WorldWideScience

Sample records for co-evolving genomic groups

  1. Group normalization for genomic data.

    Science.gov (United States)

    Ghandi, Mahmoud; Beer, Michael A

    2012-01-01

    Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN), to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  2. Group normalization for genomic data.

    Directory of Open Access Journals (Sweden)

    Mahmoud Ghandi

    Full Text Available Data normalization is a crucial preliminary step in analyzing genomic datasets. The goal of normalization is to remove global variation to make readings across different experiments comparable. In addition, most genomic loci have non-uniform sensitivity to any given assay because of variation in local sequence properties. In microarray experiments, this non-uniform sensitivity is due to different DNA hybridization and cross-hybridization efficiencies, known as the probe effect. In this paper we introduce a new scheme, called Group Normalization (GN, to remove both global and local biases in one integrated step, whereby we determine the normalized probe signal by finding a set of reference probes with similar responses. Compared to conventional normalization methods such as Quantile normalization and physically motivated probe effect models, our proposed method is general in the sense that it does not require the assumption that the underlying signal distribution be identical for the treatment and control, and is flexible enough to correct for nonlinear and higher order probe effects. The Group Normalization algorithm is computationally efficient and easy to implement. We also describe a variant of the Group Normalization algorithm, called Cross Normalization, which efficiently amplifies biologically relevant differences between any two genomic datasets.

  3. Functional Genomics Group. Program Description

    National Research Council Canada - National Science Library

    Burian, Dennis

    2008-01-01

    .... This article reviews mechanisms of gene regulation and discusses how genomics is changing the way medicine is practiced today as a means of demonstrating that molecular medicine is here to stay...

  4. Co-evolving prisoner's dilemma: Performance indicators and analytic approaches

    Science.gov (United States)

    Zhang, W.; Choi, C. W.; Li, Y. S.; Xu, C.; Hui, P. M.

    2017-02-01

    Understanding the intrinsic relation between the dynamical processes in a co-evolving network and the necessary ingredients in formulating a reliable theory is an important question and a challenging task. Using two slightly different definitions of performance indicator in the context of a co-evolving prisoner's dilemma game, it is shown that very different cooperative levels result and theories of different complexity are required to understand the key features. When the payoff per opponent is used as the indicator (Case A), non-cooperative strategy has an edge and dominates in a large part of the parameter space formed by the cutting-and-rewiring probability and the strategy imitation probability. When the payoff from all opponents is used (Case B), cooperative strategy has an edge and dominates the parameter space. Two distinct phases, one homogeneous and dynamical and another inhomogeneous and static, emerge and the phase boundary in the parameter space is studied in detail. A simple theory assuming an average competing environment for cooperative agents and another for non-cooperative agents is shown to perform well in Case A. The same theory, however, fails badly for Case B. It is necessary to include more spatial correlation into a theory for Case B. We show that the local configuration approximation, which takes into account of the different competing environments for agents with different strategies and degrees, is needed to give reliable results for Case B. The results illustrate that formulating a proper theory requires both a conceptual understanding of the effects of the adaptive processes in the problem and a delicate balance between simplicity and accuracy.

  5. Network Analysis of Earth's Co-Evolving Geosphere and Biosphere

    Science.gov (United States)

    Hazen, R. M.; Eleish, A.; Liu, C.; Morrison, S. M.; Meyer, M.; Consortium, K. D.

    2017-12-01

    A fundamental goal of Earth science is the deep understanding of Earth's dynamic, co-evolving geosphere and biosphere through deep time. Network analysis of geo- and bio- `big data' provides an interactive, quantitative, and predictive visualization framework to explore complex and otherwise hidden high-dimension features of diversity, distribution, and change in the evolution of Earth's geochemistry, mineralogy, paleobiology, and biochemistry [1]. Networks also facilitate quantitative comparison of different geological time periods, tectonic settings, and geographical regions, as well as different planets and moons, through network metrics, including density, centralization, diameter, and transitivity.We render networks by employing data related to geographical, paragenetic, environmental, or structural relationships among minerals, fossils, proteins, and microbial taxa. An important recent finding is that the topography of many networks reflects parameters not explicitly incorporated in constructing the network. For example, networks for minerals, fossils, and protein structures reveal embedded qualitative time axes, with additional network geometries possibly related to extinction and/or other punctuation events (see Figure). Other axes related to chemical activities and volatile fugacities, as well as pressure and/or depth of formation, may also emerge from network analysis. These patterns provide new insights into the way planets evolve, especially Earth's co-evolving geosphere and biosphere. 1. Morrison, S.M. et al. (2017) Network analysis of mineralogical systems. American Mineralogist 102, in press. Figure Caption: A network of Phanerozoic Era fossil animals from the past 540 million years includes blue, red, and black circles (nodes) representing family-level taxa and grey lines (links) between coexisting families. Age information was not used in the construction of this network; nevertheless an intrinsic timeline is embedded in the network topology. In

  6. How Life and Rocks Have Co-Evolved

    Science.gov (United States)

    Hazen, R.

    2014-04-01

    The near-surface environment of terrestrial planets and moons evolves as a consequence of selective physical, chemical, and biological processes - an evolution that is preserved in the mineralogical record. Mineral evolution begins with approximately 12 different refractory minerals that form in the cooling envelopes of exploding stars. Subsequent aqueous and thermal alteration of planetessimals results in the approximately 250 minerals now found in unweathered lunar and meteorite samples. Following Earth's accretion and differentiation, mineral evolution resulted from a sequence of geochemical and petrologic processes, which led to perhaps 1500 mineral species. According to some origin-of-life scenarios, a planet must progress through at least some of these stages of chemical processing as a prerequisite for life. Once life emerged, mineralogy and biology co-evolved and dramatically increased Earth's mineral diversity to >4000 species. Sequential stages of a planet's near-surface evolution arise from three primary mechanisms: (1) the progressive separation and concentration of the elements from their original relatively uniform distribution in the presolar nebula; (2) the increase in range of intensive variables such as pressure, temperature, and volatile activities; and (3) the generation of far-from-equilibrium conditions by living systems. Remote observations of the mineralogy of other terrestrial bodies may thus provide evidence for biological influences beyond Earth. Recent studies of mineral diversification through time reveal striking correlations with major geochemical, tectonic, and biological events, including large-changes in ocean chemistry, the supercontinent cycle, the increase of atmospheric oxygen, and the rise of the terrestrial biosphere.

  7. Values in the Smart Grid: The co-evolving political economy of smart distribution

    International Nuclear Information System (INIS)

    Hall, Stephen; Foxon, Timothy J.

    2014-01-01

    Investing in smart grid infrastructure is a key enabler for the transition to low carbon energy systems. Recent work has characterised the costs and benefits of individual “smart” investments. The political economy of the UK electricity system, however, has co-evolved such that there is a mismatch between where benefits accrue and where costs are incurred, leading to a problem of value capture and redeployment. Further, some benefits of smart grids are less easy to price directly and can be classified as public goods, such as energy security and decarbonisation. This paper builds on systemic treatments of energy system transitions to characterise the co-evolution of value capture and structural incentives in the electricity distribution system, drawing on semi-structured interviews and focus groups undertaken with smart grid stakeholders in the UK. This leads to an identification of municipal scale values that may be important for business models for the delivery of smart infrastructure. Municipalities may thus pursue specific economic opportunities through smart grid investment. This supports recent practical interest in an expanded role for municipalities as partners and investors in smart grid infrastructures. - Highlights: • Smart grid investments can benefit municipal economic development. • Drawing on urban political economy we describe these values. • New values alter the smart grid investment problem. • New integration of urban policy and DNOs are proposed by this research. • Socio-technical approaches are enhanced by urban political economy and vice versa

  8. InterMap3D: predicting and visualizing co-evolving protein residues

    DEFF Research Database (Denmark)

    Oliveira, Rodrigo Gouveia; Roque, francisco jose sousa simôes almeida; Wernersson, Rasmus

    2009-01-01

    InterMap3D predicts co-evolving protein residues and plots them on the 3D protein structure. Starting with a single protein sequence, InterMap3D automatically finds a set of homologous sequences, generates an alignment and fetches the most similar 3D structure from the Protein Data Bank (PDB......). It can also accept a user-generated alignment. Based on the alignment, co-evolving residues are then predicted using three different methods: Row and Column Weighing of Mutual Information, Mutual Information/Entropy and Dependency. Finally, InterMap3D generates high-quality images of the protein...

  9. Social networks and online environments: when science and practice co-evolve

    OpenAIRE

    Rosen, Devan; Barnett, George A.; Kim, Jang Hyun

    2011-01-01

    The science of social network analysis has co-evolved with the development of online environments and computer-mediated communication. Unique and precise data available from computer and information systems have allowed network scientists to explore novel social phenomena and develop new methods. Additionally, advances in the structural analysis and visualization of computer-mediated social networks have informed developers and shaped the design of social media tools. This article reviews som...

