does not seem to increase the risk of arrhythmia. At present there is no convincing evidence that caffeine or coffee consumption increases the risk for any solid tumor. The intake of coffee and caffeine has clearly been decreasing in this country over the past two decades, largely brought about by the increasing health consciousness of Americans. Although there have been many studies that hint that the fears of increased disease with coffee drinking may be warranted, many questions have yet to be answered about the health effects of coffee and caffeine use.
Control Of Rust Disease In Irradiated Vicia Faba By Using Safe Alternative Methods
International Nuclear Information System (INIS)
Ahmed, B.M.; Helal, I.M.; Mohamed, G.A.
2013-01-01
Infection of Vicia faba with Uromyces viciae-fabae causes significant decrease in growth and total nitrogen content and increase in the phenolic compounds. The study was carried out to investigate the effects of chemicals used as drench application in soil (e.g. saccharin), biotic agents (e.g. Bacillus subtilis) and artificial essential oils (e.g. rosemary) in irradiated (0, 5, 10, 15 Gy) broad bean Vicia faba on the rust fungus Uromyces viciae-fabae. Bacillus subtilis was inoculated to beans at the third leaf then saccharin (5 mM/l) was used as drench application in the soil and the essential oil was used for foliar application at concentrations 0, 500, 1000 and 1500 ppm. All treatments gave positive results to control the disease but differ in the mechanism of action. The control of the disease with saccharin application may be due to the formation of antimicrobial components (wyrone acid) by plant tissues and increase with increasing the concentration of saccharin. In case of using the essential oil, the affect on the microbe was directly observed within 28 h because the oil affect the permeability of cell membrane of the pathogen but in case of Bacillus, it acts as biological control agent induced resistance of plant by affecting the activity of antioxidant enzymes; peroxidase and chitinase. Saccharin and spore suspension induce systemic protection to rust infection after 72 and 96 hours. The disease index and the phenolic compounds were determined because they play important role in the systemic protection of rust disease 96 h after application. The results showed that the phytoalexin wyerone acid was formed in case of biotic agent (Bacillus subtilis) and the chemical (saccharin) but did not form in case of essential oil (rosemary)
Comparative effect of coffee robusta and coffee arabica (Qahwa) on memory and attention.
Alharbi, Waheeb D M; Azmat, Aisha; Ahmed, Muhammad
2018-04-13
The comparative effects of coffee robusta and coffee arabica (Qahwa) on different attention and memory related assignments were measured in a double-blind study of 300 healthy young adult women who were randomly assigned to one of three different drinks: Group I (coffee robusta sachet dissolved in 100 ml of hot water): Group II (coffee arabica): and group III (100 ml water only). Cognitive function was assessed by standardized tests. Several monitoring cognitive tests and tasks were specifically chosen and performed to investigate the comparative effects of coffee robusta (CR) and coffee arabica (Qahwa; AC) on sleepiness (sleep and clear headed scale), attention (trail A & B, symbol digit, letter cancellation), general cognitive ability (stroop test) and memory (card test). Data was interpreted by analysis of variance (ANOVA). The present study revealed that coffee robusta has beneficial effects on attention, general cognitive ability and memory. Higher though non-significant cognitive scores were associated with coffee robusta consumption. Although, consumption of coffee arabica (Qahwa) has significant effects (P < 0.05) on sleepiness, attention, general cognitive ability and memory and it significantly improve reaction time and correct responses. Since different tasks were related to the sustained attention and working memory processes, results would suggest that coffee arabica (qahwa) could increase the memory and efficiency of the attentional system might be due to the presence of chlorogenic acids (CGA) which are found in less quantity in coffee robusta. However, more studies using larger samples and different tasks are necessary to better understand the effects of coffee robusta and arabica (Qahwa) on attention and memory.
Wheat rusts in the United States in 2016
In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...
Incorporation of Monovalent Cations in Sulfate Green Rust
DEFF Research Database (Denmark)
Christiansen, B. C.; Dideriksen, K.; Katz, A.
2014-01-01
Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...... with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both...
Rust fungi on some poaceous weeds of wheat crops in Pakistan
NAJAM-UL-SEHAR AFSHAN*; ABDUL REHMAN NIAZI
2013-01-01
The article enlists common poaceous weeds found in wheat crop sand their specific parasitic rust fungi. In this study, four (04) plant taxa of Poaceae infected with rust fungi are collected from different wheat crops grown in different areas of Pakistan. The rust fungi are isolated, characterized and identified. All these host plants are known weeds of wheat crop in Pakistan. This work would help to identify and enlist the potential rust fungi on weeds of wheat crop that could be utilized to ...
Moessbauer Characterization of Rust Obtained in an Accelerated Corrosion Test
International Nuclear Information System (INIS)
Garcia, K. E.; Morales, A. L.; Arroyave, C. E.; Barrero, C. A.; Cook, D. C.
2003-01-01
We have performed drying-humectation cyclical processes (CEBELCOR) on eight A36 low carbon steel coupons in NaCl solutions containing 1x10 -2 M and 1x10 -1 M concentrations. The main purpose of these experiments is to contribute to the understanding of the conditions for akaganeite formation. Additionally, and with the idea to perform a complete characterization of the rust, this work also considers the formation of other iron oxide phases. The corrosion products were characterized by Moessbauer spectroscopy and X-ray diffraction techniques. Gravimetric analysis demonstrates that the coupons presented high corrosion rates. Magnetite/maghemite was common in the rust stuck to the steel surface, whereas akaganeite was present only in traces. In the rust collected from the solutions, i.e., the rust that goes away from the metal surface easily, a magnetite/maghemite was not present and akaganeite showed up in larger quantities. These results support the idea that high concentrations of Cl - ions are required for the akaganeite formation. We concluded that akaganeite is not easily bonded to the rust layer; this may lead to the formation of a less protective rust layer and to higher corrosion rates.
Resistance to rusts (uromyces pisi and u. viciae-fabae) in pea
Barilli, Eleonora; Sillero, Josefina C.; Prats, Elena; Rubiales, Diego
2014-01-01
Pea is the second most important food legume crop in the world. Rust is a pea disease widely distributed, particularly in regions with warm, humid weather. Pea rust can be incited by Uromyces viciae-fabae and by U. pisi. U. viciae-fabae prevails in tropical and subtropical regions such as India and China, while U. pisi prevails in temperate regions. Chemical control of rust is possible, but the use of host plant resistance is the most desired means of rust control. In this paper we revise and...
Wadhawan, Manav; Anand, Anil C
2016-03-01
Coffee is the most popular beverage in the world. Consumption of coffee has been shown to benefit health in general, and liver health in particular. This article reviews the effects of coffee intake on development and progression of liver disease due to various causes. We also describe the putative mechanisms by which coffee exerts the protective effect. The clinical evidence of benefit of coffee consumption in Hepatitis B and C, as well as nonalcoholic fatty liver disease and alcoholic liver disease, has also been presented. Coffee consumption is associated with improvement in liver enzymes (ALT, AST, and GGTP), especially in individuals with risk for liver disease. Coffee intake more than 2 cups per day in patients with preexisting liver disease has been shown to be associated with lower incidence of fibrosis and cirrhosis, lower hepatocellular carcinoma rates, as well as decreased mortality.
Directory of Open Access Journals (Sweden)
Apolonio Valdez Balero
2004-10-01
Full Text Available It was evaluated the variability fenotípic in early phases of selection from plants regenerated of the mutagenic treatment with dose of 30 Gy of radiations Gamma (source 60Co applicated to calluses in growth of the donating ´SP 70-1284´ tolerant to the rust disease of the sugarcane Puccinia melanocephala. The main changes the plants obtained in vitro, consinted in the height, the color, habit of growth, length and width of the leaf, as well as in the affectation for the rust disease. 14.28% of the changes all fenotipic was observed in plantín, and in the shoot the plants presented 10.99% of changes all fenotipic. In the vegetative multiplication one (MV1 three possible mutants were selected with smaller affectation in front rust disease of the sugarcan, resistance character to the rust disease efficiency of the tissue culture and the mutations induction with the dose of 30 Gy were of a mutant for each 1 525 plants evaluated in early phase of selection. Key words: variation fenotipic, selection early, mutagenesis
Creation and validation of a simulator for corneal rust ring removal.
Mednick, Zale; Tabanfar, Reza; Alexander, Ashley; Simpson, Sarah; Baxter, Stephanie
2017-10-01
To create and validate a simulation model for corneal rust ring removal. Rust rings were created on cadaveric eyes with the use of small particles of metal. The eyes were mounted on suction plates at slit lamps and the trainees practiced rust ring removal. An inexperienced cohort of medical students and first year ophthalmology residents (n=11), and an experienced cohort of senior residents and faculty (n=11) removed the rust rings from the eyes with the use of a burr. Rust ring removal was evaluated based on removal time, percentage of rust removed and incidence of corneal perforation. A survey was administered to participants to determine face validity. Time for rust ring removal was longer in the inexperienced group at 187±93 seconds (range of 66-408 seconds), compared to the experienced group at 117±54 seconds (range of 55-240 seconds) (p=0.046). Removal speed was similar between groups, at 4847±4355 pixels/minute and 7206±5181 pixels/minute in the inexperienced and experienced groups, respectively (p=0.26). Removal percentage values were similar between groups, at 61±15% and 69±18% (p=0.38). There were no corneal perforations. 100% (22/22) of survey respondents believed the simulator would be a valuable practice tool, and 89% (17/19) felt the simulation was a valid representation of the clinical correlate. The corneal rust ring simulator presented here is a valid training tool that could be used by early trainees to gain greater comfort level before attempting rust ring removal on a live patient. Copyright © 2017 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.
Induced mutations for soybean rust resistance
International Nuclear Information System (INIS)
Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.
1983-01-01
Soybean mutation experiments for inducing rust resistance in the cultivars G 8375, Wakashima mutant number 10, Taichung N, S.J.2, S.J.4, BM 50, BM 98, G 8377, G 8586 and G 8587 have been carried out since 1979. Six pods from each of 4438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked (M 2 bulk). In addition, 270 good M 1 plants were selected and threshed singly (M 2 single). M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both, M 3 -bulk and M 3 -single plants, together with the remaining M 2 -bulk seeds were screened for rust resistance in the rainy season of 1980 in Nong Hoi Valley (altitude about 1000 m above sea level) and at Mae Joe Station, both in Chiang Mai Province (latitude 18 deg. 31'-19 deg. N). Based on the IWGSR rating system, soybean plants with slow growth of rust were selected from both locations. The results were as follows: Six plants were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Further evaluation of these selections for rust resistance will be carried out in the rainy season of 1981 in Nong Hoi Valley, Chiang Mai. (author)
DEFF Research Database (Denmark)
Nordentoft, Helle Merete; Olesen, Birgitte Ravn
coffee can be motivated to drink less coffee. The ethnomethodological perspective reveals how the participants’ different common-sense and hierarchical perceptions of a normative theory and its meaning in practice appears to guide the talk about how to motivate the patient to drink less coffee....... The negotiation between the researchers’ and practitioners’ approach to the coffee drinking patient facilitate a more profound understanding of how different knowledge forms can be at play in other ways than expected. In conclusion the findings show that dialogue and interplay between different knowledge forms...
... coffee product Coffee Slender (Med-Eq Ltd., Tonsberg, Norway), lose an average of 2.5 to 3. ... might increase the risk of experiencing serious or life-threatening side effects such as high blood pressure, ...
African Journals Online (AJOL)
Owner
Om te trek is om jou kortstondig in 'n liminale staat te bevind. Nóg by jou vertrekpunt, nóg by jou uiteindelike bestemming, sonder die geborgenheid wat hierdie twee vaste plekke kwansuis bied. In 'n hele aantal opsigte is Trek van Winnie Rust 'n beskrywing van verskil- lende liminale state. Dit is egter nie 'n reisverhaal met ...
Eira, M.T.S.; Silva, da E.A.A.; Castro, de R.D.; Dussert, S.; Walters, C.; Bewley, J.D.; Hilhorst, H.W.M.
2006-01-01
Coffee is a member of the Rubiaceae family and the genus Coffea. There are more than 70 species of coffee but only two are economically important: Coffea arabica L. and Coffea canephora Pierre; 70 % of the coffee traded in the world is arabica and 30 % is robusta (C. canephora). Other species such
Effect of solar radiation on severity of soybean rust.
Young, Heather M; George, Sheeja; Narváez, Dario F; Srivastava, Pratibha; Schuerger, Andrew C; Wright, David L; Marois, James J
2012-08-01
Soybean rust (SBR), caused by Phakopsora pachyrhizi, is a damaging fungal disease of soybean (Glycine max). Although solar radiation can reduce SBR urediniospore survival, limited information is available on how solar radiation affects SBR progress within soybean canopies. Such information can aid in developing accurate SBR prediction models. To manipulate light penetration into soybean canopies, structures of shade cloth attenuating 30, 40, and 60% sunlight were constructed over soybean plots. In each plot, weekly evaluations of severity in lower, middle, and upper canopies, and daily temperature and relative humidity were recorded. Final plant height and leaf area index were also recorded for each plot. The correlation between amount of epicuticular wax and susceptibility of leaves in the lower, middle, and upper canopies was assessed with a detached leaf assay. Final disease severity was 46 to 150% greater in the lower canopy of all plots and in the middle canopy of 40 and 60% shaded plots. While daytime temperature within the canopy of nonshaded soybean was greater than shaded soybean by 2 to 3°C, temperatures recorded throughout typical evenings and mornings of the growing season in all treatments were within the range (10 to 28.5°C) for SBR development as was relative humidity. This indicates temperature and relative humidity were not limiting factors in this experiment. Epicuticular wax and disease severity in detached leaf assays from the upper canopy had significant negative correlation (P = 0.009, R = -0.84) regardless of shade treatment. In laboratory experiments, increasing simulated total solar radiation (UVA, UVB, and PAR) from 0.15 to 11.66 MJ m(-2) increased mortality of urediniospores from 2 to 91%. Variability in disease development across canopy heights in early planted soybean may be attributed to the effects of solar radiation not only on urediniospore viability, but also on plant height, leaf area index, and epicuticular wax, which influence
Correlation between RUST assessments of fracture healing to structural and biomechanical properties.
Cooke, Margaret E; Hussein, Amira I; Lybrand, Kyle E; Wulff, Alexander; Simmons, Erin; Choi, Jeffrey H; Litrenta, Jody; Ricci, William M; Nascone, Jason W; O'Toole, Robert V; Morgan, Elise F; Gerstenfeld, Louis C; Tornetta, Paul
2018-03-01
Radiographic Union Score for Tibia (RUST) and modified RUST (mRUST) are radiographic tools for quantitatively evaluating fracture healing using a cortical scoring system. This tool has high intra-class correlation coefficients (ICCs); however, little evidence has evaluated the scores against the physical properties of bone healing. Closed, stabilized fractures were made in the femora of C3H/HeJ male mice (8-12 week-old) of two dietary groups: A control and a phosphate restricted diet group. Micro-computed tomography (µCT) and torsion testing were carried out at post-operative days (POD) 14, 21, 35, and 42 (n = 10-16) per group time-point. Anteroposterior and lateral radiographic views were constructed from the µCT scans and scored by five raters. The raters also indicated if the fracture were healed. ICCs were 0.71 (mRUST) and 0.63 (RUST). Both RUST scores were positively correlated with callus bone mineral density (BMD) (r = 0.85 and 0.80, p RUST scores positively correlated with callus strength (r = 0.35 and 0.26, p RUST ≥10 and had excellent relationship to structural and biomechanical metrics. Effect of delayed healing due to phosphate dietary restrictions was found at later time points with all mechanical properties (p RUST scores (p > 0.318). Clinical relevance of this study is both RUST scores showed high correlation to physical properties of healing and generally distinguished healed vs. non-healed fractures. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:945-953, 2018. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species
Vaz Patto, Maria Carlota; Rubiales, Diego
2014-01-01
Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance (NHR) responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus) and two inappropriate (U. viciae-fabae and U. lupinicolus) rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However, responses to different inappropriate rust species also showed some specificity, suggesting a combination of non-specific and specific responses underlying this legume NHR to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and NHR mechanisms to breed for broad-spectrum resistance to rust in legume species. PMID:25426128
Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species
Directory of Open Access Journals (Sweden)
Maria Carlota eVaz Patto
2014-11-01
Full Text Available Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus and two inappropriate (U. viciae-fabae and U. lupinicolus rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However responses to different inappropriate rust species also showed some specificity, suggesting a combination of non specific and specific responses underlying this legume nonhost resistance to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and nonhost resistance mechanisms to breed for broad-spectrum resistance to rust in legume species.
Williams-Guillén, Kimberly; Perfecto, Ivette
2011-01-26
Shade coffee plantations have received attention for their role in biodiversity conservation. Bats are among the most diverse mammalian taxa in these systems; however, previous studies of bats in coffee plantations have focused on the largely herbivorous leaf-nosed bats (Phyllostomidae). In contrast, we have virtually no information on how ensembles of aerial insectivorous bats--nearly half the Neotropical bat species--change in response to habitat modification. To evaluate the effects of agroecosystem management on insectivorous bats, we studied their diversity and activity in southern Chiapas, Mexico, a landscape dominated by coffee agroforestry. We used acoustic monitoring and live captures to characterize the insectivorous bat ensemble in forest fragments and coffee plantations differing in the structural and taxonomic complexity of shade trees. We captured bats of 12 non-phyllostomid species; acoustic monitoring revealed the presence of at least 12 more species of aerial insectivores. Richness of forest bats was the same across all land-use types; in contrast, species richness of open-space bats increased in low shade, intensively managed coffee plantations. Conversely, only forest bats demonstrated significant differences in ensemble structure (as measured by similarity indices) across land-use types. Both overall activity and feeding activity of forest bats declined significantly with increasing management intensity, while the overall activity, but not feeding activity, of open-space bats increased. We conclude that diverse shade coffee plantations in our study area serve as valuable foraging and commuting habitat for aerial insectivorous bats, and several species also commute through or forage in low shade coffee monocultures.
Directory of Open Access Journals (Sweden)
Kimberly Williams-Guillén
Full Text Available Shade coffee plantations have received attention for their role in biodiversity conservation. Bats are among the most diverse mammalian taxa in these systems; however, previous studies of bats in coffee plantations have focused on the largely herbivorous leaf-nosed bats (Phyllostomidae. In contrast, we have virtually no information on how ensembles of aerial insectivorous bats--nearly half the Neotropical bat species--change in response to habitat modification. To evaluate the effects of agroecosystem management on insectivorous bats, we studied their diversity and activity in southern Chiapas, Mexico, a landscape dominated by coffee agroforestry. We used acoustic monitoring and live captures to characterize the insectivorous bat ensemble in forest fragments and coffee plantations differing in the structural and taxonomic complexity of shade trees. We captured bats of 12 non-phyllostomid species; acoustic monitoring revealed the presence of at least 12 more species of aerial insectivores. Richness of forest bats was the same across all land-use types; in contrast, species richness of open-space bats increased in low shade, intensively managed coffee plantations. Conversely, only forest bats demonstrated significant differences in ensemble structure (as measured by similarity indices across land-use types. Both overall activity and feeding activity of forest bats declined significantly with increasing management intensity, while the overall activity, but not feeding activity, of open-space bats increased. We conclude that diverse shade coffee plantations in our study area serve as valuable foraging and commuting habitat for aerial insectivorous bats, and several species also commute through or forage in low shade coffee monocultures.
[Coffee as hepatoprotective factor].
Szántová, Mária; Ďurkovičová, Zuzana
The mind about the coffee did change upon the recent studies and metaanalysis of the last years. Consensual protective effect of coffee on the progression of chronic liver diseases (NASH, viral hepatitis, liver cirrhosis, hepatocelullar carcinoma) was detected in experimental, clinical and large population studies together with decrease of mortality. Antioxidant, antifibrotic, insulinsensitizing and anticarcinogenic effect of coffee were detected. Modulation of genetic expression of key enzymes of fatty acid synthesis, modulation of mRNA included in autophagia, reduction of stress of endoplasmatic reticulum together with decrease of proinflammatory cytokines and decrease of fibrogenesis are main mechanisms. Chlorogenic acids, diterpens (cafestol, kahweol), caffein, polyfenols and melanoidins are key protective components of coffee. Inverse dose-dependent correlation of coffee consumption with liver diseases was found in clinical and population studies. Coffee is non-pharmacological tool of primary and secondary prevention of chronic liver diseases. Review of published data together with supposed mechanisms of hepatoprotection are given.Key words: coffee - hepatoprotective effect - metaanalysis.
DEFF Research Database (Denmark)
Bech, Bodil Hammer
Background: Coffee consumption in Denmark is high also among pregnant women and it is presumably their main source of caffeine intake. Coffee or caffeine intake during pregnancy has been linked to adverse pregnancy outcomes such as spontaneous abortion, stillbirth and reduced fetal growth. However...... a review of the literature indicates that further studies are needed to test the hypothesis of an effect of coffee or caffeine on the risk of adverse pregnancy outcomes.The aim of the thesis was to study the relation between coffee and the risk of fetal death and the relation between caffeine intake...
Aecidium kalanchoe sp. nov., a new rust on Kalanchoe blossfeldiana (Crassulaceae).
Hernádez, José R; Aime, M Catherine; Newbry, Brad
2004-07-01
A rust fungus found on cultivars of Kalanchoe blossfeldiana (Crassulaceae) is described as a new species, Aecidium kalanchoe sp. nov., and compared to the other described rusts on members of the Crassulaceae. Only one other rust is known to parasitize Kalanchoe spp. A DNA sequence of A. kalanchoe suggests that the teleomorph is related to Puccinia.
Kinetics of structural rust transformation in environments containing chloride and SO2
International Nuclear Information System (INIS)
Rendon, J. L.; Valencia, A.
2003-01-01
The behaviour of the rusts produced on low carbon steel exposed in industrial atmospheres, at different distances from the sea, was studied by simulating the wetting-drying cycle in a CEBELCOR type apparatus. Coupons electrode potential was monitored and rust layer was analyzed by gravimetric techniques, optical microscopy and Moessbauer spectroscopy. A particular chloride/sulfur ratio in the atmosphere was found, for which there is a particular behaviour in rust formation. For this ratio, corrosion rates were much less than expected. it is postulated a kinetic mechanism for rust layer formation as the origin of this special behavior. An electrode potential similar to that in a weathering steel was observed, this is reflected in the low corrosion rate obtained. The proposed kinetic mechanism for rust formation under these exposure conditions enables new research lines on layer formation and the development of protective rust for industrial marine atmospheres. (Author) 8 refs
Influence of coffee/water ratio on the final quality of espresso coffee
Andueza, S. (Susana); Vila, M.A. (María A.); Peña, M.P. (María Paz) de; Cid, C. (Concepción)
2007-01-01
Espresso coffee is a polyphasic beverage in which the physico-chemical and sensory characteristics obviously depend on both the selection of ground roasted coffee and the technical conditions of the percolation process. The aim of this work was to evaluate the influence of the coffee/water ratio on the physico-chemical and sensory quality of espresso coffee. Furthermore, the influence of botanical varieties (Arabica and Robusta) and the type of roast (conventional and torrefacto) on the selec...
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
Persistence and distribution of [14C]-lindane residues in coffee plants
International Nuclear Information System (INIS)
Flores-Rueegg, E.; Mesquita, T.B.
1976-01-01
Studies on weathering, volatilization, absorption, translocation and accumulation of [ 14 C]-lindane (γ-1,2,3,4,5,6-hexachlorocyclohexane) in coffee (Coffeea arabica L. var. Bourbon) plants are reported. Ten days after topical application to the leaf surface the insecticide can be absorbed and translocated to different parts of the plant. It accumulates mainly in the roots and appears in other leaves. In these experiments, when plants are cultivated in nutrient solution, release of radiocarbon through roots could be detected, indicating exchange of labelled material between plant and surrounding media. When the insecticide is supplied to coffee plants through the roots immersed in nutrient solution containing [ 14 C]-lindane, the labelled material is absorbed and, after 24 hours, radioactive material can be detected in young leaves of the upper parts of the plant. Loss of [ 14 C]-lindane by volatilization, evaporation and co-distillation with water is apparently continuous and represents a significant proportion of that applied. (author)
David W. Johnson
1986-01-01
Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.
lon beam analysis of Brazilian coffee
Energy Technology Data Exchange (ETDEWEB)
Debastiani, R.; Santos, C.E.I. dos; Ramos, M.M.; Souza, V.S.; Yoneama, M.L.; Amaral, L.; Dias, J.F. [Universidade Federal do Rio Grande so Sul (UFRGS), Porto Alegre, RS (Brazil). Instituto de Fisica
2013-07-01
Full text: Coffee is one of the most popular and consumed beverages worldwide. Consumers can make the beverage from different types of coffee such as ground coffee, instant coffee or grinding roasted coffee beans. Each type of coffee leads to different characteristics in flavor and scent. The aim of this work is to perform an elemental analysis of ground coffee and roasted coffee beans. To that end, eight popular Brazilian ground coffee brands have been chosen to make a comparative study among brands. One of these brands was selected for a complete study of the beverage preparation process. This same brand offers packages of roasted coffee beans, which allowed the elemental comparison between ground coffee and roasted coffee beans. Roasted coffee beans were ground with a pestle and mortar. The beverage was prepared using a typical coffee pot. The spent and liquid coffees were submitted to a heat treatment and subsequently homogenized and pressed into pellets. The filters used in the coffee pot were analyzed as well. For micro-PIXE studies, coffee beans were cut in different parts for analysis. Samples of ground coffee and roasted coffee beans (grind) were analyzed by PIXE, while light elements like C, O and N were analyzed by RBS (Rutherford Backscattering Spectrometry). The roasted coffee beans were analyzed by micro-PIXE to check the elemental distribution in the beans. The elements found in powder coffee were Mg, AI, Si, P, S, CI, K, Ca, Ti, Mn, Fe, Cu, Zn and Rb. Potassium is the element with higher concentration, while Ti and Zn are trace elements. AI, Si and Ti showed the same concentration for all brands. Potassium and chlorine have high solubility, and about 80% of their concentration is transferred from the powder to the beverage during the infusion. Mg, P, CI, K, Mn, Fe, Zn and Rb showed significant variation between ground coffee and roasted coffee beans. The elemental maps show that potassium and phosphorus are correlated, and iron appears in particular
lon beam analysis of Brazilian coffee
International Nuclear Information System (INIS)
Debastiani, R.; Santos, C.E.I. dos; Ramos, M.M.; Souza, V.S.; Yoneama, M.L.; Amaral, L.; Dias, J.F.
