Validation of WIMS-AECL/(MULTICELL)/RFSP system by the results of phase-B test at Wolsung-II unit

Energy Technology Data Exchange (ETDEWEB)

Hong, In Seob; Min, Byung Joo; Suk, Ho Chun [Korea Atomic Energy Research Institute, Taejon (Korea)

1999-03-01

The object of this study is the validation of WIMS-AECL lattice code which has been proposed for the substitution of POWDERPUFS-V(PPV) code. For the validation of this code, WIMS-AECL/(MULTICELL)/RFSP (lattice calculation/(incremental cross section calculation)/core calculation) code system has been used for the Post-Simulation of Phase-B physics Test at Wolsung-II unit. This code system had been used for the Wolsong-I and Point Lepraeu reactors, but after a few modifications of WIMS-AECL input values for Wolsong-II, the results of WIMS-AECL/RFSP code calculations are much improved to those of the old ones. Most of the results show good estimation except moderator temperature coefficient test. And the verification of this result must be done, which is one of the further work. 6 figs., 15 tabs. (Author)

AECL present and future

International Nuclear Information System (INIS)

Foster, J.S.

The history and present activities of the Crown corporation AECL are described. AECL owns limited interests in nuclear power plants and a Manitoba transmission system. AECL is the world's foremost producer of heavy water, and exports CANDU type reactors and radiation processing equipment. AECL backs up the Canadian nuclear power program wherever there is no conflict with private enterprise. (E.C.B.)

The Y2K program for scientific-analysis computer programs at AECL

International Nuclear Information System (INIS)

Popovic, J.; Gaver, C.; Chapman, D.

1999-01-01

The evaluation of scientific-analysis computer programs for year-2000 compliance is part of AECL' s year-2000 (Y2K) initiative, which addresses both the infrastructure systems at AECL and AECL's products and services. This paper describes the Y2K-compliance program for scientific-analysis computer codes. This program involves the integrated evaluation of the computer hardware, middleware, and third-party software in addition to the scientific codes developed in-house. The project involves several steps: the assessment of the scientific computer programs for Y2K compliance, performing any required corrective actions, porting the programs to Y2K-compliant platforms, and verification of the programs after porting. Some programs or program versions, deemed no longer required in the year 2000 and beyond, will be retired and archived. (author)

The Y2K program for scientific-analysis computer programs at AECL

International Nuclear Information System (INIS)

Popovic, J.; Gaver, C.; Chapman, D.

1999-01-01

The evaluation of scientific analysis computer programs for year-2000 compliance is part of AECL's year-2000 (Y2K) initiative, which addresses both the infrastructure systems at AECL and AECL's products and services. This paper describes the Y2K-compliance program for scientific-analysis computer codes. This program involves the integrated evaluation of the computer hardware, middleware, and third-party software in addition to the scientific codes developed in-house. The project involves several steps: the assessment of the scientific computer programs for Y2K compliance, performing any required corrective actions, porting the programs to Y2K-compliant platforms, and verification of the programs after porting. Some programs or program versions, deemed no longer required in the year 2000 and beyond, will be retired and archived. (author)

IFA proof of principle experiments

International Nuclear Information System (INIS)

Olson, C.L.

1979-01-01

IFA proof of principle experiments is discussed. Controlled beam front motion experiments are reported, which demonstrate that accurate IFA programming of the motion of the potential well at the head of an IREB has been achieved. The status of IFA ion experiments is also discussed

Fission gas release behavior of MOX fuels under simulated daily-load-follow operation condition. IFA-554/555 test evaluation with FASTGRASS code

International Nuclear Information System (INIS)

Ikusawa, Yoshihisa; Ozawa, Takayuki

2008-03-01

IFA-554/555 load-follow tests were performed in HALDEN reactor (HBWR) to study the MOX fuel behavior under the daily-load-follow operation condition in the framework of ATR-MOX fuel development in JAEA. IFA-554/555 rig had the instruments of rod inner pressure, fuel center temperature, fuel stack elongation, and cladding elongation. Although the daily-load-follow operation in nuclear power plant is one of the available options for economical improvement, the power change in a short period in this operation causes the change of thermal and mechanical irradiation conditions. In this report, FP gas release behavior of MOX fuel rod was evaluated under the daily-load-follow operation condition with the examination data from IFA-554/555 by using the computation code 'FASTGRASS'. From the computation results of FASTGRASS code which could compute the FP gas release behavior under the transient condition, it could be concluded that FP gas was released due to the relaxation of fuel pellet inner stress and pellet temperature increase, which were caused by the cyclic power change during the daily-load-follow operation. In addition, since the amount of released FP gas decreased during the steady operation after the daily-load-follow, it could be mentioned that the total of FP gas release at the end of life with the daily-load-follow is not so much different from that without the daily-load-follow. (author)

Ifa Divination Trays from Isale-Oyo

OpenAIRE

Pogoson, O. I.; Akande, A. O.

2016-01-01

This paper is a study of the images and patterns on ifa divination trays from Isale-Oyo. The paper also explains some ifa paraphernalia. The paper establishes that ifa trays from Isale-Oyo bear distinctive features when compared with other ifa trays in Yorubaland such as those of Ijebu and Osogbo. Central to this study is the iconographic description and interpretations of Isale-Oyo divination trays. Data were collected through direct interviews with divination tray owners. Photographs of ...

Validation of MCNP and WIMS-AECL/DRAGON/RFSP for ACR-1000 applications

International Nuclear Information System (INIS)

Bromley, Blair P.; Adams, Fred P.; Zeller, Michael B.; Watts, David G.; Shukhman, Boris V.; Pencer, Jeremy

2008-01-01

This paper gives a summary of the validation of the reactor physics codes WIMS-AECL, DRAGON, RFSP and MCNP5, which are being used in the design, operation, and safety analysis of the ACR-1000 R . The standards and guidelines being followed for code validation of the suite are established in CSA Standard N286.7-99 and ANS Standard ANS-19.3-2005. These codes are being validated for the calculation of key output parameters associated with various reactor physics phenomena of importance during normal operations and postulated accident conditions in an ACR-1000 reactor. Experimental data from a variety of sources are being used for validation. The bulk of the validation data is from critical experiments in the ZED-2 research reactor with ACR-type lattices. To supplement and complement ZED-2 data, qualified and applicable data are being taken from other power and research reactors, such as existing CANDU R units, FUGEN, NRU and SPERT research reactors, and the DCA critical facility. MCNP simulations of the ACR-1000 are also being used for validating WIMS-AECL/ DRAGON/RFSP, which involves extending the validation results for MCNP through the assistance of TSUNAMI analyses. Code validation against commissioning data in the first-build ACR-1000 will be confirmatory. The code validation is establishing the biases and uncertainties in the calculations of the WIMS-AECL/DRAGON/RFSP suite for the evaluation of various key parameters of importance in the reactor physics analysis of the ACR-1000. (authors)

Modelization Post-test experiment IFA-650.10 HALDEN with FRAP series codes; Modelizacion post-test del experimento HALDEN IFA-650.10 con los codigos de la serie FRAP

Energy Technology Data Exchange (ETDEWEB)

Vallejo, I.; Herranz, L. E.

2013-07-01

There is a need to review the criteria for security relating to LOCA accidents , including the effect of different materials of pod, as well as conditions of high burned as fuel. In this work is modeled with code FRAPTRAN-1.4 the IFA-650.10 experiment executed in the experimental reactor HALDEN. It is an approximation to the thermo-hydraulic rod-refrigerant and the results are compared with experimental measurements. The thermal behavior shows good agreement with the experimental measures; mechanical parameters are observed light quality deviations in pod and very good quantitative agreement in the maximum elongation; the diameter calculated at the end of the simulation above - predicts the post-irradiation values and oxide presents a good deal.

SUMMARY OF CHARACTERISATION DATA ON CLADDING MATERIALS USED IN THE CORROSION TEST IFA-638 AND IN THE CREEP TEST IFA-617

International Nuclear Information System (INIS)

Nakata, M.; Hauso, E.

1998-10-01

Modern PWR cladding materials are being tested in two joint programme tests; the cladding corrosion test IFA-638 and in the creep test IFA-617. The materials for the two tests, have been provided by four organisations: ABB-Atom, ENUSA, Framatome and Mitsubishi Heavy Industries. This report gives an overview of the different materials being tested as fuelled test rods and unfuelled cladding coupons in IFA-638. For IFA-638, cladding has been used for fabrication of both fresh and pre-irradiated test rods. The coupon materials, all in the unirradiated condition, comprise a range of alloys of different chemical composition, heat treatment, pre-filming and /or pre-hydriding treatment. Four pre-irradiated cladding materials of the same type of those used in IFA-638, have also been used to prepare the four fuelled subsegments that are being studied in the creep rig IFA-617. All currently available information related to the IFA-638 and IFA-617 material characterisation and properties are summarised in this report. (author)

AECL's new environmental initiatives

International Nuclear Information System (INIS)

McDonnell, F.N.

1993-01-01

AECL's research and development expenditures in environmental sciences and waste management technology are about $50 M per year. The main focus of these programs is the Nuclear Fuel Waste Management Program. This research is supplemented by activities in support of laboratory, Environmental Authority and internal waste management requirements, as well as provision of non-nuclear services. AECL intends to become more involved in performing environmental research and development with broader application. The goal is to achieve a relationship with Canadian industry that would involve a substantial portion of AECL's environmental research capabilities. The research directions and priorities of the resulting partnership would be set by the private sector in accordance with their needs and requirements. It is expected that the activities associated with this new environmental initiative will start small and grow in response to perceived needs. AECL is now increasing its non-nuclear research efforts by targeting those markets that appear most attractive. The thrust can be divided into three broad categories: environmental research, environmental services, and environmental products. (Author)

Gas Flow Measurements On IFA-504 And IFA-6 10.1

International Nuclear Information System (INIS)

Braaten, Knut; Sandberg, Rune V.

1997-12-01

This report covers the recent axial gas flow measurements performed in the Halden reactor on IFA-504 and IFA-610.1. The measurements are performed during hot standby and at power. Gas flow measurements have been performed at regular intervals on the three rods with solid pellets in IFA-504, which has reached a burnup of about 68 MWd/kgUO 2 . The measurements show, as earlier, a decrease in the hydraulic diameters, where rod number 2 has a smaller hydraulic diameter than rod number 1 and 3. Rod 1, 2 and 3 have, at the end of -97, hydraulic diameters of 9, 2.5 and 9.5 jim respectively at full power (15 kW/m). IFA-610.1 was loaded into the core in July-97 with a pre-irradiated segment, and has as of December -97 a burnup of 54 MWd/kgUO 2 . The primary objective of this rig was to perform a 'lift off' experiment where internal pressurisation of the test rod should provoke cladding creep out which would also cause an increase in the flow area. The fuel rod was pressurised to 300 bar overpressure, by steps of 50 bar. The results show an increase in the pellet-clad hydraulic diameter of 4-5 mm that occurred upon pressurisation from 0 to 200 bar overpressure. There was no sign of any further increase in the hydraulic diameter after pressurisation to 300 bar for one week. The operation with 300 bar overpressure will be continued. (author)

Final report of the AECL/SKB Cigar Lake analog study. AECL research No. AECL-10851

Energy Technology Data Exchange (ETDEWEB)

Cramer, J J; Smellie, J A.T. [eds.

1994-07-15

AECL has conducted natural analog studies on the Cigar Lake uranium deposit in northern Saskatchewan since 1984 as part of the Canadian Nuclear Fuel Waste Management Program. This report provides background information and summarizes the results of the study, emphasizing the analog aspects and the implications of modelling activities related to the performance assessment of disposal concepts for nuclear fuel wastes developed in both Canada and Sweden. The study was undertaken to obtain an understanding of the process involved in, and the effects of, steady-state water-rock interaction and trace-element migration in and around the deposit, including paleo-migration processes since the deposit was formed. To achieve these objectives, databases and models were produced to evaluate the equilibrium thermodynamic codes and databases; the role of colloids, organics, and microbes in transport processes for radionuclides; and the stability of UO2 and the influence of radiolysis on UO2 dissolution and radionuclide migration.

Development of advanced ceramics at AECL

International Nuclear Information System (INIS)

Palmer, B.J.F.; MacEwen, S.R.; Sawicka, B.D.; Hayward, P.J.; Sridhar, S.

1986-12-01

Atomic Energy of Canada Limited (AECL) has a long history of developing ceramics for nuclear fission and fusion applications. AECL is now applying its multidisciplinary materials R and D capabilities, including unique capabilities in ceramic processing and nondestructive evaluation, to develop advanced ceramic materials for commercial and industrial applications. This report provides an overview of the facilities and programs associated with the development of advanced ceramics at AECL

Compendium of the data used with the SYVAC3-CC3 system model. AECL research No. AECL-11013

Energy Technology Data Exchange (ETDEWEB)

NONE

1994-12-31

AECL is evaluating a concept for disposing of nuclear fuel waste from CANDU reactors deep in plutonic rock of the Canadian Shield. As part of this evaluation, models of the physical, chemical, geological, and biological processes that could occur in a sealed disposal vault designed to limit transport of contaminants to the accessible environment were developed. The mathematical models of the transport of radionuclides and toxic chemicals from nuclear fuel waste are incorporated into a computer model named the Systems Variability Analysis Code, Generation 3, and Canadian Concept Model, Generation 3 (SYVAC3-CC3). The report presents the data in the master database used by SYVAC3-CC3 for the postclosure assessment of deep geological disposal, derived from a major program of laboratory and field studies conducted by AECL Research over the past 15 years. The data represents characteristics of a hypothetical vault, certain geologic characteristics of the Whiteshell Research Area, and a general surface environment with a human population living a rural lifestyle on a portion of the Canadian Shield in central Canada.

AECL annual review 1991-1992

International Nuclear Information System (INIS)

1992-01-01

Formed as a Crown Corporation in 1952, AECL consists of two main divisions: AECL CANDU, based in Missisauga and Montreal, responsible for the development, design, marketing and project management of CANDU nuclear power projects; and AECL Research, with its head office in Ottawa and laboratories in Chalk River, Ontario and Pinawa, Manitoba, which supports CANDU and performs the research, development, demonstration and marketing required to apply nuclear sciences and their associated technologies. A strategic plan is under development, which will address the issues of market identification, key partnerships, securing the CANDU technology base, export financing and optimum business structure. In 1991/92 operating income was $16.4 million, up from $7.8 million in 1990/91. Good progress was made on goals to revitalize and upgrade AECL employee's skills and productivity. Key goals for AECL CANDU were: launching the Wolsung 2 reactor project in south Korea; closing the timing and product options for Wolsong 3 and 4; securing new business for Cernavoda 1; and attaining an agreement with either Saskatchewan Power Corp. or the New Brunswick Electric Power Commission regarding the timing of their CANDU 3 projects. Some success was achieved in the first three goals; Saskatchewan has chosen not to proceed with its CANDU 3 plant, but negotiations are continuing in New Brunswick. Key goals for AECL Research were: securing an advanced CANDU research and development program outside the CANDU Owners Group; Disposing of remaining non-nuclear technologies by spin-off, licensing or close-out; rationalizing commercial operations to generate increased revenues; and obtaining the Atomic Energy Control Board's approval of the NRU reactor assessment basis document. Progress was made on all goals

Beginning-of-Life Data Report for the Instrumented Fuel Assembly (IFA)-527

Energy Technology Data Exchange (ETDEWEB)

Lanning, D. D.

1981-09-01

This report presents beginning-of-life (BOL) data from the first four months of operation of the six-rod instrumented fuel assembly (IFA)-527 in the Halden Boiling Water Reactor (HBWR), Halden, Norway. This assembly is the last in a series of U.S. Nuclear Regulatory Commission (NRC)-sponsored tests to verify steady-state fuel performance computer codes. IFA-527 contains five identical rods with high-density stable fuel pellets and 0.23-mm diametral gaps and one rod with similar fuel pellets but with a 0.06-mm diametral gap. All six rods were xenon-filled to provide simulation of the effects of fission gas and to enhance the observable effects of fuel cracking and relocation on fuel temperatures. The assembly operated successfully from July 1, 1980, to August 15, 1980; and then the reactor was shut down until September 10, 1980. Sometime during the shutdown, four of the six rods suffered pressure boundary failure. The decision was made to restart the reactor to collect operating data with failed rods. This report presents both pre- and postfailure data for IFA-527.

USNRC-OECD Halden Project fuel behavior test program: experiment data report for test assemblies IFA-226 and IFA 239

International Nuclear Information System (INIS)

Laats, E.T.; MacDonald, P.E.; Quapp, W.J.

1975-12-01

The experimental data which were obtained from the IFA-226 and IFA-239 test assemblies during operation in the Halden Boiling Water Reactor are reported. Included are cladding elongation, fuel centerline temperature, internal gas pressure, and power history data from IFA-226 which were obtained from November 1971 through April 1974, and cladding elongation, diametral profile, and power history data from IFA-239 covering the period from March 1973 through April 1974. The data, presented in the form of composite graphs, have been analyzed only to the extent necessary to assure that they are reasonable and correct. A description of these mixed oxide fuel test assemblies and their instrumentation is presented. Test pin fabrication history, instrument calibration data, assembly power calibration methods, and the neutron detector data reduction technique are included as appendices

Ifa Divination Trays from Isale-Oyo

Directory of Open Access Journals (Sweden)

O. I. Pogoson

2011-10-01

Full Text Available This paper is a study of the images and patterns on ifa divination trays from Isale-Oyo. The paper also explains some ifa paraphernalia. The paper establishes that ifa trays from Isale-Oyo bear distinctive features when compared with other ifa trays in Yorubaland such as those of Ijebu and Osogbo. Central to this study is the iconographic description and interpretations of Isale-Oyo divination trays. Data were collected through direct interviews with divination tray owners. Photographs of the trays were also taken. The investigation revealed that:Divination trays from Isale-Oyo combine features found on both Ijebu and Osogbo trays.The Esu figure continues to occupy the top central position on Oyo divination trays, even though with representational variations elsewhere in Yorubaland.Some divination trays in Oyo carry no decorations on their borders, and in some recent cases, ceramic plates are now used for divination.Este artigo trata dos padrões e imagens dos tabuleiros de adivinhação ifa usados em Isale-Oyo (Nigéria, bem como de outros objectos religiosos associados. Argumenta-se que os tabuleiros ifa de Isale-Oyo têm características que os distinguem de outros tabuleiros ifa da região yoruba, como os de Ijebu e Osogbo. A descrição e a interpretação da iconografia dos tabuleiros de adivinhação constituem o foco deste estudo. Os dados discutidos foram recolhidos através de entrevistas a proprietários de tabuleiros de adivinhação e fotografias de tabuleiros. Conclui-se que:Os tabuleiros de adivinhação de Isale-Oyo combinam traços dos tabuleiros de Ijebu e dos tabuleiros de Osogbo.A figura de Esu continua a ocupar a posição central superior nos tabuleiros de adivinhação de Oyo, embora se registem variações na sua representação noutras zonas do território yoruba.Alguns tabuleiros de adivinhação de Oyo não possuem qualquer decoração nos frisos, e nalguns casos recentes vêm sendo utilizados na adivinhação pratos

AECL annual review 1992 - 1993

International Nuclear Information System (INIS)

1993-01-01

1992/93 was a pivotal year for AECL, with the redirection of its strategic plan, the refocussing of its corporate mission, a change in its structural organization to meet new challenges, the contract with South Korea for Wolsong Units 3 and 4 and the Memorandum of Understanding with Saskatchewan. AECL looks forward to the next 12 months as a time of opportunity, confident in the knowledge that they possess the means to succeed. ills

AECL annual review 1992 - 1993

Energy Technology Data Exchange (ETDEWEB)

NONE

1994-12-31

1992/93 was a pivotal year for AECL, with the redirection of its strategic plan, the refocussing of its corporate mission, a change in its structural organization to meet new challenges, the contract with South Korea for Wolsong Units 3 and 4 and the Memorandum of Understanding with Saskatchewan. AECL looks forward to the next 12 months as a time of opportunity, confident in the knowledge that they possess the means to succeed. ills.

WIMS-AECL/RFSP code validation of reactivity calculations following a long shutdown using the simple-cell history-based method

International Nuclear Information System (INIS)

Ardeshiri, F.; Donnelly, J.V.; Arsenault, B.

1998-01-01

The purpose of this analysis is to validate the Reactor Fuelling Simulation Program (RFSP) using the simple-cell model (SCM) history-based method in a startup simulation following a reactor shutdown period. This study is part of the validation work for history-based calculations, using the WIMS-AECL code with the ENDF/B-V library, and the SCM linked to the RFSP code. In this work, the RFSP code with the SCM history-based method was used to track a 1-year period of the Point Lepreau reactor operating history, that included a 12-day reactor shutdown and subsequent startup. Measured boron and gadolinium concentrations were used in the RFSP simulations, and the predicted values of core reactivity were compared to the reference (pre-shutdown) value. The discrepancies in core reactivity are shown to be better than ±2 milli-k at any time, and better than about ±0.5 milli-k towards the end of the startup transient. The results of this analysis also show that the calculated maximum channel and bundle powers are within an acceptable range during both the core-follow and the reactor startup simulations. (author)

Hydrogen recombiner development at AECL

International Nuclear Information System (INIS)

Dewit, W.A.; Koroll, G.W.; Loesel Sitar, J.; Graham, W.R.C.

1997-01-01

Catalytic recombiners have been developed at AECL for the purpose of hydrogen removal in post-accident nuclear containment buildings. The recombiners are based on a particular catalyst designed by AECL which has extraordinary resistance to fouling from water and water vapour and a large thermodynamic range of operation. The catalysts were developed, originally, for the purpose of heavy water manufacturing by way of a catalytic exchange process. Application of these catalyst materials in recombiners for containment applications began in the late 1980's. The first application was a passive recombiner, qualified for use in control of radiolytic hydrogen in the headspace of a pool-type experimental reactor of AECL design in 1988. The passive, or natural convection recombiner concept has continued development to commercial stage for application in power reactor containments. This paper reviews the AECL recombiner development, describes the current model and shows results from tests of full-scale recombiners in the Large Scale Vented Combustion Test Facility at AECL-WL. The AECL recombiner is designed for compactness and ease of engineering into containment. The design is a simple, open-ended rectangular enclosure with catalyst elements arranged inside to promote optimum convective flow driven by heat of recombination at the catalyst surface. Self start, as evidenced by catalyst heating and initiation of flow, is achieved in less than 1% hydrogen, with available oxygen, at room temperature and 100% relative humidity. This low temperature start-up in condensing atmospheres is viewed as the most challenging condition for wet-proofing effectiveness. Cold start-up is a vital performance requirement in containments, such as CANDU, where engineered air-cooling systems are operating and where long-term hydrogen control is required, after containment atmospheres have cooled. Once started, the removal capacity scales linearly with the inlet cross-section area and the partial

AECL research programs in chemistry

International Nuclear Information System (INIS)

Crocker, I.H.; Eastwood, T.A.; Smith, D.R.; Stewart, R.B.; Tomlinson, M.; Torgerson, D.F.

1980-09-01

Fundamental or underlying research in chemistry is being done in AECL laboratories to further the understanding of processes involved in current nuclear energy systems and maintain an awareness of progress at the frontiers of chemical research so that new advances can be turned to advantage in future AECL endeavours. The report introduces the current research topics and describes them briefly under the following headings: radiation chemistry, isotope separation, high temperature solution chemistry, fuel reprocessing chemistry, and analytical chemistry. (auth)

Post-irradiation examination of the vipac fuel assemblies IFA-104 and IFA-203, irradiated in the Halden boiling water reactor

International Nuclear Information System (INIS)

Linde, A. van der; Lucas Luyckx, H.J.B.

1976-11-01

Two seven pin assemblies, IFA-104 and IFA-203, have been irradiated in the Halding Boiling Water Reactor. The Zircaloy clad pins contained vibrationally compacted, sharp edged UO 2 particles with smear densities of 84-88% theoretical density and a fuel stack length of about 1520 mm. The IFA-104 pins operated satisfactorily during approximately 240 effective full power days at an average linear heat rating of about 340 W/cm, and a peak rating of about 480 W/cm. Ingress of water via a pressure transducer into one of the IFA-203 pins necessitated the premature termination of the irradiation after approximately 30 effective full power days at an average rating of about 460 W/cm, and a peak rating of about 550 W/cm. One IFA-104 pin and two IFA-203 pins failed early. The primary cause of these failures has been sought in the oxidation reaction of the tantalum tube which protected the W/Re thermocouples with the surrounding UO 2 or with moisture in the fuel at temperatures in excess of approximately 1700degC. The fuel centre temperature and the internal gas pressure measurements during the beginning of lifetime and the results of the post-irradiation chemical and microscopic analysis on fuel pin cross-sections have been correlated with corresponding data calculated on a Gapcon-Thermal computer programme written for pellet fuel pins. Fairly good agreement could be achieved between the measured data on the vipac pins and the calculated data of a pellet pin. During the corrosion of the Zircaloy-2 cladding of the IFA-104 pins which were autoclaved in 400degC steam prior to the irradiation, relatively large amounts of H 2 entered the cladding from the D 2 O coolant side. With 0.66 mole% H 2 O in the D 2 O the calculated hydrogen uptake preference ratio was 33

Comparison of Wims-Aecl / Dragon / RFSP and MCNP results with Zed-2 measurements for control device worth and reactor kinetics - 037

International Nuclear Information System (INIS)

Pencer, J.; Choy Wong, F.; Bromley, B.P.; Atfield, J.; Zeller, M.

2010-01-01

This paper summarizes comparisons between MCNP5 and WIMS-AECL / DRAGON / RFSP calculations and experimental results obtained from the Zero Energy Deuterium (ZED-2) critical facility at AECL Chalk River Laboratories. MCNP5 and WIMS-AECL / DRAGON / RFSP were used to calculate reactivity worths for two reactivity devices, a mechanical zone controller (MZC) and shut-off rod (SOR) in a lattice similar to that of the ACR-1000 R . WIMS-AECL / DRAGON / RFSP was also used to obtain kinetics parameters for a transient based on a rod drop of a ZED-2 standby absorber rod (SAR). ZED-2 experiments were performed using 43-element ACR Low Enriched Uranium (ACR-LEU) fuel bundles with H 2 O- or air-cooled fuel bundles arranged in a 24-cm pitch square lattice. Calculations with MCNP5 gave biases in device worths that were within 0.2 mk of measured values, while WIMS-AECL / DRAGON / RFSP gave values that were within 0.3 mk of measured values. Transient analyses using the CERBERUS module within RFSP yielded a total delayed neutron fraction (β) that was within 4% of the value derived by point kinetics analysis of experimental data. The corresponding delayed photo-neutron fraction (β photo-neutron ) from CERBERUS was within 5% of that derived by point kinetics. This study has helped quantify the agreement between calculation and measurement for codes that are used in the safety analysis of the ACR-1000 reactor. Results demonstrate good agreement in code predictions. (authors)

ZZ CANDULIB-AECL, Burnup-Dependent ORIGEN-S Cross-Section Libraries for Candu Reactor Fuels

International Nuclear Information System (INIS)

2002-01-01

1 - Historical background and information: - 28-element fuel cross-section library: Format: Designed for use with the ORIGEN-S isotope generation and depletion code. Materials: Co, Ge, As, Se, Br, Kr, Rb, Sr, Y, Zr, Nb, Mo, Tc, Ru, Rh, Pd, Ag, Cd, In, Sn, Sb, Te, I, Xe, Cs, Ba, La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Lu, Ta, W, Re, Au, Th, Pa, U, Np, Pu, Am, Cm. Origin: ENDSF, ENDF/B-IV, -V and -VI Weighting spectrum: determined using WIMS-AECL transport code. - 37-element fuel cross-section library: Format: Designed for use with the ORIGEN-S isotope generation and depletion code. Materials: Co, Ge, As, Se, Br, Kr, Rb, Sr, Y, Zr, Nb, Mo, Tc, Ru, Rh, Pd, Ag, Cd, In, Sn, Sb, Te, I, Xe, Cs, Ba, La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Lu, Ta, W, Re, Au, Th, Pa, U, Np, Pu, Am, Cm. Origin: ENDSF, ENDF/B-IV, -V and -VI Weighting spectrum: determined using WIMS-AECL transport code. In 1995, updated ORIGEN-S cross-section libraries were created as part of a program to upgrade and standardize the computer codes and nuclear data employed for used fuel characterization. This effort was funded through collaboration between Atomic Energy of Canada Limited and the Canadian Nuclear Power Utilities, under the Candu Owners Group (COG). The updated cross sections were generated using the WIMS-AECL lattice code and ENDF/B-V and -VI based data to provide cross section consistency with reactor physics codes. 2 - Application of the data: The libraries in this data collection are designed for characterising used fuel from Candu pressurized heavy water reactors. Two libraries are provided: one for the standard 28-element fuel bundle design, the other for the 37-element fuel bundle design. The libraries were generated for typical reactor operating conditions. The libraries are designed for use with the ORIGEN-S isotope generation and depletion code. 3 - Source and scope of data: The Candu libraries are updated with cross sections from a variety of different sources. Capture

Modelling of Rod No 8 in IFA-597:3

International Nuclear Information System (INIS)

Malen, K.

2002-06-01

A Westinghouse Atom 8x8 fuel rod irradiated in the Ringhals 1 BWR for 12 years to a local burnup of about 67 MWd/kgU was refabricated, instrumented with centreline thermocouple and pressure transducer, and irradiated in IFA-597.2 for about 20 days and in IFA-597.3 for about four months. The rod was then sent to Kjeller for puncturing and then to the Studsvik hot cells for detailed post-irradiation examinations. The peak centreline, temperature was close to 1350 deg C. The total fission gas release (FGR) determined from the puncturing was approximately 20 %. Electron probe microanalysis on a fuel section from the central part of the rod showed that virtually 100 % Xe release had occurred in the central part of the pellet out to about half the pellet radius, and this thermal release from the central part of the fuel accounted for the measured total FGR. Optical and scanning electron microscopy of the fuel cross-section showed complete pellet-clad bonding as well as an extensive high burnup 'rim' structure extending at least 0,15 mm in from the fuel surface. The fuel microstructure was characterised at different radial positions in the pellet. This report describes modelling of the rod behaviour using the code SKIROD, in particular fuel temperature and fission gas release. The transient response of the fuel centre line temperature after a scram is also modelled using the code TOODEE2. The modelling results are compared to the experimental results

IFPE/IFA-533, Fuel Thermal Behaviour at High Burnup, Halden Reactor

International Nuclear Information System (INIS)

Gyori, Cs.; Turnbull, J.A.

1997-01-01

Description: After twelve years irradiation in the Halden Boiling Water Reactor two fuel rods (Rod 807 and Rod 808) were re-instrumented with fuel centre thermocouples and reloaded into the reactor in order to investigate the fuel thermal behaviour at high burnup. The fuel rods were pre-irradiated with four other rods in the upper cluster of IFA-409 (IFA=Instrumented Fuel Assembly) from May 1973 to June 1985. After base irradiation the four neighbouring rods were re-instrumented with pressure transducers and ramp tested in IFA-535.5 and IFA-535.6 providing useful data about fission gas release (FGR) presented in the Fuel Performance Database as well (Ref. 1). The two rods re-instrumented with fuel centre thermocouples have been irradiated as IFA-533.2 from April 1992. As the irradiation history of IFA-533.2 in the first months was very similar to the history of the ramp tests, the fuel temperature and FGR data measured in the different IFAs can complement each other, although the fuel-cladding gap sizes were slightly different and due to re-instrumentation the internal gas conditions were also dissimilar

Thermalhydraulic analyses of AECL's spent fuel dry storage systems

International Nuclear Information System (INIS)

Moffett, R.; Sabourin, G.

1995-01-01

This paper presents the validation of one- and three-dimensional thermalhydraulic models to be used to evaluate the thermal performance of AECL's MACSTOR and CANSTOR spent fuel dry storage modules. For this purpose, we compared analytical results to results of experiments conducted at AECL's Whiteshell Laboratories where mockups of the MACSTOR module and of a CANDU fuel storage basket were tested. The paper shows improvements to a simple one-dimensional model of the MACSTOR mock-up used previously. The replacement of constant heat transfer coefficients by free convection correlations, the addition of a storage cylinder model, and the addition of a radiation heat transfer model improved the predictions of concrete and storage cylinder temperatures. The paper also presents a new three-dimensional model for flow and heat transfer in the MACSTOR mock-up developed using CFDS-FLOW3D and -RAD3D computer programs. CFDS-FLOW3D code can estimate loss coefficients in complex geometry to an accuracy better than standard engineering correlations. The flow and temperature fields predicted using CFDS-FLOW3D are consistent with the measurements made during MACSTOR mock-up experiments (author). 5 refs., 4 tabs., 9 figs

Compliance with Iron-folic acid (IFA) therapy among pregnant ...

African Journals Online (AJOL)

Compliance increased with the increase in age, birth order and single daily dose. Forgetfulness and both perceived as well as experienced side effects of IFA therapy were the important factors for non-compliance. Conclusion: There was a moderate level of Compliance towards IFA tablets with key social and demographic ...

Advancing CANDU technology AECL's Development program

International Nuclear Information System (INIS)

Torgerson, D.F.

1997-01-01

AECL has a comprehensive product development program that is advancing all aspects of CANDU technology including fuel and fuel cycles, fuel channels, heavy water and tritium technology, safety technology, components and systems, constructability, health and environment, and control and instrumentation. The technology arising from these programs is being incorporated into the CANDU design through an evolutionary process. This evolutionary process is focused on improving economics, enhancing safety and ensuring fuel cycle flexibility to secure fuel supply for the foreseeable future. This strategic thrusts are being used by CANDU designers and researchers to set priorities and goals for AECL's development activities. The goals are part of a 25-year development program that culminates in the 'CANDU X'. The 'CANDU X' is not a specific design - it is a concept that articulates our best extrapolation of what is achievable with the CANDU design over the next 25 years, and includes the advanced features arising from the R and D and engineering to be done over that time. AECL's current product, the 700 MWe class CANDU 6 and the 900 MWe class CANDU 9, both incorporate output from the development programs as the technology become available. A brief description of each development areas is given below. The paper ends with the conclusion that AECL has a clear vision of how CANDU technology and products will evolve over the next several years, and has structured a comprehensive development program to take full advantage of the inherent characteristics of heavy water reactors. (author)

AECL's waste management and decommissioning program

International Nuclear Information System (INIS)

Kupferschmidt, W.C.H.

2006-01-01

Full text: Canada has developed significant expertise in radioactive waste management since the mid 1940s, when the Canadian nuclear program commenced activities at Chalk River Laboratories (CRL). Atomic Energy of Canada Limited (AECL), created as a Federal Crown Corporation in 1952, continues to manage wastes from these early days, as well as other radioactive wastes produced by Canadian hospitals, universities, industry, and operational wastes from AECL's current programs. AECL is also carrying out decommissioning of nuclear facilities and installations in Canada, predominantly at its own sites in Ontario (CRL, and the Douglas Point and Nuclear Power Demonstration prototype reactors), Manitoba (Whiteshell Laboratories) and Quebec (Gentilly-1 prototype reactor). At the CRL site, several major waste management enabling facilities are being developed to facilitate both the near- and long-term management of radioactive wastes. For example, the Liquid Waste Transfer and Storage Project is underway to recover and process highly radioactive liquid wastes, currently stored in underground tanks that, in some cases, date back to the initial operations of the site. This project will stabilize the wastes and place them in modern, monitored storage for subsequent solidification and disposal. Another initiative, the Fuel Packaging and Storage Project, has been initiated to recover and condition degraded used fuel that is currently stored in below-ground standpipes. The fuel will be then be stored in new facilities based on an adaptation of AECL's proven MACSTOR TM * dry storage system, originally designed for intermediate-term above-ground storage of used CANDU fuel bundles. Other commercial-based development work is underway to improve the storage density of the MACSTOR TM design, and to extend its application to interim storage of used LWR fuels as well as to the storage of intermediate-level radioactive waste arising from upcoming reactor refurbishment activities in Canada

Expert panel on hydrogeology; report to AECL Research (1992)

International Nuclear Information System (INIS)

Domenico, P.A.; Grisak, G.E.; Schwartz, F.W.

1995-02-01

In 1992 AECL Research convened a panel of external hydrogeological experts consisting of P.A. Domenico, G.E. Grisak, and F.W. Schwartz, to review AECL's proposed approach to siting a geological repository in the rocks of the Canadian Shield for the safe disposal of Canada's nuclear fuel wastes. In particular the panel was asked to provide its opinion on 1) the soundness of the technical approach developed to characterize the groundwater flow systems for the purpose of selecting a location for a disposal vault, 2) the validity and effectiveness of the geological case study used to demonstrate the performance assessment methodology based on the hydrogeological conditions observed at the Whiteshell Research Area, and 3) the adequacy of the hydrogeological information that AECL proposes to use in its Environmental Impact Statement (EIS) of the disposal concept. This report presents the findings, conclusions and recommendations of the hydrogeology review panel. The report was submitted to AECL Research in 1992 December. (author). 24 refs., 2 tabs., 4 figs

Annual report 1997--1998. AECL research number AECL-11964

International Nuclear Information System (INIS)

1998-01-01

This is the Annual report of AECL, the legal name of Atomic Energy of Canada Limited. Its mandate is to undertake research into nuclear energy and to develop commercial applications for its developments. This annual report presents information on marketing and commercial operations, product development, CANDU research, waste management and nuclear sciences, environmental management and site refurbishment. A financial review is included, along with management responsibility, an Auditor's report, financial statements, a five-year financial summary, and a list of directors and locations

Qualification of FEAST 3.0 and FEAT 4.0 computer codes

International Nuclear Information System (INIS)

Xu, Z.; Lai, L.; Sim, K.-S.; Huang, F.; Wong, B.

2005-01-01

FEAST (Finite Element Analysis for Stresses) is an AECL computer code used to assess the structural integrity of the CANDU fuel element. FEAST models the thermo-elastic, thermo-elasto-plastic and creep deformations in CANDU fuel. FEAT (Finite Element Analysis for Temperature) is another AECL computer code and is used to assess the thermal integrity of fuel elements. FEAT models the steady-state and transient heat flows in CANDU fuel, under conditions such as flux depression, end flux peaking, temperature-dependent thermal conductivity, and non-uniform time-dependent boundary conditions. Both computer programs are used in design and qualification analyses of CANDU fuel. Formal qualifications (including coding verification and validation) of both codes were performed, in accordance with AECL software quality assurance (SQA) manual and procedures that are consistent with CSA N286.7-99. Validation of FEAST 3.0 shows very good agreement with independent analytical solutions or measurements. Validation of FEAT 4.0 also shows very good agreement with independent WIMS-AECL calculations, analytical solutions, ANSYS calculations and measurement. (author)

Qualification of FEAST 3.0 and FEAT 4.0 computer codes

Energy Technology Data Exchange (ETDEWEB)

Xu, Z.; Lai, L.; Sim, K.-S.; Huang, F.; Wong, B. [Atomic Energy of Canada Limited, Mississauga, Ontario (Canada)

2005-07-01

FEAST (Finite Element Analysis for Stresses) is an AECL computer code used to assess the structural integrity of the CANDU fuel element. FEAST models the thermo-elastic, thermo-elasto-plastic and creep deformations in CANDU fuel. FEAT (Finite Element Analysis for Temperature) is another AECL computer code and is used to assess the thermal integrity of fuel elements. FEAT models the steady-state and transient heat flows in CANDU fuel, under conditions such as flux depression, end flux peaking, temperature-dependent thermal conductivity, and non-uniform time-dependent boundary conditions. Both computer programs are used in design and qualification analyses of CANDU fuel. Formal qualifications (including coding verification and validation) of both codes were performed, in accordance with AECL software quality assurance (SQA) manual and procedures that are consistent with CSA N286.7-99. Validation of FEAST 3.0 shows very good agreement with independent analytical solutions or measurements. Validation of FEAT 4.0 also shows very good agreement with independent WIMS-AECL calculations, analytical solutions, ANSYS calculations and measurement. (author)

PEAR code review

International Nuclear Information System (INIS)

De Wit, R.; Jamieson, T.; Lord, M.; Lafortune, J.F.

1997-07-01

As a necessary component in the continuous improvement and refinement of methodologies employed in the nuclear industry, regulatory agencies need to periodically evaluate these processes to improve confidence in results and ensure appropriate levels of safety are being achieved. The independent and objective review of industry-standard computer codes forms an essential part of this program. To this end, this work undertakes an in-depth review of the computer code PEAR (Public Exposures from Accidental Releases), developed by Atomic Energy of Canada Limited (AECL) to assess accidental releases from CANDU reactors. PEAR is based largely on the models contained in the Canadian Standards Association (CSA) N288.2-M91. This report presents the results of a detailed technical review of the PEAR code to identify any variations from the CSA standard and other supporting documentation, verify the source code, assess the quality of numerical models and results, and identify general strengths and weaknesses of the code. The version of the code employed in this review is the one which AECL intends to use for CANDU 9 safety analyses. (author)

Irradiation Results And Analysis For IFA-651.1 and 2

International Nuclear Information System (INIS)

Lee, Byung Ho; Koo, Y. H.; Oh, J. Y.; Kim, H. S.; Sohn, D. S.

2009-08-01

The MOX fuel has been fabricated by attrition milling in cooperation with PSI. Two MOX fuels are being loaded in IFA-651 with the reference MOX fuel provided by BNFL. The MOX fuels have been irradiated in Halden reactor from June of 2000 until now and the in-pile test will be continued up to ∼ 50 MWd/kgHM for ∼ 5 calendar years. One of KAERI's MOX fuel is instrumented with ET while each of the other two rods has TF at the top end. All rods have PF at the bottom end. In addition, one KAERI's MOX fuel is instrumented with EF at the top of the fuel stack. MOX fuels have been successfully irradiated during eight cycles (2000. 6 ∼ 2005. 10), of which results have been reported already. The irradiation tests until the fourth cycle (IFA-651.1) can be summarized as follows: The densification of the MOX fuel rods shows 1∼2%, which means the densification has not been influenced by different fabrication method. On the other hand, the densification estimated by EF measurement indicates very negligible, which is much lower than values from PF. There is a fission gas release of 1 ∼ 3% during the third cycle. The fission gas release behavior at the MOX fuels is comparable to that of UO 2 fuel. The swelling estimated from PF measurement is ∼ 0.850%/10MWd/kgHM. At the end of four cycle irradiation, the IMF-2 rod was taken out for PIE. The second irradiation test of IFA-651.2 up to the eighth cycle from February 2004 to October 2005 reached the burnup of more than 40MWd/kgHM. The fuel centerline temperature was up to 1200 .deg. C. The higher linear heating rate of 250 ∼ 300 W/cm was observed due to the removing of IMF-2 rod. The fission gas release was 16% and 27% for MOX-ATT-ET and MOX-ATT-TF, respectively. The COSMOS code analyzed the in-pile data of IFA-651.1 and 2. The temperature and rod internal pressure was well simulated with the effect of thermal recovery accompanying with the significant fission gas release. Based on the irradiation test up to now, the

Barriers and enablers for iron folic acid (IFA) supplementation in pregnant women.

Science.gov (United States)

Siekmans, Kendra; Roche, Marion; Kung'u, Jacqueline K; Desrochers, Rachelle E; De-Regil, Luz Maria

2017-12-22

In order to inform large scale supplementation programme design, we review and summarize the barriers and enablers for improved coverage and utilization of iron and folic acid (IFA) supplements by pregnant women in 7 countries in Africa and Asia. Mixed methods were used to analyse IFA supplementation programmes in Afghanistan, Bangladesh, Indonesia, Ethiopia, Kenya, Nigeria, and Senegal based on formative research conducted in 2012-2013. Qualitative data from focus-group discussions and interviews with women and service providers were used for content analysis to elicit common themes on barriers and enablers at internal, external, and relational levels. Anaemia symptoms in pregnancy are well known among women and health care providers in all countries, yet many women do not feel personally at risk. Broad awareness and increased coverage of facility-based antenatal care (ANC) make it an efficient delivery channel for IFA; however, first trimester access to IFA is hindered by beliefs about when to first attend ANC and preferences for disclosing pregnancy status. Variable access and poor quality ANC services, including insufficient IFA supplies and inadequate counselling to encourage consumption, are barriers to both coverage and adherence. Community-based delivery of IFA and referral to ANC provides earlier and more frequent access and opportunities for follow-up. Improving ANC access and quality is needed to facilitate IFA supplementation during pregnancy. Community-based delivery and counselling can address problems of timely and continuous access to supplements. Renewed investment in training for service providers and effective behaviour change designs are urgently needed to achieve the desired impact. © 2018 John Wiley & Sons Ltd.

Radioactive waste management at AECL

International Nuclear Information System (INIS)

Gadsby, R.D.; Allan, C.J.

2003-01-01

AECL has maintained an active program in radioactive waste management since 1945, when the Canadian nuclear program commenced activities at the Chalk River Laboratories (CRL). Waste management activities have included operation of waste management storage and processing facilities at AECL's CRL and Whiteshell Laboratories (WL); operation of the Low Level Radioactive Waste Management Office on behalf of Natural Resources Canada to resolve historic radioactive waste problems (largely associated with radioactive ore recovery, transport and processing operations) that are the responsibility of the Federal Government; development of the concept and related technology for geological disposal of Canada's nuclear fuel waste; development of the Intrusion-Resistant Underground Structure (IRUS) disposal concept for low-level nuclear waste; development of dry storage technology for the interim storage of used fuel; and development and assessment of waste processing technology for application in CANDU nuclear power plants and at CRL and WL. Today these activities are continuing. In addition, AECL is: preparing to decommission the nuclear facilities at WL; carrying out a number of smaller decommissioning projects at CRL; putting in place projects to upgrade the low-level liquid waste processing capabilities of the CRL Waste Treatment Centre, recover and process highly active liquid wastes currently in storage, and recover, condition and improve the storage of selected fuel wastes currently stored in below-ground standpipes in the CRL waste management areas; and assessing options for additional remediation projects to improve the management of other wastes currently in storage and to address environmental contamination from past practices. (author)

Planning a new research reactor for AECL: The MAPLE-MTR concept

International Nuclear Information System (INIS)

Lee, A.G.; Lidstone, R.F.; Donnelly, J.V.

1992-01-01

AECL Research is assessing its needs and options for future irradiation research facilities. A planning team has been assembled to identify the irradiation requirements for AECL's research programs and compile options for satisfying the irradiation requirements. The planning team is formulating a set of criteria to evaluate the options and will recommend a plan for developing an appropriate research facility. Developing the MAPLE Materials Test Reactor (MAPLE-MTR) concept to satisfy AECL's irradiation requirements is one option under consideration by the planning team. AECL is undertaking this planning phase because the NRU reactor is 35 years old and many components are nearing the end of their design life. This reactor has been a versatile facility for proof testing CANDU components and fuel designs because the CANDU irradiation environment was simulated quite well. However, the CANDU design has matured and the irradiation requirements have changed. Future research programs will emphasize testing CANDU components near or beyond their design limits. To provide these irradiation conditions, the NRU reactor needs to be upgraded. Upgrading and refurbishing the NRU reactor is being considered, but the potentially large costs and regulatory uncertainties make this option very challenging. AECL is also developing the MAPLE-MTR concept as a potential replacement for the NRU reactor. The MAPLE-MTR concept starts from the recent MAPLE-X10 design and licensing experience and adapts this technology to satisfy the primary irradiation requirements of AECL's research programs. This approach should enable AECL to minimize the need for major advances in nuclear technology (e.g., fuel design, heat transfer). The preliminary considerations for developing the MAPLE-MTR concept are presented in this report. A summary of AECL's research programs is presented along with their irradiation requirements. This is followed by a description of safety criteria that need to be taken into

AECL's plant Information Technologies

International Nuclear Information System (INIS)

DeVerno, M.; Lupton, L.; Didsbury, R.; Judd, R.

1998-01-01

The competitiveness of the world-wide energy market is a continual driving force for improvements to CANDU performance and lower operating, maintenance, and administration costs. As in other industries, advanced Information Technologies (IT) are changing the way we work and conduct business. The nuclear industry is no different and there exists strong incentives to improve work processes and provide faster and more flexible access to the information needed to effectively manage and maintain nuclear plant assets. AECL has responded to these forces through the development of a vision of integrated IT systems addressing all phases of nuclear plant development and operations. This includes the initial engineering, design, and construction processes as well as support to the long-term operations and maintenance. Integral to the AECL vision is the need for cost-effective engineering and operational configuration management systems, proactive maintenance processes and systems, and advanced plant surveillance and diagnostics. This paper presents the vision and describes the integrated information systems needed to manage both the design basis and operating plant data systems to ensure the cost-effective, long-term viability of CANDU plants. (author)

AECL annual report 1996-1997

International Nuclear Information System (INIS)

1997-01-01

The 1996/1997 Annual Report of Atomic Energy of Canada Ltd. (AECL) is published and submitted to the Honourable member of parliament, Minister of Natural Resources. Included in this report are messages from marketing, commercial operations, product development, CANDU research, waste management, environmental management, financial review and copies of financial statements

AECL annual report 1996-1997

Energy Technology Data Exchange (ETDEWEB)

NONE

1997-07-01

The 1996/1997 Annual Report of Atomic Energy of Canada Ltd. (AECL) is published and submitted to the Honourable member of parliament, Minister of Natural Resources. Included in this report are messages from marketing, commercial operations, product development, CANDU research, waste management, environmental management, financial review and copies of financial statements.

The AECL study for an intense neutron - generator (technical details)

Energy Technology Data Exchange (ETDEWEB)

Bartholomew, G A; Tunnicliffe, P R

1966-07-01

The AECL study for an intense neutron-generator has been in progress for two years. Recently the scientific and technical details and the conceptual designs were compiled in a report supporting proposals addressed to AECL's Board of Directors for further work. The compilation is being issued in this form to permit further discussion of the technical aspects. However readers are asked to appreciate that it was written primarily for an AECL audience, and specifically that those chapters giving tentative information about costs, the rate of investment and similar items have been omitted or modified, many references have been made to interim internal reports in order to complete the local documentation, but these references do not imply that the reports themselves can be made generally available. (author)

The AECL study for an intense neutron - generator (technical details)

International Nuclear Information System (INIS)

Bartholomew, G.A.; Tunnicliffe, P.R.

1966-01-01

The AECL study for an intense neutron-generator has been in progress for two years. Recently the scientific and technical details and the conceptual designs were compiled in a report supporting proposals addressed to AECL's Board of Directors for further work. The compilation is being issued in this form to permit further discussion of the technical aspects. However readers are asked to appreciate that it was written primarily for an AECL audience, and specifically that those chapters giving tentative information about costs, the rate of investment and similar items have been omitted or modified, many references have been made to interim internal reports in order to complete the local documentation, but these references do not imply that the reports themselves can be made generally available. (author)

On the difference between DRAGON and WIMS-AECL calculations of the coolant void reactivity

International Nuclear Information System (INIS)

Altiparmakov, D.; Roubtsov, D.; Irish, J.D.

2009-01-01

A difference in the shape of the burnup dependence of the coolant void reactivity (CVR) has been observed between DRAGON and WIMS-AECL calculations. This paper discusses the root cause of the difference and assesses the impact on burnup and full-core reactor calculations. A Fortran procedure has been developed to run WIMS-AECL as necessary in order to mimic DRAGON burnup calculations with leakage effects included. The comparison of standard WIMS-AECL results and simulated DRAGON results demonstrated that the difference is due to different definitions of CVR. If the same CVR definition is used, then the results of both WIMS-AECL and DRAGON analyses are essentially indistinguishable. The discrepancies in the fuel composition and cell-averaged two-group cross sections that are due to differences in WIMS-AECL and DRAGON leakage treatments are insignificant. (author)

AECL's reliability and maintainability program

International Nuclear Information System (INIS)

Wolfe, W.A.; Nieuwhof, G.W.E.

1976-05-01

AECL's reliability and maintainability program for nuclear generating stations is described. How the various resources of the company are organized to design and construct stations that operate reliably and safely is shown. Reliability and maintainability includes not only special mathematically oriented techniques, but also the technical skills and organizational abilities of the company. (author)

The AECL study for an intense neutron - generator (technical details)

Energy Technology Data Exchange (ETDEWEB)

Bartholomew, G.A.; Tunnicliffe, P.R

1966-07-01

The AECL study for an intense neutron-generator has been in progress for two years. Recently the scientific and technical details and the conceptual designs were compiled in a report supporting proposals addressed to AECL's Board of Directors for further work. The compilation is being issued in this form to permit further discussion of the technical aspects. However readers are asked to appreciate that it was written primarily for an AECL audience, and specifically that those chapters giving tentative information about costs, the rate of investment and similar items have been omitted or modified, many references have been made to interim internal reports in order to complete the local documentation, but these references do not imply that the reports themselves can be made generally available. (author)

The year 2000 (Y2k) Programme at AECL

International Nuclear Information System (INIS)

Pauksens, J.; Jung, D.

1998-01-01

In the nuclear industry we make, in total, very extensive use of digital computers and equipment. While use of dates in our application may not be quite so extensive as in other businesses such as banking or insurance, dates are nonetheless employed, and are important in a variety of applications. Furthermore, date-related problems can sometimes propagate into overall system failures or computer crashes. Digital system or digital infrastructure failure can have serious potential consequences in a power plant, utility, or engineering design office. This in turn can have potential impact on public safety or the reliability of power production and delivery of electrical power to the public. A concerted effort is needed, and is underway by nuclear design organizations, and the nuclear utilities in order to identify and fix or avoid the problems in the short time that remains between now and the Year 2000. AECL have a substantial Year 2000 programme underway, addressing both the infrastructure systems at AECL, and AECL's products and services. High priority is placed, in the programme, on assisting AECL's customers with the Year 2000 issue. The programme, and some of the lesson learned to date, are described in this paper. The relationship to equipment vendors' and customers' Year 2000 programs is explained, and the importance of Year 2000 programmes conducted by the customers, to address systems and equipment which are under their control, is highlighted. (authors)

Benchmark Calculations on Halden IFA-650 LOCA Test Results

International Nuclear Information System (INIS)

Ek, Mirkka; Kekkonen, Laura; Kelppe, Seppo; Stengaard, J.O.; Josek, Radomir; Wiesenack, Wolfgang; Aounallah, Yacine; Wallin, Hannu; Grandjean, Claude; Herb, Joachim; Lerchl, Georg; Trambauer, Klaus; Sonnenburg, Heinz-Guenther; Nakajima, Tetsuo; Spykman, Gerold; Struzik, Christine

2010-01-01

through several blow-downs and heat-ups and reached peak clad temperatures of more than 1000 C. In the second run, where the rod was sufficiently pre-pressurised, ballooning and burst was obtained. The first benchmark consisted of three rounds of code calculations related to IFA-650.3: 1. Pre-test calculations: Participants were provided with information regarding the setup of the Halden LOCA test facility, data from the commissioning runs, and information about the test pin and power conditions to be applied in the execution of the test. 2. Post-test calculations I: In addition to the information from the first round, participants were provided with the in-pile results from the test. 3. Post-test calculations II, unified thermal-hydraulic boundary conditions: Calculations were repeated using a cladding temperature distribution calculated with ATHLET-CD at GRS. Since the test, when executed, did not produce the expected ballooning and fuel relocation, it was decided to continue with a second benchmark using tests 650.4 and 650.5, this time as post-test calculations. The fourth test of the series, IFA-650.4 conducted in April 2006, caused particular attention in the international nuclear community. The fuel used in the experiment had a high burnup, 92 MWd/kgU, and a low pre-test hydrogen content of about 50 ppm. The cladding burst at about 790 deg. C caused a marked temperature increase at the lower end of the segment and a decrease at the upper end, indicating that fuel relocation had occurred. Subsequent gamma scanning showed that approximately 19 cm (40%) of the fuel stack were missing from the upper part of the rod. PIE at the IFE-Kjeller hot cells corroborated this evidence of substantial fuel relocation. This report presents the results of the codes which participated in the various benchmarks. The two main parts, on benchmark I and II, each start with a brief description of the most important experimental data. Then, the code calculation results follow

AECL's strategy for decommissioning Canadian nuclear facilities

International Nuclear Information System (INIS)

Joubert, W.M.; Pare, F.E.; Pratapagiri, G.

1992-01-01

The Canadian policy on decommissioning of nuclear facilities as defined in the Atomic Energy Control Act and Regulations is administered by the Atomic Energy Control Board (AECB), a Federal Government agency. It requires that these facilities be decommissioned according to approved plans which are to be developed by the owner of the nuclear facility during its early stages of design and to be refined during its operating life. In this regulatory environment, Atomic Energy of Canada (AECL) has developed a decommissioning strategy for power stations which consists of three distinctive phases. After presenting AECL's decommissioning philosophy, its foundations are explained and it is described how it has and soon will be applied to various facilities. A brief summary is provided of the experience gained up to date on the implementation of this strategy. (author) 3 figs.; 1 tab

AECL experience in fuel channel inspection

Energy Technology Data Exchange (ETDEWEB)

Van Drunen, G. [Atomic Energy of Canada Limited, Chalk River, Ontario (Canada); Gunn, R. [Atomic Energy of Canada Limited, Mississauga, Ontario (Canada); Mayo, W.R. [Atomic Energy of Canada Limited, Chalk River, Ontario (Canada); Scott, D.A. [Atomic Energy of Canada Limited, Mississauga, Ontario (Canada)

1999-06-01

Inspection of CANDU fuel channels (FC) is performed to ensure safe and economic reactor operation. CANDU reactor FCs have features that make them a unique non-destructive testing (NDT) challenge. The thin, 4 mm pressure-tube wall means flaws down to about 0.1 mm deep must be reliably detected and characterized. This is one to two orders of magnitude smaller than is usually considered of significant concern for steel piping and pressure vessels. A second unique feature is that inspection sensors must operate in the reactor core--often within 20 cm of highly radioactive fuel. Work on inspection of CANDU reactor FCs at AECL dates back over three decades. In that time, AECL staff have provided equipment and conducted or supervised in-service inspections in about 250 FCs, in addition to over 8000 pre-service FCs. These inspections took place at every existing CANDU reactor except those in India and Romania. Early FC inspections focussed on measurement of changes in dimensions (gauging) resulting from exposure to a combination of neutrons, stress and elevated temperature. Expansion of inspection activities to include volumetric inspection (for flaws) started in the mid-1970s with the discovery of delayed hydride cracking in Pickering 3 and 4 rolled joints. Recognition of other types of flaw mechanisms in the 1980s led to further expansion in both pre-service and in-service inspections. These growing requirements, to meet regulatory as well as economic needs, led to the development of a wide spectrum of inspection technology that now includes tests for hydrogen concentration, structural integrity of core components, flaws, and dimensional change. This paper reviews current CANDU reactor FC inspection requirements. The equipment and techniques developed to satisfy these requirements are also described. The paper concludes with a discussion of work in progress in AECL aimed at providing state-of-the-art FC inspection services. (author)

DEMONSTRATION SOLIDIFICATION TESTS CONDUCTED ON RADIOACTIVELY CONTAMINATED ORGANIC LIQUIDS AT THE AECL WHITESHELL LABORATORIES

International Nuclear Information System (INIS)

Ryz, R. A.; Brunkow, W. G.; Govers, R.; Campbell, D.; Krause, D.

2002-01-01

The AECL, Whiteshell Laboratory (WL) near Pinawa Manitoba, Canada, was established in the early 1960's to carry out AECL research and development activities for higher temperature versions of the CANDU(reg s ign) reactor. The initial focus of the research program was the Whiteshell Reactor-1 (WR-1) Organic Cooled Reactor (OCR) that began operation in 1965. The OCR program was discontinued in the early 1970's in favor of the successful heavy-water-cooled CANDU system. WR-1 continued to operate until 1985 in support of AECL nuclear research programs. A consequence of the Federal government's recent program review process was AECL's business decision to discontinue research programs and operations at the Whiteshell Laboratories and to consolidate its' activities at the Chalk River Laboratories. As a result, AECL received government concurrence in 1998 to proceed to plan actions to achieve closure of WL. The planning actions now in progress address the need to safely and effectively transition the WL site from an operational state, in support of AECL's business, to a shutdown and decommissioned state that meets the regulatory requirements for a licensed nuclear site. The decommissioning program that will be required at WL is unique within AECL and Canada since it will need to address the entire research site rather than individual facilities declared redundant. Accordingly, the site nuclear facilities are being systematically placed in a safe shutdown state and planning for the decommissioning work to place the facilities in a secure monitoring and surveillance state is in progress. One aspect of the shutdown activities is to deal with the legacy of radioactively contaminated organic liquid wastes. Use of a polymer powder to solidify these organic wastes was identified as one possibility for improved interim storage of this material pending final disposition

Evaluation of AECL catalysts for hydrogen fuel-cell applications. Paper no. IGEC-1-073

International Nuclear Information System (INIS)

Li, J.; Suppiah, S.; Li, H.; Kutchcoskie, K.J.; Strikwerda, S.

2005-01-01

AECL has been engaged in the promotion of the nuclear-hydrogen economy, which envisions that hydrogen fuel cells will generate power using hydrogen as fuel produced by nuclear energy. Since AECL's catalysts developed for the production, upgrading and detritiation of heavy water are very similar to commercial fuel-cell catalysts, a program was initiated to evaluate AECL catalysts for fuel-cell applications. As a first step in this effort, a half-cell test facility was set up to characterize the performance of catalysts for hydrogen fuel cells. This paper outlines the results obtained from cathodic reduction of oxygen in a 0.5 M sulphuric acid solution on a rotating disc electrode at 65 o C. The performance of the catalysts was characterized using standard electrochemical methods including cyclic voltammetry, Voltammogram/Tafel plots and short-term stability plots. Several monometallic Pt and Pt-based bimetallic catalysts were tested and compared with a commercially available catalyst for fuel-cell applications. AECL's monometallic Pt catalysts showed comparable or better activities than commercial catalysts with similar Pt loading. An AECL Pt-based bimetallic catalyst has shown superior performance to a monometallic Pt catalyst with similar Pt loading. Evaluation of various catalyst formulations is ongoing on the half-cell facility at AECL. Further investigation of promising catalysts identified from half-cell test is also being carried out in single fuel cell on test stations under normal fuel-cell operating conditions. (author)

AECL's support to operating plants world wide

International Nuclear Information System (INIS)

Azeez, S.; Kakaria, B.K.; Hinchley, E.M.