  10. Adaptive cyclically dominating game on co-evolving networks: numerical and analytic results

    Science.gov (United States)

    Choi, Chi Wun; Xu, Chen; Hui, Pak Ming

    2017-10-01

    A co-evolving and adaptive Rock (R)-Paper (P)-Scissors (S) game (ARPS) in which an agent uses one of three cyclically dominating strategies is proposed and studied numerically and analytically. An agent takes adaptive actions to achieve a neighborhood to his advantage by rewiring a dissatisfying link with a probability p or switching strategy with a probability 1 - p. Numerical results revealed two phases in the steady state. An active phase for p pc has three separate clusters of agents using only R, P, and S, respectively with terminated adaptive actions. A mean-field theory based on the link densities in co-evolving network is formulated and the trinomial closure scheme is applied to obtain analytical solutions. The analytic results agree with simulation results on ARPS well. In addition, the different probabilities of winning, losing, and drawing a game among the agents are identified as the origin of the small discrepancy between analytic and simulation results. As a result of the adaptive actions, agents of higher degrees are often those being taken advantage of. Agents with a smaller (larger) degree than the mean degree have a higher (smaller) probability of winning than losing. The results are informative for future attempts on formulating more accurate theories.

  11. Directed evolution to re-adapt a co-evolved network within an enzyme.

    Science.gov (United States)

    Strafford, John; Payongsri, Panwajee; Hibbert, Edward G; Morris, Phattaraporn; Batth, Sukhjeet S; Steadman, David; Smith, Mark E B; Ward, John M; Hailes, Helen C; Dalby, Paul A

    2012-01-01

    We have previously used targeted active-site saturation mutagenesis to identify a number of transketolase single mutants that improved activity towards either glycolaldehyde (GA), or the non-natural substrate propionaldehyde (PA). Here, all attempts to recombine the singles into double mutants led to unexpected losses of specific activity towards both substrates. A typical trade-off occurred between soluble expression levels and specific activity for all single mutants, but many double mutants decreased both properties more severely suggesting a critical loss of protein stability or native folding. Statistical coupling analysis (SCA) of a large multiple sequence alignment revealed a network of nine co-evolved residues that affected all but one double mutant. Such networks maintain important functional properties such as activity, specificity, folding, stability, and solubility and may be rapidly disrupted by introducing one or more non-naturally occurring mutations. To identify variants of this network that would accept and improve upon our best D469 mutants for activity towards PA, we created a library of random single, double and triple mutants across seven of the co-evolved residues, combining our D469 variants with only naturally occurring mutations at the remaining sites. A triple mutant cluster at D469, E498 and R520 was found to behave synergistically for the specific activity towards PA. Protein expression was severely reduced by E498D and improved by R520Q, yet variants containing both mutations led to improved specific activity and enzyme expression, but with loss of solubility and the formation of inclusion bodies. D469S and R520Q combined synergistically to improve k(cat) 20-fold for PA, more than for any previous transketolase mutant. R520Q also doubled the specific activity of the previously identified D469T to create our most active transketolase mutant to date. Our results show that recombining active-site mutants obtained by saturation mutagenesis

  12. Genome plasticity of Vibrio parahaemolyticus: microevolution of the 'pandemic group'

    Directory of Open Access Journals (Sweden)

    Liu Xiumei

    2008-11-01

    Full Text Available Abstract Background Outbreak of V. parahaemolyticus infections occurred since 1996 was linked to a proposed clonal complex, the pandemic group. The whole genome sequence provides an unprecedented opportunity for dissecting genome plasticity and phylogeny of the populations of V. parahaemolyticus. In the present work, a whole-genome cDNA microarray was constructed to compare the genomic contents of a collection of 174 strains of V. parahaemolyticus. Results Genes that present variably in the genome accounted for about 22% of the whole gene pool on the genome. The phylogenetic analysis of microarray data generated a minimum spanning tree that depicted the phylogenetic structure of the 174 strains. Strains were assigned into five complexes (C1 to C5, and those in each complex were related genetically and phylogenetically. C3 and C4 represented highly virulent clinical clones. C2 and C3 constituted two different clonal complexes 'old-O3:K6 clone' and 'pandemic clone', respectively. C3 included all the 39 pandemic strains tested (trh-, tdh+ and GS-PCR+, while C2 contained 12 pre-1996 'old' O3:K6 strains (trh+, tdh- and GS-PCR- tested herein. The pandemic clone (post-1996 'new' O3:K6 and its derivates O4:K68, O1:K25, O1:KUT and O6:K18 might be emerged from the old-O3:K6 clone, which was promoted by acquisition of toxRS/new sequence and genomic islands. A phylogenetic intermediate O3:K6 clade (trh-, tdh- and GS-PCR+ was identified between the pandemic and old-O3:K6 clones. Conclusion A comprehensive overview of genomic contents in a large collection of global isolates from the microarray-based comparative genomic hybridization data enabled us to construct a phylogenetic structure of V. parahaemolyticus and an evolutionary history of the pandemic group (clone of this pathogen.

  13. Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

    Science.gov (United States)

    Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

    2016-01-01

    Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

  14. Group sparse canonical correlation analysis for genomic data integration.

    Science.gov (United States)

    Lin, Dongdong; Zhang, Jigang; Li, Jingyao; Calhoun, Vince D; Deng, Hong-Wen; Wang, Yu-Ping

    2013-08-12

    The emergence of high-throughput genomic datasets from different sources and platforms (e.g., gene expression, single nucleotide polymorphisms (SNP), and copy number variation (CNV)) has greatly enhanced our understandings of the interplay of these genomic factors as well as their influences on the complex diseases. It is challenging to explore the relationship between these different types of genomic data sets. In this paper, we focus on a multivariate statistical method, canonical correlation analysis (CCA) method for this problem. Conventional CCA method does not work effectively if the number of data samples is significantly less than that of biomarkers, which is a typical case for genomic data (e.g., SNPs). Sparse CCA (sCCA) methods were introduced to overcome such difficulty, mostly using penalizations with l-1 norm (CCA-l1) or the combination of l-1and l-2 norm (CCA-elastic net). However, they overlook the structural or group effect within genomic data in the analysis, which often exist and are important (e.g., SNPs spanning a gene interact and work together as a group). We propose a new group sparse CCA method (CCA-sparse group) along with an effective numerical algorithm to study the mutual relationship between two different types of genomic data (i.e., SNP and gene expression). We then extend the model to a more general formulation that can include the existing sCCA models. We apply the model to feature/variable selection from two data sets and compare our group sparse CCA method with existing sCCA methods on both simulation and two real datasets (human gliomas data and NCI60 data). We use a graphical representation of the samples with a pair of canonical variates to demonstrate the discriminating characteristic of the selected features. Pathway analysis is further performed for biological interpretation of those features. The CCA-sparse group method incorporates group effects of features into the correlation analysis while performs individual feature

  15. Conserved genomic organisation of Group B Sox genes in insects.

    Directory of Open Access Journals (Sweden)

    Woerfel Gertrud

    2005-05-01

    Full Text Available Abstract Background Sox domain containing genes are important metazoan transcriptional regulators implicated in a wide rage of developmental processes. The vertebrate B subgroup contains the Sox1, Sox2 and Sox3 genes that have early functions in neural development. Previous studies show that Drosophila Group B genes have been functionally conserved since they play essential roles in early neural specification and mutations in the Drosophila Dichaete and SoxN genes can be rescued with mammalian Sox genes. Despite their importance, the extent and organisation of the Group B family in Drosophila has not been fully characterised, an important step in using Drosophila to examine conserved aspects of Group B Sox gene function. Results We have used the directed cDNA sequencing along with the output from the publicly-available genome sequencing projects to examine the structure of Group B Sox domain genes in Drosophila melanogaster, Drosophila pseudoobscura, Anopheles gambiae and Apis mellifora. All of the insect genomes contain four genes encoding Group B proteins, two of which are intronless, as is the case with vertebrate group B genes. As has been previously reported and unusually for Group B genes, two of the insect group B genes, Sox21a and Sox21b, contain introns within their DNA-binding domains. We find that the highly unusual multi-exon structure of the Sox21b gene is common to the insects. In addition, we find that three of the group B Sox genes are organised in a linked cluster in the insect genomes. By in situ hybridisation we show that the pattern of expression of each of the four group B genes during embryogenesis is conserved between D. melanogaster and D. pseudoobscura. Conclusion The DNA-binding domain sequences and genomic organisation of the group B genes have been conserved over 300 My of evolution since the last common ancestor of the Hymenoptera and the Diptera. Our analysis suggests insects have two Group B1 genes, SoxN and

  16. Molecular Epidemiology and Genomics of Group A Streptococcus

    Science.gov (United States)

    Bessen, Debra E.; McShan, W. Michael; Nguyen, Scott V.; Shetty, Amol; Agrawal, Sonia; Tettelin, Hervé

    2014-01-01

    Streptococcus pyogenes (group A streptococcus; GAS) is a strict human pathogen with a very high prevalence worldwide. This review highlights the genetic organization of the species and the important ecological considerations that impact its evolution. Recent advances are presented on the topics of molecular epidemiology, population biology, molecular basis for genetic change, genome structure and genetic flux, phylogenomics and closely related streptococcal species, and the long- and short-term evolution of GAS. The application of whole genome sequence data to addressing key biological questions is discussed. PMID:25460818