2013-01-01
Full text: Coffee is one of the most popular and consumed beverages worldwide. Consumers can make the beverage from different types of coffee such as ground coffee, instant coffee or grinding roasted coffee beans. Each type of coffee leads to different characteristics in flavor and scent. The aim of this work is to perform an elemental analysis of ground coffee and roasted coffee beans. To that end, eight popular Brazilian ground coffee brands have been chosen to make a comparative study among brands. One of these brands was selected for a complete study of the beverage preparation process. This same brand offers packages of roasted coffee beans, which allowed the elemental comparison between ground coffee and roasted coffee beans. Roasted coffee beans were ground with a pestle and mortar. The beverage was prepared using a typical coffee pot. The spent and liquid coffees were submitted to a heat treatment and subsequently homogenized and pressed into pellets. The filters used in the coffee pot were analyzed as well. For micro-PIXE studies, coffee beans were cut in different parts for analysis. Samples of ground coffee and roasted coffee beans (grind) were analyzed by PIXE, while light elements like C, O and N were analyzed by RBS (Rutherford Backscattering Spectrometry). The roasted coffee beans were analyzed by micro-PIXE to check the elemental distribution in the beans. The elements found in powder coffee were Mg, AI, Si, P, S, CI, K, Ca, Ti, Mn, Fe, Cu, Zn and Rb. Potassium is the element with higher concentration, while Ti and Zn are trace elements. AI, Si and Ti showed the same concentration for all brands. Potassium and chlorine have high solubility, and about 80% of their concentration is transferred from the powder to the beverage during the infusion. Mg, P, CI, K, Mn, Fe, Zn and Rb showed significant variation between ground coffee and roasted coffee beans. The elemental maps show that potassium and phosphorus are correlated, and iron appears in particular
Directory of Open Access Journals (Sweden)
Guilherme Duarte Rossi
2010-04-01
insects is a control form whose efficacy was verified by different authors. In order to observe the efficiency of castor bean leaf extracts in inhibiting trypsin-like enzymes of the coffee leaf miner, an experiment was carried out with the purpose of observing an "in vitro" inhibition phenomenon. The results of the trypsin inhibition tests with normal and boiled with and without β-mercaptoethanol 0.2% (v/v castor bean leaf extracts and the results of the acetone precipitation process indicated that the inhibitor is a heat-resistant molecule and it is not a protein. This way, the purification process was made by adsorption chromatography with later analysis in mass spectrometer. The reached results indicated that the presence of a trypsin inhibitor of the coffee leaf miner in the castor bean leaf extracts is capable of inhibiting 2.48 + 0.15 UTI, which stands for about 40% of inhibition. Tests performed with bovine trypsin indicated that the castor bean leaf extract have no inhibiting power on this enzyme.
Coprecipitation of Arsenate and Arsenite with Green Rust Minerals
The objectives of this experiment were to evaluate the extent and nature of arsenic co-precipitation with green rusts and to examine the influence of arsenic incorporation on the mineralogy of formed solid phases. Stoichiometric green rusts were obtained by coprecipitation of fe...
Glyphosate Control of Orange and Brown Rusts in Glyphosate-Sensitive Sugarcane Cultivars
Technical Abstract: Brown and orange rust diseases cause substantial yield reductions on sugarcane (Saccharum spp.) in Florida and other regions where sugarcane is grown. Brown rust caused by Puccinia melanocephala Syd. & P. Syd has been present in Florida since 1978 and orange rust caused by Pucci...
Energy Technology Data Exchange (ETDEWEB)
Duplessis, Sebastien; Cuomo, Christina A.; Lin, Yao-Cheng; Aerts, Andrea; Tisserant, Emilie; Veneault-Fourrey, Claire; Joly, David L.; Hacquard, Stephane; Amselem, Joelle; Cantarel, Brandi; Chiu, Readman; Couthinho, Pedro; Feau, Nicolas; Field, Matthew; Frey, Pascal; Gelhaye, Eric; Goldberg, Jonathan; Grabherr, Manfred; Kodira, Chinnappa; Kohler, Annegret; Kues, Ursula; Lindquist, Erika; Lucas, Susan; Mago, Rohit; Mauceli, Evan; Morin, Emmanuelle; Murat, Claude; Pangilinan, Jasmyn L.; Park, Robert; Pearson, Matthew; Quesneville, Hadi; Rouhier, Nicolas; Sakthikumar, Sharadha; Salamov, Asaf A.; Schmutz, Jeremy; Selles, Benjamin; Shapiro, Harris; Tangay, Philippe; Tuskan, Gerald A.; Peer, Yves Van de; Henrissat, Bernard; Rouze, Pierre; Ellis, Jeffrey G.; Dodds, Peter N.; Schein, Jacqueline E.; Zhong, Shaobin; Hamelin, Richard C.; Grigoriev, Igor V.; Szabo, Les J.; Martin1, Francis
2011-04-27
Rust fungi are some of the most devastating pathogens of crop plants. They are obligate biotrophs, which extract nutrients only from living plant tissues and cannot grow apart from their hosts. Their lifestyle has slowed the dissection of molecular mechanisms underlying host invasion and avoidance or suppression of plant innate immunity. We sequenced the 101 mega base pair genome of Melampsora larici-populina, the causal agent of poplar leaf rust, and the 89 mega base pair genome of Puccinia graminis f. sp. tritici, the causal agent of wheat and barley stem rust. We then compared the 16,841 predicted proteins of M. larici-populina to the 18,241 predicted proteins of P. graminis f. sp tritici. Genomic features related to their obligate biotrophic life-style include expanded lineage-specific gene families, a large repertoire of effector-like small secreted proteins (SSPs), impaired nitrogen and sulfur assimilation pathways, and expanded families of amino-acid, oligopeptide and hexose membrane transporters. The dramatic upregulation of transcripts coding for SSPs, secreted hydrolytic enzymes, and transporters in planta suggests that they play a role in host infection and nutrient acquisition. Some of these genomic hallmarks are mirrored in the genomes of other microbial eukaryotes that have independently evolved to infect plants, indicating convergent adaptation to a biotrophic existence inside plant cells
[Coffee in Cancer Chemoprevention].
Neuwirthová, J; Gál, B; Smilek, P; Urbánková, P
Coffee consumption is associated with a reduced risk of several diseases including cancer. Its chemopreventive effect has been studied in vitro, in animal models, and more recently in humans. Several modes of action have been proposed, namely, inhibition of oxidative stress and damage, activation of metabolizing liver enzymes involved in carcinogen detoxification processes, and anti-inflammatory effects. The antioxidant activity of coffee relies partly on its chlorogenic acid content and is increased during the roasting process. Maximum antioxidant activity is observed for medium-roasted coffee. The roasting process leads to the formation of several components, e.g., melanoidins, which have antioxidant and anti-inflammatory properties. Coffee also contains two specific diterpenes, cafestol and kahweol, which have anticarcinogenic properties. Roasted coffee is a complex mixture of various chemicals. Previous studies have reported that the chemopreventive components present in coffee induce apoptosis, inhibit growth and metastasis of tumor cells, and elicit antiangiogenic effects. A meta-analysis of epidemiological studies showed that coffee consumption is associated with a lower risk of developing various malignant tumors. This review summarizes the molecular mechanisms and the experimental and epidemiological evidence supporting the chemopreventive effect of coffee.Key words: coffee - chemoprevention - antioxidative enzyme - detoxification enzyme - anti-inflammatory effect The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study. The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 11. 9. 2016Accepted: 24. 11. 2016.
Rust Inhibitor And Fungicide For Cooling Systems
Adams, James F.; Greer, D. Clay
1988-01-01
Mixture of benzotriazole, benzoic acid, and fungicide prevents growth of rust and fungus. Water-based cooling mixture made from readily available materials prevents formation of metallic oxides and growth of fungi in metallic pipes. Coolant remains clear and does not develop thick sludge tending to collect in low points in cooling systems with many commercial rust inhibitors. Coolant compatible with iron, copper, aluminum, and stainless steel. Cannot be used with cadmium or cadmium-plated pipes.
Cid, C. (Concepción); Peña, M.P. (María Paz) de; Arbillaga, L. (Leire); Vitas, A.I. (Ana Isabel); Bravo, J. (Jimena); Monente, C. (Carmen)
2015-01-01
Coffee consumption decreases the risk of oxidative stress-related diseases. The by-product obtained after brewing process (spent coffee) also has antioxidant capacity. Spent coffee and coffee brews (filter and espresso) extracts were obtained from Arabica and Robusta coffees, respectively. Spent coffee showed slightly high amounts in chlorogenic acids, but caffeine content was similar to their respective coffee brew. All samples exhibited strong protection activity against indirect acting mut...
Shumeta, Zekarias; D'Haese, Marijke
2018-06-01
Most coffee in Ethiopia is produced by smallholder farmers who face a daily struggle to get sufficient income but also to feed their families. At the same time, many smallholder coffee producers are members of cooperatives. Yet, literature has paid little attention to the effect of cooperatives on combating food insecurity among cash crop producers including coffee farmers. The objective of the study was to investigate how coffee cooperative membership may affect food security among coffee farm households in Southwest Ethiopia. The study used cross-sectional household data on income, expenditure on food, staple food production (maize and teff), and utilization of improved inputs (fertilizer and improved seed) collected from 256 randomly selected farm households (132 cooperative members and 124 nonmembers) and applied an inverse probability weighting (IPW) estimation to assess the impact of cooperative membership on food security. The result revealed that cooperative membership has a positive and significant effect on staple food production (maize and teff) and facilitated technological transformation via increased utilization of fertilizer and improved seeds. Nonetheless, the effect on food expenditure and income could not be confirmed. Findings suggest a trade-off between coffee marketing and input supply functions of the cooperatives, impairing their true food security impact from the pooled income and production effect.
Genome-Wide Association Mapping of Crown Rust Resistance in Oat Elite Germplasm.
Klos, Kathy Esvelt; Yimer, Belayneh A; Babiker, Ebrahiem M; Beattie, Aaron D; Bonman, J Michael; Carson, Martin L; Chong, James; Harrison, Stephen A; Ibrahim, Amir M H; Kolb, Frederic L; McCartney, Curt A; McMullen, Michael; Fetch, Jennifer Mitchell; Mohammadi, Mohsen; Murphy, J Paul; Tinker, Nicholas A
2017-07-01
Oat crown rust, caused by f. sp. , is a major constraint to oat ( L.) production in many parts of the world. In this first comprehensive multienvironment genome-wide association map of oat crown rust, we used 2972 single-nucleotide polymorphisms (SNPs) genotyped on 631 oat lines for association mapping of quantitative trait loci (QTL). Seedling reaction to crown rust in these lines was assessed as infection type (IT) with each of 10 crown rust isolates. Adult plant reaction was assessed in the field in a total of 10 location-years as percentage severity (SV) and as infection reaction (IR) in a 0-to-1 scale. Overall, 29 SNPs on 12 linkage groups were predictive of crown rust reaction in at least one experiment at a genome-wide level of statistical significance. The QTL identified here include those in regions previously shown to be linked with seedling resistance genes , , , , , and and also with adult-plant resistance and adaptation-related QTL. In addition, QTL on linkage groups Mrg03, Mrg08, and Mrg23 were identified in regions not previously associated with crown rust resistance. Evaluation of marker genotypes in a set of crown rust differential lines supported as the identity of . The SNPs with rare alleles associated with lower disease scores may be suitable for use in marker-assisted selection of oat lines for crown rust resistance. Copyright © 2017 Crop Science Society of America.
Directory of Open Access Journals (Sweden)
Adriano Andrade Abrahão
2009-01-01
Full Text Available O manejo adequado de doenças foliares, como a ferrugem e a cercosporiose do cafeeiro, é fator primordial para a produção de bebidas de qualidade. Nesse sentido, torna-se de extrema importância o conhecimento dos procedimentos técnicos e de produtos fitossanitários, bem como o efeito exercido pelos mesmos na qualidade do café. Objetivou-se, com este trabalho, estudar a qualidade dos grãos de café cereja descascado e bóia procedentes de tratamentos fungicidas, em duas safras agrícolas. Foram conduzidos ensaios nos anos agrícolas 2002/03 e 2003/04. O delineamento utilizado foi o inteiramente casualizado com parcelas subdivididas, utilizando-se quatro repetições, em esquema fatorial 2 x 3 x 2, compreendendo duas safras, três tratamentos fungicidas (fungicida sistêmico, nome comercial Ópera®, fungicida de contato, nome comercial Cobox®, e testemunha não tratada com fungicidas e dois tipos de processamento, cereja descascado e bóia. As avaliações da qualidade dos grãos foram realizadas por meio das análises químicas: acidez titulável, pH, lixiviação de potássio e condutividade elétrica. Os resultados indicaram que os tratamentos fungicidas afetaram apenas a lixiviação de potássio para o café bóia, no qual o Cobox® apresentou menor lixiviação comparado aos demais. Em ambos os processamentos estudados, o segundo ano de ensaio apresentou maior condutividade elétrica, e quando considerado o café bóia, maior lixiviação de potássio. O resultados apontam ainda que, no primeiro ano de ensaio o café cereja descascado apresentou efeito superior para a acidez titulável.The appropriate management of leaf diseases, such as rust and cercospora of the coffee plant, has become extremely important to the production of good quality coffee. In this context, the knowledge of technical procedures and phytosanitary products become extremely important, as well as the effect caused by them in the coffee quality. The objective
Proposal and reclassification of standards for resistance studies of brown rust sugarcane
Directory of Open Access Journals (Sweden)
Joaquín Montalván Delgado
2017-10-01
Full Text Available In Cuba, the methodology used for sugarcane brown rust resistance evaluation has limited patterning, which makes it difficult to adequately handle cultivars in the intermediate categories of reaction, provided that from an agro-productive point of view they are interest. Six known reaction patterns and 11 commercial cultivars were studied. The variables, length, amount and percentage of leaf area occupied by pustules were recorded, as well as the length of the major pustule. The application and interpretation of statistical methods allowed to ratify as highly resistant PR980, resistant Ja64-11 and as susceptible My5514. The cultivars SP70-1284 (moderately resistant, C88-380 (moderately susceptible and C323-68 (susceptible are included as new standards. They are reclassified to C334-64 (moderately susceptible, Ja60-5 and B4362 (highly susceptible.
Can good coffee prices increase smallholder revenue?
Pinard, Fabrice; Aithal, Anand
2011-01-01
The global coffee market is currently plagued by 2 paradoxes, a coffee boom in consuming countries, and a coffee crisis in producing countries (over supply of low quality coffee and shortage of high quality coffee) which is actually driving the coffee market (Daviron and Ponte, 2005). After the termination of the International Coffee Agreement between producing and consuming countries in 1989, the coffee market has been in a flux, with market forces and over supply bringing down the coffee pr...
Legume breeding for rust resistance: Lessons to learn from the model Medicago truncatula
Rubiales, Diego; Castillejo Sánchez, M. Ángeles; Madrid, Eva; Barilli, Eleonora; Rispail, Nicolas
2011-01-01
Rusts are major biotic constraints of legumes worldwide. Breeding for rust resistance is regarded as the most cost efficient method for rust control. However, in contrast to common bean for which complete monogenic resistance exists and is efficiently used, most of the rust resistance reactions described so far in cool season food legumes are incomplete and of complex inheritance. Incomplete resistance has been described in faba bean, pea, chickpea and lentil and several of their associated Q...
Decontamination Procedure for Sorghum and Coffee Leaves Sprayed With Zinc and a Surfactant
Caione, Gustavo; Guirra, Ana Paula Pires Maciel; Prado, Renato de Mello; Klar, Antonio Evaldo
2014-01-01
Decontaminating leaf samples from crops sprayed with pesticides and nutrient solutions is important for foliar analysis. This study evaluated the effect of different washing methods in coffee and sorghum foliage that had been sprayed with zinc (with or without surfactant). The plants were sprayed with a 3 g L-1 zinc sulfate solution, with and without surfactant. Seven days later, leaves were collected and washed. The experiment was completely randomized in a 2 x 2 x 3 + 2 factorial, with thre...
Loope, Lloyd
2010-01-01
The neotropical rust fungus Puccinia psidii(P. psidii) was originally described from the host common guava in its native Brazil but has been found since on hosts throughout the myrtle family (Myrtaceae), including a dramatic host jump to nonnative Eucalyptus plantations. Most rust fungi are able to live only on a very narrow range of host species. P. psidii is unusual both for having a broad host range and for the intensity of its damage to susceptible young growth. This rust first got a foothold in the United States in Florida more than three decades ago. The U.S. Department of Agriculture (USDA) has since considered it a nonactionable, nonreportable pest. Hawaii and Florida are the only two states with native species in the myrtle family. Over a period of 30 years, this rust has done little damage to any of the scattered native Myrtaceae in Florida, although the host range of the rust has gradually grown to about 30 mostly nonnative species in the family, apparently because of increasing genetic variety of the rust by repeated introductions. However, Florida’s native Myrtaceae are among the roughly 1,100 neotropical species that are largely resistant to P. psidii. The 3,000 species of non-neotropical Myrtaceae of the Pacific, Australia, Asia, and Africa are expected to prove much more vulnerable to P. psidii. Little is known about the genetics or genetic strains of P. psidii, although existing literature shows that there are numerous strains that have differential ability to infect suites of host plants.
DIVERSITY OF PUCCINIA KUEHNII AND P. MELANOCEPHALA CAUSING RUST DISEASES ON BRAZILIAN SUGARCANE
Sugarcane industry in Brazil suffers yield loss due to brown rust (Puccinia melanocephala) since 1986 and orange rust (P. kuehnii) as recent as 2009. The main control measure for both diseases has been cultivar resistance. Nevertheless, recent onsets of orange rust on previously resistant cultivars ...
Genome-wide association study of rust traits in orchardgrass using SLAF-seq technology.
Zeng, Bing; Yan, Haidong; Liu, Xinchun; Zang, Wenjing; Zhang, Ailing; Zhou, Sifan; Huang, Linkai; Liu, Jinping
2017-01-01
While orchardgrass ( Dactylis glomerata L.) is a well-known perennial forage species, rust diseases cause serious reductions in the yield and quality of orchardgrass; however, genetic mechanisms of rust resistance are not well understood in orchardgrass. In this study, a genome-wide association study (GWAS) was performed using specific-locus amplified fragment sequencing (SLAF-seq) technology in orchardgrass. A total of 2,334,889 SLAF tags were generated to produce 2,309,777 SNPs. ADMIXTURE analysis revealed unstructured subpopulations for 33 accessions, indicating that this orchardgrass population could be used for association analysis. Linkage disequilibrium (LD) analysis revealed an average r 2 of 0.4 across all SNP pairs, indicating a high extent of LD in these samples. Through GWAS, a total of 4,604 SNPs were found to be significantly ( P rust trait. The bulk analysis discovered a number of 5,211 SNPs related to rust trait. Two candidate genes, including cytochrome P450, and prolamin were implicated in disease resistance through prediction of functional genes surrounding each high-quality SNP ( P rust traits based on GWAS analysis and bulk analysis. The large number of SNPs associated with rust traits and these two candidate genes may provide the basis for further research on rust resistance mechanisms and marker-assisted selection (MAS) for rust-resistant lineages.
Growth, development, and fertilizer-15N recovery by the coffee plant
International Nuclear Information System (INIS)
Fenilli, Tatiele Anete Bergamo; Reichardt, Klaus; Bacchi, Osny Oliveira Santos; Dourado-Neto, Durval; Favarin, Jose Laercio; Trivelim, Paulo Cesar Ocheuze; Costa, Flavio Murilo Pereira da
2007-01-01
The relationship between growth and fertilizer nitrogen recovery by perennial crops such as coffee is poorly understood and improved understanding of such relations is important for the establishment of rational crop management practices. In order to characterize the growth of a typical coffee crop in Brazil and quantify the recovery of 15 N labeled ammonium sulfate, and improve information for fertilizer management practices this study presents results for two consecutive cropping years, fertilized with 280 and 350 kg ha -1 of N, respectively, applied in four splittings, using five replicates. Shoot dry matter accumulation was evaluated every 60 days, separating plants into branches, leaves and fruits. Labeled sub-plots were used to evaluate N-total and 15 N abundance by mass spectrometry. During the first year the aerial part reached a recovery of 71% of the fertilizer N applied up to February, but this value was reduced to 34% at harvest and 19% at the beginning of the next flowering period due to leaf fall and fruit export. For the second year the aerial part absorbed 36% of the fertilizer N up to March, 47% up to harvest and 19% up to the beginning of the next flowering period. The splitting into four applications of the used fertilizer rates was adequate for the requirements of the crop at these growth stages of the coffee crop. (author)
Coffee, hunger, and peptide YY.
Greenberg, James A; Geliebter, Allan
2012-06-01
There is evidence from several empirical studies suggesting that coffee may help people control body weight. Our objective was to assess the effects of caffeine, caffeinated coffee, and decaffeinated coffee, both alone and in combination with 75 g of glucose, on perceived hunger and satiety and related peptides. We conducted a placebo-controlled single-blinded randomized 4-way crossover trial. Eleven healthy male volunteers (mean age, 23.5 ± 5.7 years; mean BMI, 23.6 ± 4.2 kg/m(2)) ingested 1 of 3 test beverages (caffeine in water, caffeinated coffee, or decaffeinated coffee) or placebo (water), and 60 minutes later they ingested the glucose. Eight times during each laboratory visit, hunger and satiety were assessed by visual analog scales, and blood samples were drawn to measure 3 endogenous peptides associated with hunger and satiety: ghrelin, peptide YY (PYY), and leptin. Compared to placebo, decaffeinated coffee yielded significantly lower hunger during the whole 180-minute study period and higher plasma PYY for the first 90 minutes (p hunger or PYY. Caffeinated coffee showed a pattern between that of decaffeinated coffee and caffeine in water. These findings suggest that one or more noncaffeine ingredients in coffee may have the potential to decrease body weight. Glucose ingestion did not change the effects of the beverages. Our randomized human trial showed that decaffeinated coffee can acutely decrease hunger and increase the satiety hormone PYY.
Essential Oils for Alternative Teak Rust Control
Directory of Open Access Journals (Sweden)
Pedro Raymundo Argüelles Osorio
2018-03-01
Full Text Available ABSTRACT The objectives of this study were to evaluate the effect of lemon grass, citronella grass, Mexican-tea and noni essential oils on urediniospore germination of Olivea neotectonae , the agent responsible for rust in Teak (Tectona grandis L.f.; to evaluate the phytotoxic effect of these essential oils on teak seedlings; and to evaluate the use of essential oils to control rust in teak plants when preventively and curatively applied. We found that the noni and lemon grass essential oils inhibited 100% of urediniospore germination. On the other hand, the essential oils from noni and lemon grass caused phytotoxicity when applied to seedlings at concentrations of 2000 and 1500 μL L-1, respectively. The major constituents found in lemon grass essential oil were Geranial and Neral, while Octanoic Acid was found in noni oil. Lower values in the area below the rust progress curve were observed with the preventive application of lemon grass and noni essential oils.
A reassessment of the risk of rust fungi developing resistance to fungicides.
Oliver, Richard P
2014-11-01
Rust fungi are major pathogens of many annual and perennial crops. Crop protection is largely based on genetic and chemical control. Fungicide resistance is a significant issue that has affected many crop pathogens. Some pathogens have rapidly developed resistance and hence are regarded as high-risk species. Rust fungi have been classified as being low risk, in spite of sharing many relevant features with high-risk pathogens. An examination of the evidence suggests that rust fungi may be wrongly classified as low risk. Of the nine classes of fungicide to which resistance has developed, six are inactive against rusts. The three remaining classes are quinone outside inhibitors (QoIs), demethylation inhibitors (DMIs) and succinate dehydrogenase inhibitors (SDHIs). QoIs have been protected by a recently discovered intron that renders resistant mutants unviable. Low levels of resistance have developed to DMIs, but with limited field significance. Older SDHI fungicides were inactive against rusts. Some of the SDHIs introduced since 2003 are active against rusts, so it may be that insufficient time has elapsed for resistance to develop, especially as SDHIs are generally sold in mixtures with other actives. It would therefore seem prudent to increase the level of vigilance for possible cases of resistance to established and new fungicides in rusts. © 2014 Society of Chemical Industry.
Turkish cultural heritage: a cup of coffee
Directory of Open Access Journals (Sweden)
Birsen Yılmaz
2017-12-01
Full Text Available Setting out a fabulous journey from a tiny bean, coffee is the stimulant of the heart and mind and a mysterious plant that strengthens friendship and also takes your tiredness away during the day. Although information on how and where the coffee came from is not clear, Sheikh Şazeli is regarded as the “father” by coffee makers. The word coffee originates from “Kaffa”, a primary coffee production center in Abyssinia, Africa, which can be considered the homeland of coffee. According to this consideration, in Abyssinia, coffee was consumed with bread; it was then pulped and brought to Yemen, and Yemeni people started to cultivate coffee. The word “kahve” in Turkish does not mean the coffee plant like its synonym in Arabic but means the beverage made by boiling. Turkish coffee is a blend of high-quality Arabic-type coffee beans, originating from Brazil and Central America and moderately roasted and ground finely. The way it is prepared differentiates Turkish coffee from others. This coffee was called Turkish coffee because of a new method of preparation invented by Turkish people where it is boiled in copper coffee pots. Turkish coffee that has spread around the world with this name has been an indispensable part of the cultural and social history of Turks.
Use of gamma radiation for inducing rust resistance in soybean
International Nuclear Information System (INIS)
Smutkupt, Sumit; Wongpiyasatid, Arunee; Lamseejan, Siranut; Naritoom, Kruik
1982-01-01
Experiments on induced mutations for rust resistance in 11 soybean cultivars were started in the rainy season of 1979. M 1 seeds were grown at Farm Suwan, Pak Chong, Nakorn Rajchasima Province. Six plods from each of 4,438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked. In addition, 270 good M 1 plants were selected and threshed singly. M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both of M 3 -bulk and M 3 -single plants together with M 2 -bulk plants derived from remnant M 2 seeds were screened for rust resistance in the rainy season of 1980. The IWGSR rust rating system was used. Based on the slow growth of rust reaction on the plant (323,333) compared with the average IWGSR rust rating notation of the rates (343) in the same row, 121 plants were selected. Among them, six were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Seeds of each selection harvested. Only 88 lines of M 4 and M 5 were available for further rust evaluation in the rainy season of 1981. The results were as follows: At 77 days after planting, 82 selected lines were rated 333, 323 in comparison with 87 out of 137 rows of control S.J.1, S.J.2, S.J.4 and T.K.5 were rated 343. At 86 days after planting, most of the selections reached the diseased level 343. However, six lines which were derived from G8586 were still rated 333. In addition, a plant with slow growth of rust (323) from Taichung N No. 81-1-032 was selected. The six selected lines having characteristics of slow growth of rust reaction on the plants will be further tested. The high yielding selections among 82 selected lines having low percentage of shrivelled seeds will be used for further yield evaluation in the rainy season of 1982
Green, Paul W C; Davis, Aaron P; Cossé, Allard A; Vega, Fernando E
2015-11-04
Pests and pathogens threaten coffee production worldwide and are difficult to control using conventional methods, such as insecticides. We review the literature on the chemistry of coffee, concentrating on compounds most commonly reported from Coffea arabica and Coffea canephora. Differences in chemistry can distinguish coffee species and varieties, and plants grown under different biogeographic conditions exhibit different chemotypes. A number of chemical groups, such as alkaloids and caffeoylquinic acids, are known to be insecticidal, but most studies have investigated their effects on coffee quality and flavor. More research is required to bridge this gap in knowledge, so that coffee can be bred to be more resistant to pests. Furthermore, we report on some pesticidal plants that have been used for control of coffee pests. Locally sourced pesticidal plants have been underutilized and offer a sustainable alternative to conventional insecticides and could be used to augment breeding for resilience of coffee plants.
stem rust seedling resistance genes in ethiopian wheat cultivars
African Journals Online (AJOL)
Prof. Adipala Ekwamu
Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...
