WorldWideScience

Sample records for coffee leaf rust

  1. Incomplete resistance to coffee leaf rust (Hemileia vastatrix)

    NARCIS (Netherlands)

    Eskes, A.B.

    1983-01-01

    Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales

  2. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  3. IPR 107 – Dwarf arabic coffee cultivar with resistance to coffee leaf rust

    Directory of Open Access Journals (Sweden)

    Tumoru Sera

    2013-01-01

    Full Text Available ‘IPR 107’ was derived from a cross between ‘IAPAR 59’ and ‘Mundo Novo IAC 376-4’. ‘IPR 107’ is a dwarf medium sizeplant with medium precocity in ripening and with complete resistance to rust races in this time. This cultivar presents superior qualityand high yield in many coffee regions.

  4. Influence of Environmental Conditions and Genetic Background of Arabica Coffee (C. arabica L) on Leaf Rust (Hemileia vastatrix) Pathogenesis.

    Science.gov (United States)

    Toniutti, Lucile; Breitler, Jean-Christophe; Etienne, Hervé; Campa, Claudine; Doulbeau, Sylvie; Urban, Laurent; Lambot, Charles; Pinilla, Juan-Carlos H; Bertrand, Benoît

    2017-01-01

    Global warming is a major threat to agriculture worldwide. Between 2008 and 2013, some coffee producing countries in South and Central America suffered from severe epidemics of coffee leaf rust (CLR), resulting in high economic losses with social implications for coffee growers. The climatic events not only favored the development of the pathogen but also affected the physiological status of the coffee plant. The main objectives of the study were to evaluate how the physiological status of the coffee plant modified by different environmental conditions impact on the pathogenesis of CLR and to identify indicators of the physiological status able to predict rust incidence. Three rust susceptible genotypes (one inbred line and two hybrids) were grown in controlled conditions with a combination of thermal regime (TR), nitrogen and light intensity close to the field situation before being inoculated with the rust fungus Hemileia vastatrix . It has been demonstrated that a TR of 27-22°C resulted in 2000 times higher sporulation than with a TR of 23-18°C. It has been also shown that high light intensity combined with low nitrogen fertilization modified the CLR pathogenesis resulting in huge sporulation. CLR sporulation was significantly lower in the F1 hybrids than in the inbred line. The hybrid vigor may have reduced disease incidence. Among the many parameters studied, parameters related to photosystem II and photosynthetic electron transport chain components appeared as indicators of the physiological status of the coffee plant able to predict rust sporulation intensity. Taken together, these results show that CLR sporulation not only depends on the TR but also on the physiological status of the coffee plant, which itself depends on agronomic conditions. Our work suggests that vigorous varieties combined with a shaded system and appropriate nitrogen fertilization should be part of an agro-ecological approach to disease control.

  5. Modelling coffee leaf rust risk in Colombia with climate reanalysis data.

    Science.gov (United States)

    Bebber, Daniel P; Castillo, Ángela Delgado; Gurr, Sarah J

    2016-12-05

    Many fungal plant diseases are strongly controlled by weather, and global climate change is thus likely to have affected fungal pathogen distributions and impacts. Modelling the response of plant diseases to climate change is hampered by the difficulty of estimating pathogen-relevant microclimatic variables from standard meteorological data. The availability of increasingly sophisticated high-resolution climate reanalyses may help overcome this challenge. We illustrate the use of climate reanalyses by testing the hypothesis that climate change increased the likelihood of the 2008-2011 outbreak of Coffee Leaf Rust (CLR, Hemileia vastatrix) in Colombia. We develop a model of germination and infection risk, and drive this model using estimates of leaf wetness duration and canopy temperature from the Japanese 55-Year Reanalysis (JRA-55). We model germination and infection as Weibull functions with different temperature optima, based upon existing experimental data. We find no evidence for an overall trend in disease risk in coffee-growing regions of Colombia from 1990 to 2015, therefore, we reject the climate change hypothesis. There was a significant elevation in predicted CLR infection risk from 2008 to 2011 compared with other years. JRA-55 data suggest a decrease in canopy surface water after 2008, which may have helped terminate the outbreak. The spatial resolution and accuracy of climate reanalyses are continually improving, increasing their utility for biological modelling. Confronting disease models with data requires not only accurate climate data, but also disease observations at high spatio-temporal resolution. Investment in monitoring, storage and accessibility of plant disease observation data are needed to match the quality of the climate data now available.This article is part of the themed issue 'Tackling emerging fungal threats to animal health, food security and ecosystem resilience'. © 2016 The Authors.

  6. Smallholder Food and Water Security in the Face of Climatic Stress and the Coffee Leaf Rust: Lessons from Nicaragua

    Science.gov (United States)

    Stewart, I. T.; Bacon, C. M.; Sundstrom, W.

    2015-12-01

    Smallholder farmers in Nicaragua and throughout much of Central America preserve forest biodiversity and contribute to the sustainable production of coffee and other crops while, paradoxically, they themselves must cope with recurring periods of seasonal hunger. Smallholder food and water security in the region is affected by hurricanes, periodic drought events, climatic changes, an on-going outbreak of the coffee leaf rust, and fluctuations in food prices. Using regression analysis, our research examines what factors strengthened resilience to these hazards at the household level over the 1981 - 2014 time period. To this end, we integrate qualitative research on coping responses and local institutions, a participatory survey of 368 households, and an analysis of hydro-climatic data. Our results indicate that coping responses to the coffee leaf rust outbreak and the 2014 drought are comparable in severity to those used to endure Hurricane Mitch in 1998, and a severe 2009 drought. Higher smallholder resilience to stresses affecting food and water security is associated with larger farms, off-farm employment, more on-farm food production, higher numbers of fruit trees, and greater coffee harvests. Households that reported more severe coping responses to hazards earlier in the study period tended to be more strongly impacted by later hazards and reported generally greater seasonal hunger. Affiliation with local farmer-to-farmer institutions prioritizing either subsistence-oriented production or sales to international fair-trade markets did not correlate strongly with coping responses; however, subsistence-oriented institutions promote several resilience-enhancing practices. Lessons learned by adapting to past hazards may be used to develop adaptation and mitigation strategies for smallholders under continued climate variability and change.

  7. Impact of Regionally Distinct Agroecosystem Communities on the Potential for Autonomous Control of the Coffee Leaf Rust.

    Science.gov (United States)

    Hajian-Forooshani, Zachary; Rivera Salinas, Iris Saraeny; Jiménez-Soto, Estelí; Perfecto, Ivette; Vandermeer, John

    2016-12-01

    Recent theoretical work suggests that two ineffective control agents can provide effective biological control when coupled together. We explore the implications of this work with the system of coffee leaf rust (CLR), caused by the fungal agent Hemileiae vastatrix, and two of its natural enemies, a fungal pathogen (Lecanicillium lecanii) and a spore predator (Mycodiplosis hemileiae). Here we report on comparative surveys of the CLR and its two natural enemies in Mexico, where the CLR has been at epidemic status since 2012, and Puerto Rico, where the CLR is present but has not reached epidemic densities. We found that the densities of the two control agents per CLR lesion is higher in Puerto Rico than in Mexico, and we hypothesize that their joint presence at higher densities is contributing to the suppression of the CLR in Puerto Rico but not in Mexico. Furthermore, we found that the presence of Azteca sericeasur, a keystone ant species that occurs in Mexico but not Puerto Rico, significantly reduces the prevalence of M. hemileiae on coffee plants. Our work provides data that allows us to hypothesize that the joint presence of these two control agents may potentially provide control of the CLR and also highlights the importance of regionally specific communities within agroecosystems, and how variation in community composition may lead to varying outcomes for biological control. Additionally, this is the first report of the presence of a potentially important biological control agent, M. hemileiae, in Latin America and the Caribbean. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Overview of the functional virulent genome of the coffee leaf rust pathogen Hemileia vastatrix with an emphasis on early stages of infection

    Directory of Open Access Journals (Sweden)

    Pedro eTalhinhas

    2014-03-01

    Full Text Available Hemileia vastatrix is the causal agent of coffee leaf rust, the most important disease of coffee (Coffea arabica. In this work, a 454-pyrosequencing transcriptome analysis of H. vastatrix germinating urediniospores (gU and appressoria (Ap was performed and compared to previously published in planta haustoria-rich (H data. A total of 9234 transcripts were identified and annotated. Ca. 50% of these transcripts showed no significant homology to international databases. Only 784 sequences were shared by the three conditions, and 75% were exclusive of either gU (2146, Ap (1479 or H (3270. Relative transcript abundance and RT-qPCR analyses for a selection of genes indicated a particularly active metabolism, translational activity and production of new structures in the appressoria and intense signalling, transport, secretory activity and cellular multiplication in the germinating urediniospores, suggesting the onset of a plant-fungus dialogue as early as at the germ tube stage. Gene expression related to the production of carbohydrate-active enzymes and accumulation of glycerol in germinating urediniospores and appressoria suggests that combined lytic and physical mechanisms are involved in appressoria-mediated penetration. Besides contributing to the characterisation of molecular processes leading to appressoria-mediated infection by rust fungi, these results point towards the identification of new H. vastatrix candidate virulence factors, with 516 genes predicted to encode secreted proteins.

  9. SEASONALITY OF THE LEAF MINER, LEVEL OF PREDATION AND TEMPORAL OCCURRENCE OF RUST CORRELATED TO ABIOTIC FACTORS

    OpenAIRE

    B. M. R. Melo; F. B. S. Botelho; J. S. M. Silva; D. F. F. Lima; E. R. Moreira

    2018-01-01

    The coffee leaf miner and a rust are considered as major diseases that are able to reduce productivity in coffee plantations. These agents are influenced by abiotic factors, and their occurrence may suffer oscillation over the years. The objective of this study was to evaluate the seasonal fluctuation of the coffee leaf miner, incidence of coffee prediction and rust, correlated with abiotic factors. The study was performed IFSULDEMINAS-Campus Inconfidentes, in a coffee crop of the cultivar Ru...

  10. Climate change impacts on coffee rust disease

    Science.gov (United States)

    Alfonsi, W. M. V.; Koga-Vicente, A.; Pinto, H. S.; Alfonsi, E. L., Sr.; Coltri, P. P.; Zullo, J., Jr.; Patricio, F. R.; Avila, A. M. H. D.; Gonçalves, R. R. D. V.

    2016-12-01

    Changes in climate conditions and in extreme weather events may affect the food security due to impacts in agricultural production. Despite several researches have been assessed the impacts of extremes in yield crops in climate change scenarios, there is the need to consider the effects in pests and diseases which increase losses in the sector. Coffee Arabica is an important commodity in world and plays a key role in Brazilian agricultural exports. Although the coffee crop has a world highlight, its yield is affected by several factors abiotic or biotic. The weather as well pests and diseases directly influence the development and coffee crop yield. These problems may cause serious damage with significant economic impacts. The coffee rust, caused by the fungus Hemileia vastarix,is among the diseases of greatest impact for the crop. The disease emerged in Brazil in the 70s and is widely spread in all producing regions of coffee in Brazil, and in the world. Regions with favorable weather conditions for the pathogen may exhibit losses ranging from 30% to 50% of the total grain production. The evaluation of extreme weather events of coffee rust disease in futures scenarios was carried out using the climatic data from CMIP5 models, data field of coffee rust disease incidence and, incubation period simulation data for Brazilian municipalities. Two Regional Climate Models were selected, Eta-HadGEM2-ES and Eta-MIROC5, and the Representative Concentration Pathways 8.5 w/m2 was adopted. The outcomes pointed out that in these scenarios the period of incubation tends to decrease affecting the coffee rust disease incidence, which tends to increase. Nevertheless, the changing in average trends tends to benefit the reproduction of the pathogen. Once the temperature threshold for the disease reaches the adverse conditions it may be unfavorable for the incidence.

  11. Flutuação populacional do bicho-mineiro em cultivares de café arábica resistentes à ferrugem Fluctuation of leaf miner population in resistant arabica coffee cultivars to leaf rust

    Directory of Open Access Journals (Sweden)

    Celso Henrique Costa Conceição

    2005-01-01

    Full Text Available A intensidade de infestação pelo bicho-mineiro, Leucoptera coffeella (Guérin-Méneville (Lepidoptera: Lyonetiidae foi investigada nas cultivares Obatã IAC 1669-20 e Tupi IAC 1669-33, com resistência à ferrugem das folhas do cafeeiro, Hemileia vastatrix Berk. et Br., e Ouro Verde Amarelo IAC 4397, suscetível à doença, em ensaios de campo, localizados em Campinas (SP, Brasil. A incidência de ferrugem e a ocorrência de inimigos naturais da praga, assim como o enfolhamento das plantas, foram também observados nas três cultivares. As curvas de flutuação populacional obtidas para Obatã IAC 1669-20 e Tupi IAC 1669-33 revelaram maior incidência do bicho-mineiro entre abril e novembro. Já na cultivar Ouro Verde Amarelo IAC 4397, observaram-se dois picos de infestação, sendo o primeiro em abril-maio e o segundo em agosto-setembro. No entanto, a elevada percentagem de folhas minadas nas cultivares Tupi IAC 1669-33 e Obatã IAC 1669-20 em relação à Ouro Verde Amarelo IAC 4397 não é evidência de maior suscetibilidade à praga, mas sim devido à maior retenção foliar dessas cultivares, em conseqüência da resistência à ferrugem das folhas observada em ambas. De maneira oposta, na cultivar Ouro Verde Amarelo IAC 4397, os sintomas de ataque do bicho-mineiro ocorreram em menor nível especialmente devido a maior queda de folhas. Com base nas diferenças observadas entre as cultivares, sugere-se a adoção de estratégias distintas de manejo da praga.The intensity of infestation of leaf-miner, Leucoptera coffeella (Guérin-Méneville was investigated in coffee cultivars Obatã IAC 1669-20 and Tupi IAC 1669-33, both resistant to the leaf rust agent, Hemileia vastatrix Berk. et Br., and Ouro Verde Amarelo IAC 4397, susceptible to this coffee disease, at field assays in Campinas, SP, Brazil. The incidence of coffee rust and presence of natural enemies, as well as the plant leafiness, were also observed. In Obatã IAC 1669-20 and Tupi

  12. The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.

    Science.gov (United States)

    McCook, Stuart; Vandermeer, John

    2015-09-01

    Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.

  13. Bioprospecting endophytic bacteria for biological control of coffee leaf rust Bioprospecção de bactérias endofíticas como agentes de biocontrole da ferrugem do cafeeiro

    Directory of Open Access Journals (Sweden)

    Humberto Franco Shiomi

    2006-02-01

    Full Text Available Suppression of plant diseases due to the action of endophytic microorganisms has been demonstrated in several pathosystems. Experiments under controlled conditions involving endophytic bacteria isolated from leaves and branches of Coffea arabica L and Coffea robusta L were conducted with the objective of evaluating the inhibition of germination of Hemileia vastatrix Berk. & Br., race II, urediniospores and the control of coffee leaf rust development in tests with leaf discs, detached leaves, and on potted seedling of cv. Mundo Novo. The endophytic bacterial isolates tested proved to be effective in inhibiting urediniospore germination and/or rust development, with values above 50%, although the results obtained in urediniospore germination tests were inferior to the treatment with fungicide propiconazole. Endophytic isolates TG4-Ia, TF2-IIc, TF9-Ia, TG11-IIa, and TF7-IIa, demonstrated better coffee leaf rust control in leaf discs, detached leaves, and coffee plant tests. The endophytic isolates TG4-Ia and TF9-Ia were identified as Bacillus lentimorbus Dutky and Bacillus cereus Frank. & Frank., respectively. Some endophytic bacterial isolates were effective in controlling the coffee leaf rust, although some increased the severity of the disease. Even though a relatively small number of endophytic bacteria were tested, promising results were obtained regarding the efficiency of coffee leaf rust biocontrol. These selected agents appears to be an alternative for future replacement of chemical fungicide.Supressão de doenças de plantas por microrganismos endofíticos tem sido demonstrada em diversos patossistemas. Neste trabalho foram selecionados isolados de bactérias endofíticas de folhas e ramos de cafeeiro com potencial para o controle biológico da ferrugem do cafeeiro, pois é conhecido que esses microrganismos podem possuir essa característica. Bactérias endofíticas isoladas previamente de folhas e ramos de Coffea arabica L e Coffea

  14. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Weather and Climate Indicators for Coffee Rust Disease

    Science.gov (United States)

    Georgiou, S.; Imbach, P. A.; Avelino, J.; Anzueto, F.; del Carmen Calderón, G.

    2014-12-01

    Coffee rust is a disease that has significant impacts on the livelihoods of those who are dependent on the Central American coffee sector. Our investigation has focussed on the weather and climate indicators that favoured the high incidence of coffee rust disease in Central America in 2012 by assessing daily temperature and precipitation data available from 81 weather stations in the INSIVUMEH and ANACAFE networks located in Guatemala. The temperature data were interpolated to determine the corresponding daily data at 1250 farms located across Guatemala, between 400 and 1800 m elevation. Additionally, CHIRPS five day (pentad) data has been used to assess the anomalies between the 2012 and the climatological average precipitation data at farm locations. The weather conditions in 2012 displayed considerable variations from the climatological data. In general the minimum daily temperatures were higher than the corresponding climatology while the maximum temperatures were lower. As a result, the daily diurnal temperature range was generally lower than the corresponding climatological range, leading to an increased number of days where the temperatures fell within the optimal range for either influencing the susceptibility of the coffee plants to coffee rust development during the dry season, or for the development of lesions on the coffee leaves during the wet season. The coffee rust latency period was probably shortened as a result, and farms at high altitudes were impacted due to these increases in minimum temperature. Factors taken into consideration in developing indicators for coffee rust development include: the diurnal temperature range, altitude, the environmental lapse rate and the phenology. We will present the results of our study and discuss the potential for each of the derived weather and climatological indicators to be used within risk assessments and to eventually be considered for use within an early warning system for coffee rust disease.

  16. SEASONALITY OF THE LEAF MINER, LEVEL OF PREDATION AND TEMPORAL OCCURRENCE OF RUST CORRELATED TO ABIOTIC FACTORS

    Directory of Open Access Journals (Sweden)

    B. M. R. Melo

    2018-04-01

    Full Text Available The coffee leaf miner and a rust are considered as major diseases that are able to reduce productivity in coffee plantations. These agents are influenced by abiotic factors, and their occurrence may suffer oscillation over the years. The objective of this study was to evaluate the seasonal fluctuation of the coffee leaf miner, incidence of coffee prediction and rust, correlated with abiotic factors. The study was performed IFSULDEMINAS-Campus Inconfidentes, in a coffee crop of the cultivar Rubi. A sample for a rust and a coffee leaf miner, in addition to the middle and upper third of the plants, totaling 42 plants in the study area. At the same sampling point, perform soil analysis to correlate nutrients as studied variables. The Pearson correlation of the biotic variables was performed with a precipitation and fertility, a rate of 1 and 5% probability. It was verified that the rust cycle alternated its incidence for the same period in different years and the miner showed behavior coincident to the driest periods of the year. Data not available on precipitation data and number of mines. These diseases had no significant correlation with the fertility parameter. The coffee leaf miner yielded higher rates of occurrence in June and December of 2014. It was concluded that the percentage of coffee leaf miner was higher in the months with lower rainfall indices or no longer summer period; What is it you want to know about the one-time development that may have been influenced by the nearby woods under study and the rust alternated the peaks of occurrence for the two autumners, correlating with a precipitation.

  17. Herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro Inheritance of coffee leaf rust resistance in Timor Hybrid UFV 443-03

    Directory of Open Access Journals (Sweden)

    Alexandre Sandri Capucho

    2009-03-01

    Full Text Available O objetivo deste trabalho foi caracterizar a herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro (Hemileia vastatrix. Para isso, a raça II e o patótipo 001 de ferrugem foram inoculados em 246 plantas da população F2, 115 plantas do retrocruzamento suscetível (RC S e 87 plantas do retrocruzamento resistente (RC R, originadas do cruzamento entre o genótipo suscetível cv. Catuaí Amarelo IAC 64 e a fonte de resistência Híbrido de Timor UFV 443-03. Para ambos os inóculos, a cv. Catuaí Amarelo IAC 64 foi suscetível, enquanto o Híbrido de Timor UFV 443-03, a planta representante da geração F1 e as plantas do RC R foram resistentes. As plantas F2, quando inoculadas com a raça II, apresentaram dois padrões de segregação significativos: 15:1 e 61:3. A herança da resistência foi confirmada pela inoculação das plantas do RC S, que segregaram na proporção de 3:1, padrão esperado para herança condicionada por dois genes. A hipótese de segregação 7:1 para três genes foi rejeitada. Resultados semelhantes foram obtidos para o patótipo 001. Dois genes dominantes e independentes conferem a resistência genética do Híbrido de Timor UFV 443-03 à raça II e ao patótipo 001 de H. vastatrix.The aim of this work was to characterize the resistance inheritance of the Timor Hybrid UFV 443-03 to coffee leaf rust (Hemileia vastatrix. For this, the race II and pathotype 001 of coffee leaf rust were inoculated in 246 F2 plants, 115 susceptible backcrossing (BCS plants, and 87 resistant backcrossing (BC R plants, derived from the crossing between the susceptible genotype 'Catuaí Amarelo' IAC 64 and the resistance source Timor Hybrid UFV 443-03. For both inoculums, the 'Catuaí Amarelo' IAC 64 was susceptible, while the Timor Hybrid, the plant representing F1 generation, and the BC R plants were resistant. The F2 plants inoculated with race II presented two significant segregation ratios: 15:1 and 61:3. The

  18. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes

    Science.gov (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  19. Effectiveness of carboxylic acids from Pichia membranifaciens against coffee rust

    Directory of Open Access Journals (Sweden)

    Rosa Laura Andrade Melchor

    Full Text Available ABSTRACT Coffee rust is a fungal disease that has affected every coffee-producing region in the world. Given that the effectivity of the protectant and systemic fungicides applied routinely to control the spread of the causative agent of the disease (Hemileia vastatrix has gradually diminished, besides are harmful to mammals and ecosystems, the objective of this work was to search for a mixture of harmless natural compounds with the potential to be applied in the field. So, a yeast strain producing a battery of long-chain carboxylic acids (CA with fungicide properties was isolated from soil of coffee crop and identified as Pichia membranifaciens by ITS sequencing. Culture conditions of the yeast were optimized and the CA in the solution were characterized by Gas Chromatography-Mass Spectrometry (GC-MS as ethyl formate (55.5 g L-1, octadecenoic acid (3.5 g L-1, propionic acid (7.2 g L-1, 3-(octadecanoyl-propionic acid (7.2 g L-1 and methyl acetate (8.4 g L-1. Randomized field studies were conducted in three different locations in Chiapas, México. Five treatments were tested including three concentrations of the CA solution (389, 584 and 778 ppm and copper oxychloride (5 000 ppm as conventional control. The initial coffee rust incidence averages varied between sites: Maravillas (3-9%, Santo Domingo (10-16% and Búcaro (16-22%. The treatments of CA solution proved to be effective at slowing down the progress of the rust disease even for the sites where initial incidence was high. Likewise, the CA solution reduced the viability of H. vastatrix spores, as assessed by fluorescence microscopy.

  20. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes.

    Science.gov (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis

    2017-12-01

    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  1. Leaf and stripe rust resistance among Ethiopian grown wheat ...

    African Journals Online (AJOL)

    The result indicated that 20 varieties and lines harbor resistance to the leaf rust and 26 to the stripe rust pathotypes showing infection types <2+. Twelve bread wheat varieties and lines (Et-13 A2, HAR 1407 [Tusie], HAR 1775 [Tura], HAR 1920, HAR 2192, HAR 2534, HAR 2536, HAR 2561, HAR 2563 and three durum lines ...

  2. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  3. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh

    2017-12-08

    Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.

  4. Leaf rust of cultivated barley: pathology and control.

    Science.gov (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder

    2015-01-01

    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  5. Induced mutations for resistance to leaf rust in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.

    1983-01-01

    Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)

  6. Studies on stem and leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1983-01-01

    Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)

  7. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...

  8. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  9. Stripe rust and leaf rust resistance QTL mapping, epistatic interactions, and co-localization with stem rust resistance loci in spring wheat evaluated over three continents.

    Science.gov (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S

    2014-11-01

    In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and

  10. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.

    2015-01-01

    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  11. Slow rusting response of different wheat genotypes against the leaf rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Khan, M.A.; Haider, M.M.; Hussain, M.; Ahmad, S.

    2007-01-01

    Wheat genotypes were screened against leaf rust to evaluate slow rusting response. Among one hundred and sixty varieties/lines, 86 showed response to leaf rust while all other remained immune or showed no response. The slow rusting, wheat varieties/ lines displayed 20-40% severity level and these were Maxi-Pak65, Blue silver, Pothohar, Punjab81, Faisalabd-83, Shalimar-88, Kohnoor-83, Pasban-90, Inqilab-91, Uqab-99-94105, Punjab-76, Parwaz-94, HD2169, HD2179, HD2204, HD2285, Lr27+31, LrB, LR17, Lr14A, Lr15 and Yr1-E-1 while the fast rusting varieties/lines that showed severity level up to 90% were WL-711, Morocco, PAK-1, Punjab-85 and Chakwal-86 SA42, SA75, Lr1, Lr2A, Lr2B. Lr23, Lr3KA, Lr3g, Lr10, Lr18, Lr21, Lr24, Yr2-E35 and 95153 respectively. Slow rusting genotypes exhibited low AUDPC (200-400) values while fast rusters displayed high AUDPC (400-1500) values. Leaf rust severity displayed significant correlation with maximum and minimum temperatures, rainfall and sunshine radiation. It was observed that with an increase of these environmental conditions a significant increase in disease severity was recorded

  12. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster

    Science.gov (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  13. Leaf-associated bacterial microbiota of coffee and its correlation with manganese and calcium levels on leaves

    Directory of Open Access Journals (Sweden)

    Leandro Pio de Sousa

    2018-05-01

    Full Text Available Abstract Coffee is one of the most valuable agricultural commodities and the plants’ leaves are the primary site of infection for most coffee diseases, such as the devastating coffee leaf rust. Therefore, the use of bacterial microbiota that inhabits coffee leaves to fight infections could be an alternative agricultural method to protect against coffee diseases. Here, we report the leaf-associated bacteria in three coffee genotypes over the course of a year, with the aim to determine the diversity of bacterial microbiota. The results indicate a prevalence of Enterobacteriales in Coffea canephora, Pseudomonadales in C. arabica ‘Obatã’, and an intriguing lack of bacterial dominance in C. arabica ‘Catuaí’. Using PERMANOVA analyses, we assessed the association between bacterial abundance in the coffee genotypes and environmental parameters such as temperature, precipitation, and mineral nutrients in the leaves. We detected a close relationship between the amount of Mn and the abundance of Pseudomonadales in ‘Obatã’ and the amount of Ca and the abundance of Enterobacteriales in C. canephora. We suggest that mineral nutrients can be key drivers that shape leaf microbial communities.

  14. Leaf-associated bacterial microbiota of coffee and its correlation with manganese and calcium levels on leaves.

    Science.gov (United States)

    de Sousa, Leandro Pio de; da Silva, Marcio José da; Mondego, Jorge Maurício

    2018-05-17

    Coffee is one of the most valuable agricultural commodities and the plants' leaves are the primary site of infection for most coffee diseases, such as the devastating coffee leaf rust. Therefore, the use of bacterial microbiota that inhabits coffee leaves to fight infections could be an alternative agricultural method to protect against coffee diseases. Here, we report the leaf-associated bacteria in three coffee genotypes over the course of a year, with the aim to determine the diversity of bacterial microbiota. The results indicate a prevalence of Enterobacteriales in Coffea canephora, Pseudomonadales in C. arabica 'Obatã', and an intriguing lack of bacterial dominance in C. arabica 'Catuaí'. Using PERMANOVA analyses, we assessed the association between bacterial abundance in the coffee genotypes and environmental parameters such as temperature, precipitation, and mineral nutrients in the leaves. We detected a close relationship between the amount of Mn and the abundance of Pseudomonadales in 'Obatã' and the amount of Ca and the abundance of Enterobacteriales in C. canephora. We suggest that mineral nutrients can be key drivers that shape leaf microbial communities.

  15. Annotation of a hybrid partial genome of the Coffee Rust (Hemileia vastatrix contributes to the gene repertoire catalogue of the Pucciniales

    Directory of Open Access Journals (Sweden)

    Marco Aurelio Cristancho

    2014-10-01

    Full Text Available Coffee leaf rust caused by the fungus Hemileia vastatrix is the most damaging disease to coffee worldwide. The pathogen has recently appeared in multiple outbreaks in coffee producing countries resulting in significant yield losses and increases in costs related to its control. New races/isolates are constantly emerging as evidenced by the presence of the fungus in plants that were previously resistant. Genomic studies are opening new avenues for the study of the evolution of pathogens, the detailed description of plant-pathogen interactions and the development of molecular techniques for the identification of individual isolates. For this purpose we sequenced 8 different H. vastatrix isolates using NGS technologies and gathered partial genome assemblies due to the large repetitive content in the coffee rust hybrid genome; 74.4% of the assembled contigs harbor repetitive sequences. A hybrid assembly of 333Mb was built based on the 8 isolates; this assembly was used for subsequent analyses.Analysis of the conserved gene space showed that the hybrid H. vastatrix genome, though highly fragmented, had a satisfactory level of completion with 91.94% of core protein-coding orthologous genes present. RNA-Seq from urediniospores was used to guide the de novo annotation of the H. vastatrix gene complement. In total, 14,445 genes organized in 3,921 families were uncovered; a considerable proportion of the predicted proteins (73.8% were homologous to other Pucciniales species genomes. Several gene families related to the fungal lifestyle were identified, particularly 483 predicted secreted proteins that represent candidate effector genes and will provide interesting hints to decipher virulence in the coffee rust fungus. The genome sequence of Hva will serve as a template to understand the molecular mechanisms used by this fungus to attack the coffee plant, to study the diversity of this species and for the development of molecular markers to distinguish

  16. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.

    Science.gov (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A

    2014-08-01

    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  17. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM).

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  18. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM)

    Science.gov (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus

    2018-01-01

    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232

  19. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei and leaf rust (Puccinia hordei in barley using nested association mapping (NAM.

    Directory of Open Access Journals (Sweden)

    Thomas Vatter

    Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  20. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  1. Plant-pathogen interactions: leaf physiology alterations in poplars infected with rust (Melampsora medusae).

    Science.gov (United States)

    Gortari, Fermín; Guiamet, Juan José; Graciano, Corina

    2018-01-23

    Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  3. Spatial distribution of the coffee-leaf-miner (Leucoptera coffeella) in an organic coffee (Coffea arabica L.) field in formation

    OpenAIRE

    Scalon, João Domingos; Universidade Federal de Lavras; Freitas, Gabriela Alves; DEX/UFLA; Avelar, Maria Betania Lopes; DEX/UFLA; Zacarias, Mauricio Sérgio; EPAMIG/EcoCentro

    2011-01-01

    Coffee production has been one of the economy pillars of many tropical countries. Unfortunately, this crop is susceptible to infestation by the coffee-leaf-miner (Leucoptera coffeella (Guérin-Mèneville & Perrottet, 1842)) which causes severe damage to coffee plantations with losses that may reach 80% of the total production. In recent years, researchers have been trying to develop practices for minimizing the use of pesticides in the coffee-leaf-miner control. It is well known that the un...

  4. LEAF WHORL INOCULATION METHOD FOR SCREENING SUGARCANE RUST RESISTANCE

    Science.gov (United States)

    Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...

  5. Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J

    2014-06-01

    Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.

  6. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

    Science.gov (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

    2014-09-01

    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  7. Genome-Wide Association Mapping of Leaf Rust Response in a Durum Wheat Worldwide Germplasm Collection.

    Science.gov (United States)

    Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis

    2016-11-01

    Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.

  8. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  9. Adult plant leaf rust resistance derived from Toropi wheat is conditioned by Lr78 and three minor QTL

    Science.gov (United States)

    Brazil, was noted to have long lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat...

  10. Localising QTLs for leaf rust resistance and agronomic traits in barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Kicherer, S.; Backes, G.; Walther, U.

    2000-01-01

    to leaf rust by means of artificial infection, heading date, plant height and Kernel weight were assessed. For leaf rust resistance, 4 QTLs were localised, that explained 96.1% of the genetic variation. One QTL on chromosome 4H confirmed a position found in another genetic background and one mapped...

  11. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method

    Science.gov (United States)

    Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464

  12. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method.

    Science.gov (United States)

    Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang

    2016-01-01

    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  13. Ricoseius loxocheles (Acari: Phytoseiidae) is not a predator of false spider mite on coffee crops: What does it eat?

    Science.gov (United States)

    Vacacela Ajila, Henry E; Ferreira, João A M; Colares, Felipe; Oliveira, Cleber M; Bernardo, Ana Maria G; Venzon, Madelaine; Pallini, Angelo

    2018-01-01

    Ricoseius loxocheles (De Leon) (Acari: Phytoseiidae) is often found in coffee crops and is known to feed on coffee leaf rust, Hemileia vastatrix Berkeley and Broome (Uredinales). As the occurrence of coffee leaf rust is limited primarily to the rainy season, the mite may use other food sources to survive during the periods of low pathogen prevalence. It is well known that phytoseiid mites can survive on a variety of food sources, such as herbivorous mites, fungi and pollen. We evaluated the ability of R. loxocheles to survive and reproduce on a diet of Brevipalpus phoenicis Geijskes (Acari: Tenuipalpidae), cattail pollen (Typha spp.), clover rust (Puccinia oxalidis), bee pollen (Santa Bárbara ® dehydrated pollen, Santa Bárbara, MG, Brazil) and coffee leaf rust. Ricoseius loxocheles did not survive or reproduce on any B. phoenicis stages tested (egg, larva, adult). The survival and oviposition of R. loxocheles were directly affected by the presence of coffee rust urediniospores, but not by the presence of the prey. Survival and oviposition of the phytoseiid were similar when fed cattail pollen, clover rust and coffee leaf rust but was lower when fed bee pollen. Our results show that R. loxocheles is not a predator of B. phoenicis but it is able to utilize other resources besides coffee leaf rust.

  14. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL.

    Science.gov (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S

    2018-02-01

    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  15. First report of leaf rust of blueberry caused by Thekopsora minima in Mexico

    Science.gov (United States)

    Blueberry (Vaccinium corymbosum L.) is becoming an important crop in the states of Jalisco and Michoacan in Mexico. As the area under blueberry cultivation increases, new diseases causing severe losses are appearing. Leaf rust is one of the most destructive diseases of blueberry in Mexico. Sori on t...

  16. Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat

    NARCIS (Netherlands)

    Anker, C.C.

    2001-01-01

    In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the

  17. Comparison of multi- and hyperspectral imaging data of leaf rust infected wheat plants

    Science.gov (United States)

    Franke, Jonas; Menz, Gunter; Oerke, Erich-Christian; Rascher, Uwe

    2005-10-01

    In the context of precision agriculture, several recent studies have focused on detecting crop stress caused by pathogenic fungi. For this purpose, several sensor systems have been used to develop in-field-detection systems or to test possible applications of remote sensing. The objective of this research was to evaluate the potential of different sensor systems for multitemporal monitoring of leaf rust (puccinia recondita) infected wheat crops, with the aim of early detection of infected stands. A comparison between a hyperspectral (120 spectral bands) and a multispectral (3 spectral bands) imaging system shows the benefits and limitations of each approach. Reflectance data of leaf rust infected and fungicide treated control wheat stand boxes (1sqm each) were collected before and until 17 days after inoculation. Plants were grown under controlled conditions in the greenhouse and measurements were taken under consistent illumination conditions. The results of mixture tuned matched filtering analysis showed the suitability of hyperspectral data for early discrimination of leaf rust infected wheat crops due to their higher spectral sensitivity. Five days after inoculation leaf rust infected leaves were detected, although only slight visual symptoms appeared. A clear discrimination between infected and control stands was possible. Multispectral data showed a higher sensitivity to external factors like illumination conditions, causing poor classification accuracy. Nevertheless, if these factors could get under control, even multispectral data may serve a good indicator for infection severity.

  18. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    Selection G12 carries a new gene for leaf rust resistance, tentatively named as LrSelG12. [Singh A. K. ..... long arm of chromosome 3B were found to be polymor- phic between ... due to the evolution of new virulent races in India (Tomar et al.

  19. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    AMIT KUMAR SINGH

    seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single ... closely or distantly related species of wheat (McIntosh et al. 2013 ... An effort was also made to determine the chromo- ... Materials and methods.

  20. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen, Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant stages.

  1. Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

    Indian Academy of Sciences (India)

    2017-03-20

    Mar 20, 2017 ... resistance genes Lr19 and Lr24 using marker assisted foreground .... is linked with stem rust resistance gene Sr24(McIntosh et al. 1976). .... Received 29 July 2016, in final revised form 3 March 2017; accepted 16 March 2017.

  2. Molecular Cytogenetic Characterization of two Triticum-Secale-Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99.

    Science.gov (United States)

    Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin

    2017-01-01

    Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  3. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata.

    Science.gov (United States)

    Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P

    2015-03-01

    Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.

  4. Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust

    International Nuclear Information System (INIS)

    Kiraly, Z.; Barabas, Z.

    1983-01-01

    Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)

  5. Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Chopra, V.L.; Sawhney, R.N.; Kumar, R.

    1983-01-01

    A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)

  6. McGISH identification and phenotypic description of leaf rust and yellow rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic hybrid cross.

    Science.gov (United States)

    Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta

    2016-11-01

    A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.

  7. Crop protection strategies for major diseases of cocoa, coffee and ...

    African Journals Online (AJOL)

    In Nigeria, crop protection measures that are cheap, simple, cost-effective and sustainable are desirable to combat Phytophthora pod rot (black pod) and cocoa swollen shoot virus diseases of cocoa, coffee leaf rust and coffee berry diseases, inflorescence blight disease of cashew in order to make farming profitable and ...

  8. OCCURRENCE IN THE SOIL AND DISPERSAL OF Lecanicillium lecanii, A FUNGAL PATHOGEN OF THE GREEN COFFEE SCALE (Coccus viridis AND COFFEE RUST (Hemileia vastatrix

    Directory of Open Access Journals (Sweden)

    Doug William Jackson

    2012-08-01

    Full Text Available The fungus Lecanicillium lecanii attacks the green scale (Coccus viridis, a pest of coffee, and is also a hyperparasite of coffee rust (Hemileia vastatrix. Knowledge of the epizootiology of this fungus is potentially important for conservation biological control in coffee agroecosystems. The presence of viable propagules of L. lecanii in the soil, a possible environmental reservoir, was assessed using two baiting methods: the standard Galleria mellonella bait method and a C. viridis bait method. Infectious propagules of L. lecanii were detected in soil samples taken from a 45 ha study plot, both nearby and far from recent epizootics of L. lecanii. To test the potential for the transmission of L. lecanii conidia from the soil via rain splash or wind, coffee seedlings with populations of C. viridis were placed near L. lecanii-inoculated soil and then subjected to artificial rain and wind treatments. Rain splash was shown to be a potential transmission mechanism. Dispersal of L. lecanii conidia by the ant Azteca instabilis was tested using field and laboratory ant-exclusion experiments. Azteca instabilis was shown to transport conidia of L. lecanii; however, dispersal by A. instabilis may not be important under field conditions.

  9. Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

    Science.gov (United States)

    Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

    2018-04-25

    A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

  10. Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.

    Science.gov (United States)

    Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E

    2017-07-01

    Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.

  11. Rust scoring guide

    NARCIS (Netherlands)

    Anonymous,

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust

  12. Rust scoring guide

    OpenAIRE

    Anonymous

    1986-01-01

    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust (P. recondita).

  13. Molecular Cytogenetic Characterization of two Triticum–Secale–Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99

    Directory of Open Access Journals (Sweden)

    Yi Dai

    2017-05-01

    Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  14. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)

    uvp

    2013-05-15

    associated molecular .... Total RNA was extracted from approximately 0.1 g ground leaf tissue harvested at 0, 24, 48, 72, 96 and ... The RNA was finally dissolved in 100 µl 0.1% (v/v) DMPC treated water. Residual DNA was eliminated ...

  15. Gaya Hidup Minum Kopi Konsumen Di the Coffee Bean & Tea Leaf Plasa Tunjungan Surabaya

    OpenAIRE

    suisa, Kelvianto; febrilia, veronica; santoso, thomas

    2014-01-01

    Penelitian ini bertujuan untuk mengetahui gaya hidup minum kopi konsumen di The Coffee Bean & Tea Leaf Plasa Tunjungan Surabaya. Penelitian ini menggunakan analisis deskriptif kuantitatif terhadap 100 responden sebagai sampel. Berdasarkan hasil penelitian menunjukkan bahwa gaya hidup minum kopi konsumen di The Coffee Bean & Tea Leaf Plasa Tunjungan Surabaya didominasi oleh responden berjenis kelamin laki-laki, berusia 21-30 tahun, mempunyai pendidikan terakhir diploma/S1, berprofesi s...

  16. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  17. Adubação orgânica, nutrição e progresso de cercosporiose e ferrugem-do-cafeeiro Organic fertilization, nutrition and the progress of brown eye spot and rust in coffee trees

    Directory of Open Access Journals (Sweden)

    Florisvalda da Silva Santos

    2008-07-01

    spot and coffee rust was obtained by CP treatment (respectively 62 and 38% higher to control. The larger progress coincided with the increase in leaf potassium and decrease of calcium content in CP, compared to other nutrient sources, and it resulted in higher leaf drop and lower yield. CP+CBP and CP+SW reduced in 38% the brown eye spot incidence, and in 31 and 21%, respectively, the coffee rust incidence, and increased leaf calcium content during fruit filling, compared to CP. The better nutritional status of plants increased resistance to diseases and reduced the variation between 2004 and 2005 harvests.

  18. Evidence of isolate-specificity in non-hypersensitive resistance in spring wheat (Triticum aestivum) to wheat leaf rust

    NARCIS (Netherlands)

    Qamar, Maqsood; Niks, R.E.

    2007-01-01

    Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of

  19. Genetic differentiation of the wheat leaf rust fungus Puccinia triticina in Pakistan and genetic relationship to other worldwide populations

    Science.gov (United States)

    Collections of Puccinia triticina, the wheat leaf rust pathogen, were obtained from Pakistan in 2008, 2010, 2011, 2013, and 2014. Collections were also obtained from Bhutan in 2013. Single uredinial isolates were derived and tested for virulence phenotype to 20 lines of Thatcher wheat that differ fo...

  20. Adult plant leaf rust resistance derived from the soft red winter wheat cultivar Caldwell maps to chromosome 3BS

    Science.gov (United States)

    'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...

  1. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat

    Science.gov (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  2. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments.

    Science.gov (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P

    2017-01-01

    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  3. Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147

    International Nuclear Information System (INIS)

    Reddy, V.R.K.; Viswanathan, P.

    1999-01-01

    By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations

  4. Cytological and molecular analysis of nonhost resistance in rice to wheat powdery mildew and leaf rust pathogens.

    Science.gov (United States)

    Cheng, Yulin; Yao, Juanni; Zhang, Hongchang; Huang, Lili; Kang, Zhensheng

    2015-07-01

    Cereal powdery mildews caused by Blumeria graminis and cereal rusts caused by Puccinia spp. are constant disease threats that limit the production of almost all important cereal crops. Rice is an intensively grown agricultural cereal that is atypical because of its immunity to all powdery mildew and rust fungi. We analyzed the nonhost interactions between rice and the wheat powdery mildew fungus B. graminis f. sp. tritici (Bgt) and the wheat leaf rust fungus Puccinia triticina (Ptr) to identify the basis of nonhost resistance (NHR) in rice against cereal powdery mildew and rust fungi at cytological and molecular levels. No visible symptoms were observed on rice leaves inoculated with Bgt or Ptr. Microscopic observations showed that both pathogens exhibited aberrant differentiation and significantly reduced penetration frequencies on rice compared to wheat. The development of Bgt and Ptr was also completely arrested at early infection stages in cases of successful penetration into rice leaves. Attempted infection of rice by Bgt and Ptr induced similar defense responses, including callose deposition, accumulation of reactive oxygen species, and hypersensitive response in rice epidermal and mesophyll cells, respectively. Furthermore, a set of defense-related genes were upregulated in rice against Bgt and Ptr infection. Rice is an excellent monocot model for genetic and molecular studies. Therefore, our results demonstrate that rice is a useful model to study the mechanisms of NHR to cereal powdery mildew and rust fungi, which provides useful information for the development of novel and durable strategies to control these important pathogens.

  5. Essential oils for rust control on coffee plants Óleos essenciais no controle da ferrugem em cafeeiro

    Directory of Open Access Journals (Sweden)

    Ricardo Borges Pereira

    2012-02-01

    Full Text Available Rust is considered the most important disease in coffee because it causes severe defoliation in plants and, consequently, reduction in productivity. This study evaluated the in vitro effect of essential oils of cinnamon, citronella, lemongrass, clove, tea tree, thyme, neem and eucalyptus on the germination of urediniospores of Hemileia vastatrix; the effectiveness of these oils to control rust on seedlings of coffee cultivars Catucaí 2SL, Catuaí IAC 62 and Mundo Novo 379/19 in the greenhouse; and the effect of more promising oils on urediniospores of H. vastatrix by transmission electron microscopy (TEM. All the essential oils inhibited the germination of urediniospores with increasing concentrations. All oils promoted partial control of the disease in the greenhouse. However, the oils of thyme, clove and citronella, at a concentration of 1000 µL L-1, were most effective in controlling the disease on cultivars Catucaí 2SL, Catuaí IAC 62 and Mundo Novo 379/19, respectively. The images generated in TEM showed that urediniospores exposed to oils of clove, citronella and thyme promoted cellular disorganization and cytoplasmic vacuolization, which was more pronounced in urediniospores exposed to citronella oil. The oils of thyme, clove and citronella are promising for the control of rust in coffee.A ferrugem é considerada a doença de maior importância no cafeeiro, pois causa acentuada desfolha nas plantas e, consequentemente, redução na produtividade. Este trabalho avaliou o efeito in vitro de óleos essenciais de canela, citronela, capim-limão, cravo-da-índia, árvore-de-chá, tomilho, nim e eucalipto na germinação de urediniósporos de Hemileia vastatrix; a eficácia desses óleos no controle da ferrugem em mudas de cafeeiro das cultivares Catucaí 2SL, Catuaí IAC 62 e Mundo Novo 379/19 em casa de vegetação; e o efeito dos óleos mais promissores sobre urediniósporos de H. vastatrix por meio de microscopia eletrônica de transmiss

  6. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Science.gov (United States)

    2011-01-01

    Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt), we have generated Expressed Sequence Tags (ESTs) by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores) and asexual (germinated urediniospores) stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum), 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs). Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt) and stripe rust, P. striiformis f. sp. tritici (Pst), and poplar

  7. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Directory of Open Access Journals (Sweden)

    Wynhoven Brian

    2011-03-01

    Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp

  8. Host status of false brome grass to the leaf rust fungus Puccinia brachypodii and the stripe rust fungus P. Striiformis

    NARCIS (Netherlands)

    Barbieri, M.; Marcel, T.C.; Niks, R.E.

    2011-01-01

    Purple false brome grass (Brachypodium distachyon) has recently emerged as a model system for temperate grasses and is also a potential model plant to investigate plant interactions with economically important pathogens such as rust fungi. We determined the host status of five Brachypodium species

  9. Obtaining of coffee varieties with durable resistance to illnesses, using the genetic diversity as improvement strategy

    International Nuclear Information System (INIS)

    Moreno Ruiz, German

    2004-01-01

    With the purpose of producing improved coffee varieties with resistance to the leaf rust (Hemileia vastatrix), the national federation of coffee growers of Colombia initiated in 1970 a research program, whose first results achieved in 1982 were the abstention of the Colombia coffee variety. The use of genetic variability as a strategy in plant breeding for a durable resistance is discussed. In addition, the breeding outline is described and the main features of the developed materials are presented

  10. Effects of sowing time on pink snow mould, leaf rust and winter damage in winter rye varieties in Finland

    Directory of Open Access Journals (Sweden)

    M. SERENIUS

    2008-12-01

    Full Text Available Disease infection in relation to sowing time of winter rye (Secale cereale was studied in southern Finland in order to compare overwintering capacity of modern rye varieties and to give recommendations for rye cultivation. This was done by using three sowing times and four rye varieties in field trials conducted at three locations in 1999–2001. The early sown rye (beginning of August was severely affected by diseases caused by Puccinia recondita and Microdochium nivale, whereas postponing sowing for two weeks after the recommended sowing time resulted in considerably less infection. The infection levels of diseases differed among rye varieties. Finnish rye varieties Anna and Bor 7068 were more resistant to snow mould and more winter hardy than the Polish variety Amilo, or the German hybrid varieties Picasso and Esprit. However, Amilo was the most resistant to leaf rust. In the first year snow mould appeared to be the primary cause of winter damage, but in the second year the winter damage was positively correlated with leaf rust. No significant correlation between frit fly infestation and winter damage or disease incidence of snow mould or leaf rust was established. The late sowing of rye (in the beginning of September is recommended in Finland, particularly with hybrid varieties, to minimize the need for chemical plant protection in autumn.;

  11. Simultaneous Transfer of Leaf Rust and Powdery Mildew Resistance Genes from Hexaploid Triticale Cultivar Sorento into Bread Wheat.