  17. Comparative genome analysis of Bacillus cereus group genomes withBacillus subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Iain; Sorokin, Alexei; Kapatral, Vinayak; Reznik, Gary; Bhattacharya, Anamitra; Mikhailova, Natalia; Burd, Henry; Joukov, Victor; Kaznadzey, Denis; Walunas, Theresa; D' Souza, Mark; Larsen, Niels; Pusch,Gordon; Liolios, Konstantinos; Grechkin, Yuri; Lapidus, Alla; Goltsman,Eugene; Chu, Lien; Fonstein, Michael; Ehrlich, S. Dusko; Overbeek, Ross; Kyrpides, Nikos; Ivanova, Natalia

    2005-09-14

    Genome features of the Bacillus cereus group genomes (representative strains of Bacillus cereus, Bacillus anthracis and Bacillus thuringiensis sub spp israelensis) were analyzed and compared with the Bacillus subtilis genome. A core set of 1,381 protein families among the four Bacillus genomes, with an additional set of 933 families common to the B. cereus group, was identified. Differences in signal transduction pathways, membrane transporters, cell surface structures, cell wall, and S-layer proteins suggesting differences in their phenotype were identified. The B. cereus group has signal transduction systems including a tyrosine kinase related to two-component system histidine kinases from B. subtilis. A model for regulation of the stress responsive sigma factor sigmaB in the B. cereus group different from the well studied regulation in B. subtilis has been proposed. Despite a high degree of chromosomal synteny among these genomes, significant differences in cell wall and spore coat proteins that contribute to the survival and adaptation in specific hosts has been identified.

  18. Autonomous Agent-Based Systems and Their Applications in Fluid Dynamics, Particle Separation, and Co-evolving Networks

    Science.gov (United States)

    Graeser, Oliver

    This thesis comprises three parts, reporting research results in Fluid Dynamics (Part I), Particle Separation (Part II) and Co-evolving Networks (Part III). Part I deals with the simulation of fluid dynamics using the lattice-Boltzmann method. Microfluidic devices often feature two-dimensional, repetitive arrays. Flows through such devices are pressure-driven and confined by solid walls. We have defined new adaptive generalised periodic boundary conditions to represent the effects of outer solid walls, and are thus able to exploit the periodicity of the array by simulating the flow through one unit cell in lieu of the entire device. The so-calculated fully developed flow describes the flow through the entire array accurately, but with computational requirements that are reduced according to the dimensions of the array. Part II discusses the problem of separating macromolecules like proteins or DNA coils. The reliable separation of such molecules is a crucial task in molecular biology. The use of Brownian ratchets as mechanisms for the separation of such particles has been proposed and discussed during the last decade. Pressure-driven flows have so far been dismissed as possible driving forces for Brownian ratchets, as they do not generate ratchet asymmetry. We propose a microfluidic design that uses pressure-driven flows to create asymmetry and hence allows particle separation. The dependence of the asymmetry on various factors of the microfluidic geometry is discussed. We further exemplify the feasibility of our approach using Brownian dynamics simulations of particles of different sizes in such a device. The results show that ratchet-based particle separation using flows as the driving force is possible. Simulation results and ratchet theory predictions are in excellent agreement. Part III deals with the co-evolution of networks and dynamic models. A group of agents occupies the nodes of a network, which defines the relationship between these agents. The

  19. Partially satisfied to fully satisfied transitions in co-evolving inverse voter model and possible scaling behavior

    International Nuclear Information System (INIS)

    Choi, C.W.; Xu, C.; Hui, P.M.

    2015-01-01

    Understanding co-evolving networks characterized by the mutual influence of agents' actions and network structure remains a challenge. We study a co-evolving inverse voter model in which agents adapt to achieve a preferred environment with more opposite-opinion neighbors by rewiring their connections and switching opinion. Numerical studies reveal a transition from a dynamic partially satisfied phase to a frozen fully satisfied phase as the rewiring probability is varied. A simple mean field theory is shown to capture the behavior only qualitatively. An improved mean field theory carrying a longer spatial correlation gives better results. Motivated by numerical results in networks of different degrees and mean field results, we propose a scaling variable that combines the rewiring probability and mean degree in a special form. The scaling variable is shown to work well in analyzing data corresponding to different networks and different rewiring probabilities. An application is to predict the results for networks of different degrees based solely on results obtained from networks of one degree. Studying scaling behavior provides an alternative path for understanding co-evolving agent-based dynamical systems, especially in light of the trade-off between complexity of a theory and its accuracy. - Highlights: • Identified key features and phase transitions in coevolving inverse voter model. • Constructed a better theory incorporating longer spatial correlation. • Proposed scaling variable and illustrated possible scaling behavior. • Used scaling behavior to predict results of IVM in a different network.

  20. Modeling growth and dissemination of lymphoma in a co-evolving lymph node: a diffuse-domain approach

    Science.gov (United States)

    Chuang, Yao-Li; Cristini, Vittorio; Chen, Ying; Li, Xiangrong; Frieboes, Hermann; Lowengrub, John

    2013-03-01

    While partial differential equation models of tumor growth have successfully described various spatiotemporal phenomena observed for in-vitro tumor spheroid experiments, one challenge towards taking these models to further study in-vivo tumors is that instead of relatively static tissue culture with regular boundary conditions, in-vivo tumors are often confined in organ tissues that co-evolve with the tumor growth. Here we adopt a recently developed diffuse-domain method to account for the co-evolving domain boundaries, adapting our previous in-vitro tumor model for the development of lymphoma encapsulated in a lymph node, which may swell or shrink due to proliferation and dissemination of lymphoma cells and treatment by chemotherapy. We use the model to study the induced spatial heterogeneity, which may arise as an emerging phenomenon in experimental observations and model analysis. Spatial heterogeneity is believed to lead to tumor infiltration patterns and reduce the efficacy of chemotherapy, leaving residuals that cause cancer relapse after the treatment. Understanding the spatiotemporal evolution of in-vivo tumors can be an essential step towards more effective strategies of curing cancer. Supported by NIH-PSOC grant 1U54CA143907-01.

  1. Genomic signatures of evolutionary transitions from solitary to group living

    Science.gov (United States)

    Kapheim, Karen M.; Pan, Hailin; Li, Cai; Salzberg, Steven L.; Puiu, Daniela; Magoc, Tanja; Robertson, Hugh M.; Hudson, Matthew E.; Venkat, Aarti; Fischman, Brielle J.; Hernandez, Alvaro; Yandell, Mark; Ence, Daniel; Holt, Carson; Yocum, George D.; Kemp, William P.; Bosch, Jordi; Waterhouse, Robert M.; Zdobnov, Evgeny M.; Stolle, Eckart; Kraus, F. Bernhard; Helbing, Sophie; Moritz, Robin F. A.; Glastad, Karl M.; Hunt, Brendan G.; Goodisman, Michael A. D.; Hauser, Frank; Grimmelikhuijzen, Cornelis J. P.; Pinheiro, Daniel Guariz; Nunes, Francis Morais Franco; Soares, Michelle Prioli Miranda; Tanaka, Érica Donato; Simões, Zilá Luz Paulino; Hartfelder, Klaus; Evans, Jay D.; Barribeau, Seth M.; Johnson, Reed M.; Massey, Jonathan H.; Southey, Bruce R.; Hasselmann, Martin; Hamacher, Daniel; Biewer, Matthias; Kent, Clement F.; Zayed, Amro; Blatti, Charles; Sinha, Saurabh; Johnston, J. Spencer; Hanrahan, Shawn J.; Kocher, Sarah D.; Wang, Jun; Robinson, Gene E.; Zhang, Guojie

    2017-01-01

    The evolution of eusociality is one of the major transitions in evolution, but the underlying genomic changes are unknown. We compared the genomes of 10 bee species that vary in social complexity, representing multiple independent transitions in social evolution, and report three major findings. First, many important genes show evidence of neutral evolution as a consequence of relaxed selection with increasing social complexity. Second, there is no single road map to eusociality; independent evolutionary transitions in sociality have independent genetic underpinnings. Third, though clearly independent in detail, these transitions do have similar general features, including an increase in constrained protein evolution accompanied by increases in the potential for gene regulation and decreases in diversity and abundance of transposable elements. Eusociality may arise through different mechanisms each time, but would likely always involve an increase in the complexity of gene networks. PMID:25977371

  2. Comparative Genomics of the Bacterial Genus Streptococcus Illuminates Evolutionary Implications of Species Groups

    Science.gov (United States)

    Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; Klenk, Hans-Peter; Li, Wen-Jun