Barberry rust survey – developing tools for diagnosis, analysis and data management
DEFF Research Database (Denmark)
Justesen, Annemarie Fejer; Hansen, Jens Grønbech; Hovmøller, Mogens Støvring
Barberry (Berberis spp.) may serve as alternate host of several Puccinia species including Puccinia graminis and P. striiformis causing stem and yellow rust on cereals and grasses, respectively. In order to study the importance of barberry in the epidemiology of Puccinia species in the CWANA regi...... a rust survey was initiated. The aim was to 1) develop a surveillance protocol 2) develop molecular diagnostic tools for identifying Puccinia spp. from aecial samples, and 3) develop a data management and display system of results as part of the Wheat Rust ToolBox (http....... Due to variable quality of aecial samples DNA extraction was not successful for 40% of the samples. Sequences of EF1α, β-tubulin or ITS were analysed and compared to reference sequences of rust fungi infecting cereals and grasses. The analysis supported the presence of P. graminis s.l., P....... arrhenatheri and P. striiformoides on barberry species. Survey and DNA sample maps with species designation were displayed in the Wheat Rust ToolBox. The future aim is to integrate barberry rust survey data based on molecular diagnostics and infection assays from research groups world-wide in order to gain...
Molecular mapping of a sunflower rust resistance gene from HAR6.
Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A
2013-03-01
Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.
White pines, blister rust, and management in the Southwest
D. A. Conklin; M Fairweather; D Ryerson; B Geils; D Vogler
2009-01-01
White pines in New Mexico and Arizona are threatened by the invasive disease white pine blister rust, Cronartium ribicola. Blister rust is already causing severe damage to a large population of southwestern white pine in the Sacramento Mountains of southern New Mexico. Recent detection in northern and western New Mexico suggests that a major expansion of the...
Interacting genes in the pine-fusiform rust forest pathosystem
H.V. Amerson; T.L. Kubisiak; S.A. Garcia; G.C. Kuhlman; C.D. Nelson; S.E. McKeand; T.J. Mullin; B. Li
2005-01-01
Fusiform rust (FR) disease of pines, caused by Cronartium quercuum f.sp. fusiforme (Cqf), is the most destructive disease in pine plantations of the southern U. S. The NCSU fusiform rust program, in conjunction with the USDA-Forest Service in Saucier, MS and Athens, GA, has research underway to elucidate some of the genetic interactions in this...
Genetic characterization of stem rust resistance in a global spring wheat germplasm collection
Stem rust is considered one of the most damaging diseases of wheat. The recent emergence of the stem rust Ug99 race group poses a serious threat to world wheat production. Utilization of genetic resistance in cultivar development is the optimal way to control stem rust. Here we report association ma...
Identification of Green Rust in Groundwater
DEFF Research Database (Denmark)
Christiansen, Bo C.; Balic Zunic, Tonci; Dideriksen, Knud
2009-01-01
to air. In this paper, we present a sampling method for capturing green rust so it is not oxidized. We then we used the method to identify the compound in a groundwater sample taken below the water table from fractures in granite. X-ray diffraction patterns were weak, but clearly identical to those......Green rust, a family of Fe(II),Fe(III) layered double hydroxides, is believed to be present in environments close to the Fe(II)/Fe(III) transition zone. Attempts to identify members of this family in nature have proven difficult because the material is oxidized after only a few minutes exposure...
Structure and Charge Hopping Dynamics in Green Rust
International Nuclear Information System (INIS)
Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.
2007-01-01
Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.
Color stability of restorative materials in response to Arabic coffee, Turkish coffee and Nescafe.
Al-Samadani, Khalid H
2013-07-01
To evaluate the effect of Arabic coffee, Turkish coffee and Nescafe on the color stability of four different composite resins after a period of aging time 1, 7 and 30 days. Twenty specimens from each type of tested composite resin material were prepared. Five specimens from each tested material (Z350 XT, Artist, GC and Z250) was evaluated after storage in Arabic coffee, Turkish coffee, Nescafe and distil water (control) at 37°C in a dark container for 1, 7 and 30 days. Color measurement was done using colorimeter based on the CIE L* a* b* color scale. Color differences ΔE*ab, Δb* and Δa* among specimens immersed in distil water and staining coffee beverages were evaluated overtime. Mean values were statistically analyzed with one-way analysis of variance (ANOVA), followed by Tukey test with p Nescafe except Δa*. The highest total color difference ΔE*ab after 30 days was in group A Arabic coffee (ΔE > 1.5 perceivable) and not perceivable in group B Turkish coffee and group C Nescafe. For Δb* all materials discolored toward yellowness after 30 days except Arabic coffee group which shifted from yellowness toward blueness (Δb*> 1.5 perceivable). The effect of staining beverages on the resin composite materials increases with time of aging toward yellowness and not perceivable in all groups except with Arabic coffee which had highest effect after 30 days and the discoloration shifted from yellowness to blueness perceivable.
Morisco, Filomena; Lembo, Vincenzo; Mazzone, Giovanna; Camera, Silvia; Caporaso, Nicola
2014-01-01
Coffee is one of the most widely used beverages in the world. It includes a wide array of components that can have potential implications for health. Several epidemiological studies associate coffee consumption with a reduced incidence of various chronic diseases such as diabetes, cardiovascular diseases, and neurodegenerative diseases. Over the past 20 years, an increasing number of epidemiological and experimental studies have demonstrated the positive effects of coffee on chronic liver diseases. Coffee consumption has been inversely associated with the activity of liver enzymes in subjects at risk, including heavy drinkers. Coffee favours an improvement in hepatic steatosis and fibrosis, and a reduction in cirrhosis and the risk of hepatocellular carcinoma. The mechanisms of action through which it exerts its beneficial effects are not fully understood. Experimental studies show that coffee consumption reduces fat accumulation and collagen deposition in the liver and promotes antioxidant capacity through an increase in glutathione as well as modulation of the gene and protein expression of several inflammatory mediators. Animal and in vitro studies indicate that cafestol and kahweol, 2 diterpens, can operate by modulating multiple enzymes involved in the detoxification process of carcinogens causing hepatocellular carcinoma. It is unclear whether the benefits are significant enough to "treat" patients with chronic liver disease. While we await clarification, moderate daily unsweetened coffee use is a reasonable adjuvant to therapy for these patients.
Water and coffee: a systems approach to improving coffee harvesting work in Nicaragua.
Silverstein, Barbara A; Bao, Stephen S; Russell, Steven; Stewart, Kate
2012-12-01
The aim of this study was to reduce the physical load on coffee-harvesting workers while maintaining productivity. Coffee is second to oil in commodity trading. Water is becoming scarce worldwide. The global virtual water footprint for one cup of coffee is 140 liters. Shade-grown coffee is one approach to reducing the water footprint. A participatory ergonomics approach was used during two Nicaraguan shade-grown coffee harvesting seasons to reduce the physical load on harvesters with the use of a newly designed bag instead of a basket strapped around the waist. Productivity in the mountainous, shade-grown coffee farms was maintained while physical load on the worker was improved somewhat.Among basket users, 84.2% reported pain in at least one body area compared with 78.9% of bag users (ns). Nonetheless, 74% of participants liked the bag "much better" than the basket. Workers identified ways the bag could be improved further with the use of local materials.These suggestions included (a) reducing the horizontal distance of the bag to reduce reach and (b) having waterproof material on the bag between the worker and the bag to reduce moisture and damage to the berries.There was no difference in productivity between using the bag and using the small basket. Workers are extending this participatory approach to how to get the harvested coffee cherries down the mountain other than carrying 40-kg bags on their backs. The ultimate goal is to make the coffee-harvesting bag design available to harvesters around the world.
Characteristics of superior soybean breeding lines tolerance to rust (Phakopsora pachyrhizi Syd.
Directory of Open Access Journals (Sweden)
Alfi Inayati
2016-04-01
Full Text Available Soybean rust caused by Phakopsora pachyrhizi is one of the most important diseases which limits soybean production. The aim of this study was to evaluate the resistance of 28 superior soybean lines and their tolerance to rust. The study was conducted at a screen house and arranged in a completely randomized design (CRD; three replications. All genotypes tested were artificially inoculated with P. pachyrhizi, and a set of un-inoculated genotypes was planted as a comparison. Number of pustules was recorded weekly, and resistant criteria was rated based on the International working group on soybean rust IWGSR method. Lesion color (LC, sporulation level (SL, number of uredia (NoU, frequency of pustule which had uredia, and yield were also recorded. Among 28 genotypes tested, only one was categorized as resistant and 2 genotypes were susceptible. Resistant genotypes had few pustules, lower AUDPC values, low disease severity, and Reddish Brown lesion type. Soybean rust affected yield components, i.e. number of intact pods and yield per plant. Yield loses due to rust in this study varied from 5-89%, and the average was 51%. The set of lines from Tanggamus pedigree showed more resistant to rust but less tolerant compared to Sinabung pedigree.How to CiteInayati, A., & Yusnawan, E. (2016. Characteristics of superior soybean breeding lines tolerancet to rust (Phakopsora pachyrhizi Syd.. Biosaintifika: Journal of Biology & Biology Education, 8(1, 47-55.
Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.
Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal
2016-04-01
The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed. Copyright © 2015 Elsevier B.V. All rights reserved.
Sensitivity to coffee and subjective health
Snel, J.; Koppes, L.L.J.; Twisk, J.W.
2009-01-01
The question was whether health complaints are associated with coffee consumption and self reported sensitivity to coffee. Participants were 89 men and 107 women, all coffee drinkers. Questionnaires were used at 2 points of time with an interval of 3.7 years. The correlations among coffee
Toward systems epidemiology of coffee and health.
Cornelis, Marilyn C
2015-02-01
Coffee is one of the most widely consumed beverages in the world and has been associated with many health conditions. This review examines the limitations of the classic epidemiological approach to studies of coffee and health, and describes the progress in systems epidemiology of coffee and its correlated constituent, caffeine. Implications and applications of this growing body of knowledge are also discussed. Population-based metabolomic studies of coffee replicate coffee-metabolite correlations observed in clinical settings but have also identified novel metabolites of coffee response, such as specific sphingomyelin derivatives and acylcarnitines. Genome-wide analyses of self-reported coffee and caffeine intake and serum levels of caffeine support an overwhelming role for caffeine in modulating the coffee consumption behavior. Interindividual variation in the physiological exposure or response to any of the many chemicals present in coffee may alter the persistence and magnitude of their effects. It is thus imperative that future studies of coffee and health account for this variation. Systems epidemiological approaches promise to inform causality, parse the constituents of coffee responsible for health effects, and identify the subgroups most likely to benefit from increasing or decreasing coffee consumption.
Study of Rust Effect on the Corrosion Behavior of Reinforcement Steel Using Impedance Spectroscopy
Bensabra, Hakim; Azzouz, Noureddine
2013-12-01
Most studies on corrosion of steel reinforcement in concrete are conducted on steel samples with polished surface (free of all oxides) in order to reproduce the same experimental conditions. However, before embedding in concrete, the steel bars are often covered with natural oxides (rust), which are formed during exposure to the atmosphere. The presence of this rust may affect the electrochemical behavior of steel rebar in concrete. In order to understand the effect of rust on the corrosion behavior of reinforcement steel, potentiodynamic and electrochemical impedance spectroscopy (EIS) tests were carried out in a simulated concrete pore solution using steel samples with two different surface conditions: polished and rusted samples. The obtained results have shown that the presence of rust on the steel bar has a negative effect on its corrosion behavior, with or without the presence of chlorides. This detrimental effect can be explained by the fact that the rust provokes a decrease of the electrolyte resistance at the metal-concrete interface and reduces the repassivating ability. In addition, the rust layer acts as a barrier against the hydroxyl ion diffusion, which prevents the realkalinization phenomenon.
Characterization of the rust formed on weathering steel exposed to Qinghai salt lake atmosphere
International Nuclear Information System (INIS)
Li, Q.X.; Wang, Z.Y.; Han, W.; Han, E.H.
2008-01-01
The product formed on weathering steel exposed to salt lake atmosphere for 12 months was investigated by X-ray diffraction (XRD), infrared transmission spectroscopy (IRS), scanning electron microscopy (SEM), electron probe micro analyzer (EPMA) and electrochemical techniques. The rust was mainly composed of β-FeOOH, Fe 8 (O,OH) 16 Cl 1.3 and a little γ-FeOOH. Amorphous δ-FeOOH was only on skyward surface. The rust layer suppressed anodic reaction and facilitated the cathodic reaction. The very small value of rust resistance R r in this work indicated that the rust had poor protective ability. Cl element was rich in the whole rust layer and played an important role in accelerating the corrosion of weathering steel in salt lake atmosphere
Transfer of stripe rust resistance from Aegilops variabilis to bread ...
African Journals Online (AJOL)
In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...
Gill, Upinder S; Uppalapati, Srinivasa R; Nakashima, Jin; Mysore, Kirankumar S
2015-05-08
Switchgrass rust, caused by Puccinia emaculata, is an important disease of switchgrass, a potential biofuel crop in the United States. In severe cases, switchgrass rust has the potential to significantly affect biomass yield. In an effort to identify novel sources of resistance against switchgrass rust, we explored nonhost resistance against P. emaculata by characterizing its interactions with six monocot nonhost plant species. We also studied the genetic variations for resistance among Brachypodium inbred accessions and the involvement of various defense pathways in nonhost resistance of Brachypodium. We characterized P. emaculata interactions with six monocot nonhost species and identified Brachypodium distachyon (Bd21) as a suitable nonhost model to study switchgrass rust. Interestingly, screening of Brachypodium accessions identified natural variations in resistance to switchgrass rust. Brachypodium inbred accessions Bd3-1 and Bd30-1 were identified as most and least resistant to switchgrass rust, respectively, when compared to tested accessions. Transcript profiling of defense-related genes indicated that the genes which were induced in Bd21after P. emaculata inoculation also had higher basal transcript abundance in Bd3-1 when compared to Bd30-1 and Bd21 indicating their potential involvement in nonhost resistance against switchgrass rust. In the present study, we identified Brachypodium as a suitable nonhost model to study switchgrass rust which exhibit type I nonhost resistance. Variations in resistance response were also observed among tested Brachypodium accessions. Brachypodium nonhost resistance against P. emaculata may involve various defense pathways as indicated by transcript profiling of defense related genes. Overall, this study provides a new avenue to utilize novel sources of nonhost resistance in Brachypodium against switchgrass rust.
Mainstreaming sustainable coffee
Kolk, A.
2013-01-01
This overview article examines the various dimensions of sustainable coffee as well as the actors involved and their perceptions of how to advance the market from niche to mainstream. The issues at hand are very complex, with different types of coffee producers, manufacturing/roasting companies and
Rodrigues, Carla; Maia, Rodrigo; Brunner, Marion; Carvalho, Eduardo; Prohaska, Thomas; Máguas, Cristina
2010-05-01
Plant seeds incorporate the prevailing climate conditions and the physiological response to those conditions (Rodrigues et al., 2009; Rodrigues et al., submitted). During coffee seed maturation the biochemical compounds may either result from accumulated material in other organs such as leafs and/or from new synthesis. Accordingly, plant seeds develop in different stages along a particular part of the year, integrating the plant physiology and seasonal climatic conditions. Coffee bean is an extremely complex matrix, rich in many products derived from both primary and secondary metabolism during bean maturation. Other studies (De Castro and Marraccini, 2006) have revealed the importance of different coffee plant organs during coffee bean development as transfer tissues able to provide compounds (i.e. sugars, organic acids, etc) to the endosperm where several enzymatic activities and expressed genes have been reported. Moreover, it has been proved earlier on that green coffee bean is a particularly suitable case-study (Rodrigues et al., 2009; Rodrigues et al., submitted), not only due to the large southern hemispheric distribution but also because of this product high economic interest. The aim of our work was to evaluate the potential use of green coffee seeds as a proxy to seasonal climatic conditions during coffee bean maturation, through an array of isotopic composition determinations. We have determined carbon, nitrogen, oxygen and sulfur isotopic composition (by IRMS - Isotope Ratio Mass Spectrometry) as well as strontium isotope abundance (by MC-ICP-MS; Multicollector Inductively Coupled Plasma Mass Spectrometry), of green coffee beans harvested at different times at Minas Gerais, Brazil. The isotopic composition data were combined with air temperature and relative humidity data registered during the coffee bean developmental period, and with the parent rock strontium isotopic composition. Results indicate that coffee seeds indeed integrate the interactions
Determination of trace elements in coffee beans and instant coffee of various origins by INAA
International Nuclear Information System (INIS)
Zaidi, J.H.; Fatima, I.; Arif, M.; Qureshi, I.H.
2006-01-01
Extensive use of coffee, by one-third of world's population, entails the evaluation of trace element contents in it. Instrumental neutron activation analysis (INAA) was successfully employed to determine the concentration of 20 trace elements (essential, toxic and nonessential) in four samples of coffee beans of various origins and two instant coffee brands most commonly consumed in Pakistan. Base-line values of certain toxic and essential elements in coffee are provided. The daily intake of essential and toxic elements through coffee was estimated and compared with the recommended values. The cumulative intake of Mn is four times higher than the recommended value and that of toxic elements is well below the tolerance limits. (author)
Magnetic property based characterization of rust on weathering steels
International Nuclear Information System (INIS)
Mizoguchi, T.; Ishii, Y.; Okada, T.; Kimura, M.; Kihira, H.
2005-01-01
The characterization of rusts on weathering steels is important in understanding the origin of their corrosion resistance. Rust consists of several phases, e.g. α-, β- and γ-FeOOH, which are anti-ferromagnetic with different Neel temperatures. Rust on so-called advanced weathering steel containing 3 wt.% Ni [H. Kihira, A. Usami, K. Tanabe, M. Ito, G. Shigesato, Y. Tomita, T. Kusunoki, T. Tsuzuki, S. Ito, T. Murata, in: Proc. Symp. on Corrosion and Corrosion Control in Saltwater Environments, Honolulu, 1999, The Electrochemical Soc., pp. 127-136] contains in addition a ferrimagnetic spinel phase [M. Kimura, H. Kihira, Y. Ishii, T. Mizoguchi, in: Proc. 13th Asian-Pacific Corrosion Control Conference, Osaka, 2003; M. Kimura, H. Kihira, N. Ohta, M. Hashimoto, T. Senuma, Corros. Sci., this volume; M. Kimura, N. Ohta, H. Kihira, Mater. Trans. JIM, in press]. The nanostructure of real rust cannot be elucidated satisfactorily only with conventional analytical methods such as X-ray diffraction, because of the complex mixture of phases with fine and imperfect crystallites. Because of the short range of the super-exchange coupling between Fe ions in a solid, the magnetic properties can give information on local configurations even in the absence of perfect crystalline coherence. Therefore, the magnetic properties of rust samples were investigated in detail using a Superconducting Quantum Interference Device (SQUID) magnetometer and Moessbauer spectroscopy. SQUID magnetometry is effective to determine the quantity of the ferrimagnetic phase. The temperature dependence of the Moessbauer spectrum gives information about not only the fractions of the phases but also the distribution of grain volume, V, in each phase according to the super-paramagnetic relaxation effect. This approach has been applied to rust of conventional [T. Okada, Y. Ishii, T. Mizoguchi, I. Tamura, Y. Kobayashi, Y. Takagi, S. Suzuki, H. Kihira, M. Ito, A. Usami, K. Tanabe, K. Masuda, Jpn. J. Appl. Phys. 39
Bulked fusiform rust inocula and Fr gene interactions in loblolly pine
Fikret Isik; Henry Amerson; Saul Garcia; Ross Whetten; Steve. McKeand
2012-01-01
Fusiform rust disease in loblolly (Pinus taeda L.) and slash (Pinus elliottii Engelm. var elliottii) pine plantations in the southern United States causes multi-million dollar annual losses. The disease is endemic to the region. The fusiform rust fungus (Cronartium quercuum sp.
Thrips (Thysanoptera) of coffee flowers
A survey of thrips (Thysanoptera) associated with coffee flowers was conducted in coffee plantations in Chiapas, Mexico. The main objectives were to identify them and to determine whether they were carrying coffee pollen grains. A total of 40 thrips species in 22 genera were identified. The most com...
Thapa, Sushil; Lantinga, Egbert A.
2017-01-01
Coffee white stem borer, Xylotrechus quadripes Chevrolat (Coleoptera: Cerambycidae) is a major coffee pest in parts of Asia and Africa. In recent years, the pest has also been found in American countries. This study in Gulmi District, Nepal, aimed to determine the infestation by coffee white stem
Directory of Open Access Journals (Sweden)
Omar Vergara-Diaz
2015-06-01
Full Text Available The biotrophic fungus Puccinia striiformis f. sp. tritici is the causal agent of the yellow rust in wheat. Between the years 2010–2013 a new strain of this pathogen (Warrior/Ambition, against which the present cultivated wheat varieties have no resistance, appeared and spread rapidly. It threatens cereal production in most of Europe. The search for sources of resistance to this strain is proposed as the most efficient and safe solution to ensure high grain production. This will be helped by the development of high performance and low cost techniques for field phenotyping. In this study we analyzed vegetation indices in the Red, Green, Blue (RGB images of crop canopies under field conditions. We evaluated their accuracy in predicting grain yield and assessing disease severity in comparison to other field measurements including the Normalized Difference Vegetation Index (NDVI, leaf chlorophyll content, stomatal conductance, and canopy temperature. We also discuss yield components and agronomic parameters in relation to grain yield and disease severity. RGB-based indices proved to be accurate predictors of grain yield and grain yield losses associated with yellow rust (R2 = 0.581 and R2 = 0.536, respectively, far surpassing the predictive ability of NDVI (R2 = 0.118 and R2 = 0.128, respectively. In comparison to potential yield, we found the presence of disease to be correlated with reductions in the number of grains per spike, grains per square meter, kernel weight and harvest index. Grain yield losses in the presence of yellow rust were also greater in later heading varieties. The combination of RGB-based indices and days to heading together explained 70.9% of the variability in grain yield and 62.7% of the yield losses.
REVIEW - Advances on molecular studies of the interaction soybean - Asian rust
Directory of Open Access Journals (Sweden)
Aguida Maria Alves Pereira Morales
2012-01-01
Full Text Available Effective management practices are essential for controlling rust outbreaks. The main control methodused is the application of fungicides, which increases substantially the cost of production and is harmful to theenvironment. Prevention is still the best way to avoid more significant losses in soybean yields. Alternatives,such as planting resistant varieties to the fungus, are also important. The use of resistant or tolerant varietiesis the most promising method for controlling Asian soybean rust. Recently, five dominant genes resistant to soybean rust were described: Rpp1, Rpp2, Rpp3, Rpp4 and Rpp5. However, little is known about the molecular interaction among soybean plant and soybean rust and on the molecular pathway triggered by pathogen recognition. Understanding the molecular mechanisms involved in defense responses is of primary importance for planning strategies to control stress and, consequently, to increase plant adaptation to limiting conditions
Caffeine content of decaffeinated coffee.
McCusker, Rachel R; Fuehrlein, Brian; Goldberger, Bruce A; Gold, Mark S; Cone, Edward J
2006-10-01
Caffeine is the most widely consumed drug in the world with coffee representing a major source of intake. Despite widespread availability, various medical conditions necessitate caffeine-restricted diets. Patients on certain prescription medications are advised to discontinue caffeine intake. Such admonition has implications for certain psychiatric patients because of pharmacokinetic interactions between caffeine and certain anti-anxiety drugs. In an effort to abstain from caffeine, patients may substitute decaffeinated for caffeinated coffee. However, decaffeinated beverages are known to contain caffeine in varying amounts. The present study determined the caffeine content in a variety of decaffeinated coffee drinks. In phase 1 of the study, 10 decaffeinated samples were collected from different coffee establishments. In phase 2 of the study, Starbucks espresso decaffeinated (N=6) and Starbucks brewed decaffeinated coffee (N=6) samples were collected from the same outlet to evaluate variability of caffeine content of the same drink. The 10 decaffeinated coffee samples from different outlets contained caffeine in the range of 0-13.9 mg/16-oz serving. The caffeine content for the Starbucks espresso and the Starbucks brewed samples collected from the same outlet were 3.0-15.8 mg/shot and 12.0-13.4 mg/16-oz serving, respectively. Patients vulnerable to caffeine effects should be advised that caffeine may be present in coffees purported to be decaffeinated. Further research is warranted on the potential deleterious effects of consumption of "decaffeinated" coffee that contains caffeine on caffeine-restricted patients. Additionally, further exploration is merited for the possible physical dependence potential of low doses of caffeine such as those concentrations found in decaffeinated coffee.
The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...
Process technology of luwak coffee through bioreactor utilization
Hadipernata, M.; Nugraha, S.
2018-01-01
Indonesia has an advantage in producing exotic coffee that is Luwak coffee. Luwak coffee is produced from the fermentation process in digestion of civet. Luwak coffee production is still limited due to the difficulty level in the use of civet animals as the only medium of Luwak coffee making. The research was conducted by developing technology of luwak coffee production through bioreactor utilization and addition the bacteria isolate from gastric of civet. The process conditions in the bioreactor which include temperature, pH, and bacteria isolate of civet are adjusted to the process that occurs in civet digestion, including peristaltic movement on the stomach and small intestine of the civet will be replaced by the use of propellers that rotate on the bioreactor. The result of research showed that proximat analysis data of artificial/bioreactor luwak coffee did not significant different with original luwak coffee. However, the original luwak coffee has higher content of caffeine compared to bioreactor luwak coffee. Based on the cuping test the bioreactor luwak coffee has a value of 84.375, while the original luwak coffee is 84.875. As the result, bioreactor luwak coffee has excellent taste that similiar with original luwak coffee taste.