    Science.gov (United States)

    Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie

    2018-01-01

    Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.

  12. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  13. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification.

    Science.gov (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi

    2018-01-01

    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  14. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  15. [Analysis of methylation-sensitive amplified polymorphism in wheat genome under the wheat leaf rust stress].

    Science.gov (United States)

    Fu, Sheng-Jie; Wang, Hui; Feng, Li-Na; Sun, Yi; Yang, Wen-Xiang; Liu, Da-Qun

    2009-03-01

    Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. DNA methylation plays an important role in regulating gene expression in eukaryotes. Biological stress in plant provides an inherent epigenetic driving force of evolution. Study of DNA methylation patterns arising from biological stress will help us fully understand the epigenetic regulation of gene expression and DNA methylation of biological functions. The wheat near-isogenic lines TcLr19 and TcLr41 were resistant to races THTT and TKTJ, respectively, and Thatcher is compatible in the interaction with Puccinia triticina THTT and TKTJ, respectively. By means of methylation-sensitive amplified polymorphism (MSAP) analysis, the patterns of cytosine methylation in TcLr19, TcLr41, and Thatcher inoculated with P. triticina THTT and TKTJ were compared with those of the untreated samples. All the DNA fragments, each representing a recognition site cleaved by each or both of isoschizomers, were amplified using 60 pairs of selective primers. The results indicated that there was no significant difference between the challenged and unchallenged plants at DNA methylation level. However, epigenetic difference between the near-isogenic line for wheat leaf rust resistance gene Lr41 and Thatcher was present.

  16. Screening of wheat germplasm for the source of resistance against leaf and stripe rust under climatic conditions in Bhakkar

    International Nuclear Information System (INIS)

    Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.

    2009-01-01

    A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.

  17. Protection of wheat against leaf and stem rust and powdery mildew diseases by inhibition of polyamine metabolism

    Science.gov (United States)

    Weinstein, L. H.; Osmeloski, J. F.; Wettlaufer, S. H.; Galston, A. W.

    1987-01-01

    In higher plants, polyamines arise from arginine by one of two pathways: via ornithine and ornithine decarboxylase or via agmatine and arginine decarboxylase but in fungi, only the ornithine decarboxylase pathway is present. Since polyamines are required for normal growth of microorganisms and plants and since the ornithine pathway can be irreversibly blocked by alpha-difluoromethylornithine (DFMO) which has no effect on arginine decarboxylase, fungal infection of green plants might be controlled by the site-directed use of such a specific metabolic inhibitor. DFMO at relatively low concentrations provided effective control of the three biotrophic fungal pathogens studied, Puccinia recondita (leaf rust), P. graminis f. sp. tritici (stem rust), and Erysiphe graminis (powdery mildew) on wheat (Triticum aestivum L.) Effective control of infection by leaf or stem rust fungi was obtained with sprays of DFMO that ranged from about 0.01 to 0.20 mM in experiments where the inhibitor was applied after spore inoculation. The powdery mildew fungus was somewhat more tolerant of DFMO, but good control of the pathogen was obtained at less than 1.0 mM. In general, application of DFMO after spore inoculation was more effective than application before inoculation. Less control was obtained following treatment with alpha-difluoromethylarginine (DFMA) but the relatively high degree of control obtained raises the possibility of a DFMA to DFMO conversion by arginase.

  18. Calcium and potassium contents in nutrient solution on Phoma leaf spot intensity in coffee seedlings

    Directory of Open Access Journals (Sweden)

    Aricléia de Moraes Catarino

    Full Text Available ABSTRACT Coffee is one of the main export commodities of Brazilian agribusiness. Phoma leaf spot [Phoma tarda (Stewart Boerema & Bollen] is one of the most important coffee fungal diseases in Brazil. Therefore, this study aimed to evaluate the intensity of Phoma leaf spot in coffee seedlings supplied with different rates of Ca+2 and K+. The study was conducted under controlled conditions in a growth chamber, at the Department of Phytopathology - UFLA, from February 2010 to December 2011. The assay was repeated twice under the same conditions. The nutrient solutions consisted of five concentrations of K+ (3, 4, 5, 6, 7 mmol L-1 and Ca+2 (2, 4, 6, 8 and 10 mmol L-1. The experiment was arranged in a randomized block design, with 25 treatments and three replicates, with two plants per plot. The areas under incidence progress curve (AUIPC and severity (AUSPC were calculated. At the lowest rate of Ca2+ (2 mmol L-1 and highest K+ (6 and 7 mmol L-1, approximately, the AUIPC was the smallest. For the AUSPC, the lowest rates of Ca+2 and K+ resulted in the lowest severities. Supply of Ca+2 and K+ in nutrient solution reduced AUIPC and AUSPC of Phoma leaf spot, and these nutrients can be recommended for the management of the disease.

  19. Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis.

    Science.gov (United States)

    Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-01-01

    Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust

  20. Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

    Science.gov (United States)

    Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

    2017-12-01

    Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

  1. Rearing Technique, Biology and Sterilization of the Coffee Leaf Miner, Leucoptera Coffeella Guer. (Lepidoptera: Lyonetiidae)

    Energy Technology Data Exchange (ETDEWEB)

    Katiyar, K. P.; Ferrer, F. [Inter-American Institute of Agricultural Sciences of the OAS Training and Research Center, Turrialba (Costa Rica)

    1968-06-15

    For two years the authors studied the feasibility of controlling the coffee leaf miner Leucoptera coffeella Guer. by the radiation sterilization technique. During this period a technique for raising large numbers of tills insect on potted coffee plants in the laboratory was devised. The optimal range for the development of egg, larval and pupal stages of the coffee leaf miner was between 20 and 30 Degree-Sign C. The pupal stage of female insects was slightly shorter than that of the male. The laying of fertile eggs began during the first night following emergence. During an oviposition period of 16 days the average fecundity was 68 eggs. The maximum oviposition by a single female was 131 eggs over the life span while as many as 34 eggs were laid during a single day of oviposition. To investigate the best stage to induce radiation sterilization, pupal and adult insects were irradiated with {sup 60}CO gamma rays. Seven-day pupae (close to emergence) showed 88% lethality in males when given 60 krad; the survivors retained some fertility. Adult females receiving 70 krad were 100% sterile while males given 90 krad showed 0.02% fertility. Doses as high as 90 krad given to newly emerged adults did not reduce longevity. Studies are continuing to determine if sterilizing doses impair sexual vigour and mating competitiveness of the treated males. (author)

  2. Identification and molecular characterization of a trans-acting small interfering RNA producing locus regulating leaf rust responsive gene expression in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Dutta, Summi; Kumar, Dhananjay; Jha, Shailendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal

    2017-11-01

    A novel leaf rust responsive ta-siRNA-producing locus was identified in wheat showing similarity to 28S rRNA and generated four differentially expressing ta-siRNAs by phasing which targeted stress responsive genes. Trans-acting-small interfering RNAs (Ta-siRNAs) are plant specific molecules generally involved in development and are also stress responsive. Ta-siRNAs identified in wheat till date are all responsive to abiotic stress only. Wheat cultivation is severely affected by rusts and leaf rust particularly affects grain filling. This study reports a novel ta-siRNA producing locus (TAS) in wheat which is a segment of 28S ribosomal RNA but shows differential expression during leaf rust infestation. Four small RNA libraries prepared from wheat Near Isogenic Lines were treated with leaf rust pathogen and compared with untreated controls. A TAS with the ability to generate four ta-siRNAs by phasing events was identified along with the microRNA TamiR16 as the phase initiator. The targets of the ta-siRNAs included α-gliadin, leucine rich repeat, trans-membrane proteins, glutathione-S-transferase, and fatty acid desaturase among others, which are either stress responsive genes or are essential for normal growth and development of plants. Expression of the TAS, its generated ta-siRNAs, and their target genes were profiled at five different time points after pathogen inoculation of susceptible and resistant wheat isolines and compared with mock-inoculated controls. Comparative analysis of expression unveiled differential and reciprocal relationship as well as discrete patterns between susceptible and resistant isolines. The expression profiles of the target genes of the identified ta-siRNAs advocate more towards effector triggered susceptibility favouring pathogenesis. The study helps in discerning the functions of wheat genes regulated by ta-siRNAs in response to leaf rust.

  3. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger.

    Science.gov (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling

    2018-04-19

    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  4. Selection of active plant extracts against the coffee leaf miner Leucoptera coffeella (Lepidoptera: Lyonetiidae

    Directory of Open Access Journals (Sweden)

    D.S. Alves

    2013-01-01

    Full Text Available Aiming to contribute to the development of alternative control methods of the coffee leaf miner, Leucoptera coffeella (Guérin-Mèneville & Perrottet, 1842 (Lepidoptera: Lyonetiidae, a search for plants able to produce active substances against this insect was carried out, with species collected during different periods of time in the Alto Rio Grande region, (Lavras, Minas Gerais, Brazil. Coffee leaves containing L. coffeella mines were joined with 106 extracts from 77 plant species and, after 48 hours, the dead and alive caterpillars were counted. The extracts from Achillea millefolium, Citrus limon, Glechoma hederacea, Malva sylvestris, Mangifera indica, Mentha spicata, Mirabilis jalapa, Musa sapientum, Ocimum basiculum, Petiveria alliaceae, Porophyllum ruderale, Psidium guajava, Rosmarinus officinalis, Roupala montana, Sambucus nigra and Tropaeolum majus showed the highest mortality rates.

  5. Determination of dew absorption by coffee plant through deuterium concentrations in leaf water

    Energy Technology Data Exchange (ETDEWEB)

    Leopoldo, P R [Faculdade de Ciencias Medicas e Biologicas de Botucatu (Brazil); Salati, E; Matsui, E [Centro de Energia Nuclear na Agricultura, Piracicaba (Brazil)

    1975-12-01

    The effect of dew falling on leaves on the water metabolism of the coffee plant (Coffea arabica) is examined. The use of natural stable isotopes variations in plant physiological studies is demonstrated. Water extracted from leaf samples is analysed by mass spectrometry. Analyses of deuterium concentrations in water extracted from plant leaves, dew and nutrient solutions are made. Determination of changes in deuterium concentration in the water of leaves from plants exposed to dew, compared with leaves not exposed to dew, is carried out. Results show that during daytime there is an enrichment in deuterium in water contained in the leaves, while at night the opposite occurs.

  6. Determination of dew absorption by coffee plant through deuterium concentrations in leaf water

    International Nuclear Information System (INIS)

    Leopoldo, P.R.; Salati, E.; Matsui, E.

    1975-01-01

    The effect of dew falling on leaves on the water metabolism of the coffee plant (Coffea arabica) is examined. The use of natural stable isotopes variations in plant physiological studies is demonstrated. Water extracted from leaf samples is analysed by mass spectrometry. Analyses of deuterium concentrations in water extracted from plant leaves, dew and nutrient solutions are made. Determination of changes in deuterium concentration in the water of leaves from plants exposed to dew, compared with leaves not exposed to dew, is carried out. Results show that during daytime there is an enrichment in deuterium in water contained in the leaves, while at night the opposite occurs [pt

  7. The estimation of rust disease of daylily leaf images with GLCM based different classification methods

    OpenAIRE

    ÖZERDEM, Mehmet Siraç; ACAR, Emrullah

    2011-01-01

    Crop diseases can affect yield and/or quality of the harvested commodity. This can influence profitability and raise the risks of farming. When the diseases are estimated early, the yield will increase by taking measures thanks to farmers. The rust disease is one of the most major crop diseases that affect crop yield. Rust disease can be defined as a fungus; it makes the crops weak by blocking food to the roots and leaves. It is named “rust” disease, since the spots on the leaves look like gr...

  8. Development and characterization of a Psathyrostachys huashanica Keng 7Ns chromosome addition line with leaf rust resistance.

    Directory of Open Access Journals (Sweden)

    Wanli Du

    Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.

  9. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  10. Estimation of leaf area in coffee leaves (Coffea arabica L. of the Castillo® variety

    Directory of Open Access Journals (Sweden)

    Carlos Andrés Unigarro-Muñoz

    2015-01-01

    Full Text Available Allometric models based on measurements of single leaf dimensions or a combination there are useful tools for determining individual leaf area (LA because they are non-destructive, precise, simple and economical methods. The present study was carried out at the Central Station Naranjal of Cenicafé, located in the Department of Caldas (Colombia, four models were defined using the variables length (L and/or width (W to estimate LA in coffee leaves of the Castillo® variety (Coffea arabica L.. Estimation of regression coefficients was performed using information recorded from 6,441 leaves (group 1, and their validation was performed using records from another 992 leaves (group 2. Leaves were collected from all strata of the canopy and ranged from 0.76 to 140 cm2 in LA. In addition to exhibiting coefficients of variation differing from zero based on t-tests at 1%, the evaluated models possess coefficients of determination between 0.93 and 0.99. Four expressions have developed and adjusted to estimate leaf area in individual leaves, based on the measurement of simple variables and non-destructive.

  11. Heritable, De Novo Resistance to Leaf Rust and Other Novel Traits in Selfed Descendants of Wheat Responding to Inoculation with Wheat Streak Mosaic Virus

    Science.gov (United States)

    Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.

    2014-01-01

    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941

  12. Rust and Thinning Management Effect on Cup Quality and Plant Performance for Two Cultivars of Coffea arabica L.

    Science.gov (United States)

    Echeverria-Beirute, Fabian; Murray, Seth C; Klein, Patricia; Kerth, Chris; Miller, Rhonda; Bertrand, Benoit

    2018-05-30

    Beverage quality is a complex attribute of coffee ( Coffea arabica L.). Genotype (G), environment (E), management (M), postharvest processing, and roasting are all involved. However, little is known about how G × M interactions influence beverage quality. We investigated how yield and coffee leaf rust (CLR) disease (caused by Hemileia vastatrix Berk. et Br.) management affect cup quality and plant performance, in two coffee cultivars. Sensory and chemical analyses revealed that 10 of 70 attributes and 18 of 154 chemical volatile compounds were significantly affected by G and M. Remarkably, acetaminophen was found for the first time in roasted coffee and in higher concentrations under more stressful conditions. A principal component analysis described 87% of the variation in quality and plant overall performance. This study is a first step in understanding the complexity of the physiological, metabolic, and molecular changes in coffee production, which will be useful for the improvement of coffee cultivars.

  13. Identification of isoforms of microRNAs in wheat (Triticum aestivum L. and their role in leaf rust pathogenesis

    Directory of Open Access Journals (Sweden)

    Summi Dutta

    2017-10-01

    Full Text Available Bread wheat, a type of grass under genus Triticum and species aestivum covers the largest land area when production of cereal crops is considered. Being an allohexaploid (2n=6x=42; AABBDD, its genome is contributed by three progenitors and is evolutionarily rich. Rust in leaves, caused by Puccinia triticina, severely affects grain quality. MicroRNAs are considered as major components of gene silencing and so have deep role to play during stress. Post transcriptional modification of miRNAs which generates isomiRNAs significantly affects target specificity especially when the modification occurs in 5′end. A total of four small RNA libraries were prepared through next-generation Illumina sequencing techniques from leaves of two wheat Near Isogenic Lines (NILs, HD2329 (susceptible and HD2329 + LR24 (resistant. Prior to this, one set of the two NILs was mock inoculated and considered as control (with sRNA library code named SM-mi and RM-mi while other was treated with urediniospores of leaf rust fungus (with sRNA library code named SPI-mi and RPI-mi. Clean reads in all four libraries were previously used for prediction of 559 novel miRNAs and in the current study it was used to detect isoforms of these miRNAs. A total of 237 isoforms were detected for 41 miRNAs. These isoforms included both 5′ and 3′ modifications of miRNAs. There were 27 miRNAs with 5′ modifications and five miRNAs with 3′ modifications while nine miRNAs showed both types of modifications.

  14. Temporal Gene Expression Profiling of the Wheat Leaf Rust Pathosystem Using cDNA Microarray Reveals Differences in Compatible and Incompatible Defence Pathways

    OpenAIRE

    Fofana, Bourlaye; Banks, Travis W.; McCallum, Brent; Strelkov, Stephen E.; Cloutier, Sylvie

    2007-01-01

    In this study, we detail the construction of a custom cDNA spotted microarray containing 7728 wheat ESTs and the use of the array to identify host genes that are differentially expressed upon challenges with leaf rust fungal pathogens. Wheat cultivar RL6003 (Thatcher Lr1) was inoculated with Puccinia triticina virulence phenotypes BBB (incompatible) or TJB (7-2) (compatible) and sampled at four different time points (3, 6, 12, and 24 hours) after inoculation. Transcript expression levels rela...

  15. The genome sequence and effector complement of the flax rust pathogen Melampsora lini

    Directory of Open Access Journals (Sweden)

    Adnane eNemri

    2014-03-01

    Full Text Available Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp. Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimise parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analysed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote

  16. The genome sequence and effector complement of the flax rust pathogen Melampsora lini.

    Science.gov (United States)

    Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N

    2014-01-01

    Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their

  17. Pengujian sifat unggul beberapa klon harapan kopi arabika di kebun percobaan Andungsari, Jawa Timur (Testing for superior traits of some arabica coffee promising clones at Andungsari research station, East Java

    Directory of Open Access Journals (Sweden)

    Retno Hulupi

    2012-08-01

    Full Text Available One of the major diseases which limiting production in arabica coffee is the leaf rust caused by the fungus Hemileia vastatrix, B et Br. Selection and testing on thirteen promising arabica coffee clones were carried out at endemic area for leaf rust disease, Andungsari Research Station, for six fruiting times. The aims of these test were to find out superior planting material as clone with genetic resistance to leaf rust. As the beverage commodities, criterium selections for superiority clone besides resistant to leaf rust and yielding ability of more than 1,5 ton/ha also must be excellent in cup quality. Under this consideration, BP 416 A clone showed as the best high yielding ability i.e. 1,595 kg/ha and stable, besides resistant to leaf rust disease compared to the other clones tested. This clone had good cup quality, better than earlier released variety such as USDA 762 and S 795 although was not better than Andungsari 1 that were planted in the same location. The best physical bean characteristics was obtained on BP 513 A clone wich is derived from S 795 x Caturra red, having 89.2% of normal bean and 18.3% outurn characteristics. However, due to lower yielding and more susceptible to leaf rust, this clone could not be classified as superior clone.

  18. In vivo assessment of plant extracts for control of plant diseases: A sesquiterpene ketolactone isolated from Curcuma zedoaria suppresses wheat leaf rust.

    Science.gov (United States)

    Han, Jae Woo; Shim, Sang Hee; Jang, Kyoung Soo; Choi, Yong Ho; Dang, Quang Le; Kim, Hun; Choi, Gyung Ja

    2018-02-01

    As an alternative to synthetic pesticides, natural materials such as plant extracts and microbes have been considered to control plant diseases. In this study, methanol extracts of 120 plants were explored for in vivo antifungal activity against Rhizoctonia solani, Botrytis cinerea, Phytophthora infestans, Puccinia triticina, and Blumeria graminis f. sp. hordei. Of the 120 plant extracts, eight plant extracts exhibited a disease control efficacy of more than 90% against at least one of five plant diseases. In particular, a methanol extract of Curcuma zedoaria rhizomes exhibited strong activity against wheat leaf rust caused by P. triticina. When the C. zedoaria methanol extracts were partitioned with various solvents, the layers of n-hexane, methylene chloride, and ethyl acetate showed disease control values of 100, 80, and 43%, respectively, against wheat leaf rust. From the C. zedoaria rhizome extracts, an antifungal substance was isolated and identified as a sesquiterpene ketolactone based on the mass and nuclear magnetic resonance spectral data. The active compound controlled the development of rice sheath blight, wheat leaf rust, and tomato late blight. Considering the in vivo antifungal activities of the sesquiterpene ketolactone and the C. zedoaria extracts, these results suggest that C. zedoaria can be used as a potent fungicide in organic agriculture.

  19. Seleção para a resistência à ferrugem em progênies das cultivares de café IPR 99 e IPR 107 Selection for resistance to rust in progenies of coffee cultivars IPR 99 and IPR 107

    Directory of Open Access Journals (Sweden)

    Gustavo Hiroshi Sera

    2010-01-01

    Full Text Available As cultivares de café IPR 99 ("Sarchimor" e IPR 107 ('IAPAR 59' x 'Mundo Novo IAC 376-4' eram no passado resistentes à ferrugem (Hemileia vastatrix. Os objetivos deste estudo foram: a Identificar progênies dessas duas cultivares com resistência à ferrugem; b Identificar progênies com resistência incompleta; c Verificar a eficiência dos cruzamentos testes na seleção dessas cultivares. A avaliação da resistência em campo foi realizada em cafeeiros adultos expostos à população local de raças presentes no IAPAR. Foram avaliados 23 cruzamentos testes com progênies F3 de 'IPR 107' e 5 com progênies F4 de 'IPR 99'. Além disso, foram avaliadas 11 progênies F4 de 'IPR 107' e 5 progênies F5 de 'IPR 99', provenientes de autofecundação. Várias progênies das cultivares IPR 99 e 107 apresentaram alta freqüência de plantas com resistência completa e são portadoras de mais genes de resistência não quebrados pelas raças de ferrugem. Progênies das cultivares IPR 99 e IPR 107 com a resistência quebrada apresentaram resistência incompleta à população local de raças. Cruzamentos testes foram eficientes na seleção de progênies de café com mais genes de resistência não quebrados.All plants of the coffee cultivars IPR 99 ("Sarchimor" and IPR 107 ('IAPAR 59' x 'Mundo Novo IAC 376-4' were resistant to rust (Hemileia vastatrix in the past. Currently, susceptible plants were observed in the two cultivars due to the breakdown of resistance by new rust races. The aims of this study were: a to identify coffee (Coffea arabica L. progenies of the two cultivars with resistance to rust; b to identify progenies with incomplete resistance; c to investigate the efficiency of test-crosses for selection from these cultivars. Evaluation for field resistance was carried out in adult plants subjected to natural infection by the local leaf rust population at IAPAR. Twenty-three test-crosses with F3 progenies of 'IPR 107' and five with F4

  20. Canopy and leaf composition drive patterns of nutrient release from pruning residues in a coffee agroforest.

    Science.gov (United States)

    Tully, Katherine L; Lawrence, Deborah

    2012-06-01

    In a coffee agroforest, the crop is cultivated under the shade of fruit-bearing and nitrogen (N)-fixing trees. These trees are periodically pruned to promote flowering and fruiting as well as to make nutrients stored in tree biomass available to plants. We investigated the effect of canopy composition and substrate quality on decomposition rates and patterns of nutrient release from pruning residues in a coffee agroforest located in Costa Rica's Central Valley. Initial phosphorus (P) release was enhanced under a canopy composed solely of N-fixing, Erythrina poeppigiana compared to a mixed canopy of Erythrina and Musa acuminata (banana). Both initial and final N release were similar under the two canopy types. However, after five months of decomposition, a higher proportion of initial N had been released under the single canopy. Although patterns of decomposition and nutrient release were not predicted by initial substrate quality, mass loss in leaf mixtures rates were well predicted by mean mass loss of their component species. This study identifies specific pruning regimes that may regulate N and P release during crucial growth periods, and it suggests that strategic pruning can enhance nutrient availability. For example, during the onset of rapid fruit growth, a two-species mixture may release more P than a three-species mixture. However, by the time of the harvest, the two- and three-species mixtures have released roughly the same amount of N and P. These nutrients do not always follow the same pattern, as N release can be maximized in single-species substrates, while P release is often facilitated in species mixtures. Our study indicates the importance of management practices in mediating patterns of nutrient release. Future research should investigate how canopy composition and farm management can also mediate on-farm nutrient losses.

  1. Topography and crop management are key factors for the development of american leaf spot epidemics on coffee in costa rica.

    Science.gov (United States)

    Avelino, Jacques; Cabut, Sandrine; Barboza, Bernardo; Barquero, Miguel; Alfaro, Ronny; Esquivel, César; Durand, Jean-François; Cilas, Christian

    2007-12-01

    ABSTRACT We monitored the development of American leaf spot of coffee, a disease caused by the gemmiferous fungus Mycena citricolor, in 57 plots in Costa Rica for 1 or 2 years in order to gain a clearer understanding of conditions conducive to the disease and improve its control. During the investigation, characteristics of the coffee trees, crop management, and the environment were recorded. For the analyses, we used partial least-squares regression via the spline functions (PLSS), which is a nonlinear extension to partial least-squares regression (PLS). The fungus developed well in areas located between approximately 1,100 and 1,550 m above sea level. Slopes were conducive to its development, but eastern-facing slopes were less affected than the others, probably because they were more exposed to sunlight, especially in the rainy season. The distance between planting rows, the shade percentage, coffee tree height, the type of shade, and the pruning system explained disease intensity due to their effects on coffee tree shading and, possibly, on the humidity conditions in the plot. Forest trees and fruit trees intercropped with coffee provided particularly propitious conditions. Apparently, fertilization was unfavorable for the disease, probably due to dilution phenomena associated with faster coffee tree growth. Finally, series of wet spells interspersed with dry spells, which were frequent in the middle of the rainy season, were critical for the disease, probably because they affected the production and release of gemmae and their viability. These results could be used to draw up a map of epidemic risks taking topographical factors into account. To reduce those risks and improve chemical control, our results suggested that farmers should space planting rows further apart, maintain light shading in the plantation, and prune their coffee trees.

  2. QTL mapping provides evidence for lack of association of the avoidance of leaf rust in Hordeum chilense with stomata density

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Rubiales, D.; Martin, A.; Hernandez, P.; Lindhout, W.H.; Niks, R.E.; Stam, P.

    2003-01-01

    In cereals, rust fungi are among the most harmful pathogens. Breeders usually rely on short-lived hypersensitivity resistance. As an alternative, "avoidance" may be a more durable defence mechanism to protect plants to rust fungi. In Hordeum chilense avoidance is based on extensive wax covering of

  3. Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

    Science.gov (United States)

    Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

    2017-07-01

    NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

  4. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    Science.gov (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  5. High-resolution mapping reveals linkage between genes in common bean cultivar Ouro Negro conferring resistance to the rust, anthracnose, and angular leaf spot diseases.

    Science.gov (United States)

    Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A

    2017-08-01

    Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.

  6. Progresso da ferrugem do cafeeiro irrigado em diferentes densidades de plantio pós-poda Progress of rust in coffee plants in various densities of cultivation in irrigated planting after pruning

    Directory of Open Access Journals (Sweden)

    Bernardo Reis Teixeira Lacerda Paiva

    2011-02-01

    Full Text Available Objetivou-se, no presente trabalho, avaliar o efeito de diferentes critérios para manejo da irrigação em quatro densidades de plantio, sob sistema de gotejamento na incidência e severidade da ferrugem do cafeeiro e avaliar a influência do enfolhamento na curva de progresso dessa doença. Conduziu-se, o experimento, em área experimental da Universidade Federal de Lavras MG, utilizando a cultivar Rubi MG-1192 com seis anos. O delineamento experimental foi em blocos ao acaso com quatro repetições. Os tratamentos foram constituídos por quatro parcelas representadas pelas densidades de plantio (convencionais e adensados: 2500 (4,0x1,0 m, 3333 (3,0x1,0 m, 5000 (2,0x1,0 m, 10000 (2,0x0,5 m plantas ha-1, quatro subparcelas sendo: irrigações quando a tensão da água no solo atingiu valores de 20 e 60kPa; irrigações utilizando o manejo do balanço hídrico (calculado através do software IRRIPLUS, com turnos de irrigação fixos de três dias por semana e uma testemunha sem irrigação, perfazendo um total de 16 tratamentos. Cada subparcela foi constituída por 10 plantas, sendo consideradas como plantas úteis as seis centrais. Foram avaliadas a incidência e severidade da ferrugem e a porcentagem de enfolhamento das plantas de cafeeiros. Após análise estatística, os dados foram convertidos em área abaixo da curva de progresso da doença e do crescimento. Verificou-se que os critérios para manejo da irrigação influenciaram a curva de progresso do crescimento, porém, não interferiu na curva de progresso da incidência e da severidade da ferrugem. Os sistemas de plantios adensados favoreceram a incidência da ferrugem. Mas as densidades de plantio não interferiram no enfolhamento.The objective of this study was to evaluate the effect of different irrigation controls implemented in four planting densities on a system of drip on the incidence and severity of rust and to assess the influence of leaf growth on the progress curve of this

  7. QTL Mapping of Adult-Plant Resistance to Leaf Rust in the Wheat Cross Zhou 8425B/Chinese Spring Using High-Density SNP Markers

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-05-01

    Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.

  8. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat.

    Science.gov (United States)

    Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip

    2017-02-01

    Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.

  9. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Microsatellite markers were used to differentiate P. triticina and P. striiformis pathotypes. Amplified fragment length polymorphisms (AFLP) were used to differentiate stem rust P. graminis pathotypes. Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of leaf, stem and yellow rust were collected ...

  10. Non-nodulated bacterial leaf symbiosis promotes the evolutionary success of its host plants in the coffee family (Rubiaceae).

    Science.gov (United States)

    Verstraete, Brecht; Janssens, Steven; Rønsted, Nina

    2017-08-01

    Every plant species on Earth interacts in some way or another with microorganisms and it is well known that certain forms of symbiosis between different organisms can drive evolution. Within some clades of Rubiaceae (coffee family), a specific plant-bacteria interaction exists in which non-pathological endophytes are present in the leaves of their hosts. It is hypothesized that the bacterial endophytes, either alone or by interacting with the host, provide chemical protection against herbivory or pathogens by producing toxic or otherwise advantageous secondary metabolites. If the bacteria indeed have a direct beneficial influence on their hosts, it is reasonable to assume that the endophytes may increase the fitness of their hosts and therefore it is probable that their presence also has an influence on the long-term evolution of the particular plant lineages. In this study, the possible origin in time of non-nodulated bacterial leaf symbiosis in the Vanguerieae tribe of Rubiaceae is elucidated and dissimilarities in evolutionary dynamics between species with endophytes versus species without are investigated. Bacterial leaf symbiosis is shown to have most probably originated in the Late Miocene, a period when the savannah habitat is believed to have expanded on the African continent and herbivore pressure increased. The presence of bacterial leaf endophytes appears to be restricted to Old World lineages so far. Plant lineages with leaf endophytes show a significantly higher speciation rate than plant lineages without endophytes, while there is only a small difference in extinction rate. The transition rate shows that evolving towards having endophytes is twice as fast as evolving towards not having endophytes, suggesting that leaf symbiosis must be beneficial for the host plants. We conclude that the presence of bacterial leaf endophytes may also be an important driver for speciation of host plants. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  12. Conserved loci of leaf and stem rust fungi of wheat share synteny interrupted by lineage-specific influx of repeat elements

    Directory of Open Access Journals (Sweden)

    Fellers John P

    2013-01-01

    Full Text Available Abstract Background Wheat leaf rust (Puccinia triticina Eriks; Pt and stem rust fungi (P. graminis f.sp. tritici; Pgt are significant economic pathogens having similar host ranges and life cycles, but different alternate hosts. The Pt genome, currently estimated at 135 Mb, is significantly larger than Pgt, at 88 Mb, but the reason for the expansion is unknown. Three genomic loci of Pt conserved proteins were characterized to gain insight into gene content, genome complexity and expansion. Results A bacterial artificial chromosome (BAC library was made from P. triticina race 1, BBBD and probed with Pt homologs of genes encoding two predicted Pgt secreted effectors and a DNA marker mapping to a region of avirulence. Three BACs, 103 Kb, 112 Kb, and 166 Kb, were sequenced, assembled, and open reading frames were identified. Orthologous genes were identified in Pgt and local conservation of gene order (microsynteny was observed. Pairwise protein identities ranged from 26 to 99%. One Pt BAC, containing a RAD18 ortholog, shares syntenic regions with two Pgt scaffolds, which could represent both haplotypes of Pgt. Gene sequence is diverged between the species as well as within the two haplotypes. In all three BAC clones, gene order is locally conserved, however, gene shuffling has occurred relative to Pgt. These regions are further diverged by differing insertion loci of LTR-retrotransposon, Gypsy, Copia, Mutator, and Harbinger mobile elements. Uncharacterized Pt open reading frames were also found; these proteins are high in lysine and similar to multiple proteins in Pgt. Conclusions The three Pt loci are conserved in gene order, with a range of gene sequence divergence. Conservation of predicted haustoria expressed secreted protein genes between Pt and Pgt is extended to the more distant poplar rust, Melampsora larici-populina. The loci also reveal that genome expansion in Pt is in part due to higher occurrence of repeat-elements in this species.

  13. Induced resistant mutations in alfalfa and broad bean against rust, leaf spot and wilh diseases by Gamma rays and ethylmethanesulfonate

    International Nuclear Information System (INIS)

    1988-01-01

    In alfalfa after gamma irradiation with 50,100, and 150 krads, 38 rust resistant plants have been selected throughout a screening programme. During four months, cuttings were obtained from these plants individually. Results revealed that 20 plants were remar-kably surpassed the origin in the total fresh weight and in the average weight of each cutting. In broad bean, following gamma irradiation and EMS in two cuitivars for induction of wilt resistance. Seeds of these plants were sown in artificially infested soil . During the growing season, all susceptible plants were removed and at epidemic form of wilt disease

  14. Short communication: Emergence of a new race of leaf rust with combined virulence to Lr14a and Lr72 genes on durum wheat

    Energy Technology Data Exchange (ETDEWEB)

    Soleiman, N.H; Solis, I.; Soliman, M.H.; Sillero, J.C.; Villegas, D.; Alvaro, F.; Royo, C.; Serra, J.; Ammar, K.; Martínez-Moreno, F.

    2016-11-01

    Leaf rust is a foliar disease caused by the fungus Puccinia triticina that may severely reduce durum wheat yield. Resistance to this pathogen is common in modern durum germplasm but is frequently based on Lr72 and Lr14a. After accounts of races with virulence to Lr14a gene in France in 2000, the present study reports the detection in 2013 for the first time of a new race with virulence to Lr14a and Lr72. The aim of this work was to characterize the virulence pattern of four Spanish isolates with virulence to Lr14a, and to discuss the consequences of this presence. Rusted leaves from cultivars ‘Don Jaime’ (Lr14a) and ‘Gallareta’ (Lr72) were collected in 2013 in the field at two Spanish sites, one in the south (near Cadiz) and another in the north (near Girona). Spores from single pustule for each cultivar and site were multiplied on susceptible cultivar ‘Don Rafael’. Then, the four isolates were inoculated on a set of 19 isogenic lines Thatcher to characterize their virulence spectrum. All isolates presented the same virulence pattern. They were virulent on both Lr14a and Lr72 and the race was named DBB/BS. This race was very similar to those reported in 2009-11, but with added virulence to Lr14a. The resistance based on Lr14a has therefore been overcome in Spain, by a new race that has likely emerged via stepwise mutation from the local predominating races. This information is important to guide breeders in their breeding programmes and gene deployment strategies. (Author)

  15. Avaliação e seleção de progênies F3 de cafeeiros de porte baixo com o gene SH3 de resistência a Hemileia vastatrix Berk. et Br. Evaluation and selection of Coffea arabica F3 progenies with low height and the leaf-rust SH3 resistence gene

    Directory of Open Access Journals (Sweden)

    Albano Silva da Conceição

    2005-01-01

    porte baixo portando o gene SH3 de resistência ao agente da ferrugem.The present work evaluated 36 arabic coffee (Coffea arabica L. F3 progenies, originated from crosses among cultivars Catuaí Vermelho IAC 46 and Catuaí Vermelho IAC 81 and access IAC 1110 (BA-10. This last cultivar came from India and exhibits SH2 and SH3 rust resistance genes. The experiment was installed in 1988 at the Experimental Center of the Agronomic Institute (IAC/APTA, in Campinas, using random blocks design with six repetitions and two plants per plot. Field evaluations included yield (average of seven annual harvests, vegetative vigor, resistance to leaf rust, plant size, color of young leaves and complete fruit maturation period. Based on these evaluations, plants exhibiting high yield, good vegetative vigor, low height, and resistance to the leaf rust agent Hemileia vastatrix were selected. Fruit yield of selected plants was calculated and seeds were characterized according to type (flat, peaberry and elephant, outturn and grain size. A total of 11 optimal F3 progenies were identified as rust resistant. By further classifications, 39 plants out from these progenies were selected, along with 15 plants from other 25 evaluated progenies. Laboratory analyses lead to a final selection of 18 coffee trees, all exhibiting leaf rust resistance, high yield and low height. Also, F4 progenies of selected plants had been evaluated regarding height and leaf rust resistance, at seedling stage, in greenhouse conditions. Eighteen plants were selected for further analysis and move forward from F3 to F4 generation in the coffee breeding program developed by IAC.

  16. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...

  17. Molecular and genetic study of wheat rusts

    African Journals Online (AJOL)

    Nicholas Le Maitre

    Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.

  18. Intraspecific Trait Variation and Coordination: Root and Leaf Economics Spectra in Coffee across Environmental Gradients.

    Science.gov (United States)

    Isaac, Marney E; Martin, Adam R; de Melo Virginio Filho, Elias; Rapidel, Bruno; Roupsard, Olivier; Van den Meersche, Karel

    2017-01-01

    Hypotheses on the existence of a universal "Root Economics Spectrum" (RES) have received arguably the least attention of all trait spectra, despite the key role root trait variation plays in resource acquisition potential. There is growing interest in quantifying intraspecific trait variation (ITV) in plants, but there are few studies evaluating (i) the existence of an intraspecific RES within a plant species, or (ii) how a RES may be coordinated with other trait spectra within species, such as a leaf economics spectrum (LES). Using Coffea arabica (Rubiaceae) as a model species, we measured seven morphological and chemical traits of intact lateral roots, which were paired with information on four key LES traits. Field collections were completed across four nested levels of biological organization. The intraspecific trait coefficient of variation (cv) ranged from 25 to 87% with root diameter and specific root tip density showing the lowest and highest cv, respectively. Between 27 and 68% of root ITV was explained by site identity alone for five of the seven traits measured. A single principal component explained 56.2% of root trait covariation, with plants falling along a RES from resource acquiring to conserving traits. Multiple factor analysis revealed significant orthogonal relationships between root and leaf spectra. RES traits were strongly orthogonal with respect to LES traits, suggesting these traits vary independently from one another in response to environmental cues. This study provides among the first evidence that plants from the same species differentiate from one another along an intraspecific RES. We find that in one of the world's most widely cultivated crops, an intraspecific RES is orthogonal to an intraspecific LES, indicating that above and belowground responses of plants to managed (or natural) environmental gradients are likely to occur independently from one another.

  19. Progresso da ferrugem e da cercosporiose do cafeeiro consorciado com grevílea, com ingazeiro e a pleno sol em Lavras - MG Progress of rust and coffee plant cercosporiose mixed with grevílea, with ingazeiro and in the full sunshine in Lavras - MG

    Directory of Open Access Journals (Sweden)

    Bruno Grandi Salgado

    2007-08-01

    Full Text Available Com o presente trabalho, objetivou-se avaliar a incidência da ferrugem e da cercosporiose do cafeeiro em diferentes sistemas de cultivo, agroflorestais e a pleno sol, através da curva de progresso dessas doenças. Utilizou-se o delineamento inteiramente casualizado, com três tratamentos e sete repetições. Os tratamentos foram compostos por cafeeiros consorciados com ingazeiro, cafeeiros consorciados com grevílea e cafeeiros cultivados convencionalmente a pleno sol. As avaliações foram realizadas mensalmente no período de abril de 2001 a março de 2003. Realizou-se o cálculo da área abaixo da curva de progresso da doença (AACPD, a qual foi submetida à análise de variância. Para a incidência da ferrugem do cafeeiro o consórcio cafeeiro x ingazeiro mostrou-se com maiores índices da doença, sendo que os tratamentos consórcio cafeeiro x grevílea e cafeeiro a pleno sol não diferiram entre si e apresentaram menores incidências da doença. Diminuição na luz solar direta e maior umidade podem ter favorecido a ferrugem no sistema cafeeiro x ingazeiro. Para a incidência de cercosporiose, os cafeeiros a pleno sol obtiveram maiores valores de incidência da doença, seguidos por cafeeiros x grevílea, e menores taxas da doença foram observadas no consórcio cafeeiros x ingazeiro. A incidência de radiação solar direta pode ter favorecido a maior incidência de cercosporiose nos cafeeiros a pleno sol.The present work aimed to evaluate the incidence of rust and coffee plant cercosporiose in different systems of agroforest cultivation and in the full sunshine through the progress curve of those diseases. The completely randomized design with three treatments and seven replicates was utilized. The treatments were made up of coffee plants mixed with ingazeiro, coffee plants mixed with grevílea and coffee plants cultivated conventionally in the full sunshine. The evaluations were performed monthly during the period of April 2001 to

  20. INFESTACIÓN E INCIDENCIA DE BROCA, ROYA Y MANCHA DE HIERRO EN CULTIVO DE CAFÉ DEL DEPARTAMENTO DEL CAUCA ESTUDO DE INFESTAÇÃO E INCIDÊNCIA DA BROCA, A FERRUGEM E A CERCOSPOREOSE O CULTIVO DO CAFÉ NO DEPARTAMENTO DO CAUCA INFESTATION AND INCIDENCE STUDY OF THE COFFEE BORER, COFFEE RUST AND IRON SPOT DISEASE ON THE COFFEE CROP IN CAUCA DEPARTMENT

    Directory of Open Access Journals (Sweden)

    CONSUELO MONTES R.

    2012-06-01

    ça de Broca e a cercosporiose, e dez para avaliar a presença de ferrugem. Foram registrados os valores de temperatura, precipitação, humidade, e brilho solar objetivando determinar a relação entre o clima e a presença de doenças. O nivel máximo aceitável de infestação na plantação é do 5%. O promedio de infestação no periodo avaliado foi de 14,7% para a ferrugem, 4,7% para a Broca e 4,8 para a cercosporiose. Temperatura e precipitação foram as que apresentaram maior relação com a presença das doenças. Altas temperaturas estão relacionadas com maior apresentação de ferrugem e Broca, principalmente nos meses de junhio e setembro, pelo contrario, a cercosporiose, altamente correlacionada com a presença de chuvas, ocorre principalmente nos meses de marzo e maio. Estes resultados alertan sobre a presença destas pragas nas plantações da região.The epidemiological study was carried out on three Colombian coffee production limiting pests, i.e. Coffee borer (Hypothenemus hampei Ferrari, Coffee rust (Hemileia vastatrix and Iron spot disease (Cercospora coffeicola of four municipalities of the Cauca department. Eight sensoring localities were selected and sampled monthly in order to obtain the infestation and incidence of each pest during 2006 and 2007(from March and December. Sampling was done according to the process established by Cenicafé, 30 Coffee shrubs were taken for the Coffee borer and the Iron spot disease evaluation, and 10 for coffee rust evaluation per hectare respectively, the corresponding infestation and incidence percentages were obtained by grain and leaves counting. Temperature, precipitation, relative humidity and solar bright data were obtained from neighboring climatological stations, in order to relate the pests behavior with climate. The plagues infestation and incidence in most cases exceeded the 5% economical damage threshold; the mean incidence and infestation during the evaluation period was 14,7% for Rust, 4,7% for

  1. Genética de Coffea. XVIII - Variegação no cafeeiro Leaf variegation in coffee plants

    Directory of Open Access Journals (Sweden)

    A. Carvalho

    1954-01-01

    Full Text Available A variegação das fôlhas do cafeeiro tanto em plantas novas como em plantas adultas tem sido freqüentemente observada. Plantas variegadas podem ocorrer espontaneamente nas progénies das diversas variedades de Coffea arabica L., motivo porque não devem constituir variedade distinta dessa espécie, como foi proposto por Cramer. As plantas variegadas em estudo puderam ser agrupadas em duas categorias, isto é, aquelas em que a variegação não se acha associada com anomalias na forma e textura das folhas e aquelas nas quais a variegação é acompanhada dessas anomalias. No primeiro grupo o padrão de variegação não é uniforme para tôdas as fôlhas, enquanto no segundo grupo o padrão é semelhante para tôda a planta. Usualmente apenas alguns ramos das plantas do primeiro grupo são variegados. Observou-se algumas vezes que as duas fôlhas do mesmo verticilo têm padrões semelhantes de variegação. Encontraram-se também fôlhas variegadas nas quais a metade da lâmina é variegada ou mesmo albina, enquanto a outra metade apresenta a côr verde normal. Os dados genéticos obtidos, embora preliminares para a maioria das plantas variegadas em investigação, permitiram concluir que o padrão de variegação da planta 180, pertencente ao primeiro grupo, é herdado pelo citoplasma e não é transmitido pelo pólen. O padrão de variegação da planta 253-21, pertencente ao segundo grupo, no entanto, parece ser transmitido pelo polen.Leaf variegation in coffee plants is a relatively common abnormality, and variegated seedlings have been found to occur spontaneously in progenies of most varieties of Coffea arabica L. For this reason it is thought that variegated types should not be described as distinct varieties, as it was done before by Cramer. Variegated coffee plants can be grouped in two categories : first, those in which variegated leaves are normal in shape and texture, but do not show a uniform variegation pattern; and second, those

  2. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  3. Abnormal germling development by brown rust and powdery mildew on cer barley mutants

    NARCIS (Netherlands)

    Rubiales, D.; Ramirez, M.C.; Carver, T.L.W.; Niks, R.E.

    2001-01-01

    The barley leaf rust fungus forms appressoria over host leaf stomata and penetrates via the stomatal pore. High levels of avoidance to leaf rust fungi have been described in some wild accessions of Hordeum species where a prominent wax layer on the stomata inhibits triggering of fungal appressorium

  4. Rust essentials

    CERN Document Server

    Balbaert, Ivo

    2015-01-01

    This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.

  5. Winnie Rust

    African Journals Online (AJOL)

    Owner

    Om te trek is om jou kortstondig in 'n liminale staat te bevind. Nóg by jou vertrekpunt, nóg by jou uiteindelike bestemming, sonder die geborgenheid wat hierdie twee vaste plekke kwansuis bied. In 'n hele aantal opsigte is Trek van Winnie Rust 'n beskrywing van verskil- lende liminale state. Dit is egter nie 'n reisverhaal met ...

  6. Seeing Rust

    Science.gov (United States)

    2004-01-01

    The rust color of the Martian landscape is apparent in this low-resolution thumbnail image taken by the panoramic camera on the Mars Exploration Rover Spirit. This image is part of a larger image currently stored onboard the rover in its memory.

  7. Aegilops tauschii Accessions with Geographically Diverse Origin Show Differences in Chromosome Organization and Polymorphism of Molecular Markers Linked to Leaf Rust and Powdery Mildew Resistance Genes.

    Science.gov (United States)

    Majka, Maciej; Kwiatek, Michał T; Majka, Joanna; Wiśniewska, Halina

    2017-01-01

    Aegilops tauschii (2n = 2x = 14) is a diploid wild species which is reported as a donor of the D-genome of cultivated bread wheat. The main goal of this study was to examine the differences and similarities in chromosomes organization among accessions of Ae. tauschii with geographically diversed origin, which is believed as a potential source of genes, especially determining resistance to fungal diseases (i.e., leaf rust and powdery mildew) for breeding of cereals. We established and compared the fluorescence in situ hybridization patterns of 21 accessions of Ae. tauschii using various repetitive sequences mainly from the BAC library of wheat cultivar Chinese Spring. Results obtained for Ae. tauschii chromosomes revealed many similarities between analyzed accessions, however, some hybridization patterns were specific for accessions, which become from cognate regions of the World. The most noticeable differences were observed for accessions from China which were characterized by presence of distinct signals of pTa-535 in the interstitial region of chromosome 3D, less intensity of pTa-86 signals in chromosome 2D, as well as lack of additional signals of pTa-86 in chromosomes 1D, 5D, or 6D. Ae. tauschii of Chinese origin appeared homogeneous and separate from landraces that originated in western Asia. Ae. tauschii chromosomes showed similar hybridization patterns to wheat D-genome chromosomes, but some differences were also observed among both species. What is more, we identified reciprocal translocation between short arm of chromosome 1D and long arm of chromosome 7D in accession with Iranian origin. High polymorphism between analyzed accessions and extensive allelic variation were revealed using molecular markers associated with resistance genes. Majority of the markers localized in chromosomes 1D and 2D showed the diversity of banding patterns between accessions. Obtained results imply, that there is a moderate or high level of polymorphism in the genome of Ae

  8. Genetic variability among the brown rust resistant and susceptible genotypes of sugarcane by RAPD technique

    Science.gov (United States)

    Brown leaf rust in sugarcane is caused by Puccinia melanocephala (Syd. & P. Syd.), which is major cause of cultivar withdrawal. We attempted to analyze the RAPD diversity of two discrete phenotypic classes i.e. rust resistant (R) and rust susceptible (S) of six commercially available sugarcane elite...