    2014-01-01

    Members of the genus Streptococcus within the phylum Firmicutes are among the most diverse and significant zoonotic pathogens. This genus has gone through considerable taxonomic revision due to increasing improvements of chemotaxonomic approaches, DNA hybridization and 16S rRNA gene sequencing. It is proposed to place the majority of streptococci into “species groups”. However, the evolutionary implications of species groups are not clear presently. We use comparative genomic approaches to yield a better understanding of the evolution of Streptococcus through genome dynamics, population structure, phylogenies and virulence factor distribution of species groups. Genome dynamics analyses indicate that the pan-genome size increases with the addition of newly sequenced strains, while the core genome size decreases with sequential addition at the genus level and species group level. Population structure analysis reveals two distinct lineages, one including Pyogenic, Bovis, Mutans and Salivarius groups, and the other including Mitis, Anginosus and Unknown groups. Phylogenetic dendrograms show that species within the same species group cluster together, and infer two main clades in accordance with population structure analysis. Distribution of streptococcal virulence factors has no obvious patterns among the species groups; however, the evolution of some common virulence factors is congruous with the evolution of species groups, according to phylogenetic inference. We suggest that the proposed streptococcal species groups are reasonable from the viewpoints of comparative genomics; evolution of the genus is congruent with the individual evolutionary trajectories of different species groups. PMID:24977706

  3. Alignment-free genome tree inference by learning group-specific distance metrics.

    Science.gov (United States)

    Patil, Kaustubh R; McHardy, Alice C

    2013-01-01

    Understanding the evolutionary relationships between organisms is vital for their in-depth study. Gene-based methods are often used to infer such relationships, which are not without drawbacks. One can now attempt to use genome-scale information, because of the ever increasing number of genomes available. This opportunity also presents a challenge in terms of computational efficiency. Two fundamentally different methods are often employed for sequence comparisons, namely alignment-based and alignment-free methods. Alignment-free methods rely on the genome signature concept and provide a computationally efficient way that is also applicable to nonhomologous sequences. The genome signature contains evolutionary signal as it is more similar for closely related organisms than for distantly related ones. We used genome-scale sequence information to infer taxonomic distances between organisms without additional information such as gene annotations. We propose a method to improve genome tree inference by learning specific distance metrics over the genome signature for groups of organisms with similar phylogenetic, genomic, or ecological properties. Specifically, our method learns a Mahalanobis metric for a set of genomes and a reference taxonomy to guide the learning process. By applying this method to more than a thousand prokaryotic genomes, we showed that, indeed, better distance metrics could be learned for most of the 18 groups of organisms tested here. Once a group-specific metric is available, it can be used to estimate the taxonomic distances for other sequenced organisms from the group. This study also presents a large scale comparison between 10 methods--9 alignment-free and 1 alignment-based.

  4. Phage morphology recapitulates phylogeny: the comparative genomics of a new group of myoviruses.

    Directory of Open Access Journals (Sweden)

    André M Comeau

    Full Text Available Among dsDNA tailed bacteriophages (Caudovirales, members of the Myoviridae family have the most sophisticated virion design that includes a complex contractile tail structure. The Myoviridae generally have larger genomes than the other phage families. Relatively few "dwarf" myoviruses, those with a genome size of less than 50 kb such as those of the Mu group, have been analyzed in extenso. Here we report on the genome sequencing and morphological characterization of a new group of such phages that infect a diverse range of Proteobacteria, namely Aeromonas salmonicida phage 56, Vibrio cholerae phages 138 and CP-T1, Bdellovibrio phage φ1422, and Pectobacterium carotovorum phage ZF40. This group of dwarf myoviruses shares an identical virion morphology, characterized by usually short contractile tails, and have genome sizes of approximately 45 kb. Although their genome sequences are variable in their lysogeny, replication, and host adaption modules, presumably reflecting differing lifestyles and hosts, their structural and morphogenesis modules have been evolutionarily constrained by their virion morphology. Comparative genomic analysis reveals that these phages, along with related prophage genomes, form a new coherent group within the Myoviridae. The results presented in this communication support the hypothesis that the diversity of phages may be more structured than generally believed and that the innumerable phages in the biosphere all belong to discrete lineages or families.

  5. 'LABNOTE', a laboratory notebook system designed for academic genomics groups.

    Science.gov (United States)

    Imbert, M C; Nguyen, V K; Granjeaud, S; Nguyen, C; Jordan, B R

    1999-01-15

    We have developed a relational laboratory database system, adapted to the daily book-keeping needs of laboratories that must keep track of information acquired on hundreds or thousands of clones in an effective and user-friendly fashion. Data, whether final or related to experiments in progress, can be accessed in many different ways, e.g. by clone name, by gene, by experiment or through DNA sequence. Updating, import and export of results is made easier by specially developed tools. This system, in network version, serves several groups in our Institute and (over the Internet) elsewhere, and is instrumental in collaborative studies based on expression profiling. It can be used in many similar situations involving progressiveaccumulation of information on sets of clones or related objects.

  6. StreptoBase: An Oral Streptococcus mitis Group Genomic Resource and Analysis Platform.

    Directory of Open Access Journals (Sweden)

    Wenning Zheng

    Full Text Available The oral streptococci are spherical Gram-positive bacteria categorized under the phylum Firmicutes which are among the most common causative agents of bacterial infective endocarditis (IE and are also important agents in septicaemia in neutropenic patients. The Streptococcus mitis group is comprised of 13 species including some of the most common human oral colonizers such as S. mitis, S. oralis, S. sanguinis and S. gordonii as well as species such as S. tigurinus, S. oligofermentans and S. australis that have only recently been classified and are poorly understood at present. We present StreptoBase, which provides a specialized free resource focusing on the genomic analyses of oral species from the mitis group. It currently hosts 104 S. mitis group genomes including 27 novel mitis group strains that we sequenced using the high throughput Illumina HiSeq technology platform, and provides a comprehensive set of genome sequences for analyses, particularly comparative analyses and visualization of both cross-species and cross-strain characteristics of S. mitis group bacteria. StreptoBase incorporates sophisticated in-house designed bioinformatics web tools such as Pairwise Genome Comparison (PGC tool and Pathogenomic Profiling Tool (PathoProT, which facilitate comparative pathogenomics analysis of Streptococcus strains. Examples are provided to demonstrate how StreptoBase can be employed to compare genome structure of different S. mitis group bacteria and putative virulence genes profile across multiple streptococcal strains. In conclusion, StreptoBase offers access to a range of streptococci genomic resources as well as analysis tools and will be an invaluable platform to accelerate research in streptococci. Database URL: http://streptococcus.um.edu.my.

  7. StreptoBase: An Oral Streptococcus mitis Group Genomic Resource and Analysis Platform.

    Science.gov (United States)

    Zheng, Wenning; Tan, Tze King; Paterson, Ian C; Mutha, Naresh V R; Siow, Cheuk Chuen; Tan, Shi Yang; Old, Lesley A; Jakubovics, Nicholas S; Choo, Siew Woh

    2016-01-01

    The oral streptococci are spherical Gram-positive bacteria categorized under the phylum Firmicutes which are among the most common causative agents of bacterial infective endocarditis (IE) and are also important agents in septicaemia in neutropenic patients. The Streptococcus mitis group is comprised of 13 species including some of the most common human oral colonizers such as S. mitis, S. oralis, S. sanguinis and S. gordonii as well as species such as S. tigurinus, S. oligofermentans and S. australis that have only recently been classified and are poorly understood at present. We present StreptoBase, which provides a specialized free resource focusing on the genomic analyses of oral species from the mitis group. It currently hosts 104 S. mitis group genomes including 27 novel mitis group strains that we sequenced using the high throughput Illumina HiSeq technology platform, and provides a comprehensive set of genome sequences for analyses, particularly comparative analyses and visualization of both cross-species and cross-strain characteristics of S. mitis group bacteria. StreptoBase incorporates sophisticated in-house designed bioinformatics web tools such as Pairwise Genome Comparison (PGC) tool and Pathogenomic Profiling Tool (PathoProT), which facilitate comparative pathogenomics analysis of Streptococcus strains. Examples are provided to demonstrate how StreptoBase can be employed to compare genome structure of different S. mitis group bacteria and putative virulence genes profile across multiple streptococcal strains. In conclusion, StreptoBase offers access to a range of streptococci genomic resources as well as analysis tools and will be an invaluable platform to accelerate research in streptococci. Database URL: http://streptococcus.um.edu.my.

  8. Towards understanding the first genome sequence of a crenarchaeon by genome annotation using clusters of orthologous groups of proteins (COGs).