1998-01-01

Through their operating records, CANDU reactors have established themselves as a successful and cost-effective source of electricity in Canada and abroad. They have proven to be safe, reliable and economical. A variety of factors have contributed to the enviable CANDU record, such as a sound design based on proven principles supported by effective development programs, along with dedicated plant owners committed to excellence in safely maintaining and operating their plants. Atomic Energy of Canada Limited (AECL), the CANDU designer, has continuously maintained a close relationship with owners/operators of the plants in Canada, Argentina, Romania and South Korea. AECL and the plant operators have all benefited from this strengthening relationship by sharing experience and information. CANDU plant operators have been required to respond decisively to the economic realities of downward cost pressures and deregulation. Operating, Maintenance and Administration (OM and A) costs are being given a new focus as plant owners review each cost element to improve the economic returns from their investments. Amongst the three main OM and A constituents, plant maintenance costs are the most variable and have the largest influence on effective plant operations. The correlation between effective plant maintenance and high capacity factors shows clearly the importance of proactive maintenance planning to reduce the frequency and duration of forced plant outages and their negative impacts on plant economics. This paper describes the management processes and organizational structures m AECL that support plant operations and maintenance in operating CANDU plants with cost effective products and services. (author)

A bibliography of AECL publications on reactor safety

International Nuclear Information System (INIS)

Hawley, N.J.

1979-12-01

AECL Publications on Reactor Safety in CANDU Reactors are listed in this bibliography. The listing is chronological and the accompanying index is by subject. The bibliography will be brought up to date annually. (auth)

A bibliography of AECL publications on environmental research

International Nuclear Information System (INIS)

Hawley, N.J.

1978-12-01

Publications in the open literature on environmental research performed by AECL personnel are listed chronologically with the first entry dated 1951. It is intended that the bibliography should be brought up to date yearly. (author)

AECL's participation in the commissioning of Point Lepreau generating station unit 1

International Nuclear Information System (INIS)

Chawla, S.; Singh, K.; Yerramilli, S.

1983-05-01

Support from Atomic Energy of Canada Ltd. (AECL) to Point Lepreau during the commissioning program has been in the form of: seconded staff for commissioning program management, preparation of commissioning procedures, and hands-on commissioning of several systems; analysis of test results; engineering service for problem solving and modifications; design engineering for changes and additions; procurement of urgently-needed parts and materials; technological advice; review of operational limits; interpretation of design manuals and assistance with and preparation of submissions to regulatory authorities; and development of equipment and procedures for inspection and repairs. This, together with AECL's experience in the commissioning of other 600 MWe stations, Douglas Point and Ontario Hydro stations, provides AECL with a wide range of expertise for providing operating station support services for CANDU stations

AECL strategy for surface-based investigations of potential disposal sites and the development of a geosphere model for a site

Energy Technology Data Exchange (ETDEWEB)

Whitaker, S H; Brown, A; Davison, C C; Gascoyne, M; Lodha, G S; Stevenson, D R; Thorne, G A; Tomsons, D [AECL Research, Whiteshell Labs., Pinawa, MB (Canada)

1994-05-01

The objective of this report is to summarize AECL`s strategy for surface-based geotechnical site investigations used in screening and evaluating candidate areas and candidate sites for a nuclear fuel waste repository and for the development of geosphere models of sites. The report is one of several prepared by national nuclear fuel waste management programs for the Swedish Nuclear Fuel and Waste Management Co. (SKB) to provide international background on site investigations for SKB`s R and D programme on siting.The scope of the report is limited to surface-based investigations of the geosphere, those done at surface or in boreholes drilled from surface. The report discusses AECL`s investigation strategy and the methods proposed for use in surface-based reconnaissance and detailed site investigations at potential repository sites. Site investigations done for AECL`s Underground Research Laboratory are used to illustrate the approach. The report also discusses AECL`s strategy for developing conceptual and mathematical models of geological conditions at sites and the use of these models in developing a model (Geosphere Model) for use in assessing the performance of the disposal system after a repository is closed. Models based on the site data obtained at the URL are used to illustrate the approach. Finally, the report summarizes the lessons learned from AECL`s R and D program on site investigations and mentions some recent developments in the R and D program. 120 refs, 33 figs, 7 tabs.

AECL's advanced CANDU reactor - the ACR

International Nuclear Information System (INIS)

Alizadeh, Ala; Allsop, Peter; Hedges, Ken; Hopwood, Jerry; Yu, Stephen

2003-01-01

The ACR, the next generation CANDU design, represents the next step in development of the CANDU family of designs. AECL has achieved significant incremental improvements to the mid-size CANDU 6 nuclear power plant through successive projects, both in design and in project delivery. Building on this knowledge base, AECL is continuing to adapt the CANDU design to develop the ACR. This paper summarizes the ACR design features, which include major improvements in economics, inherent safety characteristics, performance and construction methods. Aimed at producing electrical power at a capital cost significantly less than that of the current reactor designs, the ACR is an evolutionary design based on the very successful CANDU 6 reactor. The new ACR product is specifically designed to produce power at a cost competitive with other forms of power generation while achieving short construction times, improved safety, international licensability, high investor returns, and low investor risk. It achieves these targets by taking advantage of the latest advances in both pressure-tube and pressure-vessel reactor technologies and experience. The flexibility and development potential of the fuel channel approach also enables designs to be developed that address priorities identified in international long-term specification programs such as the US Department of Energy (DOE) sponsored Generation IV program and IAEA hosted INPRO program. ACR-700 can be built in 36 months with a 48 month project duration, and deliver a lifetime capacity factor in excess of 90%. Overall, the ACR design represents a balance of proven design basis and innovations to give step improvements in safety, reliability and economics. The ACR development program, now well into the detail design stage, includes parallel formal licensing in the USA and Canada. Based on the status of the ACR design and AECL's on-going experience delivering reactor projects on-time and on-budget, the first ACR could be in service by

Data report for the NRC/PNL Halden assembly IFA-431

International Nuclear Information System (INIS)

Hann, C.R.; Bradley, E.R.; Cunningham, M.E.; Lanning, D.D.; Marshall, R.K.; Williford, R.E.

1978-04-01

The report presents the in-reactor data collected from the NRC/PNL Halden Assembly IFA-431 as a part of the program entitled ''Experimental Verification of Steady State Fuel Codes,'' sponsored by the Fuel Behavior Research Branch of the USNRC. The purpose of this program is to reduce the uncertainties of calculating the thermal stored energy in an operating nuclear fuel rod. The report presents fuel centerline thermocouple readings, cladding elongation monitor readings, rod internal pressure readings, and neutron detector readings. The neutron detector readings were corrected to represent rod local powers at the thermocouple locations. These data are presented in the form of plots of the variables versus time during the irradiation period from June 1975 to February 1976. Also included are descriptions of the test rationale, assembly and rod designs, test facility, instrument array and calibration, and data processing methods. Topical reports discussing specific aspects and results of the data analysis are referenced

AECL hot-cell facilities and post-irradiation examination services

International Nuclear Information System (INIS)

Schankula, M.H.; Plaice, E.L.; Woodworth, L.G.

1998-04-01

This paper presents an overview of the post-irradiation examination (PIE) services available at AECL's hot-cell facilities (HCF). The HCFs are used primarily to provide PIE support for operating CANDU power reactors in Canada and abroad, and for the examination of experimental fuel bundles and core components irradiated in research reactors at the Chalk River Laboratories (CRL) and off-shore. A variety of examinations and analyses are performed ranging from non-destructive visual and dimensional inspections to detailed optical and scanning electron microscopic examinations. Several hot cells are dedicated to mechanical property testing of structural materials and to determine the fitness-for-service of reactor core components. Facility upgrades and the development of innovative examination techniques continue to improve AECL's PIE capabilities. (author)

AECL hot-cell facilities and post-irradiation examination services

International Nuclear Information System (INIS)

Schankula, M.H.; Plaice, E.L.; Woodworth, L.G.

1995-01-01

This paper presents an overview of the post-irradiation examination (PIE) services available at AECL's hot-cell facilities (HCF). The HCFs are used primarily to provide PIE support for operating CANDU power reactors in Canada and abroad, and for the examination of experimental fuel bundles and core components irradiated in research reactors at the Chalk River Laboratories (CRL) and off-shore. A variety of examinations and analysis are performed ranging from non-destructive visual and dimensional inspections to detailed optical and scanning electron microscopic examinations. Several hot cells are dedicated to mechanical property testing of structural materials and to determine the fitness-for-service of reactor core components. Facility upgrades and the development of innovative examination techniques continue to improve AECL's PIE capabilities. (author)

Modelling of WWER fuel rod during LOCA conditions using FEM code ANSYS

International Nuclear Information System (INIS)

Bogatyr, S. M.; Krupkin, A. V.; Kuznetsov, V. I.; Novikov, V. V.; Petrov, O. M.; Shestopalov, A. A.

2013-01-01

The report presents the results of the computer simulation of the IFA-650.6 experiment, the sixth test in Halden LOCA test project series, performed in May 18, 2007 with a pre-irradiated WWER-440 fuel with maximum burnup of 56 MWd/kgU. The thermo-mechanical analysis was fulfilled with the license finite element ANSYS code package.The calculation was carried out with the 2D axisymmetric and 3D problem definitions. Analysis of the calculational results shows that the ANSYS code can adequately simulate thermo-mechanical behavior of cladding under IFA-650.6 test conditions. (authors)

48 CFR 432.001 - Definitions.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Definitions. 432.001 Section 432.001 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING 432.001 Definitions. The agency contract finance office is the office, other...

The AECL operator companion

International Nuclear Information System (INIS)

Lupton, L.R.; Anderson, L.L.; Basso, R.A.J.

1989-11-01

As CANDU plants become more complex, and are operated under tighter constraints and for longer periods between outages, plant operations staff will have to absorb more information to correctly and rapidly respond to upsets. A development program is underway at AECL to use expert systems and interactive media tools to assist operations staff of existing and future CANDU plants. The complete system for plant information access and display, on-line advice and diagnosis, and interactive operating procedures is called the Operator Companion. A prototype, consisting of operator consoles, expert systems and simulation modules in a distributed architecture, is currently being developed to demonstrate the concepts of the Operator Companion

Dicty_cDB: SLC432 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

42 CFR 426.432 - Discovery.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false Discovery. 426.432 Section 426.432 Public Health... § 426.432 Discovery. (a) General rule. If the ALJ orders discovery, the ALJ must establish a reasonable timeframe for discovery. (b) Protective order—(1) Request for a protective order. Any party receiving a...

7 CFR 58.432 - Catalase.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Catalase. 58.432 Section 58.432 Agriculture... Material § 58.432 Catalase. The catalase preparation shall be a stable, buffered solution, neutral in pH, having a potency of not less than 100 Keil units per milliliter. The source of the catalase, its...

International standard problem (ISP) no. 41 follow up exercise: Containment iodine computer code exercise: parametric studies

Energy Technology Data Exchange (ETDEWEB)

Ball, J.; Glowa, G.; Wren, J. [Atomic Energy of Canada Limited, Chalk River, Ontario (Canada); Ewig, F. [GRS Koln (Germany); Dickenson, S. [AEAT, (United Kingdom); Billarand, Y.; Cantrel, L. [IPSN (France); Rydl, A. [NRIR (Czech Republic); Royen, J. [OECD/NEA (France)

2001-11-01

This report describes the results of the second phase of International Standard Problem (ISP) 41, an iodine behaviour code comparison exercise. The first phase of the study, which was based on a simple Radioiodine Test Facility (RTF) experiment, demonstrated that all of the iodine behaviour codes had the capability to reproduce iodine behaviour for a narrow range of conditions (single temperature, no organic impurities, controlled pH steps). The current phase, a parametric study, was designed to evaluate the sensitivity of iodine behaviour codes to boundary conditions such as pH, dose rate, temperature and initial I{sup -} concentration. The codes used in this exercise were IODE(IPSN), IODE(NRIR), IMPAIR(GRS), INSPECT(AEAT), IMOD(AECL) and LIRIC(AECL). The parametric study described in this report identified several areas of discrepancy between the various codes. In general, the codes agree regarding qualitative trends, but their predictions regarding the actual amount of volatile iodine varied considerably. The largest source of the discrepancies between code predictions appears to be their different approaches to modelling the formation and destruction of organic iodides. A recommendation arising from this exercise is that an additional code comparison exercise be performed on organic iodide formation, against data obtained front intermediate-scale studies (two RTF (AECL, Canada) and two CAIMAN facility, (IPSN, France) experiments have been chosen). This comparison will allow each of the code users to realistically evaluate and improve the organic iodide behaviour sub-models within their codes. (author)

International standard problem (ISP) no. 41 follow up exercise: Containment iodine computer code exercise: parametric studies

International Nuclear Information System (INIS)

Ball, J.; Glowa, G.; Wren, J.; Ewig, F.; Dickenson, S.; Billarand, Y.; Cantrel, L.; Rydl, A.; Royen, J.

2001-11-01

This report describes the results of the second phase of International Standard Problem (ISP) 41, an iodine behaviour code comparison exercise. The first phase of the study, which was based on a simple Radioiodine Test Facility (RTF) experiment, demonstrated that all of the iodine behaviour codes had the capability to reproduce iodine behaviour for a narrow range of conditions (single temperature, no organic impurities, controlled pH steps). The current phase, a parametric study, was designed to evaluate the sensitivity of iodine behaviour codes to boundary conditions such as pH, dose rate, temperature and initial I - concentration. The codes used in this exercise were IODE(IPSN), IODE(NRIR), IMPAIR(GRS), INSPECT(AEAT), IMOD(AECL) and LIRIC(AECL). The parametric study described in this report identified several areas of discrepancy between the various codes. In general, the codes agree regarding qualitative trends, but their predictions regarding the actual amount of volatile iodine varied considerably. The largest source of the discrepancies between code predictions appears to be their different approaches to modelling the formation and destruction of organic iodides. A recommendation arising from this exercise is that an additional code comparison exercise be performed on organic iodide formation, against data obtained front intermediate-scale studies (two RTF (AECL, Canada) and two CAIMAN facility, (IPSN, France) experiments have been chosen). This comparison will allow each of the code users to realistically evaluate and improve the organic iodide behaviour sub-models within their codes. (author)

Uso de OK-432 em crianças com linfangioma OK-432 therapy for lymphangioma in children

Directory of Open Access Journals (Sweden)

Everaldo Ruiz Jr.

2004-04-01

Full Text Available OBJETIVO: Relatar a experiência no uso do OK-432 para tratamento de linfangiomas em crianças. MÉTODOS: Estudo retrospectivo de 19 crianças com linfangioma tratadas com OK-432 no Hospital das Clínicas da Faculdade de Medicina de Ribeirão Preto - USP, durante o período de 1999 a 2003. RESULTADOS: Todos os pacientes apresentaram alguma resposta ao OK-432, 12 pacientes apresentaram regressão total, sete apresentaram regressão parcial variando de 50% a 80%. Os pacientes apresentaram febre após a aplicação da droga com duração de 2 a 10 dias. Não se observaram cicatrizes após a aplicação do OK-432. CONCLUSÕES: A droga OK-432 é segura, eficaz e pode ser utilizada como primeira escolha no tratamento de pacientes com linfangiomas devido à excelente resposta, podendo tornar desnecessária a realização de cirurgia. Em pacientes com resposta parcial, podem ser realizadas novas aplicações de OK-432 ou cirurgia menos mutilante, devido à redução das dimensões da lesão.OBJECTIVE: To report the experience with OK-432 therapy for lymphangioma in children. METHODS: Retrospective study of 19 children with lymphangioma treated with OK-432 in Ribeirão Preto, state of São Paulo, Brazil, between 1999 and 2003. RESULTS: All patients presented response to OK-432, 12 had total shrinkage and seven had partial shrinkage varying from 50% to 80%. Patients had fever after injections of OK-432 for 2 to 10 days, no damage to the overlying skin was observed. CONCLUSION: OK-432 is safe, effective and can be used as primary choice of treatment of patients with lymphangiomas because of the excellent response. In these cases surgery should not be necessary. In patients with partial regression new injections of OK-432 must be used to shrink the lesion. Thereby safely surgery could be made.

Post-irradiation data analysis for NRC/PNL Halden assembly IFA-431

International Nuclear Information System (INIS)

Nealley, C.; Lanning, D.D.; Cunningham, M.E.; Hann, C.R.

1979-10-01

Results are presented for the post irradiation examination performed on IFA-431, which was a 6-rod test fuel assembly irradiated in Halden Reactor, Norway, under sponsorship of the Nuclear Regulatory Commission. The irradiation conditions included: peak powers of 33 kW/m; coolant pressure and temperature of 3.3 MPa and 240 0 C, respectively; and peak burnup of 4300 MWd/MTM. IFA-431 included instrumented rods of basic boiling water reactor design, with variations in fill gas composition, gap size, and UO 2 fuel type. The irradiation was designed to measure the effect of these variations upon fuel rod thermal and mechanical performance. The post irradiation examination assessed the permanent changes to the rods, including induced radioactivity, cladding deformation, fission gas release, and fuel densification

Validation of the ORIGEN-S code for predicting radionuclide inventories in used CANDU fuel

International Nuclear Information System (INIS)

Tait, J.C.; Gauld, I.; Kerr, A.H.

1995-01-01

The safety assessment being conducted by AECL Research for the concept of deep geological disposal of used CANDU UO 2 fuel requires the calculation of radionuclide inventories in the fuel to provide source terms for radionuclide release. This report discusses the validation of selected actinide and fission-product inventories calculated using the ORIGEN-S code coupled with the WIMS-AECL lattice code, using data from analytical measurements of radioisotope inventories in Pickering CANDU reactor fuel. The recent processing of new ENDF/B-VI cross-section data has allowed the ORIGEN-S calculations to be performed using the most up-to-date nuclear data available. The results indicate that the code is reliably predicting actinide and the majority of fission-product inventories to within the analytical uncertainty. ((orig.))

IfA Catalogs of Solar Data Products

Science.gov (United States)

Habbal, Shadia R.; Scholl, I.; Morgan, H.

2009-05-01

This paper presents a new set of online catalogs of solar data products. The IfA Catalogs of Solar Data Products were developed to enhance the scientific output of coronal images acquired from ground and space, starting with the SoHO era. Image processing tools have played a significant role in the production of these catalogs [Morgan et al. 2006, 2008, Scholl and Habbal 2008]. Two catalogs are currently available at http://alshamess.ifa.hawaii.edu/ : 1) Catalog of daily coronal images: One coronal image per day from EIT, MLSO and LASCO/C2 and C3 have been processed using the Normalizing Radial-Graded-Filter (NRGF) image processing tool. These images are available individually or as composite images. 2) Catalog of LASCO data: The whole LASCO dataset has been re-processed using the same method. The user can search files by dates and instruments, and images can be retrieved as JPEG or FITS files. An option to make on-line GIF movies from selected images is also available. In addition, the LASCO data set can be searched from existing CME catalogs (CDAW and Cactus). By browsing one of the two CME catalogs, the user can refine the query and access LASCO data covering the time frame of a CME. The catalogs will be continually updated as more data become publicly available.

20 CFR 702.432 - Debarment process.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Debarment process. 702.432 Section 702.432 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION, DEPARTMENT OF LABOR LONGSHOREMEN'S AND HARBOR... § 702.432 Debarment process. (a) Pertaining to health care providers. Upon receipt of information...

48 CFR 432.412 - Contract clause.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Contract clause. 432.412 Section 432.412 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Advance Payments for Non-Commercial Items 432.412 Contract clause. The decision...

Comparison of the ENIGMA code with experimental data on thermal performance, stable fission gas and iodine release at high burnup

Energy Technology Data Exchange (ETDEWEB)

Killeen, J C [Nuclear Electric plc, Barnwood (United Kingdom)

1997-08-01

The predictions of the ENIGMA code have been compared with data from high burn-up fuel experiments from the Halden and RISO reactors. The experiments modelled were IFA-504 and IFA-558 from Halden and the test II-5 from the RISO power burnup test series. The code has well modelled the fuel thermal performance and has provided a good measure of iodine release from pre-interlinked fuel. After interlinkage the iodine predictions remain a good fit for one experiment, but there is significant overprediction for a second experiment (IFA-558). Stable fission gas release is also well modelled and the predictions are within the expected uncertainly band throughout the burn-up range. This report presents code predictions for stable fission gas release to 40GWd/tU, iodine release measurements to 50GWd/tU and thermal performance (fuel centre temperature) to 55GWd/tU. Fuel ratings of up to 38kW/m were modelled at the high burn-up levels. The code is shown to accurately or conservatively predict all these parameters. (author). 1 ref., 6 figs.

Follow-up of AECL employees involved in the decontamination of NRU in 1958

International Nuclear Information System (INIS)

Werner, M.M.; Myers, D.K.; Morrison, D.P.

1982-09-01

In May 1958 the NRU reactor hall was badly contaminated by a damaged fuel rod that broke apart during its removal from the reactor. Radioactive fission products were spread around the reactor hall and into adjacent areas when a piece of the fuel rod fell into the maintenance pit and burned. AECL staff and others completed the decontamination in 2 1/2 months. This paper reports the results of a follow-up study of the AECL participants. No statistically significant increases in deaths from cancer or other diseases were found in this group

Validation of the ORIGEN-S code for predicting radionuclide inventories in used CANDU Fuel

International Nuclear Information System (INIS)

Tait, J.C.; Gauld, I.; Kerr, A.H.

1994-10-01

The safety assessment being conducted by AECL Research for the concept of deep geological disposal of used CANDU UO 2 fuel requires the calculation of radionuclide inventories in the fuel to provide source terms for radionuclide release. This report discusses the validation of selected actinide and fission-product inventories calculated using the ORIGEN-S code coupled with the WIMS-AECL lattice code, using data from analytical measurements of radioisotope inventories in Pickering CANDU reactor fuel. The recent processing of new ENDF/B-VI cross-section data has allowed the ORIGEN-S calculations to be performed using the most up-to-date nuclear data available. The results indicate that the code is reliably predicting actinide and the majority of fission-product inventories to within the analytical uncertainty. 38 refs., 4 figs., 5 tabs

5 CFR 551.432 - Sleep time.

Science.gov (United States)

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Sleep time. 551.432 Section 551.432... FAIR LABOR STANDARDS ACT Hours of Work Special Situations § 551.432 Sleep time. (a) Except as provided in paragraph (b) of this section, bona fide sleep time that fulfills the following conditions shall...

46 CFR 153.432 - Cooling systems.

Science.gov (United States)

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Cooling systems. 153.432 Section 153.432 Shipping COAST... Control Systems § 153.432 Cooling systems. (a) Each cargo cooling system must have an equivalent standby... cooling system. (b) Each tankship that has a cargo tank with a required cooling system must have a manual...

Burnup calculation of a CANDU6 reactor using the Serpent and MCNP6 codes

Energy Technology Data Exchange (ETDEWEB)

Hussein, M.S.; Bonin, H.W., E-mail: mohamed.hussein@rmc.ca, E-mail: bonin-h@rmc.ca [Royal Military College of Canada, Dept. of Chemistry and Chemical Engineering, Kingston, ON (Canada); Lewis, B.J., E-mail: Brent.Lewis@uoit.ca [Univ. of Ontario Inst. of Tech., Faculty of Energy Systems and Nuclear Science, Oshawa, ON (Canada)

2014-07-01

A study of fuel burnup for the CANDU6 reactor is carried out to validate the most recent versions of the probabilistic transport code (MCNP6) and the continuous energy burnup calculation code (Serpent). These two codes allow for 3-D geometry calculation accounting for a detailed analysis without unit-cell homogenization. On the other hand, the WIMS-AECL computer program is used to model neutron transport in nuclear-reactor lattices for design, safety analysis, and operation. It works with two-dimensional regions and can perform collision probability calculations for a periodic structure of the lattice cell. In the present work, the multiplication factor, the total flux and fuel burnup could be calculated for a CANDU6 nuclear reactor based on the GENTILLY-2 core design. The MCNP6 and Serpent codes provide a calculation of the track length estimated flux per neutron source. This estimated flux is then scaled with normalization to the reactor power in order to provide a flux in unit of n/cm{sup 2}s. Good agreement is observed between the actual total flux calculated by MCNP6, Serpent and WIMS-AECL. The effective multiplication factors of the whole core CANDU6 reactor are further calculated as a function of burnup and further compared to those calculated by WIMS-AECL where excellent agreement is also obtained. (author)

Burnup calculation of a CANDU6 reactor using the Serpent and MCNP6 codes

International Nuclear Information System (INIS)

Hussein, M.S.; Bonin, H.W.; Lewis, B.J.

2014-01-01

A study of fuel burnup for the CANDU6 reactor is carried out to validate the most recent versions of the probabilistic transport code (MCNP6) and the continuous energy burnup calculation code (Serpent). These two codes allow for 3-D geometry calculation accounting for a detailed analysis without unit-cell homogenization. On the other hand, the WIMS-AECL computer program is used to model neutron transport in nuclear-reactor lattices for design, safety analysis, and operation. It works with two-dimensional regions and can perform collision probability calculations for a periodic structure of the lattice cell. In the present work, the multiplication factor, the total flux and fuel burnup could be calculated for a CANDU6 nuclear reactor based on the GENTILLY-2 core design. The MCNP6 and Serpent codes provide a calculation of the track length estimated flux per neutron source. This estimated flux is then scaled with normalization to the reactor power in order to provide a flux in unit of n/cm 2 s. Good agreement is observed between the actual total flux calculated by MCNP6, Serpent and WIMS-AECL. The effective multiplication factors of the whole core CANDU6 reactor are further calculated as a function of burnup and further compared to those calculated by WIMS-AECL where excellent agreement is also obtained. (author)

AECL's mixed waste management program

International Nuclear Information System (INIS)

Peori, R.; Hulley, V.

2006-01-01

Every nuclear facility has it, they wish that they didn't but they have generated and do possess m ixed waste , and until now there has been no permanent disposition option; it has been for the most been simply maintained in interim storage. The nuclear industry has been responsibly developing permanent solutions for solid radioactive waste for over fifty years and for non-radioactive, chemically hazardous waste, for the last twenty years. Mixed waste (radioactive and chemically hazardous waste) however, because of its special, duo-hazard nature, has been a continuing challenge. The Hazardous Waste and Segregation Program (HW and SP) at AECL's CRL has, over the past ten years, been developing solutions to deal with their own in-house mixed waste and, as a result, have developed solutions that they would like to share with other generators within the nuclear industry. The main aim of this paper is to document and describe the early development of the solutions for both aqueous and organic liquid wastes and to advertise to other generators of this waste type how these solutions can be implemented to solve their mixed waste problems. Atomic Energy of Canada Limited (AECL) and in particular, CRL has been satisfactorily disposing of mixed waste for the last seven years. CRL has developed a program that not only disposes of mixed waste, but offers a full service mixed waste management program to customers within Canada (that could eventually include U.S. sites as well) that has developed the experience and expertise to evaluate and optimize current practices, dispose of legacy inventories, and set up an efficient segregation system to reduce and effectively manage, both the volumes and expense of, the ongoing generation of mixed waste for all generators of mixed waste. (author)

Darüşşifas Where Music Threapy was Practiced During Anatolian Seljuks and Ottomans

Directory of Open Access Journals (Sweden)

Gülşen Erdal

2013-03-01

Full Text Available AbstractMusic therapy, one of the oldest treatment methods known, dates back to thousands of years. Turks’ using music therapy practices in hospitals -Ottoman and Seljuk hospitals- built with appropriate acoustic in the treatment of mental disorders, utilizing the books which included the researches done by scientists such as İbni Sina, Razî, Farabî, Hasan Şuurî and in Gevrekzade Hasan Efendi in music therapy and improving music therapy practices exemplarily in the period of Ottomans and Seljukians is assessed as the first serious music therapy practices. Darüşşifa is one of the names given to medical and educational establishments which give people health service depending on practice and observation and treated patients in Turkish and Islamic world. Turks started various reconstruction activities following their settlement in Anatolia. Within a short period, they built several types of artifacts such as; caravansaries, madrasahs, mosques, darüşşifas. In Seljukian and Ottoman darüşşifas, medical subjects were taught according to researches and scientific principals, and surgeons were educated at medical madrasahs as well. Medical health care service was provided in those places. In this study, of darüşşifas where music therapy was practised the ones surviving today and having importance have been analyzed so as to emphasize how curative power of art history and music was used by Turkish people centuries ago. From this point of view, Kayseri Gevher Nesibe Tıp Medresesi (Medical madrasah (1206, Divriği Ulu Camii ve Darüşşifası (Mosque and Hospital (1228, Amasya Darüşşifası (1309, Fatih Darüşşifası (1470 Edirne Sultan II. Bayezid Darüşşifası (1488, Süleymaniye Tıp Medresesi and Şifahanesi (Medical Madrasah and Hospital (1556 have been examined in this study as the featured ones among the institutions where music therapy was practised.ÖzetMüziğin insanlar üzerinde bıraktığı psikolojik ve fiziksel etki

48 CFR 432.113 - Customary contract financing.

Science.gov (United States)

2010-10-01

... financing. 432.113 Section 432.113 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.113 Customary contract financing. The contracting officer may determine the necessity for customary contract financing. The...

The Constitution and Operation of the Constant Temperature Anemometer(CTA:IFA 300)

Energy Technology Data Exchange (ETDEWEB)

Nam, H. Y.; Kim, J. M.; Choi, B. H.; Choi, J. H.; Jeong, J. Y.; Kim, B. H.; Kim, T. J.; Cha, J. E.; Kim, H. R

2005-09-15

This study shows the constitution and application method on constant temperature anemometer(CTA-Model : IFA 300 by TSI Co.). Especially, the software instruction(Thermal Pro Ver. 4.55) was re-adjusted for users.

Assessment of CANDU physics codes using experimental data - II: CANDU core physics measurements

International Nuclear Information System (INIS)

Roh, Gyu Hong; Jeong, Chang Joon; Choi, Hang Bok

2001-11-01

Benchmark calculations of the advanced CANDU reactor analysis tools (WIMS-AECL, SHETAN and RFSP) and the Monte Carlo code MCNP-4B have been performed using Wolsong Units 2 and 3 Phase-B measurement data. In this study, the benchmark calculations have been done for the criticality, boron worth, reactivity device worth, reactivity coefficient, and flux scan. For the validation of the WIMS-AECL/SHETANRFSP code system, the lattice parameters of the fuel channel were generated by the WIMS-AECL code, and incremental cross sections of reactivity devices and structural material were generated by the SHETAN code. The results have shown that the criticality is under-predicted by -4 mk. The reactivity device worths are generally consistent with the measured data except for the strong absorbers such as shutoff rod and mechanical control absorber. The heat transport system temperature coefficient and flux distributions are in good agreement with the measured data. However, the moderator temperature coefficient has shown a relatively large error, which could be caused by the incremental cross-section generation methodology for the reactivity device. For the MCNP-4B benchmark calculation, cross section libraries were newly generated from ENDF/B-VI release 3 through the NJOY97.114 data processing system and a three-dimensional full core model was developed. The simulation results have shown that the criticality is estimated within 4 mk and the estimated reactivity worth of the control devices are generally consistent with the measurement data, which implies that the MCNP code is valid for CANDU core analysis. In the future, therefore, the MCNP code could be used as a reference tool to benchmark design and analysis codes for the advanced fuels for which experimental data are not available

AECL's concept for the disposal of nuclear fuel waste and the importance of its implementation

International Nuclear Information System (INIS)

Allan, C.J.

1993-07-01

Since 1978, Canada has been investigating a concept for permanently dealing with the nuclear fuel waste from Canadian CANDU (Canada Deuterium Uranium) nuclear generating stations. The concept is based on disposing of the waste in a vault excavated 500 to 1000 m deep in intrusive igneous rock of the Canadian Shield. AECL Research will soon be submitting an environmental impact statement (EIS) on the concept for review by a Panel through the federal environmental assessment and review process (EARP). In accordance with AECL Research's mandate and in keeping with the detailed requirements of the review Panel, AECL Research has conducted extensive studies on a wide variety of technical and socio-economic issues associated with the concept. If the concept is accepted, we can and should continue our responsible approach and take the next steps towards constructing a disposal facility for Canada's used nuclear fuel waste

Validation of physics and thermalhydraulic computer codes for advanced Candu reactor applications

International Nuclear Information System (INIS)

Wren, D.J.; Popov, N.; Snell, V.G.

2004-01-01

Atomic Energy of Canada Ltd. (AECL) is developing an Advanced Candu Reactor (ACR) that is an evolutionary advancement of the currently operating Candu 6 reactors. The ACR is being designed to produce electrical power for a capital cost and at a unit-energy cost significantly less than that of the current reactor designs. The ACR retains the modular Candu concept of horizontal fuel channels surrounded by a heavy water moderator. However, ACR uses slightly enriched uranium fuel compared to the natural uranium used in Candu 6. This achieves the twin goals of improved economics (via large reductions in the heavy water moderator volume and replacement of the heavy water coolant with light water coolant) and improved safety. AECL has developed and implemented a software quality assurance program to ensure that its analytical, scientific and design computer codes meet the required standards for software used in safety analyses. Since the basic design of the ACR is equivalent to that of the Candu 6, most of the key phenomena associated with the safety analyses of ACR are common, and the Candu industry standard tool-set of safety analysis codes can be applied to the analysis of the ACR. A systematic assessment of computer code applicability addressing the unique features of the ACR design was performed covering the important aspects of the computer code structure, models, constitutive correlations, and validation database. Arising from this assessment, limited additional requirements for code modifications and extensions to the validation databases have been identified. This paper provides an outline of the AECL software quality assurance program process for the validation of computer codes used to perform physics and thermal-hydraulics safety analyses of the ACR. It describes the additional validation work that has been identified for these codes and the planned, and ongoing, experimental programs to extend the code validation as required to address specific ACR design

Microbial analysis of the buffer/container experiment at AECL's underground research laboratory

International Nuclear Information System (INIS)

Stroes-Gascoyne, S.

1996-07-01

The Buffer/Container Experiment (BCE) was carried out at AECL's Underground Research Laboratory (URL) for 2.5 years to examine the in situ performance of compacted buffer material in a single emplacement borehole under vault-relevant conditions. During decommissioning of this experiment, numerous samples were taken for microbial analysis to determine if the naturally present microbial population in buffer material survived the conditions (i.e., compaction, heat and desiccation) in the BCE and to determine which group(s) of microorganisms would be dominant in such a simulated vault environment. Such knowledge will be very useful in assessing the potential effects of microbial activity on the concept for deep disposal of Canada's nuclear fuel waste, proposed by AECL. 46 refs., 31 tabs., 35 figs

7 CFR 28.432 - Middling Tinged Color.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Middling Tinged Color. 28.432 Section 28.432... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Tinged Cotton § 28.432 Middling Tinged Color. Middling Tinged Color is color which is within the range represented by a set of samples in the custody of...

Comparison of the performance of IFA, CFA, and ELISA assays for the serodiagnosis of acute Q fever by quality assessment.

Science.gov (United States)

Herremans, Tineke; Hogema, Boris M; Nabuurs, Marrigje; Peeters, Marcel; Wegdam-Blans, Marjolijn; Schneeberger, Peter; Nijhuis, Carla; Notermans, Daan W; Galama, Joep; Horrevorts, Anton; van Loo, Inge H M; Vlaminckx, Bart; Zaaijer, Hans L; Koopmans, Marion P; Berkhout, Hanneke; Socolovschi, Cristina; Raoult, Didier; Stenos, John; Nicholson, William; Bijlmer, Henk

2013-01-01

The indirect immunofluorescence assay (IFA) is considered the reference method for diagnosing Q fever, but serology is also performed by complement fixation assay (CFA) or enzyme-linked immunosorbent assay (ELISA). However, comparability between these assays is not clear, and therefore a quality assessment was performed. A total of 25 serum samples from negative controls, Q fever patients, and a serial diluted high-positive sample were analyzed in 10 Dutch laboratories. Six laboratories performed CFA, 5 performed IFA, and 5 performed ELISAs. Three international reference laboratories from Australia, France, and the USA also participated in this study. Qualitative values between laboratories using the same methods were within close range, and all 3 methods correctly identified acute Q fever patients. The IFA, ELISA, and CFA are all suitable serodiagnostic assays to diagnose acute Q fever, but the IFA remains an important tool in the follow-up of patients and in identifying patients at risk for developing chronic Q fever. Copyright © 2013 Elsevier Inc. All rights reserved.

Safety Significance of the Halden IFA-650 LOCA Test Results

International Nuclear Information System (INIS)

Fuketa, Toyoshi; Nagase, Fumihisa; Grandjean, Claude; Petit, Marc; Hozer, Zoltan; Kelppe, Seppo; Khvostov, Grigori; Hafidi, Biya; Therache, Benjamin; Heins, Lothar; Valach, Mojmir; Voglewede, John; Wiesenack, Wolfgang

2010-01-01

The safety criteria for loss-of-coolant accidents were defined to ensure that the core would remain coolable. Since the time of the first LOCA experiments, which were largely conducted with fresh fuel, changes in fuel design, the introduction of new cladding materials and in particular the move to high burnup have generated a need to re-examine these criteria and to verify their continued validity. As part of international efforts to this end, the OECD Halden Reactor Project program implemented a LOCA test series. Based on recommendations of a group of experts from the US NRC, EPRI, EDF, IRSN, FRAMATOME-ANP and GNF, the primary objective of the experiments were defined as 1. Measure the extent of fuel (fragment) relocation into the ballooned region and evaluate its possible effect on cladding temperature and oxidation. 2. Investigate the extent (if any) of 'secondary transient hydriding' on the inner side of the cladding above and below the burst region. The fourth test of the series, IFA-650.4 conducted in April 2006, caused particular attention in the international nuclear community. The fuel used in the experiment had a high burnup, 92 MWd/kgU, and a low pre-test hydrogen content of about 50 ppm. The test aimed at and achieved a peak cladding temperature of 850 deg. C. The rod burst occurred at 790 deg. C. The burst caused a marked temperature increase at the lower end and a decrease at the upper end of the system, indicating that fuel relocation had occurred. Subsequent gamma scanning showed that approximately 19 cm of the fuel stack were missing from the upper part of the rod and that fuel had fallen to the bottom of the capsule. PIE at the IFE-Kjeller hot cells corroborated this evidence of substantial fuel relocation. The fact that fuel dispersal could occur upon ballooning and burst, i.e. at cladding temperatures as low as 800 deg. C and thus far lower than the temperature entailed by the current 1200 deg. C / 17% ECR limit, caused concern. The

Linfangioma cervical: manejo terapéutico con OK-432 (Picibanil Cervical lymphangioma: therapeutic management with OK-432 (Picibanil

Directory of Open Access Journals (Sweden)

E. Valle Rodríguez

2007-12-01

Full Text Available Introducción: El linfangioma es una malformación del sistema linfático. El abordaje clásico ha sido la cirugía. El OK-432 (Picibanil tiene acción esclerosante y se está utilizando cómo primer escalón terapéutico. El objetivo es aportar un nuevo caso de linfangioma tratado con OK-432 y hacer una revisión de la literatura. Material y método: Aportamos un varón de 16 años con un linfangioma cervical macroquístico de 10 x 6 cm tratado con una dosis de OK-432. Resultados: A las 16 semanas del tratamiento, el tamaño del linfangioma era de 6 x 2 cm, siendo clínicamente inapreciable. Discusión: El tratamiento con OK-432 tiene una alta tasa de curación, con una baja tasa de recidiva y una fibrosis circunscrita a la lesión. En relación con la cirugía, se evitan cicatrices y posibles lesiones de estructuras vitales.Introduction: Lymphangioma is a malformation of the lymphatic system. The classic approach is surgery. OK-432 (Picibanil has sclerosing action and is being used as the first therapeutic step. The objective was to report a new case of lymphangioma treated with OK-432 and to review the literature. Material and method: We report the case of a 16-year-old man with a 10x6-cm macrocystic cervical lymphangioma treated with a dose of OK-432. Results: At 16 weeks of treatment, the size of the lymphangioma was 6x2 cm and it was clinically unappreciable. Discussion: OK-432 treatment has a high cure rate, low recurrence rate, and fibrosis circumscribed to the lesion. Compared to surgery, scars and possible harm to vital structures are avoided.

Comparison of MCNP and WIMS-AECL/RFSP calculations against critical heavy water experiments in ZED-2 with CANFLEX-LVRF and CANFLEX-LEU fuels

International Nuclear Information System (INIS)

Bromley, B. P.; Watts, D. G.; Pencer, J.; Zeller, M.; Dweiri, Y.

2009-01-01

This paper summarizes calculations of MCNP5 and WIMS-AECL/RFSP compared against measurements in coolant void substitution experiments in the ZED-2 critical facility with CANFLEX R-LEU/RU (Low Enriched Uranium, Recovered Uranium) reference fuels and CANFLEX-LVRF (Low Void Reactivity Fuel) test fuel, and H 2 O/air coolants. Both codes are tested for the prediction of the change in reactivity with complete voiding of all fuel channels, and that for a checkerboard voiding pattern. Understanding these phenomena is important for the ACR-1000 R reactor. Comparisons are also made for the prediction of the axial and radial neutron flux distributions, as measured by copper foil activation. The experimental data for these comparisons were obtained from critical mixed lattice / substitution experiments in AECL's ZED-2 critical facility using CANFLEX-LEU/RU and CANFLEX-LVRF fuel in a 24-cm square lattice pitch at 25 degrees C. Substitution analyses were performed to isolate the properties (buckling, bare critical lattice dimensions) of the CANFLEX-LVRF fuel. This data was then used to further test the lattice physics codes. These comparisons establish biases/uncertainties and errors in the calculation of k eff , coolant void reactivity, checkerboard coolant void reactivity, and flux distributions. Results show small to modest biases in void reactivity and very good agreement for flux distributions. The importance of boundary conditions and the modeling of un-moderated fuel in the critical experiments are demonstrated. This comparison study provides data that supports code validation and gives good confidence in the reactor physics tools used in the design and safety analysis of the ACR-1000 reactor. (authors)

48 CFR 432.003 - Simplified acquisition procedures financing.

Science.gov (United States)

2010-10-01

... procedures financing. 432.003 Section 432.003 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING 432.003 Simplified acquisition procedures financing. (a) The chief of the contracting office may approve contract financing on a contract to be...

40 CFR 432.41 - Special definitions.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Special definitions. 432.41 Section 432.41 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND... definitions. For the purpose of this subpart: High-processing packinghouse means a packinghouse which...

Experience with remediating radiostrontium-contaminated ground water and surface water with versions of AECL's CHEMIC process

International Nuclear Information System (INIS)

Vijayan, S.

2006-01-01

Numerous approaches have been developed for the remediation of radiostrontium ( 90 Sr) contaminated ground water and surface water. Several strontium-removal technologies have been assessed and applied at AECL's (Atomic Energy of Canada Limited) Chalk River Laboratories. These include simple ion exchange (based on non-selective natural zeolites or selective synthetic inorganic media), and precipitation and filtration with or without ion exchange as a final polishing step. AECL's CHEMIC process is based on precipitation-microfiltration and ion-exchange steps. This paper presents data related to radiostrontium removal performance and other operational experiences including troubleshooting with two round-the-clock, pilot-scale water remediation plants based on AECL's CHEMIC process at the Chalk River Laboratories site. These plants began operation in the early 1990s. Through optimization of process chemistry and operation, high values for system capability and system availability factors, and low concentrations of 90 Sr in the discharge water approaching drinking water standard can be achieved. (author)

40 CFR 432.31 - Special definitions.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Special definitions. 432.31 Section 432.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND... definitions. For the purpose of this subpart: Low-processing packinghouse means a packinghouse that processes...

40 CFR 432.111 - Special definitions.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Special definitions. 432.111 Section 432.111 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND... definitions. For the purpose of this subpart: Poultry first processing means slaughtering of poultry and...

Status and Plans for work on pressure tube creep at AECL

International Nuclear Information System (INIS)

Bickel, Grant A.

2013-01-01

AECL research goals: • Develop empirical models to: – regress out operating conditions/extrinsic factors – rank relative strain behavior of measured in-service pressure tubes; • Correlate the ranked strains to manufacturing variables and the microstructure to: – Develop mechanistic insights – Optimize manufacturing/microstructure for improved pressure tube performance

The Third Dryout Fuel Behaviour Test Series in IFA-613

International Nuclear Information System (INIS)

Ianiri, Raffaella

1998-02-01

The objective of the dryout experiment with the instrumented fuel assembly IFA-613 is to provide information on the consequences induced on fuel by short terms dry outs having characteristics similar to those anticipated to occur from pump trips in a Boiling Water Reactor (BWR). For the third experiment it was planned to test one fresh and two pre-irradiated segments. Unfortunately one of the channels, Channel A developed a leakage and was not suitable for testing anymore. The rig was loaded with only two rods: one fresh PWR rod with a design similar to the fresh rod in IFA-613.1 and one pre-irradiated PWR segment (N1310 with a burn-up of 29 MWd/kgU). Both rods were equipped with a clad extensometer and two clad surface thermocouples (upper and lower position). The rig was loaded during the December 1997 shutdown and the dryout tests were performed on 16th January 1998. Both rods experienced temperature excursions with a target peak clad temperature (PCT) of 650 o C. According to the measured cladding temperatures, the time above the target temperature was about 4-5 s for both rods. The lower thermocouple did not indicate dryout at any occasion. The rig was unloaded immediately after the testing. (author)

Analysis of gas flow measurements from the IFA-633 UO2/MOX comparison test

International Nuclear Information System (INIS)

Rossiter, Glyn

2005-01-01

The release rate to birth rate ratio (R/B) results from the gas flow measurements performed during the joint programme irradiation of the IFA-633 UO 2 /MOX comparison test have been analysed using both classical and fractal methodologies. Possible calculational procedures for precursor enhancement factors and rod average diffusion coefficients were considered and suitable procedures were then implemented. The surface area to volume ratio (S/V) and recoil R/B values generated using the two methodologies have been compared to each other and to results obtained for other Halden Project gas flow rigs (IFAs 504, 558, 563, 569 and 655). The merits of the methodologies have then been discussed. It was found that the trends in the classical recoil R/B and in the fractal S/V for the shortest lived isotopes were in better agreement with the expected S/V behaviour than the trends in the classical S/V and in the fractal S/V for the longer lived isotopes. The beginning of life (BOL) S/V versus temperature behaviour for both IFA-633 and IFA-655 has been investigated and has been found to be more consistent with expectation when the fractal methodology is used. The peak fuel temperature versus rod average burnup behaviour of the IFA-633 fuel rods has been examined in order to investigate whether there is any correlation between the S/V results and the extent of periods during which the Halden (or Vitanza) threshold for significant fission gas release was exceeded. The behaviour was more consistent with the trends in the classical recoil R/B and fractal S/V for the shortest lived isotopes than with the trends in the classical S/V and the fractal S/V for the longer lived isotopes. The analysis of the through-life and BOL S/V and recoil R/B results generated using the classical and fractal methodologies has shown that the behaviour of the classical recoil R/B is difficult to explain. This is evidence that the classical recoil R/B results contain a diffusional release component

Validation of computer codes used in the safety analysis of Canadian research reactors

International Nuclear Information System (INIS)

Bishop, W.E.; Lee, A.G.

1998-01-01

AECL has embarked on a validation program for the suite of computer codes that it uses in performing the safety analyses for its research reactors. Current focus is on codes used for the analysis of the two MAPLE reactors under construction at Chalk River but the program will be extended to include additional codes that will be used for the Irradiation Research Facility. The program structure is similar to that used for the validation of codes used in the safety analyses for CANDU power reactors. (author)

48 CFR 432.202-4 - Security for Government financing.

Science.gov (United States)

2010-10-01

... financing. 432.202-4 Section 432.202-4 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Commercial Item Purchase Financing 432.202-4 Security for Government financing. Prior to determining that an offeror's financial condition is adequate...

Comparative evaluation of antibody positive titer by ELISA and IFA in Theileria annulata vaccinated cattle in Iran

Directory of Open Access Journals (Sweden)

Hashemi-Fesharki R.

2006-03-01

Full Text Available An enzyme linked immunosorbent assay (ELISA was used to evaluate antibody positive titer in vaccinated and non-vaccinated cattle using schizont infected myeloid cells as an antigen. The result was compared with indirect fluorescent antibody level in the same animals. For this study 116 milking cows, 95 vaccinated and 21 non-vaccinated, were bleeded in order to prepare sera. They were tested with both ELISA and IFA tests. 94 sera had positive antibody titer and 22 sera were negative through ELISA test but, with IFA test, only 89 sera showed positive antibody titer and 27 were negative. Thereby, it was concluded that the sensitivity and specificity of ELISA test in comparison with IFA test was 95.5 % and 66.6 % respectively. This study generally indicated that ELISA could be an effective test for seroepidemiological investigations of bovine tropical theileriosis, and it is considered to be valid as an additional test to distinguish the vaccinated from the non vaccinated cattle in order to schedule vaccination programs.

Controlled drill ampersand blast excavation at AECL's Underground Research Laboratory

International Nuclear Information System (INIS)

Kuzyk, G.W.; Onagi, D.P.; Thompson, P.M.

1996-01-01

A controlled drill and blast method has been developed and used to excavate the Underground Research Laboratory, a geotechnical facility constructed by Atomic Energy of Canada Limited (AECL) in crystalline rock. It has been demonstrated that the method can effectively reduce the excavation disturbed zone (EDZ) and is suitable for the construction of a used fuel disposal vault in the plutonic rock of the Canadian Shield

48 CFR 432.102 - Description of contract financing methods.

Science.gov (United States)

2010-10-01

... financing methods. 432.102 Section 432.102 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.102 Description of contract financing methods. Progress payments based on a percentage or stage of completion are...

Treatment of lymphangiomas with OK-432 (Picibanil).

Science.gov (United States)

Rautio, Riitta; Keski-Nisula, Leo; Laranne, Jussi; Laasonen, Erkki

2003-01-01

To determine the efficacy of OK-432 sclerotherapy in the treatment of lymphangiomas. The treatment was begun for 14 patients with lymphangioma. The age range of the patients at the time of the first injection was from 10 months to 42 years. Eleven of the lesions involved the head and neck region, two the thorax and one was localized in the extremity. Prior to treatment all patients were investigated with either magnetic resonance imaging, computed tomography, ultrasound or a combination of these modalities. The injections were performed with ultrasound and/or fluoroscopic guidance. Eight patients received OK-432 as first-line treatment; five were treated after surgery and one after medical therapy. On average, 2.2 intracystic injections were performed per patient. Nine of the lesions were macrocystic and five were mixed lesions. Eleven patients showed complete or marked response to the OK-432 sclerotherapy, two patients had moderate shrinkage of their lesions and only one patient showed no response to therapy. Macrocystic lesions showed the best response to therapy. Those patients who received OK-432 as first-line treatment showed complete or marked response. It was found that treatment of lymphangiomas with OK-432 was safe and effective.

AECL strategy for surface-based investigations of potential disposal sites and the development of a geosphere model for a site

International Nuclear Information System (INIS)

Whitaker, S.H.; Brown, A.; Davison, C.C.; Gascoyne, M.; Lodha, G.S.; Stevenson, D.R.; Thorne, G.A.; Tomsons, D.

1994-05-01

The objective of this report is to summarize AECL's strategy for surface-based geotechnical site investigations used in screening and evaluating candidate areas and candidate sites for a nuclear fuel waste repository and for the development of geosphere models of sites. The report is one of several prepared by national nuclear fuel waste management programs for the Swedish Nuclear Fuel and Waste Management Co. (SKB) to provide international background on site investigations for SKB's R and D programme on siting.The scope of the report is limited to surface-based investigations of the geosphere, those done at surface or in boreholes drilled from surface. The report discusses AECL's investigation strategy and the methods proposed for use in surface-based reconnaissance and detailed site investigations at potential repository sites. Site investigations done for AECL's Underground Research Laboratory are used to illustrate the approach. The report also discusses AECL's strategy for developing conceptual and mathematical models of geological conditions at sites and the use of these models in developing a model (Geosphere Model) for use in assessing the performance of the disposal system after a repository is closed. Models based on the site data obtained at the URL are used to illustrate the approach. Finally, the report summarizes the lessons learned from AECL's R and D program on site investigations and mentions some recent developments in the R and D program. 120 refs, 33 figs, 7 tabs

Co-operative projects with AECL in the fields of hydrogeology and geochemistry

International Nuclear Information System (INIS)

1985-01-01

The report covers collaborative study with Atomic Energy of Canada Limited on geological aspects of waste disposal in crystalline rocks. A field test of the sinusoidal hydraulic pressure pulse method was carried out at the URL site to try to define hydraulic properties of major horizontal fractures. The trials were generally successful and observable sine and square wave signals were transmitted. Owing to the limited scale of the programme, and some equipment problems, the results proved difficult to interpret, although the speed and flexibility of the method was demonstrated. A second aspect of collaboration was to be the field comparison of the AECL and NERC/BGS borehole geochemical probes. In the event, the AECL probe development programme was curtailed and a Swedish design selected for purchase. Effort thus switched to technical comparison of the SGAB probe with the NERC/BGS design. Since both are still at various development points the collaboration was limited to technical exchange. The results are presented. (author)

Verification of the thermal module in the ELESIM code and the associated uncertainty analysis

International Nuclear Information System (INIS)

Arimescu, V.I.; Williams, A.F.; Klein, M.E.; Richmond, W.R.; Couture, M.

1997-01-01

Temperature is a critical parameter in fuel modelling because most of the physical processes that occur in fuel elements during irradiation are thermally activated. The focus of this paper is the temperature distribution calculation used in the computer code ELESIM, developed at AECL to model the steady state behaviour of CANDU fuel. A validation procedure for fuel codes is described and applied to ELESIM's thermal calculation

Treatment of Lymphangiomas with OK-432 (Picibanil)

International Nuclear Information System (INIS)

Rautio, Riitta; Keski-Nisula, Leo; Laranne, Jussi; Laasonen, Erkki

2003-01-01

Purpose: To determine the efficacy of OK-432 sclerotherapy in the treatment of lymphangiomas. Methods: The treatment was begun for 14 patients with lymphangioma. The age range of the patients at the time of the first injection was from 10 months to 42 years. Eleven of the lesions involved the head and neck region, two the thorax and one was localized in the extremity. Prior to treatment all patients were investigated with either magnetic resonance imaging, computed tomography, ultrasound or a combination of these modalities. The injections were performed with ultrasound and/or fluoroscopic guidance. Eight patients received OK-432 as first-line treatment; five were treated after surgery and one after medical therapy. On average, 2.2 intracystic injections were performed per patient. Nine of the lesions were macrocystic and five were mixed lesions. Results: Eleven patients showed complete or marked response to the OK-432 sclerotherapy, two patients had moderate shrinkage of their lesions and only one patient showed no response to therapy. Macrocystic lesions showed the best response to therapy. Those patients who received OK-432 as first-line treatment showed complete or marked response. Conclusion: It was found that treatment of lymphangiomas with OK-432 was safe and effective

Assessment of neutron transport codes for application to CANDU fuel lattices analysis

International Nuclear Information System (INIS)

Roh, Gyu Hong; Choi, Hang Bok

1999-08-01

In order to assess the applicability of WIMS-AECL and HELIOS code to the CANDU fuel lattice analysis, the physics calculations has been carried out for the standard CANDU fuel and DUPIC fuel lattices, and the results were compared with those of Monte Carlo code MCNP-4B. In this study, in order to consider the full isotopic composition and the temperature effect, new MCNP libraries have been generated from ENDF/B-VI release 3 and validated for typical benchmark problems. The TRX-1,2,BAPL-1,2,3 pin -cell lattices and KENO criticality safety benchmark calculations have been performed for the new MCNP libraries, and the results have shown that the new MCNP library has sufficient accuracy to be used for physics calculation. Then, the lattice codes have been benchmarked by the MCNP code for the major physics parameters such as the burnup reactivity, void reactivity, relative pin power and Doppler coefficient, etc. for the standard CANDU fuel and DUPIC fuel lattices. For the standard CANDU fuel lattice, it was found that the results of WIMS-AECL calculations are consistent with those of MCNP. For the DUPIC fuel lattice, however, the results of WIMS-AECL calculations with ENDF/B-V library have shown that the discrepancy from the results of MCNP calculations increases when the fuel burnup is relatively high. The burnup reactivities of WIMS-ACEL calculations with ENDF/B-VI library have shown excellent agreements with those of MCNP calculation for both the standard CANDU and DUPIC fuel lattices. However, the Doppler coefficient have relatively large discrepancies compared with MCNP calculations, and the difference increases as the fuel burns. On the other hand, the results of HELIOS calculation are consistent with those of MCNP even though the discrepancy is slightly larger compared with the case of the standard CANDU fuel lattice. this study has shown that the WIMS-AECL products reliable results for the natural uranium fuel. However, it is recommended that the WIMS

The use of HANDIDET{reg_sign} non-electric detonator assemblies to reduce blast-induced overpressure at AECL`s Underground Research Laboratory

Energy Technology Data Exchange (ETDEWEB)

Onagi, D.P.; Keith, S.G.; Kuzyk, G.W. [AECL, Pinawa, Manitoba (Canada). Underground Research Lab.; Proudfoot, D.F. [ICI Explosives Canada, North Delta, British Columbia (Canada)

1996-12-01

A number of aspects of the Canadian concept for nuclear fuel waste disposal are being assessed by Atomic Energy of Canada Limited (AECL) in a series of experiments at its Underground Research Laboratory (URL) near Lac du Bonnet, Manitoba, Canada. One of the major objectives of the work being carried out at the URL is to develop and evaluate the methods and technology to ensure safe, permanent disposal of Canada`s nuclear fuel waste. In 1994, AECL excavated access tunnels and a laboratory room for the Quarried Block Fracture Migration Experiment (QBFME) at the 240 Level of the URL. This facility will be used to study the transport of radionuclides in natural fractures in quarried blocks of granite under in-situ groundwater conditions. The experiment is being carried out under a cooperative agreement with the Japan Atomic Energy Research Institute. The excavation of the QBFME access tunnels and laboratory was carried out using controlled blasting techniques that minimized blast-induced overpressure which could have damaged or interrupted other ongoing experiments in the vicinity. The majority of the blasts used conventional long delay non-electric detonators but a number of blasts were carried out using HANDIDET 250/6000 non-electric long delay detonator assemblies and HTD{reg_sign} non-electric short delay trunkline detonator assemblies. The tunnel and laboratory excavation was monitored to determine the levels of blast-induced overpressure. This paper describes the blasting and monitoring results of the blasts using HANDIDET non-electric detonator assemblies and the effectiveness of these detonators in reducing blast-induced overpressure.

Simulating thermal behavior of AECL's spent fuel dry storage system with CATHENA

International Nuclear Information System (INIS)

Sabourin, G.

1998-01-01

This paper documents the comparisons between CATHENA predictions and temperature measurements taken at the Gentilly-2 NPP spent fuel dry storage facility and in a mock--up of a storage basket placed inside a storage cylinder. It also presents CATHENA temperature predictions related to the storage of spent fuel in MACSTOR modules as planned for Ignalina NPP, Lithuania. CATHENA has been chosen because it can simulate many noncondensable gases including air and helium, and because of its great flexibility in the representation of the MACSTOR module geometry. The results of the simulations show good agreement with the experimental measurements. The two comparisons indicate that CATHENA can be used to simulate heat transfer from the fuel to the external air circuit of the spent fuel dry storage system. For the Ignalina MACSTOR module, containing RBMK fuel having higher heat release than typical CANDU fuel, CATHENA predicts that the maximum fuel temperature is expected to be around 240 deg C, giving an acceptable margin below the maximum allowed temperature of 300 deg C. In conclusion, this paper shows that the thermalhydraulic code CATHENA can accurately predict the thermal behavior AECL's air cooled spent fuel dry storage system. (author)

40 CFR 86.432-78 - Deterioration factor.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Deterioration factor. 86.432-78... 1978 and Later New Motorcycles, General Provisions § 86.432-78 Deterioration factor. (a) Deterioration factors shall be developed for each test vehicle from the emission test results. A separate factor shall...

OK-432 sclerotherapy for malleolar bursitis of the ankle.

Science.gov (United States)

Park, Kwang Hwan; Lee, Jongseok; Choi, Woo Jin; Lee, Jin Woo

2013-10-01

The purpose of this study was to evaluate the clinical outcomes and usefulness of OK-432 (Picibanil) sclerotherapy as a new option in the conservative treatment of patients with malleolar bursitis of the ankle. Retrospectively, we reviewed a total of 20 consecutive patients (20 feet) in whom OK-432 sclerotherapy had been performed between March 2009 and June 2010. After aspiration of fluid in the malleolar bursal sac, 0.05 mg of OK-432 was injected into the malleolar bursal sac. We evaluated the clinical outcomes and side effects at the following time points: 2 weeks, 1 month, 3 months, 6 months, and 1 year after OK-432 sclerotherapy. The responses to the treatment were assessed according to the degree of fluctuation, shrinkage of the bursal sac, and soft tissue swelling. Complete resolution was observed in 19 patients (95%) after the first or second application of OK-432 sclerotherapy, and a partial response was observed in 1 patient (5%) after a second application of OK-432 sclerotherapy. The physical component scores of SF-36 improved from 70.0 ± 6.8 to 76.5 ± 7.3 at the last follow-up (P = .0002). OK-432 sclerotherapy was a useful procedure for patients not responding to the usual conservative treatment of malleolar bursitis of the ankle. Level IV, retrospective case series.

Effects of OK-432 (picibanil) on the estrogen receptors of MCF-7 cells and potentiation of antiproliferative effects of tamoxifen in combination with OK-432.

Science.gov (United States)

Aoyagi, H; Iino, Y; Takeo, T; Horii, Y; Morishita, Y; Horiuchi, R

1997-01-01

OK-432 (picibanil), a streptococcal preparation, has a strong biological response modifier (BRM) function and is expected to produce clinical improvement and prolongation of survival in treated cancer patients in Japan. We were interested in whether OK-432 augments estrogen receptor (ER) levels in breast cancer. To investigate the effect of the BRMs on cellular growth and the characteristics of ER and progesterone receptors (PgR) in the human breast cancer cell line MCF-7, we used OK-432, Krestin (PSK), a protein-bound polysaccharide extracted from Coriolus versicolor, and lentinan, a fungal branched (1...3)-beta-D-glycan. OK432 and PSK dose dependently inhibited DNA synthesis of MCF-7 cells, and the 50% inhibitory concentrations of OK-432 and PSK were 1.2 KE (klinische Einheit, clinical unit)/ml and 200 micrograms/ml, respectively. Lentinan showed no direct anticancer effect in vitro. We found that OK-432 induced a 2-fold increase in ER levels in MCF-7 cells at 0.005 KE/ml, but not in PgR. Lentinan and low-dose PSK did not change ER or PgR levels, but high-dose PSK decreased ER and PgR. We also studied the combined effect of OK-432 and antiestrogens, tamoxifen (TAM) and DP-TAT-59. The combined treatment with OK-432 and TAM showed an additive inhibitory effect on MCF-7 cells. These results suggest that OK-432 may augment the therapeutic effect of TAM in breast cancer.