  9. Genetic analysis of rust resistance genes in global wheat cultivars: an overview

    International Nuclear Information System (INIS)

    Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod

    2017-01-01

    Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding

  10. Non-nodulated bacterial leaf symbiosis promotes the evolutionary success of its host plants in the coffee family (Rubiaceae)

    DEFF Research Database (Denmark)

    Verstraete, Brecht; Janssens, Steven; Rønsted, Nina

    2017-01-01

    Every plant species on Earth interacts in some way or another with microorganisms and it is well known that certain forms of symbiosis between different organisms can drive evolution. Within some clades of Rubiaceae (coffee family), a specific plant-bacteria interaction exists in which non...

  11. Drinking Coffee

    DEFF Research Database (Denmark)

    Strøbæk, Pernille Solveig

    2015-01-01

    The chapter explores how coffee is an integral part of our daily life. Focusing on coffee drinking at home, at work, and on the go I show that coffee consumption is a social practice. The chapter illustrates through everyday examples that coffee is more than a caffeine drug. Coffee, with or without...... caffeine, is a social lubricant. We talk to each other and share emotions with one another as we share a cup of coffee. Coffee makes conversation and we embrace coffee, to stay or to go, in the daily rhythm of our busy and global social existence. The practice and sociality of coffee consumption provide...... the coffee industry with the opportunity to make money on our coffee preferences – indeed, also for those of us who actually dislike the taste of coffee. Would you prefer coffee mixed and stirred with non-coffee products such as salt, caramel and licorice? Then you are one of us in the modern age of coffee...

  12. Reação de cultivares de trigo à ferrugem da folha e mancha amarela e responsividade a fungicidas Reaction of wheat cultivars to leaf rust and yellow spot and responsiveness to fungicides

    Directory of Open Access Journals (Sweden)

    Nédio Rodrigo Tormen

    2013-02-01

    Full Text Available Com o objetivo de avaliar a reação de cultivares de trigo à ferrugem da folha, causada por Puccinia triticina, e mancha amarela, causada por Drechslera tritici-repentis, e sua responsividade ao controle químico com fungicidas, foi conduzido experimento de campo durante os invernos de 2009 e 2010, Itaara-RS. As cultivares avaliadas foram 'FCEP 51', 'FCEP 52', 'CD 114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' e 'OR Pampeano'; na safra 2010, a cultivar 'CD 114' foi substituída pela OR Quartzo. Os tratamentos avaliados foram: P1 - testemunha sem aplicação de fungicida; P2 - fempropimorfe (560g ha-1 de i.a.; P3 - azoxistrobina + ciproconazol (60+24g ha-1 de i.a.; e P4 - piraclostrobina + metconazol (60+97,5g ha-1 de i.a.. Após a segunda aplicação, efetuaram-se avaliações semanais de severidade das doenças, cujos dados foram utilizados para o cálculo da Área Abaixo da Curva de Progresso da Doença (AACPD. Também foram determinados a produtividade e o peso do hectolitro. No que se refere à suscetibilidade às doenças, as cultivares estudadas apresentaram respostas distintas de um ano para o outro. Para ferrugem, o comportamento mostrou-se similar em ambos os anos, enquanto que, para mancha amarela, houve variação. Quanto à resposta ao controle químico, ocorreram variações de acordo com o patógeno e com o grau de suscetibilidade das cultivares. O uso integrado de resistência genética e controle químico mostrou-se mais efetivo para ferrugem da folha.Aiming to evaluate the susceptibility of wheat cultivars to leaf rust and yellow spot and their responsiveness to chemical fungicides, two field trials were carried out, during 2009 and 2010 winter's. The cultivars evaluated were: 'FCEP 51', 'FCEP 52', 'CD114', 'FCEP Campo Real', 'FCEP Cristalino', 'FCEP Nova Era', 'OR Marfim', 'OR Abalone', 'OR Safira' and 'OR Pampeano'. In 2010, the 'CD 114' cultivar was replaced by Quartzo

  13. Reaction of Rust on Some Bread Wheat Varieties in Çukurova Region

    OpenAIRE

    AY, Hasan

    2013-01-01

    This study was conducted with 126 varieties of wheat between 2009-2010 years in Adana. There has not been artificially inoculated yellow, leaf and stem rusts. Races of rust in natural were evaluated in both years. Between 2009-2010 this study was conducted in Adana, with 126 varieties of bread wheat. In both years, only the natural environment leaf rust races inoculated for assessments reactions of bread wheat. According to results, 49 bread wheat varieties were found resistant, 6 bread wheat...

  14. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  15. Citronella essential oil in the control and activation of coffee plants defense response against rust and brown eye spot Óleo essencial de citronela no controle e na ativação de respostas de defesa do cafeeiro contra a ferrugem e cercosporiose

    Directory of Open Access Journals (Sweden)

    Ricardo Borges Pereira

    2012-08-01

    Full Text Available The rust and brown eye spot are the main coffee diseases. The losses are due to intense defoliation of plants, which has reduced its production and longevity. The brown eye spot also occurs in fruits, with negative effects on the beverage quality. Some essential oils have presented promising results in the control of plant diseases, as an alternative to the use of fungicides. The objective of this study was to evaluate citronella essential oil in the control of rust and brown eye spot and in the activation of coffee plants defense responses. Twelve-month-old plants were sprayed with citronella oil 1000 µL L-1, acibenzolar-S-methyl 200 mg L-1 and tebuconazole fungicide 200 mg L-1. Plants were inoculated with Hemileia vastatrix and Cercospora coffeicola seven days later. The application was repeated after 30 days. Plants with five months were sprayed with the same treatments to assess the induced defense responses. Citronella oil controlled rust and brown eye spot with efficiencies of 47.2% and 29.7%, respectively, while tebuconazole presented control of 96.5% and 90.5%, respectively. Acibenzolar-S-methyl reduced brown eye spot by 55.9% and showed no significant control of rust. Citronella oil increased peroxidase and chitinase activities in five months coffee plants 336, and 24 and 336 hours after spraying, respectively. Acibenzolar-S-methyl increased peroxidase, chitinase and ββ-1,3-glucanase activities 192, 288 and 336; 24 and; 240 hours after spraying, respectively. The treatments did not increase accumulation of phenols, but a significant increase in lignin was observed in plants sprayed with citronella oil.A ferrugem e a cercosporiose são as principais doenças de cafeeiro. Os prejuízos se devem a intensa desfolha das plantas que têm sua produção e longevidade reduzidas. A cercosporiose também ocorre nos frutos, com reflexos negativos na qualidade da bebida. Alguns óleos essenciais têm apresentado resultados promissores no

  16. Influência do zinco na incidência de doenças do cafeeiro Zinc influence on coffee diseases

    Directory of Open Access Journals (Sweden)

    Vicente Luiz de Carvalho

    2008-06-01

    Full Text Available Em cafeeiros, poucos estudos foram feitos relacionando aumento ou diminuição da resistência das plantas às doenças, com alteração dos níveis de nutrientes utilizados. Com este trabalho, objetivou-se estudar os efeitos do sulfato de zinco aplicado isoladamente, e associado com fungicidas e cloreto de potássio sobre a ferrugem, cercosporiose e manchas foliares do cafeeiro. O trabalho foi desenvolvido em uma lavoura de café em produção, onde foram testados oxicloreto de cobre, tebuconazole, sulfato de zinco + cloreto de potássio e sulfato de zinco e nas subparcelas foram realizadas diferentes concentrações de sulfato de zinco: ausência, 0,3 %, 0,6 % e 1,2 %. Verificou-se que os tratamentos com oxicloreto de cobre e tebuconazole reduziram a incidência e severidade de ferrugem, a incidência de cercosporiose, de manchas foliares (phoma e ascochyta e a desfolha, independente das concentrações de sulfato de zinco utilizadas. Concentrações de sulfato de zinco na faixa de 0,6 % - 0,75 % apresentaram menor severidade da ferrugem e o aumento nas concentrações de sulfato de zinco aumentou a incidência de cercosporiose, manchas foliares e a desfolha dos cafeeiros.The are few studies have been done related to the increase or decrease of disease resistance in coffee plants, with alteration from plant nutrient levels. The ain of this work was to verify the effect of zinc sulfate, applied either alone or in association with fungicides, and the effect of potassium chloride on coffee leaf rust, brown-eyes and leaf stains in coffee plants. Copper oxichloride, tebuconazole, sulfate of zinc + potassium chloride and sulfate of zinc were applied on plots and concentrations of zinc sulfate (0,0 %, 0,3 %, 0,6 % and 1,2 % were applied on sub plot. Treatments with copper and tebuconazole reduced the incidence and severity of rust, the incidence of brown-eyes and stains leaf (phoma and ascochyta and the defoliate independent of the zinc sulfate

  17. Genetic characterisation of novel resistance alleles to stem rust and stripe rust in wheat-alien introgression lines

    OpenAIRE

    Rahmatov, Mahbubjon

    2016-01-01

    Bread wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most important food crops world-wide, but is attacked by many diseases and pests that cause significant yield losses. Globally, stem rust (Sr) (Puccinia graminis f. sp. tritici Erikss & E. Henning), stripe rust (Yr) (Puccinia striiformis Westend. f. sp. tritici Eriks) and leaf rust (Lr) (Puccinia triticina Eriks) are a great threat to wheat production. The majority of the Sr, Yr and Lr resistance genes are already defeated...

  18. Aspectos anatômicos da variegação na folha do cafeeiro Anatomical features of leaf variegation in coffee plants

    Directory of Open Access Journals (Sweden)

    D. M. Dedecca

    1957-01-01

    , ao mesmo tempo que foi impedida a formação de um verdadeiro parênquima paliçádico. A grande atividade da gema apical dos cafeeiros que exibem êste tipo de variegação, tal como pode ser observada pelas freqüentes modificações na sua morfologia, conduziu essas plantas a um intenso desenvolvimento vegetativo, servindo de evidência em favor da hipótese de que distúrbios vários devem ter ocorrido durante o desenvolvimento daquelas fôlhas.Two different types of leaf variegation in coffee plants are studied on the anatomical viewpoint, and their histological differences are described, when compared with normal, green leaves. In the first case, variegated leaves are normal in shape and texture, and show different variegation patterns, being histologically identical with green leaves of normal plants. The variegation seems to be due to disturbances in the chlorophyll-producing mechanism, resulting in the formation of large, green and normal chloroplasts, aad small, yellowish and abnormal chloroplasts. The distribution at random of cells having one of these two kinds of chloroplasts can be accounted for the different variegation patterns observed. In the second example, the variegation pattern is uniform throughout the entire plant, and is a more complex phenomenon, since besides being variegated the leaves present several malformations. The anatomical study has revealed that, in this case, the chloroplasts are always normal, the variegation being rather due to the presence of an 1-3-layered hialine hypodermis, which occurs right beneath the upper epidermis. The malformations, represented by abnormalities in the shape and texture of the leaf blade, are mainly due to the lackness of a true palisade parenchyma. This tissue shows all grades of disorganization in the various portions of the leaf, being sometimes present as small patches or palisade cells or lacking completely in other instances. It is suggested that disturbances of any kind should have occurred

  19. Yield performance and leaf nutrient levels of coffee cultivars under different plant densities Produtividade e níveis foliares de nutrientes em cultivares de café sob diferentes populações de plantas

    Directory of Open Access Journals (Sweden)

    Edison Martins Paulo

    2010-12-01

    Full Text Available Coffee (Coffea Arabica L. plantations using adapted cultivars to regional environmental conditions with optimal plant population density and adequate nutrition are expected to show high yield responses. The triennial production and leaf macronutrient concentrations of four coffee cultivars were studied under different plant population densities. Catuaí Amarelo (IAC 47, Obatã (IAC 1669-20, Acaiá (IAC 474-19 and Icatu Amarelo (IAC 2944 were planted in densities of 2,500; 5,000; 7,519; and 10,000 plants ha-1 with one plant per hole and two plants per hole in the 2,500 plant ha-1. Plants were homogeneously fertilized without liming. As the population density increased the triennial coffee productivity increased, the yield per plant decreased, and leaf concentrations of phosphorus (P, potassium (K and sulfur (S increased. Coffee plants under dense systems presented equal or higher leaf macronutrient concentrations compared to the plants under conventional population. Taller cultivars presented the highest nutrient concentration values, and Obatã, a dwarf cultivar, the lowest values. Higher coffee yields and lower leaf P, Ca and S concentrations were observed in plots with one plant compared to the plots with two plants. In general, the coffee cultivars had leaf N and S concentrations above the reference limits reported in the literature, but leaf concentrations of other macronutrients were within adequate ranges.Cultivares de cafeeiro (Coffea Arabica L. adaptadas às regiões de cultivo, com população de plantas otimizada e adequado estado nutricional são premissas para a obtenção de produções elevadas de café. Estudou-se a produção trienal de café e o teor foliar de macronutrientes de cultivares de cafeeiro em função das densidades de plantio. Foram utilizados os cultivares Catuaí Amarelo (IAC 47, Obatã (IAC 1669-20, Acaiá (IAC 474-19 e Icatu Amarelo (IAC 2944 nas populações de 2.500 plantas ha-1 com duas plantas por cova; e, 5

  20. Green Coffee

    Science.gov (United States)

    ... coffee product Coffee Slender (Med-Eq Ltd., Tonsberg, Norway), lose an average of 2.5 to 3. ... might increase the risk of experiencing serious or life-threatening side effects such as high blood pressure, ...

  1. Morphology and AFLP markers suggest three Hordeum chilense ecotypes that differ in avoidance to rust fungi

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Aardse, A.; Buntjer, J.; Rubiales, D.; Martin, A.; Niks, R.E.

    2001-01-01

    In Hordeum chilense Roem. & Schult., a high variation in the level of avoidance to infection of barley leaf rust (Puccinia hordei Otth) occurs. Probably resulting from the properties of the stomata, the rust germ tube overgrows stomata, and the infection process fails in an early stage. In the

  2. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  3. Contribution of the genetic improvement to the development of the cultivation of Colombian coffee

    International Nuclear Information System (INIS)

    Moreno Ruiz, German

    1994-01-01

    After several years of study trying to obtain a variety of resistant coffee to the Rust, the variety Colombia was obtained, which is considered as the contribution more important that has made the genetic improvement to the cultivation of Colombian coffee and consequently to optimize the cultivations and to improve the environment

  4. Influence of yellow rust infection on /sup 32/P transport in detached barley leaves

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of /sup 32/P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general.

  5. Influence of yellow rust infextion on 32P transport in detached barley leaves

    International Nuclear Information System (INIS)

    Schubert, J.

    1982-01-01

    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of 32 P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general. (author)

  6. Coffee intake.

    Science.gov (United States)

    Cornelis, Marilyn C

    2012-01-01

    Coffee is one of the most widely consumed beverages in the world. Its widespread popularity and availability has fostered public health concerns of the potential health consequences of regular coffee consumption. Epidemiological studies of coffee intake and certain health outcomes have been inconsistent. The precise component of coffee potentially contributing to development of these conditions also remains unclear. One step toward addressing the challenges in studying the impact coffee has on health is a better understanding of the factors contributing to its consumption and physiological effects. This chapter focuses on those factors that are genetically determined and briefly summarizes progress in applying this knowledge to epidemiological studies of coffee and disease. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons

    International Nuclear Information System (INIS)

    Skorda, E.A.

    1977-01-01

    Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)

  8. New Rust Disease of Korean Willow (Salix koreensis) Caused by Melampsora yezoensis, Unrecorded Pathogen in Korea.

    Science.gov (United States)

    Yun, Yeo Hong; Ahn, Geum Ran; Yoon, Seong Kwon; Kim, Hoo Hyun; Son, Seung Yeol; Kim, Seong Hwan

    2016-12-01

    During the growing season of 2015, leaf specimens with yellow rust spots were collected from Salix koreensis Andersson, known as Korean willow, in riverine areas in Cheonan, Korea. The fungus on S. koreensis was identified as the rust species, Melampsora yezoensis , based on the morphology of urediniospores observed by light and scanning electron microscopy, and the molecular properties of the internal transcribed spacer rDNA region. Pathogenicity tests confirmed that the urediniospores are the causal agent of the rust symptoms on the leaves and young stems of S. koreensis . Here, we report a new rust disease of S. koreensis caused by the rust fungus, M. yezoensis , a previously unrecorded rust pathogen in Korea.

  9. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  10. HOW COFFEE COMPANIES CAN STAY COMPETITIVE

    OpenAIRE

    RALUCA DANIELA RIZEA; ROXANA SARBU; ELENA CONDREA

    2014-01-01

    The coffee shop industry in the U.S. includes 20,000 stores with combined annual revenue of about $11 billion. Major companies include Starbucks, Dunkin’ Donuts, Caribou, Coffee Bean and Tea Leaf, and Diedrich (Gloria Jean’s). The industry is highly concentrated at the top and fragmented at the bottom: the top 50 companies have over 70 percent of industry sales. Coffee is one of the world’s largest commodities. The top green coffee producing countries are Brazil, Colombia, and Vietnam. Many...

  11. Nonhost resistance to rust pathogens – a continuation of continua

    Directory of Open Access Journals (Sweden)

    Jan eBettgenhaeuser

    2014-12-01

    Full Text Available The rust fungi (order: Pucciniales are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina, which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1 the majority of accessions of a species being resistant to the rust or (2 the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host to complete immunity within a species (nonhost. In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  12. Nonhost resistance to rust pathogens – a continuation of continua

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J.

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant–pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens. PMID:25566270

  13. Nonhost resistance to rust pathogens - a continuation of continua.

    Science.gov (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J

    2014-01-01

    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  14. Characterization of rust, early and late leaf spot resistance in wild and cultivated peanut germplasm Caracterização da resistência à ferrugem, mancha preta e mancha castanha em germoplasma silvestre e cultivado de amendoim

    Directory of Open Access Journals (Sweden)

    Alessandra Pereira Fávero

    2009-02-01

    Full Text Available Groundnut (Arachis hypogaea has an AB genome and is one of the most important oil crops in the world. The main constraints of crop management in Brazil are fungal diseases. Several species of the genus Arachis are resistant to pests and diseases. The objective of our experiments was to identify wild species belonging to the taxonomic section Arachis with either A or B (or " non-A" genomes that are resistant to early leaf spot (Cercospora arachidicola, late leaf spot (Cercosporidium personatum and rust (Puccinia arachidis. For the identification of genotypes resistant to fungal diseases, bioassays with detached leaves were done in laboratory conditions, with artificial inoculation, a controlled temperature of 25ºC and a photoperiod of 10 h light/14 h dark, for 20-42 days, depending on the fungi species. Most of the accessions of wild species were more resistant than accessions of A. hypogaea for one, two or all three fungi species studied. Arachis monticola, considered to be a possible tetraploid ancestor or a derivative of A. hypogaea, was also more susceptible to Cercosporidium personatum and Puccinia arachidis, as compared to most of the wild species. Therefore, wild germplasm accessions of both genome types are available to be used for the introgression of resistance genes against three fungal diseases of peanut.O amendoim (Arachis hypogaea possui genoma AB e é uma das mais importantes culturas oleaginosas em todo o mundo. Os principais problemas da cultura no Brasil são as doenças fúngicas. Várias espécies do gênero Arachis são resistentes a pragas e doenças. Este trabalho visou a identificar espécies silvestres pertencentes à seção Arachis associadas aos genomas A ou B (ou " não-A" do amendoim que são resistentes à mancha castanha (Cercospora arachidicola, mancha preta (Cercosporidium personatum e ferrugem (Puccinia arachidis. Para a identificação de genótipos resistentes a doenças fúngicas, bioensaios utilizando

  15. Commandra Blister Rust

    Science.gov (United States)

    David W. Johnson

    1986-01-01

    Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.

  16. Progresso da ferrugem e da cercosporiose em cafeeiro (coffea arabica l. Com diferentes épocas de início e parcelamentos da fertirrigação Progress of coffee rust and brown eye spot with differents periods at initial irrigation and fertirrigation time

    Directory of Open Access Journals (Sweden)

    Viviane Talamini

    2003-02-01

    .Evaluations of incidence of rust (Hemileia vastatrix Berk. & Br. and brown eye spot (Cercospora coffeicola Berk. & Cooke took place at intervals of 14 days, observing 6 leaves per plant during the period from March 21, 1998 to February 6, 1999 in a 'Catuai' culture. The objective was to evaluate the effect of irrigation and fertirrigation on the incidence of rust and in 12 year coffee plants and analyze the progress curve of these diseases and their correlation to climatic variables. The experimental design was the one of randomized blocks with four treatments of different fertilizer splitting (1: 12 hand applications, 2:12 applications via fertirrigation, 3: 24 fertirrigated applications, 4: 36 fertirrigated applications. The plots were divided in 3 subplots that received treatments in different periods at initial irrigation (subplots A: June 1, B: July 15, C: September 1, and 2 checks (additional treats 1: fertilized 4 times and not irrigated, additional treats 2: conventional fertilizer and not irrigated. The area under disease progress curve (AUDPC was calculated and submitted to variance analysis and Tukey's test at 5% probability. For the coffee rust, no treatment was significant. Curve progress showed maximum incidences in the months of July and September. There was a significant correlation at 1% probability among all the treatments and climatic variables, with the exception of the maximum temperature. For brown eye spot, the treatments attributed to the plots and to the subplots were significant at 1% of probability. However, the interaction between the two was non-significant. Greater AUDPC in splitting fertilizer 2 and 4 was observed. In the subplots, greater AUDPC in check E following for D was observed. Curve progress showed maximum incidences from May to July. There was a significant correlation of brown eye spot incidence in the majority of the treatments in relation to climatic variables.

  17. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

    Science.gov (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

    2014-04-01

    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  18. Wheat Rust Toolbox Related to New Initiatives on Yellow Rust

    DEFF Research Database (Denmark)

    Hansen, Jens Grønbech; Lassen, Poul

    ://www.fao.org/agriculture/crops/rust/stem/rust-report/en/). The Wheat rust toolbox is one of several International research platforms hosted by Aarhus University, and it uses the same ICT framework and databases as EuroWheat (www.eurowheat.org) and EuroBlight (www.EuroBlight.net). The Wheat Rust Toolbox will also serve the Global Rust Reference Centre (GRRC) as well...... – 2009), and as soon as possible this will be expanded to cover all global yellow rust data available via the GRRC. The presentation will focus on experiences from the previous work on global databases and web based information systems, as well as propose ideas how the toolbox can be helpful regarding...

  19. Genetic and environmental variation in rust frequency on mature mountain birch trees

    Energy Technology Data Exchange (ETDEWEB)

    Elamo, Pirjo; Saloniemi, Irma; Helander, M.L.; Neuvonen, Seppo [Turku Univ. (Finland). Dept. of Biology) and (Kevo Subarctic Research Inst., Turku (Finland)

    2000-07-01

    This study investigated genetic and environmental variation in the frequency of birch rust, the most important leaf disease of birch species, The same half-sib families of mature mountain birch trees were studied in two areas corresponding to their natural growing habitats over 3 yrs. The frequency of birch rust was examined both in the field and from detached leaves inoculated in the laboratory. The frequency of birch rust varied among the mountain birch families. However, the heritability of birch rust resistance was found to be fairly low, with the heritability of naturally occurring birch rust varying between 0.27 and 0.41. The frequency of birch rust varied highly between the two study areas and among study years. Nevertheless, the relative frequency of birch rust among tree individuals and tree families remained similar and as a result no notable genotype x environment interaction was observed. The field and in vitro results differed with respect to the ranking of birch families by birch rust resistance.

  20. HOW COFFEE COMPANIES CAN STAY COMPETITIVE

    Directory of Open Access Journals (Sweden)

    RALUCA DANIELA RIZEA

    2014-04-01

    Full Text Available The coffee shop industry in the U.S. includes 20,000 stores with combined annual revenue of about $11 billion. Major companies include Starbucks, Dunkin’ Donuts, Caribou, Coffee Bean and Tea Leaf, and Diedrich (Gloria Jean’s. The industry is highly concentrated at the top and fragmented at the bottom: the top 50 companies have over 70 percent of industry sales. Coffee is one of the world’s largest commodities. The top green coffee producing countries are Brazil, Colombia, and Vietnam. Many grower countries are small, poor developing nations that depend on coffee to sustain local economies. The U.S. is the world’s largest importer of green coffee beans and the largest consumer of coffee. The main objective of this study is to investigate the competitive strategies that U.S. coffee franchise companies adopt considering customers’ expectations and industry best practices. In order to achieve this objective, a best practice benchmarking analysis was performed taking into account the top U.S. coffee companies This analysis showed that product and service innovation are necessary in order to stay competitive in the market and attract new or to keep existing customers successfully. Many customers focus on the special atmosphere each store has and which is characterized by the location, music, interior design, seating or whether internet access is provided. Particularly for specialty coffee shops it is important not to sell only the beverage but the whole experience. Coffee shops have to establish a unique image that prevents customers from buying products from another shop or use home-brewing systems which are also on the rise in American households. In addressing the increased level of competition, every company’s focus should be on differentiating from the rest of the market in every possible business segment (products, atmosphere, location, image etc..

  1. Coffee leaf and stem anatomy under boron deficiency Anatomia de ramos e folhas de cafeeiro sob feficiência de boro

    Directory of Open Access Journals (Sweden)

    Ciro Antonio Rosolem

    2007-06-01

    Full Text Available Boron deficiency in coffee is widely spread in Brazilian plantations, but responses to B fertilizer have been erratic, depending on the year, form and time of application and B source. A better understanding of the effects of B on plant physiology and anatomy is important to establish a rational fertilization program since B translocation within the plant may be affected by plant anatomy. In this experiment, coffee plantlets of two varieties were grown in nutrient solutions with B levels of 0.0 (deficient, 5.0 µM (adequate and 25.0 µM (high. At the first symptoms of deficiency, leaves were evaluated, the cell walls separated and assessed for B and Ca concentrations. Scanning electron micrographs were taken of cuts of young leaves and branch tips. The response of both coffee varieties to B was similar and toxicity symptoms were not observed. Boron concentrations in the cell walls increased with B solution while Ca concentrations were unaffected. The Ca/B ratio decreased with the increase of B in the nutrient solution. In deficiency of B, vascular tissues were disorganized and xylem walls thinner. B-deficient leaves had fewer and deformed stomata.A deficiência de B é muito comum nos cafezais brasileiros, mas as respostas do cafeeiro ao B têm sido erráticas, dependendo do ano, do modo e época de aplicação e, ainda, da fonte de B empregada. Um melhor entendimento dos efeitos do B na fisiologia e anatomia do cafeeiro é importante para o desenvolvimento de um programa racional de adubação boratada, uma vez que a anatomia da planta pode influenciar a translocação do nutriente. Neste experimento, plantas de dois cultivares foram cultivadas em soluções nutritivas com 0,0 (deficiente, 5,0 (adequado e 25,0 µM (alto de B. Quando os primeiros sintomas de deficiência apareceram, as folhas foram cortadas e tiveram suas paredes celulares isoladas e analisadas quanto aos teores de B e Ca. Cortes foram feitos em folhas novas e no ápice de

  2. Photosynthetic and antioxidative alterations in coffee leaves caused by epoxiconazole and pyraclostrobin sprays and Hemileia vastatrix infection.

    Science.gov (United States)

    Honorato Júnior, J; Zambolim, L; Aucique-Pérez, C E; Resende, R S; Rodrigues, F A

    2015-09-01

    Coffee leaf rust (CLR), caused by Hemileia vastatrix, is a major disease affecting coffee production worldwide. In this study, an in-depth analysis of the photosynthetic performance of coffee leaves challenged or not with H. vastatrix and sprayed with either epoxiconazole (EPO) or pyraclostrobin (PYR) was performed by combining chlorophyll a fluorescence images, photosynthetic pigment pools and the activities of chitinase (CHI), β-1,3-glucanase (GLU), peroxidase (POX) and catalase (CAT). The CLR severity was higher in the control plants, but reduced in plants sprayed with both PYR and EPO. Also, the CLR severity was reduced in plants sprayed with PYR compared with plants sprayed with EPO. Plants sprayed with either EPO or PYR showed maximal photosystem II quantum efficiency (Fv/Fm) values ranging from 0.78 to 0.80, which were quite similar to those obtained with inoculated plants (values ranging from 0.74 to 0.77). The decreases in the Fv/Fm ratio values and parallel increases in the F0 values in the inoculated plants, which were not observed in the control plants (sprayed with water) and were confirmed by images of the initial fluorescence (F0) and Fv/Fm parameters in the regions of the leaf tissue containing pustules and in the asymptomatic leaf tissue, indicated that photosynthesis was negatively impacted. When effective photosystem II quantum yield (Y(II)) values approached zero with a high photosynthetic photon flux density, high values of quantum yield of regulated energy dissipation (Y(NPQ)) in association with a high carotenoid concentration were noted in the inoculated plants sprayed either with PYR or EPO. The increased CLR severity in inoculated plants in contrast to inoculated plants sprayed with either PYR or EPO was associated with greater POX activity and a reduced photosynthetic pigment concentration. POX and CAT activities were increased in inoculated plants sprayed with either EPO or PYR when compared with control plants. CHI and GLU activities

  3. Effector proteins of rust fungi.

    Science.gov (United States)

    Petre, Benjamin; Joly, David L; Duplessis, Sébastien

    2014-01-01

    Rust fungi include many species that are devastating crop pathogens. To develop resistant plants, a better understanding of rust virulence factors, or effector proteins, is needed. Thus far, only six rust effector proteins have been described: AvrP123, AvrP4, AvrL567, AvrM, RTP1, and PGTAUSPE-10-1. Although some are well established model proteins used to investigate mechanisms of immune receptor activation (avirulence activities) or entry into plant cells, how they work inside host tissues to promote fungal growth remains unknown. The genome sequences of four rust fungi (two Melampsoraceae and two Pucciniaceae) have been analyzed so far. Genome-wide analyses of these species, as well as transcriptomics performed on a broader range of rust fungi, revealed hundreds of small secreted proteins considered as rust candidate secreted effector proteins (CSEPs). The rust community now needs high-throughput approaches (effectoromics) to accelerate effector discovery/characterization and to better understand how they function in planta. However, this task is challenging due to the non-amenability of rust pathosystems (obligate biotrophs infecting crop plants) to traditional molecular genetic approaches mainly due to difficulties in culturing these species in vitro. The use of heterologous approaches should be promoted in the future.

  4. Crown rust control on oats

    International Nuclear Information System (INIS)

    Frey, K.J.; Browning, J.A.; Simons, M.D.

    1976-01-01

    Attempts have been made to test the relative effectiveness of EMS treatment for inducing tolerance to crown rust among oat strains Clintland-60 of different ploidy levels. One strain of diploid and one of tetraploid oats were treated with EMS. These two strains are as susceptible to damage from crown rust as are cultivars of hexaploid oats. Multiline cultivars of oats have been shown to provide adequate protection from economic loss due to crown-rust disease in Iowa. Since 1968, eleven multiline cultivars of oats have been released from the Iowa station for use in commercial production in the midwestern USA. During the past two winter seasons, the effectiveness of multiline oat cultivars against crown-rust disease has been researched in Texas, USA, which has a ''long rust season'' of about four months, not an Iowa ''short rust season''. The protection against crown rust afforded by the multiline cultivars appeared equally good in Texas and Iowa. The seasonal productions of crown-rust spores relative to completely resistant and susceptible checks were nearly identical in both environments. Fifteen new isolines of oats have been developed for use in multiline varieties, with seed supplies sufficiently large for immediate use

  5. Simple Sequence Repeat Analysis of Selected NSIC-registered Coffee Varieties in the Philippines

    Directory of Open Access Journals (Sweden)

    Daisy May C. Santos

    2016-06-01

    Full Text Available Coffee (Coffea sp. is an important commercial crop worldwide. Three species of coffee are used as beverage, namely Coffea arabica, C. canephora, and C. liberica. Coffea arabica L. is the most cultivated among the three coffee species due to its taste quality, rich aroma, and low caffeine content. Despite its inferior taste and aroma, C. canephora Pierre ex A. Froehner, which has the highest caffeine content, is the second most widely cultivated because of its resistance to coffee diseases. On the other hand, C. liberica W.Bull ex Hierncomes is characterized by its very strong taste and flavor. The Philippines used to be a leading exporter of coffee until coffee rust destroyed the farms in Batangas, home of the famous Kapeng Barako. The country has been attempting to revive the coffee industry by focusing on the production of specialty coffee with registered varieties on the National Seed Industry Council (NSIC. Correct identification and isolation of pure coffee beans are the main factors that determine coffee’s market value. Local farms usually misidentify and mix coffee beans of different varieties, leading to the depreciation of their value. This study used simple sequence repeat (SSR markers to evaluate and distinguish Philippine NSIC-registered coffee species and varieties. The neighbor-joining tree generated using PAUP showed high bootstrap support, separating C. arabica, C. canephora, and C. liberica from each other. Among the twenty primer pairs used, seven were able to distinguish C. arabica, nine for C. liberica, and one for C. canephora.

  6. Inibição da tripsina de bicho-mineiro do cafeeiro por um fator não-protéico presente em extratos de folhas de mamona Coffee leaf miner trypsin inhibition with castor bean leaf extracts mediated by a non-protein agent

    Directory of Open Access Journals (Sweden)

    Guilherme Duarte Rossi

    2010-04-01

    insects is a control form whose efficacy was verified by different authors. In order to observe the efficiency of castor bean leaf extracts in inhibiting trypsin-like enzymes of the coffee leaf miner, an experiment was carried out with the purpose of observing an "in vitro" inhibition phenomenon. The results of the trypsin inhibition tests with normal and boiled with and without β-mercaptoethanol 0.2% (v/v castor bean leaf extracts and the results of the acetone precipitation process indicated that the inhibitor is a heat-resistant molecule and it is not a protein. This way, the purification process was made by adsorption chromatography with later analysis in mass spectrometer. The reached results indicated that the presence of a trypsin inhibitor of the coffee leaf miner in the castor bean leaf extracts is capable of inhibiting 2.48 + 0.15 UTI, which stands for about 40% of inhibition. Tests performed with bovine trypsin indicated that the castor bean leaf extract have no inhibiting power on this enzyme.

  7. Physiological measurements of coffee young plants coexisting with sourgrass

    Directory of Open Access Journals (Sweden)

    Pedro Luis da Costa Aguiar Alves

    2012-03-01

    Full Text Available Coffee is an important crop planted in Brazil and commonly infested by sourgrass plants. Crescent densities of sourgrass growing with coffee young plants were maintained up to weed full flowering when physiological measurements were performed in the crop to evaluate photosynthetic coffee plant responses to increasing of weed competition. Experiments were arranged in a completely randomized design with seven replicates. The concentration of CO2 within the leaf, the leaf transpiration, the stomatal conductance, the CO2 assimilation rate, and the ratio Fv/Fm of coffee plants were not affected by increasing of sourgrass density. On the other hand, relative content of total chlorophyll was reduced by 13.9% in the density of 8 sourgrass plants. Gas exchange and fluorescence of chlorophyll of young coffee plants were not dependent on increasing of the intensity of competition while an opposite response occurred for chlorophyll content.

  8. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  9. Analysis of coffee (Coffea arabica L.) performance in relation to radiation level and rate of nitrogen supply II. Uptake and distribution of nitrogen, leaf photosynthesis and first bean yields

    NARCIS (Netherlands)

    Bote, Adugna Debela; Zana, Zewdneh; Ocho, Fikre L.; Vos, Jan

    2018-01-01

    Natural supply of nitrogen is often limiting coffee production. From the viewpoints of growth and biomass production, adequate nitrogen supply is important. Growing coffee under full sunlight not only enhances potential yields but also increases demands for nitrogen fertilizer, the extent of which

  10. Protecting steel from rusting by rust. The mechanism of rust formation and its control

    International Nuclear Information System (INIS)

    Kimura, Masao

    2008-01-01

    Weathering steel, when exposed outdoors for a few years, forms a protective layer resulting in reduction of the corrosion rate. The state of rusts is fundamental for understanding its mechanisms, but the structure and its relationship with the mechanism have not been understood. In this study, a new crystallographic approach was applied to reveal nano-structure of rusts with using of X-ray synchrotron radiation. It has been shown that additional elements alter the corrosion process in its early stage, resulting in formation of protective rusts. (author)

  11. Sensory Description of Cultivars (Coffea Arabica L. Resistant to Rust and Its Correlation with Caffeine, Trigonelline, and Chlorogenic Acid Compounds

    Directory of Open Access Journals (Sweden)

    Larissa de Oliveira Fassio

    2016-01-01

    Full Text Available Considering the importance of the chemical compounds in Arabica coffee beans in the definition of the drink sensory quality and authentication of coffee regions, the aim of this study was to evaluate, from principal component analysis—PCA—if there is a relation between the caffeine, trigonelline, and chlorogenic acid (5-CQA content and the sensory attributes of the drink, and in this context, enabling the differentiation of cultivars in two coffee-producing regions of Brazil. We evaluated seven rust-resistant Coffea arabica cultivars, and two rust-susceptible cultivars in two cultivation environments: Lavras, in the southern region of Minas Gerais state, and Patrocinio in the Cerrado region of Minas Gerais. The flavor and acidity were determinant for differentiation of the cultivars and their interaction with the evaluated environments. Cultivars Araponga MG1, Catigua MG2, and Catigua MG1 are the most suitable for the production of specialty coffee in the state of Minas Gerais. A poor correlation was found between caffeine, trigonelline, 5-CQA contents, and fragrance, flavor, acidity, body, and final score attributes. However, these compounds enabled the differentiation of the environments. The PCA indicated superiority in the sensory quality of cultivars resistant to rust, compared to the control, Bourbon Amarelo, and Topázio MG1190.

  12. Microclimate and development of 'Conilon' coffee intercropped with rubber trees

    Directory of Open Access Journals (Sweden)

    Fábio Luiz Partelli

    2014-11-01

    Full Text Available The objective of this work was to evaluate the influence of intercropping 'Conilon' coffee (Coffea canephora with rubber trees on coffee tree microclimate, nutrition, growth, and yield. Rubber trees were planted in two double rows 33 m apart, with 4x2.3 m spacing between plants. Treatments consisted of the distances from the coffee plants to the rubber trees: 3, 6, 9, 12, and 15 m. Measurements of atmospheric variables (temperature, irradiance, and relative humidity, leaf nutrient concentration, internode length of plagiotropic and orthotropic branches, individual leaf area, chlorophyll content, and yield were performed. Intercropping promotes changes in the microclimatic conditions of coffee plants close to rubber trees, with reduction of temperature and irradiance level and increase in air relative humidity. The proximity of the coffee tree to the rubber trees promotes the elongation of the plagiotropic and orthotropic branches and increases the individual leaf area; however, it does not affect leaf concentrations of N, K, Mg, Fe, Zn, and B in 'Conilon' coffee and does not have a negative impact on yield.

  13. Smashing CoffeeScript

    CERN Document Server

    Hudson, Alex

    2013-01-01

    Brew the perfect code with CoffeeScript If you're familiar with JavaScript and the often-frustrating process of creating complex applications, a nice cup of CoffeeScript can help. CoffeeScript is a programming language that compiles into JavaScript and simplifies the entire development process. Now you can tap the full power of CoffeeScript with Smashing CoffeeScript. This full-color, practical book explains CoffeeScript language, syntax, and processes, and will soon have you producing concise and quality code. Ultimately, you'll create RIAs and mobile apps faster, with less

  14. In situ hybridization for the detection of rust fungi in paraffin embedded plant tissue sections.

    Science.gov (United States)

    Ellison, Mitchell A; McMahon, Michael B; Bonde, Morris R; Palmer, Cristi L; Luster, Douglas G

    2016-01-01

    Rust fungi are obligate pathogens with multiple life stages often including different spore types and multiple plant hosts. While individual rust pathogens are often associated with specific plants, a wide range of plant species are infected with rust fungi. To study the interactions between these important pathogenic fungi and their host plants, one must be able to differentiate fungal tissue from plant tissue. This can be accomplished using the In situ hybridization (ISH) protocol described here. To validate reproducibility using the ISH protocol, samples of Chrysanthemum × morifolium infected with Puccinia horiana, Gladiolus × hortulanus infected with Uromyces transversalis and Glycine max infected with Phakopsora pachyrhizi were tested alongside uninfected leaf tissue samples. The results of these tests show that this technique clearly distinguishes between rust pathogens and their respective host plant tissues. This ISH protocol is applicable to rust fungi and potentially other plant pathogenic fungi as well. It has been shown here that this protocol can be applied to pathogens from different genera of rust fungi with no background staining of plant tissue. We encourage the use of this protocol for the study of plant pathogenic fungi in paraffin embedded sections of host plant tissue.

  15. Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

    International Nuclear Information System (INIS)

    Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

    2014-01-01

    The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

  16. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi.

    Directory of Open Access Journals (Sweden)

    Diane G O Saunders

    Full Text Available Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i contain a secretion signal, (ii are encoded by in planta induced genes, (iii have similarity to haustorial proteins, (iv are small and cysteine rich, (v contain a known effector motif or a nuclear localization signal, (vi are encoded by genes with long intergenic regions, (vii contain internal repeats, and (viii do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.

  17. High throughput transcriptome analysis of coffee reveals prehaustorial resistance in response to Hemileia vastatrix infection.

    Science.gov (United States)

    Florez, Juan Carlos; Mofatto, Luciana Souto; do Livramento Freitas-Lopes, Rejane; Ferreira, Sávio Siqueira; Zambolim, Eunize Maciel; Carazzolle, Marcelo Falsarella; Zambolim, Laércio; Caixeta, Eveline Teixeira

    2017-12-01

    We provide a transcriptional profile of coffee rust interaction and identified putative up regulated resistant genes Coffee rust disease, caused by the fungus Hemileia vastatrix, is one of the major diseases in coffee throughout the world. The use of resistant cultivars is considered to be the most effective control strategy for this disease. To identify candidate genes related to different mechanism defense in coffee, we present a time-course comparative gene expression profile of Caturra (susceptible) and Híbrido de Timor (HdT, resistant) in response to H. vastatrix race XXXIII infection. The main objectives were to obtain a global overview of transcriptome in both interaction, compatible and incompatible, and, specially, analyze up-regulated HdT specific genes with inducible resistant and defense signaling pathways. Using both Coffea canephora as a reference genome and de novo assembly, we obtained 43,159 transcripts. At early infection events (12 and 24 h after infection), HdT responded to the attack of H. vastatrix with a larger number of up-regulated genes than Caturra, which was related to prehaustorial resistance. The genes found in HdT at early hours were involved in receptor-like kinases, response ion fluxes, production of reactive oxygen species, protein phosphorylation, ethylene biosynthesis and callose deposition. We selected 13 up-regulated HdT-exclusive genes to validate by real-time qPCR, which most of them confirmed their higher expression in HdT than in Caturra at early stage of infection. These genes have the potential to assist the development of new coffee rust control strategies. Collectively, our results provide understanding of expression profiles in coffee-H. vastatrix interaction over a time course in susceptible and resistant coffee plants.

  18. Toxicity of organic farming‑compatible products to the coffee leaf miner Toxicidade de produtos compatíveis com a agricultura orgânica ao bicho‑mineiro do cafeeiro

    Directory of Open Access Journals (Sweden)

    Madelaine Venzon

    2013-03-01

    Full Text Available The objective of this work was to evaluate the toxicity of organic farming‑compatible products to the coffee leaf miner Leucoptera coffeella. Lime sulphur, enriched Bordeaux mixture (Viça Café Plus, and the "supermagro" biofertilizer were first tested in laboratory. The most promising product was tested afterwards under field conditions. In laboratory, different concentrations of each product were applied on L. coffeella eggs and on infested coffee‑mined leaves. Only lime sulphur had ovicidal effects at an acceptable concentration (1.6% for field applications, but no significant effect on larvae mortality was found. Enriched Bordeaux mixture and the "supermagro" biofertilizer had no effect on L. coffeella eggs and larvae. In the field trial, biweekly or monthly sprayings of lime sulphur at different concentrations caused population decrease after 30 days; however, this effect was not significant after 60 or 90 days.O objetivo deste trabalho foi avaliar a toxicidade de produtos compatíveis com a agricultura orgânica ao bicho‑mineiro Leucoptera coffeella. A calda sulfocálcica, a calda Viçosa comercial (Viça Café Plus e biofertilizante supermagro foram testados inicialmente em laboratório. O produto mais eficaz foi posteriormente testado em condições de campo. Em laboratório, diferentes concentrações de cada produto foram aplicadas sobre ovos de L. coffeella e sobre folhas de café infestadas com o bicho‑mineiro. Apenas a calda sulfocálcica teve efeito ovicida a uma concentração (1,6%, viável para aplicação no campo; porém, sem nenhum efeito significativo sobre a mortalidade das larvas. A calda Viçosa comercial e o biofertilizante supermagro não tiveram efeito sobre ovos e larvas de L. coffeella. No experimento de campo, a pulverização quinzenal ou mensal de diferentes concentrações da calda causou a redução da população 30 dias após a aplicação; no entanto, esse efeito não foi significativo após 60 ou 90

  19. Coffee seed physiology

    NARCIS (Netherlands)

    Eira, M.T.S.; Silva, da E.A.A.; Castro, de R.D.; Dussert, S.; Walters, C.; Bewley, J.D.; Hilhorst, H.W.M.

    2006-01-01

    Coffee is a member of the Rubiaceae family and the genus Coffea. There are more than 70 species of coffee but only two are economically important: Coffea arabica L. and Coffea canephora Pierre; 70 % of the coffee traded in the world is arabica and 30 % is robusta (C. canephora). Other species such

  20. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases

    Science.gov (United States)

    Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031

  1. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Science.gov (United States)

    Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C

    2016-01-01

    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  2. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Directory of Open Access Journals (Sweden)

    Sundeep Kumar

    Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  3. Variação sazonal do potencial da água nas folhas de cafeeiro em Mococa, SP Seasonal changes in coffee leaf water potential in Mococa, São Paulo State, Brazil

    Directory of Open Access Journals (Sweden)

    Emilio Seigui Kobayashi

    2008-01-01

    Full Text Available Para avaliar o potencial da água nas plantas de Coffea arabica L., foi desenvolvido um experimento em Mococa (SP, de agosto de 2005 a julho de 2006, com as cultivares Mundo Novo (MN, Obatã (OB e Ouro-Verde (OV. As cultivares OB e OV tinham oito anos de idade, e as plantas do MN haviam sido recepadas há cinco anos. Os espaçamentos entre as plantas de MN, OB e OV foram de 3,6 x 1,0 m; 2,5 x 1,0 m e 3,5 x 0,74 m respectivamente. As avaliações dos potenciais da água das plantas na antemanhã (ψam foram realizadas a cada duas semanas. O potencial da água na folha durante o período diurno (ψa foi medido no final de abril. Os dados de ψam na folha variaram em função da quantidade de água no solo, com as oscilações decorrentes da precipitação pluvial sazonal. Os valores de ψam foram de -1,29; -1,60 e -1,68 MPa nos meses de estiagem e -0,06; -0,07 e -0,07 MPa nos meses de maiores precipitações para MN, OB e OV respectivamente. Esses valores são importantes para caracterizar o estado hídrico das folhas do cafeeiro ao longo do ano agrícola, visto que o período de estresse hídrico coincidiu com a fase de indução (fevereiro a junho e maturação das gemas florais, bem como o período de maiores volumes de precipitação pluvial com a granação e maturação dos frutos.In order to assess the xylem water potential in Coffea arabica L. plants, a field experiment was carried out in Mococa, São Paulo State, Brazil, from August 2005 to July 2006 with the following cultivars: Mundo Novo (MN, Obatã (OB and Ouro-Verde (OV. The OB and OV cultivars were eight years old, and MN plants had been topped five years ago. Spacing among the plants were 3.6 x 1.0 m, 2.5 x 1.0 m and 3.5 x 0.75 m, respectively. Predawn leaf water potential (ψam was measured each 15 days. Xylem water potential along the day (ψa was measured at the end of April. Data concerning leaf ψam varied according to the soil water profile as affect by seasonal rainfall.