The Impact of Coffee on Health.
Nieber, Karen
2017-11-01
Coffee is one of the most popular and widely consumed beverages worldwide due to its stimulating effects on the central nervous system as well as its taste and aroma. Coffee is a complex mixture of more than 800 volatile compounds whereas caffeine and chlorogenic acids are the most common compounds. During the last years, coffee has progressively moved to a less negative position on health due to its better-known pharmacology. Caffeine, e.g., in a cup of coffee, appears to exert most of its effects through an antagonism of the adenosine receptors. Novel approaches in epidemiological studies and experimental researches suggest that coffee consumption may help to prevent several chronic diseases, including type 2 diabetes mellitus and liver disease. Most prospective cohort studies have not found coffee consumption to be associated with a significantly increased cardiovascular disease risk. There is also evidence that decaffeinated coffee may, in some respect, have similar benefits as regular coffee, indicating that besides caffeine other components contribute to the health protecting effects. For adults consuming moderate amounts of coffee (3 - 4 cups/d providing 300 - 400 mg/d of caffeine), there is little evidence of health risks and some evidence of health benefits. This review provides up-to-date information about coffee on health. Topics addressed include the cardiovascular system, liver diseases, and diabetes as well as gastrointestinal disorders. Georg Thieme Verlag KG Stuttgart · New York.
Flavan-3-ols Are an Effective Chemical Defense against Rust Infection.
Ullah, Chhana; Unsicker, Sybille B; Fellenberg, Christin; Constabel, C Peter; Schmidt, Axel; Gershenzon, Jonathan; Hammerbacher, Almuth
2017-12-01
Phenolic secondary metabolites are often thought to protect plants against attack by microbes, but their role in defense against pathogen infection in woody plants has not been investigated comprehensively. We studied the biosynthesis, occurrence, and antifungal activity of flavan-3-ols in black poplar ( Populus nigra ), which include both monomers, such as catechin, and oligomers, known as proanthocyanidins (PAs). We identified and biochemically characterized three leucoanthocyanidin reductases and two anthocyanidin reductases from P. nigra involved in catalyzing the last steps of flavan-3-ol biosynthesis, leading to the formation of catechin [2,3-trans-(+)-flavan-3-ol] and epicatechin [2,3-cis-(-)-flavan-3-ol], respectively. Poplar trees that were inoculated with the biotrophic rust fungus ( Melampsora larici-populina ) accumulated higher amounts of catechin and PAs than uninfected trees. The de novo-synthesized catechin and PAs in the rust-infected poplar leaves accumulated significantly at the site of fungal infection in the lower epidermis. In planta concentrations of these compounds strongly inhibited rust spore germination and reduced hyphal growth. Poplar genotypes with constitutively higher levels of catechin and PAs as well as hybrid aspen ( Populus tremula × Populus alba ) overexpressing the MYB134 transcription factor were more resistant to rust infection. Silencing PnMYB134 , on the other hand, decreased flavan-3-ol biosynthesis and increased susceptibility to rust infection. Taken together, our data indicate that catechin and PAs are effective antifungal defenses in poplar against foliar rust infection. © 2017 American Society of Plant Biologists. All Rights Reserved.
Utilization of a major brown rust resistance gene in sugarcane breeding
Brown rust, caused by Puccinia melanocephala has had devastating effects on sugarcane (Saccharum spp.) breeding programs and on commercial production. The discovery of Bru1, a major gene conferring resistance to brown rust represented a substantial breakthrough and markers for the detection of Bru1 ...
Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).
Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L
2013-01-01
Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.
Turkish cultural heritage: a cup of coffee
Birsen Yılmaz; Nilüfer Acar-Tek; Saniye Sözlü
2017-01-01
Setting out a fabulous journey from a tiny bean, coffee is the stimulant of the heart and mind and a mysterious plant that strengthens friendship and also takes your tiredness away during the day. Although information on how and where the coffee came from is not clear, Sheikh Şazeli is regarded as the “father” by coffee makers. The word coffee originates from “Kaffa”, a primary coffee production center in Abyssinia, Africa, which can be considered the homeland of coffee. According to this con...
Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate.
Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A
2015-12-01
Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.
Effect of orange rust on sugarcane breeding program at canal Point
Orange rust of sugarcane (Saccharum spp. hybrids), caused by Puccinia kuehnii (W. Krüger) E.J. Butler, appeared in the Western Hemisphere ten years ago. Orange rust substantially reduces yields in susceptible sugarcane genotypes. Majority of the commercial cultivars were susceptible at the time of o...
Wheat stem rust in South Africa: Current status and future research ...
African Journals Online (AJOL)
. In South Africa, stem rust caused by Puccinia graminis Pers. f. sp. tritici. Eriks. & E. Henn. (Pgt) is an important disease of wheat. Records of stem rust occurrence in South Africa date back to the late 1720's, when it was first discovered in the ...
DEFF Research Database (Denmark)
Backes, G.; Madsen, L.H.; Jaiser, H.
2003-01-01
The aims of this investigation have been to map new (quantitative) resistance genes against powdery mildew, caused by Blumeria graminis f.sp. hordei L., and leaf rust, caused by Puccinia hordei L., in a cross between the barley (Hordeum vulgare ssp. vulgare) cultivar "Vada" and the wild barley...... (Hordeum vulgare ssp. spontaneum) line "1B-87" originating from Israel. The population consisted of 121 recombinant inbred lines. Resistance against leaf rust and powdery mildew was tested on detached leaves. The leaf rust isolate "I-80" and the powdery mildew isolate "Va-4", respectively, were used...
Markkinointiviestintäsuunnitelma : Classic Coffee Oy
Eerola, Laura
2015-01-01
Opinnäytetyön aiheena oli laatia markkinointiviestintäsuunnitelma kalenterivuodelle 2016 vuosikellon muodossa, toimintansa jo vakiinnuttaneelle Classic Coffee Oy:lle. Classic Coffee Oy on vuonna 2011 perustettu, Tampereella toimiva kahvila-alan yritys joka tarjoaa lounaskahvilatoiminnan lisäksi laadukkaita konditoria-palveluita, yritys- ja kokoustarjoiluja sekä tilavuokrausta. Classic Coffee Oy:llä on yksi kahvila, Classic Coffee Tampella. Kahvila sijaitsee Tampellassa, Tampereen keskustan vä...
Directory of Open Access Journals (Sweden)
Krystal de Alcantara Notaro
2014-04-01
Full Text Available Agroforestry systems are an alternative option for sustainable production management. These systems contain trees that absorb nutrients from deeper layers of the soil and leaf litter that help improve the soil quality of the rough terrain in high altitude areas, which are areas extremely susceptible to environmental degradation. The aim of this study was to characterize the stock and nutrients in litter, soil activity and the population of microorganisms in coffee (Coffea arabica L. plantations under high altitude agroforestry systems in the semi-arid region of the state of Pernambuco, Brazil. Samples were collected from the surface litter together with soil samples taken at two depths (0-10 and 10-20 cm from areas each subject to one of the following four treatments: agroforestry system (AS, native forest (NF, biodynamic system (BS and coffee control (CT.The coffee plantation had been abandoned for nearly 15 years and, although there had been no management or harvesting, still contained productive coffee plants. The accumulation of litter and mean nutrient content of the litter, the soil nutrient content, microbial biomass carbon, total carbon, total nitrogen, C/N ratio, basal respiration, microbial quotient, metabolic quotient and microbial populations (total bacteria, fluorescent bacteria group, total fungi and Trichoderma spp. were all analyzed. The systems thatwere exposed to human intervention (A and BS differed in their chemical attributes and contained higher levels of nutrients when compared to NF and CT. BS for coffee production at high altitude can be used as a sustainable alternative in the high altitude zones of the semi-arid region in Brazil, which is an area that is highly susceptible to environmental degradation.
Susan K. Hagle; Geral I. McDonald; Eugene A. Norby
1989-01-01
This report comprises a handbook for managing western white pine in northern ldaho and western Montana, under the threat of white pine blister rust. Various sections cover the history of the disease and efforts to combat it, the ecology of the white pine and Ribes, alternate host of the rust, and techniques for evaluating the rust hazard and attenuating it. The authors...
Banchoff, Thomas
2006-01-01
What may have been the birth of a new calculus problem took place when the author noticed that two coffee cups, one convex and one concave, fit nicely together, and he wondered which held more coffee. The fact that their volumes were about equal led to the topic of this article: complementary surfaces of revolution with equal volumes.
Evaluation of physiological changes in coffee seedlings ...
African Journals Online (AJOL)
Field experiments were carried out at three locations with different vegetation in Nigeria between 1996 and 1998 to determine the physiological changes in coffee intercropped with maize, cassava and plantain. There were four intercropping treatments comprising coffee/maize, coffee/cassava, coffee/plantain and ...
Zhang, Zhi; Song, Liqiang; Han, Haiming; Zhou, Shenghui; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui
2017-11-13
Stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat ( Triticum aestivum L.) worldwide. Agropyron cristatum (L.) Gaertn. (2 n = 28, PPPP), one of the wild relatives of wheat, exhibits resistance to stripe rust. In this study, wheat- A . cristatum 6P disomic addition line 4844-12 also exhibited resistance to stripe rust. To identify the stripe rust resistance locus from A . cristatum 6P, ten translocation lines, five deletion lines and the BC₂F₂ and BC₃F₂ populations of two wheat- A . cristatum 6P whole-arm translocation lines were tested with a mixture of two races of Pst in two sites during 2015-2016 and 2016-2017, being genotyped with genomic in situ hybridization (GISH) and molecular markers. The result indicated that the locus conferring stripe rust resistance was located on the terminal 20% of 6P short arm's length. Twenty-nine 6P-specific sequence-tagged-site (STS) markers mapped on the resistance locus have been acquired, which will be helpful for the fine mapping of the stripe rust resistance locus. The stripe rust-resistant translocation lines were found to carry some favorable agronomic traits, which could facilitate their use in wheat improvement. Collectively, the stripe rust resistance locus from A . cristatum 6P could be a novel resistance source and the screened stripe rust-resistant materials will be valuable for wheat disease breeding.
Directory of Open Access Journals (Sweden)
D. M. Dedecca
1957-01-01
, ao mesmo tempo que foi impedida a formação de um verdadeiro parênquima paliçádico. A grande atividade da gema apical dos cafeeiros que exibem êste tipo de variegação, tal como pode ser observada pelas freqüentes modificações na sua morfologia, conduziu essas plantas a um intenso desenvolvimento vegetativo, servindo de evidência em favor da hipótese de que distúrbios vários devem ter ocorrido durante o desenvolvimento daquelas fôlhas.Two different types of leaf variegation in coffee plants are studied on the anatomical viewpoint, and their histological differences are described, when compared with normal, green leaves. In the first case, variegated leaves are normal in shape and texture, and show different variegation patterns, being histologically identical with green leaves of normal plants. The variegation seems to be due to disturbances in the chlorophyll-producing mechanism, resulting in the formation of large, green and normal chloroplasts, aad small, yellowish and abnormal chloroplasts. The distribution at random of cells having one of these two kinds of chloroplasts can be accounted for the different variegation patterns observed. In the second example, the variegation pattern is uniform throughout the entire plant, and is a more complex phenomenon, since besides being variegated the leaves present several malformations. The anatomical study has revealed that, in this case, the chloroplasts are always normal, the variegation being rather due to the presence of an 1-3-layered hialine hypodermis, which occurs right beneath the upper epidermis. The malformations, represented by abnormalities in the shape and texture of the leaf blade, are mainly due to the lackness of a true palisade parenchyma. This tissue shows all grades of disorganization in the various portions of the leaf, being sometimes present as small patches or palisade cells or lacking completely in other instances. It is suggested that disturbances of any kind should have occurred
Biodiesel Production from Spent Coffee Grounds
Blinová, Lenka; Bartošová, Alica; Sirotiak, Maroš
2017-06-01
The residue after brewing the spent coffee grounds is an oil-containing waste material having a potential of being used as biodiesel feedstock. Biodiesel production from the waste coffee grounds oil involves collection and transportation of coffee residue, drying, oil extraction, and finally production of biodiesel. Different methods of oil extraction with organic solvents under different conditions show significant differences in the extraction yields. In the manufacturing of biodiesel from coffee oil, the level of reaction completion strongly depends on the quality of the feedstock oil. This paper presents an overview of oil extraction and a method of biodiesel production from spent coffee grounds.
New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery
Directory of Open Access Journals (Sweden)
Qiong Zheng
2018-03-01
Full Text Available Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI, a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor’s relative spectral response (RSR function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red, B5 (Re1, and B7 (Re3, were found to be sensitive bands using the random forest (RF method. A new multispectral index, the Red Edge Disease Stress Index (REDSI, which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI’s ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and
New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery.
Zheng, Qiong; Huang, Wenjiang; Cui, Ximin; Shi, Yue; Liu, Linyi
2018-03-15
Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI), a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe) in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor's relative spectral response (RSR) function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red), B5 (Re1), and B7 (Re3), were found to be sensitive bands using the random forest (RF) method. A new multispectral index, the Red Edge Disease Stress Index (REDSI), which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI's ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and generalized ability
Mechanical properties of the rust layer induced by impressed current method in reinforced mortar
International Nuclear Information System (INIS)
Care, S.; Nguyen, Q.T.; L'Hostis, V.; Berthaud, Y.
2008-01-01
This paper describes the mechanical effects of rust layer formed in reinforced mortar through accelerated tests of corrosion. The morphological and physico-chemical properties (composition, structures) of the corrosion system were characterized at different stages by using optical microscope and scanning electron microscope coupled with energy dispersive spectroscopy. The corrosion pattern was mainly characterized by a rust layer confined at the interface between the steel and the mortar. Expansion coefficient of rust products was determined from the rust thickness and the Faraday's law. Furthermore, in order to understand the mechanical effects of corrosion on the damage of mortar, displacement field measurements were obtained by using digital image correlation. An analytical model (hollow cylinder subjected to inner and outer pressures) was used with a set of experimental data to deduce the time of cracking and the order of magnitude of the mechanical properties of the rust layer
Coffee consumption and risk of renal cell carcinoma.
Antwi, Samuel O; Eckel-Passow, Jeanette E; Diehl, Nancy D; Serie, Daniel J; Custer, Kaitlynn M; Arnold, Michelle L; Wu, Kevin J; Cheville, John C; Thiel, David D; Leibovich, Bradley C; Parker, Alexander S
2017-08-01
Studies have suggested an inverse association between coffee consumption and risk of renal cell carcinoma (RCC); however, data regarding decaffeinated coffee are limited. We conducted a case-control study of 669 incident RCC cases and 1,001 frequency-matched controls. Participants completed identical risk factor questionnaires that solicited information about usual coffee consumption habits. The study participants were categorized as non-coffee, caffeinated coffee, decaffeinated coffee, or both caffeinated and decaffeinated coffee drinkers. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using logistic regression, adjusting for multiple risk factors for RCC. Compared with no coffee consumption, we found an inverse association between caffeinated coffee consumption and RCC risk (OR 0.74; 95% CI 0.57-0.99), whereas we observed a trend toward increased risk of RCC for consumption of decaffeinated coffee (OR 1.47; 95% CI 0.98-2.19). Decaffeinated coffee consumption was associated also with increased risk of the clear cell RCC (ccRCC) subtype, particularly the aggressive form of ccRCC (OR 1.80; 95% CI 1.01-3.22). Consumption of caffeinated coffee is associated with reduced risk of RCC, while decaffeinated coffee consumption is associated with an increase in risk of aggressive ccRCC. Further inquiry is warranted in large prospective studies and should include assessment of dose-response associations.
The Climate Change and Rwandan Coffee Sector
Directory of Open Access Journals (Sweden)
Fidele Hakorimana
2017-10-01
Full Text Available This paper provides a detailed overview of the current situation of the coffee sector in the Rwandan economy and identifies the possible challenges that the sector is currently facing. The study has identified the economic and the livelihood indicators for farmers who are engaged in coffee production and also gives the Rwandan coffee sector’ situation and its position in the global coffee market. Also, the research has found out that in Rwanda, nearly 500,000 farmers produce coffee along with other crops, notably beans, savory banana and corn and found out that in 2012, coffee accounted for almost 30 percent of Rwanda’s total export revenue. On the other hand, the study revealed that the sector throughout all the coffee production process, has undergone different challenges especially climate change as it is reported by the Ministry of Agriculture and Animal resources. A low yield was reported in 2007 and climate variability was quoted among the causes. Insufficient rainfall in the last three months of 2006 (the period of coffee flowering proceeding the short dry season in the first two months of 2007 was recorded. The reduced rainfall was also poorly distributed across coffee growing regions in Rwanda. In addition, the research revealed that even though the area under coffee production is increasing, the coffee production is decreasing due to unexpected climate change and variability in current years and also the improper use of chemical fertilizers by coffee farmers is very critical. The study concluded that adding value to the coffee supply chain of Rwanda is adding direct economic benefits and important indirect social benefits to the lives of individuals and to the health of communities in Rwanda. Moreover, more effort should continue to raise the profile of the Rwandan coffee sector suggesting that proper use of chemical fertilizers, solid marketing channels and climate change adaptations measures would be the fair ways of making the
Detection of wheat stem rust race RRTTF in Ecuador in 2016
Wheat stem rust is a devastating disease that has incited numerous severe epidemics resulting in extreme yield losses over the past century. Stem rust infection in plots of wheat line UC11075, known to carry the Sr38 resistance gene, was severe in February 2016 in a nursery at the Instituto Nacional...
Resistance to white pine blister rust in Pinus flexilis and P
Anna W. Schoettle; Richard A. Sniezko; Angelia Kegley; Jerry Hill; Kelly S. Burns
2010-01-01
The non-native fungus Cronartium ribicola, that causes white pine blister rust (WPBR), is impacting or threatening limber pine, Pinus flexilis, and Rocky Mountain bristlecone pine, Pinus aristata. In the Southern Rockies, where the rust invasion is still expanding, we have the opportunity to be proactive and prepare the landscape for invasion. Genetic...
MICROCOSM STUDY OF DEGRADATION OF CHLORINATED SOLVENTS ON SYNTHETIC GREEN RUST MINERALS
Green rust minerals contain ferrous ion in their structure that can potentially serve as a chemical reductant for degradation of chlorinated solvents. Green rusts are found in zerovalent iron based permeable reactive barriers and in certain soil and sediments. Some previous labor...
Coffee Production in Kavre and Lalitpur Districts, Nepal
Directory of Open Access Journals (Sweden)
Yogendra Kumar Karki
2018-05-01
Full Text Available Coffee (Coffea spp is an important and emerging cash crop having potential to provide farmers employment and income generation opportunities. This crop is well adapted to the climatic conditions of mid-hills of Nepal. Thus, majority of the farmers are attracted towards cultivation of coffee because of demands in national and international market. Coffee is now becoming integral part of farming system in rural areas. However, information on performance of coffee and farmers response has not been well documented. Therefore, we undertook the present work to analyze demography, ethnicity, household occupation, literacy status, average land holding, coffee cultivation area, livelihood and sources of income of coffee growers, production and productivity, pricing, cropping pattern of the coffee and problesm faced by them in mid hill district of Kavrepalanchowk (hereafter ‘Kavre’ and Lalitpur Districts. All the samples were taken randomly and selected from coffee producing cooperative of Kavre and Lalitpur. Our analysis showed that the male farmer dominant over female on adopting coffee cultivation in both districts with higher value in Kavre. Brahmin and Chetri ethnic communities were in majority over others in adopting the coffee cultivation. Literate farmers were more dominant over illiterates on adopting the coffee cultivation, The mean land holding was less, ranging from 0.15 to 2.30 ha for coffee cultivation, the history of coffee cultivation in Kavre showed that highest number of farmers were engaged in coffee farming from last 16 years. The mean yield of fresh cherry was 1027.20 kg/ha in Kavre, while it was 1849.36 kg/ha in Lalitpur. The study revealed that majority of the coffee plantations were between 6-10 years old. The major problems facing by coffee farmers were diseases spread, lack of irrigation facility and drying of plants. Despite of that the coffee farming was one of the rapidly emerging occupations among the farmers in both
Coffee harvest management by manipulation of coffee flowering with plant growth regulators
The breaking of coffee flower bud dormancy is known to be associated with one or more significant rainfall events following an extended period of dryness. In Hawaii, lack of a distinct wet-dry season poses serious problems for coffee growers because flowering is spread over several months. Multiple...
Buying cannabis in 'coffee shops'.
Monshouwer, Karin; Van Laar, Margriet; Vollebergh, Wilma A
2011-03-01
The key objective of Dutch cannabis policy is to prevent and limit the risks of cannabis consumption for users, their direct environment and society ('harm reduction'). This paper will focus on the tolerated sale of cannabis in 'coffee shops'. We give a brief overview of Dutch policy on coffee shops, its history and recent developments. Furthermore, we present epidemiological data that may be indicative of the effects of the coffee shop policy on cannabis and other drug use. Dutch coffee shop policy has become more restrictive in recent years and the number of coffee shops has decreased. Cannabis prevalence rates in the adult population are somewhat below the European average; the rate is relatively high among adolescents; and age of first use appears to be low. On a European level, the use of hard drugs in both the Dutch adult and adolescent population is average to low (except for ecstasy among adults). International comparisons do not suggest a strong, upward effect of the coffee shop system on levels of cannabis use, although prevalence rates among Dutch adolescents give rise to concern. Furthermore, the coffee shop system appears to be successful in separating the hard and soft drugs markets. Nevertheless, in recent years, issues concerning the involvement of organised crime and the public nuisance related to drug tourism have given rise to several restrictive measures on the local level and have sparked a political debate on the reform of Dutch drug policy. © 2011 Trimbos Institute.
Variation in caffeine concentration in single coffee beans.
Fox, Glen P; Wu, Alex; Yiran, Liang; Force, Lesleigh
2013-11-13
Twenty-eight coffee samples from around the world were tested for caffeine levels to develop near-infrared reflectance spectroscopy (NIRS) calibrations for whole and ground coffee. Twenty-five individual beans from five of those coffees were used to develop a NIRS calibration for caffeine concentration in single beans. An international standard high-performance liquid chromatography method was used to analyze for caffeine content. Coffee is a legal stimulant and possesses a number of heath properties. However, there is variation in the level of caffeine in brewed coffee and other caffeinated beverages. Being able to sort beans on the basis of caffeine concentration will improve quality control in the level of caffeine in those beverages. The range in caffeine concentration was from 0.01 mg/g (decaffeinated coffee) to 19.9 mg/g (Italian coffee). The majority of coffees were around 10.0-12.0 mg/g. The NIRS results showed r(2) values for bulk unground and ground coffees were >0.90 with standard errors coffee beans. One application of this calibration could be sorting beans on caffeine concentration to provide greater quality control for high-end markets. Furthermore, bean sorting may open new markets for novel coffee products.
Effects of rust in the crack face on crack detection based on Sonic-IR method
International Nuclear Information System (INIS)
Harai, Y.; Izumi, Y.; Tanabe, H.; Takamatsu, T.; Sakagami, T.
2015-01-01
Sonic-IR, which is based on the thermographic detection of the temperature rise due to frictional heating at the defect faces under ultrasonic excitation, has an advantage in the detection of closed and small defects. However, this method has a lot of nuclear factors relating to heat generation. In this study, effects of rust in the crack faces on the crack detection based on the sonic-IR method is experimentally investigated by using crack specimens. The heat generation by ultrasonic excitation was observed regularly during rust accelerated test using original device. The distribution of temperature change around the crack was changed with the progress of rust. This change in heat generation, it believed to be due to change in the contact state of the crack surface due to rust. As a result, it was found that heat generation by ultrasonic excitation is affected by rust in the crack faces. And it was also found that crack detection can be conducted by sonic-IR even if rust was generated in the crack faces. (author)
International Nuclear Information System (INIS)
Saito, M.; Suzuki, S.; Kimura, M.; Suzuki, T.; Kihira, H.; Waseda, Y.
2005-01-01
Quantitative X-ray structural analysis coupled with anomalous X-ray scattering has been used for characterizing the atomic-scale structure of rust formed on steel surfaces. Samples were prepared from rust layers formed on the surfaces of two commercial steels. X-ray scattered intensity profiles of the two samples showed that the rusts consisted mainly of two types of ferric oxyhydroxide, α-FeOOH and γ-FeOOH. The amounts of these rust components and the realistic atomic arrangements in the components were estimated by fitting both the ordinary and the environmental interference functions with a model structure calculated using the reverse Monte Carlo simulation technique. The two rust components were found to be the network structure formed by FeO 6 octahedral units, the network structure itself deviating from the ideal case. The present results also suggest that the structural analysis method using anomalous X-ray scattering and the reverse Monte Carlo technique is very successful in determining the atomic-scale structure of rusts formed on the steel surfaces
van Dijk, A.E.; Olthof, M.R.; Meeuse, J.C.; Seebus, E.; Heine, R.J.; van Dam, R.M.
2009-01-01
OBJECTIVE - Coffee consumption has been associated with lower risk of type 2 diabetes. We evaluated the acute effects of decaffeinated coffee and the major coffee components chlorogenic acid and trigonelline on glucose tolerance. RESEARCH DESIGN AND METHODS - We conducted a randomized crossover
Lee, Thomas H
2009-06-01
Whether it's a basic Mr. Coffee or a gadget that sports a snazzy device for grinding beans on demand, the office coffee machine offers a place for serendipitous encounters that can improve the social aspect of work and generate new ideas. What's more, a steaming cup of joe may be as good for your health as it is for the bottom line, says Lee, a professor of medicine at Harvard Medical School and the CEO of Partners Community HealthCare. Fears of coffee's carcinogenic effects now appear to be unfounded, and, in fact, the brew might even protect against some types of cancer. What's more, coffee may guard against Alzheimer's disease and other forms of dementia and somehow soften the blow of a heart attack. Of course, its role as a pick-me-up is well known. So there's no need to take your coffee with a dollop of guilt, especially if you ease up on the sugar, cream, double chocolate, and whipped-cream topping.
Induced mutations for rust resistance in bread wheat
International Nuclear Information System (INIS)
Sawhney, R.N.