Thermal-hydraulic interfacing code modules for CANDU reactors

Energy Technology Data Exchange (ETDEWEB)

Liu, W.S.; Gold, M.; Sills, H. [Ontario Hydro Nuclear, Toronto (Canada)] [and others

1997-07-01

The approach for CANDU reactor safety analysis in Ontario Hydro Nuclear (OHN) and Atomic Energy of Canada Limited (AECL) is presented. Reflecting the unique characteristics of CANDU reactors, the procedure of coupling the thermal-hydraulics, reactor physics and fuel channel/element codes in the safety analysis is described. The experience generated in the Canadian nuclear industry may be useful to other types of reactors in the areas of reactor safety analysis.

Thermal-hydraulic interfacing code modules for CANDU reactors

International Nuclear Information System (INIS)

Liu, W.S.; Gold, M.; Sills, H.

1997-01-01

The approach for CANDU reactor safety analysis in Ontario Hydro Nuclear (OHN) and Atomic Energy of Canada Limited (AECL) is presented. Reflecting the unique characteristics of CANDU reactors, the procedure of coupling the thermal-hydraulics, reactor physics and fuel channel/element codes in the safety analysis is described. The experience generated in the Canadian nuclear industry may be useful to other types of reactors in the areas of reactor safety analysis

Labeled OK-432, immunomodulator of streptococcus preparation, in cancer patients

International Nuclear Information System (INIS)

Toki, Hironobu; Ishikawa, Morihiro; Fujii, Masashi; Yumoto, Yasuhiro; Ishimitsu, Tetsusaburo

1982-01-01

We investigated the pharmacokinetics of OK-432, an immunomodulator of streptococcus preparation which, is used in cancer patients for active nonspecific immunotherapy. First, OK-432 was labeled with sup(99m)Technetium in vitro. Four patients with malignancy were studied. By the method of scintigraphy using gamma camera, OK-432 administered intravenously was found to be distributed in the liver, lung and spleen, by the decreasing grade. When OK-432 was administered subcutaneously or intramuscularly in the buttocks, most of the radioactivity of sup(99m)Technetium remained locally at the injected site. These results suggested that OK-432 given intravenously was effectively phagocytized by cells of reticuloendothelial system (RES). Compared with other routes of administration, the intravenous route of OK-432 administration is thus considered more effective in order to stimulate RES, which is responsible for the first step of immune reaction. (author)

Protective action of OK-432 (Picibanil) on the radiation-induced myelosuppression

International Nuclear Information System (INIS)

Aoki, Yoshiro

1986-01-01

This report aims to examine the alleviating action of OK-432 against the radiation-induced myelosuppression in the whole body irradiated mice. The mice treated with OK-432 were given OK-432 with the dose of 5.0 KE by intraperitoneal injection 24 hours before irradiation, while the control group was given 1.0 ml of saline according to the same procedure as the OK-432 group. The fifty percent lethal dose on the 30th day after the whole body irradiation is 700R in the OK-432 group, while it is 580R in the control group. The dose reduction factor (DRF) is 1.21 in this series. The white blood cell counts decreased after irradiation with 300R in both groups. The recovery of WBC counts in the OK-432 group began at the 6th or 7th day after irradiation, while the decreased level continued until the 20th day in the control group. The WBC counts and the spleen weights were examined on the 10th day after irradiation. The WBC counts of the OK-432 group were higher than those of the control group, the difference of which was statistically significant at the 5 % level at 300R. The spleens of the OK-432 group were heavier and larger than those of the control group, the difference of which was statistically significant at the 0.1 % level for the dose range from 300 to 500R. The HE-stained spleen of the OK-432 group on the 10th day after irradiation showed the increase of hematopoietic cells in the enlarged sinus in comparison with that of the control group. The timing of OK-432 administration and the percentage of the survival of the OK-432 group on 30th day, irradiated with 600R to the whole body, were examined. The 5.0 KE of OK-432 was injected from 4 days before and upto 4 days after irradiation to each group. When OK-432 was inected from 2 days before and upto 12 hours after irradiation, the OK-432 group showed the good survival rate in comparison with the control group. (J.P.N.)

AECL experience with low-level radioactive waste technologies

International Nuclear Information System (INIS)

Buckley, L.P.; Charlesworth, D.H.

1988-08-01

Atomic Energy of Canada Limited (AECL), as the Canadian government agency responsible for research and development of peaceful uses of nuclear energy, has had experience in handling a wide variety of radioactive wastes for over 40 years. Low-level radioactive waste (LLRW) is generated in Canada from nuclear fuel manufacturers and nuclear power facilities, from medical and industrial uses of radioisotopes and from research facilities. The technologies with which AECL has strength lie in the areas of processing, storage, disposal and safety assessment of LLRW. While compaction and incineration are the predominant methods practised for solid wastes, purification techniques and volume reduction methods are used for liquid wastes. The methods for processing continue to be developed to improve and increase the efficiency of operation and to accommodate the transition from storage of the waste to disposal. Site-specific studies and planning for a LLRW disposal repository to replace current storage facilities are well underway with in-service operation to begin in 1991. The waste will be disposed of in an intrusion-resistant underground structure designed to have a service life of over 500 years. Beyond this period of time the radioactivity in the waste will have decayed to innocuous levels. Safety assessments of LLRW disposal are performed with the aid of a series of interconnected mathematical models developed at Chalk River specifically to predict the movement of radionuclides through and away from the repository after its closure and the subsequent health effects of the released radionuclides on the public. The various technologies for dealing with radioactive wastes from their creation to disposal will be discussed. 14 refs

Radiation protection aspects of AECL's retube/refurbishment projects

International Nuclear Information System (INIS)

Zhuang, Y.; Boss, C.R.; Pontikakis, N.

2007-01-01

In contrast to the construction of a new nuclear reactor, Retube/Refurbishment of nuclear reactors that have been in operation for many years will involve fabrication of a new core in a radiation environment. Careful planning of the radiation protection (RP) program is crucial to ensure the protection of workers and the environment, and the success of the projects. This paper describes the key RP activities currently underway in AECL's Retube/Refurbishment projects, covering RP during retubing tooling and system designs, retubing work planning, retubing operation, and waste transfer and management. The discussion will focus on RP initiatives from engineering design aspects of the projects. (author)

Sensitivity assessment of fuel performance codes for LOCA accident scenario

Energy Technology Data Exchange (ETDEWEB)

Abe, Alfredo; Gomes, Daniel; Silva, Antonio Teixeira e; Muniz, Rafael O.R. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Giovedi, Claudia; Martins, Marcelo, E-mail: ayabe@ipen.br, E-mail: claudia.giovedi@labrisco.usp.br [Universidade de Sao Paulo (LABRISCO/USP), Sao Paulo, SP (Brazil). Lab. de Análise, Avaliação e Gerenciamento de Risco

2017-07-01

FRAPCON code predicts fuel rod performance in LWR (Light Water Reactor) by modeling fuel responses under normal operating conditions and anticipated operational occurrences; FRAPTRAN code is applied for fuel transient under fast transient and accident conditions. The codes are well known and applied for different purposes and one of the use is to address sensitivity analysis considering fuel design parameters associated to fabrication, moreover can address the effect of physical models bias. The objective of this work was to perform an assessment of fuel manufacturing parameters tolerances and fuel models bias using FRAPCON and FRAPTRAN codes for Loss of Coolant Accident (LOCA) scenario. The preliminary analysis considered direct approach taken into account most relevant manufacturing tolerances (lower and upper bounds) related to design parameters and physical models bias without considering their statistical distribution. The simulations were carried out using the data available in the open literature related to the series of LOCA experiment performed at the Halden reactor (specifically IFA-650.5). The manufacturing tolerances associated to design parameters considered in this paper were: enrichment, cladding thickness, pellet diameter, pellet density, and filling gas pressure. The physical models considered were: fuel thermal expansion, fission gas release, fuel swelling, irradiation creep, cladding thermal expansion, cladding corrosion, and cladding hydrogen pickup. The results obtained from sensitivity analysis addressed the impact of manufacturing tolerances and physical models in the fuel cladding burst time observed for the IFA-650.5 experiment. (author)

Sensitivity assessment of fuel performance codes for LOCA accident scenario

International Nuclear Information System (INIS)

Abe, Alfredo; Gomes, Daniel; Silva, Antonio Teixeira e; Muniz, Rafael O.R.; Giovedi, Claudia; Martins, Marcelo

2017-01-01

FRAPCON code predicts fuel rod performance in LWR (Light Water Reactor) by modeling fuel responses under normal operating conditions and anticipated operational occurrences; FRAPTRAN code is applied for fuel transient under fast transient and accident conditions. The codes are well known and applied for different purposes and one of the use is to address sensitivity analysis considering fuel design parameters associated to fabrication, moreover can address the effect of physical models bias. The objective of this work was to perform an assessment of fuel manufacturing parameters tolerances and fuel models bias using FRAPCON and FRAPTRAN codes for Loss of Coolant Accident (LOCA) scenario. The preliminary analysis considered direct approach taken into account most relevant manufacturing tolerances (lower and upper bounds) related to design parameters and physical models bias without considering their statistical distribution. The simulations were carried out using the data available in the open literature related to the series of LOCA experiment performed at the Halden reactor (specifically IFA-650.5). The manufacturing tolerances associated to design parameters considered in this paper were: enrichment, cladding thickness, pellet diameter, pellet density, and filling gas pressure. The physical models considered were: fuel thermal expansion, fission gas release, fuel swelling, irradiation creep, cladding thermal expansion, cladding corrosion, and cladding hydrogen pickup. The results obtained from sensitivity analysis addressed the impact of manufacturing tolerances and physical models in the fuel cladding burst time observed for the IFA-650.5 experiment. (author)

Particle-tracking code (track3d) for convective solute transport modelling in the geosphere: Description and user`s manual; Programme de reperage de particules (track3d) pour la modelisation du transport par convection des solutes dans la geosphere: description et manuel de l`utilisateur

Energy Technology Data Exchange (ETDEWEB)

Nakka, B W; Chan, T

1994-12-01

A deterministic particle-tracking code (TRACK3D) has been developed to compute convective flow paths of conservative (nonreactive) contaminants through porous geological media. TRACK3D requires the groundwater velocity distribution, which, in our applications, results from flow simulations using AECL`s MOTIF code. The MOTIF finite-element code solves the transient and steady-state coupled equations of groundwater flow, solute transport and heat transport in fractured/porous media. With few modifications, TRACK3D can be used to analyse the velocity distributions calculated by other finite-element or finite-difference flow codes. This report describes the assumptions, limitations, organization, operation and applications of the TRACK3D code, and provides a comprehensive user`s manual.

Radiotherapy of medulloblastoma combined with OK-432 (Picibanil)

International Nuclear Information System (INIS)

Aoki, Yoshiro

1986-01-01

The OK-432 group consists of 8 Medulloblastoma patients, 5 Pinealoma patients and 1 Pons glioma patient, while the historical control group consists of 12 Medulloblastoma patients who have been treated only with radiation at NIRS. The frequency of the week when the value of white blood cell counts decreased below 2,500 was 13 weeks per 98 weeks of total observation period (13.3 %) in the OK-432 group. However, it was 37 weeks per 103 weeks (35.9 %) in the control group. The frequency of the week when the value of the platelet counts decreased below 10 x 10 4 was 5 weeks per 98 weeks (5.1 %) in the OK-432 group, while it was 21 weeks per 103 weeks (20.4 %) in the control group. The OK-432 group received 54.4 ± 3.3 Gy/ 34 ± 2 fractions/ 51 ± 4 days to the cerebellar tumor, except a one-year-old girl who received only a half of the radiation dose as the other patients who were older than 5 years, while the control group received 47.2 ± 7.3 Gy/ 34 ± 7 fractions/ 49 ± 10 days. In terms of TDF, the OK-432 group received 83.5 ± 8.7 and the control group received 63.5 ± 10.2, whereby the difference between the OK-432 group and the control group is statistically significant at 2 % level. To the spinal cord, the OK-432 group received 27.1 ± 3.1 Gy/ 27 ± 5 fractions/ 41 ± 9 days, while the control group received 25.4 ± 7.5 Gy/ 27 ± 13 fractions/ 43 ± 25 days. The survival rate of 8 Medulloblastoma patients treated with radiation combined with OK-432 is as follows : the relative survival rate is 75.1 % in one year, 62.5 % in 3 years and 62.5 % in 5 years, in contrast to the rate of 73.3 % in one year, 20.0 % in 3 years and 20.0 % in 5 years in the control group. (J.P.N.)

Adult cystic hygroma: successful use of OK-432 (Picibanil).

Science.gov (United States)

Woolley, S L; Smith, D R K; Quine, S

2008-11-01

We report an adult case of cystic lymphangioma treated with OK-432 (Picibanil). A case report and review of the literature concerning the use of OK-432 to treat cystic lymphangioma is presented. A 31-year-old woman developed a cystic lymphangioma four weeks post-partum. This was treated initially by aspiration, for diagnostic purposes. Investigation suggested that surgery would be challenging. A review of the literature demonstrated success with OK-432 in the treatment of this condition, although primarily in the paediatric population. This patient was successfully treated thus, and at the time of writing remained symptom free. A suggested management plan is outlined. Treatment with OK-432 is useful in the management of cystic lymphangiomas in adults and should be considered as first line treatment.

AECL research programmes in materials science

International Nuclear Information System (INIS)

Cox, B.; Eastwood, T.A.; Mitchell, I.V.; Dutton, R.

1980-10-01

The high capacity factors achieved by CANDU nuclear power reactors can be attributed in part to the careful attention which has been paid in the concept and design phases to the selection of materials. Improved tolerance of these materials to the hostile conditions of a reactor core depends upon our understanding of such phenomena as radiation damage, corrosion and cracking. This report is an introduction to some of the fundamental and underlying research programmes that have evolved at the AECL laboratories in response to this need. The interactions of energetic atomic particles with solids on a microscopic scale are considered, first under the general heading of radiation effects, followed by sections on energy loss processes, ion channeling, and crystal lattice defects. The latter section leads into the important programmes on deformation processes (creep and growth) in zirconium. The final section discusses the extensive work on the oxidation and environmental cracking of zirconium alloys. (auth)

Research reactor fuel development at AECL

International Nuclear Information System (INIS)

Sears, D.F.; Wang, N.

2000-09-01

This paper reviews recent U 3 Si 2 and U-Mo dispersion fuel development activities at AECL. The scope of work includes fabrication development, irradiation testing, post-irradiation examination and performance qualification. U-Mo alloys with a variety of compositions, ranging from 6 to 10 wt % Mo, have been fabricated with high purity and homogeneity in the product. The alloys and powders were characterized using optical and scanning electron microscopy, chemical analysis, and X-ray diffraction and neutron diffraction analysis. U-Mo powder samples have been supplied to the Argonne National Laboratory for irradiation testing in the ATR reactor. Low-enriched uranium fuel elements containing U-7 wt % Mo and U-10 wt % Mo with loadings up to 4.5 gU/cm 3 have been fabricated at CRL for irradiation testing in the NRU reactor. The U-Mo fuel elements will be tested in NRU at linear powers up to 145 kW/m, and to 85 atom % 235 U burnup. (author)

AECL's progress in DUPIC fuel development

International Nuclear Information System (INIS)

Sullivan, J.D.; Ryz, M.A.; Lee, J.W.

1997-01-01

Previous papers described progress in choosing a fabrication route for the DUPIC (Direct Use of Spent PWR Fuel in CANDU) fuel cycle [1], details of the OREOX (Oxidation Reduction of Oxide fuel) process, and preliminary results of out-cell and small-scale in-cell experiments [2]. AECL's project to develop the DUPIC fuel cycle has now progressed to the stage of fabricating DUPIC fuel elements for irradiation testing in a research reactor. Because of the high radiation fields around the spent PWR fuel, all work is being done in hot cells. The equipment used for fabrication of the DUPIC fuel elements is described in this paper. The commissioning, in-cell installation and current status of the fabrication process are also described and plans for the completion of this phase of the DUPIC project are outlined. The goal of this phase of the project is demonstration of the technical feasibility of the DUPIC fuel cycle. (author)

Research reactor fuel development at AECL

International Nuclear Information System (INIS)

Sears, D.F.; Wang, N.

2000-01-01

This paper reviews recent U 3 Si 2 and U-Mo dispersion fuel development activities at AECL. The scope of work includes fabrication development, irradiation testing, postirradiation examination and performance qualification. U-Mo alloys with a variety of compositions, ranging from 6 to 10 wt % Mo, have been fabricated with high purity and homogeneity in the product. The alloys and powders were characterized using optical and scanning electron microscopy, chemical analysis, and X-ray diffraction and neutron diffraction analysis. U-Mo powder samples have been supplied to the Argonne National Laboratory for irradiation testing in the ATR reactor. Low-enriched uranium fuel elements containing U-7 wt % Mo and U-10 wt % Mo with loadings up to 4.5 gU/cm 3 have been fabricated at CRL for irradiation testing in the NRU reactor. The U-Mo fuel elements will be tested in NRU at linear powers up to 145 kW/m, and to 85 atom % 235 U burnup. (author)

Linking CATHENA with other computer codes through a remote process

Energy Technology Data Exchange (ETDEWEB)

Vasic, A.; Hanna, B.N.; Waddington, G.M. [Atomic Energy of Canada Limited, Chalk River, Ontario (Canada); Sabourin, G. [Atomic Energy of Canada Limited, Montreal, Quebec (Canada); Girard, R. [Hydro-Quebec, Montreal, Quebec (Canada)

2005-07-01

'Full text:' CATHENA (Canadian Algorithm for THErmalhydraulic Network Analysis) is a computer code developed by Atomic Energy of Canada Limited (AECL). The code uses a transient, one-dimensional, two-fluid representation of two-phase flow in piping networks. CATHENA is used primarily for the analysis of postulated upset conditions in CANDU reactors; however, the code has found a wider range of applications. In the past, the CATHENA thermalhydraulics code included other specialized codes, i.e. ELOCA and the Point LEPreau CONtrol system (LEPCON) as callable subroutine libraries. The combined program was compiled and linked as a separately named code. This code organizational process is not suitable for independent development, maintenance, validation and version tracking of separate computer codes. The alternative solution to provide code development independence is to link CATHENA to other computer codes through a Parallel Virtual Machine (PVM) interface process. PVM is a public domain software package, developed by Oak Ridge National Laboratory and enables a heterogeneous collection of computers connected by a network to be used as a single large parallel machine. The PVM approach has been well accepted by the global computing community and has been used successfully for solving large-scale problems in science, industry, and business. Once development of the appropriate interface for linking independent codes through PVM is completed, future versions of component codes can be developed, distributed separately and coupled as needed by the user. This paper describes the coupling of CATHENA to the ELOCA-IST and the TROLG2 codes through a PVM remote process as an illustration of possible code connections. ELOCA (Element Loss Of Cooling Analysis) is the Industry Standard Toolset (IST) code developed by AECL to simulate the thermo-mechanical response of CANDU fuel elements to transient thermalhydraulics boundary conditions. A separate ELOCA driver program

Linking CATHENA with other computer codes through a remote process

International Nuclear Information System (INIS)

Vasic, A.; Hanna, B.N.; Waddington, G.M.; Sabourin, G.; Girard, R.

2005-01-01

'Full text:' CATHENA (Canadian Algorithm for THErmalhydraulic Network Analysis) is a computer code developed by Atomic Energy of Canada Limited (AECL). The code uses a transient, one-dimensional, two-fluid representation of two-phase flow in piping networks. CATHENA is used primarily for the analysis of postulated upset conditions in CANDU reactors; however, the code has found a wider range of applications. In the past, the CATHENA thermalhydraulics code included other specialized codes, i.e. ELOCA and the Point LEPreau CONtrol system (LEPCON) as callable subroutine libraries. The combined program was compiled and linked as a separately named code. This code organizational process is not suitable for independent development, maintenance, validation and version tracking of separate computer codes. The alternative solution to provide code development independence is to link CATHENA to other computer codes through a Parallel Virtual Machine (PVM) interface process. PVM is a public domain software package, developed by Oak Ridge National Laboratory and enables a heterogeneous collection of computers connected by a network to be used as a single large parallel machine. The PVM approach has been well accepted by the global computing community and has been used successfully for solving large-scale problems in science, industry, and business. Once development of the appropriate interface for linking independent codes through PVM is completed, future versions of component codes can be developed, distributed separately and coupled as needed by the user. This paper describes the coupling of CATHENA to the ELOCA-IST and the TROLG2 codes through a PVM remote process as an illustration of possible code connections. ELOCA (Element Loss Of Cooling Analysis) is the Industry Standard Toolset (IST) code developed by AECL to simulate the thermo-mechanical response of CANDU fuel elements to transient thermalhydraulics boundary conditions. A separate ELOCA driver program starts, ends

Advanced fuel development at AECL: What does the future hold for CANDU fuels/fuel cycles?

Energy Technology Data Exchange (ETDEWEB)

Kupferschmidt, W.C.H. [Atomic Energy of Canada Limited, Chalk River, Ontario (Canada)

2013-07-01

This paper outlines advanced fuel development at AECL. It discusses expanding the limits of fuel utilization, deploy alternate fuel cycles, increase fuel flexibility, employ recycled fuels; increase safety and reliability, decrease environmental impact and develop proliferation resistant fuel and fuel cycle.

From the teachers' eyes: An ethnographic-case study on developing models of Informal Formative Assessments (IFA) and understanding the challenges to effective implementation in science classrooms

Science.gov (United States)

Sezen, Asli

The emphasis on socio-cultural theories of learning has required the understanding of multi-dimensional, dynamic and social nature of acquiring the scientific knowledge and practices. Recent policy documents suggest a focus on formative and dynamic assessment practices that will help understand and improve the complex nature of scientific learning in classrooms. This study focuses on teachers' use of "Informal Formative Assessments (IFA)" aimed at improving students' learning and teachers' frequent recognition of students' learning process. The study was designed as an ethnographic case study of four middle school teachers and their students at a local charter school. The data of the study included (a) teachers' responses to history of teaching questionnaire (b) video and audio records of teachers' assessment practices during two different scientific projects (c) video and audio records of ethnographic interviews with teachers during their reflections on their practices, and (d) field notes taken by the researcher to understand the assessment culture of the school. The analytical tools from sociolinguistics (e.g., transcripts and event maps) were prepared and discourse analysis based in an ethnographic perspective was used to analyze the data. Moreover, Cultural-Historical Activity Theory (CHAT) was also introduced as an alternative data analysis framework for understanding the role of division of labor among the elements of the community on the challenges and the outcomes of IFA practices. The findings from the analysis of the classroom discourse showed three different types of IFA cycles: connected, non-connected, and repeating. The analysis of the teachers' reflections showed that the effectiveness of these cycles did not only depend on whether the cycles were connected, but also on other variables such as the phase of the lessons and student's identities and abilities. Teachers' reflections during researcher-teacher meetings on the concept and the aims of IFA

OK-432 (Picibanil) therapy for lymphangiomas in children.

Science.gov (United States)

Laranne, J; Keski-Nisula, L; Rautio, Riitta; Rautiainen, Markus; Airaksinen, Mari

2002-05-01

Lymphangiomas are benign, soft tumors that most often affect the head and neck area, usually causing marked cosmetic and functional problems. Treatment options include surgery and a large number of different sclerotherapy agents. Surgical treatment is challenging because of the need for complete excision. The risk of damage to surrounding structures or poor cosmetic results is high. Various sclerotherapy agents have been shown to have minimal effects on lymphangiomas. Their use has been associated with severe systemic, local and cosmetic side effects. OK-432 (Picibanil) is a new and promising form of sclerotherapy. An intracystic injection of OK-432 produces a local inflammatory reaction, which leads to resolution of the lesion. We have treated 11 pediatric lymphangioma patients with OK-432 with excellent results: complete regression in six, marked regression in four and no response in one case. Local swelling should be anticipated, especially when treating lesions near the upper airway. We found OK-432 injections to be safe and effective as a first line of treatment for lymphangiomas.

The Atomic Energy of Canada Limited (AECL) employee health study

International Nuclear Information System (INIS)

Myers, D.K.; Werner, M.M.

1985-01-01

A preliminary examination of records relating to past Chalk River employees provides some reassurance that large numbers of cancer deaths that might be related to occupational radiation exposure do not exist in the groups of employees studied to the end of 1982. The lack of reliable information on deaths of ex-employees who left AECL for other employment prevented the inclusion of this group in this preliminary study. This information will presumably be obtained during the course of the more comprehensive Atomic Energy of Canada Ltd. employee health study. 6 refs

Sensitivity of 238U resonance absorption to library multigroup structure as calculated by WIMS-AECL

International Nuclear Information System (INIS)

Laughton, P.J.; Donnelly, J.V.

1995-01-01

In simulations of the TRX-1 experimental lattice, WIMS-AECL overpredicts, relative to MCNP, resonance absorption in neutron-energy groups containing the three large, low-lying resonances of 238 U when a standard ENDF/B-V-based library is used. A total excess in these groups of 4.0 neutron captures by 238 U per thousand fission neutrons has been observed. Similar comparisons are made in this work for the MIT-4 experimental lattice and simplified CANDU lattice cells containing 37-element fuel, with and without heavy-water coolant. Eleven different 89-group cross-section libraries were constructed for WIMS-AECL from ENDF/B-V data: only the neutron-energy-group boundaries used in generating multigroup cross sections and the Goldstein-Cohen correction factors differ from one library to the next. The first library uses the original 89-group structure, and the other ten involve energy groups of varying widths centred on the three large, low-lying resonances of 238 U. For TRX-1, some reduction in total discrepancy in 238 U capture can be achieved by using a new structure, although the improvement is small. The discrepancies in 238 U capture are of the same order for the MIT-4 case as those observed for TRX-1 for both the original group structure and the ten new structures. The WIMS-AECL calculation of 238 U resonance absorption in the same ranges of energy for the simplified CANDU 37-element lattice are in better agreement with MCNP than they are for TRX-1 and MIT-4: when the original structure is used, WIMS-AECL underpredicts total capture rate by 238 U in the energy range of interest by only 0.56 per thousand fission neutrons (coolant present) and 0.88 per thousand fission neutrons (voided coolant channel). The discrepancies are reduced when some of the new structures are used. For almost all of the cases considered here-TRX-1, MIT-4 and CANDU with coolant-better group-by-group agreement of 238 U capture around the 6.67-eV resonance is achieved by using a new library

Analysis of pellet center temperatures measured in HALDEN IFA-224 using program FREG-3

International Nuclear Information System (INIS)

Harayama, Yasuo; Izumi, Fumio

1977-01-01

To verify the program FREG-3, we compared the calculations by FREG-3 with those by measurement in a HALDEN instrumented fuel assembly, IFA-224. FREG-3 generally gives higher pellet center temperatures than the measurement. The temperature distribution calculated by FREG-3 to estimate the stored energy in fuel rods results in safety side. (auth.)

28 CFR 43.2 - Obligations of persons receiving care and treatment.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Obligations of persons receiving care and treatment. 43.2 Section 43.2 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) RECOVERY OF COST OF HOSPITAL AND MEDICAL CARE AND TREATMENT FURNISHED BY THE UNITED STATES § 43.2 Obligations of persons...

Comparison of biomass from integrated fixed-film activated sludge (IFAS), moving bed biofilm reactor (MBBR) and membrane bioreactor (MBR) treating recalcitrant organics: Importance of attached biomass.

Science.gov (United States)

Huang, Chunkai; Shi, Yijing; Xue, Jinkai; Zhang, Yanyan; Gamal El-Din, Mohamed; Liu, Yang

2017-03-15

This study compared microbial characteristics and oil sands process-affected water (OSPW) treatment performance of five types of microbial biomass (MBBR-biofilm, IFAS-biofilm, IFAS-floc, MBR-aerobic-floc, and MBR-anoxic-floc) cultivated from three types of bioreactors (MBBR, IFAS, and MBR) in batch experiments. Chemical oxygen demand (COD), ammonium, acid extractable fraction (AEF), and naphthenic acids (NAs) removals efficiencies were distinctly different between suspended and attached bacterial aggregates and between aerobic and anoxic suspended flocs. MBR-aerobic-floc and MBR-anoxic-floc demonstrated COD removal efficiencies higher than microbial aggregates obtained from MBBR and IFAS, MBBR and IFAS biofilm had higher AEF removal efficiencies than those obtained using flocs. MBBR-biofilm demonstrated the most efficient NAs removal from OSPW. NAs degradation efficiency was highly dependent on the carbon number and NA cyclization number according to UPLC/HRMS analysis. Mono- and di-oxidized NAs were the dominant oxy-NA species in OSPW samples. Microbial analysis with quantitative polymerase chain reaction (q-PCR) indicated that the bacterial 16S rRNA gene abundance was significantly higher in the batch bioreactors with suspended flocs than in those with biofilm, the NSR gene abundance in the MBR-anoxic bioreactor was significantly lower than that in aerobic batch bioreactors, and denitrifiers were more abundant in the suspended phase of the activated sludge flocs. Copyright © 2016 Elsevier B.V. All rights reserved.

Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

Science.gov (United States)

Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

2016-06-01

Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

Simulating thermal behavior of AECL's spent fuel dry storage system with CATHENA

Energy Technology Data Exchange (ETDEWEB)

Sabourin, G. [Atomic Energy of Canada Limited, Montreal, PQ (Canada)

1998-07-01

This paper documents the comparisons between CATHENA predictions and temperature measurements taken at the Gentilly-2 NPP spent fuel dry storage facility and in a mock--up of a storage basket placed inside a storage cylinder. It also presents CATHENA temperature predictions related to the storage of spent fuel in MACSTOR modules as planned for Ignalina NPP, Lithuania. CATHENA has been chosen because it can simulate many noncondensable gases including air and helium, and because of its great flexibility in the representation of the MACSTOR module geometry. The results of the simulations show good agreement with the experimental measurements. The two comparisons indicate that CATHENA can be used to simulate heat transfer from the fuel to the external air circuit of the spent fuel dry storage system. For the Ignalina MACSTOR module, containing RBMK fuel having higher heat release than typical CANDU fuel, CATHENA predicts that the maximum fuel temperature is expected to be around 240 deg C, giving an acceptable margin below the maximum allowed temperature of 300 deg C. In conclusion, this paper shows that the thermalhydraulic code CATHENA can accurately predict the thermal behavior AECL's air cooled spent fuel dry storage system. (author)

27 CFR 4.32a - Voluntary disclosure of major food allergens.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Voluntary disclosure of major food allergens. 4.32a Section 4.32a Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX... Requirements for Wine § 4.32a Voluntary disclosure of major food allergens. (a) Definitions. For purposes of...

Achieve efficient nitrogen removal from real sewage in a plug-flow integrated fixed-film activated sludge (IFAS) reactor via partial nitritation/anammox pathway.

Science.gov (United States)

Yang, Yandong; Zhang, Liang; Cheng, Jun; Zhang, Shujun; Li, Baikun; Peng, Yongzhen

2017-09-01

This study tested the feasibility of plug-flow integrated fixed-film activated sludge (IFAS) reactor in applying sewage partial nitritation/anammox (PN/A) process. The IFAS reactor was fed with real pre-treated sewage (C/N ratio=1.3) and operated for 200days. High nitrogen removal efficiency of 82% was achieved with nitrogen removal rates of 0.097±0.019kgN/(m 3 ·d). Therefore, plug-flow IFAS reactor could be an alternative to applying sewage PN/A process. Besides, it was found that the stability of sewage PN/A process was significantly affected by residual ammonium. Nitrate accumulated in effluent and PN/A performance deteriorated when residual ammonium was below 1mg/L. On the contrary, long-term stable PN/A operation was achieved when residual ammonium was over 3mg/L. Copyright © 2017 Elsevier Ltd. All rights reserved.

Studies on groundwater flow and radionuclide migration at underground environments. Final report of collaboration research between JAERI and AECL

International Nuclear Information System (INIS)

Ogawa, Hiromichi; Nagao, Seiya; Yamaguchi, Tetsuji

2001-01-01

The Japan Atomic Energy Research Institute (JAERI) conducted a collaboration program Phase II with the Atomic Energy of Canada Limited (AECL) from 1994 to 1998. The program was started to contribute the establishment of safety assessment methodology for the geological disposal of high-level radioactive wastes on the basis of the results from the Phase I program (1987-1993). The Phase II program consisted of following experimental items: (1) radionuclide migration experiments for quarried blocks (1m x 1m x 1m) of granite with natural fracture under in-situ geochemical conditions at 240 m level of Underground Research Laboratory of AECL; (2) study on the effects of dissolved organic materials extracted from natural groundwaters on radionuclide migration; (3) study on groundwater flow using environmental isotopes at two different geologic environments; (4) development of groundwater flow and radionuclide transport model for heterogeneous geological media. The mobility of radionuclides was retarded in the fracture by the deep geological conditions and the fracture paths. The groundwater humic substances with high molecular size were enhanced for the mobility of radionuclides in the sand and granitic media due to the complexation. The application of 36 Cl and 129 I for the analysis on the long-term groundwater flow can be validated on the basis of investigation at the URL site. Moreover, the geostatistical model for the analysis on groundwater flow and radionuclide migration was developed, and was able to describe the groundwater flow and the migration of environmental tracers at AECL sites. This report summaries the results of the Phase II program between JAERI and AECL. (author)

Studies on groundwater flow and radionuclide migration at underground environments. Final report of collaboration research between JAERI and AECL

Energy Technology Data Exchange (ETDEWEB)

Ogawa, Hiromichi; Nagao, Seiya; Yamaguchi, Tetsuji [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment] [and others

2001-01-01

The Japan Atomic Energy Research Institute (JAERI) conducted a collaboration program Phase II with the Atomic Energy of Canada Limited (AECL) from 1994 to 1998. The program was started to contribute the establishment of safety assessment methodology for the geological disposal of high-level radioactive wastes on the basis of the results from the Phase I program (1987-1993). The Phase II program consisted of following experimental items: (1) radionuclide migration experiments for quarried blocks (1m x 1m x 1m) of granite with natural fracture under in-situ geochemical conditions at 240 m level of Underground Research Laboratory of AECL; (2) study on the effects of dissolved organic materials extracted from natural groundwaters on radionuclide migration; (3) study on groundwater flow using environmental isotopes at two different geologic environments; (4) development of groundwater flow and radionuclide transport model for heterogeneous geological media. The mobility of radionuclides was retarded in the fracture by the deep geological conditions and the fracture paths. The groundwater humic substances with high molecular size were enhanced for the mobility of radionuclides in the sand and granitic media due to the complexation. The application of {sup 36}Cl and {sup 129}I for the analysis on the long-term groundwater flow can be validated on the basis of investigation at the URL site. Moreover, the geostatistical model for the analysis on groundwater flow and radionuclide migration was developed, and was able to describe the groundwater flow and the migration of environmental tracers at AECL sites. This report summaries the results of the Phase II program between JAERI and AECL. (author)

Computer code qualification program for the Advanced CANDU Reactor

International Nuclear Information System (INIS)

Popov, N.K.; Wren, D.J.; Snell, V.G.; White, A.J.; Boczar, P.G.

2003-01-01

Atomic Energy of Canada Ltd (AECL) has developed and implemented a Software Quality Assurance program (SQA) to ensure that its analytical, scientific and design computer codes meet the required standards for software used in safety analyses. This paper provides an overview of the computer programs used in Advanced CANDU Reactor (ACR) safety analysis, and assessment of their applicability in the safety analyses of the ACR design. An outline of the incremental validation program, and an overview of the experimental program in support of the code validation are also presented. An outline of the SQA program used to qualify these computer codes is also briefly presented. To provide context to the differences in the SQA with respect to current CANDUs, the paper also provides an overview of the ACR design features that have an impact on the computer code qualification. (author)

40 CFR 52.432 - Significant deterioration of air quality.

Science.gov (United States)

2010-07-01

... quality. 52.432 Section 52.432 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... deterioration of air quality. (a) The requirements of sections 160 through 165 of the Clean Air Act are not met... air quality. (b) Regulation for preventing significant deterioration of air quality. The provisions of...

Implementing the AECL decommissioning quality assurance program at the Chalk River and Whiteshell Laboratories

International Nuclear Information System (INIS)

Colotelo, C.A.; Attas, E.M.; Stephens, M.E.

2006-01-01

This paper describes the approach and progress in developing, implementing and maintaining a quality assurance (QA) program for decommissioning at the nuclear facilities managed by Atomic Energy of Canada Limited (AECL). Decommissioning activities conducted by AECL are varied in nature, so the QA program must provide adequate flexibility, while maintaining consistency with accepted quality standards. Well-written documentation adhering to the applicable decommissioning standards is a key factor. Manager commitment and input during the writing of the documentation are also important to ensure relevance of the QA program and effectiveness of implementation. Training in the use of the quality assurance plan and procedures is vital to the understanding of the QA program. Beyond the training aspect there is a need for the quality assurance program to be supported by a QA subject expert who is able to advise the group in implementing the Quality Program with consistency over the range of decommissioning work activities and to provide continual assessment of the quality assurance program for efficiency and effectiveness, with a concomitant continuous improvement process. (author)

Rationalization and future planning for AECL's research reactor capability

International Nuclear Information System (INIS)

Slater, J.B.

1990-01-01

AECL's research reactor capability has played a crucial role in the development of Canada's nuclear program. All essential concepts for the CANDU reactors were developed and tested in the NRX and NRU reactors, and in parallel, important contributions to basic physics were made. The technical feasibility of advanced fuel cycles and of the organic-cooled option for CANDU reactors were also demonstrated in the two reactors and the WR-1 reactor. In addition, an important and growing radio-isotope production industry was established and marketed on a world-wide basis. In 1984, however, it was recognized that a review and rationalization of the research reactor capability was required. The commercial success of the CANDU reactor system had reduced the scope and size of the required development program. Limited research and development funding and competition from other research facilities and programs, required that the scope be reduced to a support basis essential to maintain strategic capability. Currently, AECL, is part-way through this rationalization program and completion should be attained during 1992/93 when the MAPLE reactor is operational and decisions on NRX decommissioning will be made. A companion paper describes some of the unique operational and maintenance problems which have resulted from this program and the solutions which have been developed. Future planning must recognize the age of the NRU reactor (currently 32 years) and the need to plan for eventual replacement. Strategy is being developed and supporting studies include a full technical assessment of the NRU reactor and the required age-related upgrading program, evaluation of the performance characteristics and costs of potential future replacement reactors, particularly the advanced MAPLE concept, and opportunities for international co-operation in developing mutually supportive research programs

A study of the mortality of AECL employees. V

International Nuclear Information System (INIS)

Gribbin, M.A.; Howe, G.R.; Weeks, J.L.

1992-09-01

A study has been underway since 1980 on the mortality of past and present AECL employees. The study population consists of 13,491 persons, 9997 males and 3494 females, for a total of 262,403.5 person-years at risk. During the period 1950-1985, 1299 deaths occurred in this population. The number of female deaths (121) is too few for detailed analysis, but the 1178 deaths in the male population represent a useful basis for this study. The present report examines mortality patterns in the AECL cohort between 1950 and 1985 by comparing the observed mortality with that expected in the general population for three groups of workers: those with no exposure, those with up to 50 mSv, and those with more than 50 mSv. Comparisons among the three groups of employees are discussed. The number of deaths is fewer than would be expected on the basis of general population statistics for both males who were exposed to ionizing radiation and those who were not exposed. The findings were similar for the 'all cancer' and 'all other deaths' groupings. In the group of exposed males, elevated Standardized Mortality Ratios (SMRs) are seen for non-Hodgkin's lymphoma and for buccal cavity, rectum and rectosigmoid junction, and prostate cancers. There are elevated SMRs for lymphatic and myeloid leukemias and for large intestine, prostate, brain and biliary system cancers in the 'unexposed' male group. The number of cases identified in all of these cancers is small and the confidence intervals are wide, such that none of the elevated SMRs is statistically significant. The report compares the findings of this study with those of similar studies published in the past decade. (Author) (28 tabs., 33 refs., 2 figs.)

The effect of OK-432 (Picibanil) injection on the histopathology of nasal turbinate.

Science.gov (United States)

Sengul, S; Kaygusuz, I; Akin, M M; Yalcin, Ş; Karlidag, T; Keles, E; Arslan, I

2015-12-01

This study aimed to assess the histopathological effect of OK-432 (Picibanil) on rabbit nasal turbinates. A total of 21 rabbits were divided into 3 treatment groups and various parts of both nasal turbinates were injected with 0.5 ml OK-432, 0.2 ml OK-432 or 0.6 ml saline (control). Bilateral nasal turbinates were later excised and studied under light microscopy to assess any histopathological changes. Animals in the 0.2 ml and 0.5 ml OK-432 groups exhibited mild ciliary loss, goblet cell loss and epithelial damage, and a marked increase in inflammatory cell infiltration, submucosal vascularisation and fibrosis. There was a significant difference in histopathological changes between the two OK-432 treated groups. In addition, each OK-432 treated group had significantly more inflammatory cell infiltration, increased submucosal vascularisation and fibrosis compared with controls. The marked fibrosis observed in OK-432-injected turbinates may be responsible for a reduction in turbinate size.

Radiochemistry Lab Decommissioning and Dismantlement. AECL, Chalk River Labs, Ontario, Canada

International Nuclear Information System (INIS)

Kenny, Stephen

2008-01-01

Atomic Energy of Canada (AECL) was originally founded in the mid 1940's to perform research in radiation and nuclear areas under the Canadian Defense Department. In the mid 50's The Canadian government embarked on several research and development programs for the development of the Candu Reactor. AECL was initially built as a temporary site and is now faced with many redundant buildings. Prior to 2004 small amounts of Decommissioning work was in progress. Many reasons for deferring decommissioning activities were used with the predominant ones being: 1. Reduction in radiation doses to workers during the final dismantlement, 2. Development of a long-term solution for the management of radioactive wastes in Canada, 3. Financial constraints presented by the number of facilities shutdown that would require decommissioning funds and the absence of an approved funding strategy. This has led to the development of a comprehensive decommissioning plan that is all inclusive of AECL's current and legacy liabilities. Canada does not have a long-term disposal site; therefore waste minimization becomes the driving factor behind decontamination for decommissioning before and during dismantlement. This decommissioning job was a great learning experience for decommissioning and the associated contractors who worked on this project. Throughout the life of the project there was a constant focus on waste minimization. This focus was constantly in conflict with regulatory compliance primarily with respect to fire regulations and protecting the facility along with adjacent facilities during the decommissioning activities. Discrepancies in historical documents forced the project to treat every space as a contaminated space until proven differently. Decommissioning and dismantlement within an operating site adds to the complexity of the tasks especially when it is being conducted in the heart of the plant. This project was very successful with no lost time accidents in over one hundred

Basic research and industrialization of CANDU advanced fuel - A research for the improvement of RFSP code

Energy Technology Data Exchange (ETDEWEB)

Kim, Chang Hyo; Jang, Chang Sun; Han, Tae Young [Seoul National University, Seoul (Korea)

2000-03-01

The objective of this project is to improve the RFSP code by adopting three dimensional two neutron energy group model and accelerated iterative solution scheme (FDM3D) to 2 group diffusion equations as well. The major contents of this research are the derivation of the finite difference equation to three dimensional two neutron energy group diffusion equation, application of accelerated iterative solution scheme to the finite difference diffusion equation and validation of the improved RFSP code (FDM3D) through benchmark tests. We have shown that SOR/Chebyshev two parameter method and BICG-STAB/Wielandt method are more effective than that of RFSP in terms of computing speed. SOR/Chebyshev two parameter method shows better efficiency than BICG-STAB/Wielandt method. Because calculation efficiency of the latter depends on the right choice of pre-conditioner, however, it is considered that more studies are necessary to improve the efficiency of this latter method and to validate it. We have incorporated the new efficient method into the existing RFSP so that the resulting RFSP becomes much faster and more accurate. RFSP currently uses POWDERPUFS code as main lattice code, which is adequate to the neutron energy group model of RFSP. Because of this, we can not make the full advantage of advanced RFSP without adopting lattice code WIMS-AECL which can generate exact two neutron energy group constants. Therefore, we suggest developing a new CANDU design and analysis code which incorporate WIMS-AECL into FDM3D. 16 refs., 10 figs., 23 tabs. (Author)

Prevention of radiation-induced bacteraemia by post-treatment with OK-432 and aztreonam

Energy Technology Data Exchange (ETDEWEB)

Kurishita, A.; Ono, T. (Tohoku Univ., Sendai (Japan). School of Medicine); Uchida, A. (Kyoto Univ. (Japan). Radiation Biology Center)

1993-03-01

The effects of combined treatment with OK-432, an immunomodulator prepared from Streptococcus haemolyticus, and aztreonam, a monobactum antibiotic, in the prevention of radiation-induced bacteraemia and mortality were examined in ICR-MCH mice irradiated with 9.5 Gy. The organisms recovered from the irradiated mice were Streptococcus faecalis and Proteus mirabilis. Treatment with aztreonam reduced the incidence of mice infected with Proteus mirabilis (p<0.01), but it showed no efficacy on Streptococcus faecalis. OK-432 could reduce the frequency of bacteraemia attributed to both organisms (p<0.05). Combined treatment with OK-432 and aztreonam further decreased the incidence of bacteraemia by both organisms; no organisms were recovered at 14 days following irradiation. The survival rate at 30 days following irradiation was 80% in mice treated with OK-432 plus aztreonam and 55% with OK-432 alone, while it was 0% in the groups treated with aztreonam or saline alone. These results indicated that combined treatment with OK-432 and a suitable antibiotic such as aztreonam is more effective than OK-432 or aztreonam alone. (Author).

Prevention of radiation-induced bacteraemia by post-treatment with OK-432 and aztreonam

International Nuclear Information System (INIS)

Kurishita, A.; Ono, T.; Uchida, A.

1993-01-01

The effects of combined treatment with OK-432, an immunomodulator prepared from Streptococcus haemolyticus, and aztreonam, a monobactum antibiotic, in the prevention of radiation-induced bacteraemia and mortality were examined in ICR-MCH mice irradiated with 9.5 Gy. The organisms recovered from the irradiated mice were Streptococcus faecalis and Proteus mirabilis. Treatment with aztreonam reduced the incidence of mice infected with Proteus mirabilis (p<0.01), but it showed no efficacy on Streptococcus faecalis. OK-432 could reduce the frequency of bacteraemia attributed to both organisms (p<0.05). Combined treatment with OK-432 and aztreonam further decreased the incidence of bacteraemia by both organisms; no organisms were recovered at 14 days following irradiation. The survival rate at 30 days following irradiation was 80% in mice treated with OK-432 plus aztreonam and 55% with OK-432 alone, while it was 0% in the groups treated with aztreonam or saline alone. These results indicated that combined treatment with OK-432 and a suitable antibiotic such as aztreonam is more effective than OK-432 or aztreonam alone. (Author)

Modeling approach for annular-fuel elements using the ASSERT-PV subchannel code

International Nuclear Information System (INIS)

Dominguez, A.N.; Rao, Y.

2012-01-01

The internally and externally cooled annular fuel (hereafter called annular fuel) is under consideration for a new high burn-up fuel bundle design in Atomic Energy of Canada Limited (AECL) for its current, and its Generation IV reactor. An assessment of different options to model a bundle fuelled with annular fuel elements is presented. Two options are discussed: 1) Modify the subchannel code ASSERT-PV to handle multiple types of elements in the same bundle, and 2) coupling ASSERT-PV with an external application. Based on this assessment, the selected option is to couple ASSERT-PV with the thermalhydraulic system code CATHENA. (author)

Analysis of the results for the AECL cohort in the IARC study on the radiogenic cancer risk among nuclear industry workers in fifteen countries

Energy Technology Data Exchange (ETDEWEB)

Ashmore, J.P. [Ponsonby and Associates, Manotick, Ontario (Canada); Gentner, N.E. [Consultant, Petawawa, Ontario (Canada); Osborne, R.V. [Ranasara Consultants Inc., Deep River, Ontario (Canada)

2007-03-31

Over the last two decades there have been attempts to estimate the risks from occupational exposure in the nuclear industry by epidemiological assessments on cohorts of workers. However, generally low doses and relatively small worker populations have limited the precision of such studies. In 1995 the International Agency for Research on Cancer (IARC) completed a study that involved workers from facilities in the USA, UK and AECL. In 2005, IARC completed a further study involving nuclear workers from 15 countries including Canada. Surprisingly, the risk ascribed to the Canadian cohort for all cancers excluding leukaemia, driven by the AECL component, was significantly higher than the cohort as a whole. The work described in this report is an attempt to unravel what might have accounted for the divergence between the results for the AECL cohort and the others.

Analysis of the results for the AECL cohort in the IARC study on the radiogenic cancer risk among nuclear industry workers in fifteen countries

International Nuclear Information System (INIS)

Ashmore, J.P.; Gentner, N.E.; Osborne, R.V.

2007-01-01

Over the last two decades there have been attempts to estimate the risks from occupational exposure in the nuclear industry by epidemiological assessments on cohorts of workers. However, generally low doses and relatively small worker populations have limited the precision of such studies. In 1995 the International Agency for Research on Cancer (IARC) completed a study that involved workers from facilities in the USA, UK and AECL. In 2005, IARC completed a further study involving nuclear workers from 15 countries including Canada. Surprisingly, the risk ascribed to the Canadian cohort for all cancers excluding leukaemia, driven by the AECL component, was significantly higher than the cohort as a whole. The work described in this report is an attempt to unravel what might have accounted for the divergence between the results for the AECL cohort and the others

Some highlights of research and development at AECL

International Nuclear Information System (INIS)

Langford, W.J.; Rae, H.K.

1980-06-01

The research and development programs of AECL have as their goal the strengthening of the knowledge and ability necessary to achieve national objectives in the field of nuclear energy. These objectives include a nuclear reactor system appropriate to Canada's industrial capabilities, now realized, and the extension of that system, through scientific and technological development, to serve the nation's needs for the forseeable future. The Company's programs are carefully integrated and focused to use the available funding to maximum advantage. The research facilities on which the program depends are among the best in the world, and support a full spectrum of research from fundamental nuclear physics to full-scale power reactor component irradiation and testing. In this report it has only been possible to high-light some important facets of the programs in each of the principal areas currently employing our energies. (auth)

Trace organics removal using three membrane bioreactor configurations: MBR, IFAS-MBR and MBMBR.

Science.gov (United States)

de la Torre, T; Alonso, E; Santos, J L; Rodríguez, C; Gómez, M A; Malfeito, J J

2015-01-01

Seventeen pharmaceutically active compounds and 22 other trace organic pollutants were analysed regularly in the influent and permeate from a semi-real plant treating municipal wastewater. The plant was operated during 29 months with different configurations which basically differed in the type of biomass present in the system. These processes were the integrated fixed-film activated sludge membrane bioreactor (IFAS-MBR), which combined suspended and attached biomass, the moving bed membrane bioreactor (MBMBR) (only attached biomass) and the MBR (only suspended biomass). Moreover, removal rates were compared to those of the wastewater treatment plant (WWTP) operating nearby with conventional activated sludge treatment. Reverse osmosis (RO) was used after the pilot plant to improve removal rates. The highest elimination was found for the IFAS-MBR, especially for hormones (100% removal); this was attributed to the presence of biofilm, which may lead to different conditions (aerobic-anoxic-anaerobic) along its profile, which increases the degradation possibilities, and also to a higher sludge age of the biofilm, which allows complete acclimation to the contaminants. Operating conditions played an important role, high mixed liquor suspended solids (MLSS) and sludge retention time (SRT) being necessary to achieve these high removal rates. Although pharmaceuticals and linear alkylbenzene sulfonates showed high removal rates (65-100%), nonylphenols and phthalate could only be removed to 10-30%. RO significantly increased removal rates to 88% mean removal rate.

Biological effect of OK-432 (picibanil) and possible application to dendritic cell therapy.

Science.gov (United States)

Ryoma, Yoshiki; Moriya, Yoichiro; Okamoto, Masato; Kanaya, Isao; Saito, Motoo; Sato, Mitsunobu

2004-01-01

OK-432 (Picibanil), a streptococcal preparation with potent biological response modifying activities, was approved in Japan as an anticancer agent in 1975. In the ensuing 30 years, since then, a significant amount of data, including clinical as well as experimental studies, has been accumulated. OK-432 has been reported to induce various cytokines, activate immunological cells and thus augment anticancer immunity. Recently, the interrelation between innate immunity and adaptive immunity has become clear and it was reported that OK-432 acts, at least in part, via Toll-like receptor (TLR) 4-MD2 signaling pathway. In addition, dendritic cells (DCs) are considered to play a pivotal role in immunological response and it is reported that OK-432 induced maturation of DCs both in vitro and in vivo. These results suggest that OK-432 is a useful adjuvant in DC-based anticancer immunotherapy. Clinical studies of DC therapy with OK-432 are under way.

The prognostic advantage of preoperative intratumoral injection of OK-432 for gastric cancer patients

Science.gov (United States)

Gochi, A; Orita, K; Fuchimoto, S; Tanaka, N; Ogawa, N

2001-01-01

To investigate, by a multi-institutional randomized trial, the prognostic significance of the augmentation of tumour-infiltrating lymphocytes (TILs) by preoperative intratumoral injection of OK-432 (OK-432 it), a bacterial biological response modifier, in patients with gastric cancer. The 10-year survival and disease-free survival were examined and analysis of the factors showing survival benefit was performed. 370 patients who had undergone curative resection of gastric cancer were enrolled in this study and followed up for 10 years postoperatively. Patients were randomized into either an OK-432 it group or a control group. Ten Klinishe Einheit (KE) of OK-432 was endoscopically injected at 1 to 2 weeks before the operation in the OK-432 it group. Both groups received the same adjuvant chemoimmunotherapy consisting of a bolus injection of mitomycin C (0.4 mg kg−1i.v.) and administration of tegafur and OK-432 from postoperative day 14 up to 1 year later. Tegafur (600 mg day−1) was given orally and OK-432 (5 KE/2 weeks) was injected intradermally for a maintenance therapy. The TILs grades in resected tumour specimens and presence of metastasis and metastatic pattern in dissected lymph nodes were examined. Multivariate analysis was performed to determine the efficacy of OK-432 it on prognostic factors. All patients were followed up for 10 years. The overall 5- and 10-year survival rates and disease-free survival rates of the OK-432 it group were not significantly higher than those of the control group. However, OK-432 it significantly increased the 5- and 10-year survival rates of patients with stage IIIA + IIIB, moderate lymph node metastasis (pN2), and positive TILs. OK-432 it was most effective at prolonging the survival of patients who had both positive TILs and lymph node metastasis. The OK-432 it group with positive TILs showed a significant decrease in metastatic lymph node frequency and in the number of lymph node micro- metastatic foci when compared to

48 CFR 432.006-4 - Procedures.

Science.gov (United States)

2010-10-01

... REQUIREMENTS CONTRACT FINANCING 432.006-4 Procedures. (a) Immediately upon submittal of the referral described... decision making process. (c) The OIG will determine the need for and the extent of an investigation. (d...

42 CFR 432.31 - Training and use of subprofessional staff.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Training and use of subprofessional staff. 432.31...; Subprofessional and Volunteer Programs § 432.31 Training and use of subprofessional staff. (a) State plan requirement. A State plan must provide for the training and effective use of subprofessional staff as...

Successful pleurodesis with OK-432 (picibanil in preterm infants with persistent pleural effusion

Directory of Open Access Journals (Sweden)

Jeong Eun Kim

2012-05-01

Full Text Available OK-432 (picibanil is an inactivated preparation of &lt;em&gt;Streptococcus pyogenes&lt;/em&gt; that causes pleurodesis by inducing a strong inflammatory response. Intrapleural instillation of OK-432 has recently been used to successfully treat neonatal and fetal chylothorax. Here we report a trial of intrapleural instillation of OK-432 in two preterm infants who were born with hydrops fetalis and massive bilateral pleural effusion. Both cases showed persistent pleural effusion, refractory to conservative treatment, up to postnatal days 26 and 46, respectively. An average of 80 to 140 mL of pleural fluid was drained daily. In case 1, the infant was treated with OK-432 during the fetal period at gestation 28 weeks and 4 days of gestation, but showed recurrence of pleural effusion and progressed into hydrops. Within two to three days after OK-432 injection, the amount of pleural fluid drainage was dramatically decreased and there was no reaccumulation. We did not observe any side effects related to OK-432 injection. We suggest that OK-432 should be considered as a therapeutic option in infants who have persistent pleural effusion for more than four weeks, with the expectation of the early removal of the chest tube and a good outcome.

Final report of the AECL/SKB Cigar Lake analog study

International Nuclear Information System (INIS)

Cramer, J.J.

1994-07-01

The Cigar Lake uranium deposit is located in northern Saskatchewan, Canada. The 1.3-billion-year-old deposit is located at a depth of about 450 m below surface in a water-saturated sandstone at the unconformity contact with the high-grade metamorphic rocks of the Canadian Shield. The uranium mineralization, consisting primarily of uraninite (UO 2 ), is surrounded by a clay-rich halo in both sandstone and basement rocks, and remains extremely well preserved and intact. The average grade of the mineralization is ∼ 8 wt.% U; locally grades are as high as ∼ 55 wt.%U. The Cigar lake deposit has many features that parallel those being considered within the Canadian concept for disposal of nuclear fuel waste. Specifically, the deposit provides analog information relevant to the stability of UO 2 fuel waste, the performance of clay-based barriers, radionuclide migration, colloid formation, radiolysis, fission-product geochemistry and general aspects of water-rock interaction. The main geochemical studies on this deposit focus on the evolution of groundwater compositions in the deposit and on their redox chemistry with respect to the uranium, iron and sulphide systems. Since 1984, through cooperation from the owners of the Cigar lake deposit, analog studies have been conducted. AECL, with support from Ontario Hydro under the auspices of the CANDU Owners Group, initiated international participation in 1989 through collaboration with the Swedish Nuclear Fuel and Waste Management Company (SKB) and, more recently, with the Los Alamos National Laboratory (LANL). This report gives the results of the various studies carried out during the 3-year collaboration between AECL and SKB, as well as a summary of the LANL study. It provides detailed information on the generated databases and models, and integrates this information into conclusions for use in safety assessment of the Canadian, Swedish and United States disposal concepts. 15 refs., 25 figs., 55 tabs

OK-432 as a sclerosing agent to treat wound-healing impairment.

Science.gov (United States)

Fasching, G; Sinzig, M

2007-12-01

We report on the application of OK-432 (picibanil) in a patient with prolonged wound healing impairment. A 13-year-old girl had suffered a polytrauma with a displaced fracture of the sacrum which required neurosurgical decompression of the sacral plexus. Postoperatively, a seroma with recurrent fistulation was seen. Excision of the wound, prolonged suction drainage and the instillation of hypertonic glucose solution did not have any effect over a period of four months postoperatively. Relying on our personal experience of the treatment of lymphangiomas using OK-432 we instilled OK-432 into the wound. Leakage stopped immediately, there was a regression of fluid accumulation and four weeks later the ultrasound examination was normal. The patient is still asymptomatic four years after treatment. OK-432 can be used effectively for the treatment of chronic wound healing impairment.

Acute behavioral effects of intrapleural OK-432 (Picibanil) administration in preterm fetal sheep.

Science.gov (United States)

Cowie, Rosalind V; Stone, Peter R; Parry, Emma; Jensen, Ellen C; Gunn, Alistair J; Bennet, Laura

2009-01-01

To develop a model to study the fetal effects of intrapleural infusion of OK-432 (Picibanil), a pleurodesis agent derived from killed Gram-positive streptococci. OK-432 (0.1 mg, n = 5), or normal saline (n = 5) were infused over 20 min into the pleural space of chronically instrumented preterm fetal sheep at 0.7 gestation. Fetal physiological parameters, including breathing and nuchal activity were monitored in utero from 6 h before infusion until 12 h afterward, and fetuses were killed after 7 days recovery. OK-432 was associated with transient suppression of fetal EEG activity, breathing and body movements from 3-6 h after infusion. Hypotension and hypoxia did not occur. At postmortem, local pleural adhesions were seen around the site of OK-432 infusion but not in saline treated fetuses. Intrapleural administration of OK-432 is associated with marked but transient fetal behavioral effects. This model will enable preclinical investigation of the neural and cardiovascular safety of OK-432 at a clinical relevant stage of development. Copyright 2009 S. Karger AG, Basel.

Verification of the thermal module in the ELESIM code and the associated uncertainty analysis

International Nuclear Information System (INIS)

Arimescu, V.I.; Williams, A.F.; Klein, M.E.; Richmond, W.R.; Couture, M.

1997-09-01

Temperature is a critical parameter in fuel modelling because most of the physical processes that occur in fuel elements during irradiation are thermally activated. The focus of this paper is the temperature distribution calculation used in the computer code ELESIM, developed at AECL to model the steady-state behaviour of CANDU fuel. A validation procedure for fuel codes is described and applied to ELESIM's thermal calculation.The effects of uncertainties in model parameters, like Uranium Dioxide thermal conductivity, and input variables, such as fuel element linear power, are accounted for through an uncertainty analysis using Response Surface and Monte Carlo techniques

Enhancement of antitumor activity of OK-432 (picibanil) by Triton X-114 phase partitioning.

Science.gov (United States)

Hashimoto, Masahito; Takashige, Katsuhiro; Furuyashiki, Maiko; Yoshidome, Keitaro; Sano, Ryoko; Kawamura, Yutaka; Ijichi, Shinji; Morioka, Hirofumi; Koide, Hiroyuki; Oku, Naoto; Moriya, Yoichiro; Kusumoto, Shoich; Suda, Yasuo

2008-01-01

OK-432 (Picibanil), a Streptococcal immunotherapeutic agent, has been used for immunotherapy of various cancers as a biological response modifier (BRM). However, OK-432 contains multiple components consisting of immunotherapeutic ones and contaminants which may weaken the effects or exert side-effects. In this study, we investigated extraction of contaminants from OK-432 using Triton X-114 (TX-114)-water phase partitioning and examined an antitumor effect of the resulting preparation. OK-432 was subjected to TX-114 partitioning to give residual precipitate designated as OK-TX-ppt. OK-TX-ppt exerted no TLR2-mediated activity, but induced interleukin (IL)-6 in human PBMC. OK-TX-ppt also induced tumor necrosis factor (TNF)-alpha, IL-10, IL-12, and interferon (IFN)-gamma in PBMC. Moreover, IFN-gamma-inducing activity of OK-TX-ppt was significantly higher and IL-10 production was lower than that of OK-432. In tumor-bearing mice model, administration of OK-TX-ppt i.p. extended the survival time of Meth-A-bearing mice compared to OK-432. OK-TX-ppt also increased the levels of IL-12 and IFN-gamma in mouse spleen cells in vitro. These results indicated that TX-114 partitioning removed some contaminants, which attenuates the antitumor effect, from OK-432 and increase the immunotherapeutic effects of OK-432.

Analysis of DCA experimental data

International Nuclear Information System (INIS)

Min, B. J.; Kim, S. Y.; Ryu, S. J.; Seok, H. C.