    Science.gov (United States)

    Natale, D A; Shankavaram, U T; Galperin, M Y; Wolf, Y I; Aravind, L; Koonin, E V

    2000-01-01

    Standard archival sequence databases have not been designed as tools for genome annotation and are far from being optimal for this purpose. We used the database of Clusters of Orthologous Groups of proteins (COGs) to reannotate the genomes of two archaea, Aeropyrum pernix, the first member of the Crenarchaea to be sequenced, and Pyrococcus abyssi. A. pernix and P. abyssi proteins were assigned to COGs using the COGNITOR program; the results were verified on a case-by-case basis and augmented by additional database searches using the PSI-BLAST and TBLASTN programs. Functions were predicted for over 300 proteins from A. pernix, which could not be assigned a function using conventional methods with a conservative sequence similarity threshold, an approximately 50% increase compared to the original annotation. A. pernix shares most of the conserved core of proteins that were previously identified in the Euryarchaeota. Cluster analysis or distance matrix tree construction based on the co-occurrence of genomes in COGs showed that A. pernix forms a distinct group within the archaea, although grouping with the two species of Pyrococci, indicative of similar repertoires of conserved genes, was observed. No indication of a specific relationship between Crenarchaeota and eukaryotes was obtained in these analyses. Several proteins that are conserved in Euryarchaeota and most bacteria are unexpectedly missing in A. pernix, including the entire set of de novo purine biosynthesis enzymes, the GTPase FtsZ (a key component of the bacterial and euryarchaeal cell-division machinery), and the tRNA-specific pseudouridine synthase, previously considered universal. A. pernix is represented in 48 COGs that do not contain any euryarchaeal members. Many of these proteins are TCA cycle and electron transport chain enzymes, reflecting the aerobic lifestyle of A. pernix. Special-purpose databases organized on the basis of phylogenetic analysis and carefully curated with respect to known and

  9. Whole-genome phylogeny of Escherichia coli/Shigella group by feature frequency profiles (FFPs)

    Science.gov (United States)

    Sims, Gregory E.; Kim, Sung-Hou

    2011-01-01

    A whole-genome phylogeny of the Escherichia coli/Shigella group was constructed by using the feature frequency profile (FFP) method. This alignment-free approach uses the frequencies of l-mer features of whole genomes to infer phylogenic distances. We present two phylogenies that accentuate different aspects of E. coli/Shigella genomic evolution: (i) one based on the compositions of all possible features of length l = 24 (∼8.4 million features), which are likely to reveal the phenetic grouping and relationship among the organisms and (ii) the other based on the compositions of core features with low frequency and low variability (∼0.56 million features), which account for ∼69% of all commonly shared features among 38 taxa examined and are likely to have genome-wide lineal evolutionary signal. Shigella appears as a single clade when all possible features are used without filtering of noncore features. However, results using core features show that Shigella consists of at least two distantly related subclades, implying that the subclades evolved into a single clade because of a high degree of convergence influenced by mobile genetic elements and niche adaptation. In both FFP trees, the basal group of the E. coli/Shigella phylogeny is the B2 phylogroup, which contains primarily uropathogenic strains, suggesting that the E. coli/Shigella ancestor was likely a facultative or opportunistic pathogen. The extant commensal strains diverged relatively late and appear to be the result of reductive evolution of genomes. We also identify clade distinguishing features and their associated genomic regions within each phylogroup. Such features may provide useful information for understanding evolution of the groups and for quick diagnostic identification of each phylogroup. PMID:21536867

  10. Whole-genome pyrosequencing of an epidemic multidrug-resistant Acinetobacter baumannii strain belonging to the European clone II group

    DEFF Research Database (Denmark)

    Iacono, M.; Villa, L.; Fortini, D.

    2008-01-01

    The whole-genome sequence of an epidemic, multidrug-resistant Acinetobacter baumannii strain (strain ACICU) belonging to the European clone II group and carrying the plasmid-mediated bla(OXA-58) carbapenem resistance gene was determined. The A. baumannii ACICU genome was compared with the genomes...

  11. Complete genome sequence of the bioleaching bacterium Leptospirillum sp. group II strain CF-1.

    Science.gov (United States)

    Ferrer, Alonso; Bunk, Boyke; Spröer, Cathrin; Biedendieck, Rebekka; Valdés, Natalia; Jahn, Martina; Jahn, Dieter; Orellana, Omar; Levicán, Gloria

    2016-03-20

    We describe the complete genome sequence of Leptospirillum sp. group II strain CF-1, an acidophilic bioleaching bacterium isolated from an acid mine drainage (AMD). This work provides data to gain insights about adaptive response of Leptospirillum spp. to the extreme conditions of bioleaching environments. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. "Is It Worth Knowing?" Focus Group Participants' Perceived Utility of Genomic Preconception Carrier Screening.

    Science.gov (United States)

    Schneider, Jennifer L; Goddard, Katrina A B; Davis, James; Wilfond, Benjamin; Kauffman, Tia L; Reiss, Jacob A; Gilmore, Marian; Himes, Patricia; Lynch, Frances L; Leo, Michael C; McMullen, Carmit

    2016-02-01

    As genome sequencing technology advances, research is needed to guide decision-making about what results can or should be offered to patients in different clinical settings. We conducted three focus groups with individuals who had prior preconception genetic testing experience to explore perceived advantages and disadvantages of genome sequencing for preconception carrier screening, compared to usual care. Using a discussion guide, a trained qualitative moderator facilitated the audio-recorded focus groups. Sixteen individuals participated. Thematic analysis of transcripts started with a grounded approach and subsequently focused on participants' perceptions of the value of genetic information. Analysis uncovered two orientations toward genomic preconception carrier screening: "certain" individuals desiring all possible screening information; and "hesitant" individuals who were more cautious about its value. Participants revealed valuable information about barriers to screening: fear/anxiety about results; concerns about the method of returning results; concerns about screening necessity; and concerns about partner participation. All participants recommended offering choice to patients to enhance the value of screening and reduce barriers. Overall, two groups of likely users of genome sequencing for preconception carrier screening demonstrated different perceptions of the advantages or disadvantages of screening, suggesting tailored approaches to education, consent, and counseling may be warranted with each group.

  13. Whole genome sequencing as a tool for phylogenetic analysis of clinical strains of Mitis group streptococci

    DEFF Research Database (Denmark)

    Rasmusen, L. H.; Dargis, R.; Iversen, Katrine Højholt

    2016-01-01

    observed in single gene analyses. Species identification based on single gene analysis showed their limitations when more strains were included. In contrast, analyses incorporating more sequence data, like MLSA, SNPs and core-genome analyses, provided more distinct clustering. The core-genome tree showed......Identification of Mitis group streptococci (MGS) to the species level is challenging for routine microbiology laboratories. Correct identification is crucial for the diagnosis of infective endocarditis, identification of treatment failure, and/or infection relapse. Eighty MGS from Danish patients...

  14. The visualCMAT: A web-server to select and interpret correlated mutations/co-evolving residues in protein families.

    Science.gov (United States)

    Suplatov, Dmitry; Sharapova, Yana; Timonina, Daria; Kopylov, Kirill; Švedas, Vytas

    2018-04-01

    The visualCMAT web-server was designed to assist experimental research in the fields of protein/enzyme biochemistry, protein engineering, and drug discovery by providing an intuitive and easy-to-use interface to the analysis of correlated mutations/co-evolving residues. Sequence and structural information describing homologous proteins are used to predict correlated substitutions by the Mutual information-based CMAT approach, classify them into spatially close co-evolving pairs, which either form a direct physical contact or interact with the same ligand (e.g. a substrate or a crystallographic water molecule), and long-range correlations, annotate and rank binding sites on the protein surface by the presence of statistically significant co-evolving positions. The results of the visualCMAT are organized for a convenient visual analysis and can be downloaded to a local computer as a content-rich all-in-one PyMol session file with multiple layers of annotation corresponding to bioinformatic, statistical and structural analyses of the predicted co-evolution, or further studied online using the built-in interactive analysis tools. The online interactivity is implemented in HTML5 and therefore neither plugins nor Java are required. The visualCMAT web-server is integrated with the Mustguseal web-server capable of constructing large structure-guided sequence alignments of protein families and superfamilies using all available information about their structures and sequences in public databases. The visualCMAT web-server can be used to understand the relationship between structure and function in proteins, implemented at selecting hotspots and compensatory mutations for rational design and directed evolution experiments to produce novel enzymes with improved properties, and employed at studying the mechanism of selective ligand's binding and allosteric communication between topologically independent sites in protein structures. The web-server is freely available at https

  15. Australians' views on personal genomic testing: focus group findings from the Genioz study.

    Science.gov (United States)

    Metcalfe, Sylvia A; Hickerton, Chriselle; Savard, Jacqueline; Terrill, Bronwyn; Turbitt, Erin; Gaff, Clara; Gray, Kathleen; Middleton, Anna; Wilson, Brenda; Newson, Ainsley J

    2018-04-30

    Personal genomic testing provides healthy individuals with access to information about their genetic makeup for purposes including ancestry, paternity, sporting ability and health. Such tests are available commercially and globally, with accessibility expected to continue to grow, including in Australia; yet little is known of the views/expectations of Australians. Focus groups were conducted within a multi-stage, cross-disciplinary project (Genioz) to explore this. In mid-2015, 56 members of the public participated in seven focus groups, allocated into three age groups: 18-24, 25-49, and ≥50 years. Three researchers coded transcripts independently and generated themes. Awareness of personal genomic testing was low, but most could deduce what "personal genomics" might entail. Very few had heard of the term "direct-to-consumer" testing, which has implications for organisations developing information to support individuals in their decision-making. Participants' understanding of genetics was varied and drawn from several sources. There were diverse perceptions of the relative influence of genetics and environment on health, mental health, behavior, talent, or personality. Views about having a personal genomic test were mixed, with greater interest in health-related tests if they believed there was a reason for doing so. However, many expressed scepticisms about the types of tests available, and how the information might be used; concerns were also raised about privacy and the potential for discrimination. These exploratory findings inform subsequent stages of the Genioz study, thereby contributing to strategies of supporting Australians to understand and make meaningful and well-considered decisions about the benefits, harms, and implications of personal genomic tests.