1989-01-01
Full text: Seeds of variety ''Lalbahadur'' were treated with 0.04% NMH. M 2 plants were inoculated with a mixture of pathotypes of each of the 3 Puccinia species (P. graminis, P. recondita, P. striiformis). Plants with simultaneous resistance to all 3 rusts were selected. Repeated testing in subsequent generations confirmed the resistance. The mutant lines are morphologically similar to the parent cultivar and therefore could be used as components of a multiline variety. Comparison of variety pattern against the Indian pathotypes of rusts suggests that the mutant genes are different from the ones known already in bread wheat. (author)
Galarraga, Ibon; Markandya, Anil
2006-01-01
This paper justifies the need to introduce a tax on regular coffee drinkers in the UK to subsidise the fair trade/organic coffee production. This policy will allow to take full account of the negative external effect of regular coffee production while internalising the positive effect of fair trade initiatives. Designing such a policy is possible and the benefits of it can be calculated. This paper shows how. Propuesta para corregir las externalidades en el mercado de café: un impuesto sobre ...
Strategies for managing whitebark pine in the presence of white pine blister rust [Chapter 17
Raymond J. Hoff; Dennis E. Ferguson; Geral I. McDonald; Robert E. Keane
2001-01-01
Whitebark pine (Pinus albicaulis) is one of many North American white pine species (Pinus subgenus Strobus) susceptible to the fungal disease white pine blister rust (Cronartium ribicola). Blister rust has caused severe mortality (often reaching nearly 100 percent) in many stands of white bark pine north of 45° latitude in western North America. The rust is slowly...
Low average blister-rust infection rates may mean high control costs
Robert Marty
1965-01-01
The Northeastern Forest Experiment Station, in cooperation with Federal and State forest-pest-control agencies, undertook a survey of blister-rust infection rates in the white pine region of the East during 1962 and 1963. Those engaged in blister-rust-control activities will not be surprised at the survey's results. We found that infection rates were significantly...
Studies of the genetics of inheritance of stem rust resistance in ...
African Journals Online (AJOL)
Five resistant wheat lines (KSL-2, KSL-3, KSL-5, KSL-12 and KSL-19) which were resistant in tests during 2008, 2009 and 2010 were used as parents in crosses with stem rust susceptible line CACUKE to develop genetic populations for determining the inheritance of resistance to stem rust. F3 populations were evaluated ...
Rust fungi are obligate biotrophic pathogens causing considerable damage on crop plants. P. graminis f. sp. tritici, the causal agent of wheat stem rust, and M. larici-populina, the poplar rust pathogen, have strong deleterious impact on wheat and poplar wood production, respectively. The recently r...
Determining yield loss caused by brown rust in production fields of sugarcane
Infections of Puccinia melanocephala, the causal agent of brown rust, appear on Louisiana sugarcane in the spring. Disease expression is usually limited to 2 to 3 months until temperatures exceed those favorable for spore production. The affected sugarcane is harvested 4 to 6 months after rust sympt...
Detection, breeding, and selection of durable resistance to brown rust in sugarcane
Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane in Louisiana. The adaptability of the pathogen has repeatedly resulted in resistant cultivars becoming susceptible once they are widely grown. The frequency of the brown rust resistance gene Bru1 was low in the breedi...
Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.
Panwar, Vinay; Bakkeren, Guus
2017-01-01
Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.
Directory of Open Access Journals (Sweden)
Rafael de Ávila Rodrigues
2012-01-01
Full Text Available In recent years, crop models have increasingly been used to simulate agricultural features. The DSSAT (Decision Support System for Agrotechnology Transfer is an important tool in modeling growth; however, one of its limitations is related to the unaccounted-for effect of diseases. Therefore, the goals of this study were to calibrate and validate the CSM CROPGRO-Soybean for the soybean cultivars M-SOY 6101 and MG/BR 46 (Conquista, analyze the performance and the effect of Asian soybean rust on these cultivars under the environmental conditions of Viçosa, Minas Gerais, Brazil. The experimental data for the evaluation, testing, and adjustment of the genetic coefficients for the cultivars, M-SOY 6101 and MG/BR 46 (Conquista, were obtained during the 2006/2007, 2007/2008 and 2009/2010 growing seasons. GLUE (Generalized Likelihood Uncertainty Estimation was used for the estimation of the genetic coefficients, and pedotransfer functions have been utilized to estimate the physical characteristics of the soil. For all of the sowing dates, the early season cultivar, M-SOY 6101, exhibited a lower variance in yield, which represents more stability with regard to the interannual climate variability, i.e., the farmers who use this cultivar will have in 50% of the crop years analyzed, a higher yield than a late-season cultivar. The MG/BR 46 (Conquista cultivar demonstrated a greater probability of obtaining higher yield in years with favorable weather conditions. However, in the presence of the Asian soybean rust, yield is heavily affected. The early cultivar, M-SOY 6101, showed a lower risk of being affected by the rust and consequently exhibited less yield loss considering the scenario D90 (condensation on the leaf surface occurs when the relative humidity is greater than or equal to 90%, for a sowing date of November 14.
Consumer Acceptance of a Polyphenolic Coffee Beverage.
Nguyen, Thuy; Kuchera, Meredith; Smoot, Katie; Diako, Charles; Vixie, Beata; Ross, Carolyn F
2016-10-05
The objective of this study was to determine if Chardonnay grape seed pomace (GSP), a waste stream of wine production, could be used as a functional ingredient in brewed coffee. Two consumer panels were conducted to assess the acceptance of coffee at coffee replacement (w/w) values of 0% (control), 6.25%, 12.50%, 18.75%, or 25% GSP. The 1st consumer panel (n = 80) assessed the coffee samples served "black." The 2nd panel (n = 67) assessed the coffee samples with adjustment (that is, sweeteners, milk, and cream) options available. Consumer sensory evaluation involved evaluating the 5 treatments individually for acceptance of appearance, aroma, taste/flavor, and overall acceptance using a 9-point hedonic scale. A check-all-that-apply questionnaire surveyed the sensory attributes describing aroma, appearance, and taste/flavor of the samples. Oxygen radical absorbance capacity was used to measure the effects of antioxidant levels in GSP coffee samples. Results showed that GSP could be added at 6.25% replacement without significantly affecting the overall consumer acceptance of coffee compared to the control (0% GSP). Above 6.25% GSP supplementation, the coffee beverage was described as more tan, milky, watery/dilute, and mild, and was generally less accepted by the consumers. GSP also increased the antioxidant capacity of the coffee compared to the control (0% GSP), with no significant differences among replacement values. Therefore, 6.25% GSP replacement is recommended for creating coffee beverages acceptable to consumers. Further in vivo investigation may substantiate the free-radical scavenging capacity of GSP coffee and its potential health benefits. © 2016 Institute of Food Technologists®.
DEFF Research Database (Denmark)
Verstraete, Brecht; Janssens, Steven; Rønsted, Nina
2017-01-01
Every plant species on Earth interacts in some way or another with microorganisms and it is well known that certain forms of symbiosis between different organisms can drive evolution. Within some clades of Rubiaceae (coffee family), a specific plant-bacteria interaction exists in which non...
Directory of Open Access Journals (Sweden)
Duli Zhao
2015-07-01
Full Text Available Sugarcane (Saccharum spp. brown rust (caused by Puccinia melanocephala Syd. & P. Syd. was first reported in the United States in 1978 and is still one of the great challenges for sugarcane production. A better understanding of sugarcane genotypic variation in response to brown rust will help optimize breeding and selection strategies for disease resistance. Brown rust ratings were scaled from non-infection (0 to severe infection (4 with intervals of 0.5 and routinely recorded for genotypes in the first clonal selection stage of the Canal Point sugarcane breeding program in Florida. Data were collected from 14,272 and 12,661 genotypes and replicated check cultivars in 2012 and 2013, respectively. Mean rust rating, % infection, and severity in each family and progeny of female parent were determined, and their coefficients of variation (CV within and among families (females were estimated. Considerable variation exists in rust ratings among families or females. The families and female parents with high susceptibility or resistance to brown rust were identified and ranked. The findings of this study can help scientists to evaluate sugarcane crosses and parents for brown rust disease, to use desirable parents for crossing, and to improve genetic resistance to brown rust in breeding programs.
International Nuclear Information System (INIS)
Lyman, D.J.; Benck, R.M.; Merle, S.F.
2011-01-01
Infrared difference spectroscopy was used to study how changes in the processing of Arabica coffee cherries into green beans affected the flavor of coffee brewed from roasted green beans. Paired samples of green beans, in which the drying step or fermentation/washing step in their processing was altered, were roasted and brewed in a standard manner and their ATR-FT-IR spectra obtained. Difference spectra of the 1800 to 1680 cm-1 carbonyl region of water-subtracted spectra of paired samples of these brewed coffees provided data which indicated differences in brewed coffee flavor due to changes in fermentation/washing steps and drying steps involved in the processing of coffee cherries. The role of acid, ketone, aldehyde, ester, lactone, and vinyl ester carbonyl components on the flavor of brewed coffee is proposed that is consistent with the flavors as perceived by the coffee tasters.
Directory of Open Access Journals (Sweden)
Donald J. Lyman
2011-01-01
Full Text Available Infrared difference spectroscopy was used to study how changes in the processing of Arabica coffee cherries into green beans affected the flavor of coffee brewed from roasted green beans. Paired samples of green beans, in which the drying step or fermentation/washing step in their processing was altered, were roasted and brewed in a standard manner and their ATR-FT-IR spectra obtained. Difference spectra of the 1800 to 1680 cm−1 carbonyl region of water-subtracted spectra of paired samples of these brewed coffees provided data which indicated differences in brewed coffee flavor due to changes in fermentation/washing steps and drying steps involved in the processing of coffee cherries. The role of acid, ketone, aldehyde, ester, lactone, and vinyl ester carbonyl components on the flavor of brewed coffee is proposed that is consistent with the flavors as perceived by the coffee tasters.
Fourier transform infrared spectroscopy for Kona coffee authentication.
Wang, Jun; Jun, Soojin; Bittenbender, H C; Gautz, Loren; Li, Qing X
2009-06-01
Kona coffee, the variety of "Kona typica" grown in the north and south districts of Kona-Island, carries a unique stamp of the region of Big Island of Hawaii, U.S.A. The excellent quality of Kona coffee makes it among the best coffee products in the world. Fourier transform infrared (FTIR) spectroscopy integrated with an attenuated total reflectance (ATR) accessory and multivariate analysis was used for qualitative and quantitative analysis of ground and brewed Kona coffee and blends made with Kona coffee. The calibration set of Kona coffee consisted of 10 different blends of Kona-grown original coffee mixture from 14 different farms in Hawaii and a non-Kona-grown original coffee mixture from 3 different sampling sites in Hawaii. Derivative transformations (1st and 2nd), mathematical enhancements such as mean centering and variance scaling, multivariate regressions by partial least square (PLS), and principal components regression (PCR) were implemented to develop and enhance the calibration model. The calibration model was successfully validated using 9 synthetic blend sets of 100% Kona coffee mixture and its adulterant, 100% non-Kona coffee mixture. There were distinct peak variations of ground and brewed coffee blends in the spectral "fingerprint" region between 800 and 1900 cm(-1). The PLS-2nd derivative calibration model based on brewed Kona coffee with mean centering data processing showed the highest degree of accuracy with the lowest standard error of calibration value of 0.81 and the highest R(2) value of 0.999. The model was further validated by quantitative analysis of commercial Kona coffee blends. Results demonstrate that FTIR can be a rapid alternative to authenticate Kona coffee, which only needs very quick and simple sample preparations.
Occurrence of acrylamide carcinogen in Arabic coffee Qahwa, coffee and tea from Saudi Arabian market
Khan, Mohammad Rizwan; Alothman, Zeid Abdullah; Naushad, Mu; Alomary, Ahmed Khodran; Alfadul, Sulaiman Mohammed; Alsohaimi, Ibrahim Hotan; Algamdi, Mohammad Saad
2017-02-01
The present work describes the outcomes of the assessment on acrylamide contents in a number of thermally treated foods (Arabic coffee Qahwa, coffee and tea) obtained from the Saudi Arabian markets. A total of 56 food samples of different brands and origin were studied, the amounts of acrylamide in Arabic coffee Qahwa, coffee and tea were obtained in the range of 10 to 682 μg kg-1. In comparison to coffee (152-682 μg kg-1), the Arabic coffee Qahwa (73-108 μg kg-1) and tea (10-97 μg kg-1) contain lower amounts of acrylamide. Among the analyzed samples, the green tea contained low amounts of acrylamide ranged from 10 to 18 μg kg-1, and thus the green tea could be considered as a healthier hot drink. A great variation of acrylamide formation has been observed in these food products. This divergence may be due to the initial concentration of amino acids especially asparagines and reducing sugars in food products, in addition to roasting temperature and time, pH and water activity. The obtained data can also be used in epidemiological investigation to estimate the acrylamide exposure from nutritional survey.
Flavan-3-ols Are an Effective Chemical Defense against Rust Infection1[OPEN
Unsicker, Sybille B.; Fellenberg, Christin; Schmidt, Axel
2017-01-01
Phenolic secondary metabolites are often thought to protect plants against attack by microbes, but their role in defense against pathogen infection in woody plants has not been investigated comprehensively. We studied the biosynthesis, occurrence, and antifungal activity of flavan-3-ols in black poplar (Populus nigra), which include both monomers, such as catechin, and oligomers, known as proanthocyanidins (PAs). We identified and biochemically characterized three leucoanthocyanidin reductases and two anthocyanidin reductases from P. nigra involved in catalyzing the last steps of flavan-3-ol biosynthesis, leading to the formation of catechin [2,3-trans-(+)-flavan-3-ol] and epicatechin [2,3-cis-(−)-flavan-3-ol], respectively. Poplar trees that were inoculated with the biotrophic rust fungus (Melampsora larici-populina) accumulated higher amounts of catechin and PAs than uninfected trees. The de novo-synthesized catechin and PAs in the rust-infected poplar leaves accumulated significantly at the site of fungal infection in the lower epidermis. In planta concentrations of these compounds strongly inhibited rust spore germination and reduced hyphal growth. Poplar genotypes with constitutively higher levels of catechin and PAs as well as hybrid aspen (Populus tremula × Populus alba) overexpressing the MYB134 transcription factor were more resistant to rust infection. Silencing PnMYB134, on the other hand, decreased flavan-3-ol biosynthesis and increased susceptibility to rust infection. Taken together, our data indicate that catechin and PAs are effective antifungal defenses in poplar against foliar rust infection. PMID:29070515
Genomic dissection of nonhost resistance to wheat stem rust in Brachypodium distachyon
Wheat stem rust caused by the fungus Puccinia graminis f.sp. tritici (Pgt) is a devastating disease that has largely been controlled for decades by the deployment of resistance genes. However, new races of this pathogen have emerged that overcome many important wheat stem rust resistance genes used ...
The Little Book on CoffeeScript
MacCaw, Alex
2012-01-01
This little book shows JavaScript developers how to build superb web applications with CoffeeScript, the remarkable little language that's gaining considerable interest. Through example code, this guide demonstrates how CoffeeScript abstracts JavaScript, providing syntactical sugar and preventing many common errors. You'll learn CoffeeScript's syntax and idioms step by step, from basic variables and functions to complex comprehensions and classes. Written by Alex MacCaw, author of JavaScript Web Applications (O'Reilly), with contributions from CoffeeScript creator Jeremy Ashkenas, this book
Pushing the boundaries of resistance: insights from Brachypodium-rust interactions
Figueroa, Melania; Castell-Miller, Claudia V.; Li, Feng; Hulbert, Scot H.; Bradeen, James M.
2015-01-01
The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat, and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with i...
International Nuclear Information System (INIS)
Hao Long; Zhang Sixun; Dong Junhua; Ke Wei
2012-01-01
Highlights: ► The rusting evolution of a Mo–Cu-bearing fire-resistant steel in a simulated industrial atmosphere was investigated. ► The rusting evolution of the steel is related to the rust composition, structure, and electrochemical characteristics. ► Increased content of α-FeOOH and decreased γ-FeOOH and Fe 3 O 4 indicate the enhanced resistance of the rust. ► Mo and Cu are involved in the formation of molybdate and Cu(I)-bearing compounds in the rust. - Abstract: The corrosion evolution of a Mo–Cu-bearing fire-resistant steel in a simulated industrial atmosphere was investigated by corrosion weight gain, XRD, EPMA, XPS, and polarization curves. The results indicate that the corrosion kinetics is closely related to the rust composition and electrochemical properties. As the corrosion proceeds, the relative content of γ-FeOOH and Fe 3 O 4 decreases and α-FeOOH increases, and the rust layer becomes compact and adherent to steel substrate. Molybdenum and copper enrich in the inner rust layer, especially at the bottom of the corrosion nest, forming non-soluble molybdate and Cu(I)-bearing compounds responsible for enhanced corrosion resistance of the rust layer.
International Nuclear Information System (INIS)
1988-01-01
In alfalfa after gamma irradiation with 50,100, and 150 krads, 38 rust resistant plants have been selected throughout a screening programme. During four months, cuttings were obtained from these plants individually. Results revealed that 20 plants were remar-kably surpassed the origin in the total fresh weight and in the average weight of each cutting. In broad bean, following gamma irradiation and EMS in two cuitivars for induction of wilt resistance. Seeds of these plants were sown in artificially infested soil . During the growing season, all susceptible plants were removed and at epidemic form of wilt disease
Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi
2015-04-01
Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance.
Ona-Nguema, G.; Guerbois, D.; Morin, G.; Zhang, Y.; Noel, V.; Brest, J.
2013-12-01
The occurrence of high nitrite concentrations as a result of anthropogenic activities is an important water quality concern as it is highly toxic to human and fauna, and it is used as a nitrogen source for the assimilation process. The toxicity of nitrite is related to its transformation into carcinogenic N-nitroso compounds, which are suspected to be responsible for some gastric cancers, and to its ability to convert the hemoglobin to methaemoglobin what is then unable to fix oxygen and to transport it to the tissues, involving hypoxia and the blue-baby syndrome [1]. To reduce the adverse effect of nitrite on human health and on macroalgal blooms, any process enhancing the transformation of nitrite ions to nitrogen gas is of interest for the remediation of natural environments. To achieve this purpose the use of processes involving Fe(II)-containing minerals could be considered as one of the best options. Green-rusts are mixed Fe(II-III) layered double hydroxides commonly found in anoxic zones of natural environments such as sediments and hydromorphic soils. In such anoxic environments, green rust minerals play an important role in the biogeochemical redox cycling of iron and nitrogen, and can affect the speciation and mobility of many organic and inorganic contaminants. The present study investigates the reduction of nitrite by two synthetic and two biogenic green rusts. On the one hand, Fe(II-III) hydroxychloride and Fe(II-III) hydroxycarbonate green rusts were used as synthetic interlayer forms of GR, which are referred to as ';syn-GR(CO3)' and ';syn-GR(Cl)', respectively. On the other hand, the study was performed with biogenic Fe(II-III) hydroxycarbonate green rusts obtained from the bioreduction of two ferric precursors, either Fe(III)-oxyhydroxycarbonate or lepidocrocite; these biogenic green rusts are referred to as ';bio-GR(CO3)F' and ';bio-GR(CO3)L', respectively. For synthetic green rusts, results showed that the oxidation of both syn-GR(CO3) and syn
Wolska, J; Janda, Katarzyna; Jakubczyk, K; Szymkowiak, M; Chlubek, D; Gutowska, I
2017-10-01
Coffee is a rich source of dietary antioxidants, and this property links with the fact that coffee is one of the world's most popular beverages. Moreover, it is a source of macro- and microelements, including fluoride. The aim of this work was to determine antioxidant activity of coffee beverages and fluoride content depending on different coffee species and conditions of brewing. Three species of coffee, arabica, robusta and green coffee beans obtained from retail stores in Szczecin (Poland) were analyzed. Five different techniques of preparing drink were used: simple infusion, french press, espresso maker, overflow espresso and Turkish coffee. Antioxidant potential of coffee beverages was investigated spectrophotometrically by DPPH method. Fluoride concentrations were measured by potentiometric method with a fluoride ion-selective electrode. Statistical analysis was performed using Stat Soft Statistica 12.5. Antioxidant activity of infusions was high (71.97-83.21% inhibition of DPPH) depending on coffee species and beverage preparing method. It has been shown that the method of brewing arabica coffee and green coffee significantly affects the antioxidant potential of infusions. The fluoride concentration in the coffee infusions changed depending, both, on the species and conditions of brewing, too (0.013-0.502 mg/L). Methods of brewing didn't make a difference to the antioxidant potential of robusta coffee, which had also the lowest level of fluoride among studied species. Except overflow espresso, the fluoride content was the highest in beverages from green coffee. The highest fluoride content was found in Turkish coffee from green coffee beans.
Furan in roasted, ground and brewed coffee
Gruczyńska, Eliza; Kowalska, Dorota; Kozłowska, Mariola; Majewska, Ewa; Tarnowska, Katarzyna
2018-01-01
Coffee is the most popular hot beverage in the world. The annual coffee production in 2010, 2014 and 2016 was 8.1, 9.0 and 9.3 million tons respectively. There are more than 100 coffee species, but only two of them: Arabica (Coffea arabica) and Robusta (Coffea canephora) have gained commercial importance. During roasting of green coffee beans not only desirable compounds are formed, that exert positive influence on the taste and flavour of coffee, but also small quantities of undesirable ones. Furan (C4H4O) is one of the latter. Furan is a volatile compound (boiling temp. of 31.4 oC) formed during thermal processing of food. The toxicity of furan has been well documented and it is classified as “possible human carcinogen” (Group 2B) by the International Agency for Research on Cancer. Various pathways have been reported for furan formation during food processing. It can be formed from carbohydrates, amino acids by their thermal degradation or thermal re-arrangement and by oxidation of ascorbic acid and polyunsaturated acids and carotenoids. High concentrations of furan have been reported in coffee, baked and roasted food and in food subjected to preserving in cans and jars. Furan levels in brewed coffee are typically near or below 120 μg/L, but it can approach thousands μg/kg in roasted whole beans or ground coffee. The highest concentration of furan in roasted coffee reaches the level of 7000 μg/kg. Taking into account that coffee is the most popular hot drink, it becomes the main contributor to furan exposure from dietary sources for adults. In this article the published scientific papers concerned with the presence of furan in roasted non-brewed and brewed coffee have been reviewed. The formation mechanisms and occurrence of furan in coffee and the harmful influence of furan on the consumer health have been discussed.
Evaluation of the International coffee market conditions
FISAKOVA O.S.
2014-01-01
This article includes analysis of coffee market and its conditions for coffee companies. Also, coffee export amounts and prices are compared and analyzed. Statistics were collected over few last years to present accurate research
How coffee affects metabolic syndrome and its components.
Baspinar, B; Eskici, G; Ozcelik, A O
2017-06-21
Metabolic syndrome, with its increasing prevalence, is becoming a major public health problem throughout the world. Many risk factors including nutrition play a role in the emergence of metabolic syndrome. Of the most-consumed beverages in the world, coffee contains more than 1000 components such as caffeine, chlorogenic acid, diterpenes and trigonelline. It has been proven in many studies that coffee consumption has a positive effect on chronic diseases. In this review, starting from the beneficial effects of coffee on health, the relationship between coffee consumption and metabolic syndrome and its components has been investigated. There are few studies investigating the relationship between coffee and metabolic syndrome, and the existing ones put forward different findings. The factors leading to the differences are thought to stem from coffee variety, the physiological effects of coffee elements, and the nutritional ingredients (such as milk and sugar) added to coffee. It is reported that consumption of coffee in adults up to three cups a day reduces the risk of Type-2 diabetes and metabolic syndrome.
Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R
2016-06-01
Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust
Roasted and Ground Coffee: A Study of Extenders, Substitutes and Alternative Coffee Sources
1984-02-01
other large food service organizations. The policy of adjusting the amount of R&G coffee used in brewing recipes according to consumer preferences , as...health, such as in the reduction of caffeine levels, as well as’ general consumer preferences for hot beverages with lower levels of coffee- like
Comparative genomic analysis of coffee-infecting Xylella fastidiosa strains isolated from Brazil.
Barbosa, Deibs; Alencar, Valquíria Campos; Santos, Daiene Souza; de Freitas Oliveira, Ana Cláudia; de Souza, Alessandra A; Coletta-Filho, Helvecio D; de Oliveira, Regina Souza; Nunes, Luiz R
2015-05-01
Strains of Xylella fastidiosa constitute a complex group of bacteria that develop within the xylem of many plant hosts, causing diseases of significant economic importance, such as Pierce's disease in North American grapevines and citrus variegated chlorosis in Brazil. X. fastidiosa has also been obtained from other host plants, in direct correlation with the development of diseases, as in the case of coffee leaf scorch (CLS)--a disease with potential to cause severe economic losses to the Brazilian coffee industry. This paper describes a thorough genomic characterization of coffee-infecting X. fastidiosa strains, initially performed through a microarray-based approach, which demonstrated that CLS strains could be subdivided in two phylogenetically distinct subgroups. Whole-genomic sequencing of two of these bacteria (one from each subgroup) allowed identification of ORFs and horizontally transferred elements (HTEs) that were specific to CLS-related X. fastidiosa strains. Such analyses confirmed the size and importance of HTEs as major mediators of chromosomal evolution amongst these bacteria, and allowed identification of differences in gene content, after comparisons were made with previously sequenced X. fastidiosa strains, isolated from alternative hosts. Although direct experimentation still needs to be performed to elucidate the biological consequences associated with such differences, it was interesting to verify that CLS-related bacteria display variations in genes that produce toxins, as well as surface-related factors (such as fimbrial adhesins and LPS) that have been shown to be involved with recognition of specific host factors in different pathogenic bacteria. © 2015 The Authors.
Partial resistance to stripe rust and its effect on sustainability of wheat yield
International Nuclear Information System (INIS)
Qamar, M.; Din, R.U.; Gardazi, D.A.
2014-01-01
Stripe rust (Puccinia striiformis Westend. f. sp. tritici) poses a serious threat to wheat production in cooler areas of Pakistan. The 70% area of wheat in Pakistan is prone to stripe rust disease. It can cause 10-17% yield losses if susceptible cultivars are planted under favorable conditions. Level of partial plant resistance in bread wheat and its impact on sustainable wheat production was studied at the National Agricultural Research Centre, Islamabad under natural conditions in the field. Eleven Pakistani commercial wheat cultivars/advance lines including check (Inqalab 91) were assessed for the level of partial resistance against stripe rust using Area Under the Disease Progress Curve (AUDPC), disease severity (DS) and epidemic growth rate in comparison with wheat cultivar, Inqalab 91. During 2007 cropping season, natural epidemic was developed and relative AUDPC was recorded from 0 to 100% whereas the 2008 cropping season was dry and no stripe rust appeared. Two advanced lines (NR 268 and NR 285) showed the infection type (IT) less than 7 (incompatible reaction) to the mixture of prevailing stripe rust inoculums. Very low level of DS and AUDPC were recorded in the remaining cultivars/lines indicating a high level of partial resistance to stripe rust compared to the susceptible check cultivar, Inqalab 91. Among eight cultivars/lines that showed compatible type of reaction (IT greater then equal to 7), one was resistant (relative AUDPC = 20% of Inqalab 91) and six showed very high resistance levels (relative AUDPC greater then equal to 5%). Maximum level of resistance (relative AUDPC = 0.1%) was observed in advanced line, NR 271. The wheat cultivars/lines that showed a slow disease development (low DS and AUDPC), could be considered as -1 partially resistant for stripe rust infection. The yield (2178 kg ha) of susceptible check cultivar Inqalab-91 during 2007 was reduced to 45% as -1 compared to its yield (3945 kg ha) in epidemic free year (2008). Thus the use
Long-term changes in fusiform rust incidence in the southeastern United States
KaDonna C. Randolph; Ellis B. Cowling; Dale A. Starkey
2015-01-01
Fusiform rust is the most devastating disease of slash pine (Pinus elliottii) and loblolly pine (Pinus taeda) in the southeastern United States. Since the 1970s, the USDA Forest Service Forest Inventory and Analysis (FIA) Program has assessed fusiform rust incidence on its network of ground plots in 13 states across the...