2000-01-01

The lattice characteristics of DCA are calculated with WIMS-ATR code to validate WIMS-AECL code for the lattice analysis of CANDU core by using experimental data of DCA at JNC. Analytical studies of some critical experiments had been performed to analyze the effects of fuel composition. Different items of reactor physics such as local power peaking factor (LPF), effective multiplication factor (Keff) and coolant void reactivity were calculated for two coolant void fractions (0% and 100%). LPFs calculated by WIMS-ATR code are in close agreement with the experimental results. LPFs calculated by WIMS-AECL code with WINFRITH and ENDF/B-V libraries have similar values for both libraries but the differences between experimental data and calculated results by WIMS-AECL code are larger than those of WIMS-ATR code. The maximum difference between the values calculated by WIMS-ATR and experimental values of LPFs are within 1.3%. The coupled code systems WIMS-ATR and CITATION used in this analysis predict Keff within 1% ΔK and coolant void reactivity within 4 % ΔK/K in all cases. The coolant void reactivity of uranium fuel is found to be positive. To validate WIMS-AECL code, the core characteristics of DCA shall be calculated by WIMS-AECL and CITATION codes in the future

International benchmark study of advanced thermal hydraulic safety analysis codes against measurements on IEA-R1 research reactor

Energy Technology Data Exchange (ETDEWEB)

Hainoun, A., E-mail: pscientific2@aec.org.sy [Atomic Energy Commission of Syria (AECS), Nuclear Engineering Department, P.O. Box 6091, Damascus (Syrian Arab Republic); Doval, A. [Nuclear Engineering Department, Av. Cmdt. Luis Piedrabuena 4950, C.P. 8400 S.C de Bariloche, Rio Negro (Argentina); Umbehaun, P. [Centro de Engenharia Nuclear – CEN, IPEN-CNEN/SP, Av. Lineu Prestes 2242-Cidade Universitaria, CEP-05508-000 São Paulo, SP (Brazil); Chatzidakis, S. [School of Nuclear Engineering, Purdue University, West Lafayette, IN 47907 (United States); Ghazi, N. [Atomic Energy Commission of Syria (AECS), Nuclear Engineering Department, P.O. Box 6091, Damascus (Syrian Arab Republic); Park, S. [Research Reactor Design and Engineering Division, Basic Science Project Operation Dept., Korea Atomic Energy Research Institute (Korea, Republic of); Mladin, M. [Institute for Nuclear Research, Campului Street No. 1, P.O. Box 78, 115400 Mioveni, Arges (Romania); Shokr, A. [Division of Nuclear Installation Safety, Research Reactor Safety Section, International Atomic Energy Agency, A-1400 Vienna (Austria)

2014-12-15

Highlights: • A set of advanced system thermal hydraulic codes are benchmarked against IFA of IEA-R1. • Comparative safety analysis of IEA-R1 reactor during LOFA by 7 working teams. • This work covers both experimental and calculation effort and presents new out findings on TH of RR that have not been reported before. • LOFA results discrepancies from 7% to 20% for coolant and peak clad temperatures are predicted conservatively. - Abstract: In the framework of the IAEA Coordination Research Project on “Innovative methods in research reactor analysis: Benchmark against experimental data on neutronics and thermal hydraulic computational methods and tools for operation and safety analysis of research reactors” the Brazilian research reactor IEA-R1 has been selected as reference facility to perform benchmark calculations for a set of thermal hydraulic codes being widely used by international teams in the field of research reactor (RR) deterministic safety analysis. The goal of the conducted benchmark is to demonstrate the application of innovative reactor analysis tools in the research reactor community, validation of the applied codes and application of the validated codes to perform comprehensive safety analysis of RR. The IEA-R1 is equipped with an Instrumented Fuel Assembly (IFA) which provided measurements for normal operation and loss of flow transient. The measurements comprised coolant and cladding temperatures, reactor power and flow rate. Temperatures are measured at three different radial and axial positions of IFA summing up to 12 measuring points in addition to the coolant inlet and outlet temperatures. The considered benchmark deals with the loss of reactor flow and the subsequent flow reversal from downward forced to upward natural circulation and presents therefore relevant phenomena for the RR safety analysis. The benchmark calculations were performed independently by the participating teams using different thermal hydraulic and safety

[Treatment of lymphangioma with OK-432 infiltration].

Science.gov (United States)

Rodríguez, J; Cáceres, F; Vargas, P

2012-10-01

The management of lymphangioma using sclerotherapy has proven to be an effective therapeutic. Our aim was to evaluate the therapeutic efficacy of OK-432 (Picibanil) in patients with lymphagioma. The study was performed from November 2010 to July 2011. Fifteen patients of both genders were diagnosed with lymphangioma, 12 days to 12 years old. All patients were infiltrated with OK-432. The studied variables were: previous surgery, localization, type of lymphangioma, number of effective injections, reduction of mass valued as excellent (100% reduction), good (reduction > 50%) and bad (reduction < 50%), presence of recurrence and complications. 40% of pacients had prior surgery and 53.3% were located in the cervical-face region. The type of macrocystic lymphangioma was present in 40% of the series, mixed type in 46.6% and microcystic type in 13.4%. The number of effective infiltrations were 3. In 6 cases (40%) the result was excellent in 5 cases (33.4%) the result was good and in 4 cases (26.6%). We had 1 recurrence (6.6%) and we haven't had complications. Injection of OK-432 in macrocystic lymphangioma and mixed had a safe therapeutic modality with satisfactory results. So it is a valid alternative to conventional surgery.

The AECL reactor development programme

International Nuclear Information System (INIS)

Menelely, D.A.

1997-01-01

The modem CANDU-PHWR power reactor is the result of more than 50 years of evolutionary design development in Canada. It is one of only three commercially successful designs in the world to this date. The basis for future development is the CANDU 6 and CANDU 9 models. Four of the first type are operating and four more will go an line before the end of this decade. The CANDU 9 is a modernized single-unit version of the twelve large multi-unit plants operated by Ontario Hydro. All of these plants use proven technology which resulted from research, development, design construction, and operating experience over the past 25 years. Looking forward another 25 years, AECL plans to retain all of the essential features that distinguish today's CANDU reactors (heavy water moderation, on-power fuelling simple bundle design, horizontal fuel channels, etc.). The end product of the planned 25-year development program is more than a specific design - it is a concept which embodies advanced features expected from ongoing R and D programs. To carry out the evolutionary work we have selected seven main areas for development: Safety Technology, Fuel and Fuel Cycles, Fuel Channels, Systems and Components, Heavy Water and Tritium Information Technology, and Construction. There are three strategic measures of success for each of these work areas: improved economics, advanced fuel cycle utilization, and enhanced safety/plant robustness. The paper describes these work programs and the overall goals of each of them. (author)

A SciCode web site: building bridges between owners and users

Energy Technology Data Exchange (ETDEWEB)

Gaver, C. [Atomic Energy of Canada Ltd., Mississauga, Ontario (Canada)

2000-07-01

Web technology is a tool that is gaining in popularity. Properly used, it is a powerful tool that has tremendous potential for providing better communication. It can also be effective as a training tool, an information-sharing tool, and as a means of simplifying work load, and facilitating compliance with Company procedures. The issue is one of communication. The challenge facing many large or geographically-distributed companies is how to communicate information to their staff and to their customers. Procedures overseeing quality-assurance programs and commitment to ensuring the quality of products need to be communicated to customers. Equally important is customer feedback. This information from users becomes the kernel for future product development. The issue is even more important when speaking of scientific analysis computer programs (SciCodes). Regular ongoing communication between Primary Holders and End Users is essential in the development and use of SciCodes. Without this communication, quality assurance is at risk. Quality assurance processes are an integral part in developing any SciCode. End Users also have a role to play. Primary Holders keep End Users informed of improvements or new releases. End Users must ensure they act on this information. Equally important, End Users must communicate problems or suggestions to the Primary Holder to remedy or incorporate in new releases. In other words, quality assurance processes become most effective when both Primary Holder and End Users are involved. This requires communication. Web technology offers AECL a means of providing regular, ongoing communication between its scientific-code (SciCode) Primary Holders-Owner Branches and the End Users of these codes within and outside the Company. Using the experience we have gained by developing the Y2K SciCode Web sites, setting up online documentation systems, and incorporating lessons learned from the Y2K project we have developed a model that is geared to

A SciCode web site: building bridges between owners and users

International Nuclear Information System (INIS)

Gaver, C.

2000-01-01

Web technology is a tool that is gaining in popularity. Properly used, it is a powerful tool that has tremendous potential for providing better communication. It can also be effective as a training tool, an information-sharing tool, and as a means of simplifying work load, and facilitating compliance with Company procedures. The issue is one of communication. The challenge facing many large or geographically-distributed companies is how to communicate information to their staff and to their customers. Procedures overseeing quality-assurance programs and commitment to ensuring the quality of products need to be communicated to customers. Equally important is customer feedback. This information from users becomes the kernel for future product development. The issue is even more important when speaking of scientific analysis computer programs (SciCodes). Regular ongoing communication between Primary Holders and End Users is essential in the development and use of SciCodes. Without this communication, quality assurance is at risk. Quality assurance processes are an integral part in developing any SciCode. End Users also have a role to play. Primary Holders keep End Users informed of improvements or new releases. End Users must ensure they act on this information. Equally important, End Users must communicate problems or suggestions to the Primary Holder to remedy or incorporate in new releases. In other words, quality assurance processes become most effective when both Primary Holder and End Users are involved. This requires communication. Web technology offers AECL a means of providing regular, ongoing communication between its scientific-code (SciCode) Primary Holders-Owner Branches and the End Users of these codes within and outside the Company. Using the experience we have gained by developing the Y2K SciCode Web sites, setting up online documentation systems, and incorporating lessons learned from the Y2K project we have developed a model that is geared to

Whole abdominal irradiation for ovarian cancer in combined treatment with OK-432 picibanil

International Nuclear Information System (INIS)

Morita, Shinroku; Arai, Tatsuo; Tsunemoto, Hiroshi

1986-01-01

One hundred seventeen patients with postoperative ovarian cancer who were treated with whole abdominal irradiation by the open-field technique were analyzed as to the effectiveness of combined therapy with or without OK-432. OK-432, 0.2 to 2.0 (KE) (kev) daily, has been used to prevent bone marrow suppression since 1978 at NIRS. Cumulative five-year survival rates were 63.6 % in the OK-432 group (37 patients) and 54.5 % in the NON-OK-432 group (34 patients). The complete rates of previously arranged treatment schedules were 81 % and 66 % in the two groups, respectively, as we originally intended. (author)

On the structure of Lattice code WIMSD-5B

International Nuclear Information System (INIS)

Kim, Won Young; Min, Byung Joo

2004-03-01

The WIMS-D code is a freely available thermal reactor physics lattice code used widely for thermal research and power reactor calculation. Now the code WIMS-AECL, developed on the basis of WIMS-D, has been used as one of lattice codes for the cell calculation in Canada and also, in 1998, the latest version WIMSD-5B is released for OECD/NEA Data Bank. While WIMS-KAERI was developed and has been used, originated from WIMS-D, in Korea, it was adjusted for the cell calculation of research reactor HANARO and so it has no confirmaty to CANDU reactor. Therefore, the code development applicable to cell calculation of CANDU reactor is necessary not only for technological independence and but also for the establishment of CANDU safety analysis system. A lattice code WIMSD-5B was analyzed in order to set the system of reactor physics computer codes, to be used in the assessment of void reactivity effect. In order to improve and validate WIMSD-5B code, the analysis of the structure of WIMSD-5B lattice code was made and so its structure, algorithm and the subroutines of WIMSD-5B were presented for the cluster type and the pij method modelling the CANDU-6 fuel

Qualification of power determination and in-pile measurements in the UO{sub 2} Gd{sub 2} 0{sub 2} fuel irradiation test IFA 636

Energy Technology Data Exchange (ETDEWEB)

Tverberg, T.; Volkov, B.; Kim, J-C.

2004-04-15

IFA-S36 is irradiated with the main objective of extending the database on the performance of UO{sub 2}Gd{sub 2}O{sub 2} fuel (with 8% absorbing gadolinia isotopes) compared with commercial UO{sub 2}. The rig carries 6 rods in the lower cluster (including three Gd-doped fuel rods) and 3 rods in the upper cluster (one rod with Gd-doped fuel). The rods are instrumented with expansion thermometers (ETs), fuel and cladding elongation detectors (EFs and ECs) and pressure transducers (PFs). Repeated calorimetric power measurements, physics calculations by the HELIOS code and gamma scans of selected rods in both clusters enabled the power and burnup determination to be qualified and corrected. The data suggest that as of May 2004 the power ratings in both fuels are much alike and burnups are about 30 and 34 MW/kgUO{sub 2} in the Gd-doped and ordinary UO{sub 2} rods respectively. Analysis of in-pile measurements compared with calculations shows that neutron absorption affects fuel temperature, power and burnup radial distributions in Gd-doped fuel at BOL compared with UO{sub 2} fuel. Sensitivity analyses performed with the HELIOS and FTEMP3 codes show that fuel centreline temperature in Gd-doped fuel is influenced by radial power depression, depletion of fissile materials and absorbing Gd isotopes as well as thermal conductivity of the fuel matrix and its degradation during irradiation. Analysis of the fuel dimension changes revealed densification only in the UO{sub 2} fuel whereas fuel elongation measurements in the Gd-doped fuel rods indicated essentially constant swelling with burnup. At burnups above 5 MWd/kgUO{sub 2} the swelling rate was about 0.5-O.fi % DELTAV/V per 10 MWd/kgUO{sub 2} for both fuel types. Internal pressure measured in the Gd-doped rod at BOL showed slight fuel densification and possibly He gas absorption, whereas derived swelling rate was somewhat Iarger than values obtained from the fuel elongation measurements. Cladding elongation measurements

Development of best estimate auditing code for CANDU thermal hydraulic safety analysis

Energy Technology Data Exchange (ETDEWEB)

Chung, B. D.; Lee, W. J.; Lim, H. S. [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

1998-04-15

The main purpose of this study is to develop a thermal hydraulic auditing code for the CANDU reactor, modifying the model of existing PWR auditing tool, i.e. RELAP5/MOD3. This scope of project is first step of the whole project, thus focus to the establishment of improvement area. The study was performed by reconsideration of the previous code assessment works and investigation of AECL design analysis tools. In order to identify the thermal hydraulic phenomena for events, the whole system of CANDU plant was divided into main functional systems and subcomponents. Each phenomena was addressed to the each subcomponent. FinaIly improvement areas of model development for auditing tool were established based on the identified phenomena.

Inhibitory effects of OK-432 (Picibanil) on cellular proliferation and adhesive capacity of breast carcinoma cells.

Science.gov (United States)

Horii, Yoshio; Iino, Yuichi; Maemura, Michio; Horiguchi, Jun; Morishita, Yasuo

2005-02-01

We investigated the potent inhibitory effects of OK-432 (Picibanil) on both cellular adhesion and cell proliferation of estrogen-dependent (MCF-7) or estrogen-independent (MDA-MB-231) breast carcinoma cells. Cellular proliferation of both MCF-7 and MDA-MB-231 cells was markedly inhibited in a dose-dependent manner, when the carcinoma cells were exposed to OK-432. Cell attachment assay demonstrated that incubation with OK-432 for 24 h reduced integrin-mediated cellular adhesion of both cell types. However, fluorescence activated cell sorter (FACS) analysis revealed that incubation with OK-432 for 24 h did not decrease the cell surface expressions of any integrins. These results suggest that the binding avidity of integrins is reduced by OK-432 without alteration of the integrin expression. We conclude that OK-432 inhibits integrin-mediated cellular adhesion as well as cell proliferation of breast carcinoma cells regardless of estrogen-dependence, and that these actions of OK-432 contribute to prevention or inhibition of breast carcinoma invasion and metastasis.

40 CFR 432.101 - Special definitions.

Science.gov (United States)

2010-07-01

... slaughterhouse, packinghouse or poultry dressing or processing operation, uses raw material at rates greater than... STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY Renderers § 432.101 Special definitions. For the... animal and poultry trimmings, bones, meat scraps, dead animals, feathers and related usable by-products...

Efficacy and safety of OK-432 immunotherapy of lymphatic malformations.

Science.gov (United States)

Smith, Mark C; Zimmerman, M Bridget; Burke, Diane K; Bauman, Nancy M; Sato, Yutaka; Smith, Richard J H

2009-01-01

To determine the efficacy and safety of the immunostimulant OK-432 (Picibanil) as a treatment option in the management of children with cervicofacial lymphatic malformations. A prospective, randomized, multi-institutional phase II clinical trial at 27 U.S. academic medical centers. 182 patients with lymphatic malformations (LM) were enrolled between January 1998 and November 2004. Of the 151 patients with complete case report forms, 117 patients were randomized into immediate or delayed treatment groups; 34 patients were nonrandomized and assigned to the open-label group. Treatment consisted of a four-dose intralesional injection series of OK-432 at eight-week intervals. Patients randomized into the delayed treatment group served as observational controls for spontaneous regression. Response to therapy was measured radiographically by quantitating change in lesion size and graded as complete (90%-100%), substantial (60%-89%), intermediate (20%-59%), or none (<20%). Of 117 patients randomized with intent-to-treat, 68% demonstrated a complete or substantial response to OK-432 immunotherapy. Response data for macrocystic LM were higher, with a complete or substantial response in 94% of patients; 63% of patients with mixed macrocystic-microcystic LM responded to treatment; no patients with microcystic LM responded to treatment. Spontaneous resolution occurred in less than 2% of patients. Median follow-up of 2.9 years demonstrated a 9% recurrence rate. Major adverse effects related to therapy occurred in 11 patients. As compared to historical surgical data on LM, OK-432 immunotherapy is more effective (P < .001) and has a lower morbidity (P < .001). OK-432 immunotherapy is an effective, safe, and simple treatment option for the management of macrocystic cervicofacial LM. ClinicalTrials.gov Identifier: NCT00010452.

OK-432 sclerotherapy of cervical chylous lymphocele after neck dissection.

Science.gov (United States)

Roh, Jong-Lyel; Park, Chan Il

2008-06-01

Postoperative cervical chylous lymphoceles are extremely rare circumscribed collections of lymph which are usually treated by drainage or surgical exploration, but rarely by sclerotherapy. We investigated the efficacy of OK-432 (Picibanil, Chungai Pharmaceutical Co., Tokyo, Japan) sclerotherapy in the treatment of cervical lymphocele after neck dissection. Four patients with postoperative lymphocele who could not be cured by repeated percutaneous needle aspiration and pressure dressing were treated with intralesional injection of 0.1-0.2 mg OK-432 after aspiration of fluid. The aspirated fluid was assessed biochemically and cytologically, and regular palpation and ultrasonography/computed tomography were used to evaluate outcomes and recurrences. Two patients with chyle leak during neck dissection had lymphoceles in the left supraclavicular region 3 weeks later. The other two patients had lymphoceles on the right neck 9 and 12 months, respectively, after neck dissection. All aspirated fluids were chylous in origin without tumor cells. OK-432 sclerotherapy scored all four lesions with no major complications except for fever and local pain for several days. No lymphocele recurrences or metastatic cancers were observed in any patient for >1 year after sclerotherapy. Intralesional injection of OK-432 may be a safe and effective alternative to surgical exploration in the treatment of cervical lymphocele after neck dissection.

Final report of the AECL/SKB Cigar Lake analog study

International Nuclear Information System (INIS)

Cramer, J.

1994-05-01

The Cigar Lake uranium deposit is located in northern Saskatchewan, Canada. The 1.3-billion-year-old deposit is located at a depth of about 450 m below surface in a water-saturated sandstone at the unconformity contact with the high-grade metamorphic rocks of the Canadian Shield. The Cigar Lake deposit has many features that parallel those being considered within the Canadian concept for disposal of nuclear fuel waste. The study of these natural structures and processes provides valuable insight toward the eventual design and site selection of a nuclear fuel waste repository. The main feature of this analog is the absence of any indication on the surface of the rich uranium ore 450 m below. This indicates that the combination of natural barriers has been effective in isolating the uranium ore from the surface environment. More specifically, the deposit provides analog information relevant to the stability of UO 2 fuel waste, the performance of clay-based barriers, radionuclide migration, colloid formation, radiolysis, fission-product geochemistry and general aspects of water-rock interaction. The main geochemical studies on this deposit focus on the evolution of groundwater compositions in the deposit and on their redox chemistry with respect to the uranium, iron and sulphide systems. Since 1984, through cooperation from the owners of the Cigar Lake deposit, analog studies have been conducted. AECL, with support from Ontario Hydro under the auspices of the CANDU Owners Group, initiated international participation in 1989 through collaboration with the Swedish Nuclear Fuel and Waste Management Company (SKB) and, more recently, with the Los Alamos National Laboratory (LANL). This report gives the results of the various studies carried out during the 3-year collaboration between AECL and SKB, as well as a summery of the LANL study. It provides detailed information on the generated databases and models, and integrates this information into conclusions for use in safety

Understanding the contribution of biofilm in an integrated fixed-film-activated sludge system (IFAS) designed for nitrogen removal.

Science.gov (United States)

Moretti, P; Choubert, J M; Canler, J P; Petrimaux, O; Buffiere, P; Lessard, P

2015-01-01

The objective of this study is to improve knowledge on the integrated fixed-film-activated sludge (IFAS) system designed for nitrogen removal. Biofilm growth and its contribution to nitrification were monitored under various operating conditions in a semi-industrial pilot-scale plant. Nitrification rates were observed in biofilms developed on free-floating media and in activated sludge operated under a low sludge retention time (4 days) and at an ammonia loading rate of 45-70 gNH4-N/kgMLVSS/d. Operational conditions, i.e. oxygen concentration, redox potential, suspended solids concentration, ammonium and nitrates, were monitored continuously in the reactors. High removal efficiencies were observed for carbon and ammonium at high-loading rate. The contribution of biofilm to nitrification was determined as 40-70% of total NOx-N production under the operating conditions tested. Optimal conditions to optimize process compacity were determined. The tested configuration responds especially well to winter and summer nitrification conditions. These results help provide a deeper understanding of how autotrophic biomass evolves through environmental and operational conditions in IFAS systems.

BISON Fuel Performance Analysis of IFA-796 Rod 3 & 4 and Investigation of the Impact of Fuel Creep

Energy Technology Data Exchange (ETDEWEB)

Wirth, Brian [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Terrani, Kurt A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Sweet, Ryan T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2017-08-01

In order to improve the accident tolerance of light water reactor (LWR) fuel, alternative cladding materials have been proposed to replace the currently used zirconium (Zr)-based alloys. Of these materials, there is a particular focus on iron-chromiumaluminum (FeCrAl) alloys because they exhibit slower oxidation kinetics in high-temperature steam than Zr-alloys. This should decrease the energy release due to oxidation and slow cladding consumption in the presence of high temperature steam. These alloys should also exhibit increased “coping time” in the event of an accident scenario by improving the mechanical performance at high temperatures, allowing greater flexibility to achieve core cooling. As a continuation of the development of these alloys, in-reactor irradiation testing of FeCrAl cladded fuel rods has started. In order to provide insight on the possible behavior of these fuel rods as they undergo irradiation in the Halden Boiling Water Reactor, engineering analysis has been performed using FeCrAl material models implemented into the BISON fuel performance code. This milestone report provides an update on the ongoing development of modeling capability to predict FeCrAl cladding fuel performance and to provide an early look at the possible behavior of planned in-reactor FeCrAl cladding experiments. In particular, this report consists of two separate analyses. The first analysis consists of fuel performance simulations of IFA-796 rod 4 and two segments of rod 3. These simulations utilize previously implemented material models for the C35M FeCrAl alloy and UO2 to provide a bounding behavior analysis corresponding to variation of the initial fuel cladding gap thickness within the fuel rod. The second analysis is an assessment of the fuel and cladding stress states after modification of the fuel creep model that is currently implemented in the BISON fuel performance code. Effects from modifying the fuel creep model were identified for the BISON simulations

40 CFR 432.1 - General Applicability.

Science.gov (United States)

2010-07-01

... waters of the U.S. from facilities engaged in the slaughtering, dressing and packing of meat and poultry products for human consumption and/or animal food and feeds. Meat and poultry products for human... STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY § 432.1 General Applicability. As defined more...

Combination therapy with radiation and OK-432 immunotherapy of cancer patients

International Nuclear Information System (INIS)

Hashimoto, Shozo; Miyamoto, Hiroshi

1978-01-01

We treated cancer patients with radiotherapy alone and with radiation plus immunotherapy at the Department of Radiology, Keio University Hospital. In all of the cancer patients who had radiationtherapy alone, a general depression in their immune reactivity was seen, but not seen in those who received radiationtherapy plus immunotherapy. Immunotherapy is defined as a stimulator of cancer patient's immune reaction. Usually radiationtherapy caused lymphopenia in which mainly T lymphocytes were decreased in number selectively, but there was no lymphopenia in cases treated with immunotherapy. We have performed nonspecific immunotherapy with OK-432. The result indicated that T lymphocytes were increased by OK-432 in spite of radiationtherapy. From this fact, OK-432 will be useful for suppression of metastasis and regression of tumors. (auth.)

Results of a survey on accident and safety analysis codes, benchmarks, verification and validation methods

International Nuclear Information System (INIS)

Lee, A.G.; Wilkin, G.B.

1995-01-01

This report is a compilation of the information submitted by AECL, CIAE, JAERI, ORNL and Siemens in response to a need identified at the 'Workshop on R and D Needs' at the IGORR-3 meeting. The survey compiled information on the national standards applied to the Safety Quality Assurance (SQA) programs undertaken by the participants. Information was assembled for the computer codes and nuclear data libraries used in accident and safety analyses for research reactors and the methods used to verify and validate the codes and libraries. Although the survey was not comprehensive, it provides a basis for exchanging information of common interest to the research reactor community

Colloquia on High Energy Physics: IFAE 2012

International Nuclear Information System (INIS)

Barion, L.; Bozzi, C.; Fioravanti, E.; Pagliara, G; Ricci, B.

2013-01-01

The 2012 edition of the 'Incontri di Fisica delle Alte Energie' (IFAE2012) was held at the Aula Magna del Rettorato of the Ferrara University from April 11th to 13th. The Conference was attended by more than 150 participants, with about 75 presentations and 35 posters covering the most recent advances in High Energy Physics, Astroparticle and Neutrino Physics, Heavy Ions and Detection Techniques. Only plenary sessions were held, giving young researchers the opportunity to present their work to a large audience, either with talks or posters, which were on permanent display during the entire conference. The scientific program was organized in 7 sessions: 1-Standard Model and beyond; 2-QCD; 3-Heavy Flavour; 4-Heavy Ions; 5-Astro particles; 6-Neutrino Physics; 7-New Technologies. Introductory, state-of-the art talks, opened the Conference and each session. More detailed talks followed, stimulating lively discussions and interactions between the speakers and the participants. Three talks and two posters by young researchers (Matteo Biassoni, Roberta Cardinale, Stefano Perazzini, Federica Primavera and Laura Zotti) were selected for their high quality and awarded a prize money. It would not have been possible to held this conference without the support of INFN Sezione di Ferrara, Universita' di Ferrara and the generous contributions of Hamamatsu, Caen, National Instruments and AdvanSiD, whom we gratefully acknowledge.

OK-432 sclerotherapy for benign cystic head and neck lesions

International Nuclear Information System (INIS)

Kim, Chang Hyun; Rho, Myung Ho; Lee, Sang Wook

2003-01-01

To evaluate the efficacy of OK-432 solution for slerotheraphy of cystic lesions of the head and neck. Nineteen cystic lesions comprising ten plunging ranulas, three simple ranulas, three cystic lymphangiomas, one first branchial cleft cyst and two unknown supraclavicular cysts considered to be lymphangiomas were treated by sucking out as much liquid content as possible and then injecting the same volume of OK-432 solution under ultrasound guidance. Patients were followed up clinically and radiologically. Follow-up sonography or CT- performed after a mean interval of nine months showed total or near-total shrinkage of four plunging ranulas. However, six such lesions recurred in spite of more than one (mean, two) sclerotherapy sessions. In cases involving two simple ranulas at the floor of the mouth, failure resulted from extracystic leakage of OK-432 solution via the puncture site. Two unilocular cystic lymphangiomas completely regressed during the follow-up period (mean, seven months), but the multiocular type showed a 65% volume reduction after 12 months. A first branchial cleft cyst was markedly reduced in size, with only a small cystic portion remaining after eight months, follow-up. Two supraclavicular cysts with straw-color fluid did not respond to sclerotherapy. OK-432 sclerotherapy of macrocystic lymphangiomas is an effective and promising alternative to surgery. For other cysts, however, including plunging ranula, efficacy, varied, and 64% of such lesions recurred

OK-432 sclerotherapy for benign cystic head and neck lesions

Energy Technology Data Exchange (ETDEWEB)

Kim, Chang Hyun; Rho, Myung Ho; Lee, Sang Wook [Masan Samsung Hospital, Masan (Korea, Republic of)

2003-12-01

To evaluate the efficacy of OK-432 solution for slerotheraphy of cystic lesions of the head and neck. Nineteen cystic lesions comprising ten plunging ranulas, three simple ranulas, three cystic lymphangiomas, one first branchial cleft cyst and two unknown supraclavicular cysts considered to be lymphangiomas were treated by sucking out as much liquid content as possible and then injecting the same volume of OK-432 solution under ultrasound guidance. Patients were followed up clinically and radiologically. Follow-up sonography or CT- performed after a mean interval of nine months showed total or near-total shrinkage of four plunging ranulas. However, six such lesions recurred in spite of more than one (mean, two) sclerotherapy sessions. In cases involving two simple ranulas at the floor of the mouth, failure resulted from extracystic leakage of OK-432 solution via the puncture site. Two unilocular cystic lymphangiomas completely regressed during the follow-up period (mean, seven months), but the multiocular type showed a 65% volume reduction after 12 months. A first branchial cleft cyst was markedly reduced in size, with only a small cystic portion remaining after eight months, follow-up. Two supraclavicular cysts with straw-color fluid did not respond to sclerotherapy. OK-432 sclerotherapy of macrocystic lymphangiomas is an effective and promising alternative to surgery. For other cysts, however, including plunging ranula, efficacy, varied, and 64% of such lesions recurred.

Development of 3-dimensional neutronics kinetics analysis code for CANDU-PHWR

International Nuclear Information System (INIS)

Kim, M. W.; Kim, C. H.; Hong, I. S.

2005-02-01

The followings are the major contents and scope of the research : development of kinetics power calculation module, formulation of space-dependent neutron transient analysis - implementation of 3-D and 2-G unified nodal method, verification of the kinetics module by benchmark problem - 3-D PHWR kinetics benchmark problem suggested by AECL, reactor trip simulation by shutdown system 1 in Wolsong unit 2. Development of a dynamic linked library code, SCAN D LL, for the coupled calculation with RELAP-CANDU : modeling of shutdown system 1, development of automatic shutdown module - automatic trip module based on rate log power control logic, automatic insertion of shutdown system 1. Development of a link code for coupled calculation - development of SCAN D LL(windows version), verification of coupled code by - 40% reactor inlet header break LOCA power pulse, 100% reactor outlet header break LOCA power pulse, 50% pump suction break LOCA power pulse

[Unsuccessful treatment with OK-432 picibanil for orbital lymphangioma].

Science.gov (United States)

Lanuza García, A; Bañón Navarro, R; Llorca Cardeñosa, A; Delgado Navarro, C

2012-01-01

Lymphangioma is a malformation of the lymphatic system. The classic approach is surgery. We report a case of orbital lymphangioma in a girl who was given OK-432 to avoid surgery and its complications. OK-432 is a lyophilized mixture of group A Streptococcus pyogenes which produces a fibrosis limited to the lesion with a high cure rate. The main advantages are the easy intra-lesional application. with no scars and or damage of closed areas. Its main disadvantage is a significant local inflammatory reaction. Copyright © 2011 Sociedad Española de Oftalmología. Published by Elsevier Espana. All rights reserved.

The therapeutic effect of OK-432 (picibanil) sclerotherapy for benign neck cysts.

Science.gov (United States)

Kim, Myung Gu; Kim, Sun Gon; Lee, Jun Ho; Eun, Young Gyu; Yeo, Seung Geun

2008-12-01

In general, benign neck cysts are treated by surgical excision. This can present technical difficulties and frequent recurrences, because of insufficient surgery. Sclerosing agents such as OK-432 have been tested for the nonsurgical treatment of these cysts. We have assessed the efficacy of OK-432 sclerotherapy for benign neck cysts. The study group consisted of 75 patients (42 men, 33 women) diagnosed with and treated for benign neck cysts between March 2001 and December 2007 by intralesional injection of OK-432. The liquid content of each cyst was aspirated as much as possible, and the same volume of OK-432 solution was injected. Patients were assessed by ultrasonography or computerized tomography, and therapeutic outcomes and adverse effects were evaluated by patient age, sex, cyst type, and number of injections. Of the 75 treated patients, 31 (41.3%) showed total shrinkage, seven (9.3%) showed near-total shrinkage (>90% of cyst volume), five (6.6%) showed marked shrinkage (>70% of cyst volume), and 17 (22.7%) showed partial shrinkage (<70% of cyst volume). No response was seen in 15 patients (20%). Despite repeated sclerotherapy, eight patients (10.7%) showed recurrences. Minor adverse effects of therapy included fever, localized pain, and odynophagia but these complications spontaneously disappeared within several days. OK-432 sclerotherapy is a safe and effective primary alternative to surgery in patients with benign neck cysts.

40 CFR 432.73 - Effluent limitations attainable by the application of the best available technology economically...

Science.gov (United States)

2010-07-01

... application of the best available technology economically achievable (BAT). 432.73 Section 432.73 Protection... POULTRY PRODUCTS POINT SOURCE CATEGORY Sausage and Luncheon Meats Processors § 432.73 Effluent limitations attainable by the application of the best available technology economically achievable (BAT). Except as...

40 CFR 432.72 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.72 Section 432.72... AND POULTRY PRODUCTS POINT SOURCE CATEGORY Sausage and Luncheon Meats Processors § 432.72 Effluent limitations attainable by the application of the best practicable control technology currently available (BPT...

Verification of WIMS-ANL to be used as supporting code for WIMS-CANDU development

Energy Technology Data Exchange (ETDEWEB)

Chung, Dai Hai; Kim, Won Young; Park, Joo Hwan

2007-08-15

The lattice code WIMS-ANL has been tested in order to assess it for the qualification to be used as a supporting code to aide the WIMS-CANDU development. A series of calculations have been performed to determine lattice physics parameters such as multiplication factors, isotopic number densities and coolant void reactivity. The WIMS-ANL results are compared with the predictions of WIMS-AECL/D4/D5 and PPV (POWDERPUFS-V), and the comparisons indicate that WIMS-ANL can be used not only as a supporting code to aide the WIMS-CANDU development, but also as a starting source for the study of developing detailed model that could delineate the realistic situations as it might occur during LOCA such as the asymmetric flux distribution across lattice cell.

Irradiation performance and post-irradiation examinations of the instrumented sphere-pac UO2 assembly IFA-204, irradiated up to 1.7% FIMA in the Halden Boiling Water Reactor

International Nuclear Information System (INIS)

Linde, A. van der.

1982-12-01

Fuel assembly IFA-204 consisted of four pins filled with a blend of three sizes of UO 2 spheres. This blend was compacted in the zircaloy-4 cladding tube by vibration to achieve a 87-88% T.D. smear density of the 1500 mm long sphere-pac fuel column. IFA-204 was irradiated during 597 days, equivalent to 436 full power days, in the Halden BWR from November 1971 to April 1974 when the achieved assembly average burnup amounted to 13.7 MWd/kg UO 2 . Two of the four pins were equipped with fuel column length and pin length extensometers. The measurements showed that at average pin powers less than about 25 kW.m -1 only fuel-clad-thermal-interaction, FCTI, occurred. The clad thermal expansion coefficient was 4.8 ppm/kW.m -1 . For calculations of the irradiation behaviour of sphere-pac LWR pins, filled with 0.1 MPa helium, with the Gapcon-Thermal-2 code a new thermal conductivity-temperature relationship has been developed. The calculated data agreed reasonably well with the measured data when taking into account a restructured fuel density of 90% T.D., a fuel surface roughness of 1 μm, the absence of a fuel-cladding gap and an effective full power fuel restructuring time of 40 days. It is concluded that the porous structure of the sphere-pac fuel column, whether restructured or not, has the inherent disadvantage of a high mobility of gaseous fission products and the inherent advantage of a practically stress free operation of the cladding

Validation of the COBRA code for dry out power calculation in CANDU type advanced fuels

International Nuclear Information System (INIS)

Daverio, Hernando J.

2003-01-01

Stern Laboratories perform a full scale CHF testing of the CANFLEX bundle under AECL request. This experiment is modeled with the COBRA IV HW code to verify it's capacity for the dry out power calculation . Good results were obtained: errors below 10 % with respect to all data measured and 1 % for standard operating conditions in CANDU reactors range . This calculations were repeated for the CNEA advanced fuel CARA obtaining the same performance as the CANFLEX fuel. (author)

AECL R and D's role in promoting nuclear research and education

International Nuclear Information System (INIS)

Sadhankar, R.

2009-01-01

Nuclear renaissance has created new opportunities for new technology development and has also brought along the challenge of meeting the growing demand of trained personnel in the nuclear science and engineering. Towards meeting this challenge, AECL R and D organization is actively promoting and supporting the creation of nuclear research capabilities at the universities and also effectively leveraging the R and D at the universities. It has also put in place several new initiatives to attract and develop the talented young people for careers in nuclear science and engineering. This paper describes various interactions and collaborations with the universities that supports the nuclear R and D at the universities and develop highly qualified personnel for the future nuclear R and D needs. (author)

Alleviating action of OK-432 (Picibanil) on the myelosuppression in medulloblastoma patients induced by whole axis irradiation

International Nuclear Information System (INIS)

Aoki, Yoshiro

1982-01-01

The test subjects termed as OK-432 group which consist of 4 patients of Medulloblastoma and 2 of Pinealoma, underwent the whole axis irradiation in combination with OK-432. The control group consisting of 9 Medulloblastoma patients was subjected to the same radiation treatment without OK-432. Six of the nine patients (66.7%) irradiated showed the decrease of peripheral white blood cell counts down to 2,500, whereas, only two of six patients showed a similar decrement in OK-432 group. Three of the nine patients (33.3%) in the control group showed the decrease of white blood cell down to 2,000, but only one of the six patients in OK-432 group. The neutrophil counts decreased below the level of 1,000 in three of the nine patients (33.3%) in the control group, but none in the OK-432 group. The platelet counts decreased below the level of 100,000 in five of the nine patients (55.6%) in the control group during the irradiation period, but only one patient in the OK-432 group showed a decrease down to 100,000 counts. Three of the nine patients (33.3%) in the control group had to be stopped irradiation due to the severe leukopenia and thrombocytopenia, in contrast to the OK-432 group, which completed whole axis irradiation without interruption. These results seem to indicate that OK-432 alleviated the myelosuppression induced in patients by whole axis irradiation. This alleviating action of OK-432 is considered to be applicable to the treatment of Medulloblastoma patients. (J.P.N.)

Alleviating action of OK-432 (Picibanil) on the myelosuppression in Medulloblastoma patients induced by whole axis irradiation

Energy Technology Data Exchange (ETDEWEB)

Aoki, Yoshiro (National Inst. of Radiological Sciences, Chiba (Japan))

1982-11-01

The test subjects termed as OK-432 group which consist of 4 patients of Medulloblastoma and 2 of Pinealoma, underwent the whole axis irradiation in combination with OK-432. The control group consisting of 9 Medulloblastoma patients was subjected to the same radiation treatment without OK-432. Six of the nine patients (66.7%) irradiated showed the decrease of peripheral white blood cell counts down to 2,500, whereas, only two of six patients showed a similar decrement in OK-432 group. Three of the nine patients (33.3%) in the control group showed the decrease of white blood cell down to 2,000, but only one of the six patients in OK-432 group. The neutrophil counts decreased below the level of 1,000 in three of the nine patients (33.3%) in the control group, but none in the OK-432 group. The platelet counts decreased below the level of 100,000 in five of the nine patients (55.6%) in the control group during the irradiation period, but only one patient in the OK-432 group showed a decrease down to 100,000 counts. Three of the nine patients (33.3%) in the control group had to be stopped irradiation due to the severe leukopenia and thrombocytopenia, in contrast to the OK-432 group, which completed whole axis irradiation without interruption. These results seem to indicate that OK-432 alleviated the myelosuppression induced in patients by whole axis irradiation. This alleviating action of OK-432 is considered to be applicable to the treatment of Medulloblastoma patients.

40 CFR 432.77 - Effluent limitations attainable by the application of the best control technology for...

Science.gov (United States)

2010-07-01

... application of the best control technology for conventional pollutants (BCT). 432.77 Section 432.77 Protection... POULTRY PRODUCTS POINT SOURCE CATEGORY Sausage and Luncheon Meats Processors § 432.77 Effluent limitations attainable by the application of the best control technology for conventional pollutants (BCT). Except as...

AECL IMPELA electron beam industrial irradiators

International Nuclear Information System (INIS)

Labrie, J.P.; Drewell, N.H.; Ebrahim, N.A.; Lawrence, C.B.; Mason, V.A.; Ungrin, J.; White, B.F.

1989-01-01

A family of industrial irradiators is being developed by AECL to cover an electron-beam energy range from 5 to 18 MeV at beam powers between 20 and 250 kW. The IMPELA family of irradiators is designed for push button, reliable operation. The major irradiator components are modular, allowing for later upgrades to meet increased demands in either electron or X-ray mode. Interface between the control system, irradiator availability and dose quality assurance is in conformance with the most demanding specifications. The IMPELA irradiators use a klystron-driven, standing-wave, L-band accelerator structure with direct injection from a rugged, triode electron gun. Direct control of the accelerating field during the beam pulse ensures constant output beam energy, independent of beam power. The first member of the family, the IMPELA 10/50 (10 MeV, 50 kW), is in the final stages of assembly at Chalk River Nuclear Laboratories. The IMPELA 10/50 is constructed around a 3.25 m long, high-power-capacity accelerator structure operated at a duty factor of 5%. Beam loading exceeds 60%. The rf power is provided by a 2 MW/150 kW modulated-anode klystron protected from load mismatches by a circulator. This prototype will be used to demonstrate the reliability and dose uniformity targets of the IMPELA family. Full beam operation of the IMPELA 10/50 is scheduled for early 1989. (orig.)

Experimental performance of R432A to replace R22 in residential air-conditioners and heat pumps

International Nuclear Information System (INIS)

Park, Ki-Jung; Shim, Yun-Bo; Jung, Dongsoo

2009-01-01

In this study, thermodynamic performance of R432A and HCFC22 is measured in a heat pump bench tester under both air-conditioning and heat pumping conditions. R432A has no ozone depletion potential and very low greenhouse warming potential of less than 5. R432A also offers a similar vapor pressure to HCFC22 for 'drop-in' replacement. Test results showed that the coefficient of performance and capacity of R432A are 8.5-8.7% and 1.9-6.4% higher than those of HCFC22 for both conditions. The compressor discharge temperature of R432A is 14.1-17.3 deg. C lower than that of HCFC22 while the amount of charge for R432A is 50% lower than that of HCFC22 due to its low density. Overall, R432A is a good long term 'drop-in' environmentally friendly alternative to replace HCFC22 in residential air-conditioners and heat pumps due to its excellent thermodynamic and environmental properties

Primary treatment of pediatric plunging ranula with nonsurgical sclerotherapy using OK-432 (Picibanil).

Science.gov (United States)

Roh, Jong-Lyel; Kim, Hyo Sun

2008-09-01

Although surgery is the first choice of therapy for plunging ranula, it is associated with technical difficulties, morbidity and recurrence. Plunging ranula may be also primarily treated with nonsurgical sclerotherapy, but there is little experience in pediatric patients. We, therefore, assessed the efficacy of OK-432 sclerotherapy for pediatric plunging ranula. Nine children with plunging ranula were prospectively treated with intracystic injections of OK-432. At the outpatient clinic, the ranula was punctured in the neck and aspirated mucus was replaced with 0.1-0.2mg OK-432 solution. The size of the ranula was compared before and after sclerotherapy. Total or nearly total shrinkage was observed in 6 of 9 patients; marked reduction (>50% of original size) in 2; and partial reduction (<50% of original size) in 1. At a mean follow-up of 26 months after last sclerotherapy, recurrence was observed in only 1 patient; this patient showed complete response after reinjection of OK-432 solution. No significant complications were observed, with only fever and mild local pain observed in 4 patients for 2-4 days after treatment. OK-432 sclerotherapy is safe and effective in the treatment of pediatric plunging ranula. Sclerotherapy may become a primary treatment modality prior to surgery.

48 CFR 432.114 - Unusual contract financing.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Unusual contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.114 Unusual contract financing. The HCA is authorized to approve unusual contract financing. The signed determination and finding...

Antibiotics from bacillus subtilis AECL90 - effect of trace elements and carbohydrates on antibiotic production

International Nuclear Information System (INIS)

Malik, M.A.; Shaukat, G.A.; Ahmed, M.S.

1990-01-01

Three types of antibiotics S, X and F characteristically bioactive against staphylococcic, xanthomonas and fungi are elaborated by Bacillus Subtilis AECL 69 when grown in molasses peptone malt extract sucrose. No antibiotic production was observed when molasses was omitted from the growth medium. A mineral salt mixture was devised that could replace molasses and restore the production of antibiotics. Influence of various carbohydrates on the production of antibiotics was also studied. Mannose and mannitol had inhibitory effect on the antibiotic production. (author)

48 CFR 432.007 - Contract financing payments.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING 432.007 Contract financing payments. The HCA may prescribe, on a case-by-case basis, a shorter period for financing payments. [61 FR 53646, Oct. 15, 1996. Redesignated...

Results of a survey on accident and safety analysis codes, benchmarks, verification and validation methods

International Nuclear Information System (INIS)

Lee, A.G.; Wilkin, G.B.

1996-03-01

During the 'Workshop on R and D needs' at the 3rd Meeting of the International Group on Research Reactors (IGORR-III), the participants agreed that it would be useful to compile a survey of the computer codes and nuclear data libraries used in accident and safety analyses for research reactors and the methods various organizations use to verify and validate their codes and libraries. Five organizations, Atomic Energy of Canada Limited (AECL, Canada), China Institute of Atomic Energy (CIAE, People's Republic of China), Japan Atomic Energy Research Institute (JAERI, Japan), Oak Ridge National Laboratories (ORNL, USA), and Siemens (Germany) responded to the survey. The results of the survey are compiled in this report. (author) 36 refs., 3 tabs

27 CFR 4.32b - Petitions for exemption from major food allergen labeling.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Petitions for exemption from major food allergen labeling. 4.32b Section 4.32b Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS LABELING AND ADVERTISING OF WINE...

40 CFR 432.5 - Incorporation by reference.

Science.gov (United States)

2010-07-01

... AND STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY § 432.5 Incorporation by reference. (a... Federal Register. The material is available for purchase at the address in paragraph (b) of this section..., Washington, DC. (b) The following material is available for purchase from the National Technical Information...

Comparison of MCNP and WIMS-AECL/RFSP calculations with high temperature substitution experiments in ZED-2 using CANFLEX-L VRF

International Nuclear Information System (INIS)

Pencer, J.; Bromley, B.P.; Watts, D.G.; Carlson, P.; Rauket, A.; Zeller, M.

2009-01-01

This paper summarizes comparisons of calculation results from MCNP5 and WIMS-AECL / RFSP with experimental results obtained from the Zero Energy Deuterium (ZED-2) critical facility, examining CANFLEX Low Void Reactivity Fuel (CANFLEX-LVRF) in heated channels, substituted into a reference lattice and cooled under ACR-like coolant conditions, with H 2 O, air, or CO 2 as an air substitute. CANFLEX-LVRF shares features in common with the ACR-1000 fuel, notably an increase in enrichment (over natural uranium) in the outer elements of the fuel bundle, and presence of a neutron absorber in the central element. The reference and substituted fuel channels were arranged in a 24.5-cm hexagonal lattice in order to provide neutron similarity to the 24-cm square lattice pitch of the ACR-1000. These results therefore provide useful data for validation of the reactor physics toolset for use in ACR-1000 applications. For the mixed lattices, results for both MCNP5 and WIMS-AECL / RFSP show small biases in k eff , ranging from -7 mk to -5 mk, small biases in coolant void reactivity, ranging from -1 mk to +0.5 mk, and good agreement for copper activation rate distributions (based on calculated neutron flux). Bare core MCNP and WIMS-AECL stand-alone results, based on substitution analysis, also show small biases in k eff , ranging from -6 mk to -0.4 mk, and small biases in coolant void reactivity, ranging from -0.3 mk to +3.7 mk. This validation exercise thus gives good agreement between measurement and calculation and provides confidence in the accuracy of the physics toolset. (author)

Fretting wear of steam generator tubes: high-temperature tests on AECL rig

International Nuclear Information System (INIS)

Guerout, F.; Zbinden, M.

1993-07-01

The R and DD has undertaken the study of fretting-wear of Alloy 600 S.G. tubes which occurs by contact with migrating items. The test series was performed in Canada at AECL Research (Atomic Energy of Canada Limited) as part of an exchange program. Four types of configuration were envisaged: a tube-to-drilled hole support contact which provides reference results and three types of tube-to-support contacts which simulate the tube fretting-wear induced by a welding rod, a threaded rod and a knife-edge rod support. This programme is completed by the study of the contact between a S.G. tube and a neighbouring S.G. tube which has been broken after plugging. (authors). 1 tab., 3 refs

Environmental impact assessment of a package type IFAS reactor during construction and operational phases: a life cycle approach.

Science.gov (United States)

Singh, Nitin Kumar; Singh, Rana Pratap; Kazmi, Absar Ahmad

2017-05-01

In the present study, a life cycle assessment (LCA) approach was used to analyse the environmental impacts associated with the construction and operational phases of an integrated fixed-film activated sludge (IFAS) reactor treating municipal wastewater. This study was conducted within the boundaries of a research project that aimed to investigate the implementation related challenges of a package type IFAS reactor from an environmental perspective. Along with the LCA results of the construction phase, a comparison of the LCA results of seven operational phases is also presented in this study. The results showed that among all the inputs, the use of stainless steel in the construction phase caused the highest impact on environment, followed by electricity consumption in raw materials production. The impact of the construction phase on toxicity impact indicators was found to be significant compared to all operational phases. Among the seven operational phases of this study, the dissolved oxygen phase III, having a concentration of ∼4.5 mg/L, showed the highest impact on abiotic depletion, acidification, global warming, ozone layer depletion, human toxicity, fresh water eco-toxicity, marine aquatic eco-toxicity, terrestrial eco-toxicity, and photochemical oxidation. However, better effluent quality in this phase reduced the eutrophication load on environment.

Darüşşifas Where Music Threapy was Practiced During Anatolian Seljuks and Ottomans / Selçuklu ve Osmanlı Darüşşifalarında Müzikle Tedavi

Directory of Open Access Journals (Sweden)

Gülşen Erdal

2013-03-01

Full Text Available Abstract Music therapy, one of the oldest treatment methods known, dates back to thousands of years. Turks’ using music therapy practices in hospitals -Ottoman and Seljuk hospitals- built with appropriate acoustic in the treatment of mental disorders, utilizing the books which included the researches done by scientists such as İbni Sina, Razî, Farabî, Hasan Şuurî and in Gevrekzade Hasan Efendi in music therapy and improving music therapy practices exemplarily in the period of Ottomans and Seljukians is assessed as the first serious music therapy practices. Darüşşifa is one of the names given to medical and educational establishments which give people health service depending on practice and observation and treated patients in Turkish and Islamic world. Turks started various reconstruction activities following their settlement in Anatolia. Within a short period, they built several types of artifacts such as; caravansaries, madrasahs, mosques, darüşşifas. In Seljukian and Ottoman darüşşifas, medical subjects were taught according to researches and scientific principals, and surgeons were educated at medical madrasahs as well. Medical health care service was provided in those places. In this study, of darüşşifas where music therapy was practised the ones surviving today and having importance have been analyzed so as to emphasize how curative power of art history and music was used by Turkish people centuries ago. From this point of view, Kayseri Gevher Nesibe Tıp Medresesi (Medical madrasah (1206, Divriği Ulu Camii ve Darüşşifası (Mosque and Hospital (1228, Amasya Darüşşifası (1309, Fatih Darüşşifası (1470 Edirne Sultan II. Bayezid Darüşşifası (1488, Süleymaniye Tıp Medresesi and Şifahanesi (Medical Madrasah and Hospital (1556 have been examined in this study as the featured ones among the institutions where music therapy was practised. Özet Müziğin insanlar üzerinde bıraktığı psikolojik ve fiziksel

Power ramp tests of MOX fuel rods. HBWR irradiation with the instrument rig, IFA-591

International Nuclear Information System (INIS)

Ozawa, Takayuki; Abe, Tomoyuki

2006-03-01

Plutonium-uranium mixed oxide (MOX) fuel rods of instrumental rig IFA-591 were ramped in HBWR to study the Advanced Thermal Reactor (ATR) MOX fuel behavior during transient operation and to determine a failure threshold of the MOX fuel rods. Eleven segments were base-irradiated in ATR 'FUGEN' up to 18.4 GWd/t. Zirconium liner claddings were adopted for four segments of them. As the results of non-destructive post irradiation examinations (PIEs) after the base-irradiation and before the ramp tests, no remarkable behavior affecting the integrity of fuel assembly and fuel rod was confirmed. All segments to be used for the ramp tests, which consisted of the multi-step ramp tests and the single-step ramp tests, had instrumentations for in-pile measurements of cladding elongation or plenum pressure, and heated up to the maximum linear power of 58.3-68.4 kW/m without failure. The major results of ramp tests are as follows: There is no difference in PCMI behaviors between two type rods of Zry-2 and Zirconium liner claddings from the in-pile measurements of cladding elongation and plenum pressure. The computations of cladding elongation and inner pressure gave slightly lower elongation and pressure than the in-pile measurements during the ramp-test. However, the cladding relaxation during the power hold was in good agreement, and the fission gas release behavior during cooling down could be evaluated by taking into account the relaxation of contact pressure between pellet and cladding. Although the final power during IFA-591 ramp tests reached the higher linear power than the failure threshold power of UO 2 fuel rods, no indication of fuel failure was observed during the ramp tests. The cladding relaxation due to the creep deformation of the MOX pellets at high temperature could be confirmed at the power steps during the multi-ramp test. The fission gas release due to the emancipation from PCMI stress was observed during the power decreasing. The burn-up dependence could be

AECL's research and development program in environmental science and technology

International Nuclear Information System (INIS)

Cornett, R.J.

1998-07-01

AECL's radiological research and development (R and D) program encompasses work on sources of radiation exposure, radionuclide transport through the environment and potential impacts on biota and on human health. The application of the radiation protection knowledge and technology developed in this program provides cradle-to-grave management for CANDU and related nuclear technologies. This document provides an overview of the Environmental Science and Technology (ES and T) program which is one of the technical areas of R and D within the radiological R and D program. The ES and T program uses science from three main areas: radiochemistry, mathematical modelling and environmental assessment. In addition to providing an overview of the program, this summary also gives specific examples of recent technical work in each of the three areas. These technical examples illustrate the applied nature of the ES and T program and the close coupling of the program to CANDU customer requirements. (author)

Results from the first cycle of the PWR crud deposition test (IFA-665.1)

International Nuclear Information System (INIS)

Bennett, Peter

2004-03-01

The main objective of IFA-665.1 is to deposit crud on fuel rods operating under PWR thermal-hydraulic and water chemistry conditions, and to measure the resulting power reduction due to incorporation of boron into the crud. The test has operated for 160 days at power. Water chemistry conditions were 3.15 ppm LiOH and 1400 ppm boron (pH 300 =7.0). The coolant inlet temperature was 290/294 C, with sub-cooled nucleate boiling along the upper half of the fuel bundle. This report presents the results from the first cycle of operation. Three methods have been used to attempt to accelerate crud formation: (i) injection of simulated crud particles (NiFe 2 O 4 ); (ii) pH transients (reduction of pH 300 from 7.0 to 6.0 for periods of 48 hours); and (iii) oxygen addition transients. While the pH transients resulted in movement of large amounts of corrosion products around the loop, no significant deposition onto the fuel surfaces was measured. Comparison of the heat fluxes in IFA-665 with those in previous tests in which crud deposition has occurred does not clearly identify reasons for the lack of crud formation, although it is noted that higher heat fluxes may be required. In addition, the relatively benign boiling conditions in the current test (small void fraction with no detached voidage) may partly explain the absence of crud formation. For the second cycle of the test, changes will be made to the water chemistry to attempt to increase the concentrations of dissolved and colloidal Fe and Ni in the test rig, such that a continuous (Fe + Ni) level of 100 ppb will be targeted, with short-term concentrations of colloids of up to 500 ppb. (Author)

Decommissioning of AECL Whiteshell Laboratories: progress from first five years of legacy funding

International Nuclear Information System (INIS)

Swartz, R.S.; Bilinsky, D.M.; Harding, J.W.; Ridgway, W.R.

2011-01-01

In 2006, the Government of Canada adopted a new long-term strategy to deal with the nuclear legacy liabilities and initiated a five-year start-up phase. The objective is to safely and cost-effectively reduce these liabilities, and associated risks, based on sound waste management and environmental principles in the best interests of Canadians. AECL's Whiteshell Laboratories is part of the long-term strategy and decommissioning activities are underway. Several redundant non-nuclear buildings have been removed/decommissioned, and redundant nuclear facilities (hot cell facilities, radiochemical laboratories) are being decontaminated and prepared for demolition. This paper describes the progress in the first five-year funding period (2006 April to 2011 March). (author)

Treatment of lymphatic malformations of head and neck with OK-432 sclerotherapy induce systemic inflammatory response.

Science.gov (United States)

Närkiö-Mäkelä, Mervi; Mäkelä, Teppo; Saarinen, Pia; Salminen, Päivi; Julkunen, Ilkka; Pitkäranta, Anne

2011-01-01

Systemic immune responses after OK-432 (Picibanil) sclerotherapy in patients with head and neck lymphatic malformations (LM) were examined to achieve a better understanding of the mechanism of OK-432 sclerotherapy and to evaluate the long-term treatment outcome. Serum samples from 17 consecutive patients with head and neck LMs were collected during a total of 26 OK-432 treatment episodes. Serum C-reactive protein (CRP), interleukins (IL) 1β, 6, 8, 10, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, RANTES, immune protein (IP)-10 and macrophage chemoattractant protein (MCP)-1 as well as blood leukocyte counts were determined. Clinical outcome of the treatment was evaluated at the last visit and from patient files. Elevated serum levels of IP-10 (means at baseline 702 ng/L, after 1 day 1180 ng/L, after 4 weeks 691 ng/L) were seen on day one after OK-432 sclerotherapy (p < 0.05). C-reactive protein and leukocyte counts 1 day after treatment differed statistically significantly (p < 0.05) from the baseline. No significant differences with other cytokines investigated were observed. Patients with macrocystic LM responded better than patients with microcystic LM (p = 0.01). The elevated levels of IP-10, C-reactive protein and leukocyte levels indicate that OK-432 sclerotherapy induces systemic immune responses in patients with LM. The mechanisms of OK-432 sclerotherapy are still not precisely understood, but the IP-10 elevation may reflect local antiangiogenetic properties of immunoactivation induced by OK-432.

Treatment of lymphatic malformations with OK-432 (Picibanil): review of the literature.

Science.gov (United States)

Poldervaart, Michelle T; Breugem, Corstiaan C; Speleman, Lucienne; Pasmans, Suzanne

2009-07-01

Lymphatic malformations (LM) are benign structural defects that can cause serious complications because of their size and location. Traditionally, surgical removal was the first treatment modality, but this could be associated with many complications and risks. Since Ogita introduced OK-432 (picibanil) in 1987 as a treatment method, this sclerosant has become popular. This paper is a review of the trials published so far on this topic. A literature search of English trials with 5 or more patients in it with LM who had never been treated before was done. The paper had to use the microcystic-macrocystic classification and have a mean follow-up of more than a year to be included in this review. Results were classified as "excellent" when the lesions show a regression of more than 90%, "good" when regression is more than 50%, and "poor" when shrinkage is less than 50% (this also includes no response at all). Twenty-seven percent of microcystic LMs show an excellent result; 33%, a good result; and 40%, a poor result. Of the macrocystic LMs, 88% have excellent results. Recurrence rates vary from 5% to 8%. The adverse effects are mostly mild. Most trials have a short follow-up; therefore, there are uncertainties when it comes to cure and regression. Mostly, the adverse effects of OK-432 are trivial and disappear after a week, but the need for a temporary tracheostomy has been described. Screening for allergic reactions to penicilline is needed, with the risk of anaphylactic shock in mind. It is difficult to compare the different techniques used by the authors, and none of the trials included in this study are randomized controlled trials; most are retrospective and were so-called level 4 studies. This review demonstrates that OK-432 is an effective way to treat LM. Because of a possible risk of airway obstruction, treatment should always take place in specialized treatment facilities. Macrocystic lesions show a better response to OK-432 treatment than microcystic lesions

42 CFR 412.432 - Method of payment under the inpatient psychiatric facility prospective payment system.

Science.gov (United States)

2010-10-01

... facility prospective payment system. 412.432 Section 412.432 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM PROSPECTIVE PAYMENT SYSTEMS FOR INPATIENT HOSPITAL SERVICES Prospective Payment System for Inpatient Hospital Services of Inpatient...

Evaluation of OK-432 Injection Therapy as Possible Primary Treatment of Intraoral Ranula.

Science.gov (United States)

Kono, Michihide; Satomi, Takafumi; Abukawa, Harutsugi; Hasegawa, On; Watanabe, Masato; Chikazu, Daichi

2017-02-01

A ranula is a pseudocyst caused by mucous extravasation from the sublingual gland. Recently, a sclerosing agent, OK-432 (picibanil), has been reported to be highly effective for treating lymphangioma and cervical cystic lesions. The present study assessed the effectiveness of OK-432 injection therapy for intraoral ranula to clarify whether it can be used as the primary treatment. The present study was a retrospective clinical study of patients with intraoral ranula who received OK-432 injection therapy from 2005 to 2015. The ranula size was measured on computed tomography or magnetic resonance imaging studies. We dissolved 1 Klinische Einheit (KE) unit of OK-432 powder in normal saline equal to the aspiration volume. The primary endpoint was the treatment results. The secondary endpoints were the relation between the treatment results and the lesion length and aspiration volume. A total of 23 patients received OK-432 injection therapy for an intraoral ranula. The mean lesion size was 19.96 mm. The mean aspiration volume was 2.14 mL. The number of injections was 1 to 4 (mean 1.70). The treatment results were complete regression (CR) in 18 (78.2%), partial regression (PR) in 3 (13.0%), and no response (NR) in 2 (8%) patients after the last injection. The overall efficacy rate was 91.2% (21 of 23). No serious complications were observed. The lesion length and aspiration volume of the CR group was 17.38 mm and 1.40 mL, respectively. The lesion length and aspiration volume of the PR/NR group was 29.20 mm and 4.80 mL, respectively. The PR/NR group lesions were significantly larger than the CR group lesions. OK-432 injection therapy for intraoral ranula is safe and effective compared with other surgical therapies. This therapy could potentially become a primary treatment of intraoral ranula. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

40 CFR 432.105 - New source performance standards (NSPS).

Science.gov (United States)

2010-07-01

... GUIDELINES AND STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY Renderers § 432.105 New source... renderer that does not cure cattle hide as part of the plant operations. If a renderer does cure hide, the...