  4. Soil phosphorus dynamics and availability and irrigated coffee yield

    Directory of Open Access Journals (Sweden)

    Thiago Henrique Pereira Reis

    2011-04-01

    Full Text Available Research data have demonstrated that the P demand of coffee (Coffea arabica L. is similar to that of short-cycle crops. In this context, the objective of this study was to evaluate the influence of annual P fertilization on the soil P status by the quantification of labile, moderately labile, low-labile, and total P fractions, associating them to coffee yield. The experiment was installed in a typical dystrophic Red Latosol (Oxisol cultivated with irrigated coffee annually fertilized with triple superphosphate at rates of 0, 50, 100, 200, and 400 kg ha-1 P2O5. Phosphorus fractions were determined in two soil layers: 0-10 and 10-20 cm. The P leaf contents and coffee yield in 2008 were also evaluated. The irrigated coffee responded to phosphate fertilization in the production phase with gains of up to 138 % in coffee yield by the application of 400 kg ha-1 P2O5. Coffee leaf P contents increased with P applications and stabilized around 1.98 g kg-1, at rates of 270 kg ha-1 P2O5 and higher. Soil P application caused, in general, an increase in bioavailable P fractions, which constitute the main soil P reservoir.

  5. Rusted Designs: The New Apron

    OpenAIRE

    Swindells, Steve; Burcikova, Mila

    2013-01-01

    Articulated as a practice of design-couture, conceptualized as a project that seeks a sense \\ud of social engagement through research, design and making of everyday ‘common couture’, \\ud Rusted puts craft action in a very close relation with daily (political) or practical life. Rusted \\ud designs collage pre-used fabric and clothing (found, bought or gifted) with new cloth, thus \\ud using items of fabric and clothing from different times, countries and with variety of social \\ud histories. Th...

  6. Coffee and Liver Disease.

    Science.gov (United States)

    Wadhawan, Manav; Anand, Anil C

    2016-03-01

    Coffee is the most popular beverage in the world. Consumption of coffee has been shown to benefit health in general, and liver health in particular. This article reviews the effects of coffee intake on development and progression of liver disease due to various causes. We also describe the putative mechanisms by which coffee exerts the protective effect. The clinical evidence of benefit of coffee consumption in Hepatitis B and C, as well as nonalcoholic fatty liver disease and alcoholic liver disease, has also been presented. Coffee consumption is associated with improvement in liver enzymes (ALT, AST, and GGTP), especially in individuals with risk for liver disease. Coffee intake more than 2 cups per day in patients with preexisting liver disease has been shown to be associated with lower incidence of fibrosis and cirrhosis, lower hepatocellular carcinoma rates, as well as decreased mortality.

  7. Fusiform Rust of Southern Pines

    Science.gov (United States)

    W. R. Phelps; F. L. Czabator

    1978-01-01

    Fusiform rust, caused by the fungus Cronartium fusiforme Hedg. & Hunt ex Cumm., is distributed in the Southern United States from Maryland to Florida and west to Texas and southern Arkansas. Infections by the fungus, which develops at or near the point of infection, result in tapered, spindle-shaped swells, called galls, on branches and stems of pines. (see photo...

  8. Characterization of mild steel pre rusted and rust converted surfaces through advanced electrochemical analysis

    International Nuclear Information System (INIS)

    Riaz, F.; Rizvi, Z.H.; Arshad, K.

    2008-01-01

    The present work evaluates the anti corrosive properties of a tannin based rust converter applied on the pre rusted steel coupons as compared with the grit blasted bare metal and pre rusted steel coupons. The mechanism and the corrosion control behaviour of the rust converter are characterized and monitored using EIS technique. The result suggested that when the tannin based rust converter applied on the pre rusted/corroded coupon, the protection properties of the mild steel coupon clearly improved because of the more compact conversion layer being formed on the coupon. It is inferred that the rust converter can be applied on the pre rusted samples as an alternative technique to the surface preparation for protection purpose. (author)

  9. Anatomia foliar e potencial hídrico na tolerância de cultivares de café ao estresse hídrico Leaf anatomy and water potential in the coffee cultivars tolerance to water stress

    Directory of Open Access Journals (Sweden)

    Luiz Antônio Batista

    2010-09-01

    Full Text Available A cultura do café é de expressiva importância no mercado internacional, com uma produção anual de cerca de 120 milhões de sacas beneficiadas e no Brasil, é responsável pela geração de mais de dez milhões de empregos diretos e indiretos. O estresse hídrico é um fator ambiental que pode ser extremamente prejudicial para a cultura do café, sendo que a seleção de cultivares tolerantes é de grande importância, principalmente diante da expansão da cafeicultura brasileira para áreas consideradas marginais para o cultivo do café por estarem sujeitos à deficiência hídrica. Nesse trabalho foram avaliadas 15 cultivares de Coffea arabica quanto ao status hídrico e às características da estrutura interna das folhas, verificando quais dessas cultivares são potencialmente mais eficientes em tais condições. Dentre as cultivares estudadas destacam-se a Bourbon Amarelo e a Catimor como potencialmente mais eficientes em condições de estresse hídrico por possuírem: maior potencial hídrico, cutícula mais espessa, maior proporção de parênquima paliçádico, maior espessura da nervura central e maior densidade estomática em relação às demais variáveis. Dessa forma, as cultivares Bourbon Amarelo e Catimor são potencialmente mais eficientes na redução da transpiração, fotossíntese e translocação de fotossintatos em condições de estresse hídrico, sendo mais indicadas ao plantio em regiões sujeitas a maiores déficits hídricos em relação às demais cultivares estudadas.Coffee yield has a great importance to the international market with a 120 million 60-kilogram bags and in Brazil it produces 10 million of direct and indirect jobs. Water stress is one of the most important factors to the crop yield, and so, the selection of tolerant cultivars is of great importance in the places under water stress. In this work, 15 Coffea arabica cultivars were evaluated about the water status and leaf anatomy to indicate the most

  10. Sources of resistance to yellow rust and stem rust in wheat-alien introgressions

    OpenAIRE

    Rahmatov, Mahbubjon

    2013-01-01

    Wheat is the staple food and the main source of caloric intake in most developing countries, and thereby an important source in order to maintain food security for the growing populations in those countries. Stem rust Puccinia graminis f. sp. tritici, and yellow rust P. striiformis f. sp. tritici of wheat continues to cause severe damage locally and globally, thereby contributing to food insecurity. In this paper biology and taxonomy of stem rust and yellow rust, breeding for resistance, util...

  11. Coffee and pregnancy

    DEFF Research Database (Denmark)

    Bech, Bodil Hammer

    Background: Coffee consumption in Denmark is high also among pregnant women and it is presumably their main source of caffeine intake. Coffee or caffeine intake during pregnancy has been linked to adverse pregnancy outcomes such as spontaneous abortion, stillbirth and reduced fetal growth. However...... a review of the literature indicates that further studies are needed to test the hypothesis of an effect of coffee or caffeine on the risk of adverse pregnancy outcomes.The aim of the thesis was to study the relation between coffee and the risk of fetal death and the relation between caffeine intake...

  12. [Coffee in Cancer Chemoprevention].

    Science.gov (United States)

    Neuwirthová, J; Gál, B; Smilek, P; Urbánková, P

    Coffee consumption is associated with a reduced risk of several diseases including cancer. Its chemopreventive effect has been studied in vitro, in animal models, and more recently in humans. Several modes of action have been proposed, namely, inhibition of oxidative stress and damage, activation of metabolizing liver enzymes involved in carcinogen detoxification processes, and anti-inflammatory effects. The antioxidant activity of coffee relies partly on its chlorogenic acid content and is increased during the roasting process. Maximum antioxidant activity is observed for medium-roasted coffee. The roasting process leads to the formation of several components, e.g., melanoidins, which have antioxidant and anti-inflammatory properties. Coffee also contains two specific diterpenes, cafestol and kahweol, which have anticarcinogenic properties. Roasted coffee is a complex mixture of various chemicals. Previous studies have reported that the chemopreventive components present in coffee induce apoptosis, inhibit growth and metastasis of tumor cells, and elicit antiangiogenic effects. A meta-analysis of epidemiological studies showed that coffee consumption is associated with a lower risk of developing various malignant tumors. This review summarizes the molecular mechanisms and the experimental and epidemiological evidence supporting the chemopreventive effect of coffee.Key words: coffee - chemoprevention - antioxidative enzyme - detoxification enzyme - anti-inflammatory effect The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study. The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 11. 9. 2016Accepted: 24. 11. 2016.

  13. Too much coffee

    DEFF Research Database (Denmark)

    Nordentoft, Helle Merete; Olesen, Birgitte Ravn

    coffee can be motivated to drink less coffee. The ethnomethodological perspective reveals how the participants’ different common-sense and hierarchical perceptions of a normative theory and its meaning in practice appears to guide the talk about how to motivate the patient to drink less coffee....... The negotiation between the researchers’ and practitioners’ approach to the coffee drinking patient facilitate a more profound understanding of how different knowledge forms can be at play in other ways than expected. In conclusion the findings show that dialogue and interplay between different knowledge forms...

  14. Complementary Coffee Cups

    Science.gov (United States)

    Banchoff, Thomas

    2006-01-01

    What may have been the birth of a new calculus problem took place when the author noticed that two coffee cups, one convex and one concave, fit nicely together, and he wondered which held more coffee. The fact that their volumes were about equal led to the topic of this article: complementary surfaces of revolution with equal volumes.

  15. Mainstreaming sustainable coffee

    NARCIS (Netherlands)

    Kolk, A.

    2013-01-01

    This overview article examines the various dimensions of sustainable coffee as well as the actors involved and their perceptions of how to advance the market from niche to mainstream. The issues at hand are very complex, with different types of coffee producers, manufacturing/roasting companies and

  16. Strategies for improving rust resistance in oats

    International Nuclear Information System (INIS)

    Harder, D.E.; McKenzie, R.I.H.; Martens, J.W.; Brown, P.D.

    1977-01-01

    During the history of breeding oats for rust resistance in Canada the known sources of resistance proved inadequate to counter the virulence potential of both stem rust (Puccinia graminis avenae) and crown rust (P. coronata avenae). A major programme to overcome the rust problem was undertaken at Winnipeg, involving four alternate approaches: (1) A search for new resistance in wild oat species, particularly Avena sterilis, has provided a wealth of good resistance to crown rust, but less to stem rust. Much of the A. sterilis-derived crown rust resistance is now being used world-wide; (2) Efforts at synthesizing new resistance by mutation breeding methods have not been successful. Of about seven million plants examined, only one showed significant new resistance, but this was associated with poor plant type; (3) Resistance with low levels of expression but which appears broadly effective has been observed against both stem and crown rusts. It appears that numbers of these low-level genes exist, and that they can be accumulated to provide increasingly effective resistance. Problems in using this type of resistance in a practical way are discussed; (4) Excellent rust resistance has been found in lower ploidy species such as A. barbata, but it was not previously possible to stabilize this resistance in hexaploid species. By using mutagenic treatments attempts have been made to translocate smaller portions of the A. barbata chromosome carrying the resistance to the hexaploid cultivar Rodney. In conclusion, mutation breeding methods at present appear to have limited application in synthesizing new rust-resistant genotypes in oats. The search for already existing genetic resistance and its synthesis into multi-genic resistant lines appears to be the most effective way at present of resolving the rust problem in oats. (author)

  17. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean

    OpenAIRE

    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.

    2005-01-01

    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  18. Can good coffee prices increase smallholder revenue?

    OpenAIRE

    Pinard, Fabrice; Aithal, Anand

    2011-01-01

    The global coffee market is currently plagued by 2 paradoxes, a coffee boom in consuming countries, and a coffee crisis in producing countries (over supply of low quality coffee and shortage of high quality coffee) which is actually driving the coffee market (Daviron and Ponte, 2005). After the termination of the International Coffee Agreement between producing and consuming countries in 1989, the coffee market has been in a flux, with market forces and over supply bringing down the coffee pr...

  19. Herança da resistência à ferrugem da folha da aveia (Puccinia coronata f. sp. avenae Fraser & Led. em genótipos brasileiros de aveia branca Inheritance of oat leaf rust (Puccinia coronata f. sp. avenae Fraser & Led. resistance in white oat brazilian genotypes

    Directory of Open Access Journals (Sweden)

    Eduardo Alano Vieira

    2006-02-01

    the use of resistant cultivars. However, for the durable resistance to be acquired, it is necessary to know the genetics of resistance to crown rust in oats. Thus, the objective of this work was to determine the type of inheritance of resistance to three Puccinia coronata f. sp. avenae Fraser & Led., isolates (collected in southern Brazil in brazilian white oat genotypes. To determine the inheritance of resistance to each one of three isolates,F2 populations were used generated through artificial crosses, between resistant (R and susceptible (S and between resistant genotypes (R. Thus, F2 populations from the following artificial crosses: i URPEL 15 (R x UFRGS 7 (S, UPF 16 (R x UFRGS 7 (S and URPEL 15 (R x UPF 16 (R, were used to determine the inheritance of resistance to isolate one (1; ii URPEL 15 (R x UFRGS 7 (S, UPF 18 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (R, to determine the inheritance of resistance to isolate two (2; iii URPEL 15 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (S, to determine the inheritance of resistance to isolate three (3. The obtained results indicate that the genotype URPEL 15 present dominants genes for resistance to the three oat leaf rust isolates evaluated, the cultivar UPF 16 presents a recessive gene for resistance to isolate 1 and the cultivar UPF 18 has a recessive gene of resistence to isolate 2. Also, the resistance genes presented by genotypes URPEL 15, UPF 16 and UPF 18, segregate in an independent manner.

  20. Historic Rust College: Fulfilling a Mission.

    Science.gov (United States)

    Hoffman, Carl

    1989-01-01

    Describes Rust College, a Mississippi college dedicated to educating Blacks from economically and educationally impoverished backgrounds. Discusses the college's financial management, recent fund-raising efforts, building program, and academic programs. Examines the role of the predominantly Black college and Rust's mission to help students…

  1. Screening oat populations for rust resistant mutants

    International Nuclear Information System (INIS)

    McKenzie, R.I.H.; Martens, J.W.; Harder, D.E.; Brown, P.D.

    1976-01-01

    In 1972 a two million M 2 plants were grown at Morden, Manitoba. Thirteen plants which were thought to have possible resistance to race CI0 of oat stem rust were harvested. After extensive seedling and adult plant rust tests the best of the selected plant progenies was crossed and backcrossed to Rodney 0, a stem rust susceptible oat. The resistance in this line M-72-6 was found to be controlled by a single gene. In 1973 another two million M 2 plants were examined for rust resistance at Morden and 38 were harvested. None of the M 2 plants selected in 1973 appeared to have any seedling or adult resistance when examined more thoroughly in the greenhouse and again in the field in 1974. In 1974 one million M 2 plants were examined for resistance and 73 selected. None appeared to have any resistance when tested further. The strain CI3034 which was good adult plant stem rust resistance associated with weak straw and a light green plant colour was treated with gamma radiation and EMS in 1973 and the M 2 grown in the C10 rust nursery at Morden in 1974. A considerable number of dark green plants were present in all treatments but unfortunately all were found to be stem rust susceptible. Thus it would appear to be difficult if not impossible to separate the rust resistance in CI3034 from the undesirable characters, weak straw and light green plant colour. (author)

  2. Defeating the Warrior: genetic architecture of triticale resistance against a novel aggressive yellow rust race.

    Science.gov (United States)

    Losert, Dominik; Maurer, Hans Peter; Leiser, Willmar L; Würschum, Tobias

    2017-04-01

    Genome-wide association mapping of resistance against the novel, aggressive 'Warrior' race of yellow rust in triticale revealed a genetic architecture with some medium-effect QTL and a quantitative component, which in combination confer high levels of resistance on both leaves and ears. Yellow rust is an important destructive fungal disease in small grain cereals and the exotic 'Warrior' race has recently conquered Europe. The aim of this study was to investigate the genetic architecture of yellow rust resistance in hexaploid winter triticale as the basis for a successful resistance breeding. To this end, a diverse panel of 919 genotypes was evaluated for yellow rust infection on leaves and ears in multi-location field trials and genotyped by genotyping-by-sequencing as well as for known Yr resistance loci. Genome-wide association mapping identified ten quantitative trait loci (QTL) for yellow rust resistance on the leaves and seven of these also for ear resistance. The total genotypic variance explained by the QTL amounted to 44.0% for leaf and 26.0% for ear resistance. The same three medium-effect QTL were identified for both traits on chromosomes 1B, 2B, and 7B. Interestingly, plants pyramiding the resistance allele of all three medium-effect QTL were generally most resistant, but constitute less than 5% of the investigated triticale breeding material. Nevertheless, a genome-wide prediction yielded a higher predictive ability than prediction based on these three QTL. Taken together, our results show that yellow rust resistance in winter triticale is genetically complex, including both medium-effect QTL as well as a quantitative resistance component. Resistance to the novel 'Warrior' race of this fungal pathogen is consequently best achieved by recurrent selection in the field based on identified resistant lines and can potentially be assisted by genomic approaches.

  3. Determination of Radiographic Healing: An Assessment of Consistency Using RUST and Modified RUST in Metadiaphyseal Fractures.

    Science.gov (United States)

    Litrenta, Jody; Tornetta, Paul; Mehta, Samir; Jones, Clifford; OʼToole, Robert V; Bhandari, Mohit; Kottmeier, Stephen; Ostrum, Robert; Egol, Kenneth; Ricci, William; Schemitsch, Emil; Horwitz, Daniel

    2015-11-01

    To determine the reliability of the Radiographic Union Scale for Tibia (RUST) score and a new modified RUST score in quantifying healing and to define a value for radiographic union in a large series of metadiaphyseal fractures treated with plates or intramedullary nails. Healing was evaluated using 2 methods: (1) evaluation of interrater agreement in a series of radiographs and (2) analysis of prospectively gathered data from 2 previous large multicenter trials to define thresholds for radiographic union. Part 1: 12 orthopedic trauma surgeons evaluated a series of radiographs of 27 distal femur fractures treated with either plate or retrograde nail fixation at various stages of healing in random order using a modified RUST score. For each radiographic set, the reviewer indicated if the fracture was radiographically healed. Part 2: The radiographic results of 2 multicenter randomized trials comparing plate versus nail fixation of 81 distal femur and 46 proximal tibia fractures were reviewed. Orthopaedic surgeons at 24 trauma centers scored radiographs at 3, 6, and 12 months postoperatively using the modified RUST score above. Additionally, investigators indicated if the fracture was healed or not healed. The intraclass correlation coefficient (ICC) with 95% confidence intervals was determined for each cortex, the standard and modified RUST score, and the assignment of union for part 1 data. The RUST and modified RUST that defined "union" were determined for both parts of the study. ICC: The modified RUST score demonstrated slightly higher ICCs than the standard RUST (0.68 vs. 0.63). Nails had substantial agreement, whereas plates had moderate agreement using both modified and standard RUST (0.74 and 0.67 vs. 0.59 and 0.53). The average standard and modified RUST at union among all fractures was 8.5 and 11.4. Nails had higher standard and modified RUST scores than plates at union. The ICC for union was 0.53 (nails: 0.58; plates: 0.51), which indicates moderate

  4. [Coffee as hepatoprotective factor].

    Science.gov (United States)

    Szántová, Mária; Ďurkovičová, Zuzana

    The mind about the coffee did change upon the recent studies and metaanalysis of the last years. Consensual protective effect of coffee on the progression of chronic liver diseases (NASH, viral hepatitis, liver cirrhosis, hepatocelullar carcinoma) was detected in experimental, clinical and large population studies together with decrease of mortality. Antioxidant, antifibrotic, insulinsensitizing and anticarcinogenic effect of coffee were detected. Modulation of genetic expression of key enzymes of fatty acid synthesis, modulation of mRNA included in autophagia, reduction of stress of endoplasmatic reticulum together with decrease of proinflammatory cytokines and decrease of fibrogenesis are main mechanisms. Chlorogenic acids, diterpens (cafestol, kahweol), caffein, polyfenols and melanoidins are key protective components of coffee. Inverse dose-dependent correlation of coffee consumption with liver diseases was found in clinical and population studies. Coffee is non-pharmacological tool of primary and secondary prevention of chronic liver diseases. Review of published data together with supposed mechanisms of hepatoprotection are given.Key words: coffee - hepatoprotective effect - metaanalysis.

  5. Coffee and liver health.

    Science.gov (United States)

    Morisco, Filomena; Lembo, Vincenzo; Mazzone, Giovanna; Camera, Silvia; Caporaso, Nicola

    2014-01-01

    Coffee is one of the most widely used beverages in the world. It includes a wide array of components that can have potential implications for health. Several epidemiological studies associate coffee consumption with a reduced incidence of various chronic diseases such as diabetes, cardiovascular diseases, and neurodegenerative diseases. Over the past 20 years, an increasing number of epidemiological and experimental studies have demonstrated the positive effects of coffee on chronic liver diseases. Coffee consumption has been inversely associated with the activity of liver enzymes in subjects at risk, including heavy drinkers. Coffee favours an improvement in hepatic steatosis and fibrosis, and a reduction in cirrhosis and the risk of hepatocellular carcinoma. The mechanisms of action through which it exerts its beneficial effects are not fully understood. Experimental studies show that coffee consumption reduces fat accumulation and collagen deposition in the liver and promotes antioxidant capacity through an increase in glutathione as well as modulation of the gene and protein expression of several inflammatory mediators. Animal and in vitro studies indicate that cafestol and kahweol, 2 diterpens, can operate by modulating multiple enzymes involved in the detoxification process of carcinogens causing hepatocellular carcinoma. It is unclear whether the benefits are significant enough to "treat" patients with chronic liver disease. While we await clarification, moderate daily unsweetened coffee use is a reasonable adjuvant to therapy for these patients.

  6. Ion beam analysis of ground coffee and roasted coffee beans

    International Nuclear Information System (INIS)

    Debastiani, R.; Santos, C.E.I. dos; Yoneama, M.L.; Amaral, L.; Dias, J.F.

    2014-01-01

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans

  7. Ion beam analysis of ground coffee and roasted coffee beans

    Energy Technology Data Exchange (ETDEWEB)

    Debastiani, R., E-mail: rafa_debas@yahoo.com.br; Santos, C.E.I. dos; Yoneama, M.L.; Amaral, L.; Dias, J.F.

    2014-01-01

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans.

  8. Apple Coffee Cake

    Science.gov (United States)

    ... this page: https://medlineplus.gov/recipe/applecoffeecake.html Apple Coffee Cake To use the sharing features on ... time: 50 minutes Number of Servings: 20 Tart apples and raisins make for a moist, delicious cake. ...

  9. Induced resistance to rust disease in lentil

    International Nuclear Information System (INIS)

    Paul, Amitava; Singh, D.P.

    2006-01-01

    Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)

  10. Structure of titanium-doped goethite rust

    International Nuclear Information System (INIS)

    Nakayama, Takenori; Ishikawa, Tatsuo; Konno, Toyohiko J.

    2005-01-01

    To investigate the influence of titanium addition on the formation and structure of goethite (α-FeOOH) rust which is one of main corrosion products of weathering steel, the artificially synthesized α-FeOOH rusts were prepared by hydrolysis of aqueous solutions of Fe(III) containing Ti(IV) at different atomic ratios (Ti/Fe) in the range 0-0.1. The obtained rusts particles were observed by TEM. Characterization by XRD, N 2 absorption, Moessbauer spectroscopy was also done. TEM observation revealed that the α-FeOOH rust particle size increased with the increase of Ti/Fe, and that Ti-enriched poorly crystalline particles were formed around the rust particles. XRD confirmed that the crystallite size increased with the increase of Ti/Fe, while the XRD peaks decreased in intensity. Specific surface area obtained by N 2 absorption increased with the increase of Ti/Fe. It is deduced from the obtained results that the addition of Ti(IV) increases the crystallite size of α-FeOOH, and produces double domain particles consisting of the particle core and a porous poorly crystalline shell. It is thought that such unique rust structure produced by titanium addition contributes to the protective properties of rust layer of the weathering steel

  11. Effects of Variety and Fungicidal Rate on Cercospora Leaf Spots ...

    African Journals Online (AJOL)

    Singh, V.R., Pandes, A.K., Reddy, P.M. and. Pao P.V. (1995). Resistance to Rust and Late leaf Spot of Groundnut. ICRISAT. Information Bulletin. No.47, Patancheru,. 502, 324, Andra Pradesh, India. P.24. Thapar, S., Bhusham, R. and Mathur, R.P.. (1995). Degradation of organophosphorus and carbamate pesticides in soils- ...

  12. Genetic studies in wheat for leaf rust resistance (Puccinia recondita)

    African Journals Online (AJOL)

    user

    2011-04-18

    Apr 18, 2011 ... Generation means and variance analyses were performed for the estimation of ... population falls into clearly defined and easily recogni- zable categories by ... additive x dominance and dominance x dominance gene effects.

  13. Rust Inhibitor And Fungicide For Cooling Systems

    Science.gov (United States)

    Adams, James F.; Greer, D. Clay

    1988-01-01

    Mixture of benzotriazole, benzoic acid, and fungicide prevents growth of rust and fungus. Water-based cooling mixture made from readily available materials prevents formation of metallic oxides and growth of fungi in metallic pipes. Coolant remains clear and does not develop thick sludge tending to collect in low points in cooling systems with many commercial rust inhibitors. Coolant compatible with iron, copper, aluminum, and stainless steel. Cannot be used with cadmium or cadmium-plated pipes.

  14. Thrips (Thysanoptera) of coffee flowers

    Science.gov (United States)

    A survey of thrips (Thysanoptera) associated with coffee flowers was conducted in coffee plantations in Chiapas, Mexico. The main objectives were to identify them and to determine whether they were carrying coffee pollen grains. A total of 40 thrips species in 22 genera were identified. The most com...

  15. Growing Coffee in the Shade

    NARCIS (Netherlands)

    Thapa, Sushil; Lantinga, Egbert A.

    2017-01-01

    Coffee white stem borer, Xylotrechus quadripes Chevrolat (Coleoptera: Cerambycidae) is a major coffee pest in parts of Asia and Africa. In recent years, the pest has also been found in American countries. This study in Gulmi District, Nepal, aimed to determine the infestation by coffee white stem

  16. Occurrence of barley leaf disease and control strategies in Denmark

    DEFF Research Database (Denmark)

    Jørgensen, Lise Nistrup; Ørum, Jens Erik; Heick, Thies Marten

    Barley (Hordeum vulgare) is one of the major crops in Denmark and of special importance for malting and for pig feed. In 2016, the crop was grown covering a total area of 700,000 ha; approximately 25% of arable area in Denmark. To ensure high yield of around 60 dt ha-1, disease-tolerant cultivars...... have proven to be quite effective against all leaf diseases, aside from brown rust and mildew. Denmark has a national record system for pesticide usages. All farmers upload their fungicide use by crop, creating a good basis for assessing the differences in use pattern across different regions...... and fungicide treatments are required. Each year, barley cultivars are assessed for susceptibility towards leaf diseases in national observation plots. The most predominant fungal leaf diseases in Denmark are barley scald (Rhynchosporium secalis), net blotch (Pyrenophora teres), brown rust (Puccinia hordei...

  17. Influência de safras agrícolas e tratamentos fungicidas no café cereja descascado e bóia Influence of harvests and fungicide treatments on the parchment and floaters coffee

    Directory of Open Access Journals (Sweden)

    Adriano Andrade Abrahão

    2009-01-01

    Full Text Available O manejo adequado de doenças foliares, como a ferrugem e a cercosporiose do cafeeiro, é fator primordial para a produção de bebidas de qualidade. Nesse sentido, torna-se de extrema importância o conhecimento dos procedimentos técnicos e de produtos fitossanitários, bem como o efeito exercido pelos mesmos na qualidade do café. Objetivou-se, com este trabalho, estudar a qualidade dos grãos de café cereja descascado e bóia procedentes de tratamentos fungicidas, em duas safras agrícolas. Foram conduzidos ensaios nos anos agrícolas 2002/03 e 2003/04. O delineamento utilizado foi o inteiramente casualizado com parcelas subdivididas, utilizando-se quatro repetições, em esquema fatorial 2 x 3 x 2, compreendendo duas safras, três tratamentos fungicidas (fungicida sistêmico, nome comercial Ópera®, fungicida de contato, nome comercial Cobox®, e testemunha não tratada com fungicidas e dois tipos de processamento, cereja descascado e bóia. As avaliações da qualidade dos grãos foram realizadas por meio das análises químicas: acidez titulável, pH, lixiviação de potássio e condutividade elétrica. Os resultados indicaram que os tratamentos fungicidas afetaram apenas a lixiviação de potássio para o café bóia, no qual o Cobox® apresentou menor lixiviação comparado aos demais. Em ambos os processamentos estudados, o segundo ano de ensaio apresentou maior condutividade elétrica, e quando considerado o café bóia, maior lixiviação de potássio. O resultados apontam ainda que, no primeiro ano de ensaio o café cereja descascado apresentou efeito superior para a acidez titulável.The appropriate management of leaf diseases, such as rust and cercospora of the coffee plant, has become extremely important to the production of good quality coffee. In this context, the knowledge of technical procedures and phytosanitary products become extremely important, as well as the effect caused by them in the coffee quality. The objective

  18. Frequency of comandra blister rust infection episodes on lodgepole pine

    Science.gov (United States)

    William R. Jacobi; Brian W. Geils; Jane E. Taylor

    2002-01-01

    Comandra blister rust is a damaging canker disease of lodgepole pine in the Central Rocky Mountains. Our knowledge of previous blister rust outbreaks and the effects of weather and climate on rust epidemiology has not been sufficient to explain the frequency and severity of disease outbreaks. Thus, we sought to describe the seasonal and annual frequency and duration of...

  19. Inheritance of resistance to orange rust in sugarcane

    Science.gov (United States)

    Orange rust, caused by Puccinia kuehnii, is an economically important disease in the Florida sugarcane industry. In this study, orange rust reactions of seedlings in progenies originating from 12 crosses between female and male parents with differing resistance to orange rust (three of each categor...

  20. development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    ACSS

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  1. Development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  2. Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines that differed ...

  3. Development of RAPD based markers for wheat rust resistance ...

    African Journals Online (AJOL)

    Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...

  4. Coffee and Cigarettes

    DEFF Research Database (Denmark)

    Fahnøe, Kristian

    , I analyze how the informal and supposedly non-therapeutic interactions (e.g. coffee breaks, lunch or fieldtrips) between clients and social workers are scenes of subtle acts of governing and resistance. I employ Susie Scott’s (2010) notions of performative regulation and reinventive institutions...

  5. Application of quantitative variables in the sampling method to evaluate the sugarcane rust brown

    Directory of Open Access Journals (Sweden)

    Joaquín Montalván Delgado

    2017-01-01

    Full Text Available To develop a system that increase the precision in the resistance evaluations to sugarcane brown rust disease through the use of the quantitative sampling, six cultivars of differential behavior versus the disease (PR980, My5514, Ja60-5, C334-64, C323-68 and B4362 were studied. A random block experimental design with three replications was used in a heavy infections conditions obtained from the cultivar highly susceptible B4362. The evaluations were done at three and five months of age, in the three-thirds: bottom, half and top of the +1, +3 and +5 sugarcane plant leaves of 10 plants for replica. The variable total leaf area affected of the leaf and in each third was analyzed. In 2 cm2 were observed the long and wide of the biggest and more frequent pustule, the total of pustule and the area of the biggest and more frequent pustule, and the area percentage occupied by the most frequent pustule by each cm2 were determined. Variance analysis and Tukey tests as well as confidence intervals analysis to determine the coefficient to use as constant of the pustule width, due to the little variation of this parameter were realized. The +3 leaf represented the half infection of the incidence of the brown rust, constituting for it the most appropriate to carry out the observations and the half third. An equation was also obtained to calculate the area occupied by pustules with a high level of confidence.

  6. Coffee, hunger, and peptide YY.

    Science.gov (United States)

    Greenberg, James A; Geliebter, Allan

    2012-06-01

    There is evidence from several empirical studies suggesting that coffee may help people control body weight. Our objective was to assess the effects of caffeine, caffeinated coffee, and decaffeinated coffee, both alone and in combination with 75 g of glucose, on perceived hunger and satiety and related peptides. We conducted a placebo-controlled single-blinded randomized 4-way crossover trial. Eleven healthy male volunteers (mean age, 23.5 ± 5.7 years; mean BMI, 23.6 ± 4.2 kg/m(2)) ingested 1 of 3 test beverages (caffeine in water, caffeinated coffee, or decaffeinated coffee) or placebo (water), and 60 minutes later they ingested the glucose. Eight times during each laboratory visit, hunger and satiety were assessed by visual analog scales, and blood samples were drawn to measure 3 endogenous peptides associated with hunger and satiety: ghrelin, peptide YY (PYY), and leptin. Compared to placebo, decaffeinated coffee yielded significantly lower hunger during the whole 180-minute study period and higher plasma PYY for the first 90 minutes (p hunger or PYY. Caffeinated coffee showed a pattern between that of decaffeinated coffee and caffeine in water. These findings suggest that one or more noncaffeine ingredients in coffee may have the potential to decrease body weight. Glucose ingestion did not change the effects of the beverages. Our randomized human trial showed that decaffeinated coffee can acutely decrease hunger and increase the satiety hormone PYY.

  7. Evaluation of the International coffee market conditions

    OpenAIRE

    FISAKOVA O.S.

    2014-01-01

    This article includes analysis of coffee market and its conditions for coffee companies. Also, coffee export amounts and prices are compared and analyzed. Statistics were collected over few last years to present accurate research

  8. Identification of Green Rust in Groundwater

    DEFF Research Database (Denmark)

    Christiansen, Bo C.; Balic Zunic, Tonci; Dideriksen, Knud

    2009-01-01

    to air. In this paper, we present a sampling method for capturing green rust so it is not oxidized. We then we used the method to identify the compound in a groundwater sample taken below the water table from fractures in granite. X-ray diffraction patterns were weak, but clearly identical to those......Green rust, a family of Fe(II),Fe(III) layered double hydroxides, is believed to be present in environments close to the Fe(II)/Fe(III) transition zone. Attempts to identify members of this family in nature have proven difficult because the material is oxidized after only a few minutes exposure...

  9. 75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2010-07-30

    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... direct final rule notified the public of our intention to amend the black stem rust quarantine and...

  10. 76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties

    Science.gov (United States)

    2011-01-19

    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... notified the public of our intention to amend the black stem rust quarantine and regulations by adding four...

  11. Radioactivity in coffee

    International Nuclear Information System (INIS)

    Roselli, C.; Desideri, D.; Feduzi, L.; Rongoni, A.; Saetta, D.

    2013-01-01

    This research was dedicated to the study of the background levels of 210 Po and natural gamma emitters as 40 K, 214 Pb, 214 Bi, 228 Ac, 212 Pb and 212 Bi in coffee powder and in coffee beverage; also the artificial 137 Cs was determined. In the coffee powder the mean 210 Po activity resulted 7.25 ± 2.25 x 10 -2 Bq kg -1 . 40 K showed a mean activity of 907.4 ± 115.6 Bq kg -1 . The mean activity concentration of 214 Pb and 214 Bi, indicators of 226 Ra, given as mean value of the two radionuclides, resulted 10.61 ± 4.02 Bq kg -1 . 228 Ac, 228 Ra indicator, showed a mean activity concentration of 13.73 ± 3.20 Bq kg -1 . The mean activity concentration of 212 Pb, 224 Ra indicator, was 8.28 ± 2.88 Bq kg -1 . 208 Tl, 224 Ra indicator, presented a mean activity concentration of 11.03 ± 4.34 Bq kg -1 . In all samples, the artificial 137 Cs resulted below the detection limit (2.0 Bq kg -1 ). The arithmetical mean value of percentage of 210 Po extraction in coffee beverage resulted 20.5 ± 6.9. The percentage of transfer of gamma emitters, 40 K, 214 Pb, 214 Bi, 228 Ac, 212 Pb, 208 Tl resulted of 80.0, 33.5, 24.7, 30.0, 35.1 and 53.5 % for 40 K, 214 Pb, 214 Bi, 228 Ac, 212 Pb and 208 Tl respectively. (author)

  12. Rust dissolution and removal by iron-reducing bacteria: A potential rehabilitation of rusted equipment

    International Nuclear Information System (INIS)

    Starosvetsky, J.; Kamari, R.; Farber, Y.; Bilanović, D.; Armon, R.

    2016-01-01

    Highlights: • The present study demonstrated the high reductive capacity of both strains: the collection S. oneidensis and the wild strain Geobacter spp. (soil isolate). • The experimental strains were successful in Fe 3+ reduction for both states: soluble and crystalline (originally prepared from rust). • Rust dissolution can be improved by: addition of AFC at low concentration (0.2 g/l), increasing bacterial initial inoculum and rust reactive surface. • Both experimental IRB strains were able to completely remove previously formed rust on carbon steel coupons. • Additional results (not showed) revealed that culture S. oneidensis and the environmental isolate Geobacter spp., apparently have a different mechanism of iron reduction that requires further study. - Abstract: Iron reducing bacteria (IRB), to be used in rust dissolution and removal, have been isolated and enriched from different environmental sources. Comparative measurements revealed that a soil isolate (Geobacter sulfurreducens sp.) had the highest reductive activity equivalent to Shewanella oneidensis (strain CIP 106686, pure culture). Both reductive microorganisms can use Fe 3+ ions as electron acceptors from soluble as well as from crystalline sources. In nutrient medium containing soluble Fe 3+ , the highest reductive activity obtained for G. sulfurreducens sp. and S. oneidensis was 93 and 97% respectively. Successful removal of rust from carbon steel coupons has been achieved with both experimental bacteria.

  13. Shaded Coffee: A way to Increase Sustainability in Brazilian Organic Coffee plantations

    OpenAIRE

    Moreira, Cassio Franco; De Nadai Fernandes, Elisabete A.; Tagliaferro, Fábio Sileno

    2008-01-01

    Consumption of specialty coffee, mainly organic coffee, increases worldwide following the tendency of consuming social and ecological sustainable products. Brazil is the world largest coffee producer, with an average of 2,300,000 tons of green coffee in the last 5 years. Cultivation of organic coffee and shaded coffee are common in Central America, while in Brazil both conventional and organic coffee are cultivated in the full sun system. The full sun system is criticized due to the lack of b...

  14. Major transcriptome reprogramming underlies floral mimicry induced by the rust fungus Puccinia monoica in Boechera stricta.

    Directory of Open Access Journals (Sweden)

    Liliana M Cano

    Full Text Available Pucciniamonoica is a spectacular plant parasitic rust fungus that triggers the formation of flower-like structures (pseudoflowers in its Brassicaceae host plant Boecherastricta. Pseudoflowers mimic in shape, color, nectar and scent co-occurring and unrelated flowers such as buttercups. They act to attract insects thereby aiding spore dispersal and sexual reproduction of the rust fungus. Although much ecological research has been performed on P. monoica-induced pseudoflowers, this system has yet to be investigated at the molecular or genomic level. To date, the molecular alterations underlying the development of pseudoflowers and the genes involved have not been described. To address this, we performed gene expression profiling to reveal 256 plant biological processes that are significantly altered in pseudoflowers. Among these biological processes, plant genes involved in cell fate specification, regulation of transcription, reproduction, floral organ development, anthocyanin (major floral pigments and terpenoid biosynthesis (major floral volatile compounds were down-regulated in pseudoflowers. In contrast, plant genes involved in shoot, cotyledon and leaf development, carbohydrate transport, wax biosynthesis, cutin transport and L-phenylalanine metabolism (pathway that results in phenylethanol and phenylacetaldehyde volatile production were up-regulated. These findings point to an extensive reprogramming of host genes by the rust pathogen to induce floral mimicry. We also highlight 31 differentially regulated plant genes that are enriched in the biological processes mentioned above, and are potentially involved in the formation of pseudoflowers. This work illustrates the complex perturbations induced by rust pathogens in their host plants, and provides a starting point for understanding the molecular mechanisms of pathogen-induced floral mimicry.

  15. FLUXAPYROXAD IN THE ASIAN SOYBEAN RUST CONTROL IN THE CERRADO BIOME

    Directory of Open Access Journals (Sweden)

    RAFAEL MENEZES SILVA DE FREITAS

    2016-01-01

    Full Text Available The etiologic agent of the Asian soybean rust is the Phakopsora pachyrhizi, which causes a reduction in the photosynthetic leaf area and, consequently, in the crop yield. Chemical control is one of the main measures for its management. The objective of this work was to evaluate the efficacy and selectivity of the fluxapyroxad fungicide on controlling the Asian soybean rust, under the edaphoclimatic conditions of the Cerrado biome. The experiment was conducted in an area under no-tillage system, in the Agricultural Research Center, Rio Verde, Goias, Brazil, during the 2012/2013 crop season, using the cultivar NA7337. A randomized block experimental design was used, with twelve treatments and four replications. The treatments consisted of applications of fluxapyroxad (FX, pyraclostrobin (PT, epoxiconazole (EX and metconazole (MZ. The average severity of the disease in the plants reached 37% in the Control. All treatments with fungicides differed from the Control. Treatments 9, 10, 11 and 12 provided the greatest rates of soybean rust control. The treatments 10, 11 and 12 had the highest thousand grain weights, and the yields of the treatments 2, 3 and 11, despite higher than the Control, were lower than the treatments 4, 5, 6, 7, 8, 9, 10 and 12, which had statistically equal yields. The increasing in yield, compared to the Control, ranged from 10.05% (pyraclostrobin, epoxiconazole + pyraclostrobin + mineral oil to 30.55% (pyraclostrobin, pyraclostrobin + fluxapyroxad + mineral oil and pyraclostrobin + metconazole + mineral oil. The highest rates of soybean rust control were presented by fungicides containing fluxapyroxad.

  16. Survey the Effect of Mycorrhiza and Azospirillum of Wheat Cultivars Resistance in Yellow Rust

    Directory of Open Access Journals (Sweden)

    M. Jiriaie

    2017-01-01

    -levels (non-inoculated seeds and inoculated seed and wheat cultivars in three levels, Chamran (bread wheat, Dena and Behrang (durum wheat varieties. In this experiment evaluated, to yellow rust disease, the intensity of infection, the average coefficient of infection, type of infection and area under disease progress curve (AUDPC. Infection type and disease severity were also recorded at flag leaf stage using modified Cobb’s scale. First symptoms of yellow rust were observed in middle January of 2013. Analysis of variance was performed using PROC ANOVA of SAS (version 9.1.3, 2004The comparison of the means was done by Duncan test at a probability level of 5 percent. Results and Discussion: Survey on the resistance to yellow rust in wheat cultivars treated with Mycorrhiza and Azospirillum showed that seed inoculation with Azospirillum traits reduced between 10 percent to 13 percent and the use strains of Mycorrhiza fungi intensity of infection 45-51 percent, the average coefficient of infection and AUDPC 74-85 percent respectively for G. intraradices and G. mosseae strains have been reduced compared with control and Chamran cultivar between 40-70 percent showed more Sensitivity to disease from durum varieties. Generally, the lowest of infection intensity (18.33 was obtained from inoculation of C.V Dena seeds with Azospirillum and G. mosseae strain. According to the result, we found yellow rust in all experiment field also the incidence varied between 10-70 percent. Therefore, it is concluded that, given the climatic conditions favorable to the spread of yellow rust, the incidence of yellow rust in the region that have a high degree of pathogenicity. In general the results of this test, mycorrhiza application has a significant role in enhancing wheat resistance to yellow rust. The seed inoculation with Azospirillum although did not have significant role in disease control, but increased at an acceptable level resistance to wheat rust. But the important point was the combined

  17. Cercosporiose progression in the agroforestry consortium coffee-rubber trees

    Directory of Open Access Journals (Sweden)

    Humberto Godoy Androcioli

    2015-12-01

    Full Text Available Cercospora coffeicola is one of the primary diseases that affect coffee plants. Studies indicate that shaded coffee plants reduce the incidence of this disease and that the management of trees and coffee plants arrangement influence in the dissemination of cercospora. The objective of this study was to evaluate the incidence and severity of C. coffeicola at different distances from double rows of rubber trees (Hevea brasiliensis muell. arg. at two different sunlight exposures (north and south. This study was conducted in Londrina, Parana, between 2008 and 2010, with adult plants of the IAPAR 59 cultivar (Coffea arabica L. grown at a spacing of 2.5 m x 1.0 m. The distances between the double rows of rubber trees were 13, 16 and 22 m, compared to plants grown under full sun. The disease incidence was assessed monthly by using a non-destructive method. This analysis was conducted on coffee leaves from the third and fourth pairs of two plagiotropic branches, on eight plants per plot, with five replications. These data were used to calculate the area under the curve for the incidence of the brown eye spot. The highest disease incidence occurred in the coffee plants grown under full sun, whereas lowest disease occurred on plants located at up to two meters away from double rows of rubber trees. The incidence of Cercospora leaf spot increased with the distance from the double rows of rubber trees. The results demonstrate that the mapping of cercospora incidence in shaded coffee plants is essential to determinate the best spacing and plants arrangement.

  18. Zoete rust : Een muzikale soap-detective

    NARCIS (Netherlands)

    Maas, P.

    1989-01-01

    De komedie' Zoete Rust' werd geschreven in opdracht van Theater de Tobbe in Voorburg . Naast de circa 120 professionele voorstellingen die elk seizoen in dit theater plaats vinden, organiseert De Tobbe een maal per laar een eigen theaterproduktie, die wordt gespeeld door het Tobbe-toneel, een ad-hoc

  19. Induced mutations for soybean rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.

    1983-01-01

    Soybean mutation experiments for inducing rust resistance in the cultivars G 8375, Wakashima mutant number 10, Taichung N, S.J.2, S.J.4, BM 50, BM 98, G 8377, G 8586 and G 8587 have been carried out since 1979. Six pods from each of 4438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked (M 2 bulk). In addition, 270 good M 1 plants were selected and threshed singly (M 2 single). M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both, M 3 -bulk and M 3 -single plants, together with the remaining M 2 -bulk seeds were screened for rust resistance in the rainy season of 1980 in Nong Hoi Valley (altitude about 1000 m above sea level) and at Mae Joe Station, both in Chiang Mai Province (latitude 18 deg. 31'-19 deg. N). Based on the IWGSR rating system, soybean plants with slow growth of rust were selected from both locations. The results were as follows: Six plants were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Further evaluation of these selections for rust resistance will be carried out in the rainy season of 1981 in Nong Hoi Valley, Chiang Mai. (author)

  20. Spatial variability of leaf wetness duration in cotton, coffee and banana crop canopies Variabilidade espacial da duração do período de molhamento foliar nas culturas do algodão, do café e da banana

    Directory of Open Access Journals (Sweden)

    Eduardo Alvarez Santos

    2008-12-01

    Full Text Available Despite the importance of leaf wetness duration for plant disease epidemiology, there has been little attention paid to research on how its variability relates to different cropping situations. The objective of this study was to evaluate the spatial variability of leaf wetness duration (LWD in three crops, comparing these measurements with turfgrass LWD, obtained in a standard weather station. LWD was measured by electronic sensors in three crops with different canopy structures and leaf area: cotton, coffee and banana. For the cotton crop, cylindrical sensors were deployed at the lower third and on the top of the canopy, facing southwest. For the coffee crop, flat plate sensors were installed in the lower third of the canopy facing northeast and southwest; in the middle third facing northeast and southwest; and inside and on the top of the canopy. For the banana canopy, cylindrical sensors were used to measure LWD in the lower third of the canopy and in the upper third of the plant. Turfgrass LWD was simultaneously measured in a nearby standard weather station. The LWD showed different patterns of variation in the three crop canopies. For coffee plants, the longest LWD was found in the lower portions of the canopy; for the banana crop, the upper third of the canopy showed the longest LWD; whereas for the cotton crop no difference was observed between the top and lower third of the canopy. Turfgrass LWD presented a good relationship with LWD measured on the top or in the upper third of the crops. Thus, the estimate of crop LWD can be perfomed based on turfgrass LWD, this being a useful tool for plant disease management purposes for crops in which the longer LWD occurs at the upper canopy portion.Apesar da importância da duração do período de molhamento para a epidemiologia de doenças de plantas, pouca atenção tem sido dada à sua variabilidade em diferentes posições da cultura. O objetivo deste estudo foi avaliar a variabilidade

  1. COFFEE GROWING AREAS OF ETHIOPIA"

    African Journals Online (AJOL)

    accelerated economic growth, part of which is hoped to be achieved via increased ... at the Fifth International Conference on the Ethiopian Economy held at the United ... Samuel and Ludi: Agricultural commercialisation in coffee growing areas. ... Ethiopia produces and exports one of the best fighland coffees in the world.