  16. A genomic insight into diversity among tribal and nontribal population groups of Manipur, India.

    Science.gov (United States)

    Saraswathy, K N; Kiranmala, Naorem; Murry, Benrithung; Sinha, Ekata; Saksena, Deepti; Kaur, Harpreet; Sachdeva, M P; Kalla, A K

    2009-10-01

    Twenty autosomal markers, including linked markers at two gene markers, are used to understand the genomic similarity and diversity among three tribal (Paite, Thadou, and Kom) and one nontribal communities of Manipur (Northeast India). Two of the markers (CD4 and HB9) are monomorphic in Paite and one (the CD4 marker) in Kom. Data suggest the Meitei (nontribal groups) stand apart from the three tribal groups with respect to higher heterozygosity (0.366) and presence of the highest ancestor haplotypes of DRD2 markers (0.228); this is also supported by principal co-ordinate analysis. These populations are found to be genomically closer to the Chinese population than to other Indian populations.

  17. Acidobacteria form a coherent but highly diverse group within the bacterial domain: evidence from environmental genomics

    DEFF Research Database (Denmark)

    Quaiser, Achim; Ochsenreiter, Torsten; Lanz, Christa

    2003-01-01

    fragments differed between 2.3% and 19.9% and were placed into two different subgroups of Acidobacteria (groups III and V). Although partial co-linearity was found between genomic fragments, the gene content around the rRNA operons was generally not conserved. Phylogenetic reconstructions with orthologues......Acidobacteria have been established as a novel phylum of Bacteria that is consistently detected in many different habitats around the globe by 16S rDNA-based molecular surveys. The phylogenetic diversity, ubiquity and abundance of this group, particularly in soil habitats, suggest an important...... palustris and Bradyrhizobium japonicum, including a conserved two-component system. Phylogenetic analysis of the putative response regulator confirmed that this similarity between Rhizobiales and Acidobacteria might be due to a horizontal gene transfer. In total, our data give first insight into the genome...

  18. Extending the cereus group genomics to putative food-bornepathogens of different toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla; Goltsman, Eugene; Auger, Sandrine; Galleron,Nathalie; Segurens, Beatrice; Dossat, Carole; Land, Miriam L.; Broussole,Veronique; Brillard, Julien; Guinebretiere, Marie-Helene; Sanchis,Vincent; Nguen-the, Christophe; Lereclus, Didier; Richardson, Paul; Winker, Patrick; Weissenbach, Jean; Ehrlich, S.Dusko; Sorokin, Alexei

    2006-08-24

    The cereus group represents sporulating soil bacteriacontaining pathogenic strains which may cause diarrheic or emetic foodpoisoning outbreaks. Multiple locus sequence typing revealed a presencein natural samples of these bacteria of about thirty clonal complexes.Application of genomic methods to this group was however biased due tothe major interest for representatives closely related to B. anthracis.Albeit the most important food-borne pathogens were not yet defined,existing dataindicate that they are scattered all over the phylogenetictree. The preliminary analysis of the sequences of three genomesdiscussed in this paper narrows down the gaps in our knowledge of thecereus group. The strain NVH391-98 is a rare but particularly severefood-borne pathogen. Sequencing revealed that the strain must be arepresentative of a novel bacterial species, for which the name Bacilluscytotoxis is proposed. This strain has a reduced genome size compared toother cereus group strains. Genome analysis revealed absence of sigma Bfactor and the presence of genes encoding diarrheic Nhe toxin, notdetected earlier. The strain B. cereus F837/76 represents a clonalcomplex close to that of B. anthracis. Including F837/76, three such B.cereus strains had been sequenced. Alignment of genomes suggests that B.anthracis is their common ancestor. Since such strains often emerge fromclinical cases, they merit a special attention. The third strain, KBAB4,is a typical psychrotrophe characteristic to unbiased soil communities.Phylogenic studies show that in nature it is the most active group interms of gene exchange. Genomic sequence revealed high presence ofextra-chromosomal genetic material (about 530 kb) that may account forthis phenomenon. Genes coding Nhe-like toxin were found on a big plasmidin this strain. This may indicate a potential mechanism of toxicityspread from the psychrotrophic strain community. The results of thisgenomic work and ecological compartments of different strains incite

  19. Draft genome comparison of representatives of the three dominant genotype groups of dairy Bacillus licheniformis strains.

    Science.gov (United States)

    Dhakal, Rajat; Seale, R Brent; Deeth, Hilton C; Craven, Heather; Turner, Mark S

    2014-06-01

    The spore-forming bacterium Bacillus licheniformis is a common contaminant of milk and milk products. Strains of this species isolated from dairy products can be differentiated into three major groups, namely, G, F1, and F2, using random amplification of polymorphic DNA (RAPD) analysis; however, little is known about the genomic differences between these groups and the identity of the fragments that make up their RAPD profiles. In this work we obtained high-quality draft genomes of representative strains from each of the three RAPD groups (designated strain G-1, strain F1-1, and strain F2-1) and compared them to each other and to B. licheniformis ATCC 14580 and Bacillus subtilis 168. Whole-genome comparison and multilocus sequence typing revealed that strain G-1 contains significant sequence variability and belongs to a lineage distinct from the group F strains. Strain G-1 was found to contain genes coding for a type I restriction modification system, urease production, and bacitracin synthesis, as well as the 8-kbp plasmid pFL7, and these genes were not present in strains F1-1 and F2-1. In agreement with this, all isolates of group G, but no group F isolates, were found to possess urease activity and antimicrobial activity against Micrococcus. Identification of RAPD band sequences revealed that differences in the RAPD profiles were due to differences in gene lengths, 3' ends of predicted primer binding sites, or gene presence or absence. This work provides a greater understanding of the phylogenetic and phenotypic differences observed within the B. licheniformis species.

  20. The co-evolved Helicobacter pylori and gastric cancer: trinity of bacterial virulence, host susceptibility and lifestyle

    Directory of Open Access Journals (Sweden)

    Devi S Manjulata

    2007-01-01

    Full Text Available Abstract Helicobacter pylori is an important yet unproven etiological agent of gastric cancer. H. pylori infection is more prevalent in developing Asian countries like India and it is usually acquired at an early age. It has been two decades since Marshall and Warren (1984 first described curved bacilli in the stomach of ulcer and gastritis patients. This discovery has won them the Nobel Prize recently, but the debate whether H. pylori is a pathogen or a commensal organism is still hot. Associations with disease-specific factors remain illusive years after the genome sequences were made available. Cytotoxin-associated antigen A (CagA and the so-called plasticity region cluster genes are implicated in pathogenesis of the carcinoma of stomach. Another virulence factor VacA whose role is still debatable, has recently been projected in pathology of gastric cancer. Studies of the evolution through genetic variation in H. pylori populations have provided a window into the history of human population migrations and a possible co-evolution of this pathogen with its human host. Possible symbiotic relationships were seriously debated since the discovery of this pathogen. The debate has been further intensified as some studies proposed H. pylori infection to be beneficial in some humans. In this commentary, we attempt to briefly discuss about H. pylori as a human pathogen, and some of the important issues linked to its pathophysiology in different hosts. 'We dance around in a ring and suppose, the secret sits in the middle and knows' – Robert Frost

  1. New Insights into the genetic diversity of Clostridium botulinum Group III through extensive genome exploration

    Directory of Open Access Journals (Sweden)

    Cédric eWoudstra

    2016-05-01

    Full Text Available Animal botulism is caused by group III Clostridium botulinum strains producing type C and D toxins, or their chimeric forms C/D and D/C. Animal botulism is considered an emerging disease in Europe, notably in poultry production. Before our study, 14 genomes from different countries were available in the public database, but none were from France. In order to investigate the genetic relationship of French strains with different geographical areas and find new potential typing targets, 17 strains of C. botulinum group III were sequenced (16 from France and one from New Caledonia. Fourteen were type C/D strains isolated from chickens, ducks, guinea fowl and turkeys and three were type D/C strains isolated from cattle. The New Caledonian strain was a type D/C strain. Whole genome sequence analysis showed the French strains to be closely related to European strains from C. botulinum group III lineages Ia and Ib. The investigation of CRISPR sequences as genetic targets for differentiating strains in group III proved to be irrelevant for type C/D due to a deficient CRISPR/Cas mechanism, but not for type D/C. Conversely, the extrachromosomal elements of type C/D strains could be used to generate a genetic ID card. The highest level of discrimination was achieved with SNP core phylogeny, which allowed differentiation up to strain level and provide the most relevant information for genetic epidemiology studies and discrimination.