Ingredientes Farmacéuticos Activos Potencialmente Inapropiados en Adultos Mayores: Lista IFAsPIAM: Panel de Consenso Argentino.

Science.gov (United States)

Marzi, Marta M; Pires, Miryam S; Quaglia, Nora B

2018-04-18

To perform a list agreed by Argentinean experts and adapted to the local context containing potentially inappropriate (PI) medications in old people (OP) usingthe Delphi consensus technique optimized for this subject. A preliminary list of potentially inappropriate medications (PIM) was drawn up based on foreign PIM lists and a selective search in the scientific literature. The iterative Delphi process was used to submit the active pharmaceutical ingredients (APIs) of the preliminary PIM list to the panel of Argentinean experts. The analysis of theanswers to determine the arrival to the consensus was carried out applying three criteria specially defined for this purpose. After two Delphi rounds, it was not reached agreement about 12 APIs. The List of explicit criteria for PIAPIs for use in OP (IFAsPIAM List) was finally constituted by 128 APIs corresponding to 9 groups of the ATC classification system to which they were organized. In addition to each API, information justifying the unfavorable benefit/risk profile and therapeutic alternatives or recommendations/precautions was recorded. The group with the most PI APIs was N (NervousSystem) (60; 47%) followed by groups C (Cardiovascular) and M (Musculoskeletal). This study presents the first Latin American list of PIM in OP developed using an expert consensus technique. The IFAs PIAM List would contribute to the rational use of drugs in elderly population, constituting a valuable tool in Argentinean public health. Copyright © 2018. Published by Elsevier Inc.

AECL's underground research laboratory: technical achievements and lessons learned

International Nuclear Information System (INIS)

Ohta, M.M.; Chandler, N.A.

1997-03-01

During the development of the research program for the Canadian Nuclear Fuel Waste Management Program in the 1970's, the need for an underground facility was recognized. AECL constructed an Underground Research Laboratory (URL) for large-scale testing and in situ engineering and performance-assessment-related experiments on key aspects of deep geological disposal in a representative geological environment. Ale URL is a unique geotechnical research and development facility because it was constructed in a previously undisturbed portion of a granitic pluton that was well characterized before construction began, and because most of the shaft and experimental areas are below the water table. The specific areas of research, development and demonstration include surface and underground characterization; groundwater and solute transport; in situ rock stress conditions; temperature and time-dependent deformation and failure characteristics of rock; excavation techniques to minimize damage to surrounding rock and to ensure safe working conditions; and the performance of seals and backfills. This report traces the evolution of the URL and summarizes the technical achievements and lessons learned during its siting, design and construction, and operating phases over the last 18 years. (author)

The European source-term evaluation code ASTEC: status and applications, including CANDU plant applications

International Nuclear Information System (INIS)

Van Dorsselaere, J.P.; Giordano, P.; Kissane, M.P.; Montanelli, T.; Schwinges, B.; Ganju, S.; Dickson, L.

2004-01-01

Research on light-water reactor severe accidents (SA) is still required in a limited number of areas in order to confirm accident-management plans. Thus, 49 European organizations have linked their SA research in a durable way through SARNET (Severe Accident Research and management NETwork), part of the European 6th Framework Programme. One goal of SARNET is to consolidate the integral code ASTEC (Accident Source Term Evaluation Code, developed by IRSN and GRS) as the European reference tool for safety studies; SARNET efforts include extending the application scope to reactor types other than PWR (including VVER) such as BWR and CANDU. ASTEC is used in IRSN's Probabilistic Safety Analysis level 2 of 900 MWe French PWRs. An earlier version of ASTEC's SOPHAEROS module, including improvements by AECL, is being validated as the Canadian Industry Standard Toolset code for FP-transport analysis in the CANDU Heat Transport System. Work with ASTEC has also been performed by Bhabha Atomic Research Centre, Mumbai, on IPHWR containment thermal hydraulics. (author)

Inferred residual gaps for IFA-527 rods, compared to PIE measurements

International Nuclear Information System (INIS)

Lanning, D.D.

1983-05-01

The NRC-sponsored assembly IFA-527 contained six xenon-filled rods, each instrumented with fuel thermocouples at each end. Five of the six rods contained stable UO 2 fuel pellets with a fabricated diametral gap size of 230 microns. The rods were unique among instrumented test rods in that their lifetime peak powers were quite low (less than 20 kW/m). The assembly was removed at low exposure (about 2 MWd/kgM) due to pressure seal failures. The prefailure measured fuel temperatures in the five identical rods were quite similar, and indicated an effective fuel relocation of about 30 to 35 percent of the as-fabricated gap. Examination of rod cross sections in PIE, however, reveals virtually no reduction in the as-fabricated gap. In an attempt to reconcile these two observations, it is demonstrated that pellet eccentricity could account for the inferred effective relocation for these xenon-filled rods. That analysis is extended to an estimate of the proper effective relocation value for low-powered He-filled rods

The Halden corrosion cycling experiment IFA-560.2. Experimental results and their interpretation

International Nuclear Information System (INIS)

Beck, W.; Boehner, G.; Eberle, R.

1992-01-01

The Halden experiment IFA-560.2 was an experiment in which the corrosion behaviour of PWR fuel rodlets was investigated simultaneously under different load and cooling conditions: Permanent convective cooling at 50% power, permanent nucleate boiling at 100% power and periodic cycling between these two states. The objective was to study possible influences on the corrosion mechanism which might generically be related to the cycling operation. The oxide layer increments after 90 operations days and 60 day/night cycles were evaluated using the Siemens/KWU corrosion model regarding the special thermal hydraulic conditions of the experimental loop. The analysis proves that the layer thickness increases could be described purely following the changes in temperature caused by the power changes. No extra effect due to the frequent changes between the different cooling conditions could be observed. (orig.)

Post-irradiation treatment with OK432 can prevent radiation-induced bone marrow death

International Nuclear Information System (INIS)

Kurishita, A.; Uehara, Y.; Tohoku Univ., Sendai; Katoh, H.; Hirose, S.; Uchida, A.; Mizutani, Y.; Okada, S.; Ono, T.

1991-01-01

The radioprotective effect of OK432, a Streptocuccus haemolyticus preparation, on bone marrow death was examined in mice. The LD 50 value was increased from 7.55 Gy in controls to 8.45 Gy in mice treated once with OK432 immediately after irradiation. Multiple administration of the agent further elevated the LD 50 value to 9.56 Gy. The radioprotective effect was also apparent when multiple treatments were commenced as late as 72 h after irradiation. (author)

17 CFR 4.32 - Trading on a Registered Derivatives Transaction Execution Facility for Non-Institutional Customers.

Science.gov (United States)

2010-04-01

... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Trading on a Registered Derivatives Transaction Execution Facility for Non-Institutional Customers. 4.32 Section 4.32 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION COMMODITY POOL OPERATORS AND COMMODITY TRADING...

Modelling of LOCA Tests with the BISON Fuel Performance Code

Energy Technology Data Exchange (ETDEWEB)

Williamson, Richard L [Idaho National Laboratory; Pastore, Giovanni [Idaho National Laboratory; Novascone, Stephen Rhead [Idaho National Laboratory; Spencer, Benjamin Whiting [Idaho National Laboratory; Hales, Jason Dean [Idaho National Laboratory

2016-05-01

BISON is a modern finite-element based, multidimensional nuclear fuel performance code that is under development at Idaho National Laboratory (USA). Recent advances of BISON include the extension of the code to the analysis of LWR fuel rod behaviour during loss-of-coolant accidents (LOCAs). In this work, BISON models for the phenomena relevant to LWR cladding behaviour during LOCAs are described, followed by presentation of code results for the simulation of LOCA tests. Analysed experiments include separate effects tests of cladding ballooning and burst, as well as the Halden IFA-650.2 fuel rod test. Two-dimensional modelling of the experiments is performed, and calculations are compared to available experimental data. Comparisons include cladding burst pressure and temperature in separate effects tests, as well as the evolution of fuel rod inner pressure during ballooning and time to cladding burst. Furthermore, BISON three-dimensional simulations of separate effects tests are performed, which demonstrate the capability to reproduce the effect of azimuthal temperature variations in the cladding. The work has been carried out in the frame of the collaboration between Idaho National Laboratory and Halden Reactor Project, and the IAEA Coordinated Research Project FUMAC.

40 CFR 432.12 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.12 Section 432.12... attainable by the application of the best practicable control technology currently available (BPT). Except as...) In the case of process wastewater associated with the slaughtering of animals on-site or the...

40 CFR 432.42 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.42 Section 432.42... attainable by the application of the best practicable control technology currently available (BPT). Except as...) In the case of process wastewater associated with the slaughtering of animals on-site or the...

40 CFR 432.32 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.32 Section 432.32... attainable by the application of the best practicable control technology currently available (BPT). Except as...) In the case of process wastewater associated with slaughtering of animals on-site or the processing...

Antibiotics from bacillus subtilis AECL69 8. isolation and purification of a complex of antibacterial antibiotics x

International Nuclear Information System (INIS)

Ahmad, M.S.; Malik, M.A.; Shaukat, G.A.

1996-01-01

A bacterial strain bacillus subtilis AECL69 produces two anti bacterial antibiotics in a specified complex or synthetic medium. One of the antibiotics is characteristically active against Xanthomonas citri. Procedures have been described to isolate and purify a complex of xanthmonas antibiotics from the fermented complex broths, and from the fermented synthetic medium as well. Paper chromatography coupled with bioautography has shown that the complex of xanthomonas antibiotics has at least three components. The three components were indicated irrespective of the fact whether it was isolated from the fermented complex or synthetic broth. (author)

40 CFR 432.22 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.22 Section 432.22... attainable by the application of the best practicable control technology currently available (BPT). Except as... limitations: (1) In the case of process wastewater associated with the slaughtering of animals on-site or the...

Development, irradiation testing and PIE of UMo fuel at AECL

International Nuclear Information System (INIS)

Sears, D.F.

2005-01-01

This paper reviews recent U-Mo dispersion fuel development, irradiation testing and postirradiation examination (PIE) activities at AECL. Low-enriched uranium fuel alloys and powders have been fabricated at Chalk River Labs, with compositions ranging from U-7Mo to U-10Mo. The bulk alloys and powders were characterized using optical and scanning electron microscopy, chemical analysis, X-ray diffraction and neutron diffraction analysis. The analyses confirmed that the powders were of high quality, and in the desired gamma phase. Subsequently, kilogram quantities of DU-Mo and LEU-Mo powder have been manufactured for commercial customers. Mini-elements have been fabricated with LEU-7Mo and LEU-10Mo dispersed in aluminum, with a nominal loading of 4.5 gU/cm 3 . These have been irradiated in the NRU reactor at linear powers up to 100 kW/m. The mini-elements achieved 60 atom% 235 U burnup in 2004 March, and the irradiation is continuing to a planned discharge burnup of 80 atom% 235 U. Interim PIE has been conducted on mini-elements that were removed after 20 atom% 235 U burnup. The PIE results are presented in this paper. (author)

Process optimization by decoupled control of key microbial populations: distribution of activity and abundance of polyphosphate-accumulating organisms and nitrifying populations in a full-scale IFAS-EBPR plant

DEFF Research Database (Denmark)

Onnis-Hayden, Annalisa; Majed, Nehreen; Schramm, Andreas

2011-01-01

This study investigated the abundance and distribution of key functional microbial populations and their activities in a full-scale integrated fixed film activated sludgeeenhanced biological phosphorus removal (IFAS-EBPR) process. Polyphosphate accumulating organisms (PAOs) including Accumulibacter...

Source-term model for the SYVAC3-NSURE performance assessment code

International Nuclear Information System (INIS)

Rowat, J.H.; Rattan, D.S.; Dolinar, G.M.

1996-11-01

Radionuclide contaminants in wastes emplaced in disposal facilities will not remain in those facilities indefinitely. Engineered barriers will eventually degrade, allowing radioactivity to escape from the vault. The radionuclide release rate from a low-level radioactive waste (LLRW) disposal facility, the source term, is a key component in the performance assessment of the disposal system. This report describes the source-term model that has been implemented in Ver. 1.03 of the SYVAC3-NSURE (Systems Variability Analysis Code generation 3-Near Surface Repository) code. NSURE is a performance assessment code that evaluates the impact of near-surface disposal of LLRW through the groundwater pathway. The source-term model described here was developed for the Intrusion Resistant Underground Structure (IRUS) disposal facility, which is a vault that is to be located in the unsaturated overburden at AECL's Chalk River Laboratories. The processes included in the vault model are roof and waste package performance, and diffusion, advection and sorption of radionuclides in the vault backfill. The model presented here was developed for the IRUS vault; however, it is applicable to other near-surface disposal facilities. (author). 40 refs., 6 figs

[Effect of intravenous treatment with OK-432 on the bone marrow in patients with lung cancer].

Science.gov (United States)

Fujii, M; Ishikawa, M; Toki, H

1984-03-01

We studied effects of OK-432 on the bone marrow and peripheral blood cells of lung cancer patients. The nuclear cell count of bone marrow increased in 5 to 7 patients upon intravenous treatment with OK-432 compared with 3 of 6 patients who were intramuscularly treated with OK-432. Serial neutrophil counts of bone marrow increased in all 7 patients treated intravenously compared with 3 of 6 patients treated intramuscularly. The mean nuclear cell count or the serial neutrophil count of bone marrow in intravenously treated patients was significantly higher than the pretreatment values (p less than 0.001). In the peripheral blood picture, the difference in white blood cells or neutrophils before and after intravenous treatment was also statistically significant (p less than 0.01). There was no change in the erythrocytic series count of bone marrow and the hemoglobin count. Our results support the superiority of intravenous OK-432 treatment over intramuscular treatment in the growth-accelerating effect on bone marrow cells, especially regarding the neutrophil series.

Treatment of lymphangiomas with OK-432 (Picibanil) sclerotherapy: a prospective multi-institutional trial.

Science.gov (United States)

Giguère, Chantal M; Bauman, Nancy M; Sato, Yutaka; Burke, Diane K; Greinwald, John H; Pransky, Seth; Kelley, Peggy; Georgeson, Keith; Smith, Richard J H

2002-10-01

To describe and to determine the robustness of our study evaluating the efficacy of OK-432 (Picibanil) as a therapeutic modality for lymphangiomas. Prospective, randomized trial and parallel-case series at 13 US tertiary care referral centers. Thirty patients diagnosed as having lymphangioma. Ages in 25 ranged from 6 months to 18 years. Twenty-nine had lesions located in the head-and-neck area. Every patient received a 4-dose injection series of OK-432 scheduled 6 to 8 weeks apart unless a contraindication existed or a complete response was observed before completion of all injections. A control group was observed for 6 months. Successful outcome of therapy was defined as a complete or a substantial (>60%) reduction in lymphangioma size as determined by calculated lesion volumes on computed tomographic or magnetic resonance imaging scans. Overall, 19 (86%) of the 22 patients with predominantly macrocystic lymphangiomas had a successful outcome. OK-432 should be efficacious in the treatment of lymphangiomas. Our study design is well structured to clearly define the role of this treatment agent.

Intercomparison and validation of computer codes for thermalhydraulic safety analysis of heavy water reactors

International Nuclear Information System (INIS)

2004-08-01

Activities within the frame of the IAEA's Technical Working Group on Advanced Technologies for HWRs (TWG-HWR) are conducted in a project within the IAEA's subprogramme on nuclear power reactor technology development. The objective of the activities on HWRs is to foster, within the frame of the TWG-HWR, information exchange and co-operative research on technology development for current and future HWRs, with an emphasis on safety, economics and fuel resource sustainability. One of the activities recommended by the TWG-HWR was an international standard problem exercise entitled: Intercomparison and validation of computer codes for thermalhydraulics safety analyses. Intercomparison and validation of computer codes used in different countries for thermalhydraulics safety analyses will enhance the confidence in the predictions made by these codes. However, the intercomparison and validation exercise needs a set of reliable experimental data. The RD-14M Large-Loss Of Coolant Accident (LOCA) test B9401 simulating HWR LOCA behaviour that was conducted by Atomic Energy of Canada Ltd (AECL) was selected for this validation project. This report provides a comparison of the results obtained from six participating countries, utilizing four different computer codes. General conclusions are reached and recommendations made

Development of Off-take Model, Subcooled Boiling Model, and Radiation Heat Transfer Input Model into the MARS Code for a Regulatory Auditing of CANDU Reactors

Energy Technology Data Exchange (ETDEWEB)

Yoon, C.; Rhee, B. W.; Chung, B. D. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Ahn, S. H.; Kim, M. W. [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

2009-05-15

Korea currently has four operating units of the CANDU-6 type reactor in Wolsong. However, the safety assessment system for CANDU reactors has not been fully established due to a lack of self-reliance technology. Although the CATHENA code had been introduced from AECL, it is undesirable to use a vendor's code for a regulatory auditing analysis. In Korea, the MARS code has been developed for decades and is being considered by KINS as a thermal hydraulic regulatory auditing tool for nuclear power plants. Before this decision, KINS (Korea Institute of Nuclear Safety) had developed the RELAP5/MOD3/CANDU code for CANDU safety analyses by modifying the model of the existing PWR auditing tool, RELAP5/MOD3. The main purpose of this study is to transplant the CANDU models of the RELAP5/MOD3/CANDU code to the MARS code including a quality assurance of the developed models.

Development of Off-take Model, Subcooled Boiling Model, and Radiation Heat Transfer Input Model into the MARS Code for a Regulatory Auditing of CANDU Reactors

International Nuclear Information System (INIS)

Yoon, C.; Rhee, B. W.; Chung, B. D.; Ahn, S. H.; Kim, M. W.

2009-01-01

Korea currently has four operating units of the CANDU-6 type reactor in Wolsong. However, the safety assessment system for CANDU reactors has not been fully established due to a lack of self-reliance technology. Although the CATHENA code had been introduced from AECL, it is undesirable to use a vendor's code for a regulatory auditing analysis. In Korea, the MARS code has been developed for decades and is being considered by KINS as a thermal hydraulic regulatory auditing tool for nuclear power plants. Before this decision, KINS (Korea Institute of Nuclear Safety) had developed the RELAP5/MOD3/CANDU code for CANDU safety analyses by modifying the model of the existing PWR auditing tool, RELAP5/MOD3. The main purpose of this study is to transplant the CANDU models of the RELAP5/MOD3/CANDU code to the MARS code including a quality assurance of the developed models

The MOX fuel behaviour test IFA-597.4/.5/.6/.7; Summary of in-pile fuel temperature and gas release data

Energy Technology Data Exchange (ETDEWEB)

Koike, Hisashi

2003-11-15

It is considered important to study the in-reactor behaviour of MOX fuel in order to enhance the database on such fuel. For this reason, IFA-597.4/.5/.6/.7 were included in the joint research programme of the Halden Project. The series of tests, containing two MIMAS-MOX fuel rods, both equipped with a fuel centre thermocouple and a pressure bellows transducer, has been irradiated in the Halden Reactor since July 1997 under HBWR conditions. The objectives of the test series were to study the thermal and fission gas release (FGR) behaviour of MOX fuel and to explore potential differences in behaviour between solid and hollow pellets. One of the rods had mainly solid pellets, while the other contained only hollow pellets. Both rods had an initial Pu-fissile enrichment of 6.07%. The cladding outside diameter was 9.50 mm, and the initial fuel-clad gap was 180 mum. In the course of the test, power upratings for FGR studies of the MOX fuel were planned at burnup intervals of about 10 MWd/kg MOX. The power uprating was successfully performed at approx10 MWd/kg MOX, where the estimated fuel peak temperature of the solid pellets exceeded the FGR threshold temperature for UO{sub 2} fuel, while that of the hollow pellets remained below the threshold. For the solid fuel, the temperature at onset of FGR was consistent with the empirical threshold temperature for UO{sub 2} fuel. For the hollow fuel, gas release was observed at temperatures below the threshold. FGRs at the end-of-life were approx17% for the solid pellet rod and approx14% for the hollow pellet rod, respectively. As a result of discussions in HPG meetings, IFA-597.7 was unloaded in January 2002. PIE was carried out to check in-pile pressure measurements and examine fuel structural characteristics. The discharge burn-up of the MOX fuel was 32 MWd/kg MOX as determined from in-pile power data. This report supersedes HWR-712 (June 2002) previously issued on in-pile data from IFA-597.4/5/6/7. (Author)

Treatment of Primary Fetal Hydrothorax with OK-432 (Picibanil): Outcome in 14 Fetuses and a Review of the Literature.

Science.gov (United States)

O'Brien, Brooke; Kesby, Greg; Ogle, Robert; Rieger, Ingrid; Hyett, Jon A

2015-01-01

Primary fetal hydrothorax (PFHT) is an uncommon condition with an estimated prevalence of 1 in 10,000/15,000 pregnancies. Therapeutic interventions include thoracocentesis, thoraco-amniotic shunting (TAS), and pleurodesis using OK-432. A review of the literature was performed to identify all cases of PFHT treated with TAS and OK-432. All cases of PFHT referred to the Fetal Maternal Unit at Royal Prince Alfred Hospital between 2002 and 2012 were retrospectively reviewed. In the cohort of fetuses treated with OK-432, the main perinatal outcomes evaluated were termination of pregnancy, live birth, neonatal death, and fetal death in utero. Secondary outcomes included gestational age (GA) at diagnosis, GA at treatment, GA at resolution, birth weight, and GA at birth. The development of the children was screened using the Ages and Stages Questionnaires, Version 3 (ASQ-3, 2009). Primary hydrothorax was diagnosed in 31 fetuses, of which 14 had treatment with OK-432. One pregnancy terminated after treatment with OK-432. Survival was 85% (11/13): 100% in fetuses treated with OK-432 without hydrops, and 78% in those treated with hydrops. This compares well to the cases of TAS in the literature with an average survival of 63%: 85% in fetuses without hydrops and 55% with hydrops. The mean GA at birth was 36(+4) weeks and mean birth weight 3,007 g. Eight of the 9 children screened with ASQ-3 scored well within the normal range. OK-432 appears to be a valid treatment option in fetuses with PFHT, particularly in those diagnosed at early GAs. © 2014 S. Karger AG, Basel.

A benchmark comparison of the Canadian Supercritical Water-Cooled Reactor (SCWR) 64-element fuel lattice cell parameters using various computer codes

Energy Technology Data Exchange (ETDEWEB)

Sharpe, J.; Salaun, F.; Hummel, D.; Moghrabi, A., E-mail: sharpejr@mcmaster.ca [McMaster University, Hamilton, ON (Canada); Nowak, M. [McMaster University, Hamilton, ON (Canada); Institut National Polytechnique de Grenoble, Phelma, Grenoble (France); Pencer, J. [McMaster University, Hamilton, ON (Canada); Canadian Nuclear Laboratories, Chalk River, ON, (Canada); Novog, D.; Buijs, A. [McMaster University, Hamilton, ON (Canada)

2015-07-01

Discrepancies in key lattice physics parameters have been observed between various deterministic (e.g. DRAGON and WIMS-AECL) and stochastic (MCNP, KENO) neutron transport codes in modeling previous versions of the Canadian SCWR lattice cell. Further, inconsistencies in these parameters have also been observed when using different nuclear data libraries. In this work, the predictions of k∞, various reactivity coefficients, and relative ring-averaged pin powers have been re-evaluated using these codes and libraries with the most recent 64-element fuel assembly geometry. A benchmark problem has been defined to quantify the dissimilarities between code results for a number of responses along the fuel channel under prescribed hot full power (HFP), hot zero power (HZP) and cold zero power (CZP) conditions and at several fuel burnups (0, 25 and 50 MW·d·kg{sup -1} [HM]). Results from deterministic (TRITON, DRAGON) and stochastic codes (MCNP6, KENO V.a and KENO-VI) are presented. (author)

A benchmark comparison of the Canadian Supercritical Water-Cooled Reactor (SCWR) 64-element fuel lattice cell parameters using various computer codes

International Nuclear Information System (INIS)

Sharpe, J.; Salaun, F.; Hummel, D.; Moghrabi, A.; Nowak, M.; Pencer, J.; Novog, D.; Buijs, A.

2015-01-01

Discrepancies in key lattice physics parameters have been observed between various deterministic (e.g. DRAGON and WIMS-AECL) and stochastic (MCNP, KENO) neutron transport codes in modeling previous versions of the Canadian SCWR lattice cell. Further, inconsistencies in these parameters have also been observed when using different nuclear data libraries. In this work, the predictions of k∞, various reactivity coefficients, and relative ring-averaged pin powers have been re-evaluated using these codes and libraries with the most recent 64-element fuel assembly geometry. A benchmark problem has been defined to quantify the dissimilarities between code results for a number of responses along the fuel channel under prescribed hot full power (HFP), hot zero power (HZP) and cold zero power (CZP) conditions and at several fuel burnups (0, 25 and 50 MW·d·kg"-"1 [HM]). Results from deterministic (TRITON, DRAGON) and stochastic codes (MCNP6, KENO V.a and KENO-VI) are presented. (author)

Implementation of Wolsong Pump Model, Pressure Tube Deformation Model and Off-take Model into MARS Code for Regulatory Auditing of CANDU Reactors

Energy Technology Data Exchange (ETDEWEB)

Yoon, C.; Rhee, B. W.; Chung, B. D. [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Cho, Y. J.; Kim, M. W. [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

2008-05-15

Korea currently has four operating units of the CANDU-6 type reactor in Wolsong. However, the safety assessment system for CANDU reactors has not been fully established due to lack of self-reliance technology. Although the CATHENA code had been introduced from AECL, it is undesirable to use vendor's code for regulatory auditing analysis. In Korea, the MARS code has been developed for decades and is being considered by KINS as a thermal hydraulic regulatory auditing tool for nuclear power plants. Before this decision, KINS (Korea Institute of Nuclear Safety) had developed RELAP5/MOD3/CANDU code for CANDU safety analyses by modifying the model of existing PWR auditing tool, RELAP5/MOD3. The main purpose of this study is to transplant the CANDU models of RELAP5/MOD3/CANDU code to MARS code including quality assurance of the developed models. This first part of the research series presents the implementation and verification of the Wolsong pump model, the pressure tube deformation model, and the off-take model for arbitrary-angled branch pipes.

Implementation of Wolsong Pump Model, Pressure Tube Deformation Model and Off-take Model into MARS Code for Regulatory Auditing of CANDU Reactors

International Nuclear Information System (INIS)

Yoon, C.; Rhee, B. W.; Chung, B. D.; Cho, Y. J.; Kim, M. W.

2008-01-01

Korea currently has four operating units of the CANDU-6 type reactor in Wolsong. However, the safety assessment system for CANDU reactors has not been fully established due to lack of self-reliance technology. Although the CATHENA code had been introduced from AECL, it is undesirable to use vendor's code for regulatory auditing analysis. In Korea, the MARS code has been developed for decades and is being considered by KINS as a thermal hydraulic regulatory auditing tool for nuclear power plants. Before this decision, KINS (Korea Institute of Nuclear Safety) had developed RELAP5/MOD3/CANDU code for CANDU safety analyses by modifying the model of existing PWR auditing tool, RELAP5/MOD3. The main purpose of this study is to transplant the CANDU models of RELAP5/MOD3/CANDU code to MARS code including quality assurance of the developed models. This first part of the research series presents the implementation and verification of the Wolsong pump model, the pressure tube deformation model, and the off-take model for arbitrary-angled branch pipes

Experimental intraperitoneal infusion of OK-432 in rats: Evaluation of peritoneal complications and pathology

Energy Technology Data Exchange (ETDEWEB)

Kim, Dong Wook [Department of Radiology, Busan Paik Hospital, Inje University College of Medicine, Busan (Korea, Republic of); Kim, Hak Jin, E-mail: hakjink@pusan.ac.k [Department of Radiology, Pusan National University Hospital, Pusan National University College of Medicine, Medical Research Institute, Busan (Korea, Republic of); Lee, Jun Woo [Department of Radiology, Pusan National University Hospital, Pusan National University College of Medicine, Medical Research Institute, Busan (Korea, Republic of)

2010-06-15

Purpose: OK-432 is known to be a potent sclerosant of cystic lesions. The purpose of this study was to evaluate both its safety and pathologic effects after the infusion of OK-432 into the peritoneal cavity of rats. Materials and methods: Twenty male rats were used in this study. Twelve rats were infused intraperitoneally with 0.2 Klinishe Einheit of OK-432 melted in 2 mL of normal saline (group 1: the treated group); four rats each were infused intraperitoneally with 0.5 mL of 99% ethanol (group 2) and normal saline (group 3), and served as the control groups. An abdominal ultrasonographic examination was performed both before and after the infusions in all rats. Three rats in group 1 and one rat in each of groups 2 and 3 were sacrificed each week following the infusion. Gross and microscopic evaluations of the peritoneum and abdominal cavity were performed on each rat. Results: In group 1, the abdomen was clear on gross inspection and the peritoneum was unremarkable on microscopic examination. In group 2, mild-to-moderate peritoneal adhesions were revealed grossly, and inflammation and fibrosis of the peritoneum were demonstrated microscopically. In group 3, no specific abnormalities were noted on gross or microscopic examinations. Conclusion: Leakage or abnormal infusion of OK-432 solution into the peritoneal cavity during sclerotherapy of intra-abdominal or retroperitoneal cystic lesions does not result in any significant complications.

Experimental intraperitoneal infusion of OK-432 in rats: Evaluation of peritoneal complications and pathology

International Nuclear Information System (INIS)

Kim, Dong Wook; Kim, Hak Jin; Lee, Jun Woo

2010-01-01

Purpose: OK-432 is known to be a potent sclerosant of cystic lesions. The purpose of this study was to evaluate both its safety and pathologic effects after the infusion of OK-432 into the peritoneal cavity of rats. Materials and methods: Twenty male rats were used in this study. Twelve rats were infused intraperitoneally with 0.2 Klinishe Einheit of OK-432 melted in 2 mL of normal saline (group 1: the treated group); four rats each were infused intraperitoneally with 0.5 mL of 99% ethanol (group 2) and normal saline (group 3), and served as the control groups. An abdominal ultrasonographic examination was performed both before and after the infusions in all rats. Three rats in group 1 and one rat in each of groups 2 and 3 were sacrificed each week following the infusion. Gross and microscopic evaluations of the peritoneum and abdominal cavity were performed on each rat. Results: In group 1, the abdomen was clear on gross inspection and the peritoneum was unremarkable on microscopic examination. In group 2, mild-to-moderate peritoneal adhesions were revealed grossly, and inflammation and fibrosis of the peritoneum were demonstrated microscopically. In group 3, no specific abnormalities were noted on gross or microscopic examinations. Conclusion: Leakage or abnormal infusion of OK-432 solution into the peritoneal cavity during sclerotherapy of intra-abdominal or retroperitoneal cystic lesions does not result in any significant complications.

Verification of the MOTIF code version 3.0

International Nuclear Information System (INIS)

Chan, T.; Guvanasen, V.; Nakka, B.W.; Reid, J.A.K.; Scheier, N.W.; Stanchell, F.W.

1996-12-01

As part of the Canadian Nuclear Fuel Waste Management Program (CNFWMP), AECL has developed a three-dimensional finite-element code, MOTIF (Model Of Transport In Fractured/ porous media), for detailed modelling of groundwater flow, heat transport and solute transport in a fractured rock mass. The code solves the transient and steady-state equations of groundwater flow, solute (including one-species radionuclide) transport, and heat transport in variably saturated fractured/porous media. The initial development was completed in 1985 (Guvanasen 1985) and version 3.0 was completed in 1986. This version is documented in detail in Guvanasen and Chan (in preparation). This report describes a series of fourteen verification cases which has been used to test the numerical solution techniques and coding of MOTIF, as well as demonstrate some of the MOTIF analysis capabilities. For each case the MOTIF solution has been compared with a corresponding analytical or independently developed alternate numerical solution. Several of the verification cases were included in Level 1 of the International Hydrologic Code Intercomparison Project (HYDROCOIN). The MOTIF results for these cases were also described in the HYDROCOIN Secretariat's compilation and comparison of results submitted by the various project teams (Swedish Nuclear Power Inspectorate 1988). It is evident from the graphical comparisons presented that the MOTIF solutions for the fourteen verification cases are generally in excellent agreement with known analytical or numerical solutions obtained from independent sources. This series of verification studies has established the ability of the MOTIF finite-element code to accurately model the groundwater flow and solute and heat transport phenomena for which it is intended. (author). 20 refs., 14 tabs., 32 figs

Validation of WIMS-CANDU using Pin-Cell Lattices

International Nuclear Information System (INIS)

Kim, Won Young; Min, Byung Joo; Park, Joo Hwan

2006-01-01

The WIMS-CANDU is a lattice code which has a depletion capability for the analysis of reactor physics problems related to a design and safety. The WIMS-CANDU code has been developed from the WIMSD5B, a version of the WIMS code released from the OECD/NEA data bank in 1998. The lattice code POWDERPUFS-V (PPV) has been used for the physics design and analysis of a natural uranium fuel for the CANDU reactor. However since the application of PPV is limited to a fresh fuel due to its empirical correlations, the WIMS-AECL code has been developed by AECL to substitute the PPV. Also, the WIMS-CANDU code is being developed to perform the physics analysis of the present operating CANDU reactors as a replacement of PPV. As one of the developing work of WIMS-CANDU, the U 238 absorption cross-section in the nuclear data library of WIMS-CANDU was updated and WIMS-CANDU was validated using the benchmark problems for pin-cell lattices such as TRX-1, TRX-2, Bapl-1, Bapl-2 and Bapl-3. The results by the WIMS-CANDU and the WIMS-AECL were compared with the experimental data

RESPIROMETRIC ACTIVITY OF ACTIVATED SLUDGE AND BIOFILM IN IFAS-MBBR SYSTEM

Directory of Open Access Journals (Sweden)

Paula Piechna

2017-07-01

Full Text Available The aim of the presented study was: a assessment of activity of microorganisms developed in form of activated sludge and biofilm, b indirect assessment of the role of analyzed biocoenoses in removal of organic compounds in hybrid reactor with moving bed. Oxygen uptake rate tests (OUR have been used, and obtained results were presented as volumetric activity (expressed in mg O2/L · h and mass activity (expressed as mg O2/g VTS · h. Tests were conducted for three different variants, in which, as the biomass: 1 biofilm was used, 2 activated sludge was used, 3 biofilm and activated sludge were used. The biomass was collected from aerobic reactor from a wastewater treatment plant working in IFAS-MBBR system. The highest volumetric activity was observed for variant with biofilm and activated sludge, and the lowest for variant with biofilm only. Nonetheless, the highest value of oxygen uptake rate related to total volatile solids was observed for variant with biofilm and the lowest for activated sludge. Obtained results suggest, that during this research, at the wastewater treatment plant, the main role in removal of organic pollutants played the biomass developed in form of activated sludge.

ZENO: N-body and SPH Simulation Codes

Science.gov (United States)

Barnes, Joshua E.

2011-02-01

The ZENO software package integrates N-body and SPH simulation codes with a large array of programs to generate initial conditions and analyze numerical simulations. Written in C, the ZENO system is portable between Mac, Linux, and Unix platforms. It is in active use at the Institute for Astronomy (IfA), at NRAO, and possibly elsewhere. Zeno programs can perform a wide range of simulation and analysis tasks. While many of these programs were first created for specific projects, they embody algorithms of general applicability and embrace a modular design strategy, so existing code is easily applied to new tasks. Major elements of the system include: Structured data file utilities facilitate basic operations on binary data, including import/export of ZENO data to other systems.Snapshot generation routines create particle distributions with various properties. Systems with user-specified density profiles can be realized in collisionless or gaseous form; multiple spherical and disk components may be set up in mutual equilibrium.Snapshot manipulation routines permit the user to sift, sort, and combine particle arrays, translate and rotate particle configurations, and assign new values to data fields associated with each particle.Simulation codes include both pure N-body and combined N-body/SPH programs: Pure N-body codes are available in both uniprocessor and parallel versions.SPH codes offer a wide range of options for gas physics, including isothermal, adiabatic, and radiating models. Snapshot analysis programs calculate temporal averages, evaluate particle statistics, measure shapes and density profiles, compute kinematic properties, and identify and track objects in particle distributions.Visualization programs generate interactive displays and produce still images and videos of particle distributions; the user may specify arbitrary color schemes and viewing transformations.

Computation of a Canadian SCWR unit cell with deterministic and Monte Carlo codes

International Nuclear Information System (INIS)

Harrisson, G.; Marleau, G.

2012-01-01

The Canadian SCWR has the potential to achieve the goals that the generation IV nuclear reactors must meet. As part of the optimization process for this design concept, lattice cell calculations are routinely performed using deterministic codes. In this study, the first step (self-shielding treatment) of the computation scheme developed with the deterministic code DRAGON for the Canadian SCWR has been validated. Some options available in the module responsible for the resonance self-shielding calculation in DRAGON 3.06 and different microscopic cross section libraries based on the ENDF/B-VII.0 evaluated nuclear data file have been tested and compared to a reference calculation performed with the Monte Carlo code SERPENT under the same conditions. Compared to SERPENT, DRAGON underestimates the infinite multiplication factor in all cases. In general, the original Stammler model with the Livolant-Jeanpierre approximations are the most appropriate self-shielding options to use in this case of study. In addition, the 89 groups WIMS-AECL library for slight enriched uranium and the 172 groups WLUP library for a mixture of plutonium and thorium give the most consistent results with those of SERPENT. (authors)

Development of a high-power 432 MHz DTL

International Nuclear Information System (INIS)

Naito, F.; Kato, T.; Takasaki, E.; Yamazaki, Y.; Kawasumi, T.; Suzuki, K.; Iino, Y.

1992-01-01

A high-power model of a 432 MHz Drift-Tube Linac is under construction. It will accelerate H - ions from 3 to 5.4 MeV, and is a prototype of the DTL for the Japanese Hadron Project. Several new techniques have been developed for constructing the DTL: fabricating and assembling methods of permanent quadrupole magnet and a drift tube, alignment of the drift tube, and a method of connecting the tanks. (Author) 6 refs., 5 figs

Decommissioning of AECL Whiteshell laboratories - 16311

International Nuclear Information System (INIS)

Koroll, Grant W.; Bilinsky, Dennis M.; Swartz, Randall S.; Harding, Jeff W.; Rhodes, Michael J.; Ridgway, Randall W.

2009-01-01

Whiteshell Laboratories (WL) is a Nuclear Research and Test Establishment near Winnipeg, Canada, operated by AECL since the early 1960's and now under decommissioning. WL occupies approximately 4400 hectares of land and employed more than 1000 staff up to the late-1990's, when the closure decision was made. Nuclear facilities at WL included a research reactor, hot cell facilities and radiochemical laboratories. Programs carried out at the WL site included high level nuclear fuel waste management research, reactor safety research, nuclear materials research, accelerator technology, biophysics, and industrial radiation applications. In preparation for decommissioning, a comprehensive environmental assessment was successfully completed [1] and the Canadian Nuclear Safety Commission issued a six-year decommissioning licence for WL starting in 2003 - the first decommissioning licence issued for a Nuclear Research and Test Establishment in Canada. This paper describes the progress in this first six-year licence period. A significant development in 2006 was the establishment of the Nuclear Legacy Liabilities Program (NLLP), by the Government of Canada, to safely and cost effectively reduce, and eventually eliminate the nuclear legacy liabilities and associated risks, using sound waste management and environmental principles. The NLLP endorsed an accelerated approach to WL Decommissioning, which meant advancing the full decommissioning of buildings and facilities that had originally been planned to be decontaminated and prepared for storage-with-surveillance. As well the NLLP endorsed the construction of enabling facilities - facilities that employ modern waste handling and storage technology on a scale needed for full decommissioning of the large radiochemical laboratories and other nuclear facilities. The decommissioning work and the design and construction of enabling facilities are fully underway. Several redundant non-nuclear buildings have been removed and redundant

Past and future fracturing in AECL Research areas in the superior province of the Canadian Precambrian Shield, with emphasis on the Lac du Bonnet Batholith

Energy Technology Data Exchange (ETDEWEB)

Brown, A; Everitt, R A; Martin, C D; Davison, C C [Atomic Energy of Canada Ltd., Pinawa, MB (Canada). Whiteshell Labs.

1995-10-01

The likelihood that future fracturing, arising from geologic causes, could occur in the vicinity of a nuclear fuel waste repository in plutonic rock of the Canadian Precambrian Shield, is examined. The report discusses the possible causes of fracturing (both past and future) in Shield rocks. The report then examines case histories of fracture formation in Precambrian plutonic rocks in AECL`s Research Areas, especially the history of the Lac du Bonnet Batholith, in the Whiteshell Area, Manitoba. Initially, fractures can be introduced into intrusive plutonic rocks during crystallization and cooling of an intrusive magma. These fractures are found at all size scales; as late residual magma dyking, hydraulic fracturing by retrograde boiling off of hydrothermal fluids, and, in some cases, through local differential cooling. Subsequent fracturing is largely caused by changes in environmental temperature and stress field, rather than by alteration of the material behaviour of the rock. Pluton emplacement during orogeny is commonly accompanied by uplift and erosional exhumation, altering both the tectonic and the lithostatic stresses, the rock temperature gradient and the pore fluid characteristics.

Predictions of Critical Heat Flux Using the ASSERT-PV Subchannel Code for a CANFLEX Variant Bundle

International Nuclear Information System (INIS)

Onder, Ebru Nihan; Leung, Laurence; Kim, Hung; Rao, Yanfei

2009-01-01

The ASSERT-PV subchannel code developed by AECL has been applied as a design-assist tool to the advanced CANDU 1 reactor fuel bundle. Based primarily on the CANFLEX 2 fuel bundle, several geometry changes (such as element sizes and pitchcircle diameters of various element rings) were examined to optimize the dryout power and pressure-drop performances of the new fuel bundle. An experiment was performed to obtain dryout power measurements for verification of the ASSERT-PV code predictions. It was carried out using an electrically heated, Refrigerant-134a cooled, fuel bundle string simulator. The axial power profile of the simulator was uniform, while the radial power profile of the element rings was varied simulating profiles in bundles with various fuel compositions and burn-ups. Dryout power measurements are predicted closely using the ASSERT-PV code, particularly at low flows and low pressures, but are overpredicted at high flows and high pressures. The majority of data shows that dryout powers are underpredicted at low inlet-fluid temperatures but overpredicted at high inlet-fluid temperatures

Comparison of Heavy Water Reactor Thermalhydraulic Code Predictions with Small Break LOCA Experimental Data

International Nuclear Information System (INIS)

2012-08-01

Activities within the frame of the IAEA's Technical Working Group on Advanced Technologies for HWRs (TWG-HWR) are conducted in a project within the IAEA's subprogramme on nuclear power reactor technology development. The objective of the activities on HWRs is to foster, within the frame of the TWG-HWR, information exchange and cooperative research on technology development for current and future HWRs, with an emphasis on safety, economics and fuel resource sustainability. One of the activities recommended by the TWG-HWR was an international standard problem exercise entitled Intercomparison and Validation of Computer Codes for Thermalhydraulics Safety Analyses. Intercomparison and validation of computer codes used in different countries for thermalhydraulics safety analyses will enhance the confidence in the predictions made by these codes. However, the intercomparison and validation exercise needs a set of reliable experimental data. Two RD-14M small break loss of coolant accident (SBLOCA) tests, simulating HWR LOCA behaviour, conducted by Atomic Energy of Canada Ltd (AECL), were selected for this validation project. This report provides a comparison of the results obtained from eight participating organizations from six countries (Argentina, Canada, China, India, Republic of Korea, and Romania), utilizing four different computer codes (ATMIKA, CATHENA, MARS-KS, and RELAP5). General conclusions are reached and recommendations made.

Modification of radiation therapy by RP-170, hypoxic cell sensitizer and OK-432, biological response modifier (BRM)

International Nuclear Information System (INIS)

Murayama, Chieko; Mori, Tomoyuki; Tamauchi, Hidekazu

1995-01-01

Studies have shown that the combination therapy with RP-170, irradiation and OK-432 could produce significantly higher antitumor effect. The multiple local administration of OK-432 showed superior sensitizing effect in tumor growth delay, tumor control and survival rate. DMF from TCD 50 assay was 2.09 which might be equivalent to that from irradiation with over several hundred mg/kg of RP-170. Additionally combined with 50 mg/kg RP-170, nearly available dose in clinical use, the combined treatment with RP-170, irradiation and OK-432 produced DMF of 1.4, which could be gotten by over 100 mg/kg of RP-170. The success of this combination therapy on murine tumors might also suggest a possibility for a great benefit in clinical radiotherapy. More detailed investigations, histological and immunological research, are under progress. 14 refs., 2 tabs., 3 figs

Sclerotherapy of cervical cysts with Picibanil (OK-432).

Science.gov (United States)

Knipping, Stephan; Goetze, Gerrit; Neumann, Kerstin; Bloching, Marc

2007-04-01

The effectiveness of intralesional sclerotherapy of lymphangiomas and ranulas with OK-432 (Picibanil) has been proved in several clinical studies. The aim of our study was to review the effectiveness of sclerotherapy of benign cervical cysts with Picibanil as an alternative method to surgical excision. Between March 2002 and March 2006, a prospective observational study was carried out to assess the effects of Picibanil on cervical cysts. Between 2002 and 2006 we treated 14 patients having cervical cysts through intralesional application of Picibanil with a dose of 0.01 mg/ml. So far we used Picibanil with 13 patients achieving a high success rate. In eight cases we observed, both clinically and ultrasonographically, a nearly complete regression, and a complete regression of the cysts in three cases. In two cases the cysts atrophied. In these cases only residual findings could be observed. In one case we extirpated the remaining cyst. If there is no clear reaction of the cyst to the treatment, an excision is indicated 6 weeks after the injections to gain meaningful histological examination. No significant complication after sclerotherapy with Picibanil was observed. According to our results the application of OK-432 (Picibanil) is a safe and effective primary method for sclerotherapy of benign cervical cysts which can replace surgical extirpation in special cases. However, the risk of malign diseases has to be excluded before the commencement of the Picibanil treatment.

The bacterial preparation OK432 induces IL-12p70 secretion in human dendritic cells in a TLR3 dependent manner.

Science.gov (United States)

Hovden, Arnt-Ove; Karlsen, Marie; Jonsson, Roland; Appel, Silke

2012-01-01

Dendritic cells (DC) used in therapeutic cancer immunotherapy have to be able to stimulate T cells resulting in an immune response that can efficiently target the cancer cells. One of the critical hurdles has been the lack of IL-12p70 production when maturating the DC, which is rectified by using the bacterial preparation OK432 (trade name Picibanil) to mature the cells. In order to identify the mechanism behind OK432 stimulation of DC, we investigated the contribution of different TLR to examine their involvement in IL-12p70 production. By combining different inhibitors of TLR signaling, we demonstrate here that TLR3 is responsible for the IL-12p70 production of DC induced by OK432. Moreover, our data suggest that the ligand triggering IL-12p70 secretion upon TLR3 stimulation is sensitive to proteinase and partly also RNAse treatment. The fact that a bacterial compound like OK432 can activate the TLR3 pathway in human DC is a novel finding. OK432 demonstrates a critical ability to induce IL-12p70 production, which is of great relevance in DC based cancer immunotherapy.

The bacterial preparation OK432 induces IL-12p70 secretion in human dendritic cells in a TLR3 dependent manner.

Directory of Open Access Journals (Sweden)

Arnt-Ove Hovden

Full Text Available Dendritic cells (DC used in therapeutic cancer immunotherapy have to be able to stimulate T cells resulting in an immune response that can efficiently target the cancer cells. One of the critical hurdles has been the lack of IL-12p70 production when maturating the DC, which is rectified by using the bacterial preparation OK432 (trade name Picibanil to mature the cells. In order to identify the mechanism behind OK432 stimulation of DC, we investigated the contribution of different TLR to examine their involvement in IL-12p70 production. By combining different inhibitors of TLR signaling, we demonstrate here that TLR3 is responsible for the IL-12p70 production of DC induced by OK432. Moreover, our data suggest that the ligand triggering IL-12p70 secretion upon TLR3 stimulation is sensitive to proteinase and partly also RNAse treatment. The fact that a bacterial compound like OK432 can activate the TLR3 pathway in human DC is a novel finding. OK432 demonstrates a critical ability to induce IL-12p70 production, which is of great relevance in DC based cancer immunotherapy.

Analysis of flow-induced vibration of heat exchanger and steam generator tube bundles using the AECL computer code PIPEAU-2

International Nuclear Information System (INIS)

Gorman, D.J.

1983-12-01

PIPEAU-2 is a computer code developed at the Chalk River Nuclear Laboratories for the flow-induced vibration analysis of heat exchanger and steam generator tube bundles. It can perform this analysis for straight and 'U' tubes. All the theoretical work underlying the code is analytical rather than numerical in nature. Highly accurate evaluation of the free vibration frequencies and mode shapes is therefore obtained. Using the latest experimentally determined parameters available, the free vibration analysis is followed by a forced vibration analysis. Tube response due to fluid turbulence and vortex shedding is determined, as well as critical fluid velocity associated with fluid-elastic instability

The use of HANDIDET reg-sign non-electric detonator assemblies to reduce blast-induced overpressure at AECL's Underground Research Laboratory

International Nuclear Information System (INIS)

Onagi, D.P.; Keith, S.G.; Kuzyk, G.W.

1996-01-01

A number of aspects of the Canadian concept for nuclear fuel waste disposal are being assessed by Atomic Energy of Canada Limited (AECL) in a series of experiments at its Underground Research Laboratory (URL) near Lac du Bonnet, Manitoba, Canada. One of the major objectives of the work being carried out at the URL is to develop and evaluate the methods and technology to ensure safe, permanent disposal of Canada's nuclear fuel waste. In 1994, AECL excavated access tunnels and a laboratory room for the Quarried Block Fracture Migration Experiment (QBFME) at the 240 Level of the URL. This facility will be used to study the transport of radionuclides in natural fractures in quarried blocks of granite under in-situ groundwater conditions. The experiment is being carried out under a cooperative agreement with the Japan Atomic Energy Research Institute. The excavation of the QBFME access tunnels and laboratory was carried out using controlled blasting techniques that minimized blast-induced overpressure which could have damaged or interrupted other ongoing experiments in the vicinity. The majority of the blasts used conventional long delay non-electric detonators but a number of blasts were carried out using HANDIDET 250/6000 non-electric long delay detonator assemblies and HTD reg-sign non-electric short delay trunkline detonator assemblies. The tunnel and laboratory excavation was monitored to determine the levels of blast-induced overpressure. This paper describes the blasting and monitoring results of the blasts using HANDIDET non-electric detonator assemblies and the effectiveness of these detonators in reducing blast-induced overpressure

Qualification plan for the Genmod-PC computer program

International Nuclear Information System (INIS)

Richardson, R.B.; Wright, G.M.; Dunford, D.W.; Linauskas, S.H.

2002-07-01

Genmod-PC is an internal dosimetry code that uses Microsoft Windows operating system, and that currently calculates radionuclide doses and intakes for an adult male. This report provides a plan for specifying the quality assurance measures that conform to the recommendations of the Canadian Standards Association, as well as AECL procedural requirements for a legacy computer program developed at AECL. (author)

11 CFR 105.1 - Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)). 105.1 Section 105.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL DOCUMENT FILING (2 U.S.C. 432(g)) § 105.1 Place of filing; House candidates and their authorized...

Fission gas and iodine release measured in IFA-430 up to 15 GWd/t UO2 burnup

International Nuclear Information System (INIS)

Appelhans, A.D.; Turnbull, J.A.; White, R.J.

1983-01-01

The release of fission products from fuel pellets to the fuel-cladding gap is dependent on the fuel temperature, the power (fission rate) and the burnup (fuel structure). As part of the US Nuclear Regulatory Commission's Fuel Behavior Program, EG and G Idaho, Inc., is conducting fission product release studies in the Heavy Boiling Water Reactor in Halden, Norway. This paper presents a summary of the results up to December, 1982. The data cover fuel centerline temperatures ranging from 700 to 1500 0 C for average linear heat ratings of 16 to 35 kW/m. The measurements have been performed for the period between 4.2 and 14.8 GWd/t UO 2 of burnup of the Instrumented Fuel Assembly 430 (IFA-430). The measurement program has been directed toward quantifying the release of the short-lived radioactive noble gases and iodines

ASSERT-PV 3.2: Advanced subchannel thermalhydraulics code for CANDU fuel bundles

International Nuclear Information System (INIS)

Rao, Y.F.; Cheng, Z.; Waddington, G.M.; Nava-Dominguez, A.

2014-01-01

Highlights: • Introduction to a new version of the Canadian subchannel code, ASSERT-PV 3.2. • Enhanced models for flow-distribution, CHF and post-dryout heat transfer prediction. • Model changes focused on unique features of horizontal CANDU bundles. • Detailed description of model changes for all major thermalhydraulics models. • Discussion on rationale and limitation of the model changes. - Abstract: Atomic Energy of Canada Limited (AECL) has developed the subchannel thermalhydraulics code ASSERT-PV for the Canadian nuclear industry. The most recent release version, ASSERT-PV 3.2 has enhanced phenomenon models for improved predictions of flow distribution, dryout power and CHF location, and post-dryout (PDO) sheath temperature in horizontal CANDU fuel bundles. The focus of the improvements is mainly on modeling considerations for the unique features of CANDU bundles such as horizontal flows, small pitch to diameter ratios, high mass fluxes, and mixed and irregular subchannel geometries, compared to PWR/BWR fuel assemblies. This paper provides a general introduction to ASSERT-PV 3.2, and describes the model changes or additions in the new version to improve predictions of flow distribution, dryout power and CHF location, and PDO sheath temperatures in CANDU fuel bundles

ASSERT-PV 3.2: Advanced subchannel thermalhydraulics code for CANDU fuel bundles

Energy Technology Data Exchange (ETDEWEB)

Rao, Y.F., E-mail: raoy@aecl.ca; Cheng, Z., E-mail: chengz@aecl.ca; Waddington, G.M., E-mail: waddingg@aecl.ca; Nava-Dominguez, A., E-mail: navadoma@aecl.ca

2014-08-15

Highlights: • Introduction to a new version of the Canadian subchannel code, ASSERT-PV 3.2. • Enhanced models for flow-distribution, CHF and post-dryout heat transfer prediction. • Model changes focused on unique features of horizontal CANDU bundles. • Detailed description of model changes for all major thermalhydraulics models. • Discussion on rationale and limitation of the model changes. - Abstract: Atomic Energy of Canada Limited (AECL) has developed the subchannel thermalhydraulics code ASSERT-PV for the Canadian nuclear industry. The most recent release version, ASSERT-PV 3.2 has enhanced phenomenon models for improved predictions of flow distribution, dryout power and CHF location, and post-dryout (PDO) sheath temperature in horizontal CANDU fuel bundles. The focus of the improvements is mainly on modeling considerations for the unique features of CANDU bundles such as horizontal flows, small pitch to diameter ratios, high mass fluxes, and mixed and irregular subchannel geometries, compared to PWR/BWR fuel assemblies. This paper provides a general introduction to ASSERT-PV 3.2, and describes the model changes or additions in the new version to improve predictions of flow distribution, dryout power and CHF location, and PDO sheath temperatures in CANDU fuel bundles.

18 CFR 367.4320 - Account 432, Allowance for borrowed funds used during construction-Credit.

Science.gov (United States)

2010-04-01

... ACT OF 2005, FEDERAL POWER ACT AND NATURAL GAS ACT Income Statement Chart of Accounts Service Company Operating Income § 367.4320 Account 432, Allowance for borrowed funds used during construction—Credit. This...

Calificación del sistema de HVAC en una planta de producción de IFA

Directory of Open Access Journals (Sweden)

Otto Reyes

2006-12-01

Full Text Available La calificación de áreas asépticas constituye uno de los requerimientos esenciales en el cumplimiento de regulaciones nacionales para la fabricación de productos estériles. Se realizó la calificación inicial (as built de una Planta de Ingrediente Farmacéutico Activo (IFA para la fabricación de vacunas contra tétanos, fiebre tifoidea y tos ferina. Las comprobaciones estuvieron basadas en normas internacionales y para ello se empleó un equipamiento que cumple con los requerimientos para la industria farmacéutica. Pudo comprobarse que el sistema de clima es capaz de garantizar los parámetros críticos de operación de las áreas limpias, aunque algunos criterios de pruebas opcionales no fueron cumplidos.Los resultados obtenidos sirven como referencia para el control de los parámetros del sistema de HVAC y para la toma de acciones correctivas.

Effect of soluble factors derived from oral cancer cells on the production of interferon-γ from peripheral blood mononuclear cells following stimulation with OK-432.

Science.gov (United States)

Ohe, Go; Sasai, Akiko; Uchida, Daisuke; Tamatani, Tetsuya; Nagai, Hirokazu; Miyamoto, Youji

2013-08-01

The streptococcal antitumor agent OK-432 is commonly used as an immunopotentiator for immunotherapy in various types of malignant tumors including oral cancer. It has been demonstrated that OK-432 elicits an antitumor effect by stimulating immunocompetent cells, thereby inducing multiple cytokines including interferon (IFN)-γ, interleukin (IL)-2 and IL-12. Serum concentrations of IFN-γ in patients with oral cancer were examined 24 h after administration of OK-432. Serum concentrations of IFN-γ in patients with advanced cancer were significantly lower than those in patients with early cancer. These results suggested that some soluble factors produced by cancer cells may inhibit IFN-γ production with OK-432. Thus, in the present study, an in vitro simulation model was established for the immune status of patients with oral cancer by adding conditioned medium (CM) derived from oral cancer cell lines into a culture of peripheral blood mononuclear cells (PBMCs) derived from a healthy volunteer. We investigated whether soluble factors derived from oral cancer cells affected IFN-γ production from PBMCs following stimulation with OK-432. PBMCs stimulated with OK-432 produced a large amount of IFN-γ; however, both IFN-γ production and cytotoxic activity from PBMCs induced by OK-432 were inhibited by the addition of CM in a dose-dependent manner. In order to examine these inhibitory effects against IFN-γ production, the contribution of inhibitory cytokines such as IL-4, IL-6, IL-10, transforming growth factor-β and vascular endothelial growth factor was investigated. However, neutralization of these inhibitory cytokines did not recover IFN-γ production inhibited by CM. These results indicated that unknown molecules may inhibit IFN-γ production from PBMCs following stimulation with OK-432.

42 CFR 488.432 - Civil money penalties: When a penalty is collected.

Science.gov (United States)

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Civil money penalties: When a penalty is collected... PROCEDURES Enforcement of Compliance for Long-Term Care Facilities with Deficiencies § 488.432 Civil money... hearing on the determination of the noncompliance that is the basis for imposition of the civil money...

Effect of Picibanil (OK 432) on the Scavenging Effect of Free Radicals Produced during Liver Regeneration in the Rat

OpenAIRE

Okamoto, Ko; Hamazaki, Keisuke; Iwagaki, Hiromi; Orita, Kunzo; Mori, Akitane

1995-01-01

We administered a biological response modifier Picibanil (OK-432), attenuated Streptococcus pyogenes, via the dorsal vein of the penis after 70% hepatectomy in rats, and clarified the scavenging effect of Picibanil on free radicals generated in the regenerating liver. A group of 5 rats was intravenously administered with 25 KE/kg of OK-432 after hepatectomy, while the control group was given saline after hepatectomy. Serum levels of aspartate aminotransferase and alanine aminotransferase and ...

Development of best estimate auditing code for CANDU thermal hydraulic safety analysis

Energy Technology Data Exchange (ETDEWEB)

Chung, B. D.; Lee, W. J.; Lim, H. S. [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

2000-03-15

The main purpose of this study is to develop a thermal hydraulic auditing code for the CANDU reactor, modifying the model if existing PWR auditing tool, i.e. RELAP5/MOD3. This scope of project is a third step of the whole project, and expand the RELAP5/MOD3/CANDU version for implementation of LOCA analysis. There are three main area of model development, i.e. moody critical flow model, flow regime model of horizontal CANDU bundle, and fuel element heatup model when the stratification occurs. Newly developed version, namely RELAP5/MOD3/CANDU+ is applicable to CANDU plant analysis with keeping the function of light water reactor analysis. The limited validations of model installation were performed. Assessment of CHF model using AECL separated effect test and calculation for Wolsong 2 plant were performed also for the applicability test of the developed version.

Percutaneous sclerotherapy of sialoceles after parotidectomy with fibrin glue, OK-432, and bleomycin.

Science.gov (United States)

Chen, Wei-liang; Zhang, Li-ping; Huang, Zhi-quan; Zhou, Bin

2013-12-01

We evaluated the curative effect of fibrin glue combined with OK-432 (streptococcal pyrogenic exotoxin A, Picibanil™) and bleomycin on 9 patients with sialoceles after parotidectomy. The primary lesions included pleomorphic adenomas in 6 cases and Warthin's tumours in 3 cases. After a sialocele had been diagnosed each patient had repeated aspirations and pressure dressings for 3-4 weeks, but these treatments failed. The patients were then treated with percutaneous sclerotherapy with the injection of fibrin glue 8-10 ml combined with OK-432 5 mg and bleomycin 15 mg. All the sialoceles disappeared completely after a single procedure in 2-3 weeks. The patients have been followed up for more than 6 months with no evidence of recurrent sialocele or injury to the facial nerve related to sclerotherapy. This simple, safe technique can be successfully used to treat sialoceles after parotidectomy. Copyright © 2013 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Effect of concomitant use of immunomodulator (OK-432 and/or PSK) on advanced lung cancer (squamous cell carcinoma and adenocarcinoma) treated with radiation with combined chemotherapy

International Nuclear Information System (INIS)

Ogawa, Yasuhiro; Kimura, Shuji; Imajo, Yoshinari

1982-01-01

Between 1975 and 1979, 209 cases of primary lung cancer admitted to the department of radiology were treated with radiation with combined chemotherapy. OK-432 and/or PSK as an immunomodulator was administered to 130 of these cases, and survival curves were evaluated between the patients with OK-432 and/or PSK and those without immunomodulator. In 61 cases (squamous cell carcinoma and adenocarcinoma) in stage III (UICC, 1978), fifty percent survival period was found to be 12.5 months for 16 cases with OK-432, 13.5 months for 9 cases with OK-432 and PSK, 9.0 months for 18 cases with PSK, and 8.0 months for 18 cases without immunotherapy, respectively. (author)

Vaccination with OK-432 followed by TC-1 tumor lysate leads to significant antitumor effects.