Pushing the boundaries of resistance: insights from Brachypodium-rust interactions
Directory of Open Access Journals (Sweden)
Melania eFigueroa
2015-07-01
Full Text Available The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with increased virulence and recurrent rust epidemics around the world point out the vulnerability of monocultures. Basic research in plant immunity, especially in model plants, can make contributions to understanding plant resistance mechanisms and improve disease management strategies. The development of the grass Brachypodium distachyon as a genetically tractable model for monocots, especially temperate cereals and grasses, offers the possibility to overcome the experimental challenges presented by the genetic and genomic complexities of economically valuable crop plants. The numerous resources and tools available in Brachypodium have opened new doors to investigate the underlying molecular and genetic bases of plant-microbe interactions in grasses and evidence demonstrating the applicability and advantages of working with B. distachyon is increasing. Importantly, several interactions between B. distachyon and devastating plant pathogens, such rust fungi, have been examined in the context of non-host resistance. Here, we discuss the use of B. distachyon in these various pathosystems. Exploiting B. distachyon to understand the mechanisms underpinning disease resistance to non-adapted rust fungi may provide effective and durable approaches to fend off these pathogens. The close phylogenetic relationship among Brachypodium spp. and grasses with industrial and agronomic value support harnessing this model plant to improve cropping systems and encourage its use in
Guo, Xiang; Wang, Ming Tian; Zhang, Guo Zhi
2017-12-01
The winter reproductive areas of Puccinia striiformis var. striiformis in Sichuan Basin are often the places mostly affected by wheat stripe rust. With data on the meteorological condition and stripe rust situation at typical stations in the winter reproductive area in Sichuan Basin from 1999 to 2016, this paper classified the meteorological conditions inducing wheat stripe rust into 5 grades, based on the incidence area ratio of the disease. The meteorological factors which were biologically related to wheat stripe rust were determined through multiple analytical methods, and a meteorological grade model for forecasting wheat stripe rust was created. The result showed that wheat stripe rust in Sichuan Basin was significantly correlated with many meteorological factors, such as the ave-rage (maximum and minimum) temperature, precipitation and its anomaly percentage, relative humidity and its anomaly percentage, average wind speed and sunshine duration. Among these, the average temperature and the anomaly percentage of relative humidity were the determining factors. According to a historical retrospective test, the accuracy of the forecast based on the model was 64% for samples in the county-level test, and 89% for samples in the municipal-level test. In a meteorological grade forecast of wheat stripe rust in the winter reproductive areas in Sichuan Basin in 2017, the prediction was accurate for 62.8% of the samples, with 27.9% error by one grade and only 9.3% error by two or more grades. As a result, the model could deliver satisfactory forecast results, and predicate future wheat stripe rust from a meteorological point of view.
New Coffee Plant-Infecting Xylella fastidiosa Variants Derived via Homologous Recombination.
Jacques, Marie-Agnès; Denancé, Nicolas; Legendre, Bruno; Morel, Emmanuelle; Briand, Martial; Mississipi, Stelly; Durand, Karine; Olivier, Valérie; Portier, Perrine; Poliakoff, Françoise; Crouzillat, Dominique
2015-12-28
Xylella fastidiosa is a xylem-limited phytopathogenic bacterium endemic to the Americas that has recently emerged in Asia and Europe. Although this bacterium is classified as a quarantine organism in the European Union, importation of plant material from contaminated areas and latent infection in asymptomatic plants have engendered its inevitable introduction. In 2012, four coffee plants (Coffea arabica and Coffea canephora) with leaf scorch symptoms growing in a confined greenhouse were detected and intercepted in France. After identification of the causal agent, this outbreak was eradicated. Three X. fastidiosa strains were isolated from these plants, confirming a preliminary identification based on immunology. The strains were characterized by multiplex PCR and by multilocus sequence analysis/typing (MLSA-MLST) based on seven housekeeping genes. One strain, CFBP 8073, isolated from C. canephora imported from Mexico, was assigned to X. fastidiosa subsp. fastidiosa/X. fastidiosa subsp. sandyi. This strain harbors a novel sequence type (ST) with novel alleles at two loci. The two other strains, CFBP 8072 and CFBP 8074, isolated from Coffea arabica imported from Ecuador, were allocated to X. fastidiosa subsp. pauca. These two strains shared a novel ST with novel alleles at two loci. These MLST profiles showed evidence of recombination events. We provide genome sequences for CFBP 8072 and CFBP 8073 strains. Comparative genomic analyses of these two genome sequences with publicly available X. fastidiosa genomes, including the Italian strain CoDiRO, confirmed these phylogenetic positions and provided candidate alleles for coffee plant adaptation. This study demonstrates the global diversity of X. fastidiosa and highlights the diversity of strains isolated from coffee plants. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Thermodynamic analysis of a solar coffee maker
International Nuclear Information System (INIS)
Sosa-Montemayor, F.; Jaramillo, O.A.; Rio, J.A. del
2009-01-01
In this paper we present a novel solar concentrating application, a coffee brewing system using a satellite TV mini-Dish concentrator coupled to a stovetop espresso coffee maker. We present a theoretical model for the thermal behavior of the water in the lower chamber of the coffee maker. We validate the model obtaining good agreement with the experimental results. Our findings indicate that the coffee brewing system works, it takes 30-50 min to complete its task. The model and our practical experience encourage us to improve the concentration device in order to obtain a useful solar coffee maker, using the theoretical model as a safe guide to achieve this.
Thermodynamic analysis of a solar coffee maker
Energy Technology Data Exchange (ETDEWEB)
Sosa-Montemayor, F.; Jaramillo, O.A. [Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico, Privada Xochicalco S/N, Temixco, Morelos CP 62580 (Mexico); del Rio, J.A. [Centro Morelense de Innovacion y Tranferencia Tecnologica, CCyTEM, Camino Temixco a Emiliano Zapata, Km 0.3, Colonia Emiliano Zapata, Morelos CP 62760 (Mexico)
2009-09-15
In this paper we present a novel solar concentrating application, a coffee brewing system using a satellite TV mini-Dish concentrator coupled to a stovetop espresso coffee maker. We present a theoretical model for the thermal behavior of the water in the lower chamber of the coffee maker. We validate the model obtaining good agreement with the experimental results. Our findings indicate that the coffee brewing system works, it takes 30-50 min to complete its task. The model and our practical experience encourage us to improve the concentration device in order to obtain a useful solar coffee maker, using the theoretical model as a safe guide to achieve this. (author)
Recent Advances in the Genetic Transformation of Coffee
Mishra, M. K.; Slater, A.
2012-01-01
Coffee is one of the most important plantation crops, grown in about 80 countries across the world. The genus Coffea comprises approximately 100 species of which only two species, that is, Coffea arabica (commonly known as arabica coffee) and Coffea canephora (known as robusta coffee), are commercially cultivated. Genetic improvement of coffee through traditional breeding is slow due to the perennial nature of the plant. Genetic transformation has tremendous potential in developing improved coffee varieties with desired agronomic traits, which are otherwise difficult to achieve through traditional breeding. During the last twenty years, significant progress has been made in coffee biotechnology, particularly in the area of transgenic technology. This paper provides a detailed account of the advances made in the genetic transformation of coffee and their potential applications. PMID:22970380
Fusiform Rust of Southern Pines
W. R. Phelps; F. L. Czabator
1978-01-01
Fusiform rust, caused by the fungus Cronartium fusiforme Hedg. & Hunt ex Cumm., is distributed in the Southern United States from Maryland to Florida and west to Texas and southern Arkansas. Infections by the fungus, which develops at or near the point of infection, result in tapered, spindle-shaped swells, called galls, on branches and stems of pines. (see photo...
Remapping of the stripe rust resistance gene Yr10 in common wheat.
Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin
2018-02-23
Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.
Effect of fungicide on the development of wheat stem rust and yield ...
African Journals Online (AJOL)
Stem rust caused by Puccinia graminis f.sp tritici Erik. & E. Henn. is a highly destructive disease of wheat (Triticum aestivum L.). The effects of fungicide application on stem rust (Puccinia graminis tritici) epidemics and yield of three bread wheat varieties varying in reaction to the disease were studied in two major wheat ...
Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...
[Coffee can protect against disease].
Hermansen, Kjeld; Krogholm, Kirstine Suszkiewicz; Bech, Bodil Hammer; Dragsted, Lars Ove; Hyldstrup, Lars; Jørgensen, Kasper; Larsen, Mogens Lytken; Tjønneland, Anne Marie
2012-09-24
A moderate daily intake of 3-4 cups of coffee has convincing protective effects against development of type 2 diabetes and Parkinson's disease. The literature also indicates that moderate coffee intake reduces the risk of stroke, the overall risk of cancer, Alzheimer's disease, suicide and depression. However, pregnant women, people suffering from anxiety disorder and persons with a low calcium intake should restrain from moderate or high intake of coffee due to uncertainty regarding potential negative effects on pregnancy, anxiety and risk of osteoporosis, respectively.
Control of Fe(O,OH)6 nano-network structures of rust for high atmospheric-corrosion resistance
International Nuclear Information System (INIS)
Kimura, Masao; Kihira, Hiroshi; Ohta, Noriaki; Hashimoto, Misao; Senuma, Takehide
2005-01-01
A new-type of weathering steel containing 3.0 mass% Ni and 0.4 mass% Cu ('advanced weathering steel') exhibits good atmospheric-corrosion resistance in an atmosphere containing relatively high air-born salinity. Here, we show that the high performance was successfully achieved by controlling Fe(O,OH) 6 nano-network structures of rust formed on their surfaces. A novel technique using synchrotron radiation has been developed for the in situ observation of rust-formation during wet-dry cycles. It has been revealed that the evolution of Fe(O,OH) 6 nano-network structures of rust formed on the advanced weathering steel was more unique than those of conventional weathering steel and mild steel. At an early stage of reaction, Fe 2 NiO 4 and CuO phases precipitate, which provide sites for the nucleation of the Fe(O,OH) 6 nano-network resulting in the formation of rust composed of fine and dense-packed grains. The existence of Fe 2 NiO 4 in the nano-network changes the ion-exchanging properties of rust from anion to cation selective. Then, the rust on the advanced weathering steel 'breathes out' chloride ions from the rust/steel interface, and protects steel for more than a century by reducing the life cycle maintenance cost in an environment-friendly manner
Climate Change Impacts on Worldwide Coffee Production
Foreman, T.; Rising, J. A.
2015-12-01
Coffee (Coffea arabica and Coffea canephora) plays a vital role in many countries' economies, providing necessary income to 25 million members of tropical countries, and supporting a $81 billion industry, making it one of the most valuable commodities in the world. At the same time, coffee is at the center of many issues of sustainability. It is vulnerable to climate change, with disease outbreaks becoming more common and suitable regions beginning to shift. We develop a statistical production model for coffee which incorporates temperature, precipitation, frost, and humidity effects using a new database of worldwide coffee production. We then use this model to project coffee yields and production into the future based on a variety of climate forecasts. This model can then be used together with a market model to forecast the locations of future coffee production as well as future prices, supply, and demand.
Tea, coffee and prostate cancer.
Lee, Andy H; Fraser, Michelle L; Binns, Colin W
2009-02-01
Worldwide, prostate cancer has the second highest incidence of all cancers in males with incidence and mortality being much higher in affluent developed countries. Risk and progression of the disease may be linked to both genetic and environmental factors, especially dietary factors. Tea and coffee are two of the most popular beverages in the world and have been investigated for possible effects on health outcomes, including cancer. However, very little dietary advice for their consumption exists. The evidence for a relationship between coffee or tea consumption and prostate cancer is reviewed in this paper. While current evidence indicates that coffee is a safe beverage, its consumption probably has no relationship with prostate cancer. Tea, especially green tea, has shown some potential in the prevention of prostate cancer. While evidence from epidemiologic studies is currently inconclusive, strong evidence has emerged from animal and in vitro studies. We also consider what level of evidence is required to make recommendations for preventive measures to the public. Although evidence on the relationship between coffee, tea and prostate cancer is not complete, we consider it strong enough to recommend tea as a healthier alternative to coffee.
Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035
Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...
Lawrence, Gregory J.; Dodds, Peter N.; Ellis, Jeffrey G.
2009-01-01
Rust fungi cause devastating diseases on many important food crops, with a damaging stem rust epidemic currently affecting wheat production in Africa and the Middle East. These parasitic fungi propagate exclusively on plants, precluding the use of many biotechnological tools available for other culturable fungi. In particular the lack of a stable transformation system has been an impediment to the genetic manipulation required for molecular analysis of rust pathogenicity. We have developed an...
How Competitive is the Dutch Coffee market?
L.J.H. Bettendorf (Leon); F. Verboven
1997-01-01
textabstractWorld coffee bean prices have shown large fluctuations during the past years. Consumer prices for roasted coffee, in contrast, have varied considerably less. This article investigates whether the weak relationship between coffee bean and consumer prices can be explained by a lack of
Pons, Diego
This dissertation makes use of a physical geography perspective to examine the relationship between agriculture and climate in Guatemala using dendrochronology. I examined the potential of high-resolution climate proxy data from dendrochronology to help fill in the gaps of past climate information to better understand the natural and anthropogenic variability of precipitation which, in turn, can inform Guatemala's agriculture sector. This research has demonstrated successful cross-dating and climate sensitivity of Abies guatemalensis in the Pacific slope of Guatemala. Based on this, I have produced a 124-year record of mean precipitation from June-July-August. The mean precipitation from June-July-August at this site seems to receive an important influence from the sea surface temperature (SST) in the Pacific Ocean in the form of El Nino-Southern Oscillation (ENSO) in the region 3.4. The analysis on the frequency of the precipitation records suggests that single year droughts dominate the record yet, periods of 9 years below-average rainfall can persist. Likewise, single year pluvial events also dominate the evaluated period. The long-term reconstruction of precipitation allowed to describe past relationships between coffee plantations and pests. For instance, the frequency analysis suggests that 4 or more consecutive periods of above-average precipitation are associated with several coffee pests and subsequently great economical losses due to crop failures, including the last coffee leaf rust crisis. This study also presents a streamflow reconstruction of the Upper Samala River watershed using a tree ring-width chronology derived from the Guatemalan fir (Abies guatemalensis) to reconstruct mean August-September-October streamflow volumes for the period 1889-2013. Our analysis shows that strong statistical correlations are present between tree-ring width measurements and monthly natural streamflow series. The mean August-September-October streamflow variability is
The dynamic of the “Coffee Quality Paraná” contest in the production of specialty coffees
Directory of Open Access Journals (Sweden)
Lorian Voigt-Gair
2013-12-01
Full Text Available In Paraná, the concentration of efforts of various organizations have collaborated to improve the image of coffee. This work aims to study the coffee samples, through the sensory attributes scored in the “Test Cup” Contest of “Coffee Quality Paraná” from 2004 to 2009 and to prove the qualification of rural extension technicians and producers in order to obtain a differentiated with high quality product, linked to the methodology of marketing strategy. The study was conducted with 570 samples from 55 municipalities and analyzed in state steps of this contest. It was concluded that the methodology used in the Contest “Coffee Quality Paraná” encourages constant improvement and disseminates technical and scientific innovations in various links in the productive chain, having as the final result the increasing of the amount of coffee produced in Paraná with excellent quality drink.
Coffee Bean Grade Determination Based on Image Parameter
Directory of Open Access Journals (Sweden)
F. Ferdiansjah
2011-12-01
Full Text Available Quality standard for coffee as an agriculture commodity in Indonesia uses defect system which is regulated in Standar Nasional Indonesia (SNI for coffee bean, No: 01-2907-1999. In the Defect System standard, coffee bean is classified into six grades, from grade I to grade VI depending on the number of defect found in the coffee bean. Accuracy of this method heavily depends on the experience and the expertise of the human operators. The objective of the research is to develop a system to determine the coffee bean grading based on SNI No: 01-2907-1999. A visual sensor, a webcam connected to a computer, was used for image acquisition of coffee bean image samples, which were placed under uniform illumination of 414.5+2.9 lux. The computer performs feature extraction from parameters of coffee bean image samples in the term of texture (energy, entropy, contrast, homogeneity and color (R mean, G mean, and B mean and determines the grade of coffee bean based on the image parameters by implementing neural network algorithm. The accuracy of system testing for the coffee beans of grade I, II, III, IVA, IVB, V, and VI have the value of 100, 80, 60, 40, 100, 40, and 100%, respectively.
Solér, Cecilia; Sandström, Cecilia; Skoog, Hanna
2017-02-01
This article investigates the outcomes of mainstream coffee voluntary sustainability standards for high-biodiversity coffee diversification. By viewing voluntary sustainability standards certifications as performative marketing tools, we address the question of how such certification schemes affect coffee value creation based on unique biodiversity conservation properties in coffee farming. To date, the voluntary sustainability standards literature has primarily approached biodiversity conservation in coffee farming in the context of financial remuneration to coffee farmers. The performative analysis of voluntary sustainability standards certification undertaken in this paper, in which such certifications are analyzed in terms of their effect on mutually reinforcing representational, normalizing and exchange practices, provides an understanding of coffee diversification potential as dependent on standard criteria and voluntary sustainability standards certification as branding tools. We draw on a case of high-biodiversity, shade-grown coffee-farming practice in Kodagu, South-West India, which represents one of the world's biodiversity "hotspots".
Solér, Cecilia; Sandström, Cecilia; Skoog, Hanna
2017-02-01
This article investigates the outcomes of mainstream coffee voluntary sustainability standards for high-biodiversity coffee diversification. By viewing voluntary sustainability standards certifications as performative marketing tools, we address the question of how such certification schemes affect coffee value creation based on unique biodiversity conservation properties in coffee farming. To date, the voluntary sustainability standards literature has primarily approached biodiversity conservation in coffee farming in the context of financial remuneration to coffee farmers. The performative analysis of voluntary sustainability standards certification undertaken in this paper, in which such certifications are analyzed in terms of their effect on mutually reinforcing representational, normalizing and exchange practices, provides an understanding of coffee diversification potential as dependent on standard criteria and voluntary sustainability standards certification as branding tools. We draw on a case of high-biodiversity, shade-grown coffee-farming practice in Kodagu, South-West India, which represents one of the world's biodiversity "hotspots".
Genética de Coffea. XVIII - Variegação no cafeeiro Leaf variegation in coffee plants
Directory of Open Access Journals (Sweden)
A. Carvalho
1954-01-01
Full Text Available A variegação das fôlhas do cafeeiro tanto em plantas novas como em plantas adultas tem sido freqüentemente observada. Plantas variegadas podem ocorrer espontaneamente nas progénies das diversas variedades de Coffea arabica L., motivo porque não devem constituir variedade distinta dessa espécie, como foi proposto por Cramer. As plantas variegadas em estudo puderam ser agrupadas em duas categorias, isto é, aquelas em que a variegação não se acha associada com anomalias na forma e textura das folhas e aquelas nas quais a variegação é acompanhada dessas anomalias. No primeiro grupo o padrão de variegação não é uniforme para tôdas as fôlhas, enquanto no segundo grupo o padrão é semelhante para tôda a planta. Usualmente apenas alguns ramos das plantas do primeiro grupo são variegados. Observou-se algumas vezes que as duas fôlhas do mesmo verticilo têm padrões semelhantes de variegação. Encontraram-se também fôlhas variegadas nas quais a metade da lâmina é variegada ou mesmo albina, enquanto a outra metade apresenta a côr verde normal. Os dados genéticos obtidos, embora preliminares para a maioria das plantas variegadas em investigação, permitiram concluir que o padrão de variegação da planta 180, pertencente ao primeiro grupo, é herdado pelo citoplasma e não é transmitido pelo pólen. O padrão de variegação da planta 253-21, pertencente ao segundo grupo, no entanto, parece ser transmitido pelo polen.Leaf variegation in coffee plants is a relatively common abnormality, and variegated seedlings have been found to occur spontaneously in progenies of most varieties of Coffea arabica L. For this reason it is thought that variegated types should not be described as distinct varieties, as it was done before by Cramer. Variegated coffee plants can be grouped in two categories : first, those in which variegated leaves are normal in shape and texture, but do not show a uniform variegation pattern; and second, those
ASSESSMENT OF METALS IN ROASTED INDIGENOUS COFFEE ...
African Journals Online (AJOL)
1Department of Chemistry, College of Natural Sciences, Addis Ababa University, P.O. Box. 1176, Addis .... cultivation region of Ethiopian coffee by elemental analysis. ... health regulatory limits of the metals in coffee to provide guideline information on the .... Procedures tested for digestion of roasted coffee samples. No.
Coffee Consumption and the Risk of Colorectal Cancer.
Schmit, Stephanie L; Rennert, Hedy S; Rennert, Gad; Gruber, Stephen B
2016-04-01
Coffee contains several bioactive compounds relevant to colon physiology. Although coffee intake is a proposed protective factor for colorectal cancer, current evidence remains inconclusive. We investigated the association between coffee consumption and risk of colorectal cancer in 5,145 cases and 4,097 controls from the Molecular Epidemiology of Colorectal Cancer (MECC) study, a population-based case-control study in northern Israel. We also examined this association by type of coffee, by cancer site (colon and rectum), and by ethnic subgroup (Ashkenazi Jews, Sephardi Jews, and Arabs). Coffee data were collected by interview using a validated, semi-quantitative food frequency questionnaire. Coffee consumption was associated with 26% lower odds of developing colorectal cancer [OR (drinkers vs. non-drinkers), 0.74; 95% confidence interval (CI), 0.64-0.86; P consumption alone (OR, 0.82; 95% CI, 0.68-0.99; P = 0.04) and for boiled coffee (OR, 0.82; 95% CI, 0.71-0.94; P = 0.004). Increasing consumption of coffee was associated with lower odds of developing colorectal cancer. Compared with 2.5 servings/day (OR, 0.46; 95% CI, 0.39-0.54; P colorectal cancer (Ptrend cancers. Coffee consumption may be inversely associated with risk of colorectal cancer in a dose-response manner. Global coffee consumption patterns suggest potential health benefits of the beverage for reducing the risk of colorectal cancer. Cancer Epidemiol Biomarkers Prev; 25(4); 634-9. ©2016 AACR. ©2016 American Association for Cancer Research.
The coffee berry borer (Hypothenemus hampei (Ferrari); Coleoptera: Curculionidae: Scolytinae) is the most important insect pest of coffee worldwide, and due to the cryptic life habit of the insect inside coffee berries, effective pest management strategies have been difficult to develop. In this pap...
Chemical reduction of rust on 2 1/4 Cr-1 Mo steel surface in sodium
International Nuclear Information System (INIS)
Yokota, N.; Shimoyashiki, S.
1986-01-01
Low-alloy Fe-2 1/4 Cr-1 Mo ferritic steel has been favored for the tube material of steam generators in fast breeder reactors (FBRs). However, this material rusts easily due to moisture condensation on its surface when left in air. Therefore, measures to prevent tube materials from rusting have been taken during manufacturing of the steam generators. When rust is present on tube surfaces, its oxygen and iron dissolve into liquid sodium. When the concentration of these impurities in the sodium increases rapidly, the cold traps can become choked locally and lose their removal ability. This work has been done, therefore, to clarify reduction processes of rust in sodium and to select optimum operating temperatures of steam generators in the initial operation
Impact of caffeine and coffee on our health.
Gonzalez de Mejia, Elvira; Ramirez-Mares, Marco Vinicio
2014-10-01
Coffee is the most frequently consumed caffeine-containing beverage. The caffeine in coffee is a bioactive compound with stimulatory effects on the central nervous system and a positive effect on long-term memory. Although coffee consumption has been historically linked to adverse health effects, new research indicates that coffee consumption may be beneficial. Here we discuss the impact of coffee and caffeine on health and bring attention to the changing caffeine landscape that includes new caffeine-containing energy drinks and supplements, often targeting children and adolescents. Copyright © 2014 Elsevier Ltd. All rights reserved.
Environment-Friendly Control of Pear Scab and Rust Using Lime Sulfur
Directory of Open Access Journals (Sweden)
Ju Hoon Cha
2018-03-01
Full Text Available Pear scab and rust are the major diseases causing severe epidemics in organic cultivation of pear trees. Incidences of pear scab and rust were compared in organically managed plots and conventionally managed plots to obtain optimum application schedule of environment-friendly control agents in organically managed plots. Organically cultural practice with 10 time-applications of lime sulfur and Bordeaux mixture showed higher than 40% of control efficacies of pear scab and rust compared to conventionally cultural practice. Organically cultural practice with 8 time-applications of lime sulfur considering weather condition showed higher than 30% of control efficacies of pear scab compared to conventionally cultural practice. The results suggest that proper application of environment-friendly control agents such as lime sulfur considering weather condition will enable effective control of the major diseases for organic cultivation of pear.
Rust formed on cannons of XVIII century under two environment conditions
International Nuclear Information System (INIS)
Cindra Fonseca, M.P.; Bastos, I.N.; Caytuero, A.; Baggio Saitovitch, E.M.
2007-01-01
The corrosion products of two ancient cannons exposed to atmospheric corrosion were analysed by X-ray powder diffraction, transmission Moessbauer spectroscopy and scanning electron microscopy (SEM). After almost three centuries exposed in marine environment one of them was moved to a rural region and was maintained in this environment for approximately 30 years. The inland region has an altitude of 1000 m above sea level and consequently low aggressiveness. The studied rusts were obtained from external and internal surfaces of the cannon barrels. This investigation, using three different techniques, was done to check if the relatively short time (ca. 30 years) in rural area was sufficient to change the characteristics of the thick rust formed during long time exposure (ca. 300 years) in marine atmosphere. The time-environment effects change the physical nature of rust, mainly observed by Moessbauer spectroscopy results
Zoete rust : Een muzikale soap-detective
Maas, P.