  2. Progresso temporal da ferrugem e redução sobre a área foliar e os componentes do rendimento de grãos em soja Temporal progress of rust and reduced leaf area and yield components in soybean grain

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos

    2011-04-01

    em experimento de campo com 64 parcelas (2.7 x 5 m da cultivar Glycine max L. (Nidera 5909 RG, estabelecida em 05/12/09. Para gerar gradientes de doença utilizaram-se dois fungicidas (tebuconazol e epoxiconazol + piraclostrobina, em uma, duas ou três aplicações em estádios fonológicos diferentes. A doença foi quantificada por número de lesões e urédias, posteriormente convertido para severidade (%. Quantificou-se também o índice de área foliar ao final do enchimento de grãos e os componentes do rendimento após a colheita. A severidade média final da ferrugem superou 50%. As diferenças em severidade entre os estratos da planta foram influenciadas pela quantidade inicial de doença, uma vez que as taxas de progresso, determinadas pelos modelos logístico e de Gompertz, foram semelhantes entre os estratos (0.13 a 0.14 para o logístico e 0.10 a 0.11 para Gompertz. O índice de área foliar (IAF foi de apenas 1.96 nas plantas não tratadas, contra 4.40 no tratamento com quatro aplicações de epoxiconazol + piraclostrobina. Programas de controle iniciados em estádio fonológico V9, com duas ou três aplicações, diferiram da testemunha em IAF. O número de legumes e grãos por planta, assim como grãos por legume não variaram entre os tratamentos. Só houve diferença no peso de grãos do estrato superior, quando os fungicidas foram aplicados duas ou três vezes a partir de estádio fonológico V9.The harvest of the year 2009-10 of soybean crop in Southern Brazil occurred under higher intensity of soybean rust (Phakopsora pachyrhizi Sydow y Sydow, which allowed studies on disease progress and crop reduction. A field experiment with 64 plots (2.7 x 5 m of the cultivar Glycine max L. (Nidera 5909 RG sown on 5/Dec/2009 was used for the evaluations. Disease gradients were obtained by spraying the fungicides tebuconazol or epoxiconazol + pyraclostrobin once, twice or three times, at different plant growth stages. Disease progress was assessed as number of

  3. Ultrastructure of the Rust Fungus Puccinia miscanthi in the Teliospore Stage Interacting with the Biofuel Plant Miscanthus sinensis

    Directory of Open Access Journals (Sweden)

    Ki Woo Kim

    2015-09-01

    Full Text Available Interaction of the the rust fungus Puccinia miscanthi with the biofuel plant Miscanthus sinensis during the teliospore phase was investigated by light and electron microscopy. P. miscanthi telia were oval-shaped and present on both the adaxial and abaxial leaf surfaces. Teliospores were brown, one-septate (two-celled, and had pedicels attached to one end. Transmission electron microscopy revealed numerous electron-translucent lipid globules in the cytoplasm of teliospores. Extensive cell wall dissolution around hyphae was not observed in the host tissues beneath the telia. Hyphae were found between mesophyll cells in the leaf tissues as well as in host cells. Intracellular hyphae, possibly haustoria, possessed electron-dense fungal cell walls encased by an electron-transparent fibrillar extrahaustorial sheath that had an electron-dense extrahaustorial membrane. The infected host cells appeared to maintain their membrane-bound structures such as nuclei and chloroplasts. These results suggest that the rust fungus maintains its biotrophic phase with most mesophyll cells of M. sinensis. Such a nutritional mode would permit the rust fungus to obtain food reserves for transient growth in the course of host alteration.

  4. Impact of coffee crop renewal program on small producers in department Cundinamarca (Colombia

    Directory of Open Access Journals (Sweden)

    Guarín N. Carlos Andrés

    2012-04-01

    Full Text Available

    The modernization of crops through renewal is a vital option for the restoration of the productivity and competitiveness of the coffee crop. The Federación Nacional de Cafeteros (National Federation of Coffee is banking on a strategy that promotes renewal by providing resources to stimulate growers. As a result of the implementation of the program, it is hoped that it will reverse the aging process of coffee crops, consolidate a productive and competitive market, provide appropriate ages and densities and promote the use of coffee rust resistant varieties. Similarly, it is expected that small producers, who constitute the majority of farmers and who presumably suffer major limitations to independent renewal, will be the main beneficiaries.

  5. Nitrogen fertilization of coffee: organic compost and Crotalaria juncea L.

    Directory of Open Access Journals (Sweden)

    João Batista Silva Araujo

    2013-12-01

    Full Text Available Information concerning the response of coffee to organic fertilizers is scarce. This study evaluates the effect of different doses of compost and Crotalaria juncea L. on growth, production and nitrogen nutrition of coffee trees. The treatments consisted of compost at rates of 25, 50, 75 and 100% of the recommended fertilization, with or without the aerial part of C. juncea. C. juncea was grown with NH4-N (2% 15N and applied to coffee. The use of C. juncea increased growth in height and diameter of the coffee canopy. In the first year, the percentage of N derived from C. juncea reached 8.5% at seven months and 4.1% at fifteen months after fertilization. In the second year, the percentage of N derived from C. juncea reached 17.9% N at the early harvest, five months after fertilization. Increased rates of compost increased pH , P , K , Ca , Mg , sum of bases , effective CEC, base saturation and organic matter and reduced potential acidity. 15N allowed the identification of the N contribution from C. juncea with percentage of leaf N derived from Crotalaria juncea from 9.2 to 17.9%.

  6. Turkish cultural heritage: a cup of coffee

    Directory of Open Access Journals (Sweden)

    Birsen Yılmaz

    2017-12-01

    Full Text Available Setting out a fabulous journey from a tiny bean, coffee is the stimulant of the heart and mind and a mysterious plant that strengthens friendship and also takes your tiredness away during the day. Although information on how and where the coffee came from is not clear, Sheikh Şazeli is regarded as the “father” by coffee makers. The word coffee originates from “Kaffa”, a primary coffee production center in Abyssinia, Africa, which can be considered the homeland of coffee. According to this consideration, in Abyssinia, coffee was consumed with bread; it was then pulped and brought to Yemen, and Yemeni people started to cultivate coffee. The word “kahve” in Turkish does not mean the coffee plant like its synonym in Arabic but means the beverage made by boiling. Turkish coffee is a blend of high-quality Arabic-type coffee beans, originating from Brazil and Central America and moderately roasted and ground finely. The way it is prepared differentiates Turkish coffee from others. This coffee was called Turkish coffee because of a new method of preparation invented by Turkish people where it is boiled in copper coffee pots. Turkish coffee that has spread around the world with this name has been an indispensable part of the cultural and social history of Turks.

  7. Sensitivity to coffee and subjective health

    NARCIS (Netherlands)

    Snel, J.; Koppes, L.L.J.; Twisk, J.W.

    2009-01-01

    The question was whether health complaints are associated with coffee consumption and self reported sensitivity to coffee. Participants were 89 men and 107 women, all coffee drinkers. Questionnaires were used at 2 points of time with an interval of 3.7 years. The correlations among coffee

  8. Evaluation of physiological changes in coffee seedlings ...

    African Journals Online (AJOL)

    Field experiments were carried out at three locations with different vegetation in Nigeria between 1996 and 1998 to determine the physiological changes in coffee intercropped with maize, cassava and plantain. There were four intercropping treatments comprising coffee/maize, coffee/cassava, coffee/plantain and ...

  9. Have coffee reforms and coffee supply chains affected farmers' income? The case of coffee growers in Rwanda

    OpenAIRE

    Murekezi, Abdoul Karim; Loveridge, Scott

    2009-01-01

    Low prices in the international coffee markets have worsened the economic well-being among coffee farmers. In the face of this situation, the Government of Rwanda has introduced coffee sector reforms that aimed to transform the sector in a way that targets the high quality market and moves away from the bulk coffee market. The high quality coffee market has shown consistent growth over time and exhibits price premiums in international market. If these high prices are passed on to farmers who ...

  10. Effect of Puccinia silphii on Yield Components and Leaf Physiology in Silphium integrifolium: Lessons for the Domestication of a Perennial Oilseed Crop

    Directory of Open Access Journals (Sweden)

    M. Kathryn Turner

    2018-03-01

    Full Text Available New crops with greater capacity for delivering ecosystem services are needed to increase agricultural sustainability. However, even in these crops, seed yield is usually the main criteria for grain domestication. This focus on yield can cause unintended structural and functional changes. Leaves of selected plants tend to be more vulnerable to infection, which can reduce performance, assimilates, and ultimately yield. Our objectives were to determine the impact of rust (caused by Puccinia silphii on yield and leaf function in selected Silphium integrifolium (Asteraceae plants. We tested the effect of a fungicide treatment on rust severity and yield, compared the rust infection of individuals in a population selected for yield, and related this to chemical changes at the leaf level. We also estimated heritability for rust resistance. We found that productivity indicators (head number and weight, leaf weight and leaf processes (photosynthetic capacity, water use efficiency were reduced when silphium leaves and stems were more heavily infected by P. silphii. Leaf resin content increased when susceptible plants were infected. Fungicide treatments were effective at reducing rust infection severity, but were ineffective at preventing yield losses. We propose that disease resistance should be included early in the selection process of new perennial crops.

  11. Effect of solar radiation on severity of soybean rust.

    Science.gov (United States)

    Young, Heather M; George, Sheeja; Narváez, Dario F; Srivastava, Pratibha; Schuerger, Andrew C; Wright, David L; Marois, James J

    2012-08-01

    Soybean rust (SBR), caused by Phakopsora pachyrhizi, is a damaging fungal disease of soybean (Glycine max). Although solar radiation can reduce SBR urediniospore survival, limited information is available on how solar radiation affects SBR progress within soybean canopies. Such information can aid in developing accurate SBR prediction models. To manipulate light penetration into soybean canopies, structures of shade cloth attenuating 30, 40, and 60% sunlight were constructed over soybean plots. In each plot, weekly evaluations of severity in lower, middle, and upper canopies, and daily temperature and relative humidity were recorded. Final plant height and leaf area index were also recorded for each plot. The correlation between amount of epicuticular wax and susceptibility of leaves in the lower, middle, and upper canopies was assessed with a detached leaf assay. Final disease severity was 46 to 150% greater in the lower canopy of all plots and in the middle canopy of 40 and 60% shaded plots. While daytime temperature within the canopy of nonshaded soybean was greater than shaded soybean by 2 to 3°C, temperatures recorded throughout typical evenings and mornings of the growing season in all treatments were within the range (10 to 28.5°C) for SBR development as was relative humidity. This indicates temperature and relative humidity were not limiting factors in this experiment. Epicuticular wax and disease severity in detached leaf assays from the upper canopy had significant negative correlation (P = 0.009, R = -0.84) regardless of shade treatment. In laboratory experiments, increasing simulated total solar radiation (UVA, UVB, and PAR) from 0.15 to 11.66 MJ m(-2) increased mortality of urediniospores from 2 to 91%. Variability in disease development across canopy heights in early planted soybean may be attributed to the effects of solar radiation not only on urediniospore viability, but also on plant height, leaf area index, and epicuticular wax, which influence

  12. Buying cannabis in 'coffee shops'.

    Science.gov (United States)

    Monshouwer, Karin; Van Laar, Margriet; Vollebergh, Wilma A

    2011-03-01

    The key objective of Dutch cannabis policy is to prevent and limit the risks of cannabis consumption for users, their direct environment and society ('harm reduction'). This paper will focus on the tolerated sale of cannabis in 'coffee shops'. We give a brief overview of Dutch policy on coffee shops, its history and recent developments. Furthermore, we present epidemiological data that may be indicative of the effects of the coffee shop policy on cannabis and other drug use. Dutch coffee shop policy has become more restrictive in recent years and the number of coffee shops has decreased. Cannabis prevalence rates in the adult population are somewhat below the European average; the rate is relatively high among adolescents; and age of first use appears to be low. On a European level, the use of hard drugs in both the Dutch adult and adolescent population is average to low (except for ecstasy among adults). International comparisons do not suggest a strong, upward effect of the coffee shop system on levels of cannabis use, although prevalence rates among Dutch adolescents give rise to concern. Furthermore, the coffee shop system appears to be successful in separating the hard and soft drugs markets. Nevertheless, in recent years, issues concerning the involvement of organised crime and the public nuisance related to drug tourism have given rise to several restrictive measures on the local level and have sparked a political debate on the reform of Dutch drug policy. © 2011 Trimbos Institute.

  13. Caffeine content of decaffeinated coffee.

    Science.gov (United States)

    McCusker, Rachel R; Fuehrlein, Brian; Goldberger, Bruce A; Gold, Mark S; Cone, Edward J

    2006-10-01

    Caffeine is the most widely consumed drug in the world with coffee representing a major source of intake. Despite widespread availability, various medical conditions necessitate caffeine-restricted diets. Patients on certain prescription medications are advised to discontinue caffeine intake. Such admonition has implications for certain psychiatric patients because of pharmacokinetic interactions between caffeine and certain anti-anxiety drugs. In an effort to abstain from caffeine, patients may substitute decaffeinated for caffeinated coffee. However, decaffeinated beverages are known to contain caffeine in varying amounts. The present study determined the caffeine content in a variety of decaffeinated coffee drinks. In phase 1 of the study, 10 decaffeinated samples were collected from different coffee establishments. In phase 2 of the study, Starbucks espresso decaffeinated (N=6) and Starbucks brewed decaffeinated coffee (N=6) samples were collected from the same outlet to evaluate variability of caffeine content of the same drink. The 10 decaffeinated coffee samples from different outlets contained caffeine in the range of 0-13.9 mg/16-oz serving. The caffeine content for the Starbucks espresso and the Starbucks brewed samples collected from the same outlet were 3.0-15.8 mg/shot and 12.0-13.4 mg/16-oz serving, respectively. Patients vulnerable to caffeine effects should be advised that caffeine may be present in coffees purported to be decaffeinated. Further research is warranted on the potential deleterious effects of consumption of "decaffeinated" coffee that contains caffeine on caffeine-restricted patients. Additionally, further exploration is merited for the possible physical dependence potential of low doses of caffeine such as those concentrations found in decaffeinated coffee.

  14. Waste management regroups units into Rust International

    International Nuclear Information System (INIS)

    Kirschner, E.

    1992-01-01

    Three Waste Management (Oak Brook, IL) subsidiaries have proposed merging units from Chemical Waste Management (CWM) and Wheelabrator Technologies with the Brand Companies (Park Ridge, IL). Waste Management says the new company, to be called Rust International, will become one of the US's largest environmental consulting and infrastructure organizations and will include design and construction services. Waste Management expects the merged company's 1993 revenues to reach $1.8 billion. It will be based in Birmingham, AL and have 12,000 employees

  15. Tolerance of Loblolly Pines to Fusiform Rust

    Science.gov (United States)

    Charles H. Walkinshaw; James P. Barnett

    1995-01-01

    Loblolly pines (Pinus taeda L.) that were 8 to 17 yr old tolerated one to three fusiform rust (Cronartium quercuum [Berk.] Miyabe ex Shirai f. sp. fusiforme) galls in their stems.Families with four or more galls in their stems lost 2.5% or more of the trees by age 17.In living trees with less than four stem galls, diameter growth was comparable to...

  16. [Coffee can protect against disease].

    Science.gov (United States)

    Hermansen, Kjeld; Krogholm, Kirstine Suszkiewicz; Bech, Bodil Hammer; Dragsted, Lars Ove; Hyldstrup, Lars; Jørgensen, Kasper; Larsen, Mogens Lytken; Tjønneland, Anne Marie

    2012-09-24

    A moderate daily intake of 3-4 cups of coffee has convincing protective effects against development of type 2 diabetes and Parkinson's disease. The literature also indicates that moderate coffee intake reduces the risk of stroke, the overall risk of cancer, Alzheimer's disease, suicide and depression. However, pregnant women, people suffering from anxiety disorder and persons with a low calcium intake should restrain from moderate or high intake of coffee due to uncertainty regarding potential negative effects on pregnancy, anxiety and risk of osteoporosis, respectively.

  17. Uptake and movement of 14C-lindane in coffee plants

    International Nuclear Information System (INIS)

    Ruegg, E.F.; Lord, K.A.; Mesquita, T.B.

    1977-01-01

    Several types of experiments were performed to investigate the uptake and distribution of lindane in coffee plants using 14 C-labelled insecticide. The investigations showed that the insecticide taken from nutrient solution is concentrated in the roots and then moves to other parts of the plant. Experiments using macerated plant tissue showed that concentration of lindane in the roots occurs probably by a passive physical process. In another series of tests, leaf tretments of coffee plants grown in pots or in solution indicated that in a few hours about 90% of lindane may be lost from treated leaf as vapor. Some lindane, however, has been detected in other parts of the plant indicating leaf transllocation or migration of the insecticide through the air. The latter hypothesis has been proved by closed and open system comparative experiments using gas chromatographic techniques. This does not exclude a slower and possibly smaller translocation within the plant, suggested by the experiments using radioactivity,. (author) [pt

  18. Essential Oils for Alternative Teak Rust Control

    Directory of Open Access Journals (Sweden)

    Pedro Raymundo Argüelles Osorio

    2018-03-01

    Full Text Available ABSTRACT The objectives of this study were to evaluate the effect of lemon grass, citronella grass, Mexican-tea and noni essential oils on urediniospore germination of Olivea neotectonae , the agent responsible for rust in Teak (Tectona grandis L.f.; to evaluate the phytotoxic effect of these essential oils on teak seedlings; and to evaluate the use of essential oils to control rust in teak plants when preventively and curatively applied. We found that the noni and lemon grass essential oils inhibited 100% of urediniospore germination. On the other hand, the essential oils from noni and lemon grass caused phytotoxicity when applied to seedlings at concentrations of 2000 and 1500 μL L-1, respectively. The major constituents found in lemon grass essential oil were Geranial and Neral, while Octanoic Acid was found in noni oil. Lower values in the area below the rust progress curve were observed with the preventive application of lemon grass and noni essential oils.

  19. Radiation disinfestation of tobacco leaves and coffee beans

    International Nuclear Information System (INIS)

    Soemartaputra, M.H.; Rosalina, S.H.; Rahayu, A.; Harsojo; Kardha, S.

    1985-01-01

    The most important insects found on coffee and tobacco in storage are A. fasciculatus and L. serricorne, respectively. Some genera of mold, such as Rhyzopus, Aspergillus, Penicillium and Mucor, were found on stored coffee. A preliminary study of radiation disinfestation of coffee beans was carried out using 24 bags (each l.5 kg) of Arabica coffee. Each bag was infested with l00 adults of l-day-old to 8-day old A. fasciculatus. One month after infestation, the bags were divided into 6 groups (4 bags each). Five groups were irradiated with doses of 0, 0.05, 0.l0, 0.20, and 0.40 kGy, while the sixth group was fumigated with about 3 g phosphine-m/sup 3/. The work is still in progress. The preliminary data (insect density, percentage weight loss of coffee beans, and mold infestation) from l0 observation periods during 20 weeks of storage after treatment was reported. Radiation disinfestation of tobacco was done on 36 export-size bales (each l00 x 75 x 40 cm in size and about k00 kg in weight) of tobacco. Each bale was infested with larvae, pupae, and adults of L. serricorne. One week after infestation, the bales were divided into 3 groups, the first group kept untreated as controls, the second group irradiated at a dose range of 0.30 to 0.60 kGy, and the third group fumigated with about 3 g phosphine/m/sup 3/. Insect density, leaf moisture content and mold infestation will be observed after 0, 2, 4, and 6 months of storage. The work was begun in October l983 and data presently are being collected

  20. Coffee Shop Youth Lifestyle

    Directory of Open Access Journals (Sweden)

    Vahid Shalchi

    2008-04-01

    Full Text Available This article has a review on the third zone coffee shop youth life style and looks forward to note the features of this group’s life style. Some of the other objective of this article are notifying the importance of different elements in life, consumption norms and the types of leisure. The results of this research shows that in this social atmosphere, post modern lifestyle features are seen as fashion, hybrid taste, interaction among local and global affairs, the importance of hobbies, consumption and the necessity of leisure. The study on this group of Iranian youth foretells how difficult. Complicated and fragile cultural policy is. Therefore, cultural affecting on the youth generation is not possible only through addrssing the values in surface.

  1. Exploring Historical Coffee and Climate Relations in Southern Guatemala: An Integration of Tree Ring Analysis and Remote Sensing Data =

    Science.gov (United States)

    Pons, Diego

    This dissertation makes use of a physical geography perspective to examine the relationship between agriculture and climate in Guatemala using dendrochronology. I examined the potential of high-resolution climate proxy data from dendrochronology to help fill in the gaps of past climate information to better understand the natural and anthropogenic variability of precipitation which, in turn, can inform Guatemala's agriculture sector. This research has demonstrated successful cross-dating and climate sensitivity of Abies guatemalensis in the Pacific slope of Guatemala. Based on this, I have produced a 124-year record of mean precipitation from June-July-August. The mean precipitation from June-July-August at this site seems to receive an important influence from the sea surface temperature (SST) in the Pacific Ocean in the form of El Nino-Southern Oscillation (ENSO) in the region 3.4. The analysis on the frequency of the precipitation records suggests that single year droughts dominate the record yet, periods of 9 years below-average rainfall can persist. Likewise, single year pluvial events also dominate the evaluated period. The long-term reconstruction of precipitation allowed to describe past relationships between coffee plantations and pests. For instance, the frequency analysis suggests that 4 or more consecutive periods of above-average precipitation are associated with several coffee pests and subsequently great economical losses due to crop failures, including the last coffee leaf rust crisis. This study also presents a streamflow reconstruction of the Upper Samala River watershed using a tree ring-width chronology derived from the Guatemalan fir (Abies guatemalensis) to reconstruct mean August-September-October streamflow volumes for the period 1889-2013. Our analysis shows that strong statistical correlations are present between tree-ring width measurements and monthly natural streamflow series. The mean August-September-October streamflow variability is

  2. Evaluation of Local Wheat Cultivars Susceptibility to infection with Black Stem Rust

    International Nuclear Information System (INIS)

    Batta, Y.A.

    2007-01-01

    The present study was conducted to assess the susceptibility of seven local wheat cultivars from Palestine to infection with black stem rust caused by Puccinia graminis f. sp. tritici. Two techniques of disease inoculation were applied during bioassays: global inoculation of entire wheat plants with urediospores and localized inoculation with urediospores and localized inoculation with urediospores on wheat leaf-pieces incubated under humid conditions. Susceptibility of tested cultivars was evaluated according to disease scale based on number and size of typical unredial pustules that appeared after inoculation on entire plants or leaf pieces. Results obtained on bioassay of susceptibility and disease rating on entire plants indicated that Anbar, Kamata and Hetiya safra cultivars were the least susceptible to P. g. tritici infection, whereas Debiya beda cultivar was the most susceptible. The other tested cultivars such as Nab-El-Jama, sawda and Senf 870 were moderately susceptible. On leaf-pieces, Anbar and Kamatat were the least susceptible cultivars, whereas Debiya beda and Nab-El-Jamal were the most susceptible cultivars. The other tested cultivars such as Debiya swada, Senf 870 and Hetiya safra were moderately susceptible. Significant reductions were obtained for the size of unredial postules formed on leaf-pieces when inoculated in an unwounded state compared to the wounded indicating the importance of wounds during inoculation. The global results indicated the possibility of using above method of disease inoculating, scaling and rating for evaluation of wheat cultivars susceptibility for the eventual use in breeding program for resistant varieties in Palestine. (author)

  3. Coprecipitation of Arsenate and Arsenite with Green Rust Minerals

    Science.gov (United States)

    The objectives of this experiment were to evaluate the extent and nature of arsenic co-precipitation with green rusts and to examine the influence of arsenic incorporation on the mineralogy of formed solid phases. Stoichiometric green rusts were obtained by coprecipitation of fe...

  4. Interacting genes in the pine-fusiform rust forest pathosystem

    Science.gov (United States)

    H.V. Amerson; T.L. Kubisiak; S.A. Garcia; G.C. Kuhlman; C.D. Nelson; S.E. McKeand; T.J. Mullin; B. Li

    2005-01-01

    Fusiform rust (FR) disease of pines, caused by Cronartium quercuum f.sp. fusiforme (Cqf), is the most destructive disease in pine plantations of the southern U. S. The NCSU fusiform rust program, in conjunction with the USDA-Forest Service in Saucier, MS and Athens, GA, has research underway to elucidate some of the genetic interactions in this...

  5. White pines, blister rust, and management in the Southwest

    Science.gov (United States)

    D. A. Conklin; M Fairweather; D Ryerson; B Geils; D Vogler

    2009-01-01

    White pines in New Mexico and Arizona are threatened by the invasive disease white pine blister rust, Cronartium ribicola. Blister rust is already causing severe damage to a large population of southwestern white pine in the Sacramento Mountains of southern New Mexico. Recent detection in northern and western New Mexico suggests that a major expansion of the...

  6. Transfer of stripe rust resistance from Aegilops variabilis to bread ...

    African Journals Online (AJOL)

    In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...

  7. Wheat rusts in the United States in 2016

    Science.gov (United States)

    In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...

  8. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  9. The Azteca Chess experience: learning how to share concepts of ecological complexity with small coffee farmers

    Directory of Open Access Journals (Sweden)

    Luís García-Barrios

    2017-06-01

    Full Text Available Small-scale coffee farmers understand certain complex ecological processes, and successfully navigate some of the challenges emerging from the ecological complexity on their farms. It is generally thought that scientific knowledge is able to complement farmers' knowledge. However, for this collaboration to be fruitful, the gap between the knowledge frameworks of both farmers and scientists will need to be closed. We report on the learning results of 14 workshops held in Chiapas, Mexico during 2015 in which 117 small-scale coffee farmers of all genders (30% women and ages who had little schooling were exposed by researchers to a natural history narrative, a multispecies network representation, a board game, and a series of graphical quizzes, all related to a nine-species complex ecological network with potential for autonomous control of the ongoing and devastating coffee rust epidemic that was affecting them. Farmers' retention and understanding of direct and indirect bilateral interactions among organisms was assessed with different methods to elucidate the effect of adding Azteca Chess gaming sessions to a detailed and very graphical lecture. Evaluation methods that were better adapted to farmers' conditions improved learning scores and showed statistically significant age effect (players older than 40 had lower retention scores and gaming effect (lower retention of interactions included in the lecture but not in the game. The combination of lecture and game sessions helped participants better understand cascades of trait-mediated interactions. Participants' debriefings confirmed qualitatively that they learned that beneficial organisms and interactions occur on their farms, and that gaming was enjoyable, motivating, and critical to grasp complex interactions. Many of the farmers concluded that the outcome of these interactions is not unique and not always in favor of rust control but is context dependent. Many concluded that there are

  10. 29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    rust pathogen. The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines ...

  11. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...

  12. Turkish cultural heritage: a cup of coffee

    OpenAIRE

    Birsen Yılmaz; Nilüfer Acar-Tek; Saniye Sözlü

    2017-01-01

    Setting out a fabulous journey from a tiny bean, coffee is the stimulant of the heart and mind and a mysterious plant that strengthens friendship and also takes your tiredness away during the day. Although information on how and where the coffee came from is not clear, Sheikh Şazeli is regarded as the “father” by coffee makers. The word coffee originates from “Kaffa”, a primary coffee production center in Abyssinia, Africa, which can be considered the homeland of coffee. According to this con...

  13. lon beam analysis of Brazilian coffee

    Energy Technology Data Exchange (ETDEWEB)

    Debastiani, R.; Santos, C.E.I. dos; Ramos, M.M.; Souza, V.S.; Yoneama, M.L.; Amaral, L.; Dias, J.F. [Universidade Federal do Rio Grande so Sul (UFRGS), Porto Alegre, RS (Brazil). Instituto de Fisica

    2013-07-01

    Full text: Coffee is one of the most popular and consumed beverages worldwide. Consumers can make the beverage from different types of coffee such as ground coffee, instant coffee or grinding roasted coffee beans. Each type of coffee leads to different characteristics in flavor and scent. The aim of this work is to perform an elemental analysis of ground coffee and roasted coffee beans. To that end, eight popular Brazilian ground coffee brands have been chosen to make a comparative study among brands. One of these brands was selected for a complete study of the beverage preparation process. This same brand offers packages of roasted coffee beans, which allowed the elemental comparison between ground coffee and roasted coffee beans. Roasted coffee beans were ground with a pestle and mortar. The beverage was prepared using a typical coffee pot. The spent and liquid coffees were submitted to a heat treatment and subsequently homogenized and pressed into pellets. The filters used in the coffee pot were analyzed as well. For micro-PIXE studies, coffee beans were cut in different parts for analysis. Samples of ground coffee and roasted coffee beans (grind) were analyzed by PIXE, while light elements like C, O and N were analyzed by RBS (Rutherford Backscattering Spectrometry). The roasted coffee beans were analyzed by micro-PIXE to check the elemental distribution in the beans. The elements found in powder coffee were Mg, AI, Si, P, S, CI, K, Ca, Ti, Mn, Fe, Cu, Zn and Rb. Potassium is the element with higher concentration, while Ti and Zn are trace elements. AI, Si and Ti showed the same concentration for all brands. Potassium and chlorine have high solubility, and about 80% of their concentration is transferred from the powder to the beverage during the infusion. Mg, P, CI, K, Mn, Fe, Zn and Rb showed significant variation between ground coffee and roasted coffee beans. The elemental maps show that potassium and phosphorus are correlated, and iron appears in particular

  14. lon beam analysis of Brazilian coffee

    International Nuclear Information System (INIS)

    Debastiani, R.; Santos, C.E.I. dos; Ramos, M.M.; Souza, V.S.; Yoneama, M.L.; Amaral, L.; Dias, J.F.

    2013-01-01

    Full text: Coffee is one of the most popular and consumed beverages worldwide. Consumers can make the beverage from different types of coffee such as ground coffee, instant coffee or grinding roasted coffee beans. Each type of coffee leads to different characteristics in flavor and scent. The aim of this work is to perform an elemental analysis of ground coffee and roasted coffee beans. To that end, eight popular Brazilian ground coffee brands have been chosen to make a comparative study among brands. One of these brands was selected for a complete study of the beverage preparation process. This same brand offers packages of roasted coffee beans, which allowed the elemental comparison between ground coffee and roasted coffee beans. Roasted coffee beans were ground with a pestle and mortar. The beverage was prepared using a typical coffee pot. The spent and liquid coffees were submitted to a heat treatment and subsequently homogenized and pressed into pellets. The filters used in the coffee pot were analyzed as well. For micro-PIXE studies, coffee beans were cut in different parts for analysis. Samples of ground coffee and roasted coffee beans (grind) were analyzed by PIXE, while light elements like C, O and N were analyzed by RBS (Rutherford Backscattering Spectrometry). The roasted coffee beans were analyzed by micro-PIXE to check the elemental distribution in the beans. The elements found in powder coffee were Mg, AI, Si, P, S, CI, K, Ca, Ti, Mn, Fe, Cu, Zn and Rb. Potassium is the element with higher concentration, while Ti and Zn are trace elements. AI, Si and Ti showed the same concentration for all brands. Potassium and chlorine have high solubility, and about 80% of their concentration is transferred from the powder to the beverage during the infusion. Mg, P, CI, K, Mn, Fe, Zn and Rb showed significant variation between ground coffee and roasted coffee beans. The elemental maps show that potassium and phosphorus are correlated, and iron appears in particular

  15. Control Of Rust Disease In Irradiated Vicia Faba By Using Safe Alternative Methods

    International Nuclear Information System (INIS)

    Ahmed, B.M.; Helal, I.M.; Mohamed, G.A.

    2013-01-01

    Infection of Vicia faba with Uromyces viciae-fabae causes significant decrease in growth and total nitrogen content and increase in the phenolic compounds. The study was carried out to investigate the effects of chemicals used as drench application in soil (e.g. saccharin), biotic agents (e.g. Bacillus subtilis) and artificial essential oils (e.g. rosemary) in irradiated (0, 5, 10, 15 Gy) broad bean Vicia faba on the rust fungus Uromyces viciae-fabae. Bacillus subtilis was inoculated to beans at the third leaf then saccharin (5 mM/l) was used as drench application in the soil and the essential oil was used for foliar application at concentrations 0, 500, 1000 and 1500 ppm. All treatments gave positive results to control the disease but differ in the mechanism of action. The control of the disease with saccharin application may be due to the formation of antimicrobial components (wyrone acid) by plant tissues and increase with increasing the concentration of saccharin. In case of using the essential oil, the affect on the microbe was directly observed within 28 h because the oil affect the permeability of cell membrane of the pathogen but in case of Bacillus, it acts as biological control agent induced resistance of plant by affecting the activity of antioxidant enzymes; peroxidase and chitinase. Saccharin and spore suspension induce systemic protection to rust infection after 72 and 96 hours. The disease index and the phenolic compounds were determined because they play important role in the systemic protection of rust disease 96 h after application. The results showed that the phytoalexin wyerone acid was formed in case of biotic agent (Bacillus subtilis) and the chemical (saccharin) but did not form in case of essential oil (rosemary)

  16. The effect of dewaxing of green coffee on the coffee brew

    NARCIS (Netherlands)

    Stegen, G.H.D. van der

    1979-01-01

    The two commercially most important mild treatments for green coffee are the steam treatment and the dewaxing process. In the former treatment the green coffee is just steamed. In the dewaxing process the waxy layer is extracted from the green coffee with an organic solvent, after which this coffee

  17. DEVELOPMENT OF COFFEE MARKET AND CHANGES IN COFFEE CONSUMPTION AMONG POLES

    Directory of Open Access Journals (Sweden)

    Sylwia Chudy

    2014-12-01

    Full Text Available The paper presents results of a survey concerning coffee consumption together with results of visual and instrumental coffee analyses. The investigations focused on the type of additives used when preparing coffee. Based on the survey it was found that 58.3% respondents use sweeteners and 92.7% coffee whiteners (mainly milk with 3.2% fat content.

  18. Evidence from The Rwandan Coffee Sector.

    African Journals Online (AJOL)

    the coffee value chain and to promote the production of speciality coffee. A research team ... exporters and the installation of several parchment mills by companies ..... use a Simple linear regression model was used to explain the total quantity.

  19. Physical water treatment against calcification and rust

    International Nuclear Information System (INIS)

    Burger, A.

    1995-01-01

    In contrast to Germany, where the installation of small-sized, decentralised plants is still prefered, water supply companies in countries such as Denmark have already for some time successfully been using physical water treatment systems. Although the health and environmental benefits of this non-chemical method of water treatment are undisputed and its proper application is also economically beneficial, there is still a widerspread lack of information as to where such plants can be used. Consequently, older methods are often resorted to combatting calcification and rust. (orig.) [de

  20. Water use efficiency by coffee arabica after glyphosate application

    Directory of Open Access Journals (Sweden)

    Felipe Paolinelli de Carvalho

    2014-07-01

    Full Text Available Many coffee growers apply glyphosate in directed applications, but some phytotoxicity has been noted. It is believed some herbicides can exert a direct or indirect negative effect on photosynthesis by reducing the metabolic rate in a way that can affect the water use efficiency. The objective of this study was to investigate the variables related to water use among coffee cultivars subjected to the application of glyphosate and the effects of each dose. The experiment was conducted in a greenhouse using three varieties of coffee (Coffea arabica, Acaiá (MG-6851, Catucaí Amarelo (2SL and Topázio (MG-1190, and three doses of glyphosate (0.0, 115.2 and 460.8 g acid equivalent ha-1, in a factorial 3 x 3 design. At 15 days after application, a reduction in stomatal conductance was observed, and smaller transpiration rate and water use efficiency were found in the fourth leaf at 15 days after application. There was a decrease in the transpiration rate at 45 DAA, with the Acaiá cultivar showing reductions with 115.2 g ha-1. There was transitory reduction in water use efficiency with glyphosate application, but can affect the growth and production. The Acaiá cultivar showed the highest tolerance to glyphosate because the water use efficiency after herbicide application.

  1. Markkinointiviestintäsuunnitelma : Classic Coffee Oy

    OpenAIRE

    Eerola, Laura

    2015-01-01

    Opinnäytetyön aiheena oli laatia markkinointiviestintäsuunnitelma kalenterivuodelle 2016 vuosikellon muodossa, toimintansa jo vakiinnuttaneelle Classic Coffee Oy:lle. Classic Coffee Oy on vuonna 2011 perustettu, Tampereella toimiva kahvila-alan yritys joka tarjoaa lounaskahvilatoiminnan lisäksi laadukkaita konditoria-palveluita, yritys- ja kokoustarjoiluja sekä tilavuokrausta. Classic Coffee Oy:llä on yksi kahvila, Classic Coffee Tampella. Kahvila sijaitsee Tampellassa, Tampereen keskustan vä...

  2. Tea, coffee and prostate cancer.

    Science.gov (United States)

    Lee, Andy H; Fraser, Michelle L; Binns, Colin W

    2009-02-01

    Worldwide, prostate cancer has the second highest incidence of all cancers in males with incidence and mortality being much higher in affluent developed countries. Risk and progression of the disease may be linked to both genetic and environmental factors, especially dietary factors. Tea and coffee are two of the most popular beverages in the world and have been investigated for possible effects on health outcomes, including cancer. However, very little dietary advice for their consumption exists. The evidence for a relationship between coffee or tea consumption and prostate cancer is reviewed in this paper. While current evidence indicates that coffee is a safe beverage, its consumption probably has no relationship with prostate cancer. Tea, especially green tea, has shown some potential in the prevention of prostate cancer. While evidence from epidemiologic studies is currently inconclusive, strong evidence has emerged from animal and in vitro studies. We also consider what level of evidence is required to make recommendations for preventive measures to the public. Although evidence on the relationship between coffee, tea and prostate cancer is not complete, we consider it strong enough to recommend tea as a healthier alternative to coffee.

  3. Good news for coffee addicts.

    Science.gov (United States)

    Lee, Thomas H

    2009-06-01

    Whether it's a basic Mr. Coffee or a gadget that sports a snazzy device for grinding beans on demand, the office coffee machine offers a place for serendipitous encounters that can improve the social aspect of work and generate new ideas. What's more, a steaming cup of joe may be as good for your health as it is for the bottom line, says Lee, a professor of medicine at Harvard Medical School and the CEO of Partners Community HealthCare. Fears of coffee's carcinogenic effects now appear to be unfounded, and, in fact, the brew might even protect against some types of cancer. What's more, coffee may guard against Alzheimer's disease and other forms of dementia and somehow soften the blow of a heart attack. Of course, its role as a pick-me-up is well known. So there's no need to take your coffee with a dollop of guilt, especially if you ease up on the sugar, cream, double chocolate, and whipped-cream topping.

  4. DIRECT AND INDIRECT SOMATIC EMBRYOGENESIS ON ARABICA COFFEE (Coffea arabica

    Directory of Open Access Journals (Sweden)

    Meynarti Sari Dewi Ibrahim

    2013-10-01

    Full Text Available Propagation of Coffea arabica L. through direct and indirect somatic embryogenesis technique is promising for producing large number of coffee seedlings. The objectives of the research were to evaluate methods for direct and indirect somatic embryo-genesis induction of C. arabica var. Kartika. The explants were the youngest fully expanded leaves of arabica coffee. The evalu-ated medium was modified Murashige and Skoog (MS medium supplemented with a combination of 2.26 µM 2,4-D + 4.54 or 9.08 µM thidiazuron; 4.52 µM 2,4-D + 4.54 or 9.08 µM thidiazuron; or 9.04 µM 2,4-D + 9.08 µM thidiazuron. Both calli (100 mg and pre-embryos developed from the edge of leaf explants were subcultured into regeneration medium (half strength MS with modified vitamin, supplemented with kinetine 9.30 µM and adenine sulfate 40 mg L-1. The results showed coffee leaf explant cultured on medium containing 2.26 µM 2,4-D + 4.54 or 9.08 µM thidiazuron to induce direct somatic embriogenesis from explant, while that of 4.52 or 9.04 µM 2,4-D + 9.08 µM thidiazuron to induced indirect somatic embrio-genesis. The medium for calli induction from coffee by explants was medium supplemented with 4.52 or 9.04 µM 2,4-D in combination with 9.08 µM thidiazuron. On the other hand, the best medium for activation of induction of somatic embryos was MS medium supplemented with 9.04 µM 2,4-D + 9.08 µM thidiazuron. Based on this results, the first step for developing micropropagation for coffee has been resolved. The subsequent studies will be directed to evaluate agronomic performance of the derived planting materials.

  5. Relationship between sugarcane rust severity and soil properties in louisiana.

    Science.gov (United States)

    Johnson, Richard M; Grisham, Michael P; Richard, Edward P

    2007-06-01

    ABSTRACT The extent of spatial and temporal variability of sugarcane rust (Puccinia melanocephala) infestation was related to variation in soil properties in five commercial fields of sugarcane (interspecific hybrids of Saccharum spp., cv. LCP 85-384) in southern Louisiana. Sugarcane fields were grid-soil sampled at several intensities and rust ratings were collected at each point over 6 to 7 weeks. Soil properties exhibited significant variability (coefficients of variation = 9 to 70.1%) and were spatially correlated in 39 of 40 cases with a range of spatial correlation varying from 39 to 201 m. Rust ratings were spatially correlated in 32 of 33 cases, with a range varying from 29 to 241 m. Rust ratings were correlated with several soil properties, most notably soil phosphorus (r = 0.40 to 0.81) and soil sulfur (r = 0.36 to 0.68). Multiple linear regression analysis resulted in coefficients of determination that ranged from 0.22 to 0.73, and discriminant analysis further improved the overall predictive ability of rust models. Finally, contour plots of soil properties and rust levels clearly suggested a link between these two parameters. These combined data suggest that sugarcane growers that apply fertilizer in excess of plant requirements will increase the incidence and severity of rust infestations in their fields.

  6. Host jumps shaped the diversity of extant rust fungi (Pucciniales).

    Science.gov (United States)

    McTaggart, Alistair R; Shivas, Roger G; van der Nest, Magriet A; Roux, Jolanda; Wingfield, Brenda D; Wingfield, Michael J

    2016-02-01

    The aim of this study was to determine the evolutionary time line for rust fungi and date key speciation events using a molecular clock. Evidence is provided that supports a contemporary view for a recent origin of rust fungi, with a common ancestor on a flowering plant. Divergence times for > 20 genera of rust fungi were studied with Bayesian evolutionary analyses. A relaxed molecular clock was applied to ribosomal and mitochondrial genes, calibrated against estimated divergence times for the hosts of rust fungi, such as Acacia (Fabaceae), angiosperms and the cupressophytes. Results showed that rust fungi shared a most recent common ancestor with a mean age between 113 and 115 million yr. This dates rust fungi to the Cretaceous period, which is much younger than previous estimations. Host jumps, whether taxonomically large or between host genera in the same family, most probably shaped the diversity of rust genera. Likewise, species diversified by host shifts (through coevolution) or via subsequent host jumps. This is in contrast to strict coevolution with their hosts. Puccinia psidii was recovered in Sphaerophragmiaceae, a family distinct from Raveneliaceae, which were regarded as confamilial in previous studies. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  7. Farmer awareness, coping mechanisms and economic implications ...

    African Journals Online (AJOL)

    Coffee leaf rust (CLR) still remains a serious threat to the economics of coffee farming in Uganda. The disease is more severe on Arabica coffee (Coffea arabica) at mid and low altitude (1500 m and below) where crop losses is up to 50%. The objective of this study was to document farmers' knowledge about the disease, ...

  8. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 50 of 171 ... Vol 4, No 2 (2010), Coffee Leaf Rust Epidemics (Hemileia vastatrix) ... Study on Wind Power using Meteorological Data and Wind Turbine ... Conservation Structures in Adama District, Oromia Region, Ethiopia, Abstract PDF.

  9. Toward systems epidemiology of coffee and health.

    Science.gov (United States)

    Cornelis, Marilyn C

    2015-02-01

    Coffee is one of the most widely consumed beverages in the world and has been associated with many health conditions. This review examines the limitations of the classic epidemiological approach to studies of coffee and health, and describes the progress in systems epidemiology of coffee and its correlated constituent, caffeine. Implications and applications of this growing body of knowledge are also discussed. Population-based metabolomic studies of coffee replicate coffee-metabolite correlations observed in clinical settings but have also identified novel metabolites of coffee response, such as specific sphingomyelin derivatives and acylcarnitines. Genome-wide analyses of self-reported coffee and caffeine intake and serum levels of caffeine support an overwhelming role for caffeine in modulating the coffee consumption behavior. Interindividual variation in the physiological exposure or response to any of the many chemicals present in coffee may alter the persistence and magnitude of their effects. It is thus imperative that future studies of coffee and health account for this variation. Systems epidemiological approaches promise to inform causality, parse the constituents of coffee responsible for health effects, and identify the subgroups most likely to benefit from increasing or decreasing coffee consumption.

  10. ASSESSMENT OF METALS IN ROASTED INDIGENOUS COFFEE ...

    African Journals Online (AJOL)

    1Department of Chemistry, College of Natural Sciences, Addis Ababa University, P.O. Box. 1176, Addis .... cultivation region of Ethiopian coffee by elemental analysis. ... health regulatory limits of the metals in coffee to provide guideline information on the .... Procedures tested for digestion of roasted coffee samples. No.

  11. How Competitive is the Dutch Coffee market?

    NARCIS (Netherlands)

    L.J.H. Bettendorf (Leon); F. Verboven

    1997-01-01

    textabstractWorld coffee bean prices have shown large fluctuations during the past years. Consumer prices for roasted coffee, in contrast, have varied considerably less. This article investigates whether the weak relationship between coffee bean and consumer prices can be explained by a lack of

  12. Coffee seeds isotopic composition as a potential proxy to evaluate Minas Gerais, Brazil seasonal variations during seed maturation

    Science.gov (United States)

    Rodrigues, Carla; Maia, Rodrigo; Brunner, Marion; Carvalho, Eduardo; Prohaska, Thomas; Máguas, Cristina

    2010-05-01

    Plant seeds incorporate the prevailing climate conditions and the physiological response to those conditions (Rodrigues et al., 2009; Rodrigues et al., submitted). During coffee seed maturation the biochemical compounds may either result from accumulated material in other organs such as leafs and/or from new synthesis. Accordingly, plant seeds develop in different stages along a particular part of the year, integrating the plant physiology and seasonal climatic conditions. Coffee bean is an extremely complex matrix, rich in many products derived from both primary and secondary metabolism during bean maturation. Other studies (De Castro and Marraccini, 2006) have revealed the importance of different coffee plant organs during coffee bean development as transfer tissues able to provide compounds (i.e. sugars, organic acids, etc) to the endosperm where several enzymatic activities and expressed genes have been reported. Moreover, it has been proved earlier on that green coffee bean is a particularly suitable case-study (Rodrigues et al., 2009; Rodrigues et al., submitted), not only due to the large southern hemispheric distribution but also because of this product high economic interest. The aim of our work was to evaluate the potential use of green coffee seeds as a proxy to seasonal climatic conditions during coffee bean maturation, through an array of isotopic composition determinations. We have determined carbon, nitrogen, oxygen and sulfur isotopic composition (by IRMS - Isotope Ratio Mass Spectrometry) as well as strontium isotope abundance (by MC-ICP-MS; Multicollector Inductively Coupled Plasma Mass Spectrometry), of green coffee beans harvested at different times at Minas Gerais, Brazil. The isotopic composition data were combined with air temperature and relative humidity data registered during the coffee bean developmental period, and with the parent rock strontium isotopic composition. Results indicate that coffee seeds indeed integrate the interactions

  13. Incorporation of Monovalent Cations in Sulfate Green Rust

    DEFF Research Database (Denmark)

    Christiansen, B. C.; Dideriksen, K.; Katz, A.

    2014-01-01

    Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...... with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both...

  14. Heavier smoking increases coffee consumption

    DEFF Research Database (Denmark)

    Bjørngaard, Johan H; Nordestgaard, Ask Tybjærg; Taylor, Amy E

    2017-01-01

    Background: There is evidence for a positive relationship between cigarette and coffee consumption in smokers. Cigarette smoke increases metabolism of caffeine, so this may represent a causal effect of smoking on caffeine intake. Methods: We performed Mendelian randomization analyses in the UK...... Biobank ( N  = 114 029), the Norwegian HUNT study ( N  = 56 664) and the Copenhagen General Population Study (CGPS) ( N  = 78 650). We used the rs16969968 genetic variant as a proxy for smoking heaviness in all studies and rs4410790 and rs2472297 as proxies for coffee consumption in UK Biobank and CGPS....... Analyses were conducted using linear regression and meta-analysed across studies. Results: Each additional cigarette per day consumed by current smokers was associated with higher coffee consumption (0.10 cups per day, 95% CI: 0.03, 0.17). There was weak evidence for an increase in tea consumption per...