Science.gov (United States)

Chen, I-Ju; Yen, Chih-Feng; Lin, Kun-Ju; Lee, Chyi-Long; Soong, Yung-Kuei; Lai, Chyong-Huey; Lin, Cheng-Tao

2011-07-01

Human papillomavirus (HPV) infects large numbers of women worldwide and is present in more than 99% of all cervical cancer. TC-1 cell is a cell line with high expression of E7 antigen of HPV type 16 and its cell lysate has been demonstrated as an ideal inducer of E7-specific, antitumor immunity. OK-432 (Picibanil), a penicillin-killed Streptococcus pyogenes, has been reported with potent immunomodulation properties in cancer treatment by stimulating the maturation of dendritic cells (DCs) and secretion of Th-1 type cytokines. The current study demonstrated that a protocol to immunize the C57BL/6 mice with OK-432 followed by treatment with TC-1 lysate can generate markedly increased immune responses of E7-specific CD4(+) T cells and a moderate increase of natural killer (NK) cell, as well as a satisfactorily protective and therapeutic antitumor effect by triggering the DCs to prime T cells. Depletion of lymphocyte subset in vivo suggested that the antitumor effects could be dominantly executed by CD8+ T cells and followed by NK cells, and both of these reactions were induced by the generation of robust E7-specific CD4(+) T helper cell response. These findings warrant OK-432 combination with tumor-lysate as an effective and safe vaccine in future clinical application of cervical cancer.

11 CFR 101.1 - Candidate designations (2 U.S.C. 432(e)(1)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate designations (2 U.S.C. 432(e)(1)). 101.1 Section 101.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL CANDIDATE STATUS AND... and address, party affiliation, and office sought, the District and State in which Federal office is...

Retrofit of AECL CAN6 seals into the Pickering shutdown cooling pumps

International Nuclear Information System (INIS)

Rhodes, D.; Metcalfe, R.; Brown, G.

1997-01-01

The existing mechanical seals in the shutdown cooling (SDC) pumps at the eight-unit Pickering Nuclear Generating Station have caused as least seven forced outages in the last fifteen years. The SDC pumps were originally intended to run only during shutdowns, mostly at low pressure, except for short periods during routine testing of SDC isolation valves while the plant is operating at full pressure to verify that the emergency core injection system is available. Unfortunately, in practice, some SDC pumps must be run much more frequently than this to prevent overheating or freezing of components in the system while the plant is at power. This more severe service has decreased seal lifetime from about 8000 running hours to about 3000 running hours. Rather than tackling the difficult task of eliminating on-power running of the pumps, Pickering decided to install a more robust seal design that could withstand this. Through the process of competitive tender, AECL's CAN6 seal was chosen. This seal has a successful history in similarly demanding conditions in boiling water reactors in the USA. To supplement this and demonstrate there would be no 'surprises,' a 2000-hour test program was conducted. Testing consisted of simulating all the expected conditions, plus some special tests under abnormal conditions. This has given assurance that the seal will operate reliably in the Pickering shutdown cooling pumps. (author)

Retrofit of AECL CAN6 seals into the Pickering shutdown cooling pumps

International Nuclear Information System (INIS)

Rhodes, D.; Metcalfe, R.; Brown, G.; Kiameh, P.; Burchett, P.

1997-01-01

The existing mechanical seals in the shutdown cooling (SDC) pumps at the eight-unit Pickering Nuclear Generating Station have caused at least seven forced outages in the last fifteen years. The SDC pumps were originally intended to run only during shutdowns, mostly at low pressure, except for short periods during routine testing of SDC isolation valves while the plant is operating at full pressure to verify that the emergency core injection system is available. Unfortunately, in practice, some SDC pumps must be run much more frequently than this to prevent overheating or freezing of components in the system while the plant is at power. This more severe service has decreased seal lifetime from about 8000 running hours to about 3000 running hours. Rather than tackling the difficult task of eliminating on-power running of the pumps, Pickering decided to install a more robust seal design that could withstand this. Through the process of competitive tender, AECL's CAN6 seal was chosen. This seal has a successful history in similarly demanding conditions in boiling water reactors in the USA. To supplement this and demonstrate there would be no 'surprises,' a 2000-hour test program was conducted. Testing consisted of simulating all the expected conditions, plus some special tests under abnormal conditions. This has given assurance that the seal will operate reliably in the Pickering shutdown cooling pumps. (author)

11 CFR 102.11 - Petty cash fund (2 U.S.C. 432(h)(2)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Petty cash fund (2 U.S.C. 432(h)(2)). 102.11 Section 102.11 Federal Elections FEDERAL ELECTION COMMISSION GENERAL REGISTRATION, ORGANIZATION, AND... and Congressional district) sought by such candidate. ...

Comparison of 432 Pseudomonas strains through integration of genomic, functional, metabolic and expression data

NARCIS (Netherlands)

Koehorst, Jasper J.; Dam, van Jesse C.J.; Heck, van Ruben G.A.; Saccenti, Edoardo; Martins dos Santos, Vitor; Suarez-Diez, Maria; Schaap, Peter J.

2016-01-01

Pseudomonas is a highly versatile genus containing species that can be harmful to humans and plants while others are widely used for bioengineering and bioremediation. We analysed 432 sequenced Pseudomonas strains by integrating results from a large scale functional comparison using protein

Effect of concomitant use of immunomodulator (OK-432 and/or PSK) on primary lung cancer (stages III, IV) treated with radiation combined with chemotherapy

International Nuclear Information System (INIS)

Kimura, S.; Ogawa, Y.; Imajo, Y.

1982-01-01

OK-432 (a lyophilized preparation of a low virulent strain, Su, of Streptococcus hemolytics (Group A) treated with penicillin G) and/or PSK (a protein-bound polysaccharide prepared from Coriolus versicolor) as an immunomodulator was administered to 209 patients of advanced lung cancer treated with radiation with combined chemotherapy. Their effects on immunological parameters and patients' survival periods were examined. Suppression of both PHA (phytohemagglutinin) skin test activities and lymphocyte blastoid transformation with PHA were reduced in the immunomodulator administered group compared with the non-administered group. Survival curves were evaluated between the patients with OK-432 and/or PSK and those without immunomodulator. It was suggested that OK-432 and/or PSK combined with radiation with combined chemotherapy was effective for the elongation of the survival period. These results indicated that the long-term administration of OK-432 and/or PSK was recommended for patients with advanced lung cancer. (author)

AECL'S approach to managing long term liabilities at Chalk River Laboratories. Annex II

International Nuclear Information System (INIS)

Audet, M.C.

2006-01-01

Chalk River Laboratories (CRL) is a large nuclear research and development/ industrial site operated by Atomic Energy of Canada Limited (AECL). Construction of the site started in 1944, and it now includes over 100 buildings/facilities operating in various nuclear fields. A well developed decommissioning programme exists at CRL, with progress being made on decommissioning older redundant buildings, in parallel with ongoing site operations and development. The decommissioning programme is predicated on the assumption that the current nuclear operations will continue over a 100 year operating period, but with a decline towards the end of the period. Although decommissioning and remediation work will be carried out throughout the operational period, residual levels of activity remaining in a few areas will require institutional control (IC) for an assumed period of 300 years. The intention is to complete all necessary active remediation work before the start of the IC period and thereafter rely only on passive means to reduce residual contamination to levels that do not require IC measures. The latter include environmental monitoring, active and passive controls to prevent intrusion, and management controls to prohibit access or development. A formal information and records management programme at CRL has been initiated. (author)

Percutaneous sclerotherapy of massive macrocystic lymphatic malformations of the face and neck using fibrin glue with OK-432 and bleomycin.

Science.gov (United States)

Chen, W-l; Huang, Z-q; Chai, Q; Zhang, D-m; Wang, Y-y; Wang, H-j; Wang, L; Fan, S

2011-06-01

Picibanil (OK-432) and bleomycin have been used as alternative sclerosing agents for lymphatic malformations. This study evaluated the clinical curative effect of sclerotherapy using fibrin glue combined with OK-432 and bleomycin for the treatment of macrocystic lymphatic malformations of the face and neck. Fifteen paediatric patients (6 males; 9 females, aged 13 months to 14 years) who had received percutaneous sclerotherapy for massive macrocystic lymphatic malformations of the face and neck were retrospectively reviewed. Affected regions included the neck, parotid region and parapharynx, mouth floor, face and cheek, and orbital regions. All patients showed preoperative symptoms of space-occupying lesions between 4 cm × 5 cm and 12 cm × 16 cm in size. Fibrin glue with OK-432 and bleomycin was injected under general anaesthesia. All patients received preoperative and follow-up CT scans. Outcomes were assessed by three surgeons. All patients exhibited mid-facial swelling for 3-4 weeks after surgery, but no major complications. Follow-up periods ranged from 8 to 16 months. Eight lesions were completely involuted, five were mostly involuted, and two were partially involuted. Percutaneous sclerotherapy using fibrin glue with OK-432 and bleomycin provided a simple, safe, and reliable alternative treatment for massive macrocystic lymphatic malformations of the face and neck. Copyright © 2011 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

Research on radionuclide migration under subsurface geochemical conditions. JAERI/AECL Phase II Collaborative Program Year 1 (joint research)

International Nuclear Information System (INIS)

1998-11-01

A radionuclide migration experiment program for fractured rocks was performed under the JAERI/AECL Phase-II Collaborative Program on research and development in radioactive waste management. The program started in the fiscal year 1993, as a five-year program consists of Quarried block radionuclide migration program, Speciation of long-lived radionuclides in groundwater, Isotopic hydrogeology and Groundwater flow model development. During the first year of the program (Program Year 1: March 18, 1994 - September 30, 1994), a plan was developed to take out granite blocks containing part of natural water-bearing fracture from the wall of the experimental gallery at the depth of 240 m, and literature reviews were done in the area of the speciation of long-lived radionuclides in groundwater, isotopic hydrogeology and the groundwater flow model development to proceed further work for the Program Year 2. (author)

Efficacy of in vitro sensitized cells generated by in vivo priming with OK-432 for adoptive immunotherapy of the poorly immunogenic B16-Bl6 melanoma.

Science.gov (United States)

Mukai, S; Kato, H; Kimura, S; Asai, K; Kawahito, Y; Inoue, M; Yamamura, Y; Sano, H; Sugino, S; Shu, S; Kondo, M

1996-02-01

We investigated the efficacy of the streptococcal preparation OK-432 as an adjuvant for in vivo priming in induction of sensitized cells for adoptive immunotherapy of the poorly immunogenic B16-BL6 (BL6) melanoma. C57BL/6 (B6) mice were immunized subcutaneously (s.c.) with 3 x 10(6) viable BL6 tumor cells admixed with various doses of OK-432 ranging from 1 to 100 micrograms in the foot-pad. Draining popliteal lymph nodes (LNs) were harvested 7 days after immunization and LN cells were further sensitized with irradiated tumor cells in the presence of 60-300 IU/ml of IL-2 for 11 days. These in vitro sensitized (IVS) cells (2 x 10(6)) were transferred intravenously (i.v.) to B6 mice bearing 4-day pulmonary metastases established by i.v. injection of 2-4 x 10(5) viable BL6 cells. The mice were also received intraperitoneally (i.p.) 4 x 10(4) IU/day of IL-2 for 4 days after adoptive transfer. Transfer of IVS cells from mice immunized by s.c. injection of tumor cells admixed with 10 micrograms of OK-432 significantly reduced the numbers of BL6 pulmonary metastases compared with that of control IVS' cells without the administration of OK-432 (P = 0.003). These effective IVS cells also significantly prolonged the survival of treated animals (P = 0.003). Functional IVS cells required in vitro stimulation with tumor cells. However, addition of OK-432 in the vaccine resulted in no enhancement of in vitro cytotoxicity and no characteristic change of phenotype of IVS cells. These results suggest that in vivo priming of OK-432 facilitates the sensitization of tumor-reactive T-cells. The procedure of in vivo priming with OK-432 may be beneficial in the adoptive immunotherapy of melanoma.

OK-432 reduces mortality and bacterial translocation in irradiated and granulocyte-colony stimulating factor (G-CSF)-treated mice

Energy Technology Data Exchange (ETDEWEB)

Nose, Masako; Uzawa, Akiko; Ogyu, Toshiaki [National Inst. of Radiological Sciences, Chiba (Japan); Suzuki, Gen

2001-06-01

Acute radiation induces bacterial translocation from the gut, followed by systemic infection and sepsis. In order to reduce the mortality after acute whole body irradiation, it is essential to control bacterial translocation. In this study, we established a bacterial translocation assay as a sensitive method to detect minor mucosal injury by radiation. By utilizing this assay, we evaluated the adverse effects, if any, of hematopoietic reagents on the mucosal integrity in the respiratory and gastro-intestinal tracts. Bacterial translocation to the liver and spleen occurred after whole-body irradiation if the dose exceeded 6 Gy. The administration of G-CSF unexpectedly increased the bacterial translocation in 8 Gy-irradiated mice. The pharmaceutical preparation of low-virulent Streptococcus pyogenes, OK-432, significantly reduced the endotoxin levels in peripheral blood without any reduction of bacterial translocation. A combined treatment with G-CSF and OK-432 decreased bacterial translocation and prevented death. This result indicates that the early administration of G-CSF has an adverse effect on bacterial translocation, and that a combined treatment of G-CSF and OK-432 attenuates the adverse effect of G-CSF and improves the survival rate after acute irradiation. (author)

The contribution of AECL CommercialProducts to nuclear medicine and radiation processing

International Nuclear Information System (INIS)

Beddoes, J.M.

1980-02-01

A review is given of the technology of the uses of radiation equipment and radioisotopes, in which field Canada has long been a world leader. AECL CommercialProducts has pioneered many of the most important applications. The development and sale of Co-60 radiation teletherapy units for cancer treatment is a familiar example of such an application, and CommercialProducts dominates the world market. Another such example is the marketing of Mo-99, which is produced in the reactors at Chalk River, and from which the short-lived daughter Tc-99 is eluted as required for use in in-vivo diagnosis. New products coming into use for this purpose include Tl-201, I-123, Ga-67 and In-111, all produced in the TRIUMF cyclotron in Vancouver, while I-125 continues to be in demand for in-vitro radioimmunoassays. Radioisotopes continue to play an important part in manufacturing, where their well-known uses include controlling thickness, contents, etc., in production, and industrial radiography. The application of large industrial irradiators for the sterilization of medical products is now a major world industry for which Commercial Products is the main manufacturer. Isotopes are also used in products such as smoke detectors. Isotopes continue to find extensive use as tracers, both in industrial applications and in animal and plant biology studies. Some more recent uses include pest control by the 'sterile male' technique and neutron activation and delayed neutron counting in uranium assay. (auth)

Modification of fuel performance code to evaluate iron-based alloy behavior under LOCA scenario

Energy Technology Data Exchange (ETDEWEB)

Giovedi, Claudia; Martins, Marcelo Ramos, E-mail: claudia.giovedi@labrisco.usp.br, E-mail: mrmartin@usp.br [Laboratorio de Analise, Avaliacao e Gerenciamento de Risco (LabRisco/POLI/USP), São Paulo, SP (Brazil); Abe, Alfredo; Muniz, Rafael O.R.; Gomes, Daniel de Souza; Silva, Antonio Teixeira e, E-mail: ayabe@ipen.br, E-mail: dsgomes@ipen.br, E-mail: teixiera@ipen.br [Instituto de Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

2017-07-01

Accident tolerant fuels (ATF) has been studied since the Fukushima Daiichi accident in the research efforts to develop new materials which under accident scenarios could maintain the fuel rod integrity for a longer period compared to the cladding and fuel system usually utilized in Pressurized Water Reactors (PWR). The efforts have been focused on new materials applied as cladding, then iron-base alloys appear as a possible candidate. The aim of this paper is to implement modifications in a fuel performance code to evaluate the behavior of iron based alloys under Loss-of-Coolant Accident (LOCA) scenario. For this, initially the properties related to the thermal and mechanical behavior of iron-based alloys were obtained from the literature, appropriately adapted and introduced in the fuel performance code subroutines. The adopted approach was step by step modifications, where different versions of the code were created. The assessment of the implemented modification was carried out simulating an experiment available in the open literature (IFA-650.5) related to zirconium-based alloy fuel rods submitted to LOCA conditions. The obtained results for the iron-based alloy were compared to those obtained using the regular version of the fuel performance code for zircaloy-4. The obtained results have shown that the most important properties to be changed are those from the subroutines related to the mechanical properties of the cladding. The results obtained have shown that the burst is observed at a longer time for fuel rods with iron-based alloy, indicating the potentiality of this material to be used as cladding with ATF purposes. (author)

Modification of fuel performance code to evaluate iron-based alloy behavior under LOCA scenario

International Nuclear Information System (INIS)

Giovedi, Claudia; Martins, Marcelo Ramos; Abe, Alfredo; Muniz, Rafael O.R.; Gomes, Daniel de Souza; Silva, Antonio Teixeira e

2017-01-01

Accident tolerant fuels (ATF) has been studied since the Fukushima Daiichi accident in the research efforts to develop new materials which under accident scenarios could maintain the fuel rod integrity for a longer period compared to the cladding and fuel system usually utilized in Pressurized Water Reactors (PWR). The efforts have been focused on new materials applied as cladding, then iron-base alloys appear as a possible candidate. The aim of this paper is to implement modifications in a fuel performance code to evaluate the behavior of iron based alloys under Loss-of-Coolant Accident (LOCA) scenario. For this, initially the properties related to the thermal and mechanical behavior of iron-based alloys were obtained from the literature, appropriately adapted and introduced in the fuel performance code subroutines. The adopted approach was step by step modifications, where different versions of the code were created. The assessment of the implemented modification was carried out simulating an experiment available in the open literature (IFA-650.5) related to zirconium-based alloy fuel rods submitted to LOCA conditions. The obtained results for the iron-based alloy were compared to those obtained using the regular version of the fuel performance code for zircaloy-4. The obtained results have shown that the most important properties to be changed are those from the subroutines related to the mechanical properties of the cladding. The results obtained have shown that the burst is observed at a longer time for fuel rods with iron-based alloy, indicating the potentiality of this material to be used as cladding with ATF purposes. (author)

Development of a best estimate auditing code for CANDU thermal hydraulic safety analysis

Energy Technology Data Exchange (ETDEWEB)

Chung, B.D.; Lee, W.J.; Lim, H.S. [Korea Atomic Energy Research Institute, Taejeon (Korea)

2000-03-01

The main purpose of this study is to develop a thermal hydraulic auditing code for the CANDU reactor, modifying the model of existing PWR auditing tool , i.e. RELAP5/MOD3. This scope of project is a third step of the whole project, and expand the RELAP5/MOD3/CANDU version for implementation of LOCA Analysis. There are three main area of model development, i.e. Moody critical flow model, flow regime model of horizontal CANDU bundle, and fuel element heatup model when the stratification occurs. Newly developed version, namely RELAP5/MOD3/CANDU+ is applicable to CANDU plant analysis with keeping the function of light water reactor analysis. The limited validations of model installation were performed. Assessment of CHF model using AECL separated effect test and calculation for Wolsong 2 plant were performed also for the applicability test of the developed version. 15 refs., 37 figs., 8 tabs. (Author)

O uso de Picibanil (OK-432 no tratamento do linfangioma de cabeça e pescoço

Directory of Open Access Journals (Sweden)

Mello-Filho Francisco V.

2002-01-01

Full Text Available Introdução e Objetivo: O Linfangioma Cérvico-Facial (LCF é geralmente um tumor volumoso, envolvendo estruturas importantes da face e do pescoço. A terapia habitualmente recomendada é a retirada cirúrgica, porém, esta é geralmente seguida de seqüelas importantes, causando deformidade da região. Com o objetivo de avaliarmos uma terapêutica alternativa, analisamos a eficiência do Picibanil (OK 432 no tratamento de LCF em crianças. Forma de Estudo: Clínico retrospectivo. Material e Método: Estudo retrospectivo de seis crianças com diagnóstico de LCF tratadas com OK-432 no HCFMRP-USP no período de 1997 a 2001. Foram analisadas as seguintes características dos LCF: dimensões, tipos de cistos e volume aspirado. Avaliamos, também, o número de aplicações de OK 432 com os respectivos intervalos de tempo utilizados, sua evolução, intercorrências e o resultado final do tratamento. Resultados: Os LCFs apresentavam de oito a 15cm em seu maior diâmetro, na ocasião da primeira consulta, sendo o tipo de cisto mais freqüentemente encontrado o tipo macro cisto. O volume de liquido aspirado variou de dois a 60 ml e o número de aplicações de uma a cinco vezes em intervalos variáveis de um mês a um ano. Em todos os pacientes ocorreu regressão da massa tumoral, sendo que em três houve o desaparecimento total do LCF. A única intercorrência observada foi febre em media de 38.2º C em todos pacientes. Conclusão: O OK 432 é uma droga segura, eficaz e que pode ser utilizada como medida de primeira escolha no tratamento do LCF.

Therapie einer postoperativ entstandenen zystischen Raumforderung mit Picibanil (OK-432): Ein Fallbericht

OpenAIRE

Schlüter, A; Weller, P; Mattheis, S; Lang, S

2014-01-01

Einleitung: Picibanil (=OK432) ist ein Lysat bestehend aus Penicillin G und mit H2O2 attenuiertem Streptococcus pyogenes. In den letzten Jahrzehnten wurde Picibanil zur Therapie von Pleuraergüssen, Lymphangiomen, Chylusfisteln, medianen Halszysten und Ranulae eingesetzt. Es verursacht eine Immunreaktion mit aseptischer Entzündung. Dies führt zu einer Zerstörung des Endothels und konsekutiv zu einer Verklebung und Schrumpfung des Zystensacks.Falldarstellung: Wir berichten über einen 40-jähri...

Treatment of lymphangiomas of the head and neck in children by intralesional injection of OK-432 (Picibanil).

Science.gov (United States)

Brewis, C; Pracy, J P; Albert, D M

2000-04-01

The treatments previously used for lymphangiomas of the head and neck in children-surgery and intralesional injection of sclerosants-are associated with significant morbidity. A new treatment-intralesional injection of OK-432-was used for lymphangiomas of the head and neck in 11 children. The results were total shrinkage in two, marked shrinkage in two, slight shrinkage in five and no response in two. The results were not affected by previous surgery nor by whether aspiration prior to injection was possible. There were no recurrences in those children in whom shrinkage occurred and no child had subsequent surgery following injection. The results of this series support those of previous series showing that OK-432 injection is an effective and safe treatment for lymphangiomas of the head and neck in children.

Validation of Non-Invasive Waste Assay System (Gamma Box Counter) Performance at AECL Whiteshell Laboratories - 13136

International Nuclear Information System (INIS)

Attas, E.M.; Bialas, E.; Rhodes, M.J.

2013-01-01

Low-level radioactive waste (LLW) in solid form, resulting from decommissioning and operations activities at AECL's Whiteshell Laboratories (WL), is packaged in B-25 and B-1000 standard waste containers and characterized before it is shipped to an on-site interim storage facility, pending AECL decisions on long term management of its LLW. Assay of the waste packages before shipment contributes to an inventory of the interim storage facility and provides data to support acceptance at a future repository. A key characterization step is a gamma spectrometric measurement carried out under standard conditions using an automated, multi-detector Waste Assay System (WAS), purchased from Antech Corporation. A combination of ORTEC gamma acquisition software and custom software is used in this system to incorporate multiple measurements from two collimated high-resolution detectors. The software corrects the intensities of the gamma spectral lines for geometry and attenuation, and generates a table of calculated activities or limits of detection for a user-defined list of radioisotopes that may potentially be present. Validation of WAS performance was a prerequisite to routine operation. Documentation of the validation process provides assurance of the quality of the results produced, which may be needed one or two decades after they were generated. Aspects of the validation included setting up a quality control routine, measurements of standard point sources in reproducible positions, study of the gamma background, optimization of user-selectable software parameters, investigation of the effect of non-uniform distribution of materials and radionuclides, and comparison of results with measurements made using other gamma detector systems designed to assay bulk materials. The following key components of the validation process have been established. A daily quality control routine has been instituted, to verify stability of the gamma detector operation and the background levels

Experiments in ZED-2 to study the physics of low-void reactivity fuel in CANDU

International Nuclear Information System (INIS)

Zeller, M.B.; Celli, A.; McPhee, G.P.

1994-01-01

Prospective CANDU clients have indicated a desire for a zero or negative coolant void reactivity. In response to this market requirement AECL Research and AECL CANDU are jointly developing and testing a Low-Void Reactivity Fuel (LVRF) bundle, which will be retrofitable to the current generation of CANDU reactors. An important component of the LVRF program is the undertaking of reactor-physics experiments in the zero-energy ZED-2 lattice test facility at Chalk River Laboratories. Preliminary void-reactivity measurements have already been performed in ZED-2 using a limited amount of the prototype fuel. These experiments were to provide a proof-of-principle for the LVRF concept. A more comprehensive set of experiments are planned for later this year. Experiments to be performed include: measuring the critical buckling of CANDU-type lattices containing LVRF, with and without coolant in the channels; measuring the reactivity effect of heating the LVRF fuel and coolant in ZED-2 hot channels; and measuring detailed reaction rates and neutron density distributions across a LVRF bundle, in voided and D 2 O-cooled channels, by the foil activation method. This paper describes the experimental approach to be used for the study and presents calculations employing transport and diffusion theory to predict the results. The codes used for the simulations are the lattice code WIMS-AECL and the core code CONIFERS. Included in the paper are results from the preliminary measurement of void coefficient for LVRF in a ZED-2 lattice and a comparison of those results to predictions based on WIMS-AECL calculations. (author). 3 refs., 1 tab., 10 figs

The MOX fuel behaviour test IFA-597.4/.5. Temperature and pressure data to a burn-up of 15 MWd/kg MOX

International Nuclear Information System (INIS)

Takano, K.

1999-04-01

The behaviour of MOX fuel should be investigated in detail for more effective use in the future, especially concerning its thermal performance and fission gas release. IFA-597.4 and IFA-597.5, containing two MOX fuel rods each with a fuel centre thermocouple and a pressure transducer, have been irradiated in the Halden Reactor to study the temperature threshold of fission gas release for MOX fuel and to explore potential differences in the thermal and fission gas release behaviour between solid and hollow pellets. The two rods of MOX fuel with an initial Pu-fissile content of 6.07 percent have solid pellets and hollow pellets respectively, and with an active length of about 220 mm. The diameter of the pellets is 8.05 mm with 180μm of diametral gap to the cladding. For the purpose of the test, power ramp operation, in which estimated peak temperature of the MOX pellets increases and decreases above and below the threshold for fission gas release in UO 2 fuel, is planned every 10 MWd/kgMOX of burn-up. The first ramp operation has been successfully performed at 10 MWd/kgMOX. When the estimated peak temperature of the fuel gets close to but below the threshold of UO 2 , fission gas release was observed at around 28 kW/m of power. Densification of the MOX pellets could be estimated to about 1.2 percent for the solid pellets and about 2,3 percent for the hollow pellets from normalised internal rod pressure. After 13.5 MWd/kgMOX the average assembly power has been operated low enough to observe swelling rate of MOX fuel pellets and behaviour after significant fission gas release. The burn-up had reached 15.5 MWd/kgMOX as of the end of 1998. The target burn-up of this MOX test is 60 MWd/kgMOX (author) (ml)

Manifestations of nonlinearity in fuel center thermocouple steady-state and transient data: implications for data analysis

International Nuclear Information System (INIS)

Lanning, D.D.; Barnes, B.O.; Williford, R.E.

1979-01-01

The interpretation and verification of fuel centerline thermocouple data are analyzed. Two new concepts are discussed along with their application to in-reactor data from IFA-432, a heavily instrumented six-rod Halden reactor test assembly sponsored by the Nuclear Regulatory Commission. The main ideas presented in this report are that: it is more useful to plot resistance versus power than simply to plot temperature versus power; and the response of the centerline temperature to a linear power decrease is correlated to the rod's current resistance-vs-power behavior. Thus, the resistance-vs-power measurement can be verified by performing a linear power decrease and by plotting the temperature response

An approach to neutronics analysis of candu reactors

International Nuclear Information System (INIS)

Gul, S.; Arshad, M.

1982-12-01

An attempt is made to tackle the problem of neutronics analysis of CANDU reactors. Until now CANDU reactors have been analysed by the methods developed at AECL and CGE using mainly receipe methods. Relying on multigroup transport codes GAM-GATHER in combination with diffusion code CITATION a package of codes is established to use it for survey as well as production purposes. (authors)

Picibanil (OK-432) in the treatment of head and neck lymphangiomas in children

OpenAIRE

Rebuffini, Elena; Zuccarino, Luca; Grecchi, Emma; Carinci, Francesco; Merulla, Vittorio Emanuele

2012-01-01

Background: Picibanil (OK-432) is a lyophilized mixture of group A Streptococcus pyogenes with antineoplastic activity. Because of its capacity to produce a selective fibrosis of lymphangiomas (LMs), it has been approved by Japanese administration in 1995 for the treatment of LMs. Materials and Methods: We treated 15 children (age range: 6-60 months) affected by head and neck macrocystic LMs with intracystic injections (single dose of 0.2 mL) of Picibanil (1-3 injections). Results: Co...

CRYOCOL a computer program to calculate the cryogenic distillation of hydrogen isotopes

International Nuclear Information System (INIS)

Douglas, S.R.

1993-02-01

This report describes the computer model and mathematical method coded into the AECL Research computer program CRYOCOL. The purpose of CRYOCOL is to calculate the separation of hydrogen isotopes by cryogenic distillation. (Author)

Prototype scale demonstration of CECE detritiation

International Nuclear Information System (INIS)

Sadhankar Ramesh; Cobanoglu, Macit

2004-01-01

AECL has developed and demonstrated the Combined Electrolysis and Catalytic Exchange (CECE) Process for detritiation of heavy water. Although CECE has been the subject of pilot-scale demonstrations by various organizations, AECL is the first to demonstrate this technology in an industrial prototype plant. AECL designed, built and operated a CECE demonstration facility under CAN/CSA N286 Quality Assurance Program. The facility was licensed by the Canadian nuclear regulator. This was a two-fold demonstration of the CECE technology - for upgrading (removal of light water) and for detritiation of heavy water. In 1998 June, AECL began operating the facility in upgrading mode. The design feed rate ranged up to 25 Mg/a for 95 mol% D 2 O feed water. After 18 months of operation in upgrading mode, the facility was reconfigured and operated for an additional 9 months from 2000 August in detritiation mode. Design capacity for detritiation was 5 Mg/a with a detritiation factor (DF) of 100. However, significantly higher DFs, up to 56 000, were demonstrated. Highlights of the detritiation demonstration were: Proven robustness of AECL's proprietary wetproofed catalyst for Liquid Phase Catalytic Exchange; Demonstration of a trickle-bed-recombiner for stoichiometric combination of deuterium and oxygen; Demonstration of electrolysis of highly tritiated heavy water; High process availability and controllability was demonstrated by a long interrupted run; Low emissions; Demonstration of high DF - up to 56 000 - a significant advantage of the CECE process over other approaches to detritiation; Validation of AECL's simulation code for the CECE process over a range of DFs from 100 to 50 000. Apart from the technology, AECL has expertise in all aspects of setting up a new detritiation facility including design, engineering, safety assessment, licensing support, project management and training. AECL is also the engineering and design contractor for a tritium removal facility that is under

Input modelling of ASSERT-PV V2R8M1 for RUFIC fuel bundle

Energy Technology Data Exchange (ETDEWEB)

Park, Joo Hwan; Suk, Ho Chun

2001-02-01

This report describes the input modelling for subchannel analysis of CANFLEX-RU (RUFIC) fuel bundle which has been developed for an advanced fuel bundle of CANDU-6 reactor, using ASSERT-PV V2R8M1 code. Execution file of ASSERT-PV V2R8M1 code was recently transferred from AECL under JRDC agreement between KAERI and AECL. SSERT-PV V2R8M1 which is quite different from COBRA-IV-i code has been developed for thermalhydraulic analysis of CANDU-6 fuel channel by subchannel analysis method and updated so that 43-element CANDU fuel geometry can be applied. Hence, ASSERT code can be applied to the subchannel analysis of RUFIC fuel bundle. The present report was prepared for ASSERT input modelling of RUFIC fuel bundle. Since the ASSERT results highly depend on user's input modelling, the calculation results may be quite different among the user's input models. The objective of the present report is the preparation of detail description of the background information for input data and gives credibility of the calculation results.

Input modelling of ASSERT-PV V2R8M1 for RUFIC fuel bundle

International Nuclear Information System (INIS)

Park, Joo Hwan; Suk, Ho Chun

2001-02-01

This report describes the input modelling for subchannel analysis of CANFLEX-RU (RUFIC) fuel bundle which has been developed for an advanced fuel bundle of CANDU-6 reactor, using ASSERT-PV V2R8M1 code. Execution file of ASSERT-PV V2R8M1 code was recently transferred from AECL under JRDC agreement between KAERI and AECL. SSERT-PV V2R8M1 which is quite different from COBRA-IV-i code has been developed for thermalhydraulic analysis of CANDU-6 fuel channel by subchannel analysis method and updated so that 43-element CANDU fuel geometry can be applied. Hence, ASSERT code can be applied to the subchannel analysis of RUFIC fuel bundle. The present report was prepared for ASSERT input modelling of RUFIC fuel bundle. Since the ASSERT results highly depend on user's input modelling, the calculation results may be quite different among the user's input models. The objective of the present report is the preparation of detail description of the background information for input data and gives credibility of the calculation results

The post irradiation examination of three fuel rods from the IFA 429 experiment irradiated in the Halden Reactor

International Nuclear Information System (INIS)

Williams, J.

1979-11-01

A series of fuel rod irradiation experiments were performed in the Halden Heavy Boiling Water Reactor in Norway. These were designed to provide a range of fuel property data as a function of burn-up. One of these experiments was the IFA-429. This was designed to study the absorption of helium filling gas by the UO 2 fuel pellets, steady state and transient fission gas release and fuel thermal behaviour to high burn-up. This data was to be obtained as a function of fuel density, fuel grain size, initial fuel/cladding gap, average linear heat rating, burn-up and overpower transients. All the fuel is in the form of pressed and sintered UO 2 pellets enriched to 13 weight percent 235 U. All the rods were clad in Zircaloy 4 tube. The details of the experiment are given. The post irradiation examination included: visual examination, neutron radiography, dimensional measurements, gamma scanning, measurement of gases in fuel rods and internal free volume, burn-up analysis, metallographic examination, measurement of retained gas in UO 2 pellets, measurement of bulk density of UO 2 . The results are given and discussed. (U.K.)

Current status of the waste identification program at AECL's Chalk River Laboratories

International Nuclear Information System (INIS)

Csullog, G.W.; Edwards, N.W.; TerHuurne, M.A.

1998-01-01

The management of routine operating waste by Waste Management and Decommissioning (WM and D) at Atomic Energy of Canada Limited's (AECL) Chalk River Laboratories (CRL) is supported by the Waste Identification (WI) Program. The principal purpose of the WI Program is to minimize the cost and the effort associated with waste characterization and waste tracking, which are needed to optimize waste handling, storage and disposal. The major steps in the WI Program are: (1) identify and characterize the processes that generate the routine radioactive wastes accepted by WM and D - radioisotope production, radioisotope use, reactor operation, fuel fabrication, et cetera (2) identify and characterize the routine blocks of waste generated by each process or activity - the initial characterization is based on inference (process knowledge) (3) prepare customized, template data sheets for each routine waste block - templates contain information such as package type, waste material, waste type, solidifying agent, the average non-radiological contaminant inventory, the average radiological contaminant inventory, and the waste class (4) ensure generators 'use the right piece of paper with the right waste' when they transfer waste to WM and D - that is they use the correct template data sheets to transfer routine wastes, by: identifying and marking waste collection points in the generator's facility; ensuring that generators implement effective waste collection/segregation procedures; implementing standard procedures to transfer waste to WM and D; and, auditing waste collection and segregation within a generator's facility (5) determine any additional waste block characterization requirements (is anything needed beyond the original characterization by process knowledge?) This paper describes the WI Program, it provides an example of its implementation, and it summarizes the current status of its implementation for both CRL and non-CRL waste generators. (author)

Thermal-mechanical properties of cracked UO2 pellets

International Nuclear Information System (INIS)

Williford, R.E.; Mohr, C.L.; Lanning, D.D.

1980-11-01

A series of experiments (IFA-431, 432, 513, and 527) sponsored by the Fuel Behavior Research Branch of the USNRC are being irradiated in the Halden Boiling Water Reactor to better define LWR fuel behavior over the normal operating range of power reactor fuel rods. One fuel behavior variable of interest is the thermally induced cracking of UO 2 fuel pellets. The effects of pellet cracking on the effective thermal conductivity and elastic moduli for the fragmented fuel were found to be primarily dependent on the free area in the r, theta plane of the fuel rod. The free area is defined as the area within the cladding inner surface that is not occupied by the fuel fragments themselves

Nuclear Fuel Design Technology Development for the Future Fuel

Energy Technology Data Exchange (ETDEWEB)

Koo, Yang Hyun; Lee, Byung Ho; Cheon, Jin Sik; Oh, Je Yong; Yim, Jeong Sik; Sohn, Dong Seong; Lee, Byung Uk; Ko, Han Suk; So, Dong Sup; Koo, Dae Seo

2006-04-15

The test MOX fuels have been irradiated in the Halden reactor, and their burnup attained 40 GWd/t as of October 2005. The fuel temperature and internal pressure were measured by the sensors installed in the fuels and test rig. The COSMOS code, which was developed by KAERI, well predicted in-reactor behavior of MOX fuel. The COSMOS code was verified by OECD-NEA benchmarks, and the result confirmed the superiority of COSMOS code. MOX in-pile database (IFA-629.3, IFA-610.2 and 4) in Halden was also used for the verification of code. The COSMOS code was improved by introducing Graphic User Interface (GUI) and batch mode. The PCMI analysis module was developed and introduced by the new fission gas behavior model. The irradiation test performed under the arbitrary rod internal pressure could also be analyzed with the COSMOS code. Several presentations were made for the preparation to transfer MOX fuel performance analysis code to the industry, and the transfer of COSMOS code to the industry is being discussed. The user manual and COSMOS program (executive file) were provided for the industry to test the performance of COSMOS code. To envisage the direction of research, the MOX fuel research trend of foreign countries, specially focused on USA's GENP policy, was analyzed.

New combined therapy of radiation and local administration of OK-432 for esophageal cancer

International Nuclear Information System (INIS)

Mukai, Minoru; Morita, Shinroku; Tsunemoto, Hiroshi

1990-01-01

We devised new combination therapy of radiation and local administration of OK-432 and performed for 26 patients with esophageal cancer between March, 1987 and December, 1988 as a pilot study. The average age was 73 years. Among 26 patients, males were 20 and females were six. Patients were irradiated at the schedule of under 2 Gy/day and the dose of TDF (time, dose and fractionation factor) 100 totally. OK-432, 10KE was endoscopically administered around cancer lesion at the beginning of the radiotherapy, and two weeks later, 5KE was given in the same manner. Complete response was obtained in 20 out of 26 cases (77%) and partial response was obtained in the remaining six cases (23%). All six patients with tumor length less than five cm showed complete response. All 16 patients who could not eat food orally before treatment, became to take food enough orally after the treatment and could discharge in good condition. One year and two years survival rate of 26 patients by Kaplan Meier method were 67.4% and 47.2%, respectively. Six patients with tumor length less than five cm, are all alive without a sign of recurrence. This combination therapy will improve not only the response rate and the survival rate, but also the quality of life of patients with esophageal cancer. (author)

A plan for the modification and assessment of TRAC-PF1/MOD2 for use in analyzing CANDU 3 transient thermal-hydraulic phenomena

International Nuclear Information System (INIS)

Siebe, D.A.; Boyack, B.E.; Giguere, P.T.

1994-11-01

This report presents the results of the review and planning done for the United States Nuclear Regulatory Commission to identify the thermal-hydraulic phenomena that could occur in the CANDU 3 reactor design during transient conditions, plan modifications to the TRAC-PF1/MOD2 (TRAC) computer code needed to adequately predict CANDU 3 transient thermal-hydraulic phenomena, and identify an assessment program to verify the ability of TRAC, when modified, to predict these phenomena. This work builds on analyses and recommendations produced by the Idaho National Engineering Laboratory (INEL). To identify the thermal-hydraulic phenomena, a large-break loss-of-coolant accident simulation, performed as part of earlier work by INEL with an Atomic Energy of Canada, Limited (AECL) thermal-hydraulic computer code (CATHENA), was analyzed in detail. Other accident scenarios were examined for additional phenomena. A group of Los Alamos National Laboratory reactor thermal-hydraulics experts ranked the phenomena to produce a preliminary phenomena identification and ranking table (PIRT). The preliminary nature of the PIRT was a result of a lack of direct expertise with the unique processes and phenomena of the CANDU 3. Nonetheless, this PIRT provided an adequate foundation for planning a program of code modifications. We believe that this PIRT captured the most important phenomena and that refinements to the PIRT will mainly produce clarification of the relative importance (ranking) of phenomena. A plan for code modifications was developed based on this PIRT and on information about the modeling methodologies for CANDU-specific phenomena used in AECL codes. AECL thermal-hydraulic test facilities and programs were reviewed and the information used in developing an assessment plan to ensure that TRAC-PF1/MOD2, when modified, will adequately predict CANDU 3 phenomena

AECL'S (Atomic Energy Canada Limited) R and D program in health and environmental sciences

International Nuclear Information System (INIS)

Osborne, R.V.

1996-01-01

Radiological protection is a fundamental requirement in any nuclear technology endeavour. It is also an area where public concerns are often expressed. If protection is inadequate, or is believed to be so, or if concerns are not addressed, the beneficial application of nuclear technologies is inhibited. Historically. AECL, as the driver of nuclear technology in Canada, has ensured that the growing Canadian nuclear industry and other users of the technology have a sound technical base to support, explain and confirm all aspects of radiological protection. Meeting this need has meant developing and maintaining R%D programs in environmental sciences, health physics, radiation biology, and radiological health matters in general. The programs undertaken encompass the links from sources of radiation exposure and radionuclides to potential impact on biota and on human health. The behaviours of radionuclides released to the atmosphere, surface waters, or ground waters are examined and described quantitatively to enable predictions to be made of the radiation doses received in different parts of the biosphere and by people. Radiation properties and human physiological and biokinetic processes are studied to provide quantitative links from exposure to radiation dose in tissues and organs. Biological processes involved in determining whether there are any consequences to health from small absorbed doses are identified at levels ranging from molecular level, to cells in tissue culture, and animals. Throughout the programs, required measurement technologies are developed. The results of the R%D have contributed to radiological protection programs being soundly based and, equally important, are being seen to be soundly based. (author)

The influence of solid retention time on IFAS-MBR systems: Assessment of nitrous oxide emission.

Science.gov (United States)

Mannina, Giorgio; Capodici, Marco; Cosenza, Alida; Laudicina, Vito Armando; Di Trapani, Daniele

2017-12-01

The aim of the present study was to investigate the nitrous oxide (N 2 O) emissions from a moving bed based Integrated Fixed Film Activated Sludge (IFAS) - membrane bioreactor (MBR) pilot plant, designed according to the University of Cape Town (UCT) layout. The experimental campaign had a duration of 110 days and was characterized by three different sludge retention time (SRT) values (∞, 30 d and 15 d). Results highlighted that N 2 O concentrations decreased when the biofilm concentrations increased within the aerobic reactor. Results have shown an increase of N 2 O with the decrease of SRT. Specifically, an increase of N 2 O-N emission factor occurred with the decrease of the SRT (0.13%, 0.21% and 0.76% of influent nitrogen for SRT = ∞, SRT = 30 d and SRT = 15 d, respectively). Moreover, the MBR tank resulted the key emission source (up to 70% of the total N 2 O emission during SRT = ∞ period) whereas the highest N 2 O production occurred in the anoxic reactor. Moreover, N 2 O concentrations measured in the permeate flow were not negligible, thus highlighting its potential detrimental contribution for the receiving water body. The role of each plant reactor as N 2 O-N producer/consumer varies with the SRT variation, indeed the aerobic reactor was a N 2 O consumer at SRT = ∞ and a producer at SRT = 30 d. Copyright © 2017 Elsevier Ltd. All rights reserved.

Modifications to the FISS program

International Nuclear Information System (INIS)

Donnelly, J.V.

1985-11-01

FISS is a computer code for use in investigating alternative fuel cycle strategies, performing system simulations accounting for the dynamic effects in growing systems. The changes that have been made to the original FISS program reported in AECL-5814 are described

A Case of Sublingual Ranula That Responded Successfully to Localized Injection Treatment with OK-432 after Healing from Drug Induced Hypersensitivity Syndrome

Directory of Open Access Journals (Sweden)

Kunio Yoshizawa

2016-01-01

Full Text Available A ranula is a mucus retention cyst or pseudocyst caused by leakage of mucus from the sublingual gland and generally occurs in the oral floor. In addition, drug induced hypersensitivity syndrome (DIHS is a rare but well-recognized serious adverse effect characterized by fever, skin rashes, generalized lymphadenopathy, hepatitis, and hepatosplenomegaly and oral stomatitis. This paper presents the first case of successfully treated sublingual ranula with localized injection of OK-432 after healing from drug induced hypersensitivity syndrome, which has previously been unreported in the literature. We present the case of a 38-year-old Japanese woman with sublingual ranula that responded successfully to localized injection treatment with OK-432 after healing from drug induced hypersensitivity syndrome. She was affected with cutaneous myositis and interstitial lung disease when she was 26 years old. At the age 34 years, she received additional oral treatment of diaminodiphenyl-sulfone due to deterioration of the cutaneous myositis, which resulted in drug induced hypersensitivity syndrome (DIHS with severe oral stomatitis. Local injection of OK-432 to the ranula may be a very safe and useful treatment method even if the patient has a history of drug allergy and has connective tissue disease such as cutaneous myositis.

The effect of fuel micro-structure and burn-up on FGR and PCMI studied in IFA-534.13

International Nuclear Information System (INIS)

Matsson, I.; Teshima, H.

1998-02-01

Fission gas pressure (FGR) and cladding elongation (PCMI) data of four high burnup PWR fuel rods with different grain size (8.5 and 22.1 μm) have been analysed and compared in the IFA-534.13 experiment. The fission gas release is low for both fuel types. During the first part of the irradiation there is no significant difference between the normal grain size fuel and the large grain size fuel. During the second part of the experiment , the FGR appears to be higher in the large grain size fuel. However, this result should be taken with some reservation since the bellows pressure transducer showed signs of irregular behaviour during this period. The FGR at end-of-life in the large grain size fuel is #approx=#2.1 %. The FGR at end-of-life in the normal grain size fuel is #approx=#1.5 %. The degree of PCMI is higher in the large grain size fuel during the first part of the irradiation. During the second period the difference is very small. The point of interaction for PCMI during power ramps has shifted to lower power between beginning and end of irradiation. The two fuel types exhibit very similar behaviour during power ramps. There is no clear indication of relaxation during the irradiation. (author)

Input modelling of ASSERT-PV V2R8M1 for RUFIC fuel bundle

Energy Technology Data Exchange (ETDEWEB)

Park, Joo Hwan; Suk, Ho Chun

2001-02-01

This report describes the input modelling for subchannel analysis of CANFLEX-RU (RUFIC) fuel bundle which has been developed for an advanced fuel bundle of CANDU-6 reactor, using ASSERT-PV V2R8M1 code. Execution file of ASSERT-PV V2R8M1 code was recently transferred from AECL under JRDC agreement between KAERI and AECL. SSERT-PV V2R8M1 which is quite different from COBRA-IV-i code has been developed for thermalhydraulic analysis of CANDU-6 fuel channel by subchannel analysis method and updated so that 43-element CANDU fuel geometry can be applied. Hence, ASSERT code can be applied to the subchannel analysis of RUFIC fuel bundle. The present report was prepared for ASSERT input modelling of RUFIC fuel bundle. Since the ASSERT results highly depend on user's input modelling, the calculation results may be quite different among the user's input models. The objective of the present report is the preparation of detail description of the background information for input data and gives credibility of the calculation results.

OK-432 (Picibanil) sclerotherapy for recurrent dislocation of the temporomandibular joint in elderly edentulous patients: Case reports.

Science.gov (United States)

Matsushita, Kazuhiro; Abe, Takae; Fujiwara, Toshikatsu

2007-09-01

Dislocation of the temporomandibular joint (TMJ) is a thorny problem not only for a patient but also a doctor. Especially for the elderly edentulous patients, it is very hard to treat the condition although there are many surgical and non-surgical procedures. We successfully treated it in two elderly edentulous patients by injection of OK-432 as a sclerosing agent.

Detection of anti-Toxoplasma gondii antibodies in experimentally and naturally infected non-human primates by Indirect Fluorescence Assay (IFA and indirect ELISA Detecção de anticorpos anti-Toxoplasma gondii por meio das técnicas de Imunofluorescência Indireta e ELISA Indireto em primatas experimentalmente e naturalmente infectados

Directory of Open Access Journals (Sweden)

Andréa Bouer

2010-03-01

Full Text Available The Indirect Fluorescence Assay (IFA and the indirect ELISA were comparatively used to detect IgG and IgM antibodies for Toxoplasma gondii in experimentally and naturally infected primates. In the experimentally infected group, antibodies of diagnostic value were detected at day 9 post-infection (PI with the IFA (IgG and IgM and with IgG-ELISA. IgM-ELISA detected antibodies for T. gondii starting at day 3 PI until the end of the experiment (102 days PI. Of the 209 naturally infected sera tested, from many zoos of State of Sao Paulo, 64.59 and 67.94% were positive in the IgG-IFA test and IgG-ELISA respectively. IgM-ELISA test detected seropositivity in 52.63% of the sera although IgM-IFA test detected it in only in 0.96% of the samples. The differential toxoplasmosis diagnosis was accomplished with Neospora caninum by IFA, observing 61 (29.2% seropositive animals for this parasite and 149 (70.8% negative. Sixty animals were positive for both T. gondii and N. caninum. Pneumonia, splenomegaly, and intestinal ulcers were macroscopically observed. Unremarkable interstitial pneumonia, enteritis, colitis, splenitis, and glomerulitis were microscopically observed. The immunohistochemical stain could not detect the presence of T. gondii in the tissues of the animals infected experimentally.Detectou-se anticorpos das classes IgG e IgM anti-Toxoplasma gondii em primatas experimentalmente e naturalmente infectados, utilizando-se como técnicas comparativas a RIFI e o ELISA-teste. No grupo dos primatas experimentalmente infectados, anticorpos de valor diagnóstico foram detectados a partir do 9º dia de infecção tanto na RIFI (IgG e IgM como no ELISA-IgG. O ELISA IgM detectou anticorpos a partir do 3º dia de infecção até o final do experimento (102 dias pós-infecção. Dos 209 soros dos primatas naturalmente infectados, de diversos zoológicos do Estado de São Paulo, 64,59 e 67,94% mostraram-se positivos na RIFI-IgG e no ELISA-IgG, respectivamente. O

Toxicity mitigation and solidification of municipal solid waste incinerator fly ash using alkaline activated coal ash

International Nuclear Information System (INIS)

Ivan Diaz-Loya, E.; Allouche, Erez N.; Eklund, Sven; Joshi, Anupam R.; Kupwade-Patil, Kunal

2012-01-01

Highlights: ► Incinerator fly ash (IFA) is added to an alkali activated coal fly ash (CFA) matrix. ► Means of stabilizing the incinerator ash for use in construction applications. ► Concrete made from IFA, CFA and IFA-CFA mixes was chemically characterized. ► Environmentally friendly solution to IFA disposal by reducing its toxicity levels. - Abstract: Municipal solid waste (MSW) incineration is a common and effective practice to reduce the volume of solid waste in urban areas. However, the byproduct of this process is a fly ash (IFA), which contains large quantities of toxic contaminants. The purpose of this research study was to analyze the chemical, physical and mechanical behaviors resulting from the gradual introduction of IFA to an alkaline activated coal fly ash (CFA) matrix, as a mean of stabilizing the incinerator ash for use in industrial construction applications, where human exposure potential is limited. IFA and CFA were analyzed via X-ray fluorescence (XRF), X-ray diffraction (XRD) and Inductive coupled plasma (ICP) to obtain a full chemical analysis of the samples, its crystallographic characteristics and a detailed count of the eight heavy metals contemplated in US Title 40 of the Code of Federal Regulations (40 CFR). The particle size distribution of IFA and CFA was also recorded. EPA’s Toxicity Characteristic Leaching Procedure (TCLP) was followed to monitor the leachability of the contaminants before and after the activation. Also images obtained via Scanning Electron Microscopy (SEM), before and after the activation, are presented. Concrete made from IFA, CFA and IFA-CFA mixes was subjected to a full mechanical characterization; tests include compressive strength, flexural strength, elastic modulus, Poisson’s ratio and setting time. The leachable heavy metal contents (except for Se) were below the maximum allowable limits and in many cases even below the reporting limit. The leachable Chromium was reduced from 0.153 down to 0.0045 mg

Final Report for the FUMEX-III Exercise with the TRANSURANUS Code

International Nuclear Information System (INIS)

Van Uffelen, P.; Schubert, A.; Van de Laar, J.; Di Marcello, V.

2013-01-01

This report describes the results of the fourth round robin exercise organized by the IAEA for the LWR fuel behaviour codes. The previous exercise was organized by the IAEA in 2002-2007. ITU contributed to the IAEA FUMEX- II co-ordinated research project (CRP) by: - The development of a high burn-up TRANSURANUS-WWER Version - Verification of the TRANSURANUS-WWER Version for WWER-1000 reactors - Further verification of the TRANSURANUS Code by selected irradiations from the IFPE Database - Transfer of latest ITU knowledge in the following areas: high burnup effects and MOX behaviour as far as confidentiality is not concerned. Within the FUMEX-III project this work continues by: - Knowledge transfer and release of the TRANSURANUS code to safety authorities in several neighbouring countries of the European Union - Further verification of the TRANSURANUS Code by selected irradiations from the IFPE Database: extending the verification of the TRANSURANUS code on the basis of the cases related to the behaviour of high burnup UO 2 fuel, Gd-containing UO 2 fuel and MOX fuel under normal operating conditions in LWRs, including WWER. The simulation of the pellet-cladding mechanical interaction received particular attention. - Extending the TRANSURANUS code for simulation of fuel rods under accidental conditions, such as a loss of coolant accidents (LOCA) and a Reactivity Initiated Accident (RIA), for which various code improvements have been implemented and other changes are still under development. During the entire period of the CRP, ITU has carried out all priority cases, except for IFA-519 for which insufficient data have been provided. All these results are considered in this report. However, in order to limit the redundancy of work of various TRANSURANUS users involved in the FUMEX-III CRP, ITU has co-ordinated part of the work of the partners in Bulgaria, Romania and Italy. More precisely, the work on the WWER version of the code has been carried out in collaboration

In-pile data analysis of the comparative WWER/PWR test IFA-503.1. Final report.

Energy Technology Data Exchange (ETDEWEB)

Volkov, B.; Devold, H.; Ryazantzev, E.; Yakovlev, V.

1999-04-15

The comparative WWER/PWR test in IFA-503.1 was commenced in July 1995 and successfully finished at the end of November 1998. The main objective of the test was generation of representative and comparative data of standard WWER-440 fuel fabricated at the 'MSZ' Electrostal (Russia) and PWR type fuel manufactured at IFE Kjeller (Norway). The test assembly comprised two clusters, each with 3 WWER rods and 3 PWR type rods. Eight rods with two types of fuel were instrumented with expansion thermometers, four rods were equipped with both fuel stack elongation detectors and pressure transducers. All sensors worked satisfactorily during the test. The average burnups achieved in the lower and upper clusters were around 25 and 20 MWd/kgUO{sub 2}, respectively. Some difference in densification of the two types of fuel was revealed during the first irradiation period. However, the fuel temperatures and commencement of fuel stack swelling were similar despite this fact. At the end of the test the rig was moved to a higher flux position in the HBWR core with the aim of promoting FGR and to compare the behaviour of the two types of fuel under higher power. Pressure measurements indicated a comparable low FGR (around 1 percent) in both types of rods. The centreline temperatures measured in the PWR rods were very close to the Halden FGR threshold whilst the WWER fuel temperatures were slightly lower. Despite the differences found in the behaviour of the two types of fuel during the test, the analysis of the in-pile data showed that these differences would not affect the fuel efficiency, at least, up to the burnup achieved in the test. It is supposed that these differences can be related to the fuel microstructure, in particular to the fuel grain and pore sizes (author) (ml)

In-pile data analysis of the comparative WWER/PWR test IFA-503.1. Final report

Energy Technology Data Exchange (ETDEWEB)

Volkov, B.; Devold, H.; Ryazantzev, E.; Yakovlev, V

1999-04-15

The comparative WWER/PWR test in IFA-503.1 was commenced in July 1995 and successfully finished at the end of November 1998. The main objective of the test was generation of representative and comparative data of standard WWER-440 fuel fabricated at the 'MSZ' Electrostal (Russia) and PWR type fuel manufactured at IFE Kjeller (Norway). The test assembly comprised two clusters, each with 3 WWER rods and 3 PWR type rods. Eight rods with two types of fuel were instrumented with expansion thermometers, four rods were equipped with both fuel stack elongation detectors and pressure transducers. All sensors worked satisfactorily during the test. The average burnups achieved in the lower and upper clusters were around 25 and 20 MWd/kgUO{sub 2}, respectively. Some difference in densification of the two types of fuel was revealed during the first irradiation period. However, the fuel temperatures and commencement of fuel stack swelling were similar despite this fact. At the end of the test the rig was moved to a higher flux position in the HBWR core with the aim of promoting FGR and to compare the behaviour of the two types of fuel under higher power. Pressure measurements indicated a comparable low FGR (around 1 percent) in both types of rods. The centreline temperatures measured in the PWR rods were very close to the Halden FGR threshold whilst the WWER fuel temperatures were slightly lower. Despite the differences found in the behaviour of the two types of fuel during the test, the analysis of the in-pile data showed that these differences would not affect the fuel efficiency, at least, up to the burnup achieved in the test. It is supposed that these differences can be related to the fuel microstructure, in particular to the fuel grain and pore sizes (author) (ml)

Transport modeling of sorbing tracers in artificial fractures

International Nuclear Information System (INIS)

Keum, Dong Kwon; Baik, Min Hoon; Park, Chung Kyun; Cho, Young Hwan; Hahn, Phil Soo.

1998-02-01

This study was performed as part of a fifty-man year attachment program between AECL (Atomic Energy Canada Limited) and KAERI. Three kinds of computer code, HDD, POMKAP and VAMKAP, were developed to predict transport of contaminants in fractured rock. MDDM was to calculate the mass transport of contaminants in a single fracture using a simple hydrodynamic dispersion diffusion model. POMKAP was to predict the mass transport of contaminants by a two-dimensional variable aperture model. In parallel with modeling, the validation of models was also performed through the analysis of the migration experimental data obtained in acrylic plastic and granite artificial fracture system at the Whiteshell laboratories, AECL, Canada. (author). 34 refs., 11 tabs., 76 figs

Transport modeling of sorbing tracers in artificial fractures

Energy Technology Data Exchange (ETDEWEB)

Keum, Dong Kwon; Baik, Min Hoon; Park, Chung Kyun; Cho, Young Hwan; Hahn, Phil Soo

1998-02-01

This study was performed as part of a fifty-man year attachment program between AECL (Atomic Energy Canada Limited) and KAERI. Three kinds of computer code, HDD, POMKAP and VAMKAP, were developed to predict transport of contaminants in fractured rock. MDDM was to calculate the mass transport of contaminants in a single fracture using a simple hydrodynamic dispersion diffusion model. POMKAP was to predict the mass transport of contaminants by a two-dimensional variable aperture model. In parallel with modeling, the validation of models was also performed through the analysis of the migration experimental data obtained in acrylic plastic and granite artificial fracture system at the Whiteshell laboratories, AECL, Canada. (author). 34 refs., 11 tabs., 76 figs.

MAAP4 CANDU analysis of a generic CANDU-6 plant: preliminary results

Energy Technology Data Exchange (ETDEWEB)

Petoukhov, S.M.; Mathew, P.M

2001-10-01

To support the generic probabilistic safety analysis (PSA) program at AECL, in particular to conduct Level 2 PSA analysis of a CANDU 6 plant undergoing a postulated severe accident, the capability to conduct severe accident consequence analysis for a CANDU plant is required. For this purpose, AECL selected MAAP4 CANDU from a number of other severe accident codes. The necessary models for a generic CANDU 6 station have been implemented in the code, and the code version 0.2 beta was tested using station data, which were assembled for a generic CANDU 6 station. This paper describes the preliminary results of the consequence analysis using MAAP4 CANDU for a generic CANDU 6 station, when it undergoes a station blackout and a large loss-of-coolant accident scenario. The analysis results show that the plant response is consistent with the physical phenomena modeled and the failure criteria used. The results also confirm that the CANDU design is robust with respect to severe accidents, which is reflected in the calculated long times that are available for administering accident management measures to arrest the accident progression before the calandria vessel or containment become at risk. (author)

The period analysis of V418 AQL, SU BOO, RV CVn, CR CAS, GV CYG, V432 PER, and BD+42 2782

International Nuclear Information System (INIS)

Zasche, P.; Wolf, M.; Kučáková, H.; Uhlař, R.

2014-01-01

The minimum timings of eclipsing binaries V418 Aql, SU Boo, RV CVn, CR Cas, GV Cyg, V432 Per, and BD+42 2782 were collected and analyzed. Their long-term behavior was studied via period analysis, revealing a periodic term in eclipse times. We derived 576 new times of minimum. Hence, to describe the periodic variation, a third-body hypothesis was proposed and the resulting orbital periods are as follows: 70, 7.4, 53, 37, 27, 53, and 18 yr, respectively. For the system V432 Per an additional 9.5 yr variation was also found. The predicted minimum masses of these distant bodies were calculated and their detectability discussed. The light curves of SU Boo and RV CVn were analyzed using the PHOEBE program, resulting in physical parameters of the components. New variable stars in the field of V418 Aql were discovered.

Biodegradation of Mexel 432 By Bacteria From the Seine River

International Nuclear Information System (INIS)

Allonier, A.S.; Khalanski, M.