1989-01-01
De komedie' Zoete Rust' werd geschreven in opdracht van Theater de Tobbe in Voorburg . Naast de circa 120 professionele voorstellingen die elk seizoen in dit theater plaats vinden, organiseert De Tobbe een maal per laar een eigen theaterproduktie, die wordt gespeeld door het Tobbe-toneel, een ad-hoc
Green rusts synthesis by coprecipitation of Fe II-Fe III ions and mass-balance diagram
Ruby, Christian; Aïssa, Rabha; Géhin, Antoine; Cortot, Jérôme; Abdelmoula, Mustapha; Génin, Jean-Marie
2006-06-01
A basic solution is progressively added to various mixed Fe II-Fe III solutions. The nature and the relative quantities of the compounds that form can be visualised in a mass-balance diagram. The formation of hydroxysulphate green rust {GR( SO42-)} is preceded by the precipitation of a sulphated ferric basic salt that transforms in a badly ordered ferric oxyhydroxide. Then octahedrally coordinated Fe II species and SO42- anions are adsorbed on the FeOOH surface and GR( SO42-) is formed at the solid/solution interface. By using the same method of preparation, other types of green rust were synthesised, e.g. hydroxycarbonate green rust {GR( CO32-)}. Like other layered double hydroxides, green rusts obey the general chemical formula [ṡ[ṡmHO]x+ with x⩽1/3. Al-substituted hydroxysulphate green rust consists of small hexagonal crystals with a lateral size ˜50 nm, which is significantly smaller than the size of the GR( SO42-) crystals (˜500 nm). To cite this article: C. Ruby et al., C. R. Geoscience 338 (2006).
Sugarcane is susceptible to infection by two rust pathogens, Puccinia melanocephala and P. kuehnii, causing brown and orange rust, respectively. Orange rust of sugarcane was first reported in the Western hemisphere in Florida in July 2007. The pathogen was found to be distributed widely throughout t...
Coffee berry borer, Hypothenemus hampei (Ferrari) is the most serious insect pest of coffee around the world. While it is already present in most of the world’s major coffee growing regions, it is important to delay further spread and to prevent re-introductions which might include hyperparasites or...
Nurmanisa, Aisy; Wilopo,; Sanawiri, Brillyanes
2016-01-01
This research aims to understand and explain; How to Starbucks Coffee create value proposition for their customer? How to Starbucks Coffee segmented the customer, to create the value proposition? How to Starbucks Coffee build and choose the channels to grab the customer and create value proposition? How to Starbucks Coffee build a customer relationship and create value proposition from the process? .This reaserch uses primery data descriptive analysis method with fenomelogy kualitative o...
Fernandes, F L; Picanço, M C; Campos, S O; Bastos, C S; Chediak, M; Guedes, R N C; Silva, R S
2011-12-01
The currently existing sample procedures available for decision-making regarding the control of the coffee berry borer Hypothenemus hampei (Ferrari) (Coleoptera: Curculionidae: Scolytinae) are time-consuming, expensive, and difficult to perform, compromising their adoption. In addition, the damage functions incorporated in such decision levels only consider the quantitative losses, while dismissing the qualitative losses. Traps containing ethanol, methanol, and benzaldehyde may allow cheap and easy decision-making. Our objective was to determine the economic injury level (EIL) for the adults of the coffee berry borer by using attractant-baited traps. We considered both qualitative and quantitative losses caused by the coffee borer in estimating the EILs. These EILs were determined for conventional and organic coffee under high and average plant yield. When the quantitative losses caused by H. hampei were considered alone, the EILs ranged from 7.9 to 23.7% of bored berries for high and average-yield conventional crops, respectively. For high and average-yield organic coffee the ELs varied from 24.4 to 47.6% of bored berries, respectively. When qualitative and quantitative losses caused by the pest were considered together, the EIL was 4.3% of bored berries for both conventional and organic coffee. The EILs for H. hampei associated to the coffee plants in the flowering, pinhead fruit, and ripening fruit stages were 426, 85, and 28 adults per attractive trap, respectively.
International Nuclear Information System (INIS)
Yamashita, Masato; Uchida, Hitoshi; Konishi, Hiroyuki; Mizuki, Jun'ichiro
2004-01-01
The X-ray absorption fine structure (XAFS) spectrum of pure goethite around the Fe K absorption edge and that of the protective rust layer formed on weathering steel exposed for 17 years in an atmospheric environment around the Cr K edge, have been examined using synchrotron radiation X-rays. It was found that the rust layer on the weathering steel mainly consisted of Cr-goethite. By examining the fine structure at the Cr K edge and the Fe K edge, we concluded that Cr 3+ in the rust layer is coordinated with O 2- and is positioned in the double chains of vacant sites in the network of FeO 3 (OH) 3 octahedra in the goethite crystal. This Cr 3+ site indicates that the protective effect of the rust layer is due to the dense aggregation of fine crystals of Cr-goethite with cation selectivity. (author)
Appraisal of wheat germplasm for adult plant resistance against stripe rust
Directory of Open Access Journals (Sweden)
Saleem Kamran
2015-12-01
Full Text Available The resurgence of wheat stripe rust is of great concern for world food security. Owing to resistance breakdown and the appearance of new virulent high-temperature adapted races of Puccinia striiformis f. sp. tritici (Pst, many high yielding commercial varieties in the country lost their yield potential. Searching for new sources of resistance is the best approach to mitigate the problem. Quantitative resistance (partial or adult plant or durable resistance is reported to be more stable than race specific resistance. In the current perusal, a repertoire of 57 promising wheat lines along with the KLcheck line Morocco, developed through hybridisation and selection of local and international lines with International Maize and Wheat Improvement Center (CIMMYT origin, were evaluated under natural field conditions at Nuclear Institute for Agriculture and Biology (NIAB during the 2012−2013 and 2013−2014 time periods. Final rust severity (FRS, the area under the rust progress curve (AURPC, the relative area under the rust progress curve (rAURPC, and the coefficient of infection (CI were unraveled to infer the level of quantitative resistance. Final rust severity was recorded when the susceptible check exhibited 100% severity. There were 21 lines which were immune (no disease, 16 which were resistant, five moderately resistant, two resistant-to-moderately resistant, one moderately resistant-to-moderately susceptible, 5 moderately susceptible-to-susceptible, one moderately susceptible, and six exhibited a susceptible response. Nevertheless, 51 lines exhibited a high level of partial resistance while the three lines, NW-5-1212-1, NW-7-30-1, and NW-7-5 all showed a moderate level of partial resistance based on FRS, while 54 lines, on the basis of AURPC and rAURPC, were identified as conferring a high level of partial resistance. Moreover, adult plant resistance was conferred by 47 wheat lines, based on CI value. It was striking that, 13 immune lines
[Spectroscopic methods applied to component determination and species identification for coffee].
Chen, Hua-zhou; Xu, Li-li; Qin, Qiang
2014-06-01
Spectroscopic analysis was applied to the determination of the nutrient quality of ground, instant and chicory coffees. By using inductively coupled plasma atomic emission spectrometry (ICP-ES), nine mineral elements were determined in solid coffee samples. Caffeine was determined by ultraviolet (UV) spectrometry and organic matter was investigated by Fourier transform infrared (FTIR) spectroscopy. Oxidation-reduction titration was utilized for measuring the oxalate. The differences between ground coffee and instant coffee was identified on the basis of the contents of caffeine, oxalate and mineral elements. Experimental evidence showed that, caffeine in instant coffee was 2-3 times higher than in ground coffee. Oxalate in instant coffee was significantly higher in ground coffee. Mineral elements of Mg, P and Zn in ground coffee is lower than in instant coffee, while Cu is several times higher. The mineral content in chicory coffee is overall lower than the instant coffee. In addition, we determined the content of Ti for different types of coffees, and simultaneously detected the elements of Cu, Ti and Zn in chicory coffee. As a fast detection technique, FTIR spectroscopy has the potential of detecting the differences between ground coffee and instant coffee, and is able to verify the presence of caffeine and oxalate.
Influence of lactate ions on the formation of rust
International Nuclear Information System (INIS)
Sabot, R.; Jeannin, M.; Gadouleau, M.; Guo, Q.; Sicre, E.; Refait, Ph.
2007-01-01
The formation of rust can be simulated by oxidation of aqueous suspensions of Fe(OH) 2 obtained by mixing solutions of NaOH and a Fe(II) salt. The aim of this study was to investigate the influence of organic species associated with microbially influenced corrosion. The lactate anion, often used as a carbon and electrons source for the development of microorganisms, was chosen as an example. Then, in the first part of the study, Fe(OH) 2 was precipitated using iron(II) lactate and NaOH. Its oxidation process involved two stages, as usually observed. The first stage led to a Fe(II-III) intermediate compound, the lactate green rust, GR(C 3 H 5 O 3 - ). This compound has never been reported yet. Its existence demonstrates that the GR structure is able to incorporate a very wide range of anions, whatever the size and geometry. The second stage corresponded to the oxidation of GR(C 3 H 5 O 3 - ). It led to ferrihydrite, the most poorly ordered form of iron(III) oxides and oxyhydroxides. In the second part of the study, the formation of rust in seawater was simulated by oxidation of Fe(OH) 2 in an aqueous media containing both Cl - and SO 4 2- anions. The first stage led to the sulphate green rust, GR(SO 4 2- ), the second stage to lepidocrocite γ-FeOOH. Small amounts of iron(II) lactate were added to the reactants. Lactate ions did not modify the first stage but drastically perturbed the second stage, as ferrihydrite was obtained instead of γ-FeOOH
Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.
Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H
2017-06-01
We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.
Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum.
Sallam, Ahmad H; Tyagi, Priyanka; Brown-Guedira, Gina; Muehlbauer, Gary J; Hulse, Alex; Steffenson, Brian J
2017-10-05
Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1 , losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB) and foreign (TTKSK aka isolate Ug99) pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC) (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum ) for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC) of the wheat stem rust pathogen ( Puccinia graminis f. sp. tritici , Pgt ) and one isolate (92-MN-90) of the rye stem rust pathogen ( P. graminis f. sp. secalis , Pgs ). Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis A genome-wide association study (GWAS) was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley. Copyright © 2017 Sallam et al.
Salakinkop, S R; Shivaprasad, P
2012-01-01
A field experiment was conducted to study the influence of treated coffee effluent irrigation on performance of established robusta coffee, nutrient contribution and microbial activities in the soil. The results revealed that the field irrigated with coffee effluent from aerobic tank having COD of 1009 ppm, did not affect the yield of clean coffee (1309 kg/ha) and it was statistically similar (on par) with the plots irrigated with fresh water (1310 kg/ha) with respect to clean coffee yield. Effluent irrigation increased significantly the population bacteria, yeast, fungi, actinomycetes and PSB (122, 52, 12, 34 and 6 x 104/g respectively)) in the soil compared to the soil irrigated with fresh water (87, 22, 5, 24 and 2 x 10(4)/g respectively). The organic carbon (2.60%), available nutrients in the soil like P (57.2 kg/ha), K (401.6 kg/ha, Ca (695.3 ppm), S (5.3 ppm),Cu (4.09 ppm) and Zn(4.78 ppm) were also increased due to effluent irrigation compared to fresh water irrigation. Thus analysis of coffee effluent for major and minor plant nutrients content revealed its potential as source of nutrients and water for plant growth.
Current and future molecular approaches to investigate the white pine blister rust pathosystem
B. A. Richardson; A. K. M. Ekramoddoulah; J.-J. Liu; M.-S. Kim; N. B. Klopfenstein
2010-01-01
Molecular genetics is proving to be especially useful for addressing a wide variety of research and management questions on the white pine blister rust pathosystem. White pine blister rust, caused by Cronartium ribicola, is an ideal model for studying biogeography, genetics, and evolution because: (1) it involves an introduced pathogen; (2) it includes multiple primary...
White pine blister rust resistance in limber pine: Evidence for a major gene
A. W. Schoettle; R. A. Sniezko; A. Kegley; K. S. Burns
2014-01-01
Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections...
Coffee Production in Kigoma Region, Tanzania: Profitability and ...
African Journals Online (AJOL)
Farmers processed at CPU gained about TZS 1350/kg as coffee improvement gain. Coffee production ... explored, keeping in mind the theories put forth in the theoretical ... Information used in the gross margin analysis encompass total coffee ...
COFFEE GROWING AREAS OF ETHIOPIA"
African Journals Online (AJOL)
accelerated economic growth, part of which is hoped to be achieved via increased ... at the Fifth International Conference on the Ethiopian Economy held at the United ... Samuel and Ludi: Agricultural commercialisation in coffee growing areas. ... Ethiopia produces and exports one of the best fighland coffees in the world.
Directory of Open Access Journals (Sweden)
Joice Andrade Bonfim
2010-01-01
Full Text Available O trabalho foi realizado em cafeeiros cultivados a pleno sol e consorciado com grevíleas em Vitória da Conquista (BA, em duas estações: seca e chuvosa, com objetivo de verificar a influência da arborização dos cafezais e da disponibilidade hídrica sobre a densidade de Fungos Micorrízicos Arbusculares (FMA e ainda relacionar tais fatores com aspectos fisiológicos do cafeeiro. O experimento foi realizado em campos de observação com dois tratamentos e seis repetições, sendo as médias comparadas pelo teste t (pThe work was performed aiming to check the influence of the agroforestry system and water availability on the density of Arbuscular Mycorrhizal Fungi (AMF, and to correlate these factors with physiological aspects of coffee. This study was conducted in a full sun coffee field, where coffee plants were associated with grevilea during dry and rainy seasons. The experiment had two treatments and six replicates, and the resulting averages were compared by a t test at 5% of probability, comparing the systems and seasons. There was a rise in spore number in the dry season. Also the rate of root colonization of AMF was higher in intercropped cultivation but it did not differ between seasons. The shading of coffee plants in dry season promoted a raise of leaf Spad index. In the rainy season the leaf water potential had higher absolute value.
Directory of Open Access Journals (Sweden)
Alessandra Gaspar SOUSA
2016-01-01
Full Text Available Abstract The aim of this study is to describe the characteristics of consumers and non-consumers, the reasons and foods associated with coffee intake among adults from the Federal District, Brazil. This is a cross-sectional population-based survey conducted by telephone interview (n= 1,368. We collected information on detailed coffee intake, socio-demographic aspects and personal characteristics. The coffee had an average daily intake of 319 mL. Individuals were more likely to drink coffee at an older age (68% and with higher body mass index (58%. The most cited reason for consuming coffee was the “personal pleasure” (48%, followed by “habit / tradition” of consuming coffee. Among non-consumers of this beverage, the main reason was not liking the taste and / or aroma of coffee (62%. The method of coffee preparation used was by infusion (86% and sugar was the main sweetener used by 83% of consumers. The majority of consumers (59% reported consuming coffee with certain foods such as bakery products. The results from our study may suggest that the popularity of coffee can be attributed to its taste, personal pleasure and habit, and the consumption is more likely to occur with the advance of age and with intake of other foods.
Association between coffee consumption and serum lipid profile.
Karabudak, Efsun; Türközü, Duygu; Köksal, Eda
2015-05-01
The aim of the present study was to investigate the association between coffee consumption and serum lipid levels in a study population of 122 Turkish subjects (mean age, 41.4±12.69 years), including 48 males and 74 females. A questionnaire was compiled to determine baseline characteristics, and food and coffee consumption. Subjects were divided into three groups, which included non-drinkers, Turkish coffee and instant coffee drinkers, and anthropometric measurements were acquired, including weight, height and body mass index. Serum lipid levels were analyzed, including the total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C) and very low-density lipoprotein cholesterol (VLDL-C) levels. Of the population studied, 76.2% had consumed at least one cup of coffee per week over the previous year. Daily consumption values were 62.3±40.60 ml (0.7±0.50 cup) for Turkish coffee and 116.3±121.96 ml (0.7±0.81 cup) for instant coffee. No statistically significant differences were observed in the serum levels of TC, TG, LDL-C, HDL-C or VLDL-C among the three groups. In addition, no statistically significant differences were observed in the serum lipid levels when comparing individuals who consumed coffee with sugar/cream or who smoked and those who did not (P>0.05). Therefore, the present observations indicated no significant association between the consumption of Turkish or instant coffee and serum lipid levels.
Directory of Open Access Journals (Sweden)
MOSS, Charles B.
2004-05-01
Full Text Available RESUMOA afirmação que a produção de café de qualidade é mais cara que a produção de café de menor qualidade, também que mercado falha na transmissão de sinais de qualidade para os produtores baixarem a qualidade média do café produzido. Ao usar equações simultâneas em mínimos quadrados de três estágios, descobriu-se que algumas variáveis foram significantes: o tamanho do produtor afeta a parcela de café cherry vendida, a qualidade afeta o preço internacional de café verde do México, e a qualidade da cherry aumenta a parcela vendida de café verde. Mas, não há evidencia que a concentração de poder de mercado afete a parcela de preços do café verde.ABSTRACTThe assumption that the production of quality coffee is more expensive than the production of coffee of less quality, also that market failures in the transmission of quality signals to producer lower the average quality of coffee produced industry. Used its simultaneous equations in three stage lest square we have found that some variable were significant; the size of the producer affects the share of sold cherry, the quality affects the international green coffee price of México and the quality of cherry increases the share of green coffee sold. But there in no evidence that market power concentration affects the share prices of green coffee.RESUMENSe afirma que producir café de calidad es más caro que producir café de peor calidad, y también que el mercado falla en la transmisión de señales de calidad para que los productores disminuyan la calidad media del café producido. Al usar ecuaciones simultáneas en mínimos cuadrados de tres etapas, se descubrió que algunas variables fueron significativas: el tamaño del productor afecta la fracción de café cherry vendida, la calidad afecta el precio internacional del café verde de México y la calidad de la cherry aumenta la fracción vendida de café verde. Pero no hay evidencia de que la concentración de
Coffee and tea: perks for health and longevity?
Bhatti, Salman K; O'Keefe, James H; Lavie, Carl J
2013-11-01
Tea and coffee, after water, are the most commonly consumed beverages in the world and are the top sources of caffeine and antioxidant polyphenols in the American diet. The purpose of this review is to assess the health effects of chronic tea and/or coffee consumption. Tea consumption, especially green tea, is associated with significantly reduced risks for stroke, diabetes and depression, and improved levels of glucose, cholesterol, abdominal obesity and blood pressure. Habitual coffee consumption in large epidemiological studies is associated with reduced mortality, both for all-cause and cardiovascular deaths. In addition, coffee intake is associated with risks of heart failure, stroke, diabetes mellitus and some cancers in an inverse dose-dependent fashion. Surprisingly, coffee is associated with neutral to reduced risks for both atrial and ventricular arrhythmias. However, caffeine at high doses can increase anxiety, insomnia, calcium loss and possibly the risk of fractures. Coffee and tea can generally be recommended as health-promoting additions to an adult diet. Adequate dietary calcium intake may be particularly important for tea and coffee drinkers.
Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten
2015-08-01
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.
Coffee Berry Borer Joins Bark Beetles in Coffee Klatch
Jaramillo, Juliana; Torto, Baldwyn; Mwenda, Dickson; Troeger, Armin; Borgemeister, Christian; Poehling, Hans-Michael; Francke, Wittko
2013-01-01
Unanswered key questions in bark beetle-plant interactions concern host finding in species attacking angiosperms in tropical zones and whether management strategies based on chemical signaling used for their conifer-attacking temperate relatives may also be applied in the tropics. We hypothesized that there should be a common link in chemical signaling mediating host location by these Scolytids. Using laboratory behavioral assays and chemical analysis we demonstrate that the yellow-orange exocarp stage of coffee berries, which attracts the coffee berry borer, releases relatively high amounts of volatiles including conophthorin, chalcogran, frontalin and sulcatone that are typically associated with Scolytinae chemical ecology. The green stage of the berry produces a much less complex bouquet containing small amounts of conophthorin but no other compounds known as bark beetle semiochemicals. In behavioral assays, the coffee berry borer was attracted to the spiroacetals conophthorin and chalcogran, but avoided the monoterpenes verbenone and α-pinene, demonstrating that, as in their conifer-attacking relatives in temperate zones, the use of host and non-host volatiles is also critical in host finding by tropical species. We speculate that microorganisms formed a common basis for the establishment of crucial chemical signals comprising inter- and intraspecific communication systems in both temperate- and tropical-occurring bark beetles attacking gymnosperms and angiosperms. PMID:24073204
The formation of green rust induced by tropical river biofilm components
International Nuclear Information System (INIS)
Jorand, F.; Zegeye, A.; Ghanbaja, J.; Abdelmoula, M.
2011-01-01
In the Sinnamary Estuary (French Guiana), a dense red biofilm grows on flooded surfaces. In order to characterize the iron oxides in this biofilm and to establish the nature of secondary minerals formed after anaerobic incubation, we conducted solid analysis and performed batch incubations. Elemental analysis indicated a major amount of iron as inorganic compartment along with organic matter. Solid analysis showed the presence of two ferric oxides ferrihydrite and lepidocrocite. Bacteria were abundant and represented more than 10 11 cells g -1 of dry weight among which iron reducers were revealed. Optical and electronic microscopy analysis revealed than the bacteria were in close vicinity of the iron oxides. After anaerobic incubations with exogenous electron donors, the biofilm's ferric material was reduced into green rust, a Fe II -Fe III layered double hydroxide. This green rust remained stable for several years. From this study and previous reports, we suggest that ferruginous biofilms should be considered as a favorable location for GR biomineralization when redox conditions and electron donors availability are gathered. - Research highlights: → Characterization of ferruginous biofilm components by solid analysis methods. → Lepidocrocite and ferrihydrite were the main iron oxides. → Anaerobic incubation of biofilm with electron donors produced green rust. → Biofilm components promote the formation of the green rust. → Ferruginous biofilm could contribute to the natural mercury attenuation.
The formation of green rust induced by tropical river biofilm components
Energy Technology Data Exchange (ETDEWEB)
Jorand, F., E-mail: jorand@pharma.uhp-nancy.fr [Laboratoire de Chimie Physique et Microbiologie pour l' Environnement (LCPME) UMR 7564, CNRS-Nancy-Universite, Institut Jean Barriol, 405 rue de Vandoeuvre, F-54600 Villers-les Nancy (France); Zegeye, A. [Laboratoire de Chimie Physique et Microbiologie pour l' Environnement (LCPME) UMR 7564, CNRS-Nancy-Universite, Institut Jean Barriol, 405 rue de Vandoeuvre, F-54600 Villers-les Nancy (France); Ghanbaja, J. [Service Commun de Microscopies Electroniques et Microanalyses X (SCMEM), Nancy-Universite, Bvd des Aiguillettes, BP 239, 54506, Vandoeuvre-les-Nancy (France); Abdelmoula, M. [Laboratoire de Chimie Physique et Microbiologie pour l' Environnement (LCPME) UMR 7564, CNRS-Nancy-Universite, Institut Jean Barriol, 405 rue de Vandoeuvre, F-54600 Villers-les Nancy (France)
2011-06-01
In the Sinnamary Estuary (French Guiana), a dense red biofilm grows on flooded surfaces. In order to characterize the iron oxides in this biofilm and to establish the nature of secondary minerals formed after anaerobic incubation, we conducted solid analysis and performed batch incubations. Elemental analysis indicated a major amount of iron as inorganic compartment along with organic matter. Solid analysis showed the presence of two ferric oxides ferrihydrite and lepidocrocite. Bacteria were abundant and represented more than 10{sup 11} cells g{sup -1} of dry weight among which iron reducers were revealed. Optical and electronic microscopy analysis revealed than the bacteria were in close vicinity of the iron oxides. After anaerobic incubations with exogenous electron donors, the biofilm's ferric material was reduced into green rust, a Fe{sup II}-Fe{sup III} layered double hydroxide. This green rust remained stable for several years. From this study and previous reports, we suggest that ferruginous biofilms should be considered as a favorable location for GR biomineralization when redox conditions and electron donors availability are gathered. - Research highlights: {yields} Characterization of ferruginous biofilm components by solid analysis methods. {yields} Lepidocrocite and ferrihydrite were the main iron oxides. {yields} Anaerobic incubation of biofilm with electron donors produced green rust. {yields} Biofilm components promote the formation of the green rust. {yields} Ferruginous biofilm could contribute to the natural mercury attenuation.
Coordinating quality practices in Direct Trade coffee
DEFF Research Database (Denmark)
Holland, Emil; Kjeldsen, Chris; Kerndrup, Søren
2016-01-01
Over the past few decades, many food niches have emerged with a specific focus on quality. In specialty coffee, micro roasters have brought about Direct Trade coffee as a way of organising an alternative around new tastes and qualities through ongoing and ‘direct’ relations to farmers...... and cooperatives. But Direct Trade also involves exporters. We ask, how do exporters and roasters work together in these new coffee relations, and what do they work on? We observe and participate in a situation where Colombian coffee exporters visit Danish roasters. They tour the roasting facilities and taste...... a number of coffees. Often, the term power is used to analyse such value chain interactions, but we argue that the term coordination better opens up these interactions for exploration and analysis. What emerges is a coordination of quality. Through touring and tasting, issues emerge and differences...
Rust types from JSON samples - Approximating type providers with procedural macros in Rust
Vesteraas, Erik Andreas
2017-01-01
When programmers access external data in a statically typed programming language, they are often faced with a dilemma between convenient and type-safe access to the data. In the programming language F#, a concept called type providers has been proposed as a solution to this problem by having compiler support for libraries with the capability to generate types at compile time. This thesis presents "json_typegen", a project which aims to show the feasibility of similar solutions in the Rust pro...
Jarvis, Lovell S.
2004-01-01
Brazil, the world's largest coffee exporter, encouraged efforts in the 1960s to form the International Coffee Agreement (ICA), which restricted total coffee exports via country export quotas. The quotas led to significant domestic quota rents in producing countries. This paper analyzes the effects of rent seeking in Brazil. The Brazilian Institute of Coffee (IBC), which was responsible for coffee policy, was the focus of rent seeking. The paper models the policy instruments used by the IB...
THE LATIN AMERICAN ORGANIC COFFEE INDUSTRY: U.S. MARKET INROADS
Rodriguez, Danilo; Epperson, James E.
2001-01-01
Certified organic coffee is a minuscule but important portion of coffee production and trade and is the fastest growing sector in sales revenue. Organic coffee has its roots in sustainable crop production and economic development policy. Latin America has become the center of the organic coffee movement, representing a change from the old market structure of the coffee trade. The U.S. organic coffee market has experienced extraordinary growth in the past five years because of an increase in c...