  2. The chromosomal distributions of Ty1-copia group retrotransposable elements in higher plants and their implications for genome evolution

    Science.gov (United States)

    J.S. (Pat) Heslop-Harrison; Andrea Brandes; Shin Taketa; Thomas Schmidt; Alexander V. Vershinin; Elena G. Alkhimova; Anette Kamm; Robert L. Doudrick; . [and others

    1997-01-01

    Retrotransposons make up a major fraction - sometimes more than 40% - of all plant genomes investigated so far. We have isolated the reverse transcriptase domains of theTyl-copia group elements from several species, ranging in genome size from some 100 Mbp to 23,000 Mbp, and determined the distribution patterns of these retrotransposons on metaphase chromosomes and...

  3. Identification of copy number variants defining genomic differences among major human groups.

    Directory of Open Access Journals (Sweden)

    Lluís Armengol

    Full Text Available BACKGROUND: Understanding the genetic contribution to phenotype variation of human groups is necessary to elucidate differences in disease predisposition and response to pharmaceutical treatments in different human populations. METHODOLOGY/PRINCIPAL FINDINGS: We have investigated the genome-wide profile of structural variation on pooled samples from the three populations studied in the HapMap project by comparative genome hybridization (CGH in different array platforms. We have identified and experimentally validated 33 genomic loci that show significant copy number differences from one population to the other. Interestingly, we found an enrichment of genes related to environment adaptation (immune response, lipid metabolism and extracellular space within these regions and the study of expression data revealed that more than half of the copy number variants (CNVs translate into gene-expression differences among populations, suggesting that they could have functional consequences. In addition, the identification of single nucleotide polymorphisms (SNPs that are in linkage disequilibrium with the copy number alleles allowed us to detect evidences of population differentiation and recent selection at the nucleotide variation level. CONCLUSIONS: Overall, our results provide a comprehensive view of relevant copy number changes that might play a role in phenotypic differences among major human populations, and generate a list of interesting candidates for future studies.

  4. Characterization of a group of MITEs with unusual features from two coral genomes.

    Directory of Open Access Journals (Sweden)

    Shi Wang

    Full Text Available BACKGROUND: Miniature inverted-repeat transposable elements (MITEs, which are common in eukaryotic genomes, are small non-coding elements that transpose by utilizing transposases encoded by autonomous transposons. Recent genome-wide analyses and cross-mobilization assays have greatly improved our knowledge on MITE proliferation, however, specific mechanisms for the origin and evolution of MITEs are still unclear. PRINCIPAL FINDINGS: A group of coral MITEs called CMITE were identified from two corals, Acropora millepora and Acropora palmata. CMITEs conform to many common characteristics of MITEs, but also present several unusual features. The most unusual feature of CMITEs is conservation of the internal region, which is more conserved between MITE families than the TIRs. The origin of this internal region remains unknown, although we found one CMITE family that seems to be derived from a piggyBac-like transposon in A. millepora. CMITEs can form tandem arrays, suggesting an unconventional way for MITEs to increase copy numbers. We also describe a case in which a novel transposable element was created by a CMITE insertion event. CONCLUSIONS: To our knowledge, this is the first report of identification of MITEs from coral genomes. Proliferation of CMITEs seems to be related to the transposition machinery of piggyBac-like autonomous transposons. The highly conserved internal region of CMITEs suggests a potential role for this region in their successful transposition. However, the origin of these unusual features in CMITEs remains unclear, and thus represents an intriguing topic for future investigations.

  5. Characterization of a group of MITEs with unusual features from two coral genomes.

    Science.gov (United States)

    Wang, Shi; Zhang, Lingling; Meyer, Eli; Matz, Mikhail V

    2010-05-18

    Miniature inverted-repeat transposable elements (MITEs), which are common in eukaryotic genomes, are small non-coding elements that transpose by utilizing transposases encoded by autonomous transposons. Recent genome-wide analyses and cross-mobilization assays have greatly improved our knowledge on MITE proliferation, however, specific mechanisms for the origin and evolution of MITEs are still unclear. A group of coral MITEs called CMITE were identified from two corals, Acropora millepora and Acropora palmata. CMITEs conform to many common characteristics of MITEs, but also present several unusual features. The most unusual feature of CMITEs is conservation of the internal region, which is more conserved between MITE families than the TIRs. The origin of this internal region remains unknown, although we found one CMITE family that seems to be derived from a piggyBac-like transposon in A. millepora. CMITEs can form tandem arrays, suggesting an unconventional way for MITEs to increase copy numbers. We also describe a case in which a novel transposable element was created by a CMITE insertion event. To our knowledge, this is the first report of identification of MITEs from coral genomes. Proliferation of CMITEs seems to be related to the transposition machinery of piggyBac-like autonomous transposons. The highly conserved internal region of CMITEs suggests a potential role for this region in their successful transposition. However, the origin of these unusual features in CMITEs remains unclear, and thus represents an intriguing topic for future investigations.

  6. Proliferation of group II introns in the chloroplast genome of the green alga Oedocladium carolinianum (Chlorophyceae

    Directory of Open Access Journals (Sweden)

    Jean-Simon Brouard

    2016-10-01

    Full Text Available Background The chloroplast genome sustained extensive changes in architecture during the evolution of the Chlorophyceae, a morphologically and ecologically diverse class of green algae belonging to the Chlorophyta; however, the forces driving these changes are poorly understood. The five orders recognized in the Chlorophyceae form two major clades: the CS clade consisting of the Chlamydomonadales and Sphaeropleales, and the OCC clade consisting of the Oedogoniales, Chaetophorales, and Chaetopeltidales. In the OCC clade, considerable variations in chloroplast DNA (cpDNA structure, size, gene order, and intron content have been observed. The large inverted repeat (IR, an ancestral feature characteristic of most green plants, is present in Oedogonium cardiacum (Oedogoniales but is lacking in the examined members of the Chaetophorales and Chaetopeltidales. Remarkably, the Oedogonium 35.5-kb IR houses genes that were putatively acquired through horizontal DNA transfer. To better understand the dynamics of chloroplast genome evolution in the Oedogoniales, we analyzed the cpDNA of a second representative of this order, Oedocladium carolinianum. Methods The Oedocladium cpDNA was sequenced and annotated. The evolutionary distances separating Oedocladium and Oedogonium cpDNAs and two other pairs of chlorophycean cpDNAs were estimated using a 61-gene data set. Phylogenetic analysis of an alignment of group IIA introns from members of the OCC clade was performed. Secondary structures and insertion sites of oedogonialean group IIA introns were analyzed. Results The 204,438-bp Oedocladium genome is 7.9 kb larger than the Oedogonium genome, but its repertoire of conserved genes is remarkably similar and gene order differs by only one reversal. Although the 23.7-kb IR is missing the putative foreign genes found in Oedogonium, it contains sequences coding for a putative phage or bacterial DNA primase and a hypothetical protein. Intergenic sequences are 1.5-fold

  7. Differentiation of strains from the Bacillus cereus group by RFLP-PFGE genomic fingerprinting.

    Science.gov (United States)

    Otlewska, Anna; Oltuszak-Walczak, Elzbieta; Walczak, Piotr

    2013-11-01

    Bacillus mycoides, Bacillus pseudomycoides, Bacillus weihenstephanensis, Bacillus anthracis, Bacillus thuringiensis, and Bacillus cereus belong to the B. cereus group. The last three species are characterized by different phenotype features and pathogenicity spectrum, but it has been shown that these species are genetically closely related. The macrorestriction analysis of the genomic DNA with the NotI enzyme was used to generate polymorphism of restriction profiles for 39 food-borne isolates (B. cereus, B. mycoides) and seven reference strains (B. mycoides, B. thuringiensis, B. weihenstephanensis, and B. cereus). The PFGE method was applied to differentiate the examined strains of the B. cereus group. On the basis of the unweighted pair group method with the arithmetic mean method and Dice coefficient, the strains were divided into five clusters (types A-E), and the most numerous group was group A (25 strains). A total of 21 distinct pulsotypes were observed. The RFLP-PFGE analysis was successfully used for the differentiation and characterization of B. cereus and B. mycoides strains isolated from different food products. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Genomes

    National Research Council Canada - National Science Library

    Brown, T. A. (Terence A.)

    2002-01-01

    ... of genome expression and replication processes, and transcriptomics and proteomics. This text is richly illustrated with clear, easy-to-follow, full color diagrams, which are downloadable from the book's website...

  9. Genomic analysis reveals the molecular basis for capsule loss in the group B Streptococcus population.

    Directory of Open Access Journals (Sweden)

    Roberto Rosini

    Full Text Available The human and bovine bacterial pathogen Streptococcus agalactiae (Group B Streptococcus, GBS expresses a thick polysaccharide capsule that constitutes a major virulence factor and vaccine target. GBS can be classified into ten distinct serotypes differing in the chemical composition of their capsular polysaccharide. However, non-typeable strains that do not react with anti-capsular sera are frequently isolated from colonized and infected humans and cattle. To gain a comprehensive insight into the molecular basis for the loss of capsule expression in GBS, a collection of well-characterized non-typeable strains was investigated by genome sequencing. Genome based phylogenetic analysis extended to a wide population of sequenced strains confirmed the recently observed high clonality among GBS lineages mainly containing human strains, and revealed a much higher degree of diversity in the bovine population. Remarkably, non-typeable strains were equally distributed in all lineages. A number of distinct mutations in the cps operon were identified that were apparently responsible for inactivation of capsule synthesis. The most frequent genetic alterations were point mutations leading to stop codons in the cps genes, and the main target was found to be cpsE encoding the portal glycosyl transferase of capsule biosynthesis. Complementation of strains carrying missense mutations in cpsE with a wild-type gene restored capsule expression allowing the identification of amino acid residues essential for enzyme activity.