1996-01-01

This report deals with a study of the biodegradation of a filmogenic organic product (Mexel 432) usable in the fight against corrosion, scale and fouling, presenting a certain interest in the research of processes enabling a functional and environmental efficiency for the cooling systems of thermal power stations. The study of the degradation of this product is followed by a global colorimetric method. It shows that the product is stable on the long-term in demineralized water. On the other hand, its rate of disappearance in river waters is significant (50 % in 2 or 3 days). In this phenomenon of disappearance, biodegradation seems to play a part. Some bacteria from the natural environment (river Seine) have been isolated. Two of them seem to play a significant part, since they can degrade the product in three weeks. During the degradation, the amines with long chains (more than six carbons) of the Mexel, measured by the colorimetric method, disappear. The other compounds generated by the biodegradation process are not identified. (authors)

75 FR 15419 - Notice of Intent To Grant Exclusive License of U.S. Patent Application No. 12/432,842 Filed April...

Science.gov (United States)

2010-03-29

... Exclusive License of U.S. Patent Application No. 12/432,842 Filed April 30, 2009 Entitled: ``A Soil Stabilization Soil Comprising Same, and a Method of Stabilizing Soil'' AGENCY: Department of the Army, U.S. Army... climates with sandy, gravelly soils where emulsions and hydraulic cements will not effectively cure. If...

List of publications 1986-1987

International Nuclear Information System (INIS)

1988-03-01

This list includes all the scientific and technical publications of Atomic Energy of Canada Limited - reports, reprints of journal articles, and translations - issued from 1986 April to 1987 December. Together with the earlier cumulative lists (AECL-5000, AECL-5001, AECL-5002, AECL--5003, AECL--5004, AECL--5005), it provides a complete catalogue of publications in the AECL-series. In the future, lists will be produced at twelve month intervals. The titles and other bibliographic information are arranged in several categories, each devoted to a broad subject area. In addition, each document is identified with an AECL number (for example, AECL-12345) which should be used in ordering reports and making enquiries

Simulations with the DIONISIO 1.0 Code of Experiments Proposed for the Fumex III Exercise. Final Report

International Nuclear Information System (INIS)

Soba, Alejandro; Denis, Alicia

2013-01-01

This presentation is intended to summarize the results obtained with DIONISIO within the frame of the FUMEX III exercise. From that list we selected those cases that fall within the scope of our code and excluded examples oriented to loss of coolant accidents, like FIO 131, Mt4 and Mt6, or to reactivity initiated accidents, like NSRR, or to oxidation and creep behavior of the cladding under variable stress conditions, like E110 or IFA 585. The models contained in DIONISIO permit the prediction of the temperature distribution in the pellet, cladding and gap, the elastic and plastic stress and strain, creep, swelling and densification, release of fission gases, cesium and iodine to the internal free volume of the rod, gas mixing, pressure increase, irradiation growth of the Zircaloy cladding, development of an oxide layer and hydrogen uptake on the waterside surface, restructuring and grain growth in the pellet. The effects of an internal or external corrosive atmosphere (SCC) as well as the possibility of pellet-cladding interaction (PCI) and crack propagation are also considered. Among the several models included in the code, we consider that two merit some more attention: the thermal description of the gap, since it is determinant of the quality of the simulation of pellet-cladding interaction, and the model of mechanical contact between them designed to predict the failure conditions of the cladding. A summary of both is given below. The participation of our code in the FUMEX III exercise prompted the development of the tools necessary to simulate the fuel behavior in the high burnup range. On the one hand, a subroutine was included in DIONISIO designed to give the radial distribution of the Pu and U isotopes that play a role in the absorption and capture of neutrons in the fuel. As a result, the local distribution of burnup can be obtained with the code. On that basis, the dependence of the thermal conductivity with burnup was included. The code is two

IFPE/IFA-597.3, centre-line temperature, fission gas release and clad elongation at high burn-up (60-62 MWd/kg)

International Nuclear Information System (INIS)

Turnbull, J.A.

2003-01-01

Description: The fuel segments for the high burn-up integral rod behaviour test IFA-597 were taken from fuel rod 33-25065, which was irradiated in the Ringhals 1 BWR for approximately 12 years. The irradiation of this rod and its sibling rod 33-25046 was performed in two stages. During the first irradiation, 1980 to 1986, the rods were part of Ringhals assembly 6477 and an approximate rod averaged burn-up of 31 MWd/kg UO 2 was reached. The rods were then placed into fuel assembly 9902 for a second period of irradiation from 1986 to 1992. The location of the fuel rods 33-25065 and 33-25046 in this assembly were in positions 9902/D and 9902/E4 respectively. A final rod averaged burn-up of 52 MWd/kg UO 2 was achieved. The burn-up at the location of the Halden segments was estimated as 59 MWd/kg UO 2 , well beyond the formation of High Burn-up Structure (Hobs) formation at the pellet rim. At the rim, the burn-up was estimated as 130 MWd/kg UO 2 . After commercial irradiation, PIE was performed at Studsvik. Inner and outer clad oxide thickness measurements were 42 and 5 microns respectively. The measured cold rod diameter varied between 12.20 and 12.25 mm, thus only a small amount of creep-down had occurred from the original diameter of 12.25 mm. Cold gap measurements were taken by diametral compression of the clad onto the fuel. The stiffness changes twice during these measurements, the first (relocated gap) associated with the onset of pellet fragment movement, the second (compressed gap) when the fragments are together and the pellet is compressed. For these rods, the compressed diametral gap was measured as 30 microns. This is in agreement with the pellet and cladding being in contact during the final irradiation cycle, i.e., at ∼12 kW/m. FGR measurements were made after puncturing and values of 2.5%-3.3% were calculated from the extracted gas. The uncertainty is due to different methods of calculation. Ceramography showed a normal crack pattern and no evidence of

Variations in the response of AECL random coil seals as a function of the angular position of the probe

International Nuclear Information System (INIS)

Silk, M.G.

1986-04-01

The AECL random coil seal is to be used as a Nuclear Safeguards seal to deter and detect tampering with nuclear material in store. To be effective the ultrasonic signature from the seal must remain constant and be different from that of other seals. Angular variations in the ultrasonic response from certain seals have, however, been observed and the programme of study reported here has been carried out in order to clarify the source of this variation. It is shown that the variation observed may most probably be attributed to the ultrasonic probes used in the investigation and, in particular, to deviation of the probe beam from circularity. However it is probable that the angle of the beam with respect to the probe case (squint) is also a contributory factor. In addition, to reduce the degree of angular variation it is important to exclude air bubbles and to ensure that the coil is placed as centrally in the beam as possible. It is anticipated that the exclusion of air bubbles will be easier in the field than in the laboratory studies. The need to place the seal reasonably centrally with respect to the beam places some minor limits on the coil design and also makes it essential that the probe fits closely into its holder in the seal as any slackness may give rise to signature variations. (author)

Optimal codes as Tanner codes with cyclic component codes

DEFF Research Database (Denmark)

Høholdt, Tom; Pinero, Fernando; Zeng, Peng

2014-01-01

In this article we study a class of graph codes with cyclic code component codes as affine variety codes. Within this class of Tanner codes we find some optimal binary codes. We use a particular subgraph of the point-line incidence plane of A(2,q) as the Tanner graph, and we are able to describe ...

Compliance characteristics of cracked UO2 pellets

International Nuclear Information System (INIS)

Williford, R.E.; Mohr, C.L.; Lanning, D.D.

1981-01-01

The thermally induced cracking of UO 2 fuel pellets causes simultaneous reductions of the bulk (extrinsic) fuel thermal conductivity and elastic moduli to values significantly less than those for solid pellets. The magnitude of these bulk properly reductions was found to be primarily dependent on the amount of crack area in the transverse plane of the fuel. The model described herein uses a simple description of the crack geometry to couple the fuel rod thermal and mechanical behaviors by relating in-reactor data to Hooke's Law and a crack compliance model. Data from the NRC/PNL Halden experiment IFA-432 show that for a typical helium-filled BWR-design rod at 30 kW/m, the effective thermal conductivity and elastic moduli of the cracked fuel are 4/5 and 1/40 of that for solid pellets, respectively

Treatment of lymphangiomas in children: an update of Picibanil (OK-432) sclerotherapy.

Science.gov (United States)

Greinwald, J H; Burke, D K; Sato, Y; Poust, R I; Kimura, K; Bauman, N M; Smith, R J

1999-10-01

Picibanil (OK-432) is a sclerosing agent derived from a low-virulence strain of Streptococcus pyogenes that induces regression of macrocystic lymphangiomas. This report describes a prospective, nonrandomized trial to evaluate the efficacy of Picibanil in the treatment of 13 affected children ranging in age from 1 to 94 months. On average, 4.1 fluoroscopically guided intracystic injections were performed per child, with an average total dose of 0.56 mg of Picibanil. As judged by physical examination and radiographic studies, 5 children (42%) showed a complete or substantial response, and 2 children (16%) showed an intermediate response. No response was seen in 5 children (42%), 2 of whom had massive craniofacial lymphangioma. Factors that contribute to failure with Picibanil sclerotherapy are the presence of a significant microcystic component to the lesion, massive craniofacial involvement, and previous surgical resection. Macrocystic lymphangiomas of the infratemporal fossa or cervical area have the best response to therapy.

CFD analysis of flow and heat transfer in Canadian supercritical water reactor bundle

International Nuclear Information System (INIS)

Podila, K.; Rao, Y.F.

2015-01-01

Highlights: • Flow and heat transfer in SCWR fuel bundle design by AECL is studied using CFD. • Bare-rod bundle geometry is tested at 23.5, 25 and 28 MPa using STAR-CCM+ code. • SST k–ω low-Re model was used to study occurrence of heat transfer deterioration. - Abstract: Within the Gen-IV International Forum, AECL is leading the effort in developing a conceptual design for the Canadian SCWR. AECL proposed a new fuel bundle design with two rings of fuel elements placed between central flow tube and the pressure tube. In line with the scope of the conceptual design, the objective of the present CFD work is to aid in developing a bundle heat transfer correlation for the Canadian SCWR fuel bundle design. This paper presents results from an ongoing effort in determining the conditions favorable for occurrence of HTD in the supercritical bundle flows. In the current investigation, bare-rod bundle geometry was tested for the proposed fuel bundle design at 23.5, 25 and 28 MPa using STAR-CCM+ CFD code. Taking advantage of the design symmetry of the fuel bundle, only 1/32 of the computational domain was simulated. The low-Reynolds number modification of SST k–ω turbulence model along with y + < 1 was used in the simulations. For lower mass flow simulations, the increase of inlet temperature and operational pressure was found effective in reducing the occurrence of HTD. For higher mass flow simulations, normal heat transfer behaviour was observed except for the lower pressure range (23.5 MPa)

Parametric studies of radiolytic oxidation of iodide solutions with and without paint: comparison with code calculations

Energy Technology Data Exchange (ETDEWEB)

Poletiko, C; Hueber, C [Inst. de Protection et de Surete Nucleaire, C.E. Cadarache, St. Paul-lez-Durance (France); Fabre, B [CISI, C.E. Cadarache, St. Paul-lez-Durance (France)

1996-12-01

In case of severe nuclear accident, radioactive material may be released into the environment. Among the fission products involved, are the very volatile iodine isotopes. However, the chemical forms are not well known due to the presence of different species in the containment with which iodine may rapidly react to form aerosols, molecular iodine, hydroiodic acid and iodo-organics. Tentative explanations of different mechanisms were performed through benchscale tests. A series of tests has been performed at AEA Harwell (GB) to study parameters such as pH, dose rate, concentration, gas flow rate, temperature in relation to molecular iodine production, under dynamic conditions. Another set of tests has been performed in AECL Whiteshell (CA) to study the behaviour of painted coupons, standing in gas phase or liquid phase or both, with iodine compounds under radiation. The purpose of our paper is to synthesize the data and compare the results to the IODE code calculation. Some parameters of the code were studied to fit the experimental result the best. A law, concerning the reverse reaction of iodide radiolytic oxidation, has been proposed versus: pH, concentrations and gas flow-rate. This law does not apply for dose rate variations. For the study of painted coupons, it has been pointed out that molecular iodine tends to be adsorbed or chemically absorbed on the surface in gas phase, but the mechanism should be more sophisticated in the aqueous phase. The iodo-organics present in liquid phase tend to be partly or totally destroyed by oxidation under radiation (depending upon the dose delivered). These points are discussed. (author) 18 figs., 3 tabs., 15 refs.

Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens.

Science.gov (United States)

Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann

2014-09-01

We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

Annual report 1998-1999

Energy Technology Data Exchange (ETDEWEB)

NONE

1999-07-01

This is the Annual Report of the Atomic Energy of Canada Limited for the year ending March 31, 1999 and summarizes the activities of AECL during the period 1998-1999. The Activities covered in this Report include the CANDU Reactor Business, with excellent progress reported on the construction of two 700 MWe-class CANDU reactors in Qinshan, China. In the Republic of Korea, Wolsong Unit entered into commercial operation and Wolsong Unit 4 achieved sustained nuclear reaction. The Report also covers AECL's R and D and Waste Management programs. In the R and D section, the report outlines the development of the CANFLEX fuel bundle, Fuel Channels, Reactor Safety, Code Validation, Fuels and Fuel Cycles as well as Heavy Water production. Progress in the Waste Management program is also discussed.

Annual report 1998-1999

International Nuclear Information System (INIS)

1999-01-01

This is the Annual Report of the Atomic Energy of Canada Limited for the year ending March 31, 1999 and summarizes the activities of AECL during the period 1998-1999. The Activities covered in this Report include the CANDU Reactor Business, with excellent progress reported on the construction of two 700 MWe-class CANDU reactors in Qinshan, China. In the Republic of Korea, Wolsong Unit entered into commercial operation and Wolsong Unit 4 achieved sustained nuclear reaction. The Report also covers AECL's R and D and Waste Management programs. In the R and D section, the report outlines the development of the CANFLEX fuel bundle, Fuel Channels, Reactor Safety, Code Validation, Fuels and Fuel Cycles as well as Heavy Water production. Progress in the Waste Management program is also discussed

Fuel Behaviour Simulations in Fumex III CRP at NRI

International Nuclear Information System (INIS)

Valach, M.; Klouzal, J.; Dostal, M.; Zymak, J.

2013-01-01

NRI Rez plc took part in the previous coordinated research projects focused on fuel behaviour modelling held by the IAEA - FUMEX-I and FUMEX-II. These were very helpful for the development and validation of various codes used in the Nuclear Research Institute Rez (NRI) for the evaluation of the fuel rod thermomechanical behaviour. Based on the considerations of our needs related to the modeling for Czech NPPs we have performed basic parametric calculations of two LOCA cases (IFA-650.1 and IFA-650.2) and detailed evaluation WWER related cases Kola MIR ramp rods. The AREVA ''Idealized case'' and 16x16 LTA cases were also calculated because of the high burnup reached. Report summarises simulated cases in the frame of FUMEX III Project at the NRI Rez plc. (author)

Removing fuelling transient using neutron absorbers

Energy Technology Data Exchange (ETDEWEB)

Paquette, S.; Chan, P.K.; Bonin, H.W., E-mail: Stephane.Paquette@rmc.ca [Royal Military College of Canada, Chemistry and Chemical Engineering Dept., Kingston, Ontario (Canada); Pant, A. [Cameco Fuel Manufacturing, Port Hope, Ontario (Canada)

2012-07-01

Preliminary criticality and burnup calculation results indicate that by employing a small amount of neutron absorber the fuelling transient, currently occurring in a CANDU 37-element fuel bundle, can be significantly reduced. A parametric study using the Los Alamos National Laboratories' MCNP 5 code and Atomic Energy of Canada Limited's WIMS-AECL 3.1 is presented in this paper. (author)

Past and future fracturing in AECL Research areas in the superior province of the Canadian Precambrian Shield, with emphasis on the Lac du Bonnet Batholith

International Nuclear Information System (INIS)

Brown, A.; Everitt, R.A.; Martin, C.D.; Davison, C.C.

1995-10-01

The likelihood that future fracturing, arising from geologic causes, could occur in the vicinity of a nuclear fuel waste repository in plutonic rock of the Canadian Precambrian Shield, is examined. The report discusses the possible causes of fracturing (both past and future) in Shield rocks. The report then examines case histories of fracture formation in Precambrian plutonic rocks in AECL's Research Areas, especially the history of the Lac du Bonnet Batholith, in the Whiteshell Area, Manitoba. Initially, fractures can be introduced into intrusive plutonic rocks during crystallization and cooling of an intrusive magma. These fractures are found at all size scales; as late residual magma dyking, hydraulic fracturing by retrograde boiling off of hydrothermal fluids, and, in some cases, through local differential cooling. Subsequent fracturing is largely caused by changes in environmental temperature and stress field, rather than by alteration of the material behaviour of the rock. Pluton emplacement during orogeny is commonly accompanied by uplift and erosional exhumation, altering both the tectonic and the lithostatic stresses, the rock temperature gradient and the pore fluid characteristics

Burnup dependence of coolant void reactivity for ACR-1000 cell

International Nuclear Information System (INIS)

Le Tellier, R.; Marleau, G.; Hebert, A.; Roubstov, D.; Altiparmakov, D.; Irish, D.

2008-01-01

The Advanced Candu Reactor (ACR-1000) is light water cooled, fueled with enriched uranium and has a smaller lattice pitch than the Candu-6. As a result, the neutronic behavior of the ACR-1000 cell is expected to be somewhat different from that of the Candu-6 leading to a negative coolant void reactivity (CVR). Here we evaluate the CVR for the ACR-1000 cell using the lattice code DRAGON and compare our results with those obtained using the code WIMS-AECL. The differences observed between these two codes for the burnup dependence of the CVR is mainly explained in terms of the specific cell leakage model used by both codes. (authors)

Natural Icing Re-Evaluation of the EH-60A Quick Fix Helicopter

Science.gov (United States)

1989-05-01

INDIVIDUAL 22b. TELEPHONE (Include Area Code) 22c. OFFICE SYMBOL ,!.lIl.,.\\ R I ,VIS (805) 277-2115 , , SAVIF-PR DDForm 1473, JUN 86 Previous editions are...Rc1iiort. -\\I-.FA PI lcit No. 88-06, Artijical and Natural Iking Test. of the I-il- trA )iuck IFix lI ic-opici June 1988. I ttcr. AVSCO(), AISA \\V--S

Picibanil (OK-432) in the treatment of head and neck lymphangiomas in children.

Science.gov (United States)

Rebuffini, Elena; Zuccarino, Luca; Grecchi, Emma; Carinci, Francesco; Merulla, Vittorio Emanuele

2012-12-01

Picibanil (OK-432) is a lyophilized mixture of group A Streptococcus pyogenes with antineoplastic activity. Because of its capacity to produce a selective fibrosis of lymphangiomas (LMs), it has been approved by Japanese administration in 1995 for the treatment of LMs. We treated 15 children (age range: 6-60 months) affected by head and neck macrocystic LMs with intracystic injections (single dose of 0.2 mL) of Picibanil (1-3 injections). Complete disappearance of the lesion was noticed in eight (53.33%) cases, a marked (>50%) reduction of LMs was found five (33.33%) cases, while a moderate (Picibanil side effects included fever, local inflammation, and transitory increase of blood platelets' concentration; a single case of anemia was resolved with concentrated red blood cells transfusion. Intracystic injection of Picibanil is an effective and safe treatment for macrocystic LMs in pediatric patients and may represent the treatment of choice in such cases, especially where surgical excision is associated with the risk of functional/cosmetic side effects.

Corrosion in nuclear systems. 4. Comparison of the PWR Cladding Corrosion Models for Test IFA-638.1-3

International Nuclear Information System (INIS)

Kim, Yong-Deog; Bae, Seong-Man; Lee, Chang-Sup

2001-01-01

The cladding corrosion test (IFA-638) is being performed to investigate the corrosion properties of different modern PWR cladding materials. The experimental results are evaluated by the corrosion models EPRI/KWU/CE, ESCORE, NEPLC, and COCHISE. When comparing the measured and the predicted oxide thickness, the following conclusions can be drawn: 1. Considering the fresh material parts (lower parts) of each rod, the oxide thickness calculations of all models under-predicted the measured values by up to 50% after 118 days of exposure. The NEPLC model, however, showed good agreement for 263 days of exposure, while the COCHISE and EPRI/KWU/CE-ESCORE models over-predicted (about +50%) and under-predicted (about -42%), respectively. 2. The oxide layer thickness on the pre-irradiated parts (upper parts) of each rod is well predicted by the COCHISE model after 118 days of exposure, but the other models over-predicted the thickness. All the models over-predicted the oxide thickness after 263 days of exposure, and the divergency between the measured and calculated oxide thickness became larger. 3. The differences in the calculated oxide thickness between the models at low burnup (fresh parts) are attributed to the different transition point determinations of the models. 4. Comparing the measurements with the calculations from the pre-irradiated parts of each rod, the overall over-prediction could be accounted for by the fact that the post-transition regime of all four models was calibrated for standard Zircaloy-4 materials. The differences between the models were attributed to empirical variables such as the frequency factor (k 2 , B) and the activation energy (Q 2 ) in Tables I, II, and III, which were calibrated with other experimental/plant data. (authors)

A phase II study of cisplatin, oral administration of etoposide, OK-432 and radiation therapy for inoperable stage III non-small cell lung cancer

International Nuclear Information System (INIS)

Abe, Yoshinao; Takahashi, Jutaro; Fukuda, Hiroshi

1998-01-01

This study was designed to evaluate the feasibility and efficiency of giving cisplatin, etoposide, and OK-432 concurrently with conventional radiotherapy (RTx) for patient's with inoperable stage III, based on the TNM classification according to the International Union against Cancer staging system for lung cancer (1987) non-small cell lung cancer (NSCLC). From January 1992 to December 1994, 31 patients with cytologically or histologically confirmed stage III NSCLC were treated with RTx, to a total dose of 56-64 Gy, with concurrent daily oral administration of etoposide (25 mg) and cisplatin (20 mg) for 5 days during the third or fourth week from the start of RTx. The subcutaneous injection of 1 or 2 KE of OK-432, three times a week, for the duration of radiotherapy also started from the beginning of RTx. The number of eligible patients was 29 (26 men and 3 women). Their mean age was 66 years (range, 55-77 years). Six patients had an Eastern Cooperative Oncology Group performance status (PS) of 0; 15, 1; 8; 2. Three were stage IIIA, and 26, stage IIIB. Histologically, 2 had adenocarcinoma, 23, squamous cell carcinoma, and 4, large cell carcinoma. In 27 of the 29 patients, the RTx schedule was completed. There were no treatment-related deaths. Grade 4 toxicity (according to World Health Organisation criteria) leukopenia (700/μl) was observed in 1 patient. The response rate was 79% and the median survival was 17 months. Survival rates at 1, 2 and 3 years were 62%, 31%, and 21%, respectively. The local failure rate was 51%. The combination of cisplatin, etoposide, and OK-432, given concurrently with conventional RTx is feasible and effective for inoperable stage III NSCLC. (author)

Development of a graphical animation interactive feature to assess MAAP-CANDU simulation results

Energy Technology Data Exchange (ETDEWEB)

Petoukhov, S.M., E-mail: sergei.petoukhov@cnl.ca [Canadian Nuclear Laboratories, Chalk River, ON (Canada); Karancevic, N., E-mail: karancevic@fauske.com [Fauske and Associates Inc. (FAI), Burr Ridge, IL (United States); Morreale, A.C., E-mail: andrew.morreale@cnl.ca [Canadian Nuclear Laboratories, Chalk River, ON (Canada); Paik, C.Y., E-mail: paik@fauske.com [Fauske and Associates Inc., Burr Ridge, IL (United States); Brown, M.J., E-mail: morgan.brown@cnl.ca [Canadian Nuclear Laboratories, Chalk River, ON (Canada); Cole, C., E-mail: christopher.cole@cnsc-ccsn.gc.ca [Canadian Nuclear Safety Commission, Ottawa, ON (Canada)

2015-07-01

MAAP-CANDU is an integrated severe accident analysis code for CANDU plant simulations that necessitates the assessment and post-processing of extensive amounts of information obtained from code run results. The MAAP-CANDU GRaphical Animation Package Extension (GRAPE) is a flexible, efficient, interactive and integrated visualization tool for analyzing plant behaviour during postulated accidents including accident management actions for single and multi-unit CANDU plants. GRAPE was developed by FAI in consultation with CNL (AECL) and CNSC from the FAI MAAP-GRAAPH code used in MAAP (LWR version). CNSC plans to use MAAP-CANDU and GRAPE as one of the tools in their Emergency Operations Centre.(author)

Development of a graphical animation interactive feature to assess MAAP-CANDU simulation results

International Nuclear Information System (INIS)

Petoukhov, S.M.; Karancevic, N.; Morreale, A.C.; Paik, C.Y.; Brown, M.J.; Cole, C.

2015-01-01

MAAP-CANDU is an integrated severe accident analysis code for CANDU plant simulations that necessitates the assessment and post-processing of extensive amounts of information obtained from code run results. The MAAP-CANDU GRaphical Animation Package Extension (GRAPE) is a flexible, efficient, interactive and integrated visualization tool for analyzing plant behaviour during postulated accidents including accident management actions for single and multi-unit CANDU plants. GRAPE was developed by FAI in consultation with CNL (AECL) and CNSC from the FAI MAAP-GRAAPH code used in MAAP (LWR version). CNSC plans to use MAAP-CANDU and GRAPE as one of the tools in their Emergency Operations Centre.(author)

Individual and facility-level determinants of iron and folic acid receipt and adequate consumption among pregnant women in rural Bihar, India.

Directory of Open Access Journals (Sweden)

Amanda Wendt

Full Text Available In Bihar, India, high maternal anemia prevalence and low iron and folic acid supplement (IFA receipt and consumption have continued over time despite universal IFA distribution and counseling during pregnancy.To examine individual and facility-level determinants of IFA receipt and consumption among pregnant women in rural Bihar, India.Using District Level Household Survey (2007-08 data, multilevel modeling was conducted to examine the determinants of two outcomes: IFA receipt (any IFA receipt vs. none and IFA consumption (≥90 days vs. <90 days. Individual-level and facility-level factors were included. Factor analysis was utilized to construct antenatal care (ANC quality and health sub-center (HSC capacity variables.Overall, 37% of women received any IFA during their last pregnancy. Of those, 24% consumed IFA for 90 or more days. Women were more likely to receive any IFA when they received additional ANC services and counseling, and attended ANC earlier and more frequently. Significant interactions were found between ANC quality factors (odds ratio (OR: 0.37, 95% confidence interval (CI: 0.25, 0.56 and between ANC services and ANC timing and frequency (OR: 0.68, 95% CI: 0.56, 0.82. No HSC factors were significantly associated with IFA receipt. Women were more likely to consume IFA for ≥90 days if they attended at least 4 ANC check-ups and received more ANC services. IFA supply at the HSC (OR: 1.37, 95% CI: 1.04, 1.82 was also significantly associated with IFA consumption.Our findings indicate that individual and ANC factors (timing, frequency, and quality play a key role in facilitating IFA receipt and consumption. Although HSC capacity factors were not found to influence our outcomes, significant variation at the facility level indicates unmeasured factors that could be important to address in future interventions.

Toxicity mitigation and solidification of municipal solid waste incinerator fly ash using alkaline activated coal ash.

Science.gov (United States)

Diaz-Loya, E Ivan; Allouche, Erez N; Eklund, Sven; Joshi, Anupam R; Kupwade-Patil, Kunal

2012-08-01

Municipal solid waste (MSW) incineration is a common and effective practice to reduce the volume of solid waste in urban areas. However, the byproduct of this process is a fly ash (IFA), which contains large quantities of toxic contaminants. The purpose of this research study was to analyze the chemical, physical and mechanical behaviors resulting from the gradual introduction of IFA to an alkaline activated coal fly ash (CFA) matrix, as a mean of stabilizing the incinerator ash for use in industrial construction applications, where human exposure potential is limited. IFA and CFA were analyzed via X-ray fluorescence (XRF), X-ray diffraction (XRD) and Inductive coupled plasma (ICP) to obtain a full chemical analysis of the samples, its crystallographic characteristics and a detailed count of the eight heavy metals contemplated in US Title 40 of the Code of Federal Regulations (40 CFR). The particle size distribution of IFA and CFA was also recorded. EPA's Toxicity Characteristic Leaching Procedure (TCLP) was followed to monitor the leachability of the contaminants before and after the activation. Also images obtained via Scanning Electron Microscopy (SEM), before and after the activation, are presented. Concrete made from IFA, CFA and IFA-CFA mixes was subjected to a full mechanical characterization; tests include compressive strength, flexural strength, elastic modulus, Poisson's ratio and setting time. The leachable heavy metal contents (except for Se) were below the maximum allowable limits and in many cases even below the reporting limit. The leachable Chromium was reduced from 0.153 down to 0.0045 mg/L, Arsenic from 0.256 down to 0.132 mg/L, Selenium from 1.05 down to 0.29 mg/L, Silver from 0.011 down to .001 mg/L, Barium from 2.06 down to 0.314 mg/L and Mercury from 0.007 down to 0.001 mg/L. Although the leachable Cd exhibited an increase from 0.49 up to 0.805 mg/L and Pd from 0.002 up to 0.029 mg/L, these were well below the maximum limits of 1.00 and 5

From concatenated codes to graph codes

DEFF Research Database (Denmark)

Justesen, Jørn; Høholdt, Tom

2004-01-01

We consider codes based on simple bipartite expander graphs. These codes may be seen as the first step leading from product type concatenated codes to more complex graph codes. We emphasize constructions of specific codes of realistic lengths, and study the details of decoding by message passing...

OK432 (picibanil) efficacy in an adult with cystic cervical lymphangioma. A case report.

Science.gov (United States)

Alonso, Juan; Barbier, Luis; Alvarez, Julio; Romo, Laura; Martín, Jesús C; Arteagoitia, Iciar; Santamaría, Joseba

2005-01-01

Cervical cystic lymphangioma (CCL) is a rare and benign tumour involving congenital and cystic abnormalities derived from lymphatic vessels. The most accepted treatment continues to be surgical excision. However, when this infiltrates vital neurovascular neck structures, complete excision is difficult and if only partial, the recurrence rate is very high. The most frequently used alternative treatment is to inject sclerosants into the lesion. The use of these techniques has reported good results in children; however, there are few references thereof with regard to adults. We are reporting on a cervical cystic lymphangioma in a male aged 22, treated with an intra-lesion injection of 20 cc with 0.01 mg/cc dilution of OK-432 (picibanil) in physiological serum. Sole complications were fever and local reaction where the solution was injected. One month after treatment the lymphangioma had totally remitted and sixteen months later continues in remittance.

Prevalence of and factors associated with antenatal care seeking and adherence to recommended iron-folic acid supplementation among pregnant women in Zinder, Niger.

Science.gov (United States)

Begum, Khadija; Ouédraogo, Césaire T; Wessells, K Ryan; Young, Rebecca R; Faye, M Thierno; Wuehler, Sara E; Hess, Sonja Y

2018-02-01

The World Health Organization recommends iron and folic acid (IFA) supplementation for pregnant women. The high prevalence of anaemia among pregnant women in Niger warrants better understanding of the utilization of antenatal care (ANC) and IFA. We aimed to assess the prevalence of and factors associated with ANC coverage and adherence to IFA recommendation among pregnant women. Pregnant women (n = 923) from 64 randomly selected villages within the catchment area of 12 health centres were interviewed during a baseline household survey in Zinder, Niger. ANC and IFA coverage were 60.1% and 43.6%, respectively. Only 71.7% of women who attended ANC received IFA. Of the 401 women who reportedly received any IFA supplements, 99.3% had attended any ANC during their current pregnancy and 68.6% reported adherence to recommended IFA supplementation (i.e., consumed IFA every day in the previous week). Women with gestational age ≥27 weeks were more likely to have attended ANC than women with gestational age ANC were more likely to attend ANC (OR: 1.48, 95% CI [1.03, 2.11]) and adhere to IFA recommendations (OR: 1.80, 95% CI [1.04, 3.13]) compared to those who did not receive any advice. ANC attendance is crucial to ensure distribution of IFA supplementation among pregnant women in Zinder. Interventions to improve ANC and IFA adherence will require promotion of early ANC, ensure availability of IFA at ANC, and involve husbands in ANC. © 2018 John Wiley & Sons Ltd.

International standard problem (ISP) No. 41. Containment iodine computer code exercise based on a radioiodine test facility (RTF) experiment

International Nuclear Information System (INIS)

2000-04-01

International Standard Problem (ISP) exercises are comparative exercises in which predictions of different computer codes for a given physical problem are compared with each other or with the results of a carefully controlled experimental study. The main goal of ISP exercises is to increase confidence in the validity and accuracy of the tools, which were used in assessing the safety of nuclear installations. Moreover, they enable code users to gain experience and demonstrate their competence. The ISP No. 41 exercise, computer code exercise based on a Radioiodine Test Facility (RTF) experiment on iodine behaviour in containment under severe accident conditions, is one of such ISP exercises. The ISP No. 41 exercise was borne at the recommendation at the Fourth Iodine Chemistry Workshop held at PSI, Switzerland in June 1996: 'the performance of an International Standard Problem as the basis of an in-depth comparison of the models as well as contributing to the database for validation of iodine codes'. [Proceedings NEA/CSNI/R(96)6, Summary and Conclusions NEA/CSNI/R(96)7]. COG (CANDU Owners Group), comprising AECL and the Canadian nuclear utilities, offered to make the results of a Radioiodine Test Facility (RTF) test available for such an exercise. The ISP No. 41 exercise was endorsed in turn by the FPC (PWG4's Task Group on Fission Product Phenomena in the Primary Circuit and the Containment), PWG4 (CSNI Principal Working Group on the Confinement of Accidental Radioactive Releases), and the CSNI. The OECD/NEA Committee on the Safety of Nuclear Installations (CSNI) has sponsored forty-five ISP exercises over the last twenty-four years, thirteen of them in the area of severe accidents. The criteria for the selection of the RTF test as a basis for the ISP-41 exercise were; (1) complementary to other RTF tests available through the PHEBUS and ACE programmes, (2) simplicity for ease of modelling and (3) good quality data. A simple RTF experiment performed under controlled

Toric Varieties and Codes, Error-correcting Codes, Quantum Codes, Secret Sharing and Decoding

DEFF Research Database (Denmark)

Hansen, Johan Peder

We present toric varieties and associated toric codes and their decoding. Toric codes are applied to construct Linear Secret Sharing Schemes (LSSS) with strong multiplication by the Massey construction. Asymmetric Quantum Codes are obtained from toric codes by the A.R. Calderbank P.W. Shor and A.......M. Steane construction of stabilizer codes (CSS) from linear codes containing their dual codes....

Assessment of genetic mutations in the XRCC2 coding region by high resolution melting curve analysis and the risk of differentiated thyroid carcinoma in Iran

Directory of Open Access Journals (Sweden)

Shima Fayaz

2012-01-01

Full Text Available Homologous recombination (HR is the major pathway for repairing double strand breaks (DSBs in eukaryotes and XRCC2 is an essential component of the HR repair machinery. To evaluate the potential role of mutations in gene repair by HR in individuals susceptible to differentiated thyroid carcinoma (DTC we used high resolution melting (HRM analysis, a recently introduced method for detecting mutations, to examine the entire XRCC2 coding region in an Iranian population. HRM analysis was used to screen for mutations in three XRCC2 coding regions in 50 patients and 50 controls. There was no variation in the HRM curves obtained from the analysis of exons 1 and 2 in the case and control groups. In exon 3, an Arg188His polymorphism (rs3218536 was detected as a new melting curve group (OR: 1.46; 95%CI: 0.432-4.969; p = 0.38 compared with the normal melting curve. We also found a new Ser150Arg polymorphism in exon 3 of the control group. These findings suggest that genetic variations in the XRCC2 coding region have no potential effects on susceptibility to DTC. However, further studies with larger populations are required to confirm this conclusion.

Automatic coding method of the ACR Code

International Nuclear Information System (INIS)

Park, Kwi Ae; Ihm, Jong Sool; Ahn, Woo Hyun; Baik, Seung Kook; Choi, Han Yong; Kim, Bong Gi

1993-01-01

The authors developed a computer program for automatic coding of ACR(American College of Radiology) code. The automatic coding of the ACR code is essential for computerization of the data in the department of radiology. This program was written in foxbase language and has been used for automatic coding of diagnosis in the Department of Radiology, Wallace Memorial Baptist since May 1992. The ACR dictionary files consisted of 11 files, one for the organ code and the others for the pathology code. The organ code was obtained by typing organ name or code number itself among the upper and lower level codes of the selected one that were simultaneous displayed on the screen. According to the first number of the selected organ code, the corresponding pathology code file was chosen automatically. By the similar fashion of organ code selection, the proper pathologic dode was obtained. An example of obtained ACR code is '131.3661'. This procedure was reproducible regardless of the number of fields of data. Because this program was written in 'User's Defined Function' from, decoding of the stored ACR code was achieved by this same program and incorporation of this program into program in to another data processing was possible. This program had merits of simple operation, accurate and detail coding, and easy adjustment for another program. Therefore, this program can be used for automation of routine work in the department of radiology

Prospecting for success in the American market

International Nuclear Information System (INIS)

Thomas, Ron.

1992-01-01

AECL Technologies is a US subsidiary of AECL originally set up to obtain licensing of CANDU reactors in the US, as well as to market technology. AECL Technologies has been successful in marketing digital control technology and software development, and also design and consulting services. Dry storage of spent fuel represents a large future opportunity. AECL hopes to sell CANDU reactors in the USA after the turn of the century. AECL Technologies did about $4.2 million worth of business in 1991

Annual report 1993-1994

Energy Technology Data Exchange (ETDEWEB)

NONE

1994-12-31

Established in 1952 as a Crown corporation, AECL reports to Parliament through the Ministry of Natural Resources. Its mandate is to undertake research into nuclear energy and prepare and develop its commercial applications. AECL`s mission is to secure the maximum economic benefit for Canada from CANDU technology and associated research and development - the CANDU business. AECL`s accomplishments include the development of products and services which, through diligent marketing efforts, are now in use worldwide. The corporation`s world-renowned flagship product, the CANDU reactor, currently satisfies 16% of Canada`s electricity requirements and is a key component of the energy programs in five other countries. AECL`s vision over the next 20 years is to: be a world-leading supplier of full-scope nuclear power capability; be a long-term business with at least a quarter share of the emerging global market for the next generation of nuclear power plants; have a comprehensive ongoing research program to: maintain at the highest levels the performance and safety of operating CANDU plants; advance the CANDU technology and the science that underlies it; develop knowledge on the health effects of radiation and on the safety and environmental impacts of nuclear reactor operation. AECL currently employees 4000 people. With headquarters in Ottawa, AECL operates two research laboratories, one in Ontario and one in Manitoba, and engineering and design offices in Ontario, Quebec, Saskatchewan, and New Brunswick, as well as offices abroad. AECL has a subsidiary, AECL Technologies Inc., situated in Washington, DC.

Coding in pigeons: Multiple-coding versus single-code/default strategies.

Science.gov (United States)

Pinto, Carlos; Machado, Armando

2015-05-01

To investigate the coding strategies that pigeons may use in a temporal discrimination tasks, pigeons were trained on a matching-to-sample procedure with three sample durations (2s, 6s and 18s) and two comparisons (red and green hues). One comparison was correct following 2-s samples and the other was correct following both 6-s and 18-s samples. Tests were then run to contrast the predictions of two hypotheses concerning the pigeons' coding strategies, the multiple-coding and the single-code/default. According to the multiple-coding hypothesis, three response rules are acquired, one for each sample. According to the single-code/default hypothesis, only two response rules are acquired, one for the 2-s sample and a "default" rule for any other duration. In retention interval tests, pigeons preferred the "default" key, a result predicted by the single-code/default hypothesis. In no-sample tests, pigeons preferred the key associated with the 2-s sample, a result predicted by multiple-coding. Finally, in generalization tests, when the sample duration equaled 3.5s, the geometric mean of 2s and 6s, pigeons preferred the key associated with the 6-s and 18-s samples, a result predicted by the single-code/default hypothesis. The pattern of results suggests the need for models that take into account multiple sources of stimulus control. © Society for the Experimental Analysis of Behavior.

Code Cactus; Code Cactus

Energy Technology Data Exchange (ETDEWEB)

Fajeau, M; Nguyen, L T; Saunier, J [Commissariat a l' Energie Atomique, Centre d' Etudes Nucleaires de Saclay, 91 - Gif-sur-Yvette (France)

1966-09-01

This code handles the following problems: -1) Analysis of thermal experiments on a water loop at high or low pressure; steady state or transient behavior; -2) Analysis of thermal and hydrodynamic behavior of water-cooled and moderated reactors, at either high or low pressure, with boiling permitted; fuel elements are assumed to be flat plates: - Flowrate in parallel channels coupled or not by conduction across plates, with conditions of pressure drops or flowrate, variable or not with respect to time is given; the power can be coupled to reactor kinetics calculation or supplied by the code user. The code, containing a schematic representation of safety rod behavior, is a one dimensional, multi-channel code, and has as its complement (FLID), a one-channel, two-dimensional code. (authors) [French] Ce code permet de traiter les problemes ci-dessous: 1. Depouillement d'essais thermiques sur boucle a eau, haute ou basse pression, en regime permanent ou transitoire; 2. Etudes thermiques et hydrauliques de reacteurs a eau, a plaques, a haute ou basse pression, ebullition permise: - repartition entre canaux paralleles, couples on non par conduction a travers plaques, pour des conditions de debit ou de pertes de charge imposees, variables ou non dans le temps; - la puissance peut etre couplee a la neutronique et une representation schematique des actions de securite est prevue. Ce code (Cactus) a une dimension d'espace et plusieurs canaux, a pour complement Flid qui traite l'etude d'un seul canal a deux dimensions. (auteurs)

Research on calculation of mixing fraction for natural uranium equivalent fuel

International Nuclear Information System (INIS)

Huang Shien; Wang Lianjie; Wei Yanqin; Li Qing; Zheng Jiye

2013-01-01

Based on the first-order perturbation theory and reasonable approximations, the calculation method of recycled uranium (RU) and depleted uranium (DU) mixing fraction for natural uranium equivalent (NUE) fuel was studied, so the equivalence between NUE fuel and natural uranium (NU) fuel was assured. The adopted calculation method accurately takes the variation of micro cross sections alone with fuel depletion into account. A computer code named ALPHA was programmed to execute the calculation procedure. Then the ALPHA code and the WIMS-AECL code compose a processing system, which is applicable to the mixing fraction calculation for heavy water reactor NUE fuel. The validation shows that the processing system can accurately calculate the mixing fraction for NUE fuel. (authors)

Optimization of the fuel assembly for the Canadian Supercritical Water-cooled Reactor (SCWR)

Energy Technology Data Exchange (ETDEWEB)

French, C.; Bonin, H.; Chan, P., E-mail: Corey.French@rmc.ca [Royal Military College of Canada, Dept. of Chemistry and Chemical Engineering, Kingston, Ontario (Canada)

2013-07-01

A parametric optimization of the Canadian Supercritical Water-cooled Reactor (SCWR) lattice geometry and fresh fuel content is performed in this work. With the potential to improve core physics and performance, significant gains to operating and safety margins could be achieved through slight progressions. The fuel performance codes WIMS-AECL and SERPENT are used to calculate performance factors, and use them as inputs to an optimization algorithm. (author)

Clinical response, drug survival and predictors thereof in 432 patients with ankylosing spondylitis switching anti tumor necrosis factor α therapy: Results from the Danish nationwide Danbio registry

DEFF Research Database (Denmark)

Glintborg, Bente; Østergaard, Mikkel; Krogh, N.

2012-01-01

, 432 patients (30%) switched to a second and 137 (10%) to a third biological drug. Compared with non-switchers, switchers were more frequently women (33%/22%), had shorter disease duration (3 years/5 years) and higher BASDAI (62(52-76) mm/56(43-69) mm (median(interquartile-range))), Bath AS Functional...

Evaluation Codes from an Affine Veriety Code Perspective

DEFF Research Database (Denmark)

Geil, Hans Olav

2008-01-01

Evaluation codes (also called order domain codes) are traditionally introduced as generalized one-point geometric Goppa codes. In the present paper we will give a new point of view on evaluation codes by introducing them instead as particular nice examples of affine variety codes. Our study...... includes a reformulation of the usual methods to estimate the minimum distances of evaluation codes into the setting of affine variety codes. Finally we describe the connection to the theory of one-pointgeometric Goppa codes. Contents 4.1 Introduction...... . . . . . . . . . . . . . . . . . . . . . . . 171 4.9 Codes form order domains . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173 4.10 One-point geometric Goppa codes . . . . . . . . . . . . . . . . . . . . . . . . 176 4.11 Bibliographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 178 References...

Identifying bottlenecks in the iron and folic acid supply chain in Bihar, India: a mixed-methods study.

Science.gov (United States)

Wendt, Amanda S; Stephenson, Rob; Young, Melissa F; Verma, Pankaj; Srikantiah, Sridhar; Webb-Girard, Amy; Hogue, Carol J; Ramakrishnan, Usha; Martorell, Reynaldo

2018-04-12

Maternal anaemia prevalence in Bihar, India remains high despite government mandated iron supplementation targeting pregnant women. Inadequate supply has been identified as a potential barrier to iron and folic acid (IFA) receipt. Our study objective was to examine the government health system's IFA supply and distribution system and identify bottlenecks contributing to insufficient IFA supply. Primary data collection was conducted in November 2011 and July 2012 across 8 districts in Bihar, India. A cross-sectional, observational, mixed methods approach was utilized. Auxiliary Nurse Midwives were surveyed on current IFA supply and practices. In-depth interviews (n = 59) were conducted with health workers at state, district, block, health sub-centre, and village levels. Overall, 44% of Auxiliary Nurse Midwives were out of IFA stock. Stock levels and supply chain practices varied greatly across districts. Qualitative data revealed specific bottlenecks impacting IFA forecasting, procurement, storage, disposal, lack of personnel, and few training opportunities for key players in the supply chain. Inadequate IFA supply is a major constraint to the IFA supplementation program, the extent of which varies widely across districts. Improvements at all levels of infrastructure, practices, and effective monitoring will be critical to strengthen the IFA supply chain in Bihar.

The Effect of Intermittent Antenatal Iron Supplementation on Maternal and Infant Outcomes in Rural Viet Nam: A Cluster Randomised Trial

Science.gov (United States)

Hanieh, Sarah; Ha, Tran T.; Simpson, Julie A.; Casey, Gerard J.; Khuong, Nguyen C.; Thoang, Dang D.; Thuy, Tran T.; Pasricha, Sant-Rayn; Tran, Thach D.; Tuan, Tran; Dwyer, Terence; Fisher, Jane; Biggs, Beverley-Ann

2013-01-01

Background Anemia affects over 500 million women, and in pregnancy is associated with impaired maternal and infant outcomes. Intermittent antenatal iron supplementation is an attractive alternative to daily dosing; however, the impact of this strategy on infant outcomes remains unclear. We compared the effect of intermittent antenatal iron supplementation with daily iron supplementation on maternal and infant outcomes in rural Viet Nam. Methods and Findings This cluster randomised trial was conducted in Ha Nam province, Viet Nam. 1,258 pregnant women (<16 wk gestation) in 104 communes were assigned to daily iron–folic acid (IFA), twice weekly IFA, or twice weekly multiple micronutrient (MMN) supplementation. Primary outcome was birth weight. Mean birth weight was 3,148 g (standard deviation 416). There was no difference in the birth weights of infants of women receiving twice weekly IFA compared to daily IFA (mean difference [MD] 28 g; 95% CI −22 to 78), or twice weekly MMN compared to daily IFA (MD −36.8 g; 95% CI −82 to 8.2). At 32 wk gestation, maternal ferritin was lower in women receiving twice weekly IFA compared to daily IFA (geometric mean ratio 0.73; 95% CI 0.67 to 0.80), and in women receiving twice weekly MMN compared to daily IFA (geometric mean ratio 0.62; 95% CI 0.57 to 0.68), but there was no difference in hemoglobin levels. Infants of mothers who received twice weekly IFA had higher cognitive scores at 6 mo of age compared to those who received daily IFA (MD 1.89; 95% CI 0.23 to 3.56). Conclusions Twice weekly antenatal IFA or MMN did not produce a clinically important difference in birth weight, when compared to daily IFA supplementation. The significant improvement in infant cognitive outcomes at 6 mo of age following twice weekly antenatal IFA requires further exploration, and provides additional support for the use of intermittent, rather than daily, antenatal IFA in populations with low rates of iron deficiency. Trial registration

An Optimal Linear Coding for Index Coding Problem

OpenAIRE

Pezeshkpour, Pouya

2015-01-01

An optimal linear coding solution for index coding problem is established. Instead of network coding approach by focus on graph theoric and algebraic methods a linear coding program for solving both unicast and groupcast index coding problem is presented. The coding is proved to be the optimal solution from the linear perspective and can be easily utilize for any number of messages. The importance of this work is lying mostly on the usage of the presented coding in the groupcast index coding ...

Annual report 1994-1995

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-12-31

Established in 1952 as a Crown corporation, AECL reports to Parliament through the Ministry of Natural Resources. Its mandate is to undertake research into nuclear energy and prepare and develop its commercial applications. AECL`s objective is to secure the maximum economic benefit for Canada from CANDU technology and the associated research and development. AECL`s accomplishments include the development of products and services which are now in use worldwide. The corporation`s world-renowned flagship product, the CANDU reactor, supplies almost one-fifth of Canada`s electricity requirements and is an important component of the energy programs in five other countries. Building upon these achievements, AECL continues to consolidate its position as a world-leading supplies of full-scope nuclear power capabilities with expectations to capture a substantial share of the emerging global nuclear power market. The immediate goals are to meet the customers` requirements in the delivery of current projects, to ensure that operating CANDU stations continue to maintain a high level of performance, to secure further CANDU sales, to garner increased revenues from further commercialization of CANDU technology, and to serve the Government of Canada`s nuclear policy initiatives. AECL currently employs 3900 people in a variety of locations, including two major research laboratories located in Ontario and Manitoba, as well as business, engineering and design offices in Ottawa, Toronto, Montreal, Saskatoon and Fredericton. AECL has two subsidiaries, AECL Technologies Inc., in Washington, DC, and AECL Technologies B.V., in the Hague, Netherlands, and maintains a significant presence in South Korea, as well as several smaller offices in other countries.

RODOS - The domestic counterpart

International Nuclear Information System (INIS)

Vamanu, Dan V.

1999-01-01

One term of reference for validly teaming up with Project RODOS (Real-Time-On-Line Decision Support System for Nuclear Emergencies in Europe) is to institutionally - contribute research initiatives geared towards emulating the RODOS functions on novel conceptual pathways, expand system's coverage of issues that are relevant in a nuclear crisis management and bring in a domestic perspective on how the system may best perform in each and every national - i.e. legal, managerial, logistic and cultural environment. On this line, one reviews the approach taken in the IFIN-HH RODOS Group to address the challenge, as well a number of representative outputs. These include: i) A phase-one, pre-RODOS, period (1990 - 1994), involving topical field orientation, feasibility demonstrations and expertise acquisition by hands-on training in environmental radiology modeling and DSS code development, the resulting products - codes in the 'APUD' and 'ACA-IFA' family, including custom versions developed by appointment of the IAEA Safety Section and AECL-Research, Ontario, Canada - being favourably reviewed by the NEA/OECD Data Bank; ii) A phase-two, upgrading and consolidation period (1994 -1996), assisted by the IAEA fellowship system and the US Government via the Nuclear Regulatory Commission in Washington, D.C, having on record an effective participation in the development of the US NRC, EPA, and DOE's 'FRMAC Assessment Manual - The Federal manual for Assessing Environmental Data during a Radiological Emergency', and the 'RTM-95 International Technical Response Manual', and the research initiative of developing a software support for the manuals' implementation - the codes 'ROBOT' (Rule-Oriented Basic Operational Tool); iii) A phase-three period (1996 - ), evolving within the RODOS framework and featuring, inter alia: (a) the application of the ROBOT concept in the development of a standalone software platform, code-named NOTEPAD for DSS support in field operations, nuclear accident

A DRAGON-MCNP comparison of void reactivity calculations

Energy Technology Data Exchange (ETDEWEB)

Marleau, G [Ecole Polytechnique, Montreal, PQ (Canada). Inst. de Genie Nucleaire; Milgram, M S [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)

1996-12-31

The determination of the reactivity coefficients associated with coolant voiding in a CANDU reactor is a subject which has attracted a large amount of interest in the last few years both from the theoretical and experimental point of view. One expects that deterministic codes such as DRAGON and WIMS-AECL or the MCNP4 Monte Carlo code should be able to adequately simulate the cell behaviour upon coolant voiding. However, the absence of an experimental database at equilibrium and discharge burnups has not permitted the full validation of any of these lattice codes, although a partial validation through comparison of two different computer codes has been considered. Here we present a comparison between DRAGON and MCNP4 of the void reactivity evaluation for fresh fuel. (author). 16 refs., 5 tabs.

A DRAGON-MCNP comparison of void reactivity calculations

International Nuclear Information System (INIS)

Marleau, G.

1995-01-01

The determination of the reactivity coefficients associated with coolant voiding in a CANDU reactor is a subject which has attracted a large amount of interest in the last few years both from the theoretical and experimental point of view. One expects that deterministic codes such as DRAGON and WIMS-AECL or the MCNP4 Monte Carlo code should be able to adequately simulate the cell behaviour upon coolant voiding. However, the absence of an experimental database at equilibrium and discharge burnups has not permitted the full validation of any of these lattice codes, although a partial validation through comparison of two different computer codes has been considered. Here we present a comparison between DRAGON and MCNP4 of the void reactivity evaluation for fresh fuel. (author). 16 refs., 5 tabs

DRAGON analysis of MOX fueled VVER cell benchmarks

International Nuclear Information System (INIS)

Marleau, G.; Foissac, F.

2002-01-01

The computational unit-cell benchmarks problems for LEU and MOX fueled VVER-1000 ('water-water energetic reactor') have been analyzed using the code DRAGON with ENDF/B-V and ENDF/B-VI based WIMS-AECL cross section libraries. The results obtained were compared with those generated using the SAS2H module of the SCALE-4.3 computational code system and with the code HELIOS. Good agreements between DRAGON and HELIOS were obtained when the ENDF/B-VI based library was considered while the ENDF/B-V DRAGON results were generally closer to those obtained using SAS2H. This study was useful for the verification of the DRAGON code and confirms that HELIOS and DRAGON have a similar behavior when compatible cross sections library are used. (author)

Technology transfer from Canadian nuclear laboratories

International Nuclear Information System (INIS)

MacDonald, R.D.; Evans, W.; MacEwan, J.R.; Melvin, J.G.

1985-09-01

Canada has developed a unique nuclear power system, the CANDU reactor. AECL - Research Company (AECL-RC) has played a key role in the CANDU program by supplying its technology to the reactor's designers, constructors and operators. This technology was transferred from our laboratories to our sister AECL companies and to domestic industries and utilities. As CANDUs were built overseas, AECL-RC made its technology available to foreign utilities and agencies. Recently the company has embarked on a new transfer program, commercial R and D for nuclear and non-nuclear customers. During the years of CANDU development, AECL-RC has acquired the skills and technology that are especially valuable to other countries embarking on their own nuclear programs. This report describes AECL-RC's thirty years' experience with the transfer of technology

The Effect of Different Attentional Focus Instructions during Finger Movement Tasks in Healthy Subjects: An Exploratory Study

Directory of Open Access Journals (Sweden)

Giacomo Rossettini

2017-01-01

Full Text Available External focus of attention (EFA and internal focus of attention (IFA represent commonly used strategies to instruct subjects during exercise. Several studies showed EFA to be more effective than IFA to improve motor performance and learning. To date the role of these strategies on motor performance during finger movement was less studied. The objective of the study was to investigate motor performance, patient’s preference induced by IFA and EFA, and the focus during control condition. Ten healthy right-handed participants performed a finger movement task in control, EFA, and IFA conditions (counterbalanced. Errors, patient’s preference, and type of attentional focus spontaneously adopted during the control condition were recorded. EFA determined less error (p<0.01 compared to control and IFA. Participants preferred EFA against IFA and control condition. In the control group 10% of subjects adopted a purely EFA, 70% of subjects adopted a purely IFA, and 20% of subjects adopted a mixture of the two foci. Our results confirm that EFA is more effective than IFA and control in finger movement task. Due its clinical relevance, the interaction between attention and finger movement should be further investigated.

AECL's use of FMEA and OPEX for field service tooling and process development, implementation and improvement: a model for the future

International Nuclear Information System (INIS)

Cox, E.; Dam, R.F.; Wilson, E.

2008-01-01

Failure Modes and Effects Analysis (FMEA) is a systematic and rigorous process applied to new or complex systems to predict system failures and assist with the development of mitigating strategies. The process is especially beneficial when applied to higher-risk applications such as nuclear systems. FMEA may be used for design verification and maintenance program development. For field service tooling, FMEA is complimented well by operating experience (OPEX) and continuous improvement initiatives. FMEA is generally conducted while developing systems and processes to ensure safe and successful implementation, while OPEX is fed back into the system design and operation to improve those systems and processes for subsequent field applications. This paper will explore these techniques as they have been applied to AECL's CANDUclean system. The portable CANDUclean system is employed to mechanically clean the inside of steam generator (SG) tubes in CANDU nuclear power plants. During normal plant operation, the steam generator tubes in the heat transport system develop a build-up of magnetite on their internal diameter, which decreases heat transfer efficiency, impedes SG maintenance activities and increases the radiation fields in and around the boilers. As part of a regular plant aging management routine, the CANDUclean system is used to remove the magnetite layers. The nature of this work includes risks to personnel safety, however by continually applying FMEA and other improvement initiatives, safety and system effectiveness are maximized. This paper will provide an overview of the integrated continuous improvement approach applied to the CANDUclean system and consider the value of strategies when applied to field service tooling and CANDU systems. (author)

Randomized controlled study on the effect of adjuvant immunotherapy with OK-432 on malignant gliomas

International Nuclear Information System (INIS)

Shibata, Shobu; Mori, Kazuo; Moriyama, Tadayoshi; Tanaka, Keisei; Moroki, Jiro.

1985-01-01

During periods from January, 1981 to December, 1983, 51 patients (31 malignant astrocytomas, 17 glioblastomas, and others 3) were treated with radiochemotherapy using Nimustine hydrochloride, ACNU (group B) and radiochemoimmunotherapy with Picibanil, OK-432 (group A) by randomized controlled study. Group A consisted of 24 patients and group B of 27 patients. The differences in the background of the two groups were not statistically significant. Survival curves of both groups were shown by the Kaplan-Meier method. The postoperative survival rate at 1 year and 2 years were 70 % and 30 %, respectively, equal in both groups, and the differences between groups A and B were not statistically significant by the Cox-Mantel test. The side effects by group B therapy were most prominent in the bone marrow, and severe leukopenia occurred. However, group A therapy suppressed leukopenia after 2 months. Immunological parameters, such as purified protein derivative skin reaction test did not change, but streptococcal Su-polysaccharide skin reaction test became positive after group A therapy. (author)

Rate-adaptive BCH codes for distributed source coding

DEFF Research Database (Denmark)

Salmistraro, Matteo; Larsen, Knud J.; Forchhammer, Søren

2013-01-01

This paper considers Bose-Chaudhuri-Hocquenghem (BCH) codes for distributed source coding. A feedback channel is employed to adapt the rate of the code during the decoding process. The focus is on codes with short block lengths for independently coding a binary source X and decoding it given its...... strategies for improving the reliability of the decoded result are analyzed, and methods for estimating the performance are proposed. In the analysis, noiseless feedback and noiseless communication are assumed. Simulation results show that rate-adaptive BCH codes achieve better performance than low...... correlated side information Y. The proposed codes have been analyzed in a high-correlation scenario, where the marginal probability of each symbol, Xi in X, given Y is highly skewed (unbalanced). Rate-adaptive BCH codes are presented and applied to distributed source coding. Adaptive and fixed checking...

Self-complementary circular codes in coding theory.

Science.gov (United States)

Fimmel, Elena; Michel, Christian J; Starman, Martin; Strüngmann, Lutz

2018-04-01

Self-complementary circular codes are involved in pairing genetic processes. A maximal [Formula: see text] self-complementary circular code X of trinucleotides was identified in genes of bacteria, archaea, eukaryotes, plasmids and viruses (Michel in Life 7(20):1-16 2017, J Theor Biol 380:156-177, 2015; Arquès and Michel in J Theor Biol 182:45-58 1996). In this paper, self-complementary circular codes are investigated using the graph theory approach recently formulated in Fimmel et al. (Philos Trans R Soc A 374:20150058, 2016). A directed graph [Formula: see text] associated with any code X mirrors the properties of the code. In the present paper, we demonstrate a necessary condition for the self-complementarity of an arbitrary code X in terms of the graph theory. The same condition has been proven to be sufficient for codes which are circular and of large size [Formula: see text] trinucleotides, in particular for maximal circular codes ([Formula: see text] trinucleotides). For codes of small-size [Formula: see text] trinucleotides, some very rare counterexamples have been constructed. Furthermore, the length and the structure of the longest paths in the graphs associated with the self-complementary circular codes are investigated. It has been proven that the longest paths in such graphs determine the reading frame for the self-complementary circular codes. By applying this result, the reading frame in any arbitrary sequence of trinucleotides is retrieved after at most 15 nucleotides, i.e., 5 consecutive trinucleotides, from the circular code X identified in genes. Thus, an X motif of a length of at least 15 nucleotides in an arbitrary sequence of trinucleotides (not necessarily all of them belonging to X) uniquely defines the reading (correct) frame, an important criterion for analyzing the X motifs in genes in the future.

Diagonal Eigenvalue Unity (DEU) code for spectral amplitude coding-optical code division multiple access

Science.gov (United States)

Ahmed, Hassan Yousif; Nisar, K. S.

2013-08-01

Code with ideal in-phase cross correlation (CC) and practical code length to support high number of users are required in spectral amplitude coding-optical code division multiple access (SAC-OCDMA) systems. SAC systems are getting more attractive in the field of OCDMA because of its ability to eliminate the influence of multiple access interference (MAI) and also suppress the effect of phase induced intensity noise (PIIN). In this paper, we have proposed new Diagonal Eigenvalue Unity (DEU) code families with ideal in-phase CC based on Jordan block matrix with simple algebraic ways. Four sets of DEU code families based on the code weight W and number of users N for the combination (even, even), (even, odd), (odd, odd) and (odd, even) are constructed. This combination gives DEU code more flexibility in selection of code weight and number of users. These features made this code a compelling candidate for future optical communication systems. Numerical results show that the proposed DEU system outperforms reported codes. In addition, simulation results taken from a commercial optical systems simulator, Virtual Photonic Instrument (VPI™) shown that, using point to multipoint transmission in passive optical network (PON), DEU has better performance and could support long span with high data rate.