  15. Proposal and reclassification of standards for resistance studies of brown rust sugarcane

    Directory of Open Access Journals (Sweden)

    Joaquín Montalván Delgado

    2017-10-01

    Full Text Available In Cuba, the methodology used for sugarcane brown rust resistance evaluation has limited patterning, which makes it difficult to adequately handle cultivars in the intermediate categories of reaction, provided that from an agro-productive point of view they are interest. Six known reaction patterns and 11 commercial cultivars were studied. The variables, length, amount and percentage of leaf area occupied by pustules were recorded, as well as the length of the major pustule. The application and interpretation of statistical methods allowed to ratify as highly resistant PR980, resistant Ja64-11 and as susceptible My5514. The cultivars SP70-1284 (moderately resistant, C88-380 (moderately susceptible and C323-68 (susceptible are included as new standards. They are reclassified to C334-64 (moderately susceptible, Ja60-5 and B4362 (highly susceptible.

  16. Orange rust in sugarcane: molecular identification in Rio de Janeiro State

    Directory of Open Access Journals (Sweden)

    Carla Vanessa Borges Castro

    2013-09-01

    Full Text Available Sugarcane (Saccharum spp. cultivation is one of the major agricultural activities in the Brazilian states. This study aimed to molecularly identify the pathogen associated with rust in sugarcane cultivars in the state of Rio de Janeiro and to suggest a control strategy. Among the 14 PCR-tested cultivars, Puccinia kuehnii infection was identified for RB947520, RB92606, RB835486, RB72454, SP89-11I5, SP83-2847, both from infected leaf sample and from urediniospores. Puccinia kuehnii was not detected by PCR for the cultivars RB955971, RB951541, RB92579, RB867515, RB855536, SP91-1049, SP80-3280, SP80-1816. This is the first molecular detection of this fungus in the state of Rio de Janeiro for six of the 14 analyzed cultivars.

  17. CoffeeScript application development

    CERN Document Server

    Young, Ian

    2013-01-01

    CoffeeScript Application Development is a practical, hands-on guide with step-by-step instructions. Follow the smooth and easy tutorial approach, covering examples that build in complexity. By the final chapter you'll be wondering why you didn't try CoffeeScript sooner.If you are a JavaScript developer who wants to save time and add power to your code, then this is the book that will help you do it. With minimal fuss you will learn a whole new language which will reduce your application development time from weeks to days.

  18. Biodiesel Production from Spent Coffee Grounds

    Science.gov (United States)

    Blinová, Lenka; Bartošová, Alica; Sirotiak, Maroš

    2017-06-01

    The residue after brewing the spent coffee grounds is an oil-containing waste material having a potential of being used as biodiesel feedstock. Biodiesel production from the waste coffee grounds oil involves collection and transportation of coffee residue, drying, oil extraction, and finally production of biodiesel. Different methods of oil extraction with organic solvents under different conditions show significant differences in the extraction yields. In the manufacturing of biodiesel from coffee oil, the level of reaction completion strongly depends on the quality of the feedstock oil. This paper presents an overview of oil extraction and a method of biodiesel production from spent coffee grounds.

  19. Thermodynamic analysis of a solar coffee maker

    International Nuclear Information System (INIS)

    Sosa-Montemayor, F.; Jaramillo, O.A.; Rio, J.A. del

    2009-01-01

    In this paper we present a novel solar concentrating application, a coffee brewing system using a satellite TV mini-Dish concentrator coupled to a stovetop espresso coffee maker. We present a theoretical model for the thermal behavior of the water in the lower chamber of the coffee maker. We validate the model obtaining good agreement with the experimental results. Our findings indicate that the coffee brewing system works, it takes 30-50 min to complete its task. The model and our practical experience encourage us to improve the concentration device in order to obtain a useful solar coffee maker, using the theoretical model as a safe guide to achieve this.

  20. Thermodynamic analysis of a solar coffee maker

    Energy Technology Data Exchange (ETDEWEB)

    Sosa-Montemayor, F.; Jaramillo, O.A. [Centro de Investigacion en Energia, Universidad Nacional Autonoma de Mexico, Privada Xochicalco S/N, Temixco, Morelos CP 62580 (Mexico); del Rio, J.A. [Centro Morelense de Innovacion y Tranferencia Tecnologica, CCyTEM, Camino Temixco a Emiliano Zapata, Km 0.3, Colonia Emiliano Zapata, Morelos CP 62760 (Mexico)

    2009-09-15

    In this paper we present a novel solar concentrating application, a coffee brewing system using a satellite TV mini-Dish concentrator coupled to a stovetop espresso coffee maker. We present a theoretical model for the thermal behavior of the water in the lower chamber of the coffee maker. We validate the model obtaining good agreement with the experimental results. Our findings indicate that the coffee brewing system works, it takes 30-50 min to complete its task. The model and our practical experience encourage us to improve the concentration device in order to obtain a useful solar coffee maker, using the theoretical model as a safe guide to achieve this. (author)

  1. Rust types from JSON samples - Approximating type providers with procedural macros in Rust

    OpenAIRE

    Vesteraas, Erik Andreas

    2017-01-01

    When programmers access external data in a statically typed programming language, they are often faced with a dilemma between convenient and type-safe access to the data. In the programming language F#, a concept called type providers has been proposed as a solution to this problem by having compiler support for libraries with the capability to generate types at compile time. This thesis presents "json_typegen", a project which aims to show the feasibility of similar solutions in the Rust pro...

  2. Analysis of acrylamide in coffee and dietary exposure to acrylamide from coffee

    DEFF Research Database (Denmark)

    Granby, Kit; Fagt, Sisse

    2004-01-01

    An analytical method for analysing acrylamide in coffee was validated. The analysis of prepared coffee includes a comprehensive clean-up using multimode solid-phase extraction (SPE) by automatic SPE equipment and detection by liquid chromatography tandem mass spectrometry using electrospray...... in the positive mode. The recoveries of acrylamide in ready-to-drink coffee spiked with 5 and 10 mug l(-1) were 96 +/- 14% and 100 +/- 8%, respectively. Within laboratory reproducibility for the same spiking levels were 14% and 9%, respectively. Coffee samples (n = 25) prepared twice by coffee machines and twice...... by a French Press Cafetiere coffee maker contained 8 +/- 3 mug l(-1) and 9 +/- 3 mug l(-1) acrylamide. Five ready-to-drink instant coffee prepared twice contained 8 +/- 2 mug l(-1). Hence, the results do not show significant differences in the acrylamide contents in ready-to-drink coffee prepared by coffee...

  3. Coffee and spent coffee extracts protect against cell mutagens and inhibit growth of food-borne pathogen microorganisms

    OpenAIRE

    Cid, C. (Concepción); Peña, M.P. (María Paz) de; Arbillaga, L. (Leire); Vitas, A.I. (Ana Isabel); Bravo, J. (Jimena); Monente, C. (Carmen)

    2015-01-01

    Coffee consumption decreases the risk of oxidative stress-related diseases. The by-product obtained after brewing process (spent coffee) also has antioxidant capacity. Spent coffee and coffee brews (filter and espresso) extracts were obtained from Arabica and Robusta coffees, respectively. Spent coffee showed slightly high amounts in chlorogenic acids, but caffeine content was similar to their respective coffee brew. All samples exhibited strong protection activity against indirect acting mut...

  4. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Seedling resistance is usually race-specific, but often pro- vides complete ... Genomic DNA was extracted using the CTAB method of. Saghai-Maroof ... Polymerase chain reactions (PCR) were performed in ..... The continuous supply of the rust ...

  5. Two distinct classes of QTL determine rust resistance in sorghum.

    Science.gov (United States)

    Wang, Xuemin; Mace, Emma; Hunt, Colleen; Cruickshank, Alan; Henzell, Robert; Parkes, Heidi; Jordan, David

    2014-12-31

    Agriculture is facing enormous challenges to feed a growing population in the face of rapidly evolving pests and pathogens. The rusts, in particular, are a major pathogen of cereal crops with the potential to cause large reductions in yield. Improving stable disease resistance is an on-going major and challenging focus for many plant breeding programs, due to the rapidly evolving nature of the pathogen. Sorghum is a major summer cereal crop that is also a host for a rust pathogen Puccinia purpurea, which occurs in almost all sorghum growing areas of the world, causing direct and indirect yield losses in sorghum worldwide, however knowledge about its genetic control is still limited. In order to further investigate this issue, QTL and association mapping methods were implemented to study rust resistance in three bi-parental populations and an association mapping set of elite breeding lines in different environments. In total, 64 significant or highly significant QTL and 21 suggestive rust resistance QTL were identified representing 55 unique genomic regions. Comparisons across populations within the current study and with rust QTL identified previously in both sorghum and maize revealed a high degree of correspondence in QTL location. Negative phenotypic correlations were observed between rust, maturity and height, indicating a trend for both early maturing and shorter genotypes to be more susceptible to rust. The significant amount of QTL co-location across traits, in addition to the consistency in the direction of QTL allele effects, has provided evidence to support pleiotropic QTL action across rust, height, maturity and stay-green, supporting the role of carbon stress in susceptibility to rust. Classical rust resistance QTL regions that did not co-locate with height, maturity or stay-green QTL were found to be significantly enriched for the defence-related NBS-encoding gene family, in contrast to the lack of defence-related gene enrichment in multi-trait effect

  6. Wheat Rust Information Resources - Integrated tools and data for improved decision making

    DEFF Research Database (Denmark)

    Hodson, David; Hansen, Jens Grønbech; Lassen, Poul

    giving access to an unprecedented set of data for rust surveys, alternate hosts (barberry), rust pathotypes, trap nurseries and resistant cultivars. Standardized protocols for data collection have permitted the development of a comprehensive data management system, named the Wheat Rust Toolbox....... Integration of the CIMMYT Wheat Atlas and the Genetic Resources Information System (GRIS) databases provides a rich resource on wheat cultivars and their resistance to important rust races. Data access is facilitated via dedicated web portals such as Rust Tracker (www.rusttracker.org) and the Global Rust...

  7. Decontamination Procedure for Sorghum and Coffee Leaves Sprayed With Zinc and a Surfactant

    OpenAIRE

    Caione, Gustavo; Guirra, Ana Paula Pires Maciel; Prado, Renato de Mello; Klar, Antonio Evaldo

    2014-01-01

    Decontaminating leaf samples from crops sprayed with pesticides and nutrient solutions is important for foliar analysis. This study evaluated the effect of different washing methods in coffee and sorghum foliage that had been sprayed with zinc (with or without surfactant). The plants were sprayed with a 3 g L-1 zinc sulfate solution, with and without surfactant. Seven days later, leaves were collected and washed. The experiment was completely randomized in a 2 x 2 x 3 + 2 factorial, with thre...

  8. Say goodbye to coffee stains

    NARCIS (Netherlands)

    Eral, Burak; van den Ende, Henricus T.M.; Mugele, Friedrich Gunther

    2012-01-01

    Discussing ideas over a mug of coffee or tea is the lifeblood of science, but have you ever thought about the stains that can be inadvertently left behind? H Burak Eral, Dirk van den Ende and Frieder Mugele explain how these stains, which can be a major annoyance in some biology techniques, can be

  9. Coffee Cup Atomic Force Microscopy

    Science.gov (United States)

    Ashkenaz, David E.; Hall, W. Paige; Haynes, Christy L.; Hicks, Erin M.; McFarland, Adam D.; Sherry, Leif J.; Stuart, Douglas A.; Wheeler, Korin E.; Yonzon, Chanda R.; Zhao, Jing; Godwin, Hilary A.; Van Duyne, Richard P.

    2010-01-01

    In this activity, students use a model created from a coffee cup or cardstock cutout to explore the working principle of an atomic force microscope (AFM). Students manipulate a model of an AFM, using it to examine various objects to retrieve topographic data and then graph and interpret results. The students observe that movement of the AFM…

  10. Double Coffee opens in China

    Index Scriptorium Estoniae

    2009-01-01

    Läti suursaadik Ingrida Levrence avas esimese Double Coffee kohviku Hiina pealinnas Pekingi südames. Rahvusvaheline kohvikukett kavatseb laieneda mõne kohviku võrra igal aastal. Seni tegutsetakse Lätis, Eestis, Leedus, Ukrainas ja Valgevenes

  11. Coffee berry disease in Kenya

    NARCIS (Netherlands)

    Vermeulen, H.

    1979-01-01

    Data are presented on research in Kenya in 1964 - 1969 on anatomical, mycological, epidemiological, chemical control and cultural aspects of coffee berry disease, Colletotrichum coffeanum Noack, of Coffea arabica L. The pathogen causes flower and berry

  12. Moessbauer Characterization of Rust Obtained in an Accelerated Corrosion Test

    International Nuclear Information System (INIS)

    Garcia, K. E.; Morales, A. L.; Arroyave, C. E.; Barrero, C. A.; Cook, D. C.

    2003-01-01

    We have performed drying-humectation cyclical processes (CEBELCOR) on eight A36 low carbon steel coupons in NaCl solutions containing 1x10 -2 M and 1x10 -1 M concentrations. The main purpose of these experiments is to contribute to the understanding of the conditions for akaganeite formation. Additionally, and with the idea to perform a complete characterization of the rust, this work also considers the formation of other iron oxide phases. The corrosion products were characterized by Moessbauer spectroscopy and X-ray diffraction techniques. Gravimetric analysis demonstrates that the coupons presented high corrosion rates. Magnetite/maghemite was common in the rust stuck to the steel surface, whereas akaganeite was present only in traces. In the rust collected from the solutions, i.e., the rust that goes away from the metal surface easily, a magnetite/maghemite was not present and akaganeite showed up in larger quantities. These results support the idea that high concentrations of Cl - ions are required for the akaganeite formation. We concluded that akaganeite is not easily bonded to the rust layer; this may lead to the formation of a less protective rust layer and to higher corrosion rates.

  13. The Impact of Coffee on Health.

    Science.gov (United States)

    Nieber, Karen

    2017-11-01

    Coffee is one of the most popular and widely consumed beverages worldwide due to its stimulating effects on the central nervous system as well as its taste and aroma. Coffee is a complex mixture of more than 800 volatile compounds whereas caffeine and chlorogenic acids are the most common compounds. During the last years, coffee has progressively moved to a less negative position on health due to its better-known pharmacology. Caffeine, e.g., in a cup of coffee, appears to exert most of its effects through an antagonism of the adenosine receptors. Novel approaches in epidemiological studies and experimental researches suggest that coffee consumption may help to prevent several chronic diseases, including type 2 diabetes mellitus and liver disease. Most prospective cohort studies have not found coffee consumption to be associated with a significantly increased cardiovascular disease risk. There is also evidence that decaffeinated coffee may, in some respect, have similar benefits as regular coffee, indicating that besides caffeine other components contribute to the health protecting effects. For adults consuming moderate amounts of coffee (3 - 4 cups/d providing 300 - 400 mg/d of caffeine), there is little evidence of health risks and some evidence of health benefits. This review provides up-to-date information about coffee on health. Topics addressed include the cardiovascular system, liver diseases, and diabetes as well as gastrointestinal disorders. Georg Thieme Verlag KG Stuttgart · New York.

  14. The performances of coffee processors and coffee market in the Republic of Serbia

    Directory of Open Access Journals (Sweden)

    Nuševa Daniela

    2017-01-01

    Full Text Available The main aim of this paper is to investigate the performances of coffee processors and coffee market in Serbia based on the market concentration analysis, profitability analysis, and profitability determinants analysis. The research was based on the sample of 40 observations of coffee processing companies divided into two groups: large and small coffee processors. The results indicate that two large coffee processors have dominant market share. Even though the Serbian coffee market is an oligopolistic, profitability analysis indicates that small coffee processors have a significant better profitability ratio than large coffee processors. Furthermore, results show that profitability ratio is positively related to the inventory turnover and negatively related to the market share.

  15. Adaptive Measures for the Factors Affecting Marketing of Coffee ...

    African Journals Online (AJOL)

    Adaptive Measures for the Factors Affecting Marketing of Coffee ( Coffea robusta ... of coffee in the study area was poor pricing and marketing systems; this is as a ... of quality control and relevant information on improved coffee technologies.

  16. Antioxidant effect of Arabian coffee (Coffea arabica L) blended with ...

    African Journals Online (AJOL)

    antioxidants (GSH, vitamins C and E) were significantly elevated (p < 0.05) in mice administered. Arabian coffee ... cancer [9,10]. In addition ... HFD alone. IV. HFD + Arabian coffee + cardamom. V. HFD + Arabian coffee + cardamom + cloves.

  17. Coffee Production in Kigoma Region, Tanzania: Profitability and ...

    African Journals Online (AJOL)

    Farmers processed at CPU gained about TZS 1350/kg as coffee improvement gain. Coffee production ... explored, keeping in mind the theories put forth in the theoretical ... Information used in the gross margin analysis encompass total coffee ...

  18. Influence of coffee/water ratio on the final quality of espresso coffee

    OpenAIRE

    Andueza, S. (Susana); Vila, M.A. (María A.); Peña, M.P. (María Paz) de; Cid, C. (Concepción)

    2007-01-01

    Espresso coffee is a polyphasic beverage in which the physico-chemical and sensory characteristics obviously depend on both the selection of ground roasted coffee and the technical conditions of the percolation process. The aim of this work was to evaluate the influence of the coffee/water ratio on the physico-chemical and sensory quality of espresso coffee. Furthermore, the influence of botanical varieties (Arabica and Robusta) and the type of roast (conventional and torrefacto) on the selec...

  19. Coffee Berry Borer Joins Bark Beetles in Coffee Klatch

    Science.gov (United States)

    Jaramillo, Juliana; Torto, Baldwyn; Mwenda, Dickson; Troeger, Armin; Borgemeister, Christian; Poehling, Hans-Michael; Francke, Wittko

    2013-01-01

    Unanswered key questions in bark beetle-plant interactions concern host finding in species attacking angiosperms in tropical zones and whether management strategies based on chemical signaling used for their conifer-attacking temperate relatives may also be applied in the tropics. We hypothesized that there should be a common link in chemical signaling mediating host location by these Scolytids. Using laboratory behavioral assays and chemical analysis we demonstrate that the yellow-orange exocarp stage of coffee berries, which attracts the coffee berry borer, releases relatively high amounts of volatiles including conophthorin, chalcogran, frontalin and sulcatone that are typically associated with Scolytinae chemical ecology. The green stage of the berry produces a much less complex bouquet containing small amounts of conophthorin but no other compounds known as bark beetle semiochemicals. In behavioral assays, the coffee berry borer was attracted to the spiroacetals conophthorin and chalcogran, but avoided the monoterpenes verbenone and α-pinene, demonstrating that, as in their conifer-attacking relatives in temperate zones, the use of host and non-host volatiles is also critical in host finding by tropical species. We speculate that microorganisms formed a common basis for the establishment of crucial chemical signals comprising inter- and intraspecific communication systems in both temperate- and tropical-occurring bark beetles attacking gymnosperms and angiosperms. PMID:24073204

  20. Climate Change Impacts on Worldwide Coffee Production

    Science.gov (United States)

    Foreman, T.; Rising, J. A.

    2015-12-01

    Coffee (Coffea arabica and Coffea canephora) plays a vital role in many countries' economies, providing necessary income to 25 million members of tropical countries, and supporting a $81 billion industry, making it one of the most valuable commodities in the world. At the same time, coffee is at the center of many issues of sustainability. It is vulnerable to climate change, with disease outbreaks becoming more common and suitable regions beginning to shift. We develop a statistical production model for coffee which incorporates temperature, precipitation, frost, and humidity effects using a new database of worldwide coffee production. We then use this model to project coffee yields and production into the future based on a variety of climate forecasts. This model can then be used together with a market model to forecast the locations of future coffee production as well as future prices, supply, and demand.

  1. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  2. Rust fungi on some poaceous weeds of wheat crops in Pakistan

    OpenAIRE

    NAJAM-UL-SEHAR AFSHAN*; ABDUL REHMAN NIAZI

    2013-01-01

    The article enlists common poaceous weeds found in wheat crop sand their specific parasitic rust fungi. In this study, four (04) plant taxa of Poaceae infected with rust fungi are collected from different wheat crops grown in different areas of Pakistan. The rust fungi are isolated, characterized and identified. All these host plants are known weeds of wheat crop in Pakistan. This work would help to identify and enlist the potential rust fungi on weeds of wheat crop that could be utilized to ...

  3. Legume breeding for rust resistance: Lessons to learn from the model Medicago truncatula

    OpenAIRE

    Rubiales, Diego; Castillejo Sánchez, M. Ángeles; Madrid, Eva; Barilli, Eleonora; Rispail, Nicolas

    2011-01-01

    Rusts are major biotic constraints of legumes worldwide. Breeding for rust resistance is regarded as the most cost efficient method for rust control. However, in contrast to common bean for which complete monogenic resistance exists and is efficiently used, most of the rust resistance reactions described so far in cool season food legumes are incomplete and of complex inheritance. Incomplete resistance has been described in faba bean, pea, chickpea and lentil and several of their associated Q...

  4. Assessment of Cellular Mutagenicity of Americano Coffees from Popular Coffee Chains.

    Science.gov (United States)

    Liu, Zhen-Shu; Chen, Po-Wen; Wang, Jung-Yu; Kuo, Tai-Chen

    2017-09-01

    Coffee is a popular beverage worldwide, but coffee beans can be contaminated with carcinogens. The Ames Salmonella mutagenicity test is often used for analysis of carcinogens for mutagenicity. However, previous studies have provided controversial data about the direct mutagenicity of coffee beans based on Ames test results. This study was conducted to determine the mutagenicity of popular Americano coffee based on results from the Ames test. Coffee samples without additives that were served by five international coffee chain restaurants were subjected to the analysis using Salmonella Typhimurium tester strains TA98, TA100, and TA1535. The levels of bacterial revertants in samples from coffee chains were lower than the twofold criterion of the control sets, and no significant dose-response effect was observed with or without rat liver enzyme activation. These data indicate that Americano coffees from the selected coffee chains possessed no direct mutagenic activity with or without enzyme activation. These findings suggest a low mutagenic risk from Americano coffees served by the selected coffee chains and support the use of other methods to confirm the nonmutagenicity of coffee products. These results are consistent with most recent epidemiological reports.

  5. What every dentist should know about coffee.

    Science.gov (United States)

    Seidman, Lara M; Eckenrode, Kelsey N; Bloom, Ira T; Bashirelahi, Nasir

    2016-01-01

    Coffee is one of the most widely consumed beverages throughout the world. Its stimulating nature is responsible for much of its popularity, which paradoxically has resulted in its reputation for negative effects on consumer health. This review will address recent research on the systemic and dental health effects of coffee. Many of its supposed harmful effects have been disproved, while many protective and beneficial roles for coffee are emerging.

  6. Furan in roasted, ground and brewed coffee

    Science.gov (United States)

    Gruczyńska, Eliza; Kowalska, Dorota; Kozłowska, Mariola; Majewska, Ewa; Tarnowska, Katarzyna

    2018-01-01

    Coffee is the most popular hot beverage in the world. The annual coffee production in 2010, 2014 and 2016 was 8.1, 9.0 and 9.3 million tons respectively. There are more than 100 coffee species, but only two of them: Arabica (Coffea arabica) and Robusta (Coffea canephora) have gained commercial importance. During roasting of green coffee beans not only desirable compounds are formed, that exert positive influence on the taste and flavour of coffee, but also small quantities of undesirable ones. Furan (C4H4O) is one of the latter. Furan is a volatile compound (boiling temp. of 31.4 oC) formed during thermal processing of food. The toxicity of furan has been well documented and it is classified as “possible human carcinogen” (Group 2B) by the International Agency for Research on Cancer. Various pathways have been reported for furan formation during food processing. It can be formed from carbohydrates, amino acids by their thermal degradation or thermal re-arrangement and by oxidation of ascorbic acid and polyunsaturated acids and carotenoids. High concentrations of furan have been reported in coffee, baked and roasted food and in food subjected to preserving in cans and jars. Furan levels in brewed coffee are typically near or below 120 μg/L, but it can approach thousands μg/kg in roasted whole beans or ground coffee. The highest concentration of furan in roasted coffee reaches the level of 7000 μg/kg. Taking into account that coffee is the most popular hot drink, it becomes the main contributor to furan exposure from dietary sources for adults. In this article the published scientific papers concerned with the presence of furan in roasted non-brewed and brewed coffee have been reviewed. The formation mechanisms and occurrence of furan in coffee and the harmful influence of furan on the consumer health have been discussed.

  7. Coffee: The magical bean for liver diseases

    OpenAIRE

    Heath, Ryan D; Brahmbhatt, Mihir; Tahan, Asli C; Ibdah, Jamal A; Tahan, Veysel

    2017-01-01

    Coffee has long been recognized as having hepatoprotective properties, however, the extent of any beneficial effect is still being elucidated. Coffee appears to reduce risk of hepatocellular carcinoma, reduce advancement of fibrotic disease in a variety of chronic liver diseases, and perhaps reduce ability of hepatitis C virus to replicate. This review aims to catalog the evidence for coffee as universally beneficial across a spectrum of chronic liver diseases, as well as spotlight opportunit...

  8. White pine blister rust in northern ldaho and western Montana: alternatives for integrated management

    Science.gov (United States)

    Susan K. Hagle; Geral I. McDonald; Eugene A. Norby

    1989-01-01

    This report comprises a handbook for managing western white pine in northern ldaho and western Montana, under the threat of white pine blister rust. Various sections cover the history of the disease and efforts to combat it, the ecology of the white pine and Ribes, alternate host of the rust, and techniques for evaluating the rust hazard and attenuating it. The authors...

  9. Strategies for managing whitebark pine in the presence of white pine blister rust [Chapter 17

    Science.gov (United States)

    Raymond J. Hoff; Dennis E. Ferguson; Geral I. McDonald; Robert E. Keane

    2001-01-01

    Whitebark pine (Pinus albicaulis) is one of many North American white pine species (Pinus subgenus Strobus) susceptible to the fungal disease white pine blister rust (Cronartium ribicola). Blister rust has caused severe mortality (often reaching nearly 100 percent) in many stands of white bark pine north of 45° latitude in western North America. The rust is slowly...

  10. Glyphosate Control of Orange and Brown Rusts in Glyphosate-Sensitive Sugarcane Cultivars

    Science.gov (United States)

    Technical Abstract: Brown and orange rust diseases cause substantial yield reductions on sugarcane (Saccharum spp.) in Florida and other regions where sugarcane is grown. Brown rust caused by Puccinia melanocephala Syd. & P. Syd has been present in Florida since 1978 and orange rust caused by Pucci...

  11. DIVERSITY OF PUCCINIA KUEHNII AND P. MELANOCEPHALA CAUSING RUST DISEASES ON BRAZILIAN SUGARCANE

    Science.gov (United States)

    Sugarcane industry in Brazil suffers yield loss due to brown rust (Puccinia melanocephala) since 1986 and orange rust (P. kuehnii) as recent as 2009. The main control measure for both diseases has been cultivar resistance. Nevertheless, recent onsets of orange rust on previously resistant cultivars ...

  12. Genetic characterization of stem rust resistance in a global spring wheat germplasm collection

    Science.gov (United States)

    Stem rust is considered one of the most damaging diseases of wheat. The recent emergence of the stem rust Ug99 race group poses a serious threat to world wheat production. Utilization of genetic resistance in cultivar development is the optimal way to control stem rust. Here we report association ma...

  13. Aecidium kalanchoe sp. nov., a new rust on Kalanchoe blossfeldiana (Crassulaceae).

    Science.gov (United States)

    Hernádez, José R; Aime, M Catherine; Newbry, Brad

    2004-07-01

    A rust fungus found on cultivars of Kalanchoe blossfeldiana (Crassulaceae) is described as a new species, Aecidium kalanchoe sp. nov., and compared to the other described rusts on members of the Crassulaceae. Only one other rust is known to parasitize Kalanchoe spp. A DNA sequence of A. kalanchoe suggests that the teleomorph is related to Puccinia.

  14. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi

    Science.gov (United States)

    Rust fungi are obligate biotrophic pathogens causing considerable damage on crop plants. P. graminis f. sp. tritici, the causal agent of wheat stem rust, and M. larici-populina, the poplar rust pathogen, have strong deleterious impact on wheat and poplar wood production, respectively. The recently r...

  15. The Little Book on CoffeeScript

    CERN Document Server

    MacCaw, Alex

    2012-01-01

    This little book shows JavaScript developers how to build superb web applications with CoffeeScript, the remarkable little language that's gaining considerable interest. Through example code, this guide demonstrates how CoffeeScript abstracts JavaScript, providing syntactical sugar and preventing many common errors. You'll learn CoffeeScript's syntax and idioms step by step, from basic variables and functions to complex comprehensions and classes. Written by Alex MacCaw, author of JavaScript Web Applications (O'Reilly), with contributions from CoffeeScript creator Jeremy Ashkenas, this book

  16. Coffee: biochemistry and potential impact on health.

    Science.gov (United States)

    Ludwig, Iziar A; Clifford, Michael N; Lean, Michael E J; Ashihara, Hiroshi; Crozier, Alan

    2014-08-01

    This review provides details on the phytochemicals in green coffee beans and the changes that occur during roasting. Key compounds in the coffee beverage, produced from the ground, roasted beans, are volatile constituents responsible for the unique aroma, the alkaloids caffeine and trigonelline, chlorogenic acids, the diterpenes cafestol and kahweol, and melanoidins, which are Maillard reaction products. The fate of these compounds in the body following consumption of coffee is discussed along with evidence of the mechanisms by which they may impact on health. Finally, epidemiological findings linking coffee consumption to potential health benefits including prevention of several chronic and degenerative diseases, such as cancer, cardiovascular disorders, diabetes, and Parkinson's disease, are evaluated.

  17. PAH in tea and coffee

    DEFF Research Database (Denmark)

    Duedahl-Olesen, Lene; Navarantem, Marin; Adamska, Joanna

    For food regulation in the European Union maximum limits on other foods than tea and coffee includes benzo[a]pyrene and the sum of PAH4 (sum of benzo[a]pyrene, chrysene, benz[a]anthracene and benzo[b]fluoranthene). This study includes analysis of the above mentioned PAH in both, tea leaves, coffee...... beans and ready-to-drink preparations. Compared to other food matrices (e.g. fish), the analytical methods were challenged by the hot water extracts. Preparation of tea includes roasting and drying of the tea leaves using combustion gases from burning wood, oil, or coal. These are responsible...... for accumulation of PAH in tea leaves. Different varieties of tea leaves were analyzed and highest concentrations were found in leaves from mate and black tea with maximum concentrations of 32 μg/kg for benzo[a]pyrene and 115 μg/kg for the sum of PAH4. Also, coffee beans are roasted during processing. However...

  18. Painting rusted steel: The role of aluminum phosphosilicate

    International Nuclear Information System (INIS)

    Roselli, S.N.; Amo, B. del; Carbonari, R.O.; Di Sarli, A.R.; Romagnoli, R.

    2013-01-01

    Highlights: •Aluminum phosphosilicate is an acid pigment which could act as mild phosphating agent. •Aluminum phosphosilicate can phosphatize iron oxides on rusted surfaces. •Aluminum phosphosilicate is compatible with acid binders. •Aluminum phosphosilicate could replace chromate in complete painting schemes. •Aluminum phosphosilicate primers improve paints adhesion on rusted surfaces. -- Abstract: Surface preparation is a key factor for the adequate performance of a paint system. The aim of this investigation is to employ a wash-primer to accomplish the chemical conversion of rusted surface when current cleaning operations are difficult to carry out. The active component of the wash-primer was aluminum phosphosilicate whose electrochemical behavior and the composition of the generated protective layer, both, were studied by electrochemical techniques and scanning electron microscopy (SEM), respectively. Primed rusted steel panels were coated with an alkyd system to perform accelerated tests in the salt spray chamber and electrochemical impedance measurements (EIS). These tests were conducted in parallel with a chromate wash primer and the same alkyd system. Results showed that the wash-primer containing aluminum phosphosilicate could be used satisfactorily to paint rusted steel exhibiting a similar performance to the chromate primer

  19. The Climate Change and Rwandan Coffee Sector

    Directory of Open Access Journals (Sweden)

    Fidele Hakorimana

    2017-10-01

    Full Text Available This paper provides a detailed overview of the current situation of the coffee sector in the Rwandan economy and identifies the possible challenges that the sector is currently facing. The study has identified the economic and the livelihood indicators for farmers who are engaged in coffee production and also gives the Rwandan coffee sector’ situation and its position in the global coffee market. Also, the research has found out that in Rwanda, nearly 500,000 farmers produce coffee along with other crops, notably beans, savory banana and corn and found out that in 2012, coffee accounted for almost 30 percent of Rwanda’s total export revenue. On the other hand, the study revealed that the sector throughout all the coffee production process, has undergone different challenges especially climate change as it is reported by the Ministry of Agriculture and Animal resources. A low yield was reported in 2007 and climate variability was quoted among the causes. Insufficient rainfall in the last three months of 2006 (the period of coffee flowering proceeding the short dry season in the first two months of 2007 was recorded. The reduced rainfall was also poorly distributed across coffee growing regions in Rwanda. In addition, the research revealed that even though the area under coffee production is increasing, the coffee production is decreasing due to unexpected climate change and variability in current years and also the improper use of chemical fertilizers by coffee farmers is very critical. The study concluded that adding value to the coffee supply chain of Rwanda is adding direct economic benefits and important indirect social benefits to the lives of individuals and to the health of communities in Rwanda. Moreover, more effort should continue to raise the profile of the Rwandan coffee sector suggesting that proper use of chemical fertilizers, solid marketing channels and climate change adaptations measures would be the fair ways of making the

  20. Consumer Acceptance of a Polyphenolic Coffee Beverage.

    Science.gov (United States)

    Nguyen, Thuy; Kuchera, Meredith; Smoot, Katie; Diako, Charles; Vixie, Beata; Ross, Carolyn F

    2016-10-05

    The objective of this study was to determine if Chardonnay grape seed pomace (GSP), a waste stream of wine production, could be used as a functional ingredient in brewed coffee. Two consumer panels were conducted to assess the acceptance of coffee at coffee replacement (w/w) values of 0% (control), 6.25%, 12.50%, 18.75%, or 25% GSP. The 1st consumer panel (n = 80) assessed the coffee samples served "black." The 2nd panel (n = 67) assessed the coffee samples with adjustment (that is, sweeteners, milk, and cream) options available. Consumer sensory evaluation involved evaluating the 5 treatments individually for acceptance of appearance, aroma, taste/flavor, and overall acceptance using a 9-point hedonic scale. A check-all-that-apply questionnaire surveyed the sensory attributes describing aroma, appearance, and taste/flavor of the samples. Oxygen radical absorbance capacity was used to measure the effects of antioxidant levels in GSP coffee samples. Results showed that GSP could be added at 6.25% replacement without significantly affecting the overall consumer acceptance of coffee compared to the control (0% GSP). Above 6.25% GSP supplementation, the coffee beverage was described as more tan, milky, watery/dilute, and mild, and was generally less accepted by the consumers. GSP also increased the antioxidant capacity of the coffee compared to the control (0% GSP), with no significant differences among replacement values. Therefore, 6.25% GSP replacement is recommended for creating coffee beverages acceptable to consumers. Further in vivo investigation may substantiate the free-radical scavenging capacity of GSP coffee and its potential health benefits. © 2016 Institute of Food Technologists®.

  1. Can Coffee Chemical Compounds and Insecticidal Plants Be Harnessed for Control of Major Coffee Pests?

    Science.gov (United States)

    Green, Paul W C; Davis, Aaron P; Cossé, Allard A; Vega, Fernando E

    2015-11-04

    Pests and pathogens threaten coffee production worldwide and are difficult to control using conventional methods, such as insecticides. We review the literature on the chemistry of coffee, concentrating on compounds most commonly reported from Coffea arabica and Coffea canephora. Differences in chemistry can distinguish coffee species and varieties, and plants grown under different biogeographic conditions exhibit different chemotypes. A number of chemical groups, such as alkaloids and caffeoylquinic acids, are known to be insecticidal, but most studies have investigated their effects on coffee quality and flavor. More research is required to bridge this gap in knowledge, so that coffee can be bred to be more resistant to pests. Furthermore, we report on some pesticidal plants that have been used for control of coffee pests. Locally sourced pesticidal plants have been underutilized and offer a sustainable alternative to conventional insecticides and could be used to augment breeding for resilience of coffee plants.

  2. Coffee farming and soil management in Rwanda

    NARCIS (Netherlands)

    Nzeyimana, I.; Hartemink, A.E.; Graaff, de J.

    2013-01-01

    Agriculture is the cornerstone of Rwanda's economy. The authors review how the sector has changed and specifically what soil management practices are now being implemented to enhance coffee production. Coffee covers around 2.3% of total cultivated arable land, and is grown mainly by smallholder

  3. Coffee and cardiovascular risk; an epidemiological study

    NARCIS (Netherlands)

    A.A.A. Bak (Annette)

    1990-01-01

    textabstractThis thesis comprises several studies on the effect of coffee and caffeine on cardiovascular risk in general, and the effect on serum lipids, blood pressure and selected hemostatic variables in particular. The association between coffee use and cardiovascular morbidity and

  4. Saving coffee | IDRC - International Development Research Centre

    International Development Research Centre (IDRC) Digital Library (Canada)

    2017-09-26

    Sep 26, 2017 ... These orange patches, caused by a microscopic fungus that eats away at the ... 70% of coffee trees in Central America and Mexico were affected. ... broca, in Spanish) exclusively eats the fruit of coffee trees, and its life cycle is ...

  5. Utilization of the cropgro-soybean model to estimate yield loss caused by Asian rust in cultivars with different cycle

    Directory of Open Access Journals (Sweden)

    Rafael de Ávila Rodrigues

    2012-01-01

    Full Text Available In recent years, crop models have increasingly been used to simulate agricultural features. The DSSAT (Decision Support System for Agrotechnology Transfer is an important tool in modeling growth; however, one of its limitations is related to the unaccounted-for effect of diseases. Therefore, the goals of this study were to calibrate and validate the CSM CROPGRO-Soybean for the soybean cultivars M-SOY 6101 and MG/BR 46 (Conquista, analyze the performance and the effect of Asian soybean rust on these cultivars under the environmental conditions of Viçosa, Minas Gerais, Brazil. The experimental data for the evaluation, testing, and adjustment of the genetic coefficients for the cultivars, M-SOY 6101 and MG/BR 46 (Conquista, were obtained during the 2006/2007, 2007/2008 and 2009/2010 growing seasons. GLUE (Generalized Likelihood Uncertainty Estimation was used for the estimation of the genetic coefficients, and pedotransfer functions have been utilized to estimate the physical characteristics of the soil. For all of the sowing dates, the early season cultivar, M-SOY 6101, exhibited a lower variance in yield, which represents more stability with regard to the interannual climate variability, i.e., the farmers who use this cultivar will have in 50% of the crop years analyzed, a higher yield than a late-season cultivar. The MG/BR 46 (Conquista cultivar demonstrated a greater probability of obtaining higher yield in years with favorable weather conditions. However, in the presence of the Asian soybean rust, yield is heavily affected. The early cultivar, M-SOY 6101, showed a lower risk of being affected by the rust and consequently exhibited less yield loss considering the scenario D90 (condensation on the leaf surface occurs when the relative humidity is greater than or equal to 90%, for a sowing date of November 14.

  6. Grain yield losses in yellow-rusted durum wheat estimated using digital and conventional parameters under field conditions

    Directory of Open Access Journals (Sweden)

    Omar Vergara-Diaz

    2015-06-01

    Full Text Available The biotrophic fungus Puccinia striiformis f. sp. tritici is the causal agent of the yellow rust in wheat. Between the years 2010–2013 a new strain of this pathogen (Warrior/Ambition, against which the present cultivated wheat varieties have no resistance, appeared and spread rapidly. It threatens cereal production in most of Europe. The search for sources of resistance to this strain is proposed as the most efficient and safe solution to ensure high grain production. This will be helped by the development of high performance and low cost techniques for field phenotyping. In this study we analyzed vegetation indices in the Red, Green, Blue (RGB images of crop canopies under field conditions. We evaluated their accuracy in predicting grain yield and assessing disease severity in comparison to other field measurements including the Normalized Difference Vegetation Index (NDVI, leaf chlorophyll content, stomatal conductance, and canopy temperature. We also discuss yield components and agronomic parameters in relation to grain yield and disease severity. RGB-based indices proved to be accurate predictors of grain yield and grain yield losses associated with yellow rust (R2 = 0.581 and R2 = 0.536, respectively, far surpassing the predictive ability of NDVI (R2 = 0.118 and R2 = 0.128, respectively. In comparison to potential yield, we found the presence of disease to be correlated with reductions in the number of grains per spike, grains per square meter, kernel weight and harvest index. Grain yield losses in the presence of yellow rust were also greater in later heading varieties. The combination of RGB-based indices and days to heading together explained 70.9% of the variability in grain yield and 62.7% of the yield losses.

  7. Induced mutations for rust resistance in bread wheat

    International Nuclear Information System (INIS)

    Sawhney, R.N.

    1989-01-01

    Full text: Seeds of variety ''Lalbahadur'' were treated with 0.04% NMH. M 2 plants were inoculated with a mixture of pathotypes of each of the 3 Puccinia species (P. graminis, P. recondita, P. striiformis). Plants with simultaneous resistance to all 3 rusts were selected. Repeated testing in subsequent generations confirmed the resistance. The mutant lines are morphologically similar to the parent cultivar and therefore could be used as components of a multiline variety. Comparison of variety pattern against the Indian pathotypes of rusts suggests that the mutant genes are different from the ones known already in bread wheat. (author)

  8. Use of gamma radiation for inducing rust resistance in soybean

    International Nuclear Information System (INIS)

    Smutkupt, Sumit; Wongpiyasatid, Arunee; Lamseejan, Siranut; Naritoom, Kruik

    1982-01-01

    Experiments on induced mutations for rust resistance in 11 soybean cultivars were started in the rainy season of 1979. M 1 seeds were grown at Farm Suwan, Pak Chong, Nakorn Rajchasima Province. Six plods from each of 4,438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked. In addition, 270 good M 1 plants were selected and threshed singly. M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both of M 3 -bulk and M 3 -single plants together with M 2 -bulk plants derived from remnant M 2 seeds were screened for rust resistance in the rainy season of 1980. The IWGSR rust rating system was used. Based on the slow growth of rust reaction on the plant (323,333) compared with the average IWGSR rust rating notation of the rates (343) in the same row, 121 plants were selected. Among them, six were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Seeds of each selection harvested. Only 88 lines of M 4 and M 5 were available for further rust evaluation in the rainy season of 1981. The results were as follows: At 77 days after planting, 82 selected lines were rated 333, 323 in comparison with 87 out of 137 rows of control S.J.1, S.J.2, S.J.4 and T.K.5 were rated 343. At 86 days after planting, most of the selections reached the diseased level 343. However, six lines which were derived from G8586 were still rated 333. In addition, a plant with slow growth of rust (323) from Taichung N No. 81-1-032 was selected. The six selected lines having characteristics of slow growth of rust reaction on the plants will be further tested. The high yielding selections among 82 selected lines having low percentage of shrivelled seeds will be used for further yield evaluation in the rainy season of 1982

  9. Coffee Consumption During Pregnancy and Birth Weight

    DEFF Research Database (Denmark)

    Bech, Bodil Hammer; Frydenberg, Morten; Henriksen, Tine Brink

    2015-01-01

    weight and whether it was modified by the mothers' smoking habits. Methods: In the Danish National Birth Cohort, coffee intake and smoking during pregnancy were recorded prospectively in 89,539 pregnancies that ended with live born singletons. Information on birth weight was obtained from the Danish......Background: A previous randomized trial demonstrated an association between coffee intake and birth weight in smokers only. This could be a chance finding or because smoking interferes with caffeine metabolism. This study assessed the association between coffee intake during pregnancy and birth....../cup/day). Compared to non-coffee drinkers, intake of eight or more cups of coffee per day was associated with an adjusted birth weight difference of −65 g [95% confidence interval (CI) −92 to −39] for non-smokers and −79 g [95% CI −124 to −34] for women smoking more than 10 cigarettes per day. Women drinking eight...

  10. Caffeine, coffee, and appetite control: a review.

    Science.gov (United States)

    Schubert, Matthew M; Irwin, Christopher; Seay, Rebekah F; Clarke, Holly E; Allegro, Deanne; Desbrow, Ben

    2017-12-01

    Coffee and caffeine consumption has global popularity. However, evidence for the potential of these dietary constituents to influence energy intake, gut physiology, and appetite perceptions remains unclear. The purpose of this review was to examine the evidence regarding coffee and caffeine's influence on energy intake and appetite control. The literature was examined for studies that assessed the effects of caffeine and coffee on energy intake, gastric emptying, appetite-related hormones, and perceptual measures of appetite. The literature review indicated that coffee administered 3-4.5 h before a meal had minimal influence on food and macronutrient intake, while caffeine ingested 0.5-4 h before a meal may suppress acute energy intake. Evidence regarding the influence of caffeine and coffee on gastric emptying, appetite hormones, and appetite perceptions was equivocal. The influence of covariates such as genetics of caffeine metabolism and bitter taste phenotype remain unknown; longer controlled studies are needed.

  11. Caffeine adsorption of montmorillonite in coffee extracts.

    Science.gov (United States)

    Shiono, Takashi; Yamamoto, Kenichiro; Yotsumoto, Yuko; Yoshida, Aruto

    2017-08-01

    The growth in health-conscious consumers continues to drive the demand for a wide variety of decaffeinated beverages. We previously developed a new technology using montmorillonite (MMT) in selective decaffeination of tea extract. This study evaluated and compared decaffeination of coffee extract using MMT and activated carbon (AC). MMT adsorbed caffeine without significant adsorption of caffeoylquinic acids (CQAs), feruloylquinic acids (FQAs), dicaffeoylquinic acids (di-CQAs), or caffeoylquinic lactones (CQLs). AC adsorbed caffeine, chlorogenic acids (CGAs) and CQLs simultaneously. The results suggested that the adsorption selectivity for caffeine in coffee extract is higher in MMT than AC. The caffeine adsorption isotherms of MMT in coffee extract fitted well to the Langmuir adsorption model. The adsorption properties in coffee extracts from the same species were comparable, regardless of roasting level and locality of growth. Our findings suggest that MMT is a useful adsorbent in the decaffeination of a wide range of coffee extracts.

  12. Coordinating quality practices in Direct Trade coffee

    DEFF Research Database (Denmark)

    Holland, Emil; Kjeldsen, Chris; Kerndrup, Søren

    2016-01-01

    Over the past few decades, many food niches have emerged with a specific focus on quality. In specialty coffee, micro roasters have brought about Direct Trade coffee as a way of organising an alternative around new tastes and qualities through ongoing and ‘direct’ relations to farmers...... and cooperatives. But Direct Trade also involves exporters. We ask, how do exporters and roasters work together in these new coffee relations, and what do they work on? We observe and participate in a situation where Colombian coffee exporters visit Danish roasters. They tour the roasting facilities and taste...... a number of coffees. Often, the term power is used to analyse such value chain interactions, but we argue that the term coordination better opens up these interactions for exploration and analysis. What emerges is a coordination of quality. Through touring and tasting, issues emerge and differences...