Fine Mapping of Ur-3, a Historically Important Rust Resistance Locus in Common Bean
Directory of Open Access Journals (Sweden)
Oscar P. Hurtado-Gonzales
2017-02-01
Full Text Available Bean rust, caused by Uromyces appendiculatus, is a devastating disease of common bean (Phaseolus vulgaris in the Americas and Africa. The historically important Ur-3 gene confers resistance to many races of the highly variable bean rust pathogen that overcome other rust resistance genes. Existing molecular markers tagging Ur-3 for use in marker-assisted selection produce false results. Here, we describe the fine mapping of the Ur-3 locus for the development of highly accurate markers linked to Ur-3. An F2 population from the cross Pinto 114 (susceptible × Aurora (resistant with Ur-3 was evaluated for its reaction to four different races of U. appendiculatus. A bulked segregant analysis using the SNP chip BARCBEAN6K_3 placed the approximate location of Ur-3 in the lower arm of chromosome Pv11. Specific SSR and SNP markers and haplotype analysis of 18 sequenced bean varieties positioned Ur-3 in a 46.5 kb genomic region from 46.96 to 47.01 Mb on Pv11. We discovered in this region the SS68 KASP marker that was tightly linked to Ur-3. Validation of SS68 on a panel of 130 diverse common bean cultivars containing all known rust resistance genes revealed that SS68 was highly accurate and produced no false results. The SS68 marker will be of great value in pyramiding Ur-3 with other rust resistance genes. It will also significantly reduce time and labor associated with the current phenotypic detection of Ur-3. This is the first utilization of fine mapping to discover markers linked to rust resistance in common bean.
Fine Mapping of Ur-3, a Historically Important Rust Resistance Locus in Common Bean.
Hurtado-Gonzales, Oscar P; Valentini, Giseli; Gilio, Thiago A S; Martins, Alexandre M; Song, Qijian; Pastor-Corrales, Marcial A
2017-02-09
Bean rust, caused by Uromyces appendiculatus , is a devastating disease of common bean ( Phaseolus vulgaris ) in the Americas and Africa. The historically important Ur-3 gene confers resistance to many races of the highly variable bean rust pathogen that overcome other rust resistance genes. Existing molecular markers tagging Ur-3 for use in marker-assisted selection produce false results. Here, we describe the fine mapping of the Ur-3 locus for the development of highly accurate markers linked to Ur-3 An F 2 population from the cross Pinto 114 (susceptible) × Aurora (resistant with Ur-3 ) was evaluated for its reaction to four different races of U. appendiculatus A bulked segregant analysis using the SNP chip BARCBEAN6K_3 placed the approximate location of Ur-3 in the lower arm of chromosome Pv11. Specific SSR and SNP markers and haplotype analysis of 18 sequenced bean varieties positioned Ur-3 in a 46.5 kb genomic region from 46.96 to 47.01 Mb on Pv11. We discovered in this region the SS68 KASP marker that was tightly linked to Ur-3 Validation of SS68 on a panel of 130 diverse common bean cultivars containing all known rust resistance genes revealed that SS68 was highly accurate and produced no false results. The SS68 marker will be of great value in pyramiding Ur-3 with other rust resistance genes. It will also significantly reduce time and labor associated with the current phenotypic detection of Ur-3 This is the first utilization of fine mapping to discover markers linked to rust resistance in common bean. Copyright © 2017 Hurtado-Gonzales et al.
A mutagenesis-derived broad-spectrum disease resistance locus in wheat
Wheat leaf rust, stem rust, stripe rust, and powdery mildew caused by the fungal pathogens Puccinia triticina, P. graminis f. sp. tritici, P. striiformis f. sp. tritici, and Blumeria graminis f. sp. tritici, respectively, are destructive diseases of wheat worldwide. The most effective and widely uti...
International Nuclear Information System (INIS)
Roselli, C.; Desideri, D.; Feduzi, L.; Rongoni, A.; Saetta, D.
2013-01-01
This research was dedicated to the study of the background levels of 210 Po and natural gamma emitters as 40 K, 214 Pb, 214 Bi, 228 Ac, 212 Pb and 212 Bi in coffee powder and in coffee beverage; also the artificial 137 Cs was determined. In the coffee powder the mean 210 Po activity resulted 7.25 ± 2.25 x 10 -2 Bq kg -1 . 40 K showed a mean activity of 907.4 ± 115.6 Bq kg -1 . The mean activity concentration of 214 Pb and 214 Bi, indicators of 226 Ra, given as mean value of the two radionuclides, resulted 10.61 ± 4.02 Bq kg -1 . 228 Ac, 228 Ra indicator, showed a mean activity concentration of 13.73 ± 3.20 Bq kg -1 . The mean activity concentration of 212 Pb, 224 Ra indicator, was 8.28 ± 2.88 Bq kg -1 . 208 Tl, 224 Ra indicator, presented a mean activity concentration of 11.03 ± 4.34 Bq kg -1 . In all samples, the artificial 137 Cs resulted below the detection limit (2.0 Bq kg -1 ). The arithmetical mean value of percentage of 210 Po extraction in coffee beverage resulted 20.5 ± 6.9. The percentage of transfer of gamma emitters, 40 K, 214 Pb, 214 Bi, 228 Ac, 212 Pb, 208 Tl resulted of 80.0, 33.5, 24.7, 30.0, 35.1 and 53.5 % for 40 K, 214 Pb, 214 Bi, 228 Ac, 212 Pb and 208 Tl respectively. (author)
Activity of some isoenzymatic systems in stored coffee grains
Directory of Open Access Journals (Sweden)
Reni Saath
2014-02-01
Full Text Available Considering the worldwide consumption of coffee, it is natural that throughout the history many people have dedicated the research to markers that contribute somehow on gauging its quality. This research aimed to evaluate the biochemical performance of arabica coffee during storage. Coffee in beans (natural and in parchment (pulped dried in concrete terrace and in dryer with heated air were packed in jute bags and stored in not controlled environmental conditions. Enzymatic activities of superoxide dismutase, catalase, peroxidase, polyphenoloxidase, esterase and lipoxygenase in coffee grains were evaluated at zero, three, six, nine and twelve months by means of electrophoresis. Independently of the drying method, the activity of isoenzymatic complexes highlighted deteriorative processes in stored grains of coffee. The treatments 60/40º C and 60º C used to reduce the water content imposed a greater stress condition, accelerated metabolism of natural coffee in the storage with decreased activity of defense mechanisms due to latent damage in these grains. Natural coffees are more sensible to high drying temperatures and its quality reduces faster than pulped coffee in the storage.
Bongers, G.; Fleskens, L.; Ven, van de G.W.J.; Mukasa, D.; Giller, K.E.; Asten, van P.
2015-01-01
Many smallholder farm systems in Uganda produce coffee as an important cash crop. Yet coffee yields are poor. To increase farmers’ production, a range of agronomic practices have been recommended by national and international agencies. Yet the adoption potential of recommendations differs between
Directory of Open Access Journals (Sweden)
Christina Dudienas
2013-03-01
localities of São Paulo State, correlated to yield. A total of 50 simple and triple hybrids (HST and 22 double hybrids and varieties of maize (HDV in use by farmers were evaluated in 2005/2006 for their reaction to southern rust in six locations in western and north-central regions of São Paulo State. In the experiments with HST, the most resistant cultivars with the highest yields were: 30F80, 30F90, 30K73, AG 7000, DAS 2B710, DKB 191, DKB 466 and Impacto. Among HDV, the most resistant ones presenting the highest yields were: 30S40 and AG 2040. Yield losses due to the severity of southern rust, assessed in the stage of pastry grain, ranged from 3.5%, for cultivars with approximately 2.5% of leaf area affected by the disease, to 20.3% for cultivars with 39% of the leaf area affected, compared to cultivars of higher resistance to the disease (1.4% affected leaf area.
Reinforcing effects of caffeine in coffee and capsules.
Griffiths, R R; Bigelow, G E; Liebson, I A
1989-09-01
In a residential research ward the reinforcing and subjective effects of caffeine were studied under double-blind conditions in volunteer subjects with histories of heavy coffee drinking. In Experiment 1, 6 subjects had 13 opportunities each day to self-administer either a caffeine (100 mg) or a placebo capsule for periods of 14 to 61 days. All subjects developed a clear preference for caffeine, with intake of caffeine becoming relatively stable after preference had been attained. Preference for caffeine was demonstrated whether or not preference testing was preceded by a period of 10 to 37 days of caffeine abstinence, suggesting that a recent history of heavy caffeine intake (tolerance/dependence) was not a necessary condition for caffeine to function as a reinforcer. In Experiment 2, 6 subjects had 10 opportunities each day to self-administer a cup of coffee or (on different days) a capsule, dependent upon completing a work requirement that progressively increased and then decreased over days. Each day, one of four conditions was studied: caffeinated coffee (100 mg/cup), decaffeinated coffee, caffeine capsules (100 mg/capsule), or placebo capsules. Caffeinated coffee maintained the most self-administration, significantly higher than decaffeinated coffee and placebo capsules but not different from caffeine capsules. Both decaffeinated coffee and caffeine capsules were significantly higher than placebo capsules but not different from each other. In both experiments, subject ratings of "linking" of coffee or capsules covaried with the self-administration measures. These experiments provide the clearest demonstrations to date of the reinforcing effects of caffeine in capsules and in coffee.
Induced multiple disease resistance in wheat
International Nuclear Information System (INIS)
Borojevic, K.; Worland, A.J.
1990-01-01
Full text: The existence of genes suppressing resistance to leaf rust, stem rust and yellow rust in hexaploid wheat has been suggested. If such genes are deleted or inactivated, a more resistant variety may be obtained. In mutant lines of the wheat variety San Pastore, selected after treatment with 20,000 rad of gamma-rays, resistance to leaf rust, yellow rust, stem rust, and to some extent to Erysiphe graminis was determined. The mutants responded to infection by producing necrotic flecks in the presence of high level of disease inoculum. Similar flecks develop under stress condition. It is likely that the mother variety San Pastore carries genes for resistance which are masked by suppressor genes. Irradiation inactivates suppressors so that resistance genes which were previously masked are expressed. The first results of monosomic analysis indicate that chromosomes of groups 4 and 5 or possibly 7 may be critical for expression of resistance in the mutant lines. (author)
Caffeine adsorption of montmorillonite in coffee extracts.
Shiono, Takashi; Yamamoto, Kenichiro; Yotsumoto, Yuko; Yoshida, Aruto
2017-08-01
The growth in health-conscious consumers continues to drive the demand for a wide variety of decaffeinated beverages. We previously developed a new technology using montmorillonite (MMT) in selective decaffeination of tea extract. This study evaluated and compared decaffeination of coffee extract using MMT and activated carbon (AC). MMT adsorbed caffeine without significant adsorption of caffeoylquinic acids (CQAs), feruloylquinic acids (FQAs), dicaffeoylquinic acids (di-CQAs), or caffeoylquinic lactones (CQLs). AC adsorbed caffeine, chlorogenic acids (CGAs) and CQLs simultaneously. The results suggested that the adsorption selectivity for caffeine in coffee extract is higher in MMT than AC. The caffeine adsorption isotherms of MMT in coffee extract fitted well to the Langmuir adsorption model. The adsorption properties in coffee extracts from the same species were comparable, regardless of roasting level and locality of growth. Our findings suggest that MMT is a useful adsorbent in the decaffeination of a wide range of coffee extracts.
A Real Options Analysis of Coffee Planting in Vietnam
Luong, Quoc; Tauer, Loren W.
2004-01-01
Vietnam grew from an insignificant to the world’s second largest coffee producer during the 1990s. To understand this growth, this paper examines Vietnamese coffee growers’ investment decisions using real options theory. The study finds that producers, with variable costs of 19 cents/lb and total cost of 29.3 cents/lb, would enter coffee production at a coffee price of 47 cents/lb and exit at a coffee price of 14 cents/lb. Most Vietnamese growers appear to be sufficiently efficient to continu...
Directory of Open Access Journals (Sweden)
Kang Yu
2013-12-01
Full Text Available Leaf diseases, such as powdery mildew and leaf rust, frequently infect barley plants and severely affect the economic value of malting barley. Early detection of barley diseases would facilitate the timely application of fungicides. In a field experiment, we investigated the performance of fluorescence and reflectance indices on (1 detecting barley disease risks when no fungicide is applied and (2 estimating leaf chlorophyll concentration (LCC. Leaf fluorescence and canopy reflectance were weekly measured by a portable fluorescence sensor and spectroradiometer, respectively. Results showed that vegetation indices recorded at canopy level performed well for the early detection of slightly-diseased plants. The combined reflectance index, MCARI/TCARI, yielded the best discrimination between healthy and diseased plants across seven barley varieties. The blue to far-red fluorescence ratio (BFRR_UV and OSAVI were the best fluorescence and reflectance indices for estimating LCC, respectively, yielding R2 of 0.72 and 0.79. Partial least squares (PLS and support vector machines (SVM regression models further improved the use of fluorescence signals for the estimation of LCC, yielding R2 of 0.81 and 0.84, respectively. Our results demonstrate that non-destructive spectral measurements are able to detect mild disease symptoms before significant losses in LCC due to diseases under natural conditions.
Coffee and Depression: A Short Review of Literature.
Tenore, Gian Carlo; Daglia, Maria; Orlando, Valentina; D'Urso, Emanuela; Saadat, Seyed Hassan; Novellino, Ettore; Nabavi, Seyed Fazel; Nabavi, Seyed Mohammad
2015-01-01
Coffee is among the most widespread and healthiest beverages in the world. It is known to be a highly rich source of biologically active natural metabolites which possess therapeutic effects (i.e. caffeine) and functional properties (i.e. chlorogenic acids). Therefore, coffee can be considered a drink which has different positive effects on human health such as cardioprotective, neuroprotective, hepatoprotective, nephroprotective, etc. However, heavy coffee consumption may be related to some unpleasant symptoms, mainly anxiety, headache, increased blood pressure, nausea, and restlessness. During the past two decades, several studies have indicated that there is a close correlation between consumption of coffee and incidence of depression. In addition, phytochemical studies showed that caffeine is the main responsible constituent for antidepressant effects of coffee through multiple molecular mechanisms. The aim of the present paper was to collect the latest literature data (from 1984 to 2014) on the positive and negative impacts of coffee consumption on the major depressive disorders and to clarify the role of bioactive constituents of coffee in the related different clinical trials. To the best of our knowledge, this the first review on this topic.
The inclusion of coffee in commercial layer diets
Directory of Open Access Journals (Sweden)
LR Mendes
2013-06-01
Full Text Available This experiment aimed at evaluating the effect of the dietary inclusion of caffeinated and decaffeinated coffee on the performance and internal and external egg quality of commercial layers. One hundred and twenty 25-week-old Hy-line Brown layers, with 1575 ± 91 average body weight, were distributed according to a completely randomized experimental design with three treatments (control, 1.2% caffeinated coffee, or 1.2% decaffeinated coffee of five replicates of eight birds each. The inclusion of 1.2% caffeinated coffee was calculated to supply 6mg caffeine per kg body weight, which is considered a moderate dose. The applied treatments did not influence (p>0.05 feed intake, egg production, egg weight, egg mass, feed conversion ratio, Haugh units, yolk color or albumen and yolk percentages. The eggs of hens fed 1.2% caffeinated coffee presented lower (p<0.05 eggshell thickness and egg specific density. The eggs of layers fed 1.2% caffeinated coffee tended (p=0.0637 to present lower eggshell percentage. It was concluded that feeding caffeinated coffee to commercial layers does not affect their performance or internal egg quality; however, eggshell quality is impaired.
Ochratoxin A in Brazilian green coffee
Directory of Open Access Journals (Sweden)
LEONI Luís A.B.
2001-01-01
Full Text Available Ochratoxin A is a nephrotoxic, teratogenic and imunotoxic compound produced by Aspergillus and Penicillium spp. It is a suspected carcinogen to humans and it is carcinogenic to rats. Recently it has drawn attention because it has been found in coffee and it has been the object of regulation by coffee importing countries. Brazil is the largest coffee producing country and its largest consumer. In order to conduct an initial assessment of the situation of the coffee produced in the country and offered to its population, one hundred and thirty two samples of Brazilian green coffee from 5 producing states (Minas Gerais, Paraná, São Paulo, Espírito Santo and Bahia and destined for the home market, were collected at sales points at the cities of Londrina and Santos, Brazil, and analyzed for ochratoxin A. The toxin was isolated in immunoaffinity columns and quantified by HPLC with florescence detection. The limit of detection was 0.7ng/g and the average RSD for duplicates of the samples was 11%. Twenty seven samples were found contaminated with the toxin and the average concentration for the contaminated samples was 7.1ng/g ochratoxin A. Neither the total number of defects nor the number of specific defects according to the Brazilian coffee classification system (black, partly -- black, sour, stinkers-black, stinkers-green, pod beans showed any relation to the contamination of the samples with ochratoxin A.
Evidence from The Rwandan Coffee Sector.
African Journals Online (AJOL)
the coffee value chain and to promote the production of speciality coffee. A research team ... exporters and the installation of several parchment mills by companies ..... use a Simple linear regression model was used to explain the total quantity.
Granular zerovalent iron has been proposed to be used as a medium in permeable reactive barriers (PRBs) to remove arsenic from contaminated groundwater. Iron(II, III) hydroxycarbonate green rust (carbonate green rust, or CGR) is a major corrosion product of zerovalent iron under ...
The structural changes in the Mexican coffee sector
Padron, Benigno Rodriguez; Burger, Kees
2015-01-01
This paper analyses the structural changes which have been present since the economic clauses of the International Coffee Agreements have no longer been in effect. It studies the elements that modified the coffee policy over time. It also investigates the main characteristics of the entire coffee
Coffee drinking enhances the analgesic effect of cigarette smoking
DEFF Research Database (Denmark)
Nastase, Anca; Ioan, Silvia; Braga, Radu I
2007-01-01
Nicotine (from cigarette smoke) and caffeine (from coffee) have analgesic effects in humans and experimental animals. We investigated the combined effects of coffee drinking and cigarette smoking on pain experience in a group of moderate nicotine-dependent, coffee drinking, young smokers. Pain...... threshold and pain tolerance were measured during cold pressor test following the habitual nocturnal deprivation of smoking and coffee drinking. Smoking increased pain threshold and pain tolerance in both men and women. Coffee drinking, at a dose that had no independent effect, doubled the increase in pain...
Directory of Open Access Journals (Sweden)
Viviane Talamini
2003-02-01
.Evaluations of incidence of rust (Hemileia vastatrix Berk. & Br. and brown eye spot (Cercospora coffeicola Berk. & Cooke took place at intervals of 14 days, observing 6 leaves per plant during the period from March 21, 1998 to February 6, 1999 in a 'Catuai' culture. The objective was to evaluate the effect of irrigation and fertirrigation on the incidence of rust and in 12 year coffee plants and analyze the progress curve of these diseases and their correlation to climatic variables. The experimental design was the one of randomized blocks with four treatments of different fertilizer splitting (1: 12 hand applications, 2:12 applications via fertirrigation, 3: 24 fertirrigated applications, 4: 36 fertirrigated applications. The plots were divided in 3 subplots that received treatments in different periods at initial irrigation (subplots A: June 1, B: July 15, C: September 1, and 2 checks (additional treats 1: fertilized 4 times and not irrigated, additional treats 2: conventional fertilizer and not irrigated. The area under disease progress curve (AUDPC was calculated and submitted to variance analysis and Tukey's test at 5% probability. For the coffee rust, no treatment was significant. Curve progress showed maximum incidences in the months of July and September. There was a significant correlation at 1% probability among all the treatments and climatic variables, with the exception of the maximum temperature. For brown eye spot, the treatments attributed to the plots and to the subplots were significant at 1% of probability. However, the interaction between the two was non-significant. Greater AUDPC in splitting fertilizer 2 and 4 was observed. In the subplots, greater AUDPC in check E following for D was observed. Curve progress showed maximum incidences from May to July. There was a significant correlation of brown eye spot incidence in the majority of the treatments in relation to climatic variables.
International Nuclear Information System (INIS)
Konishi, Hiroyuki; Mizuki, Jun'ichiro; Yamashita, Masato; Uchida, Hitoshi
2005-01-01
The rust layer formed on weathering steel possesses a strong protective ability against corrosives in an atmospheres. This ability is related to the structure of the rust layer. The difference in the protective ability of a rust layer. The difference in the protective ability of a rust layer in a Cl-rich environment between conventional weathering steel containing Cr and advanced weathering steel containing Ni is believed to be caused by the differences in local structural and chemical properties between alloying elements. Cr and Ni, in the rust layer. In order to examine the effect of these alloying elements on the structure of the rust layer formed on steel in a Cl-rich environment, we have performed Cr and Ni K-edge X-ray absorption near-edge structure (XANES) measurements for the rust layer of Fe-Cr and Fe-Ni binary alloys exposed to a Cl-rich atmosphere using synchrotron radiation. The results of the Cr K-edge XANES measurements for the rust layer of Fe-Cr binary alloys show that the atomic geometry around Cr depends on the concentration of Cr. Therefore, it is expected that the local structure around Cr in the rust layer is unstable. On the other hand, from the results of the Ni K-edge XANES measurements for the rust layer of Fe-Ni binary alloys. Ni is considered to be positioned at a specific site in the crystal structure of a constituent of the rust layer, such as akaganeite or magnetite. As a consequence, Ni negligibly interacts with Cl - ions in the rust layer. (author)
Effects of coffee management on deforestation rates and forest integrity.
Hylander, Kristoffer; Nemomissa, Sileshi; Delrue, Josefien; Enkosa, Woldeyohannes
2013-10-01
Knowledge about how forest margins are utilized can be crucial for a general understanding of changes in forest cover, forest structure, and biodiversity across landscapes. We studied forest-agriculture transitions in southwestern Ethiopia and hypothesized that the presence of coffee (Coffea arabica)decreases deforestation rates because of coffee's importance to local economies and its widespread occurrence in forests and forest margins. Using satellite images and elevation data, we compared changes in forest cover over 37 years (1973-2010) across elevations in 2 forest-agriculture mosaic landscapes (1100 km(2) around Bonga and 3000 km(2) in Goma-Gera). In the field in the Bonga area, we determined coffee cover and forest structure in 40 forest margins that differed in time since deforestation. Both the absolute and relative deforestation rates were lower at coffee-growing elevations compared with at higher elevations (-10/20% vs. -40/50% comparing relative rates at 1800 m asl and 2300-2500 m asl, respectively). Within the coffee-growing elevation, the proportion of sites with high coffee cover (>20%) was significantly higher in stable margins (42% of sites that had been in the same location for the entire period) than in recently changed margins (0% of sites where expansion of annual crops had changed the margin). Disturbance level and forest structure did not differ between sites with 30% or 3% coffee. However, a growing body of literature on gradients of coffee management in Ethiopia reports coffee's negative effects on abundances of forest-specialist species. Even if the presence of coffee slows down the conversion of forest to annual-crop agriculture, there is a risk that an intensification of coffee management will still threaten forest biodiversity, including the genetic diversity of wild coffee. Conservation policy for Ethiopian forests thus needs to develop strategies that acknowledge that forests without coffee production may have higher deforestation
7 CFR 319.73-2 - Products prohibited importation.
2010-01-01
... the fungus Hemileia vastatrix (Berkely and Broome), which causes an injurious rust disease, the..., seeds of all kinds when in pulp, including coffee berries or fruits, are prohibited importation into all...
Schubert, Matthew M; Grant, Gary; Horner, Katy; King, Neil; Leveritt, Michael; Sabapathy, Surendran; Desbrow, Ben
2014-12-01
Coffee is one of the most widely consumed beverages in the world and has a number of potential health benefits. Coffee may influence energy expenditure and energy intake, which in turn may affect body weight. However, the influence of coffee and its constituents - particularly caffeine - on appetite remains largely unexplored. The objective of this study was to examine the impact of coffee consumption (with and without caffeine) on appetite sensations, energy intake, gastric emptying, and plasma glucose between breakfast and lunch meals. In a double-blind, randomised crossover design. Participants (n = 12, 9 women; Mean ± SD age and BMI: 26.3 ± 6.3 y and 22.7 ± 2.2 kg•m⁻²) completed 4 trials: placebo (PLA), decaffeinated coffee (DECAF), caffeine (CAF), and caffeine with decaffeinated coffee (COF). Participants were given a standardised breakfast labelled with ¹³C-octanoic acid and 225 mL of treatment beverage and a capsule containing either caffeine or placebo. Two hours later, another 225 mL of the treatment beverage and capsule was administered. Four and a half hours after breakfast, participants were given access to an ad libitum meal for determination of energy intake. Between meals, participants provided exhaled breath samples for determination of gastric emptying; venous blood and appetite sensations. Energy intake was not significantly different between the trials (Means ± SD, p> 0.05; Placebo: 2118 ± 663 kJ; Decaf: 2128 ± 739 kJ; Caffeine: 2287 ± 649 kJ; Coffee: 2016 ± 750 kJ); Other than main effects of time (p appetite sensations or plasma glucose between treatments (p > 0.05). Gastric emptying was not significantly different across trials (p > 0.05). No significant effects of decaffeinated coffee, caffeine or their combination were detected. However, the consumption of caffeine and/or coffee for regulation of energy balance over longer periods of time warrant further
Coffee berry borer in conilon coffee in the Brazilian Cerrado: an ancient pest in a new environment.
Oliveira, C M; Santos, M J; Amabile, R F; Frizzas, M R; Bartholo, G F
2018-02-01
The aim of this study was to verify the occurrence of the coffee berry borer, Hypothenemus hampei (Ferrari), and to evaluate the population fluctuation of the pest in the Brazilian Cerrado (Federal District). The study was conducted, between November 2014 and October 2015, at Embrapa Cerrados (Planaltina/DF, Brazil) in an irrigated conilon coffee production area. In November 2014, 120 samples (ten berries/sample) were collected from berries that had fallen on the ground from the previous harvest. Between November 2014 and October 2015, insects were collected weekly, using traps (polyethylene terephthalate bottles) baited with ethyl alcohol (98 GL), ethyl alcohol (98 GL) with coffee powder, or molasses. Between January and July 2015, samples were collected fortnightly from 92 plants (12 berries per plant). All samples were evaluated for the presence of adult coffee berry borers. Samples from the previous harvest had an attack incidence of 72.4%. The baited traps captured 4062 H. hampei adults, and showed no statistical difference in capture efficiency among the baits. Pest population peaked in the dry season, with the largest percentage of captured adults occurring in July (31.0%). An average of 18.6% of the collected berries was attacked by the borer and the highest percentage incidence was recorded in July (33.2%). Our results suggest that the coffee berry borer, if not properly managed, could constitute a limiting factor for conilon coffee production in the Brazilian Cerrado.