List Decoding of Matrix-Product Codes from nested codes: an application to Quasi-Cyclic codes

DEFF Research Database (Denmark)

Hernando, Fernando; Høholdt, Tom; Ruano, Diego

2012-01-01

A list decoding algorithm for matrix-product codes is provided when $C_1,..., C_s$ are nested linear codes and $A$ is a non-singular by columns matrix. We estimate the probability of getting more than one codeword as output when the constituent codes are Reed-Solomon codes. We extend this list...... decoding algorithm for matrix-product codes with polynomial units, which are quasi-cyclic codes. Furthermore, it allows us to consider unique decoding for matrix-product codes with polynomial units....

Coding Partitions

Directory of Open Access Journals (Sweden)

Fabio Burderi

2007-05-01

Full Text Available Motivated by the study of decipherability conditions for codes weaker than Unique Decipherability (UD, we introduce the notion of coding partition. Such a notion generalizes that of UD code and, for codes that are not UD, allows to recover the ``unique decipherability" at the level of the classes of the partition. By tacking into account the natural order between the partitions, we define the characteristic partition of a code X as the finest coding partition of X. This leads to introduce the canonical decomposition of a code in at most one unambiguouscomponent and other (if any totally ambiguouscomponents. In the case the code is finite, we give an algorithm for computing its canonical partition. This, in particular, allows to decide whether a given partition of a finite code X is a coding partition. This last problem is then approached in the case the code is a rational set. We prove its decidability under the hypothesis that the partition contains a finite number of classes and each class is a rational set. Moreover we conjecture that the canonical partition satisfies such a hypothesis. Finally we consider also some relationships between coding partitions and varieties of codes.

Combinatorial neural codes from a mathematical coding theory perspective.

Science.gov (United States)

Curto, Carina; Itskov, Vladimir; Morrison, Katherine; Roth, Zachary; Walker, Judy L

2013-07-01

Shannon's seminal 1948 work gave rise to two distinct areas of research: information theory and mathematical coding theory. While information theory has had a strong influence on theoretical neuroscience, ideas from mathematical coding theory have received considerably less attention. Here we take a new look at combinatorial neural codes from a mathematical coding theory perspective, examining the error correction capabilities of familiar receptive field codes (RF codes). We find, perhaps surprisingly, that the high levels of redundancy present in these codes do not support accurate error correction, although the error-correcting performance of receptive field codes catches up to that of random comparison codes when a small tolerance to error is introduced. However, receptive field codes are good at reflecting distances between represented stimuli, while the random comparison codes are not. We suggest that a compromise in error-correcting capability may be a necessary price to pay for a neural code whose structure serves not only error correction, but must also reflect relationships between stimuli.

LDGM Codes for Channel Coding and Joint Source-Channel Coding of Correlated Sources

Directory of Open Access Journals (Sweden)

Javier Garcia-Frias

2005-05-01

Full Text Available We propose a coding scheme based on the use of systematic linear codes with low-density generator matrix (LDGM codes for channel coding and joint source-channel coding of multiterminal correlated binary sources. In both cases, the structures of the LDGM encoder and decoder are shown, and a concatenated scheme aimed at reducing the error floor is proposed. Several decoding possibilities are investigated, compared, and evaluated. For different types of noisy channels and correlation models, the resulting performance is very close to the theoretical limits.

Software Certification - Coding, Code, and Coders

Science.gov (United States)

Havelund, Klaus; Holzmann, Gerard J.

2011-01-01

We describe a certification approach for software development that has been adopted at our organization. JPL develops robotic spacecraft for the exploration of the solar system. The flight software that controls these spacecraft is considered to be mission critical. We argue that the goal of a software certification process cannot be the development of "perfect" software, i.e., software that can be formally proven to be correct under all imaginable and unimaginable circumstances. More realistically, the goal is to guarantee a software development process that is conducted by knowledgeable engineers, who follow generally accepted procedures to control known risks, while meeting agreed upon standards of workmanship. We target three specific issues that must be addressed in such a certification procedure: the coding process, the code that is developed, and the skills of the coders. The coding process is driven by standards (e.g., a coding standard) and tools. The code is mechanically checked against the standard with the help of state-of-the-art static source code analyzers. The coders, finally, are certified in on-site training courses that include formal exams.

Discussion on LDPC Codes and Uplink Coding

Science.gov (United States)

Andrews, Ken; Divsalar, Dariush; Dolinar, Sam; Moision, Bruce; Hamkins, Jon; Pollara, Fabrizio

2007-01-01

This slide presentation reviews the progress that the workgroup on Low-Density Parity-Check (LDPC) for space link coding. The workgroup is tasked with developing and recommending new error correcting codes for near-Earth, Lunar, and deep space applications. Included in the presentation is a summary of the technical progress of the workgroup. Charts that show the LDPC decoder sensitivity to symbol scaling errors are reviewed, as well as a chart showing the performance of several frame synchronizer algorithms compared to that of some good codes and LDPC decoder tests at ESTL. Also reviewed is a study on Coding, Modulation, and Link Protocol (CMLP), and the recommended codes. A design for the Pseudo-Randomizer with LDPC Decoder and CRC is also reviewed. A chart that summarizes the three proposed coding systems is also presented.

New quantum codes constructed from quaternary BCH codes

Science.gov (United States)

Xu, Gen; Li, Ruihu; Guo, Luobin; Ma, Yuena

2016-10-01

In this paper, we firstly study construction of new quantum error-correcting codes (QECCs) from three classes of quaternary imprimitive BCH codes. As a result, the improved maximal designed distance of these narrow-sense imprimitive Hermitian dual-containing quaternary BCH codes are determined to be much larger than the result given according to Aly et al. (IEEE Trans Inf Theory 53:1183-1188, 2007) for each different code length. Thus, families of new QECCs are newly obtained, and the constructed QECCs have larger distance than those in the previous literature. Secondly, we apply a combinatorial construction to the imprimitive BCH codes with their corresponding primitive counterpart and construct many new linear quantum codes with good parameters, some of which have parameters exceeding the finite Gilbert-Varshamov bound for linear quantum codes.

Discharge Burnup Evaluation of Natural Uranium Loaded CANFLEX-43 Fuel Bundle

International Nuclear Information System (INIS)

Roh, Gyu Hong; Kim, Yong Hee; Kim, Won Young; Park, Joo Hwan

2009-11-01

Using WIMS-AECL code, which is 2-dimensional lattice core used in CANDU physics calculation, the discharge burnup of the natural uranium loaded CANFLEX-43 fuel bundle was evaluated by comparing the discharge burnup of standard 37 element fuel bundle. When the discharge burnup of the standard 37 element fuel is 7,200 MWd/MTU, that of the CANFLEX 43 fuel bundle was evaluated as 7,077 MWd/MTU, by applying the same lattice conditions for both fuel bundles

Entanglement-assisted quantum MDS codes from negacyclic codes

Science.gov (United States)

Lu, Liangdong; Li, Ruihu; Guo, Luobin; Ma, Yuena; Liu, Yang

2018-03-01

The entanglement-assisted formalism generalizes the standard stabilizer formalism, which can transform arbitrary classical linear codes into entanglement-assisted quantum error-correcting codes (EAQECCs) by using pre-shared entanglement between the sender and the receiver. In this work, we construct six classes of q-ary entanglement-assisted quantum MDS (EAQMDS) codes based on classical negacyclic MDS codes by exploiting two or more pre-shared maximally entangled states. We show that two of these six classes q-ary EAQMDS have minimum distance more larger than q+1. Most of these q-ary EAQMDS codes are new in the sense that their parameters are not covered by the codes available in the literature.

Visualizing code and coverage changes for code review

NARCIS (Netherlands)

Oosterwaal, Sebastiaan; van Deursen, A.; De Souza Coelho, R.; Sawant, A.A.; Bacchelli, A.

2016-01-01

One of the tasks of reviewers is to verify that code modifications are well tested. However, current tools offer little support in understanding precisely how changes to the code relate to changes to the tests. In particular, it is hard to see whether (modified) test code covers the changed code.

Simulation of buoyancy induced gas mixing tests performed in a large scale containment facility using GOTHIC code

Energy Technology Data Exchange (ETDEWEB)

Liang, Z.; Chin, Y.S. [Atomic Energy of Canada Limited, Chalk River, ON (Canada)

2014-07-01

This paper compares containment thermal-hydraulics simulations performed using GOTHIC against a past test set of large scale buoyancy induced helium-air-steam mixing experiments that had been performed at the AECL's Chalk River Laboratories. A number of typical post-accident containment phenomena, including thermal/gas stratification, natural convection, cool air entrainment, steam condensation on concrete walls and active local air cooler, were covered. The results provide useful insights into hydrogen gas mixing behaviour following a loss-of-coolant accident and demonstrate GOTHIC's capability in simulating these phenomena. (author)

Simulation of buoyancy induced gas mixing tests performed in a large scale containment facility using GOTHIC code

International Nuclear Information System (INIS)

Liang, Z.; Chin, Y.S.

2014-01-01

This paper compares containment thermal-hydraulics simulations performed using GOTHIC against a past test set of large scale buoyancy induced helium-air-steam mixing experiments that had been performed at the AECL's Chalk River Laboratories. A number of typical post-accident containment phenomena, including thermal/gas stratification, natural convection, cool air entrainment, steam condensation on concrete walls and active local air cooler, were covered. The results provide useful insights into hydrogen gas mixing behaviour following a loss-of-coolant accident and demonstrate GOTHIC's capability in simulating these phenomena. (author)

Homological stabilizer codes

Energy Technology Data Exchange (ETDEWEB)

Anderson, Jonas T., E-mail: jonastyleranderson@gmail.com

2013-03-15

In this paper we define homological stabilizer codes on qubits which encompass codes such as Kitaev's toric code and the topological color codes. These codes are defined solely by the graphs they reside on. This feature allows us to use properties of topological graph theory to determine the graphs which are suitable as homological stabilizer codes. We then show that all toric codes are equivalent to homological stabilizer codes on 4-valent graphs. We show that the topological color codes and toric codes correspond to two distinct classes of graphs. We define the notion of label set equivalencies and show that under a small set of constraints the only homological stabilizer codes without local logical operators are equivalent to Kitaev's toric code or to the topological color codes. - Highlights: Black-Right-Pointing-Pointer We show that Kitaev's toric codes are equivalent to homological stabilizer codes on 4-valent graphs. Black-Right-Pointing-Pointer We show that toric codes and color codes correspond to homological stabilizer codes on distinct graphs. Black-Right-Pointing-Pointer We find and classify all 2D homological stabilizer codes. Black-Right-Pointing-Pointer We find optimal codes among the homological stabilizer codes.

SPECTRAL AMPLITUDE CODING OCDMA SYSTEMS USING ENHANCED DOUBLE WEIGHT CODE

Directory of Open Access Journals (Sweden)

F.N. HASOON

2006-12-01

Full Text Available A new code structure for spectral amplitude coding optical code division multiple access systems based on double weight (DW code families is proposed. The DW has a fixed weight of two. Enhanced double-weight (EDW code is another variation of a DW code family that can has a variable weight greater than one. The EDW code possesses ideal cross-correlation properties and exists for every natural number n. A much better performance can be provided by using the EDW code compared to the existing code such as Hadamard and Modified Frequency-Hopping (MFH codes. It has been observed that theoretical analysis and simulation for EDW is much better performance compared to Hadamard and Modified Frequency-Hopping (MFH codes.

Radioactive waste repository study

International Nuclear Information System (INIS)

1978-11-01

This is the third part of a report of a preliminary study for AECL. It summarizes the topics considered in reports AECL-6188-1 and AECL-6188-2 as requirements for an undergpound repository for disposal of wastes produced by the Canadian Nuclear Fuel Program. (author)

A Continuum Diffusion Model for Viscoelastic Materials

Science.gov (United States)

1988-11-01

ZIP Code) 7b. ADDRESS (CJI. Slow, and ZIP Code) Mechanics Div isi on Office of Naval Research; Code 432 Collge Satio, T as 7843800 Quincy Ave. Collge ...these studies, which involved experimental, analytical, and materials science aspects, were conducted by researchers in the fields of physical and...thermodynamics, with irreversibility stemming from the foregoing variables yr through "growth laws" that correspond to viscous resistance. The physical ageing of

A compendium of the data used with the SYVAC3-CC3 system model

International Nuclear Information System (INIS)

Szekely, J.G.; Stephens, M.E.; Witzke, K.H.; Melnyk, T.W.; LeNeveu, D.M.; McConnell, D.B.; Goodwin, B.W.

1994-12-01

AECL is evaluating a concept for disposing of nuclear fuel waste from Canada's CANDU reactors deep in plutonic rock of the Canadian Shield. As part of this evaluation, AECL has developed models of the physicals, chemical, geological and biological processes that could occur in a sealed accessible environment over thousands of years. The mathematical models of the transport of radionuclides and toxic chemicals from nuclear fuel waste to the environment are incorporated into a computer model named the SYstems Variability Analysis Code, generation 3, and Canadian Concept model, generation 3 (SYVAC3-CC3). This report reproduces the data in the master database used by SYVAC3-CC3 for the postclosure assessment of deep laboratory and field studies conducted by AECL Research over the past fifteen years, including the investigations at an Underground Research Laboratory excavated to a depth of 450 meters in a large granitic batholith within the Whiteshell Research area near Lac du Bonnet, Manitoba; conceptual engineering studies; detailed analyses of specific features, events and processes; and published literature. The data represent characteristics of a hypothetical vault, certain geological characteristics of the Whiteshell Research area, and a general surface environment with a human population living a rural lifestyle on a portion of the Canadian Shield in central Canada. The data are stored in a master database, which is used with a suite of computer programs to create the input data files used by SYVAC3-CC3. (author). 19 refs., 11 tabs., 2 figs

DLLExternalCode

Energy Technology Data Exchange (ETDEWEB)

2014-05-14

DLLExternalCode is the a general dynamic-link library (DLL) interface for linking GoldSim (www.goldsim.com) with external codes. The overall concept is to use GoldSim as top level modeling software with interfaces to external codes for specific calculations. The DLLExternalCode DLL that performs the linking function is designed to take a list of code inputs from GoldSim, create an input file for the external application, run the external code, and return a list of outputs, read from files created by the external application, back to GoldSim. Instructions for creating the input file, running the external code, and reading the output are contained in an instructions file that is read and interpreted by the DLL.

High efficiency video coding coding tools and specification

CERN Document Server

Wien, Mathias

2015-01-01

The video coding standard High Efficiency Video Coding (HEVC) targets at improved compression performance for video resolutions of HD and beyond, providing Ultra HD video at similar compressed bit rates as for HD video encoded with the well-established video coding standard H.264 | AVC. Based on known concepts, new coding structures and improved coding tools have been developed and specified in HEVC. The standard is expected to be taken up easily by established industry as well as new endeavors, answering the needs of todays connected and ever-evolving online world. This book presents the High Efficiency Video Coding standard and explains it in a clear and coherent language. It provides a comprehensive and consistently written description, all of a piece. The book targets at both, newbies to video coding as well as experts in the field. While providing sections with introductory text for the beginner, it suits as a well-arranged reference book for the expert. The book provides a comprehensive reference for th...

Converter of a continuous code into the Grey code

International Nuclear Information System (INIS)

Gonchar, A.I.; TrUbnikov, V.R.

1979-01-01

Described is a converter of a continuous code into the Grey code used in a 12-charged precision amplitude-to-digital converter to decrease the digital component of spectrometer differential nonlinearity to +0.7% in the 98% range of the measured band. To construct the converter of a continuous code corresponding to the input signal amplitude into the Grey code used is the regularity in recycling of units and zeroes in each discharge of the Grey code in the case of a continuous change of the number of pulses of a continuous code. The converter is constructed on the elements of 155 series, the frequency of continuous code pulse passing at the converter input is 25 MHz

Annual report 1993-1994

International Nuclear Information System (INIS)

1994-01-01

Established in 1952 as a Crown corporation, AECL reports to Parliament through the Ministry of Natural Resources. Its mandate is to undertake research into nuclear energy and prepare and develop its commercial applications. AECL's mission is to secure the maximum economic benefit for Canada from CANDU technology and associated research and development - the CANDU business. AECL's accomplishments include the development of products and services which, through diligent marketing efforts, are now in use worldwide. The corporation's world-renowned flagship product, the CANDU reactor, currently satisfies 16% of Canada's electricity requirements and is a key component of the energy programs in five other countries. AECL's vision over the next 20 years is to: be a world-leading supplier of full-scope nuclear power capability; be a long-term business with at least a quarter share of the emerging global market for the next generation of nuclear power plants; have a comprehensive ongoing research program to: maintain at the highest levels the performance and safety of operating CANDU plants; advance the CANDU technology and the science that underlies it; develop knowledge on the health effects of radiation and on the safety and environmental impacts of nuclear reactor operation. AECL currently employees 4000 people. With headquarters in Ottawa, AECL operates two research laboratories, one in Ontario and one in Manitoba, and engineering and design offices in Ontario, Quebec, Saskatchewan, and New Brunswick, as well as offices abroad. AECL has a subsidiary, AECL Technologies Inc., situated in Washington, DC

An accident involving transport of radioactive materials, Canada 1994 March

Energy Technology Data Exchange (ETDEWEB)

Keeling, F; Dunn, L E.G. [Atomic Energy of Canada Ltd., Chalk River, ON (Canada)

1996-12-31

AECL-Chalk River Laboratories (CRL) located at Chalk River, Ontario, routinely ships radioisotopes in bulk to Nordion International Inc. in Kanata, Ontario. On 1994 March 22, an AECL vehicle carrying three packages containing radioisotopes collided with a tractor trailer carrying steel, approximately 15 km east of the Chalk River Laboratories. The AECL-CRL emergency response plan was activated. A series of post-accident meetings were held to evaluate the effectiveness of the plan and to address any identified deficiencies. AECL-CRL is continuing to work towards addressing the identified deficiencies. (author). 2 figs.

An accident involving transport of radioactive materials, Canada 1994 March

International Nuclear Information System (INIS)

Keeling, F.; Dunn, L.E.G.

1995-01-01

AECL-Chalk River Laboratories (CRL) located at Chalk River, Ontario, routinely ships radioisotopes in bulk to Nordion International Inc. in Kanata, Ontario. On 1994 March 22, an AECL vehicle carrying three packages containing radioisotopes collided with a tractor trailer carrying steel, approximately 15 km east of the Chalk River Laboratories. The AECL-CRL emergency response plan was activated. A series of post-accident meetings were held to evaluate the effectiveness of the plan and to address any identified deficiencies. AECL-CRL is continuing to work towards addressing the identified deficiencies. (author). 2 figs

Babesia microti real-time polymerase chain reaction testing of Connecticut blood donors: potential implications for screening algorithms.

Science.gov (United States)

Johnson, Stephanie T; Van Tassell, Eric R; Tonnetti, Laura; Cable, Ritchard G; Berardi, Victor P; Leiby, David A

2013-11-01

Babesia microti, an intraerythrocytic parasite, has been implicated in transfusion transmission. B. microti seroprevalence in Connecticut (CT) blood donors is approximately 1%; however, it is not known what percentage of donors is parasitemic and poses a risk for transmitting infection. Therefore, we determined the prevalence of demonstrable B. microti DNA in donors from a highly endemic area of CT and compared observed rates with concurrent immunofluorescence assay (IFA) testing results. Blood samples from consenting donors in southeastern CT were collected from mid-August through early October 2009 and tested by IFA for immunoglobulin G antibodies and real-time polymerase chain reaction (PCR) for B. microti DNA. IFA specificity was determined using blood donor samples collected in northwestern Vermont (VT), an area nonendemic for Babesia. Of 1002 CT donors, 25 (2.5%) were IFA positive and three (0.3%) were real-time PCR positive. Among the three real-time PCR-positive donors, two were also IFA positive, while one was IFA negative and may represent a window period infection. The two IFA- and real-time PCR-positive donors appeared to subsequently clear infection. The other real-time PCR-positive donor did not provide follow-up samples. Of 1015 VT donors tested by IFA, only one (0.1%) was positive, but may have acquired infection during travel to an endemic area. We prospectively identified several real-time PCR-positive blood donors, including an IFA-negative real-time PCR-positive donor, in an area highly endemic for B. microti. These results suggest the need to include nucleic acid testing in planned mitigation strategies for B. microti. © 2013 American Association of Blood Banks.

The Aster code; Code Aster

Energy Technology Data Exchange (ETDEWEB)

Delbecq, J.M

1999-07-01

The Aster code is a 2D or 3D finite-element calculation code for structures developed by the R and D direction of Electricite de France (EdF). This dossier presents a complete overview of the characteristics and uses of the Aster code: introduction of version 4; the context of Aster (organisation of the code development, versions, systems and interfaces, development tools, quality assurance, independent validation); static mechanics (linear thermo-elasticity, Euler buckling, cables, Zarka-Casier method); non-linear mechanics (materials behaviour, big deformations, specific loads, unloading and loss of load proportionality indicators, global algorithm, contact and friction); rupture mechanics (G energy restitution level, restitution level in thermo-elasto-plasticity, 3D local energy restitution level, KI and KII stress intensity factors, calculation of limit loads for structures), specific treatments (fatigue, rupture, wear, error estimation); meshes and models (mesh generation, modeling, loads and boundary conditions, links between different modeling processes, resolution of linear systems, display of results etc..); vibration mechanics (modal and harmonic analysis, dynamics with shocks, direct transient dynamics, seismic analysis and aleatory dynamics, non-linear dynamics, dynamical sub-structuring); fluid-structure interactions (internal acoustics, mass, rigidity and damping); linear and non-linear thermal analysis; steels and metal industry (structure transformations); coupled problems (internal chaining, internal thermo-hydro-mechanical coupling, chaining with other codes); products and services. (J.S.)

Entanglement-assisted quantum MDS codes constructed from negacyclic codes

Science.gov (United States)

Chen, Jianzhang; Huang, Yuanyuan; Feng, Chunhui; Chen, Riqing

2017-12-01

Recently, entanglement-assisted quantum codes have been constructed from cyclic codes by some scholars. However, how to determine the number of shared pairs required to construct entanglement-assisted quantum codes is not an easy work. In this paper, we propose a decomposition of the defining set of negacyclic codes. Based on this method, four families of entanglement-assisted quantum codes constructed in this paper satisfy the entanglement-assisted quantum Singleton bound, where the minimum distance satisfies q+1 ≤ d≤ n+2/2. Furthermore, we construct two families of entanglement-assisted quantum codes with maximal entanglement.

Error-correction coding

Science.gov (United States)

Hinds, Erold W. (Principal Investigator)

1996-01-01

This report describes the progress made towards the completion of a specific task on error-correcting coding. The proposed research consisted of investigating the use of modulation block codes as the inner code of a concatenated coding system in order to improve the overall space link communications performance. The study proposed to identify and analyze candidate codes that will complement the performance of the overall coding system which uses the interleaved RS (255,223) code as the outer code.

A study on the effect of the CHF correlations to the LOCA analysis

International Nuclear Information System (INIS)

Kim, Ho Kee

1998-02-01

The critical heat flux (CHF) is a major parameter which determines the cooling performance and therefore the prediction of CHF is of importance for the design and safety analysis in boiling systems; such as nuclear reactors, conventional boilers, and other various two-phase flow systems. Until now, many CHF correlations have been developed and for the actual design a correlation has been selected in consideration of its characteristics. For the analysis of Loss of Coolant Accident (LOCA) in a Nuclear Power Plant, which shows the drastic parameters change during the system transient, a correlation having a reasonable degree of accuracy over a wide range is preferred, rather than that having accuracy for a specific range. It is required to have tangible insight about the effects of the CHF correlation to the LOCA analysis for the purpose of computer code development and nuclear regulation. The related research is further recommended. The purpose of this research is to obtain an insight and/or intuition about the above effect and to evaluate the selected CHF correlations. To achieve these purposes LOCA is analysed for the UL-JIN 3 and 4 nuclear power plant, the Korea Standard Type Nuclear Power Plant and the Loss of Flow Test (LOFT) L2-5 experiment is simulated using the RELAP5/MOD3.1 computer code for each selected CHF correlation. The selected correlations are the AECL-UO Lookup Table, adapted in RELAP5 code; the K110 CHF correlation, developed by KAERI; and the original W-3 CHF correlation, developed by L.S. Tong. LOFT is also simulated using the AECL-UO Lookup Table having the CHF multiplication factors 0.5 and 1.5, and then compared with the result of the original Lookup Table and the experiment result. In the LOCA analysis, the CHF correlations affect the magnitude of peak cladding temperatures, but does not seriously affect the occurrence points of time. The effect of each CHF correlation to the fuel cladding temperature behavior becomes apparent at the end of

Turbo-Gallager Codes: The Emergence of an Intelligent Coding ...

African Journals Online (AJOL)

Today, both turbo codes and low-density parity-check codes are largely superior to other code families and are being used in an increasing number of modern communication systems including 3G standards, satellite and deep space communications. However, the two codes have certain distinctive characteristics that ...

TASS code topical report. V.1 TASS code technical manual

International Nuclear Information System (INIS)

Sim, Suk K.; Chang, W. P.; Kim, K. D.; Kim, H. C.; Yoon, H. Y.

1997-02-01

TASS 1.0 code has been developed at KAERI for the initial and reload non-LOCA safety analysis for the operating PWRs as well as the PWRs under construction in Korea. TASS code will replace various vendor's non-LOCA safety analysis codes currently used for the Westinghouse and ABB-CE type PWRs in Korea. This can be achieved through TASS code input modifications specific to each reactor type. The TASS code can be run interactively through the keyboard operation. A simimodular configuration used in developing the TASS code enables the user easily implement new models. TASS code has been programmed using FORTRAN77 which makes it easy to install and port for different computer environments. The TASS code can be utilized for the steady state simulation as well as the non-LOCA transient simulations such as power excursions, reactor coolant pump trips, load rejections, loss of feedwater, steam line breaks, steam generator tube ruptures, rod withdrawal and drop, and anticipated transients without scram (ATWS). The malfunctions of the control systems, components, operator actions and the transients caused by the malfunctions can be easily simulated using the TASS code. This technical report describes the TASS 1.0 code models including reactor thermal hydraulic, reactor core and control models. This TASS code models including reactor thermal hydraulic, reactor core and control models. This TASS code technical manual has been prepared as a part of the TASS code manual which includes TASS code user's manual and TASS code validation report, and will be submitted to the regulatory body as a TASS code topical report for a licensing non-LOCA safety analysis for the Westinghouse and ABB-CE type PWRs operating and under construction in Korea. (author). 42 refs., 29 tabs., 32 figs

Decoding of concatenated codes with interleaved outer codes

DEFF Research Database (Denmark)

Justesen, Jørn; Høholdt, Tom; Thommesen, Christian

2004-01-01

Recently Bleichenbacher et al. proposed a decoding algorithm for interleaved (N, K) Reed-Solomon codes, which allows close to N-K errors to be corrected in many cases. We discuss the application of this decoding algorithm to concatenated codes.......Recently Bleichenbacher et al. proposed a decoding algorithm for interleaved (N, K) Reed-Solomon codes, which allows close to N-K errors to be corrected in many cases. We discuss the application of this decoding algorithm to concatenated codes....

Fast Coding Unit Encoding Mechanism for Low Complexity Video Coding

OpenAIRE

Gao, Yuan; Liu, Pengyu; Wu, Yueying; Jia, Kebin; Gao, Guandong

2016-01-01

In high efficiency video coding (HEVC), coding tree contributes to excellent compression performance. However, coding tree brings extremely high computational complexity. Innovative works for improving coding tree to further reduce encoding time are stated in this paper. A novel low complexity coding tree mechanism is proposed for HEVC fast coding unit (CU) encoding. Firstly, this paper makes an in-depth study of the relationship among CU distribution, quantization parameter (QP) and content ...

The MOX Fuel Behaviour Test IFA-597.4: Temperature And Pressure Data To A Burn-Up Of 5.4 MWd/kg MOX

International Nuclear Information System (INIS)

McGrath, M. A.; Teshima, H.

1998-02-01

Characterising the behaviour of MOX fuel is becoming increasingly important as many commercial reactors are or will be operating with this type of fuel. With this as a driving force, a new joint programme experiment, IFA-597.4, has been loaded into the reactor at Halden for the purpose of establishing the fission gas release behaviour of MOX fuel. Both annular and solid pellet fuel is being utilised and the irradiation is being conducted such that the fuel is initially operated below the onset of fission gas release. The fuel will later be subjected to small power up ratings which will be held for short periods of time. These are designed to bring the fuel to just above the temperature threshold for fission gas release thus allowing the FGR behaviour of both solid and annular MOX fuel to be established. The rig contains two fuel rods of active length 220 mm and diameter 8.05 mm. Both fuel rods contain MOX fuel with an initial Pu-fissile content of 6.07% and both are instrumented with a fuel centre thermocouple and a pressure transducer. The test is being performed under HBWR conditions and at the time of the reactor shutdown at the end of 1997 a mean burn-up of 5.4 MWd/kg MOX had been achieved with the rods at an average rating of 30 kW/m. The rod pressure data show that no fission gas had been released up to the shutdown. The fuel centre temperatures of both rods exhibit an initial increase concurrent with a fall in the monitored rod internal pressures as a result of fuel densification. It was estimated that about 1-1.4% fuel densification by volume had occurred in the two rods by a burn-up of about 3 MWd/kg MOX. (author)

Comparison of anterior segment optical coherence tomography angiography and fluorescein angiography for iris vasculature analysis.

Science.gov (United States)

Zett, Claudio; Stina, Deborah M Rosa; Kato, Renata Tiemi; Novais, Eduardo Amorim; Allemann, Norma

2018-04-01

The aim of this study is to perform imaging of irises of different colors using spectral domain anterior segment optical coherence tomography angiography (AS-OCTA) and iris fluorescein angiography (IFA) and compare their effectiveness in examining iris vasculature. This is a cross-sectional observational clinical study. Patients with no vascular iris alterations and different pigmentation levels were recruited. Participants were imaged using OCTA adapted with an anterior segment lens and IFA with a confocal scanning laser ophthalmoscope (cSLO) adapted with an anterior segment lens. AS-OCTA and IFA images were then compared. Two blinded readers classified iris pigmentation and compared the percentage of visible vessels between OCTA and IFA images. Twenty eyes of 10 patients with different degrees of iris pigmentation were imaged using AS-OCTA and IFA. Significantly more visible iris vessels were observed using OCTA than using FA (W = 5.22; p Iris pigmentation was negatively correlated to the percentage of visible vessels in both imaging methods (OCTA, rho = - 0.73, p iris vasculature. In both AS-OCTA and IFA, iris pigmentation caused vasculature imaging blockage, but AS-OCTA provided more detailed iris vasculature images than IFA. Additional studies including different iris pathologies are needed to determine the most optimal scanning parameters in OCTA of the anterior segment.

Codes Over Hyperfields

Directory of Open Access Journals (Sweden)

Atamewoue Surdive

2017-12-01

Full Text Available In this paper, we define linear codes and cyclic codes over a finite Krasner hyperfield and we characterize these codes by their generator matrices and parity check matrices. We also demonstrate that codes over finite Krasner hyperfields are more interesting for code theory than codes over classical finite fields.

Amino acid codes in mitochondria as possible clues to primitive codes

Science.gov (United States)

Jukes, T. H.

1981-01-01

Differences between mitochondrial codes and the universal code indicate that an evolutionary simplification has taken place, rather than a return to a more primitive code. However, these differences make it evident that the universal code is not the only code possible, and therefore earlier codes may have differed markedly from the previous code. The present universal code is probably a 'frozen accident.' The change in CUN codons from leucine to threonine (Neurospora vs. yeast mitochondria) indicates that neutral or near-neutral changes occurred in the corresponding proteins when this code change took place, caused presumably by a mutation in a tRNA gene.

User`s manual for the CC3 computer models of the concept for disposal of Canada`s nuclear fuel waste

Energy Technology Data Exchange (ETDEWEB)

Dougan, K D; Wojciechowski, L C

1995-06-01

Atomic Energy of Canada Limited (AECL) is assessing a concept for disposing of CANDU reactor fuel waste in a vault deep in plutonic rock of the Canadian Shield. A computer program called the Systems Variability Analysis Code (SYVAC) has been developed as an analytical tool for the postclosure (long-term) assessment of the concept, and for environmental assessments of other systems. SYVAC3, the third generation of the code, is an executive program that directs repeated simulation of the disposal system, which is represented by the CC3 (Canadian Concept, generation 3) models comprising a design-specific vault, a site-specific geosphere and a biosphere typical of the Canadian Shield. (author). 23 refs., 7 tabs., 21 figs.

User's manual for the CC3 computer models of the concept for disposal of Canada's nuclear fuel waste

International Nuclear Information System (INIS)

Dougan, K.D.; Wojciechowski, L.C.

1995-06-01

Atomic Energy of Canada Limited (AECL) is assessing a concept for disposing of CANDU reactor fuel waste in a vault deep in plutonic rock of the Canadian Shield. A computer program called the Systems Variability Analysis Code (SYVAC) has been developed as an analytical tool for the postclosure (long-term) assessment of the concept, and for environmental assessments of other systems. SYVAC3, the third generation of the code, is an executive program that directs repeated simulation of the disposal system, which is represented by the CC3 (Canadian Concept, generation 3) models comprising a design-specific vault, a site-specific geosphere and a biosphere typical of the Canadian Shield. (author). 23 refs., 7 tabs., 21 figs

抽动障碍患儿432例血铅水平对脑电图活动的影响%Influence of Blood Lead Level on Electrical Activity of Brain in 432 Children with Tic Disorder

Institute of Scientific and Technical Information of China (English)

田广燕; 梁向荣; 高在芬; 刘勇

2011-01-01

目的 探讨抽动障碍患儿血铅水平变化对脑电活动的影响及其发病机制的研究,对比不同血铅水平患儿脑电图变化的特点.方法 对本院2005年1月- 2011年4月临床确诊的432例抽动障碍患儿进行血铅水平及脑电图检测.采用原子吸收光谱分析法测定其血铅水平,并进行t检验.将432例抽动障碍患儿分为3组,Ⅰ组:血铅水平＜50μg·L-1；Ⅱ组:血铅水平50 ～ 100μg·L-1；Ⅲ组:血铅水平＞ 100 μg·L-1.结果 1.Ⅰ组患儿脑电图异常发生率为7.14％(2/28例),Ⅱ组患儿脑电图异常发生率为14.23％(40/281例),Ⅲ组患儿脑电图异常发生率为46.34％(57/123例).Ⅰ组与Ⅱ组脑电图异常发生率比较差异无统计学意义(P＞0.05),Ⅰ组与Ⅲ组脑电图异常发生率比较差异有统计学意义(P＜0.01),Ⅱ组与Ⅲ组脑电图异常发生率比较差异有统计学意义(P＜0.01).2.除年龄≤4岁患儿外,脑电图异常患儿较脑电图正常患儿血铅水平明显升高(P＜0.01,0.05).结论 血铅水平升高会加重抽动障碍患儿的脑功能损伤.及早进行驱铅治疗可能对抽动障碍患儿脑功能损伤的恢复有重要意义.%Objective To study the influence and pathogenesis of blood lead level on electrical activity of brain in children with tic disorder, and to research the characteristics of electroencephalogram (EEG) in children with different concentrations of blood lead. Methods The level of blood lead and EEG were assessed in 432 children with tic disorder from Jan. 2005 to Apr. 2011. The level of blood lead were examined by atomic absorption spectrophotometry method. Statistical analysis were performed by t - test. According to the blood lead level, the children were divided into 3 groups, group Ⅰ :blood lead 100 μg · L-1. Results 1. The EEG abnormal statistics results showed abnormal rate in group Ⅰ ,group Ⅱ and group Ⅲ were 7. 14% (2/28 cases) , 14.23% (40/ 281 cases) and 46. 34% (57/123 cases

Analysis of quantum error-correcting codes: Symplectic lattice codes and toric codes

Science.gov (United States)

Harrington, James William

Quantum information theory is concerned with identifying how quantum mechanical resources (such as entangled quantum states) can be utilized for a number of information processing tasks, including data storage, computation, communication, and cryptography. Efficient quantum algorithms and protocols have been developed for performing some tasks (e.g. , factoring large numbers, securely communicating over a public channel, and simulating quantum mechanical systems) that appear to be very difficult with just classical resources. In addition to identifying the separation between classical and quantum computational power, much of the theoretical focus in this field over the last decade has been concerned with finding novel ways of encoding quantum information that are robust against errors, which is an important step toward building practical quantum information processing devices. In this thesis I present some results on the quantum error-correcting properties of oscillator codes (also described as symplectic lattice codes) and toric codes. Any harmonic oscillator system (such as a mode of light) can be encoded with quantum information via symplectic lattice codes that are robust against shifts in the system's continuous quantum variables. I show the existence of lattice codes whose achievable rates match the one-shot coherent information over the Gaussian quantum channel. Also, I construct a family of symplectic self-dual lattices and search for optimal encodings of quantum information distributed between several oscillators. Toric codes provide encodings of quantum information into two-dimensional spin lattices that are robust against local clusters of errors and which require only local quantum operations for error correction. Numerical simulations of this system under various error models provide a calculation of the accuracy threshold for quantum memory using toric codes, which can be related to phase transitions in certain condensed matter models. I also present

Annual report 1994-1995

International Nuclear Information System (INIS)

1995-01-01

Established in 1952 as a Crown corporation, AECL reports to Parliament through the Ministry of Natural Resources. Its mandate is to undertake research into nuclear energy and prepare and develop its commercial applications. AECL's objective is to secure the maximum economic benefit for Canada from CANDU technology and the associated research and development. AECL's accomplishments include the development of products and services which are now in use worldwide. The corporation's world-renowned flagship product, the CANDU reactor, supplies almost one-fifth of Canada's electricity requirements and is an important component of the energy programs in five other countries. Building upon these achievements, AECL continues to consolidate its position as a world-leading supplies of full-scope nuclear power capabilities with expectations to capture a substantial share of the emerging global nuclear power market. The immediate goals are to meet the customers' requirements in the delivery of current projects, to ensure that operating CANDU stations continue to maintain a high level of performance, to secure further CANDU sales, to garner increased revenues from further commercialization of CANDU technology, and to serve the Government of Canada's nuclear policy initiatives. AECL currently employs 3900 people in a variety of locations, including two major research laboratories located in Ontario and Manitoba, as well as business, engineering and design offices in Ottawa, Toronto, Montreal, Saskatoon and Fredericton. AECL has two subsidiaries, AECL Technologies Inc., in Washington, DC, and AECL Technologies B.V., in the Hague, Netherlands, and maintains a significant presence in South Korea, as well as several smaller offices in other countries

Coding for dummies

CERN Document Server

Abraham, Nikhil

2015-01-01

Hands-on exercises help you learn to code like a pro No coding experience is required for Coding For Dummies,your one-stop guide to building a foundation of knowledge inwriting computer code for web, application, and softwaredevelopment. It doesn't matter if you've dabbled in coding or neverwritten a line of code, this book guides you through the basics.Using foundational web development languages like HTML, CSS, andJavaScript, it explains in plain English how coding works and whyit's needed. Online exercises developed by Codecademy, a leading online codetraining site, help hone coding skill

The Preliminary GAMMA Code Thermal hydraulic Analysis for the Steady State of HTR-10 Initial Core

Energy Technology Data Exchange (ETDEWEB)

Jun, Ji Su; Lim, Hong Sik; Lee, Won Jae

2006-07-15

This report describes the preliminary thermalhydraulic analysis of HTR-10 steady state full power initial core to provide a benchmark calculation of VHTGR(Very High-Temperature Gas-Cooled Reactors) safety analysis code of GAMMA(GAs Multicomponent Mixture Analysis). The input data of GAMMA code are produced for the models of fluid block, wall block, radiation heat transfer and each component material properties in HTR-10 reactor. The temperature and flow distributions of HTR-10 steady state 10 MW{sub th} full power initial core are calculated by GAMMA code with boundary conditions of total reactor inlet flow rate of 4.32 kg/s, inlet temperature of 250 .deg. C, inlet pressure of 3 MPa, outlet pressure of 2.992 MPa and the fixed temperature at RCCS water cooling tube of 50 .deg C. The calculation results are compared with the measured solid material temperatures at 22 fixed instrumentation positions in HTR-10. The wall temperature distribution in pebble bed core shows that the minimum temperature of 358 .deg. C is located at upper core, a higher temperature zone than 829 .deg. C is located at the inner region of 0.45 m radius at the bottom of core centre, and the maximum wall temperature is 897 .deg. C. The wall temperatures linearly decreases at radially and axially farther side from the bottom of core centre. The maximum temperature of RPV is 230 .deg. C, and the maximum values of fuel average temperature and TRISO centreline temperature are 907 .deg. C and 929 .deg. C, respectively and they are much lower than the fuel temperature limitation of 1230 .deg. C. The comparsion between the GAMMA code predictions and the measured temperature data shows that the calculation results are very close to the measured values in top and side reflector region, but a great difference is appeared in bottom reflector region. Some measured data are abnormally high in bottom reflector region, and so the confirmation of data is necessary in future. Fifteen of twenty two data have a

Detecting non-coding selective pressure in coding regions

Directory of Open Access Journals (Sweden)

Blanchette Mathieu

2007-02-01

Full Text Available Abstract Background Comparative genomics approaches, where orthologous DNA regions are compared and inter-species conserved regions are identified, have proven extremely powerful for identifying non-coding regulatory regions located in intergenic or intronic regions. However, non-coding functional elements can also be located within coding region, as is common for exonic splicing enhancers, some transcription factor binding sites, and RNA secondary structure elements affecting mRNA stability, localization, or translation. Since these functional elements are located in regions that are themselves highly conserved because they are coding for a protein, they generally escaped detection by comparative genomics approaches. Results We introduce a comparative genomics approach for detecting non-coding functional elements located within coding regions. Codon evolution is modeled as a mixture of codon substitution models, where each component of the mixture describes the evolution of codons under a specific type of coding selective pressure. We show how to compute the posterior distribution of the entropy and parsimony scores under this null model of codon evolution. The method is applied to a set of growth hormone 1 orthologous mRNA sequences and a known exonic splicing elements is detected. The analysis of a set of CORTBP2 orthologous genes reveals a region of several hundred base pairs under strong non-coding selective pressure whose function remains unknown. Conclusion Non-coding functional elements, in particular those involved in post-transcriptional regulation, are likely to be much more prevalent than is currently known. With the numerous genome sequencing projects underway, comparative genomics approaches like that proposed here are likely to become increasingly powerful at detecting such elements.

A compilation of subsurface hydrogeologic data

International Nuclear Information System (INIS)

1986-03-01

This volume contains a continuation of the fracture data for the research sites discussed in Volume 1 which have been studied in sufficient detail to allow for analysis. The sites discussed in this volume are the following: Climax Granite Nevada Test Site; OCRD Room, Colorado School of Mines; Savannah River Plant, Aiken, South Carolina; Oracle, Arizona; Basalt Waste Isolation Project (BWIP), Hanford, Washington Underground Research Laboratory, AECL, Canada; Atikokan Research Area, AECL; Chalk River Research Area, AECL; Whiteshell Research Area, AECL. Other sources of information have been included where sufficient site specific geologic and hydrogeologic information is provided

Dynamic Shannon Coding

OpenAIRE

Gagie, Travis

2005-01-01

We present a new algorithm for dynamic prefix-free coding, based on Shannon coding. We give a simple analysis and prove a better upper bound on the length of the encoding produced than the corresponding bound for dynamic Huffman coding. We show how our algorithm can be modified for efficient length-restricted coding, alphabetic coding and coding with unequal letter costs.

The correspondence between projective codes and 2-weight codes

NARCIS (Netherlands)

Brouwer, A.E.; Eupen, van M.J.M.; Tilborg, van H.C.A.; Willems, F.M.J.

1994-01-01

The hyperplanes intersecting a 2-weight code in the same number of points obviously form the point set of a projective code. On the other hand, if we have a projective code C, then we can make a 2-weight code by taking the multiset of points E PC with multiplicity "Y(w), where W is the weight of

Rock fracture dynamics research at AECL's Underground Research Laboratory: applications to geological disposal of radioactive waste

Energy Technology Data Exchange (ETDEWEB)

Young, R.P. [Univ. of Toronto, Toronto, ON (Canada); Haycox, J.R. [Applied Seismology Consultants Limited, Shrewsbury, Shropshire (United Kingdom); Martino, J. [Atomic Energy of Canada Limited, Pinawa, MB (Canada)

2011-07-01

Studies of rock fracture dynamics at AECL's Underground Research Laboratory (URL) have helped to provide a fundamental understanding of how crystalline rock responds to stresses induced from excavation, pressurization and temperature changes. The data acquired continue to provide insights into how a facility for the future geological disposal of radioactive waste could be engineered. Research into microseismic (MS), acoustic emission (AE), and ultrasonic velocity measurements has been performed on the full-scale sealed, pressurized, and heated horizontal elliptical tunnel at the Tunnel Sealing Experiment (TSX). The continuous monitoring of the experiment for 8 years provides a unique dataset for the understanding of the medium-term performance of an engineered disposal facility. This paper summarizes the results, interpretations and key findings of the experiment paying particular focus to the heating and cooling/depressurization of the chamber. Initial drilling of the tunnel and bulkheads causes microfracturing around the tunnel, mapped by MS and AEs, and is used as a benchmark for fracturing representing the excavated damaged zone (EDZ). There is no further extension to the volume during pressurization or heating of the tunnel suggesting an increase in crack density and coalescence of cracks rather than extension into unfractured rock. The dominant structure within the seismic cloud has been investigated using a statistical approach applying the three-point method. MS events in the roof exhibit a dominant pattern of sub-horizontal and shallow-dipping well defined planar features, but during cooling and depressurization a 45 degree dip normal to the tunnel axis is observed, which may be caused by movement in the rock-concrete interface due to differential cooling of the bulkhead and host rock. Cooling and depressurization of the TSX have not led to a significant increase in the number of MS or AE events. Ultrasonic results suggest the rock gets even stiffer

Quality Improvement of MARS Code and Establishment of Code Coupling

International Nuclear Information System (INIS)

Chung, Bub Dong; Jeong, Jae Jun; Kim, Kyung Doo

2010-04-01

The improvement of MARS code quality and coupling with regulatory auditing code have been accomplished for the establishment of self-reliable technology based regulatory auditing system. The unified auditing system code was realized also by implementing the CANDU specific models and correlations. As a part of the quality assurance activities, the various QA reports were published through the code assessments. The code manuals were updated and published a new manual which describe the new models and correlations. The code coupling methods were verified though the exercise of plant application. The education-training seminar and technology transfer were performed for the code users. The developed MARS-KS is utilized as reliable auditing tool for the resolving the safety issue and other regulatory calculations. The code can be utilized as a base technology for GEN IV reactor applications

Community-based distribution of iron-folic acid supplementation in low- and middle-income countries: a review of evidence and programme implications.

Science.gov (United States)

Kavle, Justine A; Landry, Megan

2018-02-01

The present literature review aimed to review the evidence for community-based distribution (CBD) of iron-folic acid (IFA) supplementation as a feasible approach to improve anaemia rates in low- and middle-income countries. The literature review included peer-reviewed studies and grey literature from PubMed, Cochrane Library, LILAC and Scopus databases. Low- and middle-income countries. Non-pregnant women, pregnant women, and girls. CBD programmes had moderate success with midwives and community health workers (CHW) who counselled on health benefits and compliance with IFA supplementation. CHW were more likely to identify and reach a greater number of women earlier in pregnancy, as women tended to present late to antenatal care. CBD channels had greater consistency in terms of adequate supplies of IFA in comparison to clinics and vendors, who faced stock outages. Targeting women of reproductive age through school and community settings showed high compliance and demonstrated reductions in anaemia. CBD of IFA supplementation can be a valuable platform for improving knowledge about anaemia, addressing compliance and temporary side-effects of IFA supplements, and increasing access and coverage of IFA supplementation. Programmatic efforts focusing on community-based platforms should complement services and information provided at the health facility level. Provision of training and supportive supervision for CHW on how to counsel women on benefits, side-effects, and when, why, and how to take IFA supplements, as part of behaviour change communication, can be strengthened, alongside logistics and supply systems to ensure consistent supplies of IFA tablets at both the facility and community levels.

Multiple component codes based generalized LDPC codes for high-speed optical transport.

Science.gov (United States)

Djordjevic, Ivan B; Wang, Ting

2014-07-14

A class of generalized low-density parity-check (GLDPC) codes suitable for optical communications is proposed, which consists of multiple local codes. It is shown that Hamming, BCH, and Reed-Muller codes can be used as local codes, and that the maximum a posteriori probability (MAP) decoding of these local codes by Ashikhmin-Lytsin algorithm is feasible in terms of complexity and performance. We demonstrate that record coding gains can be obtained from properly designed GLDPC codes, derived from multiple component codes. We then show that several recently proposed classes of LDPC codes such as convolutional and spatially-coupled codes can be described using the concept of GLDPC coding, which indicates that the GLDPC coding can be used as a unified platform for advanced FEC enabling ultra-high speed optical transport. The proposed class of GLDPC codes is also suitable for code-rate adaption, to adjust the error correction strength depending on the optical channel conditions.

Sclerotherapy with picibanil (OK-432) for congenital lymphatic malformation in the head and neck.

Science.gov (United States)

Sung, M W; Lee, D W; Kim, D Y; Lee, S J; Hwang, C H; Park, S W; Kim, K H

2001-08-01

Congenital lymphatic malformations of the head and neck (LMHN) present special challenges to the otolaryngologist-head and neck surgeon. Recently, a number of sclerotherapy trials have shown promising results. In this study, we present our experiences with picibanil (OK-432) sclerotherapy for this lesion. Retrospectively review. We retrospectively reviewed 21 patients who have undergone sclerotherapy with picibanil for LMHN. Satisfactory response with complete or nearly complete shrinkage of the lesions was observed in 15 cases after repeated sclerotherapy (average, two times). We did not observe any significant morbidity or complications in the patients treated with picibanil. Reduction in size of the mass was achieved in weeks to months. Some of the patients who had not had any other previous treatment showed remarkable reductions in size even after the first therapy. When we used picibanil sclerotherapy as a primary treatment for the LMHN, most of our patients showed satisfactory results regardless of the size or location of the lesions. Given with our experience and the reports that failure of picibanil sclerotherapy does not hinder subsequent surgical salvage procedures, we recommend trying picibanil sclerotherapy as a primary treatment for the LMHN and performing surgical excision as a secondary modality if the response to the sclerotherapy is not satisfactory.

The effect of proposed crush tests on transport containers

International Nuclear Information System (INIS)

1984-09-01

Crush tests were performed on two AECL F112 packaging specimens, two simulated AECL-CRNL 4H packaging specimens, and on empty steel drums. The 9 m drop test was carried out on two simulated AECL-CRNL 4H packaging specimens for comparison with the effects of the crush test. The tests were filmed using high speed photography and 35mm still photographs

Vector Network Coding

OpenAIRE

Ebrahimi, Javad; Fragouli, Christina

2010-01-01

We develop new algebraic algorithms for scalar and vector network coding. In vector network coding, the source multicasts information by transmitting vectors of length L, while intermediate nodes process and combine their incoming packets by multiplying them with L X L coding matrices that play a similar role as coding coefficients in scalar coding. Our algorithms for scalar network jointly optimize the employed field size while selecting the coding coefficients. Similarly, for vector co...

Rateless feedback codes

DEFF Research Database (Denmark)

Sørensen, Jesper Hemming; Koike-Akino, Toshiaki; Orlik, Philip

2012-01-01

This paper proposes a concept called rateless feedback coding. We redesign the existing LT and Raptor codes, by introducing new degree distributions for the case when a few feedback opportunities are available. We show that incorporating feedback to LT codes can significantly decrease both...... the coding overhead and the encoding/decoding complexity. Moreover, we show that, at the price of a slight increase in the coding overhead, linear complexity is achieved with Raptor feedback coding....

A Comparison of Anti-Nuclear Antibody Quantification Using Automated Enzyme Immunoassays and Immunofluorescence Assays

DEFF Research Database (Denmark)

Baronaite, Renata; Engelhart, Merete; Mørk Hansen, Troels

2014-01-01

using IFA and automated EIA techniques. The IFA results generated by two independent laboratories were compared with the EIA results from antibodies against double-stranded DNA (dsDNA), from ANA screening, and from tests of the seven included subantigens. The final IFA and EIA results for 386 unique......, with Cohen's kappa value of 0.30 (95% confidence interval (CI) = 0.14-0.46), which decreased to 0.23 (95% CI = 0.06-0.40) when the results for dsDNA were omitted. The EIA method was less reliable for assessing nuclear and speckled reactivity patterns, whereas the IFA method presented difficulties detecting...... dsDNA and Ro activity. The automated EIA method was performed in a similar way to the conventional IFA method using HEp-2 cells; thus, automated EIA may be used as a screening test....

New quantum codes derived from a family of antiprimitive BCH codes

Science.gov (United States)

Liu, Yang; Li, Ruihu; Lü, Liangdong; Guo, Luobin

The Bose-Chaudhuri-Hocquenghem (BCH) codes have been studied for more than 57 years and have found wide application in classical communication system and quantum information theory. In this paper, we study the construction of quantum codes from a family of q2-ary BCH codes with length n=q2m+1 (also called antiprimitive BCH codes in the literature), where q≥4 is a power of 2 and m≥2. By a detailed analysis of some useful properties about q2-ary cyclotomic cosets modulo n, Hermitian dual-containing conditions for a family of non-narrow-sense antiprimitive BCH codes are presented, which are similar to those of q2-ary primitive BCH codes. Consequently, via Hermitian Construction, a family of new quantum codes can be derived from these dual-containing BCH codes. Some of these new antiprimitive quantum BCH codes are comparable with those derived from primitive BCH codes.

Surface acoustic wave coding for orthogonal frequency coded devices

Science.gov (United States)

Malocha, Donald (Inventor); Kozlovski, Nikolai (Inventor)

2011-01-01

Methods and systems for coding SAW OFC devices to mitigate code collisions in a wireless multi-tag system. Each device producing plural stepped frequencies as an OFC signal with a chip offset delay to increase code diversity. A method for assigning a different OCF to each device includes using a matrix based on the number of OFCs needed and the number chips per code, populating each matrix cell with OFC chip, and assigning the codes from the matrix to the devices. The asynchronous passive multi-tag system includes plural surface acoustic wave devices each producing a different OFC signal having the same number of chips and including a chip offset time delay, an algorithm for assigning OFCs to each device, and a transceiver to transmit an interrogation signal and receive OFC signals in response with minimal code collisions during transmission.

Factors controlling the population size of microbes in groundwater from AECL's Underground Research Laboratory

Energy Technology Data Exchange (ETDEWEB)

Stroes-Gascoyne, S.; Hamon, C. [Atomic Energy of Canada Limited, Whiteshell Labs., Pinawa, Manitoba (Canada); Mills, K. [University of Saskatoon, Saskatoon, SK (Canada); Rana, S.; Vaidyanathan, S. [Deep River Science Academy, Whiteshell Campus Summer 1997, Pinawa, Manitoba (Canada)

2001-01-01

Microbial populations in groundwaters from AECL's Underground Research Laboratory (URL) range from 10{sup 3} to 10{sup 5} cells/mL. Based on the total dissolved organic carbon (DOC), nitrate and phosphate content of these waters, populations of about 10{sup 5} to 10{sup 7} cells/mL should be possible. Upon storage of groundwater samples, total cell counts generally increase and viable cell counts always increase. A study was undertaken to determine what controls the in situ microbial population size in groundwater and what causes this population to grow upon sampling. Fresh URL groundwater was filter-sterilized, inoculated with small quantities of the unaltered water and incubated in the absence and presence of added nutrients (nitrate, phosphate and glucose). Unfiltered groundwater and R2A growth medium inoculated with unaltered groundwater, were also incubated. Microbial changes over time were followed by total and viable (on R2A medium) cell counts. Results showed that in the absence of any nutrient addition, populations grew to between 5 x 10{sup 5} to 4 x 10{sup 6} cells/mL, regardless of the initial size of the population ({approx}10{sup 1} to 10{sup 4} cells/mL), suggesting that nutrients for growth were available in the unamended groundwater. It was hypothesized that the original groundwater population was in 'equilibrium' with the underground environment, which likely included a large population of sessile cells in biofilms on fracture surfaces. Sampling of the groundwater removed the large demand on nutrient supplies by the sessile population which subsequently allowed the planktonic population to grow to a new 'equilibrium' with the available nutrients in the sample bottles. Addition of single nutrients (C, N or P) did not increase cell numbers, suggesting that more than one nutrient is limiting growth. Glucose was used very efficiently aerobically in the presence of both added N and P, but somewhat less under anaerobic

Separate Turbo Code and Single Turbo Code Adaptive OFDM Transmissions

Directory of Open Access Journals (Sweden)

Burr Alister

2009-01-01

Full Text Available Abstract This paper discusses the application of adaptive modulation and adaptive rate turbo coding to orthogonal frequency-division multiplexing (OFDM, to increase throughput on the time and frequency selective channel. The adaptive turbo code scheme is based on a subband adaptive method, and compares two adaptive systems: a conventional approach where a separate turbo code is used for each subband, and a single turbo code adaptive system which uses a single turbo code over all subbands. Five modulation schemes (BPSK, QPSK, 8AMPM, 16QAM, and 64QAM are employed and turbo code rates considered are and . The performances of both systems with high ( and low ( BER targets are compared. Simulation results for throughput and BER show that the single turbo code adaptive system provides a significant improvement.

Development of MOX fuel database

International Nuclear Information System (INIS)

Ikusawa, Yoshihisa; Ozawa, Takayuki

2007-03-01

We developed MOX Fuel Database, which included valuable data from several irradiation tests in FUGEN and Halden reactor, for help of LWR MOX use. This database includes the data of fabrication and irradiation, and the results of post-irradiation examinations for seven fuel assemblies, i.e. P06, P2R, E03, E06, E07, E08 and E09, irradiated in FUGEN. The highest pellet peak burn-up reached ∼48GWd/t in MOX fuels, of which the maximum plutonium content was ∼6 wt%, irradiated in E09 fuel assembly without any failure. Also the data from the instrumented MOX fuels irradiated in HBWR to study the irradiation behavior of BWR MOX fuels under the steady state condition (IFA-514/565 and IFA-529), under the load-follow operation condition (IFA-554/555) and under the transit condition (IFA-591) are included in this database. The highest assembly burn-up reached ∼56 GWd/t in IFA-565 steady state irradiation test, and the maximum linear power of MOX fuel rods was 58.3-68.4 kW/m without any failure in IFA-591 ramp test. In addition, valuable instrument data, i.e. cladding elongation, fuel stack elongation, fuel center temperature and rod inner pressure were obtained from IFA-554/555 load-follow test. (author)

Iron-Folic Acid Supplementation During Pregnancy Reduces the Risk of Stunting in Children Less Than 2 Years of Age: A Retrospective Cohort Study from Nepal

Directory of Open Access Journals (Sweden)

Yasir Bin Nisar

2016-01-01

Full Text Available The aim of the study was to investigate the effect of antenatal iron-folic acid (IFA supplementation on child stunting in Nepalese children age <2 years. A retrospective cohort study design was used, in which a pooled cohort of 5235 most recent live births 2 years prior to interview from three Nepal Demographic and Health Surveys (2001, 2006 and 2011 was analysed. The primary outcome was stunting in children age <2 years. The main exposure variable was antenatal IFA supplementation. Multivariate Poisson regression analysis was performed. In our sample, 31% and 10% of Nepalese children age <2 years were stunted and severely stunted, respectively. The adjusted relative risk of being stunted was 14% lower in children whose mothers used IFA supplements compared to those whose mothers did not use (aRR = 0.86, 95% CI = 0.77–0.97. Additionally, the adjusted relative risk of being stunted was significantly reduced by 23% when antenatal IFA supplementation was started ≤6 months with ≥90 IFA supplements used during pregnancy (aRR = 0.77, 95% CI = 0.64–0.92. Antenatal IFA supplementation significantly reduced the risk of stunting in Nepalese children age <2 years. The greatest impact on the risk reduction of child stunting was when IFA supplements were started ≤6 months with ≥90 supplements were used.

Codes and curves

CERN Document Server

Walker, Judy L

2000-01-01

When information is transmitted, errors are likely to occur. Coding theory examines efficient ways of packaging data so that these errors can be detected, or even corrected. The traditional tools of coding theory have come from combinatorics and group theory. Lately, however, coding theorists have added techniques from algebraic geometry to their toolboxes. In particular, by re-interpreting the Reed-Solomon codes, one can see how to define new codes based on divisors on algebraic curves. For instance, using modular curves over finite fields, Tsfasman, Vladut, and Zink showed that one can define a sequence of codes with asymptotically better parameters than any previously known codes. This monograph is based on a series of lectures the author gave as part of the IAS/PCMI program on arithmetic algebraic geometry. Here, the reader is introduced to the exciting field of algebraic geometric coding theory. Presenting the material in the same conversational tone of the lectures, the author covers linear codes, inclu...

A compilation of subsurface hydrogeologic data

International Nuclear Information System (INIS)

1986-03-01

This volume contains the permeability data for the research sites discussed in Volume 1 which have been studied in sufficient detail to allow for analysis. These sites are the following: Stripa Mine, Sweden; Finnsjon, Kamlunge, Fjallveden, Gidea, Svartboberget, Sweden; Olkiluoto, Loviisa, Lavia, Finland; Climax Granite Nevada Test Site; OCRD Room, Colorado School of Mines; Savannah River Plant, Aiken, South Carolina; Oracle, Arizona; Basalt Waste Isolation Project (BWIP), Hanford, Washington; Underground Research Laboratory, AECL, Canada; Atikokan Research Area, AECL; Chalk River Research Area, AECL; Whiteshell Research Area, AECL. Other sources of information have been included where sufficient site specific geologic and hydrogeologic information is provided

Separate Turbo Code and Single Turbo Code Adaptive OFDM Transmissions

Directory of Open Access Journals (Sweden)

Lei Ye

2009-01-01

Full Text Available This paper discusses the application of adaptive modulation and adaptive rate turbo coding to orthogonal frequency-division multiplexing (OFDM, to increase throughput on the time and frequency selective channel. The adaptive turbo code scheme is based on a subband adaptive method, and compares two adaptive systems: a conventional approach where a separate turbo code is used for each subband, and a single turbo code adaptive system which uses a single turbo code over all subbands. Five modulation schemes (BPSK, QPSK, 8AMPM, 16QAM, and 64QAM are employed and turbo code rates considered are 1/2 and 1/3. The performances of both systems with high (10−2 and low (10−4 BER targets are compared. Simulation results for throughput and BER show that the single turbo code adaptive system provides a significant improvement.

Quantum Codes From Cyclic Codes Over The Ring R 2

International Nuclear Information System (INIS)