  13. Obligate Biotrophy Features Unraveled by the Genomic Analysis of the Rust Fungi, Melampsora larici-populina and Puccinia graminis f. sp. tritici

    Energy Technology Data Exchange (ETDEWEB)

    Duplessis, Sebastien; Cuomo, Christina A.; Lin, Yao-Cheng; Aerts, Andrea; Tisserant, Emilie; Veneault-Fourrey, Claire; Joly, David L.; Hacquard, Stephane; Amselem, Joelle; Cantarel, Brandi; Chiu, Readman; Couthinho, Pedro; Feau, Nicolas; Field, Matthew; Frey, Pascal; Gelhaye, Eric; Goldberg, Jonathan; Grabherr, Manfred; Kodira, Chinnappa; Kohler, Annegret; Kues, Ursula; Lindquist, Erika; Lucas, Susan; Mago, Rohit; Mauceli, Evan; Morin, Emmanuelle; Murat, Claude; Pangilinan, Jasmyn L.; Park, Robert; Pearson, Matthew; Quesneville, Hadi; Rouhier, Nicolas; Sakthikumar, Sharadha; Salamov, Asaf A.; Schmutz, Jeremy; Selles, Benjamin; Shapiro, Harris; Tangay, Philippe; Tuskan, Gerald A.; Peer, Yves Van de; Henrissat, Bernard; Rouze, Pierre; Ellis, Jeffrey G.; Dodds, Peter N.; Schein, Jacqueline E.; Zhong, Shaobin; Hamelin, Richard C.; Grigoriev, Igor V.; Szabo, Les J.; Martin1, Francis

    2011-04-27

    Rust fungi are some of the most devastating pathogens of crop plants. They are obligate biotrophs, which extract nutrients only from living plant tissues and cannot grow apart from their hosts. Their lifestyle has slowed the dissection of molecular mechanisms underlying host invasion and avoidance or suppression of plant innate immunity. We sequenced the 101 mega base pair genome of Melampsora larici-populina, the causal agent of poplar leaf rust, and the 89 mega base pair genome of Puccinia graminis f. sp. tritici, the causal agent of wheat and barley stem rust. We then compared the 16,841 predicted proteins of M. larici-populina to the 18,241 predicted proteins of P. graminis f. sp tritici. Genomic features related to their obligate biotrophic life-style include expanded lineage-specific gene families, a large repertoire of effector-like small secreted proteins (SSPs), impaired nitrogen and sulfur assimilation pathways, and expanded families of amino-acid, oligopeptide and hexose membrane transporters. The dramatic upregulation of transcripts coding for SSPs, secreted hydrolytic enzymes, and transporters in planta suggests that they play a role in host infection and nutrient acquisition. Some of these genomic hallmarks are mirrored in the genomes of other microbial eukaryotes that have independently evolved to infect plants, indicating convergent adaptation to a biotrophic existence inside plant cells

  14. Effect of Superheated Steam Roasting on Radical Scavenging Activity and Phenolic Content of Robusta Coffee Beans

    OpenAIRE

    Ooi Ee Shan; Wahidu Zzaman; Tajul A. Yang

    2015-01-01

    Robusta coffee is one of the coffee species grown in Malaysia. However, there is little research conducted on Robusta coffee beans as Arabica coffee is more popular among the consumers. Coffee is a rich source of antioxidants, therefore research on antioxidant properties of Robusta coffee beans is important to explore its market value. Nowadays, most of coffee analysis is on conventional roasted coffee which reduces their antioxidant properties. In this study, Robusta coffee beans (Coffea can...

  15. Innovative Strategies for Control of Coffee Insect Pests in Tanzania ...

    African Journals Online (AJOL)

    Coffee insect pests are one of the major factors which affect coffee production and quality. globally, coffee insect pests are estimated to cause losses of about 13%. However in Africa, yield losses can be much higher, particularly where Arabica and Robusta coffee are grown for a long time. In Tanzania the major insect pests ...

  16. Development of a method for the mineralization of coffee husk ...

    African Journals Online (AJOL)

    Every year, large quantities of husk resulting from the dry method of treatment of robusta coffee are dumped into nature. This generates multiple harmful ecological effects. The downward trend of coffee prices and the rise in the cost of manure has urged coffee farmers to better exploit the by-products of coffee transformation.

  17. Spices Coffee : Innovation Strategy To Increase Quality On Powder Coffee Farmers

    Science.gov (United States)

    Amir, I. T.; Indah, P. N.; Widayanti, S.

    2018-01-01

    The purpose of the study is a) to analyze the condition of internal environment industry spices coffee, b) to analyze the condition of the external environment industry spices coffee, and c) to determine the technological innovation strategy spices coffee in order to improve the competitiveness of the coffee people. Most of the coffee grown in Tutur district is cultivated by smallholder farms, resulting in low quality. The strategy of coffee spice agro-industry aims to increase the added value of the products so that farmers obtain higher coffee prices. Activities include the provision of raw materials, processing, supply of final products, and marketing.The results showed that the internal environmental conditions that have the highest value is the strengthen factors. The highest score of strengthen factors is the availability of coffee, availability of labor and communications group. The highest score of opportunity factors is technological assistance from the government and other government support for the development of people’s coffee industry and high market potential. The development of agrotourism should improve as well as expand the network to seize market. The strategy should be applied in the development of spices coffee industry is to support aggressive growth (Growth-oriented strategy).

  18. Evaluation of the phenotype variability and early selection to rust of the sugar cane (Puccinia melanocephala H. & P. Syd in plants generated from irradiated callus from the variaty of sugar cane ´SP 70-1284´.

    Directory of Open Access Journals (Sweden)

    Apolonio Valdez Balero

    2004-10-01

    Full Text Available It was evaluated the variability fenotípic in early phases of selection from plants regenerated of the mutagenic treatment with dose of 30 Gy of radiations Gamma (source 60Co applicated to calluses in growth of the donating ´SP 70-1284´ tolerant to the rust disease of the sugarcane Puccinia melanocephala. The main changes the plants obtained in vitro, consinted in the height, the color, habit of growth, length and width of the leaf, as well as in the affectation for the rust disease. 14.28% of the changes all fenotipic was observed in plantín, and in the shoot the plants presented 10.99% of changes all fenotipic. In the vegetative multiplication one (MV1 three possible mutants were selected with smaller affectation in front rust disease of the sugarcan, resistance character to the rust disease efficiency of the tissue culture and the mutations induction with the dose of 30 Gy were of a mutant for each 1 525 plants evaluated in early phase of selection. Key words: variation fenotipic, selection early, mutagenesis

  19. Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions.

    Science.gov (United States)

    Muleta, Kebede T; Rouse, Matthew N; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G; Pumphrey, Michael O

    2017-08-04

    The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90 K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations. Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons, and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust in all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three loci on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel. Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in

  20. Antibiotic Treatment of Blister Rust Cankers in Eastern White Pine

    Science.gov (United States)

    William R. Phelps; Ray Weber

    1970-01-01

    Cycloheximide (Acti-dione) and Phytoactin antibiotics, applied as basal stem treatments, aerial spray treatments, and complete foliar drenches were not effective in controlling blister rust cankers in eastern white pine. Cycloheximide was effective in suppressing canker activity and growth if directly applied to scarified cankers.

  1. Control of Bean Rust using Antibiotics Produced by Bacillus and ...

    African Journals Online (AJOL)

    Antibiotic culture filtrates produced by Bacillus (CA5) and Streptomyces spp. were tested for translocation and persistence when applied on snap beans inoculated with rust (Uromyces appendiculatus) in greenhouse pot experiments. The antibiotics were applied on the first trifoliate leaves and translocation was assessed as ...

  2. Blister rust control in the management of western white pine

    Science.gov (United States)

    Kenneth P. Davis; Virgil D. Moss

    1940-01-01

    The forest industry of the western white pine region depends on the production of white pine as a major species on about 2,670,000 acres of commercial forest land. Continued production of this species and maintenance of the forest industry at anything approaching its present level is impossible unless the white pine blister rust is controlled. Existing merchantable...

  3. Resistance of three interspecific white pine hybrids to blister rust

    Science.gov (United States)

    R. Z. Callaham

    1962-01-01

    Three white pine hybrids exposed to infection by white pine blister rust (Cronartium ribicola Fischer) since 1946 have inherited the relative resistance of their parental species. The hybrids were produced from controlled pollinations in 1940 and 1941 at the Institute of Forest Genetics, Placerville, Calif. Twelve seedlings of each hybrid were...

  4. Characteristics of Blister Rust Cankers on Eastern White Pine

    Science.gov (United States)

    William R. Phelps; Ray Weber

    1969-01-01

    The growth, development, and sporulation of white pine blister rust cankers were studied on eastern white pine in Wisconsin and Minnesota. Three district canker types were identified on the basis of physical appearance, growth rate, and sporulation. Canker growth rate and sporulation decreased as tree size or age increased, and many cankers apparently became inactive...

  5. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Thirty durum wheat (19 commercial cultivars and 11 breeding lines) and 30 bread wheat (20 commercial cultivars and 10 breeding lines) were tested for gene postulation. Stem rust infection types produced on wheat cultivars and breeding lines by ten Pgt races was compared with infection types produced on 40 near ...

  6. Reductive and sorptive properties of sulfate green rust (GRSO4)

    DEFF Research Database (Denmark)

    Nedel, Sorin

    The Fe(II), Fe(III) hydroxide containing sulfate in its structure, called sulfate green rust (GRSO4), can effectively reduce and convert contaminants to less mobile and less toxic forms. However, the ability of GRSO4 to remove positively charged species from solution, via sorption, is very limited...

  7. White pine blister rust resistance research in Minnesota and Wisconsin

    Science.gov (United States)

    Andrew David; Paul Berrang; Carrie Pike

    2012-01-01

    The exotic fungus Cronartium ribicola causes the disease white pine blister rust on five-needled pines throughout North America. Although the effects of this disease are perhaps better known on pines in the western portion of the continent, the disease has also impacted regeneration and growth of eastern white pine (Pinus strobus L. ...

  8. White pines, Ribes, and blister rust: integration and action

    Science.gov (United States)

    R. S. Hunt; B. W. Geils; K. E. Hummer

    2010-01-01

    The preceding articles in this series review the history, biology and management of white pine blister rust in North America, Europe and eastern Asia. In this integration, we connect and discuss seven recurring themes important for understanding and managing epidemics of Cronartium ribicola in the white pines (five-needle pines in subgenus Strobus). Information and...

  9. Sources of stem rust resistance in Ethiopian tetraploid wheat ...

    African Journals Online (AJOL)

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat worldwide. Pgt is an obligate biotroph, heteroceous in its life cycle and heterothallic in mating type. Seedlings of 41 emmer (Triticum dicoccum), 56 durum (T. durum) wheat accessions were ...

  10. White pines, Ribes, and blister rust: a review and synthesis

    Science.gov (United States)

    Brian W. Geils; Kim E. Hummer; Richard S. Hunt

    2010-01-01

    For over a century, white pine blister rust (Cronartium ribicola) has linked white pines (Strobus) with currants and gooseberries (Ribes) in a complex and serious disease epidemic in Asia, Europe, and North America. Because of ongoing changes in climate, societal demands for forests and their amenities, and scientific advances in genetics and proteomics, our current...

  11. White pine blister rust in the interior Mountain West

    Science.gov (United States)

    Kelly Burns; Jim Blodgett; Dave Conklin; Brian Geils; Jim Hoffman; Marcus Jackson; William Jacobi; Holly Kearns; Anna Schoettle

    2010-01-01

    White pine blister rust is an exotic, invasive disease of white, stone, and foxtail pines (also referred to as white pines or five-needle pines) in the genus Pinus and subgenus Strobus (Price and others 1998). Cronartium ribicola, the fungus that causes WPBR, requires an alternate host - currants and gooseberries in the genus Ribes and species of Pedicularis...

  12. Screening of fungicides for the management of wattle rust ...

    African Journals Online (AJOL)

    % of the revenue from the species obtained from the timber and 15% from the bark. From 2012/13 a wattle rust disease has spread throughout the black wattle plantation area in KwaZulu-Natal and from 2015 it was recorded in southern ...

  13. Developing clones of Eucalyptus cloeziana resistant to rust (Puccinia psidii)

    Science.gov (United States)

    Rafael F. Alfenas; Marcelo M. Coutinho; Camila S. Freitas; Rodrigo G. Freitas; Acelino C. Alfenas

    2012-01-01

    Besides its high resistance to Chrysoporthe cubensis canker, Eucalyptus cloeziana F. Muell. is a highly valuable tree species for wood production. It can be used for furniture, electric poles, fence posts, and charcoal. Nevertheless, it is highly susceptible to the rust caused by Puccinia psidii, which...

  14. Taxonomy, phylogeny, and coevolution of pines and their stem rusts

    Science.gov (United States)

    C. I. Millar; B. B. Kinloch

    1991-01-01

    We review and reinterpret major events in the evolution of pines and their stem rusts using information from their taxonomy, genetics, biogeography, and fossil history. Understanding of pine evolution has been significantly revised in the last 20 years. Pines appear to have evolved early in the Mesozoic and to have diversified and migrated throughout middle latitudes...

  15. HOW TO Identify White Pine Blister Rust and Remove Cankers

    Science.gov (United States)

    Thomas H. Nicholls; Robert L. Anderson

    1977-01-01

    White pine blister rust (caused by the fungus Cronartium ribicola J. C. Fisch. ex Rabenh.) was introduced into the United States about 1900 and has since spread throughout the range of white pine. The disease intensity varies throughout the range but is normally most severe where late summers (July-September) are cool (below 67? F) and damp, conditions necessary for...

  16. Molecular Characterization of wheat stem rust races in Kenya

    Science.gov (United States)

    Stem or black rust caused by Puccinia graminis f. sp. tritici (Pgt) Erikss. & Henning causes severe losses to wheat (Triticum aestivum L.), historically threatening global wheat production. Characterizing prevalent isolates of Pgt would enhance the knowledge of population dynamics and evolution of t...

  17. Ensemble composition and activity levels of insectivorous bats in response to management intensification in coffee agroforestry systems.

    Science.gov (United States)

    Williams-Guillén, Kimberly; Perfecto, Ivette

    2011-01-26

    Shade coffee plantations have received attention for their role in biodiversity conservation. Bats are among the most diverse mammalian taxa in these systems; however, previous studies of bats in coffee plantations have focused on the largely herbivorous leaf-nosed bats (Phyllostomidae). In contrast, we have virtually no information on how ensembles of aerial insectivorous bats--nearly half the Neotropical bat species--change in response to habitat modification. To evaluate the effects of agroecosystem management on insectivorous bats, we studied their diversity and activity in southern Chiapas, Mexico, a landscape dominated by coffee agroforestry. We used acoustic monitoring and live captures to characterize the insectivorous bat ensemble in forest fragments and coffee plantations differing in the structural and taxonomic complexity of shade trees. We captured bats of 12 non-phyllostomid species; acoustic monitoring revealed the presence of at least 12 more species of aerial insectivores. Richness of forest bats was the same across all land-use types; in contrast, species richness of open-space bats increased in low shade, intensively managed coffee plantations. Conversely, only forest bats demonstrated significant differences in ensemble structure (as measured by similarity indices) across land-use types. Both overall activity and feeding activity of forest bats declined significantly with increasing management intensity, while the overall activity, but not feeding activity, of open-space bats increased. We conclude that diverse shade coffee plantations in our study area serve as valuable foraging and commuting habitat for aerial insectivorous bats, and several species also commute through or forage in low shade coffee monocultures.

  18. Ensemble composition and activity levels of insectivorous bats in response to management intensification in coffee agroforestry systems.

    Directory of Open Access Journals (Sweden)

    Kimberly Williams-Guillén

    Full Text Available Shade coffee plantations have received attention for their role in biodiversity conservation. Bats are among the most diverse mammalian taxa in these systems; however, previous studies of bats in coffee plantations have focused on the largely herbivorous leaf-nosed bats (Phyllostomidae. In contrast, we have virtually no information on how ensembles of aerial insectivorous bats--nearly half the Neotropical bat species--change in response to habitat modification. To evaluate the effects of agroecosystem management on insectivorous bats, we studied their diversity and activity in southern Chiapas, Mexico, a landscape dominated by coffee agroforestry. We used acoustic monitoring and live captures to characterize the insectivorous bat ensemble in forest fragments and coffee plantations differing in the structural and taxonomic complexity of shade trees. We captured bats of 12 non-phyllostomid species; acoustic monitoring revealed the presence of at least 12 more species of aerial insectivores. Richness of forest bats was the same across all land-use types; in contrast, species richness of open-space bats increased in low shade, intensively managed coffee plantations. Conversely, only forest bats demonstrated significant differences in ensemble structure (as measured by similarity indices across land-use types. Both overall activity and feeding activity of forest bats declined significantly with increasing management intensity, while the overall activity, but not feeding activity, of open-space bats increased. We conclude that diverse shade coffee plantations in our study area serve as valuable foraging and commuting habitat for aerial insectivorous bats, and several species also commute through or forage in low shade coffee monocultures.

  19. Contribution to Kinetics of Formation of White Rust on Galvanized Steel

    International Nuclear Information System (INIS)

    Han, D. J.; Pyun, Su Il; Hahn, Y. D.

    1981-01-01

    Kinetics of formation of white rust on galvanized steel coated with various chromating solutions was studied. White rust occurs as a mixture of zinc oxide and zinc hydroxide. White rust formation rate was measured with a salt spray test as related to Cr 3+ ion amount, ratio of Cr 3+ to Cr 6+ ion(by weight) and surface roughness of the chromate film. Incubation time of white rust formation increased as the ratio of Cr 3+ to Cr 6+ ion in the chromate film increased. White rust propagation rate decreased as the amount of Cr 3+ ion increased. Surface roughness had no detectable relationship with incubation time and white rust propagation rate. Experimental results showed that kinetics of white rust formation was as follows: chromate film consists of insoluble Cr 3+ ion and soluble Cr 6+ ion, the latter act: as a corrosion inhibitor. Leaching rate of Cr 6+ ion from the film decreases with an increase of the ratio of Cr 3+ to Cr 6+ ion in the chromate film. When Cr 6+ ion is leached from the film, a bare zine layer is exposed to air and discontinuities occur in the film where white rust formation is initiated. Further white rust formation occurs due to destruction of the chromate film by chlorine ion. It is concluded that two stages of white rust formation are present and can be ascribed to Cr 6+ ion leaching and destruction of the chromate film by chlorine ion

  20. Comparative effect of coffee robusta and coffee arabica (Qahwa) on memory and attention.

    Science.gov (United States)

    Alharbi, Waheeb D M; Azmat, Aisha; Ahmed, Muhammad

    2018-04-13

    The comparative effects of coffee robusta and coffee arabica (Qahwa) on different attention and memory related assignments were measured in a double-blind study of 300 healthy young adult women who were randomly assigned to one of three different drinks: Group I (coffee robusta sachet dissolved in 100 ml of hot water): Group II (coffee arabica): and group III (100 ml water only). Cognitive function was assessed by standardized tests. Several monitoring cognitive tests and tasks were specifically chosen and performed to investigate the comparative effects of coffee robusta (CR) and coffee arabica (Qahwa; AC) on sleepiness (sleep and clear headed scale), attention (trail A & B, symbol digit, letter cancellation), general cognitive ability (stroop test) and memory (card test). Data was interpreted by analysis of variance (ANOVA). The present study revealed that coffee robusta has beneficial effects on attention, general cognitive ability and memory. Higher though non-significant cognitive scores were associated with coffee robusta consumption. Although, consumption of coffee arabica (Qahwa) has significant effects (P < 0.05) on sleepiness, attention, general cognitive ability and memory and it significantly improve reaction time and correct responses. Since different tasks were related to the sustained attention and working memory processes, results would suggest that coffee arabica (qahwa) could increase the memory and efficiency of the attentional system might be due to the presence of chlorogenic acids (CGA) which are found in less quantity in coffee robusta. However, more studies using larger samples and different tasks are necessary to better understand the effects of coffee robusta and arabica (Qahwa) on attention and memory.

  1. Green coffee decontamination by electron beam irradiation

    International Nuclear Information System (INIS)

    Nemtanu, Monica R.; Brasoveanu, Mirela; Grecu, Maria Nicoleta; Minea, R.

    2005-01-01

    Microbiological load of green coffee is a real problem considering that it is extremely sensitive to contamination. Irradiation is a decontamination method for a lot of foodstuffs, being a feasible, very effective and environment friendly one. Beans and ground green coffee were irradiated with electron beams up to 40 kGy. Microbial load, rheological behavior, electron paramagnetic resonance (EPR) and visible spectroscopy were carried out. The results show that electron beam irradiation of green coffee could decontaminate it without severe changes in its properties

  2. What is more addictive : cannabis or coffee?

    OpenAIRE

    Hili, Alexander

    2016-01-01

    The answer is coffee. Coffee is drunk by around 80% of Americans. The large numbers call for extensive studies on the effect of this drug on the brain. Caffeine is a stimulant. It has a similar molecular structure to adenosine, a chemical linked to us feeling tired. Caffeine binds to adenosine and stops it from working. Coffee does not wake you up but makes your body forget it is tired. Taking that espresso in the morning makes your body increase the number of receptors to caffeine in the bra...

  3. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.

    2007-01-01

    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  4. Production of Flammulina velutipes on coffee husk and coffee spent-ground

    Directory of Open Access Journals (Sweden)

    Leifa Fan

    2001-01-01

    Full Text Available Solid state cultivation (SSC was carried out to evaluate the feasibility of using coffee husk and spent-ground as substrates for the production of edible mushroom Flammulina under different conditions of moisture and spawn rate. The strain of F. velutipes LPB 01 was adapted for a coffee husk extract medium. Best results were obtained with 25% spawn rate, though there was not much difference when lower spawn rates (10-20% were used. Ideal moisture content for mycelial growth was 60% and 55% for coffee husk and spent-ground, respectively. With coffee husk as substrate, first fructification occurred after 25 days of inoculation and the biological efficiency reached about 56% with two flushes after 40 days. With spent-ground as substrate, first fructification occurred 21 days after inoculation and the biological efficiency reached about 78% in 40 days. There was decrease in the caffeine and tannins contents (10.2 and 20.4%, respectively in coffee husk after 40 days. In coffee spent-ground, the tannin contents decreased by 28% after 40 days. These decrease was attributed to the degradation of caffeine or tannins by the culture because these were not adsorbed in the fungal mycelia. Results showed the feasibility of using coffee husk and coffee spent-ground as substrate without any nutritional supplementation for cultivation of edible fungus in SSC. Spent ground appeared better than coffee husk.

  5. Agroforestry systems, nutrients in litter and microbial activity in soils cultivated with coffee at high altitude

    Directory of Open Access Journals (Sweden)

    Krystal de Alcantara Notaro

    2014-04-01

    Full Text Available Agroforestry systems are an alternative option for sustainable production management. These systems contain trees that absorb nutrients from deeper layers of the soil and leaf litter that help improve the soil quality of the rough terrain in high altitude areas, which are areas extremely susceptible to environmental degradation. The aim of this study was to characterize the stock and nutrients in litter, soil activity and the population of microorganisms in coffee (Coffea arabica L. plantations under high altitude agroforestry systems in the semi-arid region of the state of Pernambuco, Brazil. Samples were collected from the surface litter together with soil samples taken at two depths (0-10 and 10-20 cm from areas each subject to one of the following four treatments: agroforestry system (AS, native forest (NF, biodynamic system (BS and coffee control (CT.The coffee plantation had been abandoned for nearly 15 years and, although there had been no management or harvesting, still contained productive coffee plants. The accumulation of litter and mean nutrient content of the litter, the soil nutrient content, microbial biomass carbon, total carbon, total nitrogen, C/N ratio, basal respiration, microbial quotient, metabolic quotient and microbial populations (total bacteria, fluorescent bacteria group, total fungi and Trichoderma spp. were all analyzed. The systems thatwere exposed to human intervention (A and BS differed in their chemical attributes and contained higher levels of nutrients when compared to NF and CT. BS for coffee production at high altitude can be used as a sustainable alternative in the high altitude zones of the semi-arid region in Brazil, which is an area that is highly susceptible to environmental degradation.

  6. Do Coffee Farmers Benefit in Food Security from Participating in Coffee Cooperatives? Evidence from Southwest Ethiopia Coffee Cooperatives.

    Science.gov (United States)

    Shumeta, Zekarias; D'Haese, Marijke

    2018-06-01

    Most coffee in Ethiopia is produced by smallholder farmers who face a daily struggle to get sufficient income but also to feed their families. At the same time, many smallholder coffee producers are members of cooperatives. Yet, literature has paid little attention to the effect of cooperatives on combating food insecurity among cash crop producers including coffee farmers. The objective of the study was to investigate how coffee cooperative membership may affect food security among coffee farm households in Southwest Ethiopia. The study used cross-sectional household data on income, expenditure on food, staple food production (maize and teff), and utilization of improved inputs (fertilizer and improved seed) collected from 256 randomly selected farm households (132 cooperative members and 124 nonmembers) and applied an inverse probability weighting (IPW) estimation to assess the impact of cooperative membership on food security. The result revealed that cooperative membership has a positive and significant effect on staple food production (maize and teff) and facilitated technological transformation via increased utilization of fertilizer and improved seeds. Nonetheless, the effect on food expenditure and income could not be confirmed. Findings suggest a trade-off between coffee marketing and input supply functions of the cooperatives, impairing their true food security impact from the pooled income and production effect.

  7. Review: Utilization of Waste From Coffee Production

    Science.gov (United States)

    Blinová, Lenka; Sirotiak, Maroš; Bartošová, Alica; Soldán, Maroš

    2017-06-01

    Coffee is one of the most valuable primary products in the world trade, and also a central and popular part of our culture. However, coffees production generate a lot of coffee wastes and by-products, which, on the one hand, could be used for more applications (sorbent for the removal of heavy metals and dyes from aqueous solutions, production of fuel pellets or briquettes, substrate for biogas, bioethanol or biodiesel production, composting material, production of reusable cups, substrat for mushroom production, source of natural phenolic antioxidants etc.), but, on the other hand, it could be a source of severe contamination posing a serious environmental problem. In this paper, we present an overview of utilising the waste from coffee production.

  8. Coffee Consumption Attenuates Insulin Resistance and Glucose ...

    African Journals Online (AJOL)

    olayemitoyin

    Alzheimer's disease (CBS 2012), dementia (Health news 2012) and ... the effects of coffee on insulin resistance and glucose tolerance as ..... mortality among patients with type 2 diabetes. ... transporter family: Structure, function and tissue-.

  9. High Molecular Weight Melanoidins from Coffee Brew

    NARCIS (Netherlands)

    Bekedam, E.K.; Schols, H.A.; Boekel, van T.; Smit, G.

    2006-01-01

    The composition of high molecular weight (HMw) coffee melanoidin populations, obtained after ethanol precipitation, was studied. The specific extinction coefficient (Kmix) at 280, 325, 405 nm, sugar composition, phenolic group content, nitrogen content, amino acid composition, and non-protein

  10. Coffee consumption and risk of fatal cancers.

    Science.gov (United States)

    Snowdon, D A; Phillips, R L

    1984-01-01

    In 1960, the coffee consumption habits and other lifestyle characteristics of 23,912 white Seventh-day Adventists were assessed by questionnaire. Between 1960 and 1980, deaths due to cancer were identified. There were positive associations between coffee consumption and fatal colon and bladder cancer. The group consuming two or more cups of coffee per day had an estimated relative risk (RR) of 1.7 for fatal colon cancer and 2.0 for fatal bladder cancer, compared to the group that consumed less than one cup per day (RR = 1.0). These positive associations were apparently not confounded by age, sex, cigarette smoking, or meat consumption habits. In this study, there were no significant or suggestive associations between coffee consumption and fatal pancreatic, breast, and ovarian cancer, or a combined group of all other cancer sites. PMID:6742274

  11. Effect of greenhouse conditions on the leaf apoplastic proteome of Coffea arabica plants.

    Science.gov (United States)

    Guerra-Guimarães, Leonor; Vieira, Ana; Chaves, Inês; Pinheiro, Carla; Queiroz, Vagner; Renaut, Jenny; Ricardo, Cândido P

    2014-06-02

    This work describes the coffee leaf apoplastic proteome and its modulation by the greenhouse conditions. The apoplastic fluid (APF) was obtained by leaf vacuum infiltration, and the recovered proteins were separated by 2-DE and subsequently identified by matrix assisted laser desorption/ionization time of flight-mass spectrometry, followed by homology search in EST coffee databases. Prediction tools revealed that the majority of the 195 identified proteins are involved in cell wall metabolism and in stress/defense responses. Although most of the proteins follow the classical secretory mechanism, a low percentage of them seem to result from unconventional secretion (leaderless secreted proteins). Principal components analysis revealed that the APF samples formed two distinct groups, with the temperature amplitude mostly contributing for this separation (higher or lower than 10°C, respectively). Sixty one polypeptide spots allowed defining these two groups and 28 proteins were identified, belonging to carbohydrate metabolism, cell wall modification and proteolysis. Interestingly stress/defense proteins appeared as more abundant in Group I which is associated with a higher temperature amplitude. It seems that the proteins in the coffee leaf APF might be implicated in structural modifications in the extracellular space that are crucial for plant development/adaptation to the conditions of the prevailing environment. This is the first detailed proteomic study of the coffee leaf apoplastic fluid (APF) and of its modulation by the greenhouse conditions. The comprehensive overview of the most abundant proteins present in the extra-cellular compartment is particularly important for the understanding of coffee responses to abiotic/biotic stress. This article is part of a Special Issue entitled: Environmental and structural proteomics. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Process technology of luwak coffee through bioreactor utilization

    Science.gov (United States)

    Hadipernata, M.; Nugraha, S.

    2018-01-01

    Indonesia has an advantage in producing exotic coffee that is Luwak coffee. Luwak coffee is produced from the fermentation process in digestion of civet. Luwak coffee production is still limited due to the difficulty level in the use of civet animals as the only medium of Luwak coffee making. The research was conducted by developing technology of luwak coffee production through bioreactor utilization and addition the bacteria isolate from gastric of civet. The process conditions in the bioreactor which include temperature, pH, and bacteria isolate of civet are adjusted to the process that occurs in civet digestion, including peristaltic movement on the stomach and small intestine of the civet will be replaced by the use of propellers that rotate on the bioreactor. The result of research showed that proximat analysis data of artificial/bioreactor luwak coffee did not significant different with original luwak coffee. However, the original luwak coffee has higher content of caffeine compared to bioreactor luwak coffee. Based on the cuping test the bioreactor luwak coffee has a value of 84.375, while the original luwak coffee is 84.875. As the result, bioreactor luwak coffee has excellent taste that similiar with original luwak coffee taste.

  13. Kinetics of structural rust transformation in environments containing chloride and SO2

    International Nuclear Information System (INIS)

    Rendon, J. L.; Valencia, A.

    2003-01-01

    The behaviour of the rusts produced on low carbon steel exposed in industrial atmospheres, at different distances from the sea, was studied by simulating the wetting-drying cycle in a CEBELCOR type apparatus. Coupons electrode potential was monitored and rust layer was analyzed by gravimetric techniques, optical microscopy and Moessbauer spectroscopy. A particular chloride/sulfur ratio in the atmosphere was found, for which there is a particular behaviour in rust formation. For this ratio, corrosion rates were much less than expected. it is postulated a kinetic mechanism for rust layer formation as the origin of this special behavior. An electrode potential similar to that in a weathering steel was observed, this is reflected in the low corrosion rate obtained. The proposed kinetic mechanism for rust formation under these exposure conditions enables new research lines on layer formation and the development of protective rust for industrial marine atmospheres. (Author) 8 refs

  14. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.

    Science.gov (United States)

    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal

    2016-04-01

    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Wake up and smell the coffee. Caffeine, coffee, and the medical consequences.

    Science.gov (United States)

    Chou, T

    1992-11-01

    Caffeine is a methylxanthine whose primary biologic effect is antagonism of the adenosine receptor. Its presence in coffee, tea, soda beverages, chocolate, and many prescription and over-the-counter drugs makes it the most commonly consumed stimulant drug. Initially caffeine increases blood pressure, plasma catecholamine levels, plasma renin activity, serum free fatty acid levels, urine production, and gastric acid secretion. Its long-term effects have been more difficult to substantiate. Most of the caffeine consumed in the United States is in coffee, which contains many other chemicals that may have other biologic actions. The consumption of coffee is a self-reinforcing behavior, and caffeine dependence and addiction are common. Coffee and caffeine intake have been linked to many illnesses, but definitive correlations have been difficult to substantiate. Initial trials showing coffee's association with coronary disease and myocardial infarction have been difficult to reproduce and have many confounding variables. Recent studies showing a larger effect over long follow-up periods and with heavy coffee consumption have again brought the question of the role of coffee in disease states to the fore. Caffeine in average dosages does not seem to increase the risk of arrhythmia. At present there is no convincing evidence that caffeine or coffee consumption increases the risk for any solid tumor. The intake of coffee and caffeine has clearly been decreasing in this country over the past two decades, largely brought about by the increasing health consciousness of Americans. Although there have been many studies that hint that the fears of increased disease with coffee drinking may be warranted, many questions have yet to be answered about the health effects of coffee and caffeine use.

  16. Transformation of the flax rust fungus, Melampsora lini: selection via silencing of an avirulence gene

    OpenAIRE

    Lawrence, Gregory J.; Dodds, Peter N.; Ellis, Jeffrey G.

    2009-01-01

    Rust fungi cause devastating diseases on many important food crops, with a damaging stem rust epidemic currently affecting wheat production in Africa and the Middle East. These parasitic fungi propagate exclusively on plants, precluding the use of many biotechnological tools available for other culturable fungi. In particular the lack of a stable transformation system has been an impediment to the genetic manipulation required for molecular analysis of rust pathogenicity. We have developed an...

  17. HPLC determination of caffeine in coffee beverage

    Science.gov (United States)

    Fajara, B. E. P.; Susanti, H.

    2017-11-01

    Coffee is the second largest beverage which is consumed by people in the world, besides the water. One of the compounds which contained in coffee is caffeine. Caffeine has the pharmacological effect such as stimulating the central nervous system. The purpose of this study is to determine the level of caffeine in coffee beverages with HPLC method. Three branded coffee beverages which include in 3 of Top Brand Index 2016 Phase 2 were used as samples. Qualitative analysis was performed by Parry method, Dragendorff reagent, and comparing the retention time between sample and caffeine standard. Quantitative analysis was done by HPLC method with methanol-water (95:5v/v) as mobile phase and ODS as stationary phasewith flow rate 1 mL/min and UV 272 nm as the detector. The level of caffeine data was statistically analyzed using Anova at 95% confidence level. The Qualitative analysis showed that the three samples contained caffeine. The average of caffeine level in coffee bottles of X, Y, and Z were 138.048 mg/bottle, 109.699 mg/bottle, and 147.669 mg/bottle, respectively. The caffeine content of the three coffee beverage samples are statistically different (pcoffee beverage samples were not meet the requirements set by the Indonesian Standard Agency of 50 mg/serving.

  18. Bioethanol Quality Improvement of Coffee Fruit Leather

    Directory of Open Access Journals (Sweden)

    Edahwati Luluk

    2016-01-01

    Full Text Available Recently, Indonesia’s dependence on petroleum is to be reduced and even eliminated. To overcome the problem of finding the needed alternative materials that can produce ethanol, in this case as a substitute material or a transport fuel mix, boosting the octane number, and gasoline ethanol (gasohol can be conducted. In the red coffee processing (cooking that will produce 65% and 35% of coffee beans, coffee leather waste is a source of organic material with fairly high cellulose content of 46.82%, 3.01% of pectin and 7.68% of lignin. In this case, its existence is abundant in Indonesia and optimally utilized. During the coffee fruit peeling, the peel waste is only used as a mixture of animal feed or simply left to rot. The purpose of this study was to produce and improve the quality of the fruit skin of bioethanol from coffee cellulose. However, to improve the quality of bioethanol, the production of the lignin content in the skin of the coffee fruit should be eliminated or reduced. Hydrolysis process using organosolve method is expected to improve the quality of bioethanol produced. In particular, the use of enzyme Saccharomyces and Zymmomonas will change the resulting sugar into bioethanol. On one hand, by using batch distillation process for 8 hours with Saccharomyces, bioethanol obtains high purity which is 39.79%; on the other hand, by using the same batch distillation process with Zymmomonas, the bioethanol obtains 38.78%.

  19. Exposure to lead from intake of coffee

    DEFF Research Database (Denmark)

    Hansen, Max; Sloth, Jens Jørgen; Rasmussen, Rie Romme

    Food and beverages is one of the primary sources of intake of and exposure to lead, with beverages accounting for almost 50%. Previous studies from Denmark have estimated that the intake of lead from coffee is very high and may contribute to up to 20% of the total lead intake from food and bevera......Food and beverages is one of the primary sources of intake of and exposure to lead, with beverages accounting for almost 50%. Previous studies from Denmark have estimated that the intake of lead from coffee is very high and may contribute to up to 20% of the total lead intake from food...... and beverages. This estimate is, however, based on older, non-published data. In the current project extensive chemical analyses of coffee beans, drinking water and ready-to-drink coffee have been performed. The results hereof have been compared to calculations of the total intake of lead from food...... and beverages. The results show that the intake of lead from coffee is considerably lower than previously estimated and account for 4.2% and 3.3% of the total lead intake from food and beverages for Danish men and women, respectively. It can generally be concluded that the intake of lead from coffee is low...

  20. Ochratoxin A in Brazilian green coffee

    Directory of Open Access Journals (Sweden)

    LEONI Luís A.B.

    2001-01-01

    Full Text Available Ochratoxin A is a nephrotoxic, teratogenic and imunotoxic compound produced by Aspergillus and Penicillium spp. It is a suspected carcinogen to humans and it is carcinogenic to rats. Recently it has drawn attention because it has been found in coffee and it has been the object of regulation by coffee importing countries. Brazil is the largest coffee producing country and its largest consumer. In order to conduct an initial assessment of the situation of the coffee produced in the country and offered to its population, one hundred and thirty two samples of Brazilian green coffee from 5 producing states (Minas Gerais, Paraná, São Paulo, Espírito Santo and Bahia and destined for the home market, were collected at sales points at the cities of Londrina and Santos, Brazil, and analyzed for ochratoxin A. The toxin was isolated in immunoaffinity columns and quantified by HPLC with florescence detection. The limit of detection was 0.7ng/g and the average RSD for duplicates of the samples was 11%. Twenty seven samples were found contaminated with the toxin and the average concentration for the contaminated samples was 7.1ng/g ochratoxin A. Neither the total number of defects nor the number of specific defects according to the Brazilian coffee classification system (black, partly -- black, sour, stinkers-black, stinkers-green, pod beans showed any relation to the contamination of the samples with ochratoxin A.

  1. Quantitative variables associated to the resistance to sugarcane brown rust disease

    Directory of Open Access Journals (Sweden)

    Joaquin Montalvan Delgado

    2017-01-01

    Full Text Available With the purpose to analyze the behavior of a group of sugarcane cultivars in the presence of brown rust (Puccinia melanocephala Sydow and P. Sydow in the area of the Territorial Sugarcane Research Station Oriental Center Camagüey, it was carried out an experiment with 11 sugarcane cultivars (C1051-73, C132-81, C266-70, C323-68, C86-12, C86-503, C86- 56, C88-380, C90-530, Co997, SP70-1284 and six patterns of well-known reaction PR980 (I grade, Ja64-11 (II grade, C334-64 (III grade, My5514 y Ja60-5 (IV grade y B4362 (V grade. The evaluations were made at the plant and ratoon shoot at the ages of three, four, five, six and nine months in the leaves +1, +3 y +5. The evaluated parameters were: length and the number of pustules, size of the biggest pustule, and the occupied area by pustules. It was made an analysis of variance and Tukey’s test to find the differences between the cultivars. The statistical packet SPSS such as the main additive and multiplicative interactions (AMMI Models were used. There are differences in every analyzed factors (cultivar, leaf and evaluation moment and in the analyzed variables (TPM and occupied area by pustule. The resistance patterns kept the expected behavior and the biggest cultivars percentage behaved like resistant.

  2. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  3. Physical Localization of a Locus from Agropyron cristatum Conferring Resistance to Stripe Rust in Common Wheat.

    Science.gov (United States)

    Zhang, Zhi; Song, Liqiang; Han, Haiming; Zhou, Shenghui; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

    2017-11-13

    Stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat ( Triticum aestivum L.) worldwide. Agropyron cristatum (L.) Gaertn. (2 n = 28, PPPP), one of the wild relatives of wheat, exhibits resistance to stripe rust. In this study, wheat- A . cristatum 6P disomic addition line 4844-12 also exhibited resistance to stripe rust. To identify the stripe rust resistance locus from A . cristatum 6P, ten translocation lines, five deletion lines and the BC₂F₂ and BC₃F₂ populations of two wheat- A . cristatum 6P whole-arm translocation lines were tested with a mixture of two races of Pst in two sites during 2015-2016 and 2016-2017, being genotyped with genomic in situ hybridization (GISH) and molecular markers. The result indicated that the locus conferring stripe rust resistance was located on the terminal 20% of 6P short arm's length. Twenty-nine 6P-specific sequence-tagged-site (STS) markers mapped on the resistance locus have been acquired, which will be helpful for the fine mapping of the stripe rust resistance locus. The stripe rust-resistant translocation lines were found to carry some favorable agronomic traits, which could facilitate their use in wheat improvement. Collectively, the stripe rust resistance locus from A . cristatum 6P could be a novel resistance source and the screened stripe rust-resistant materials will be valuable for wheat disease breeding.

  4. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  5. Resistance to rusts (uromyces pisi and u. viciae-fabae) in pea

    OpenAIRE

    Barilli, Eleonora; Sillero, Josefina C.; Prats, Elena; Rubiales, Diego

    2014-01-01

    Pea is the second most important food legume crop in the world. Rust is a pea disease widely distributed, particularly in regions with warm, humid weather. Pea rust can be incited by Uromyces viciae-fabae and by U. pisi. U. viciae-fabae prevails in tropical and subtropical regions such as India and China, while U. pisi prevails in temperate regions. Chemical control of rust is possible, but the use of host plant resistance is the most desired means of rust control. In this paper we revise and...

  6. An analysis of the risk of introduction of additional strains of the rust puccinia psidii Winter ('Ohi'a Rust) to Hawai'i

    Science.gov (United States)

    Loope, Lloyd; La Rosa, Anne Marie

    2010-01-01

    In April 2005, the rust fungus Puccinia psidii (most widely known as guava rust or eucalyptus rust) was found in Hawai'i. This was the first time this rust had been found outside the Neotropics (broadly-defined, including subtropical Florida, where the rust first established in the 1970s). First detected on a nursery-grown 'ohi'a plant, it became known as ''ohi'a rust'in Hawai'i. The rust spread rapidly and by August 2005 had been found throughout the main Hawaiian Islands. The rust probably reached Hawai'i via the live plant trade or via the foliage trade. In Hawai'i, the rust has infected three native plant species and at least eight non-native species. Effects have been substantial on the endangered endemic plant Eugenia koolauensis and the introduced rose apple, Syzygium jambos. Billions of yellow, asexual urediniospores are produced on rose apple, but a complete life cycle (involving sexual reproduction) has not yet been observed. The rust is autoecious (no alternate host known) on Myrtaceae. The strain introduced into Hawai'i is found sparingly on 'ohi'a (Metrosideros polymorpha), the dominant tree of Hawai'i's forests, with sporadic damage detected to date. The introduction of a rust strain that causes widespread damage to 'ohi'a would be catastrophic for Hawai'i's native biodiversity. Most imports of material potentially contaminated with rust are shipped to Hawai'i from Florida and California (from which P. psidii was reported in late 2005 by Mellano, 2006). Florida is known to have multiple strains. The identity of the strain or strains in California is unclear, but one of them is known to infect myrtle, Myrtus communis, a species commonly imported into Hawai'i. It is important to ecosystem conservation and commercial forestry that additional rust strains or genotypes be prevented from establishing in Hawai'i. The purpose of this analysis of risk is to evaluate the need for an interim rule by the Hawai'i Department of Agriculture to regulate plant

  7. The Hawaii protocol for scientific monitoring of coffee berry borer: a model for coffee agroecosystems worldwide

    Science.gov (United States)

    Coffee Berry Borer (CBB) is the most devastating insect pest for coffee crops worldwide. We developed a scientific monitoring protocol aimed at capturing and quantifying the dynamics and impact of this invasive insect pest as well as the development of its host plant across a heterogeneous landscape...

  8. Coffee harvest management by manipulation of coffee flowering with plant growth regulators

    Science.gov (United States)

    The breaking of coffee flower bud dormancy is known to be associated with one or more significant rainfall events following an extended period of dryness. In Hawaii, lack of a distinct wet-dry season poses serious problems for coffee growers because flowering is spread over several months. Multiple...

  9. Roasted and Ground Coffee: A Study of Extenders, Substitutes and Alternative Coffee Sources

    Science.gov (United States)

    1984-02-01

    other large food service organizations. The policy of adjusting the amount of R&G coffee used in brewing recipes according to consumer preferences , as...health, such as in the reduction of caffeine levels, as well as’ general consumer preferences for hot beverages with lower levels of coffee- like

  10. Diversity in smallholder farms growing coffee and their use of recommended coffee management practices in Uganda

    NARCIS (Netherlands)

    Bongers, G.; Fleskens, L.; Ven, van de G.W.J.; Mukasa, D.; Giller, K.E.; Asten, van P.

    2015-01-01

    Many smallholder farm systems in Uganda produce coffee as an important cash crop. Yet coffee yields are poor. To increase farmers’ production, a range of agronomic practices have been recommended by national and international agencies. Yet the adoption potential of recommendations differs between

  11. Severity of angular leaf spot and rust diseases on common beans in ...

    African Journals Online (AJOL)

    ACSS

    5.3, respectively. Key words: Common beans, disease management, Phaseolus vulgaris, Pseudocercospora griseola, .... Pearson product- moment ..... SAS Institute. 1989. SAS/STAT User's. Guide (version 6, vol. 1, 4th ed.), Cary: SAS Institute ...

  12. Determination of trace elements in coffee beans and instant coffee of various origins by INAA

    International Nuclear Information System (INIS)

    Zaidi, J.H.; Fatima, I.; Arif, M.; Qureshi, I.H.

    2006-01-01

    Extensive use of coffee, by one-third of world's population, entails the evaluation of trace element contents in it. Instrumental neutron activation analysis (INAA) was successfully employed to determine the concentration of 20 trace elements (essential, toxic and nonessential) in four samples of coffee beans of various origins and two instant coffee brands most commonly consumed in Pakistan. Base-line values of certain toxic and essential elements in coffee are provided. The daily intake of essential and toxic elements through coffee was estimated and compared with the recommended values. The cumulative intake of Mn is four times higher than the recommended value and that of toxic elements is well below the tolerance limits. (author)

  13. Coffee Production in Kavre and Lalitpur Districts, Nepal

    Directory of Open Access Journals (Sweden)

    Yogendra Kumar Karki

    2018-05-01

    Full Text Available Coffee (Coffea spp is an important and emerging cash crop having potential to provide farmers employment and income generation opportunities. This crop is well adapted to the climatic conditions of mid-hills of Nepal. Thus, majority of the farmers are attracted towards cultivation of coffee because of demands in national and international market. Coffee is now becoming integral part of farming system in rural areas. However, information on performance of coffee and farmers response has not been well documented. Therefore, we undertook the present work to analyze demography, ethnicity, household occupation, literacy status, average land holding, coffee cultivation area, livelihood and sources of income of coffee growers, production and productivity, pricing, cropping pattern of the coffee and problesm faced by them in mid hill district of Kavrepalanchowk (hereafter ‘Kavre’ and Lalitpur Districts. All the samples were taken randomly and selected from coffee producing cooperative of Kavre and Lalitpur. Our analysis showed that the male farmer dominant over female on adopting coffee cultivation in both districts with higher value in Kavre. Brahmin and Chetri ethnic communities were in majority over others in adopting the coffee cultivation. Literate farmers were more dominant over illiterates on adopting the coffee cultivation, The mean land holding was less, ranging from 0.15 to 2.30 ha for coffee cultivation, the history of coffee cultivation in Kavre showed that highest number of farmers were engaged in coffee farming from last 16 years. The mean yield of fresh cherry was 1027.20 kg/ha in Kavre, while it was 1849.36 kg/ha in Lalitpur. The study revealed that majority of the coffee plantations were between 6-10 years old. The major problems facing by coffee farmers were diseases spread, lack of irrigation facility and drying of plants. Despite of that the coffee farming was one of the rapidly emerging occupations among the farmers in both

  14. Coffee consumption and risk of renal cell carcinoma.

    Science.gov (United States)

    Antwi, Samuel O; Eckel-Passow, Jeanette E; Diehl, Nancy D; Serie, Daniel J; Custer, Kaitlynn M; Arnold, Michelle L; Wu, Kevin J; Cheville, John C; Thiel, David D; Leibovich, Bradley C; Parker, Alexander S

    2017-08-01

    Studies have suggested an inverse association between coffee consumption and risk of renal cell carcinoma (RCC); however, data regarding decaffeinated coffee are limited. We conducted a case-control study of 669 incident RCC cases and 1,001 frequency-matched controls. Participants completed identical risk factor questionnaires that solicited information about usual coffee consumption habits. The study participants were categorized as non-coffee, caffeinated coffee, decaffeinated coffee, or both caffeinated and decaffeinated coffee drinkers. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using logistic regression, adjusting for multiple risk factors for RCC. Compared with no coffee consumption, we found an inverse association between caffeinated coffee consumption and RCC risk (OR 0.74; 95% CI 0.57-0.99), whereas we observed a trend toward increased risk of RCC for consumption of decaffeinated coffee (OR 1.47; 95% CI 0.98-2.19). Decaffeinated coffee consumption was associated also with increased risk of the clear cell RCC (ccRCC) subtype, particularly the aggressive form of ccRCC (OR 1.80; 95% CI 1.01-3.22). Consumption of caffeinated coffee is associated with reduced risk of RCC, while decaffeinated coffee consumption is associated with an increase in risk of aggressive ccRCC. Further inquiry is warranted in large prospective studies and should include assessment of dose-response associations.

  15. Magnetic property based characterization of rust on weathering steels

    International Nuclear Information System (INIS)

    Mizoguchi, T.; Ishii, Y.; Okada, T.; Kimura, M.; Kihira, H.

    2005-01-01

    The characterization of rusts on weathering steels is important in understanding the origin of their corrosion resistance. Rust consists of several phases, e.g. α-, β- and γ-FeOOH, which are anti-ferromagnetic with different Neel temperatures. Rust on so-called advanced weathering steel containing 3 wt.% Ni [H. Kihira, A. Usami, K. Tanabe, M. Ito, G. Shigesato, Y. Tomita, T. Kusunoki, T. Tsuzuki, S. Ito, T. Murata, in: Proc. Symp. on Corrosion and Corrosion Control in Saltwater Environments, Honolulu, 1999, The Electrochemical Soc., pp. 127-136] contains in addition a ferrimagnetic spinel phase [M. Kimura, H. Kihira, Y. Ishii, T. Mizoguchi, in: Proc. 13th Asian-Pacific Corrosion Control Conference, Osaka, 2003; M. Kimura, H. Kihira, N. Ohta, M. Hashimoto, T. Senuma, Corros. Sci., this volume; M. Kimura, N. Ohta, H. Kihira, Mater. Trans. JIM, in press]. The nanostructure of real rust cannot be elucidated satisfactorily only with conventional analytical methods such as X-ray diffraction, because of the complex mixture of phases with fine and imperfect crystallites. Because of the short range of the super-exchange coupling between Fe ions in a solid, the magnetic properties can give information on local configurations even in the absence of perfect crystalline coherence. Therefore, the magnetic properties of rust samples were investigated in detail using a Superconducting Quantum Interference Device (SQUID) magnetometer and Moessbauer spectroscopy. SQUID magnetometry is effective to determine the quantity of the ferrimagnetic phase. The temperature dependence of the Moessbauer spectrum gives information about not only the fractions of the phases but also the distribution of grain volume, V, in each phase according to the super-paramagnetic relaxation effect. This approach has been applied to rust of conventional [T. Okada, Y. Ishii, T. Mizoguchi, I. Tamura, Y. Kobayashi, Y. Takagi, S. Suzuki, H. Kihira, M. Ito, A. Usami, K. Tanabe, K. Masuda, Jpn. J. Appl. Phys. 39

  16. Studies on general resistance to stem rust in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1977-01-01

    Eight cultivars that were thought to have field resistance to stem rust were selected and crossed to produce four four-cultivar hybrids. From those crosses lines were produced that lacked seedling resistance to race 15B-1 of stem rust but had good field resistance to it. They also proved to have field resistance to many other races and it is hoped that the resistance is general. Genetic studies indicated that there is some variation in the lines, but resistance is generally inherited as a quantitative character with several largely recessive genes having small additive effects. This suggests that in an induced mutation programme, no one plant is likely to accumulate sufficient mutant genes that it will appear resistant. (author)

  17. Protective, curative and eradicative activities of fungicides against grapevine rust

    Directory of Open Access Journals (Sweden)

    Francislene Angelotti

    2014-01-01

    Full Text Available The protective, eradicative and curative activities of the fungicides azoxystrobin, tebuconazole, pyraclostrobin+metiram, and ciproconazole against grapevine rust, were determined in greenhouse. To evaluate the protective activity, leaves of potted ´Niagara´ (Vitis labrusca vines were artificially inoculated with an urediniospore suspension of Phakopsora euvitis four, eight or forteen days after fungicidal spray; and to evaluate the curative and eradicative activities, leaves were sprayed with fungicides two, four or eight days after inoculation. Disease severity was assessed 14 days after each inoculation. All tested fungicides present excellent preventive activity against grapevine rust; however, tebuconazole and ciproconazole provide better curative activity than azoxystrobin and pyraclostrobin+metiram. It was observed also that all tested fungicides significantly reduced the germination of urediniospore produced on sprayed leaves.

  18. Study of a low alloy steel rust using Moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Maier, I.A.; Saragovi-Badler, C.; Labenski, F.

    1978-01-01

    Moessbauer spectroscopy has been used to analyze the internal and external rust layers of a weathering steel exposed for ten months to an urban-industrial atmosphere. Superparamagnetic α-FeOOH and γ-FeOOH were found in both layers. The external one also contained small sized delta-FeOOH and/or amorphous iron oxyhydroxide. These compounds were not present in the internal layer at this stage of the patina formation. (author)

  19. Influence of lactate ions on the formation of rust

    International Nuclear Information System (INIS)

    Sabot, R.; Jeannin, M.; Gadouleau, M.; Guo, Q.; Sicre, E.; Refait, Ph.

    2007-01-01

    The formation of rust can be simulated by oxidation of aqueous suspensions of Fe(OH) 2 obtained by mixing solutions of NaOH and a Fe(II) salt. The aim of this study was to investigate the influence of organic species associated with microbially influenced corrosion. The lactate anion, often used as a carbon and electrons source for the development of microorganisms, was chosen as an example. Then, in the first part of the study, Fe(OH) 2 was precipitated using iron(II) lactate and NaOH. Its oxidation process involved two stages, as usually observed. The first stage led to a Fe(II-III) intermediate compound, the lactate green rust, GR(C 3 H 5 O 3 - ). This compound has never been reported yet. Its existence demonstrates that the GR structure is able to incorporate a very wide range of anions, whatever the size and geometry. The second stage corresponded to the oxidation of GR(C 3 H 5 O 3 - ). It led to ferrihydrite, the most poorly ordered form of iron(III) oxides and oxyhydroxides. In the second part of the study, the formation of rust in seawater was simulated by oxidation of Fe(OH) 2 in an aqueous media containing both Cl - and SO 4 2- anions. The first stage led to the sulphate green rust, GR(SO 4 2- ), the second stage to lepidocrocite γ-FeOOH. Small amounts of iron(II) lactate were added to the reactants. Lactate ions did not modify the first stage but drastically perturbed the second stage, as ferrihydrite was obtained instead of γ-FeOOH

  20. Coffee and cancer risk: a summary overview.

    Science.gov (United States)

    Alicandro, Gianfranco; Tavani, Alessandra; La Vecchia, Carlo

    2017-09-01

    We reviewed available evidence on coffee drinking and the risk of all cancers and selected cancers updated to May 2016. Coffee consumption is not associated with overall cancer risk. A meta-analysis reported a pooled relative risk (RR) for an increment of 1 cup of coffee/day of 1.00 [95% confidence interval (CI): 0.99-1.01] for all cancers. Coffee drinking is associated with a reduced risk of liver cancer. A meta-analysis of cohort studies found an RR for an increment of consumption of 1 cup/day of 0.85 (95% CI: 0.81-0.90) for liver cancer and a favorable effect on liver enzymes and cirrhosis. Another meta-analysis showed an inverse relation for endometrial cancer risk, with an RR of 0.92 (95% CI: 0.88-0.96) for an increment of 1 cup/day. A possible decreased risk was found in some studies for oral/pharyngeal cancer and for advanced prostate cancer. Although data are mixed, overall, there seems to be some favorable effect of coffee drinking on colorectal cancer in case-control studies, in the absence of a consistent relation in cohort studies. For bladder cancer, the results are not consistent; however, any possible direct association is not dose and duration related, and might depend on a residual confounding effect of smoking. A few studies suggest an increased risk of childhood leukemia after maternal coffee drinking during pregnancy, but data are limited and inconsistent. Although the results of studies are mixed, the overall evidence suggests no association of coffee intake with cancers of the stomach, pancreas, lung, breast, ovary, and prostate overall. Data are limited, with RR close to unity for other neoplasms, including those of the esophagus, small intestine, gallbladder and biliary tract, skin, kidney, brain, thyroid, as well as for soft tissue sarcoma and lymphohematopoietic cancer.

  1. Coffee consumption and periodontal disease in males.

    Science.gov (United States)

    Ng, Nathan; Kaye, Elizabeth Krall; Garcia, Raul I

    2014-08-01

    Coffee is a major dietary source of antioxidants as well as of other anti-inflammatory factors. Given the beneficial role of such factors in periodontal disease, whether coffee intake is associated with periodontal disease in adult males was explored. Existing data collected by a prospective, closed-panel cohort study of aging and oral health in adult males was used. Participants included the 1,152 dentate males in the Veterans Affairs (VA) Dental Longitudinal Study who presented for comprehensive medical and dental examinations from 1968 to 1998. Mean age at baseline was 48 years; males were followed for up to 30 years. Participants are not VA patients; rather, they receive their medical and dental care in the private sector. Periodontal status was assessed by probing depth (PD), bleeding on probing, and radiographic alveolar bone loss (ABL), measured on intraoral periapical radiographs with a modified Schei ruler method. Moderate-to-severe periodontal disease was defined as cumulative numbers of teeth exhibiting PD ≥4 mm or ABL ≥40%. Coffee intake was obtained from participant self-reports using the Cornell Medical Index and food frequency questionnaires. Multivariate repeated-measures generalized linear models estimated mean number of teeth with moderate-to-severe disease at each examination by coffee intake level. It was found that higher coffee consumption was associated with a small but significant reduction in number of teeth with periodontal bone loss. No evidence was found that coffee consumption was harmful to periodontal health. Coffee consumption may be protective against periodontal bone loss in adult males.

  2. Induced mutations in beans and peas for resistance to rust

    International Nuclear Information System (INIS)

    Fadl, F.A.M.

    1983-01-01

    Gamma rays and ethyl methanesulphonate (EMS) were applied in a mutation-induction programme for rust resistance in bean and pea. Bean and pea seeds were pre-soaked 2 hours before irradiation with 9, 10 and 12 krad. For chemical mutagen treatments bean and pea seeds were pre-soaked for 8 hours and treated with 0.5 and 1.5% EMS for four hours. M 2 seeds of beans and peas were planted in 1979. Resistant M 2 plants were selected for their rust resistance and other morphological characters. M 3 seeds of selected plants were planted in 1980. In 1980 more seeds of the same varieties of beans and peas were treated with 0.1 and 0.3% EMS with the aim to produce rust-resistant mutants. Seed germination was reduced by gamma rays or EMS. Dwarf, malformed and abnormal plants were noticed. Some resistant M 2 plants selected gave high grain yields. Some were different in morphological characters. In the M 3 of selected plants various other mutant characters appeared, such as different height of plants, early and late flowering, resistance to powdery mildew in peas, altered grain yield, thickness of stem, pod shape and flower colour. (author)

  3. Crônica de uma praga anunciada epidemias agrícolas e história ambiental do café nas Américas Chronicle of a plague foretold crop epidemics and the environmental history of coffee in the Americas

    Directory of Open Access Journals (Sweden)

    Stuart Mccook

    2008-06-01

    Full Text Available As epidemias agrícolas fornecem um ponto de vista privilegiado para a história ambiental global e transnacional de commodities. A epidemia da ferrugem, causada pelo fungo Hemileia nastatrix, é uma das mais sérias doenças que têm atingido a indústria global de café. No século XIX, ela devastou as plantações de café no Velho Mundo. Também reduziu agudamente a produção de café do tipo arábica na África, Ásia e no Pacífico. Esse foi um dos fatores que permitiu aos países da Américas dominarem a produção global no século XX. Essa epidemia foi detectada nas Américas pela primeira vez na década de 1970. A sua história nas Américas, e as tentativas de seu controle lançam luzes sobre dois paradigmas maiores que moldaram a história ambiental do café no final do século XX. São eles: o paradigma tecnicista, dominante entre meados do século XX até o início dos anos 1990; e o paradigma da sustentabilidade, cujo domínio emergiu em meados dos anos 1980 e se mantém até o presente.Crop epidemics provide a portal into the global and transnational environmental history of commodities. The coffee rust epidemic, caused by the fungus Hemileia vastatrix, is one of the most serious diseases to have afflicted the global coffee industry. In the nineteenth century, it devastated the coffee plantations in the Old World. It sharply curtailed arabica coffee production in Africa, Asia, and the Pacific. This was one of the factors that allowed the Americas do dominate global coffee production in the twentieth century. The coffee rust epidemic was first detected in the Americas in the 1970s. The history of the rust epidemic in the Americas, and attempts to control it, shed light on two major paradigms that shaped the environmental history of coffee in the late twentieth century. The paradigm of technification, which dominated from the mid-20th century to the early 1990s; and the paradigm of sustainability, which dominated emerged in the

  4. The Impact of Market Reform Programmes on Coffee Prices in ...

    African Journals Online (AJOL)

    (ICA) and liberalization of coffee marketing in Tanzania on coffee prices. The motivation for this ... indirect effects of market reforms on the level of prices, their variance ..... This strategy could be achieved through dedicated support to farmers to ...

  5. Assessment of metals in roasted indigenous coffee varieties of ...

    African Journals Online (AJOL)

    Assessment of metals in roasted indigenous coffee varieties of Ethiopia. ... Bulletin of the Chemical Society of Ethiopia ... values and drinking two cups of coffee is safe for an adult person and free from the risks of Cd and Pb toxicity.

  6. COFFEE - Coherent Optical System Field Trial for Spectral Efficiency Enhancement

    DEFF Research Database (Denmark)

    Imran, Muhammad; Fresi, Francesco; Rommel, Simon

    2016-01-01

    The scope, aims, and contributions of the COFFEE project for spectral efficiency enhancement and market exposure are presented.......The scope, aims, and contributions of the COFFEE project for spectral efficiency enhancement and market exposure are presented....

  7. Differential returns from globalization to women smallholder coffee ...

    African Journals Online (AJOL)

    Differential returns from globalization to women smallholder coffee and food ... the same area, female coffee producers represented a higher level of integration ... involved in small-scale production, and of a similar age and education level.

  8. Comparative genomic analysis of coffee-infecting Xylella fastidiosa strains isolated from Brazil.

    Science.gov (United States)

    Barbosa, Deibs; Alencar, Valquíria Campos; Santos, Daiene Souza; de Freitas Oliveira, Ana Cláudia; de Souza, Alessandra A; Coletta-Filho, Helvecio D; de Oliveira, Regina Souza; Nunes, Luiz R

    2015-05-01

    Strains of Xylella fastidiosa constitute a complex group of bacteria that develop within the xylem of many plant hosts, causing diseases of significant economic importance, such as Pierce's disease in North American grapevines and citrus variegated chlorosis in Brazil. X. fastidiosa has also been obtained from other host plants, in direct correlation with the development of diseases, as in the case of coffee leaf scorch (CLS)--a disease with potential to cause severe economic losses to the Brazilian coffee industry. This paper describes a thorough genomic characterization of coffee-infecting X. fastidiosa strains, initially performed through a microarray-based approach, which demonstrated that CLS strains could be subdivided in two phylogenetically distinct subgroups. Whole-genomic sequencing of two of these bacteria (one from each subgroup) allowed identification of ORFs and horizontally transferred elements (HTEs) that were specific to CLS-related X. fastidiosa strains. Such analyses confirmed the size and importance of HTEs as major mediators of chromosomal evolution amongst these bacteria, and allowed identification of differences in gene content, after comparisons were made with previously sequenced X. fastidiosa strains, isolated from alternative hosts. Although direct experimentation still needs to be performed to elucidate the biological consequences associated with such differences, it was interesting to verify that CLS-related bacteria display variations in genes that produce toxins, as well as surface-related factors (such as fimbrial adhesins and LPS) that have been shown to be involved with recognition of specific host factors in different pathogenic bacteria. © 2015 The Authors.

  9. Growth, development, and fertilizer-15N recovery by the coffee plant

    International Nuclear Information System (INIS)

    Fenilli, Tatiele Anete Bergamo; Reichardt, Klaus; Bacchi, Osny Oliveira Santos; Dourado-Neto, Durval; Favarin, Jose Laercio; Trivelim, Paulo Cesar Ocheuze; Costa, Flavio Murilo Pereira da

    2007-01-01

    The relationship between growth and fertilizer nitrogen recovery by perennial crops such as coffee is poorly understood and improved understanding of such relations is important for the establishment of rational crop management practices. In order to characterize the growth of a typical coffee crop in Brazil and quantify the recovery of 15 N labeled ammonium sulfate, and improve information for fertilizer management practices this study presents results for two consecutive cropping years, fertilized with 280 and 350 kg ha -1 of N, respectively, applied in four splittings, using five replicates. Shoot dry matter accumulation was evaluated every 60 days, separating plants into branches, leaves and fruits. Labeled sub-plots were used to evaluate N-total and 15 N abundance by mass spectrometry. During the first year the aerial part reached a recovery of 71% of the fertilizer N applied up to February, but this value was reduced to 34% at harvest and 19% at the beginning of the next flowering period due to leaf fall and fruit export. For the second year the aerial part absorbed 36% of the fertilizer N up to March, 47% up to harvest and 19% up to the beginning of the next flowering period. The splitting into four applications of the used fertilizer rates was adequate for the requirements of the crop at these growth stages of the coffee crop. (author)

  10. The Investigation of the Element Contents in the Turkish Coffees

    OpenAIRE

    Demir, Funda; Selvi, Nigar; Kıpçak, Seyhun; Özdemir, Özgül; Piskin, Mehmet; Moroydor Derun, Emek

    2015-01-01

    The Investigation of the Element Contents in the Turkish CoffeesCoffee is one of the most popular drinks across the world and its enormous commercial and social importance is obvious. Coffee has become the essential consumption matter and one of the rituals of many societies for several years.Turkish people's first confrontation with it dates back to 16th century, in Ottoman era. Since then, because of the differences in terms of preparation and presentation styles, the coffee has been n...

  11. Investigation on the extractability of melanoidins in portioned espresso coffee

    OpenAIRE

    Bartel, C.; Mesías, Marta; Morales, F. J.

    2015-01-01

    © 2014 Elsevier Ltd. Coffee melanoidins have attracted interest as a result of its potential health benefits. This investigation aims to elucidate the extraction behavior of melanoidins and their populations during the preparation of portioned espresso coffee and its relationship with the antioxidant activity of the coffee brew. Filter-paper pods, FAP capsule, and clone capsule containing light roasted coffee have been investigated. An accumulative fractionation approach has applied to model ...

  12. The coffee-time challenge

    CERN Document Server

    CERN Bulletin

    2010-01-01

    The challenge to identify the LEP events displayed on coffee tables in Restaurant 1 (Bulletin 02-03/2010) sparked interest among readers who do not have the opportunity to see them . Table 1, Table 2, Table 3, Table 4, Table 5, Table 6, Table 7, Table 8, Table 9, Table 10, Table 11, Table 12 Table 13, Table 14, Table 15, Table 16       We have therefore decided to open the challenge to these readers by displaying the events on the web. We are also extending the deadline accordingly to 2 March. There are 16 events in total (in two areas), four from each of the four LEP experiments, and they include examples of different particle decays observed at LEP during its 11 years of operation. The list below indicates the decay channels represented. We are offering a prize of the ATLAS pop-up book, Voyage to the Heart of Matter, for the correct identification of all 16 events.  Entries should indicate the table number corresponding to each of the decays listed. There wi...

  13. A coffee-time challenge

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    Can you tell a Z from a WW? The Bulletin is offering a prize for deciphering LEP events on show in Restaurant No. 1.   If you’ve been to the coffee areas in Restaurant 1 you’ve probably noticed the ‘LEP event’ table tops, installed for the symposium and exhibition ‘From the Proton Synchrotron to the Large Hadron Collider - 50 Years of Nobel Memories in High-Energy Physics’. There are 16 events in total (in two areas), four from each of the four LEP experiments, and they include examples of different particle decays observed at LEP during its 11 years of operation. The list below indicates the decay channels represented. We are offering a prize of the ATLAS pop-up book, ‘Voyage to the Heart of Matter’, for the correct identification of all 16 events. Entries should indicate the table number corresponding to each of the decays listed. There will be a draw on 19 January to pick the winner from entries that correctl...

  14. Spread, genetic variation and methods for the detection of Puccinia kuehnii, the causal agent of sugarcane orange rust.

    Science.gov (United States)

    Sugarcane is susceptible to infection by two rust pathogens, Puccinia melanocephala and P. kuehnii, causing brown and orange rust, respectively. Orange rust of sugarcane was first reported in the Western hemisphere in Florida in July 2007. The pathogen was found to be distributed widely throughout t...

  15. Coffee consumption and risk of colorectal cancer.

    Science.gov (United States)

    Bidel, S; Hu, G; Jousilahti, P; Antikainen, R; Pukkala, E; Hakulinen, T; Tuomilehto, J

    2010-09-01

    The possible association between coffee consumption and risk of colorectal cancer has been extensively studied in the many populations. The aim of this study is to examine this relationship among Finns, who are the heaviest coffee consumers in the world. A total of 60 041 Finnish men and women who were 26-74 years of age and without history of any cancer at baseline were included in the present analyses. Their coffee consumption and other study characteristics were determined at baseline, and they were prospectively followed up for onset of colon and rectal cancer, emigration, death or until 30 June 2006. During a mean follow-up period of 18 years, 538 cases of colorectal cancer (304 cases of colon cancer and 234 cases of rectal cancer) were diagnosed. The multivariate-adjusted hazard ratio of colorectal cancer incidence for > or =10 cups of coffee per day compared with non-drinkers was 0.98 (95% CI, 0.47-2.03) for men (P for trend=0.86), 1.24 (95% CI, 0.49-3.14) for women (p for trend=0.83) and 1.03 (95% CI, 0.58-1.83) for men and women combined (P for trend=0.61). In this study, we found no association between coffee consumption and the risk of colorectal, colon and rectal cancer.

  16. Roasting Effects on Formation Mechanisms of Coffee Brew Melanoidins

    NARCIS (Netherlands)

    Bekedam, E.K.; Loots, M.J.; Schols, H.A.; Boekel, van M.A.J.S.; Smit, G.

    2008-01-01

    The effect of the roasting degree on coffee brew melanoidin properties and formation mechanisms was studied. Coffee brew fractions differing in molecular weight (Mw) were isolated from green and light-, medium-, and dark-roasted coffee beans. Isolated fractions were characterized for their

  17. Population dynamics and distribution of the coffee berry borer ...

    African Journals Online (AJOL)

    Population dynamics and distribution of coffee berry borer, Hypothenemus hampei (Ferrari) (Coleoptera: Scolytidae) were studied on Coffea arabica L. in southwestern region of Ethiopia. Thirty coffee trees were sampled at weekly intervals from 2000 to 2001. Findings of this study showed that coffee berry borer population ...

  18. The structural changes in the Mexican coffee sector

    NARCIS (Netherlands)

    Padron, Benigno Rodriguez; Burger, Kees

    2015-01-01

    This paper analyses the structural changes which have been present since the economic clauses of the International Coffee Agreements have no longer been in effect. It studies the elements that modified the coffee policy over time. It also investigates the main characteristics of the entire coffee

  19. Diversification and Labor Market Effects of the Mexican Coffee Crisis

    NARCIS (Netherlands)

    Rodriguez Padron, B.; Burger, C.P.J.

    2015-01-01

    This paper analyses how coffee-producing households responded to the low coffee prices prevailing around 2003. We provide theory on differential responses in regions dedicated to coffee growing, compared to more diversified or better accessible regions. We show how labor market effects can explain

  20. Correlation between caffeine contents of green coffee beans and ...

    African Journals Online (AJOL)

    A moderate negative correlation (R = 0.5463) was found between the caffeine contents of green coffee beans and the altitudes at which the coffee plants were grown. The caffeine contents of 9 of the green coffee bean samples analyzed by high performance liquid chromatography (HPLC) provided comparable results in the ...

  1. Color stability of restorative materials in response to Arabic coffee, Turkish coffee and Nescafe.

    Science.gov (United States)

    Al-Samadani, Khalid H

    2013-07-01

    To evaluate the effect of Arabic coffee, Turkish coffee and Nescafe on the color stability of four different composite resins after a period of aging time 1, 7 and 30 days. Twenty specimens from each type of tested composite resin material were prepared. Five specimens from each tested material (Z350 XT, Artist, GC and Z250) was evaluated after storage in Arabic coffee, Turkish coffee, Nescafe and distil water (control) at 37°C in a dark container for 1, 7 and 30 days. Color measurement was done using colorimeter based on the CIE L* a* b* color scale. Color differences ΔE*ab, Δb* and Δa* among specimens immersed in distil water and staining coffee beverages were evaluated overtime. Mean values were statistically analyzed with one-way analysis of variance (ANOVA), followed by Tukey test with p Nescafe except Δa*. The highest total color difference ΔE*ab after 30 days was in group A Arabic coffee (ΔE > 1.5 perceivable) and not perceivable in group B Turkish coffee and group C Nescafe. For Δb* all materials discolored toward yellowness after 30 days except Arabic coffee group which shifted from yellowness toward blueness (Δb*> 1.5 perceivable). The effect of staining beverages on the resin composite materials increases with time of aging toward yellowness and not perceivable in all groups except with Arabic coffee which had highest effect after 30 days and the discoloration shifted from yellowness to blueness perceivable.

  2. Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species

    Science.gov (United States)

    Vaz Patto, Maria Carlota; Rubiales, Diego

    2014-01-01

    Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance (NHR) responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus) and two inappropriate (U. viciae-fabae and U. lupinicolus) rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However, responses to different inappropriate rust species also showed some specificity, suggesting a combination of non-specific and specific responses underlying this legume NHR to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and NHR mechanisms to breed for broad-spectrum resistance to rust in legume species. PMID:25426128

  3. Bulked fusiform rust inocula and Fr gene interactions in loblolly pine

    Science.gov (United States)

    Fikret Isik; Henry Amerson; Saul Garcia; Ross Whetten; Steve. McKeand

    2012-01-01

    Fusiform rust disease in loblolly (Pinus taeda L.) and slash (Pinus elliottii Engelm. var elliottii) pine plantations in the southern United States causes multi-million dollar annual losses. The disease is endemic to the region. The fusiform rust fungus (Cronartium quercuum sp.

  4. Targeted introgression of stem rust Ug99 resistance from wheatgrasses into pasta and bread wheat

    Science.gov (United States)

    In the past 50 years, a number of stem rust resistance (Sr) genes have been transferred from several wheat-related grasses into durum (i.e. pasta) and bread wheat through chromosome translocations and additions. To utilize these genes for controlling the Ug99 races of the stem rust pathogen, we ini...

  5. Current and future molecular approaches to investigate the white pine blister rust pathosystem

    Science.gov (United States)

    B. A. Richardson; A. K. M. Ekramoddoulah; J.-J. Liu; M.-S. Kim; N. B. Klopfenstein

    2010-01-01

    Molecular genetics is proving to be especially useful for addressing a wide variety of research and management questions on the white pine blister rust pathosystem. White pine blister rust, caused by Cronartium ribicola, is an ideal model for studying biogeography, genetics, and evolution because: (1) it involves an introduced pathogen; (2) it includes multiple primary...

  6. Effect of orange rust on sugarcane breeding program at canal Point

    Science.gov (United States)

    Orange rust of sugarcane (Saccharum spp. hybrids), caused by Puccinia kuehnii (W. Krüger) E.J. Butler, appeared in the Western Hemisphere ten years ago. Orange rust substantially reduces yields in susceptible sugarcane genotypes. Majority of the commercial cultivars were susceptible at the time of o...

  7. Prescreening slash pine and Cronartium pedigrees for evaluation of complementary gene action in fusiform rust disease.

    Science.gov (United States)

    H.E. Stelzer; Robert L. Doudrick; Thomas L. Kubisiak; C. Dana Nelson

    1999-01-01

    Single-urediniospore cultures of the fusiform rust fungus were used to inoculate seedlings from 10 full-sib families of a five-parent slash pine diallel at two different times in 1994. The presence or absence of fusiform rust galls was recorded for each inoculated seedling at 9 months postinoculation, and percent infection levels for each family-inoculum-time...

  8. Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species

    Directory of Open Access Journals (Sweden)

    Maria Carlota eVaz Patto

    2014-11-01

    Full Text Available Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus and two inappropriate (U. viciae-fabae and U. lupinicolus rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However responses to different inappropriate rust species also showed some specificity, suggesting a combination of non specific and specific responses underlying this legume nonhost resistance to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and nonhost resistance mechanisms to breed for broad-spectrum resistance to rust in legume species.

  9. Low average blister-rust infection rates may mean high control costs

    Science.gov (United States)

    Robert Marty

    1965-01-01

    The Northeastern Forest Experiment Station, in cooperation with Federal and State forest-pest-control agencies, undertook a survey of blister-rust infection rates in the white pine region of the East during 1962 and 1963. Those engaged in blister-rust-control activities will not be surprised at the survey's results. We found that infection rates were significantly...

  10. Effect of fungicide on the development of wheat stem rust and yield ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f.sp tritici Erik. & E. Henn. is a highly destructive disease of wheat (Triticum aestivum L.). The effects of fungicide application on stem rust (Puccinia graminis tritici) epidemics and yield of three bread wheat varieties varying in reaction to the disease were studied in two major wheat ...

  11. Determining yield loss caused by brown rust in production fields of sugarcane

    Science.gov (United States)

    Infections of Puccinia melanocephala, the causal agent of brown rust, appear on Louisiana sugarcane in the spring. Disease expression is usually limited to 2 to 3 months until temperatures exceed those favorable for spore production. The affected sugarcane is harvested 4 to 6 months after rust sympt...

  12. Utilization of a major brown rust resistance gene in sugarcane breeding

    Science.gov (United States)

    Brown rust, caused by Puccinia melanocephala has had devastating effects on sugarcane (Saccharum spp.) breeding programs and on commercial production. The discovery of Bru1, a major gene conferring resistance to brown rust represented a substantial breakthrough and markers for the detection of Bru1 ...

  13. Detection, breeding, and selection of durable resistance to brown rust in sugarcane

    Science.gov (United States)

    Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane in Louisiana. The adaptability of the pathogen has repeatedly resulted in resistant cultivars becoming susceptible once they are widely grown. The frequency of the brown rust resistance gene Bru1 was low in the breedi...

  14. Screening for sugarcane brown rust in first clonal stage of the Canal Point sugarcane breeding program

    Science.gov (United States)

    Sugarcane (Saccharum spp.) brown rust (caused by Puccinia melanocephala H. & P. Sydow) was first reported in the United States in 1978 and is still one of great challenges for sugarcane production. A better understanding of sugarcane genotypic variation in response to brown rust will help optimize b...

  15. Biology and pathology of Ribes and their implications for management of white pine blister rust

    Science.gov (United States)

    P. J. Zambino

    2010-01-01

    Ribes (currants and gooseberries) are telial hosts for the introduced and invasive white pine blister rust fungus, Cronartium ribicola. Knowledge of wild and introduced Ribes helps us understand the epidemiology of blister rust on its aecial hosts, white pines, and develop disease control and management strategies. Ribes differ by species in their contribution to...

  16. Detection of wheat stem rust race RRTTF in Ecuador in 2016

    Science.gov (United States)

    Wheat stem rust is a devastating disease that has incited numerous severe epidemics resulting in extreme yield losses over the past century. Stem rust infection in plots of wheat line UC11075, known to carry the Sr38 resistance gene, was severe in February 2016 in a nursery at the Instituto Nacional...

  17. Genome-Wide Association Mapping of Crown Rust Resistance in Oat Elite Germplasm.

    Science.gov (United States)

    Klos, Kathy Esvelt; Yimer, Belayneh A; Babiker, Ebrahiem M; Beattie, Aaron D; Bonman, J Michael; Carson, Martin L; Chong, James; Harrison, Stephen A; Ibrahim, Amir M H; Kolb, Frederic L; McCartney, Curt A; McMullen, Michael; Fetch, Jennifer Mitchell; Mohammadi, Mohsen; Murphy, J Paul; Tinker, Nicholas A

    2017-07-01

    Oat crown rust, caused by f. sp. , is a major constraint to oat ( L.) production in many parts of the world. In this first comprehensive multienvironment genome-wide association map of oat crown rust, we used 2972 single-nucleotide polymorphisms (SNPs) genotyped on 631 oat lines for association mapping of quantitative trait loci (QTL). Seedling reaction to crown rust in these lines was assessed as infection type (IT) with each of 10 crown rust isolates. Adult plant reaction was assessed in the field in a total of 10 location-years as percentage severity (SV) and as infection reaction (IR) in a 0-to-1 scale. Overall, 29 SNPs on 12 linkage groups were predictive of crown rust reaction in at least one experiment at a genome-wide level of statistical significance. The QTL identified here include those in regions previously shown to be linked with seedling resistance genes , , , , , and and also with adult-plant resistance and adaptation-related QTL. In addition, QTL on linkage groups Mrg03, Mrg08, and Mrg23 were identified in regions not previously associated with crown rust resistance. Evaluation of marker genotypes in a set of crown rust differential lines supported as the identity of . The SNPs with rare alleles associated with lower disease scores may be suitable for use in marker-assisted selection of oat lines for crown rust resistance. Copyright © 2017 Crop Science Society of America.

  18. MICROCOSM STUDY OF DEGRADATION OF CHLORINATED SOLVENTS ON SYNTHETIC GREEN RUST MINERALS

    Science.gov (United States)

    Green rust minerals contain ferrous ion in their structure that can potentially serve as a chemical reductant for degradation of chlorinated solvents. Green rusts are found in zerovalent iron based permeable reactive barriers and in certain soil and sediments. Some previous labor...

  19. White pine blister rust resistance in limber pine: Evidence for a major gene

    Science.gov (United States)

    A. W. Schoettle; R. A. Sniezko; A. Kegley; K. S. Burns

    2014-01-01

    Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections...

  20. Genome-wide association study of rust traits in orchardgrass using SLAF-seq technology.

    Science.gov (United States)

    Zeng, Bing; Yan, Haidong; Liu, Xinchun; Zang, Wenjing; Zhang, Ailing; Zhou, Sifan; Huang, Linkai; Liu, Jinping

    2017-01-01

    While orchardgrass ( Dactylis glomerata L.) is a well-known perennial forage species, rust diseases cause serious reductions in the yield and quality of orchardgrass; however, genetic mechanisms of rust resistance are not well understood in orchardgrass. In this study, a genome-wide association study (GWAS) was performed using specific-locus amplified fragment sequencing (SLAF-seq) technology in orchardgrass. A total of 2,334,889 SLAF tags were generated to produce 2,309,777 SNPs. ADMIXTURE analysis revealed unstructured subpopulations for 33 accessions, indicating that this orchardgrass population could be used for association analysis. Linkage disequilibrium (LD) analysis revealed an average r 2 of 0.4 across all SNP pairs, indicating a high extent of LD in these samples. Through GWAS, a total of 4,604 SNPs were found to be significantly ( P  rust trait. The bulk analysis discovered a number of 5,211 SNPs related to rust trait. Two candidate genes, including cytochrome P450, and prolamin were implicated in disease resistance through prediction of functional genes surrounding each high-quality SNP ( P  rust traits based on GWAS analysis and bulk analysis. The large number of SNPs associated with rust traits and these two candidate genes may provide the basis for further research on rust resistance mechanisms and marker-assisted selection (MAS) for rust-resistant lineages.

  1. Resistance to white pine blister rust in Pinus flexilis and P

    Science.gov (United States)

    Anna W. Schoettle; Richard A. Sniezko; Angelia Kegley; Jerry Hill; Kelly S. Burns

    2010-01-01

    The non-native fungus Cronartium ribicola, that causes white pine blister rust (WPBR), is impacting or threatening limber pine, Pinus flexilis, and Rocky Mountain bristlecone pine, Pinus aristata. In the Southern Rockies, where the rust invasion is still expanding, we have the opportunity to be proactive and prepare the landscape for invasion. Genetic...

  2. Blister rust in North America: What we have not learned in the past 100 years

    Science.gov (United States)

    Eugene P. Van Arsdel; Brian W. Geils

    2011-01-01

    Introduction of Cronartium ribicola (white pine blister rust) greatly motivated development of tree disease control and research in America. Although foresters and pathologists have learned much in the past 100 years, more remains to learn. The most important lesson is that fear of blister rust has reduced pine regeneration more than the disease itself. Based on six...

  3. Genomic dissection of nonhost resistance to wheat stem rust in Brachypodium distachyon

    Science.gov (United States)

    Wheat stem rust caused by the fungus Puccinia graminis f.sp. tritici (Pgt) is a devastating disease that has largely been controlled for decades by the deployment of resistance genes. However, new races of this pathogen have emerged that overcome many important wheat stem rust resistance genes used ...

  4. CHEMICAL INTERACTIONS OF ARSENATE, ARSENITE, PHOSPHATE, AND SILICATE WITH IRON (II, III) HYDROXYCARBONATE GREEN RUST

    Science.gov (United States)

    Granular zerovalent iron has been proposed to be used as a medium in permeable reactive barriers (PRBs) to remove arsenic from contaminated groundwater. Iron(II, III) hydroxycarbonate green rust (carbonate green rust, or CGR) is a major corrosion product of zerovalent iron under ...

  5. Long-term changes in fusiform rust incidence in the southeastern United States

    Science.gov (United States)

    KaDonna C. Randolph; Ellis B. Cowling; Dale A. Starkey

    2015-01-01

    Fusiform rust is the most devastating disease of slash pine (Pinus elliottii) and loblolly pine (Pinus taeda) in the southeastern United States. Since the 1970s, the USDA Forest Service Forest Inventory and Analysis (FIA) Program has assessed fusiform rust incidence on its network of ground plots in 13 states across the...

  6. Wheat stem rust in South Africa: Current status and future research ...

    African Journals Online (AJOL)

    . In South Africa, stem rust caused by Puccinia graminis Pers. f. sp. tritici. Eriks. & E. Henn. (Pgt) is an important disease of wheat. Records of stem rust occurrence in South Africa date back to the late 1720's, when it was first discovered in the ...

  7. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035

    Science.gov (United States)

    Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...

  8. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    Five resistant wheat lines (KSL-2, KSL-3, KSL-5, KSL-12 and KSL-19) which were resistant in tests during 2008, 2009 and 2010 were used as parents in crosses with stem rust susceptible line CACUKE to develop genetic populations for determining the inheritance of resistance to stem rust. F3 populations were evaluated ...

  9. Analisis Customer Segment, Channels, Dan Customer Relationship Dalam Pembentukan Value Proposition Di Starbucks Coffee (Studi Kasus Pada Starbucks Coffee Indonesia)

    OpenAIRE

    Nurmanisa, Aisy; Wilopo,; Sanawiri, Brillyanes

    2016-01-01

    This research aims to understand and explain; How to Starbucks Coffee create value proposition for their customer? How to Starbucks Coffee segmented the customer, to create the value proposition? How to Starbucks Coffee build and choose the channels to grab the customer and create value proposition? How to Starbucks Coffee build a customer relationship and create value proposition from the process? .This reaserch uses primery data descriptive analysis method with fenomelogy kualitative o...

  10. Coffee intake, cardiovascular disease and allcause mortality

    DEFF Research Database (Denmark)

    Nordestgaard, Ask Tybjærg; Nordestgaard, Børge Grønne

    2016-01-01

    Background: Coffee has been associated with modestly lower risk of cardiovascular disease and all-cause mortality in meta-analyses; however, it is unclear whether these are causal associations. We tested first whether coffee intake is associated with cardiovascular disease and all-cause mortality...... observationally; second, whether genetic variations previously associated with caffeine intake are associated with coffee intake; and third, whether the genetic variations are associated with cardiovascular disease and all-cause mortality. Methods: First, we used multivariable adjusted Cox proportional hazard......- and age adjusted Cox proportional hazard regression models to examine genetic associations with cardiovascular disease and all-cause mortality in 112 509 Danes. Finally, we used sex and age-adjusted logistic regression models to examine genetic associations with ischaemic heart disease including...

  11. Physiological aspects of seedling development of coffee grown under colored screens

    International Nuclear Information System (INIS)

    Henrique, Paola de Castro; Alves, Jose Donizeti; Livramento, Darlan Einstein do; Goulart, Patricia de Fatima Pereira

    2011-01-01

    The objective of this work was to evaluate the physiological aspects of the development of coffee seedlings grown under colored screens with different spectral characteristics. Seedlings of Catucai Amarelo 2SL, in the stage known as 'orelha de onca', were arranged in a randomized block design, with five replicates, under structures individually covered with blue, white, gray, black or red screens with 50% shade. Four months after, evaluations were done for seedling growth, pigment content of the leaves, total soluble sugars and starch contents of the leaves and roots. The red screen was the most effective in promoting growth in four out of the seven studied traits: plant height, leaf area and leaf dry weight and total dry matter. For the other characteristics, there was no difference among the screens. The pigment analysis showed that, except for the gray screen, the other ones did not differ for this trait. In leaves, the red screen promoted higher levels of carbohydrates and starch. At the root, carbohydrate contents were higher under the red and black screens. Among the five screen colors, the red one was the most efficient in the production of coffee seedlings with higher vigor and quality, with outstanding carbohydrate contents and biomass. (author)

  12. Acute effects of decaffeinated coffee and the major coffee components chlorogenic acid and trigonelline on glucose tolerance

    NARCIS (Netherlands)

    van Dijk, A.E.; Olthof, M.R.; Meeuse, J.C.; Seebus, E.; Heine, R.J.; van Dam, R.M.

    2009-01-01

    OBJECTIVE - Coffee consumption has been associated with lower risk of type 2 diabetes. We evaluated the acute effects of decaffeinated coffee and the major coffee components chlorogenic acid and trigonelline on glucose tolerance. RESEARCH DESIGN AND METHODS - We conducted a randomized crossover

  13. Freezing as a treatment to prevent the spread of coffee berry borer, Hypothenemus hampei (Ferrari) (Coleoptera: Curculionidae) in coffee

    Science.gov (United States)

    Coffee berry borer, Hypothenemus hampei (Ferrari) is the most serious insect pest of coffee around the world. While it is already present in most of the world’s major coffee growing regions, it is important to delay further spread and to prevent re-introductions which might include hyperparasites or...

  14. Micro-CT unveils the secret life of the coffee berry borer (Hypothenemus hampei; Coleoptera, Curculionidae: Scolytinae) inside coffee berries

    Science.gov (United States)

    The coffee berry borer (Hypothenemus hampei (Ferrari); Coleoptera: Curculionidae: Scolytinae) is the most important insect pest of coffee worldwide, and due to the cryptic life habit of the insect inside coffee berries, effective pest management strategies have been difficult to develop. In this pap...

  15. Characterization of the rust formed on weathering steel exposed to Qinghai salt lake atmosphere

    International Nuclear Information System (INIS)

    Li, Q.X.; Wang, Z.Y.; Han, W.; Han, E.H.

    2008-01-01

    The product formed on weathering steel exposed to salt lake atmosphere for 12 months was investigated by X-ray diffraction (XRD), infrared transmission spectroscopy (IRS), scanning electron microscopy (SEM), electron probe micro analyzer (EPMA) and electrochemical techniques. The rust was mainly composed of β-FeOOH, Fe 8 (O,OH) 16 Cl 1.3 and a little γ-FeOOH. Amorphous δ-FeOOH was only on skyward surface. The rust layer suppressed anodic reaction and facilitated the cathodic reaction. The very small value of rust resistance R r in this work indicated that the rust had poor protective ability. Cl element was rich in the whole rust layer and played an important role in accelerating the corrosion of weathering steel in salt lake atmosphere

  16. Mechanical properties of the rust layer induced by impressed current method in reinforced mortar

    International Nuclear Information System (INIS)

    Care, S.; Nguyen, Q.T.; L'Hostis, V.; Berthaud, Y.

    2008-01-01

    This paper describes the mechanical effects of rust layer formed in reinforced mortar through accelerated tests of corrosion. The morphological and physico-chemical properties (composition, structures) of the corrosion system were characterized at different stages by using optical microscope and scanning electron microscope coupled with energy dispersive spectroscopy. The corrosion pattern was mainly characterized by a rust layer confined at the interface between the steel and the mortar. Expansion coefficient of rust products was determined from the rust thickness and the Faraday's law. Furthermore, in order to understand the mechanical effects of corrosion on the damage of mortar, displacement field measurements were obtained by using digital image correlation. An analytical model (hollow cylinder subjected to inner and outer pressures) was used with a set of experimental data to deduce the time of cracking and the order of magnitude of the mechanical properties of the rust layer

  17. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate.

    Science.gov (United States)

    Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A

    2015-12-01

    Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  18. Briu: A Coffee Roasting Startup

    OpenAIRE

    Beck, Maximilian

    2015-01-01

    The purpose of this study is to examine the German coffee market and its appropriateness as a new market to enter for the startup Company Briu. The company has been continuously growing since its initial start. The Chilean Coffee startup has since then looked for new markets opportunities in Europe. Their favored market is Germany. The research conducted in this paper is supposed to reveal the market its suitability for the company its expansion. The following key areas are assessed in order ...

  19. BUSINESS DEVELOPMENT STRATEGY FOR SPECIALTY COFFEE

    Directory of Open Access Journals (Sweden)

    Vharessa Aknesia

    2015-01-01

    Full Text Available Specialty coffee is a coffee of premium quality that has been made through various stages of post-harvest processing and strictly controlled to produce distinctive taste of origins. PT Sinar Mayang Lestari is one of the companies that currently produce and develop specialty coffee type, Arabica Java Preanger. The objectives of the study are to examine competitive advantages and develop an alternative strategy that need to be done by PT Sinar Mayang Lestari for their business development. The research methods used are value chain analysis and VRIO framework to explore competitive advantage owned by the company. The result shows the company currently has a temporary competitive advantage of the technological resources and reputation. By using SWOT-AHP technique, the alternative strategies that can be done by company are as follows: 1 increasing the production of natural and honey coffee  type; 2 building coffee center in plantation site for sharing knowledge and innovation media to the farmers; 3 improving the competency of human resource in plantation, post harvest, and promoting area; 4 building management system gradually 5 forwarding integration by building roast and ground coffee business; and 6 maximizing the ability of the land and human resources through research and development.Keywords: competitive advantage, specialty coffee, SWOT-AHP, value chain, VRIOABSTRAKKopi special merupakan kopi dengan kualitas premium yang sudah melalui berbagai tahapan pengolahan pascapanen yang diawasi dengan ketat sehingga menghasilkan cita rasa yang khas sesuai dengan daerah asalnya. PT Sinar Mayang Lestari adalah salah satu perusahaan yang saatini memproduksi dan mengembangkan kopi spesial jenis Arabika Java Preanger. Tujuan dari penelitian ini adalah menganalisis keunggulan bersaing yang dimiliki dan mengembangkan alternative strategi yang perlu dilakukanoleh PT Sinar Mayang Lestari untuk pengembangan usahanya. Penelitian ini menggunakan analisis rantai

  20. Correlation between RUST assessments of fracture healing to structural and biomechanical properties.

    Science.gov (United States)

    Cooke, Margaret E; Hussein, Amira I; Lybrand, Kyle E; Wulff, Alexander; Simmons, Erin; Choi, Jeffrey H; Litrenta, Jody; Ricci, William M; Nascone, Jason W; O'Toole, Robert V; Morgan, Elise F; Gerstenfeld, Louis C; Tornetta, Paul

    2018-03-01

    Radiographic Union Score for Tibia (RUST) and modified RUST (mRUST) are radiographic tools for quantitatively evaluating fracture healing using a cortical scoring system. This tool has high intra-class correlation coefficients (ICCs); however, little evidence has evaluated the scores against the physical properties of bone healing. Closed, stabilized fractures were made in the femora of C3H/HeJ male mice (8-12 week-old) of two dietary groups: A control and a phosphate restricted diet group. Micro-computed tomography (µCT) and torsion testing were carried out at post-operative days (POD) 14, 21, 35, and 42 (n = 10-16) per group time-point. Anteroposterior and lateral radiographic views were constructed from the µCT scans and scored by five raters. The raters also indicated if the fracture were healed. ICCs were 0.71 (mRUST) and 0.63 (RUST). Both RUST scores were positively correlated with callus bone mineral density (BMD) (r = 0.85 and 0.80, p RUST scores positively correlated with callus strength (r = 0.35 and 0.26, p RUST ≥10 and had excellent relationship to structural and biomechanical metrics. Effect of delayed healing due to phosphate dietary restrictions was found at later time points with all mechanical properties (p RUST scores (p > 0.318). Clinical relevance of this study is both RUST scores showed high correlation to physical properties of healing and generally distinguished healed vs. non-healed fractures. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:945-953, 2018. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.