  10. Final report of the group research. Genome analysis on the biological effects of radiation. Second research group of NIRS

    International Nuclear Information System (INIS)

    2001-10-01

    This report concerns investigations on the title conducted by 5 subgroups of National Institute of Radiological Sciences (NIRS) during the period of 1993-2001. The report involves the organization of research teams and summary reports from the subgroups for Genome sequencing and informatics, Genome analysis on model organisms, The genome analysis on the specific chromosomal region related to radiation-sensitivity, Molecular analysis on the structure and function of particular regions of human genome, and Generation and characterization of DNA repair-deficient model mice. Significant results are as follows: Sequencing of the radiation sensitivity gene ATM, finding of a novel cell cycle regulator gene NPAT and regulation of gene expression of ATM/NPAT; Findings that the cause of the variability related to instability of human genome is derived from particular repeat structures of 5 and 35 bases and of the instability mutation, from the mutation of EPILS (mRNA synthase gene); Program development for novel human genome finding in the DNA sequences and making novel human gene as a resource by polymerase chain reaction (PCR) technique; and generation of the highly UV-sensitive mouse model for human xeroderma pigmentosum G. Conclusion is that findings will contribute for better understanding of the genes functioning radiation sensitivity and also biodefense mechanism against radiation and other environmental stress. (N.I.)

  11. Assignment of simian rotavirus SA11 temperature-sensitive mutant groups B and E to genome segments

    International Nuclear Information System (INIS)

    Gombold, J.L.; Estes, M.K.; Ramig, R.F.

    1985-01-01

    Recombinant (reassortant) viruses were selected from crosses between temperature-sensitive (ts) mutants of simian rotavirus SA11 and wild-type human rotavirus Wa. The double-stranded genome RNAs of the reassortants were examined by electrophoresis in Tris-glycine-buffered polyacrylamide gels and by dot hybridization with a cloned DNA probe for genome segment 2. Analysis of replacements of genome segments in the reassortants allowed construction of a map correlating genome segments providing functions interchangeable between SA11 and Wa. The reassortants revealed a functional correspondence in order of increasing electrophoretic mobility of genome segments. Analysis of the parental origin of genome segments in ts+ SA11/Wa reassortants derived from the crosses SA11 tsB(339) X Wa and SA11 tsE(1400) X Wa revealed that the group B lesion of tsB(339) was located on genome segment 3 and the group E lesion of tsE(1400) was on segment 8

  12. Assignment of simian rotavirus SA11 temperature-sensitive mutant groups B and E to genome segments

    Energy Technology Data Exchange (ETDEWEB)

    Gombold, J.L.; Estes, M.K.; Ramig, R.F.

    1985-05-01

    Recombinant (reassortant) viruses were selected from crosses between temperature-sensitive (ts) mutants of simian rotavirus SA11 and wild-type human rotavirus Wa. The double-stranded genome RNAs of the reassortants were examined by electrophoresis in Tris-glycine-buffered polyacrylamide gels and by dot hybridization with a cloned DNA probe for genome segment 2. Analysis of replacements of genome segments in the reassortants allowed construction of a map correlating genome segments providing functions interchangeable between SA11 and Wa. The reassortants revealed a functional correspondence in order of increasing electrophoretic mobility of genome segments. Analysis of the parental origin of genome segments in ts+ SA11/Wa reassortants derived from the crosses SA11 tsB(339) X Wa and SA11 tsE(1400) X Wa revealed that the group B lesion of tsB(339) was located on genome segment 3 and the group E lesion of tsE(1400) was on segment 8.

  13. 77 FR 75425 - Interagency Working Group on Plant Genomics (IWGPG): The National Plant Genome Initiative-What's...

    Science.gov (United States)

    2012-12-20

    ... Genome Initiative--What's Next? AGENCY: Office of Science, Office of Biological and Environmental... INFORMATION CONTACT: Dr. Catherine Ronning, U.S. Department of Energy, Office of Science, Office of Biological... 20585-1290. Phone 301-903-9549, fax (301) 903-5051, email: [email protected]science.doe.gov ; Dr. Jane...

  14. How the indirect reciprocity with co-evolving norm and strategy for 2 × 2 prisoner's dilemma game works for emerging cooperation

    Science.gov (United States)

    Tanimoto, Jun; Sagara, Hirokji

    2015-11-01

    We built a new indirect reciprocity model based on binary image scores, where an agent's strategy and norm co-evolve. The norm, meaning what behavior is evaluated as "good" or "bad," stipulates how image scores of two agents playing a game is altered, which has been presumed to be a fixed value in most previous studies. Also, unlike former studies, our model allows an agent to play with an agent who has a different norm. This point of relaxing the freedom of the model pulls down cooperation level vis-à-vis the case where an agent always plays with another one having same norm. However, it is observed that a rather larger dilemma shows robust cooperation establishing compared with a smaller dilemma, since a norm that punishes a so-called second-order free-rider is prompted. To encourage the evolution of norms to be able to punish second-order free-riders, a society needs a small number of defectors. This is elucidated by the fact that cases with action error are more cooperative than those without action error.

  15. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome

    Science.gov (United States)

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo. PMID:26559182

  16. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome.

    Science.gov (United States)

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo.

  17. Novel phage group infecting Lactobacillus delbrueckii subsp. lactis, as revealed by genomic and proteomic analysis of bacteriophage Ldl1.

    Science.gov (United States)

    Casey, Eoghan; Mahony, Jennifer; Neve, Horst; Noben, Jean-Paul; Dal Bello, Fabio; van Sinderen, Douwe

    2015-02-01

    Ldl1 is a virulent phage infecting the dairy starter Lactobacillus delbrueckii subsp. lactis LdlS. Electron microscopy analysis revealed that this phage exhibits a large head and a long tail and bears little resemblance to other characterized phages infecting Lactobacillus delbrueckii. In vitro propagation of this phage revealed a latent period of 30 to 40 min and a burst size of 59.9 +/- 1.9 phage particles. Comparative genomic and proteomic analyses showed remarkable similarity between the genome of Ldl1 and that of Lactobacillus plantarum phage ATCC 8014-B2. The genomic and proteomic characteristics of Ldl1 demonstrate that this phage does not belong to any of the four previously recognized L. delbrueckii phage groups, necessitating the creation of a new group, called group e, thus adding to the knowledge on the diversity of phages targeting strains of this industrially important lactic acid bacterial species.

  18. Northeast African genomic variation shaped by the continuity of indigenous groups and Eurasian migrations.

    Directory of Open Access Journals (Sweden)

    Nina Hollfelder

    2017-08-01

    Full Text Available Northeast Africa has a long history of human habitation, with fossil-finds from the earliest anatomically modern humans, and housing ancient civilizations. The region is also the gate-way out of Africa, as well as a portal for migration into Africa from Eurasia via the Middle East and the Arabian Peninsula. We investigate the population history of northeast Africa by genotyping ~3.9 million SNPs in 221 individuals from 18 populations sampled in Sudan and South Sudan and combine this data with published genome-wide data from surrounding areas. We find a strong genetic divide between the populations from the northeastern parts of the region (Nubians, central Arab populations, and the Beja and populations towards the west and south (Nilotes, Darfur and Kordofan populations. This differentiation is mainly caused by a large Eurasian ancestry component of the northeast populations likely driven by migration of Middle Eastern groups followed by admixture that affected the local populations in a north-to-south succession of events. Genetic evidence points to an early admixture event in the Nubians, concurrent with historical contact between North Sudanese and Arab groups. We estimate the admixture in current-day Sudanese Arab populations to about 700 years ago, coinciding with the fall of Dongola in 1315/1316 AD, a wave of admixture that reached the Darfurian/Kordofanian populations some 400-200 years ago. In contrast to the northeastern populations, the current-day Nilotic populations from the south of the region display little or no admixture from Eurasian groups indicating long-term isolation and population continuity in these areas of northeast Africa.

  19. Northeast African genomic variation shaped by the continuity of indigenous groups and Eurasian migrations.

    Science.gov (United States)

    Hollfelder, Nina; Schlebusch, Carina M; Günther, Torsten; Babiker, Hiba; Hassan, Hisham Y; Jakobsson, Mattias

    2017-08-01

    Northeast Africa has a long history of human habitation, with fossil-finds from the earliest anatomically modern humans, and housing ancient civilizations. The region is also the gate-way out of Africa, as well as a portal for migration into Africa from Eurasia via the Middle East and the Arabian Peninsula. We investigate the population history of northeast Africa by genotyping ~3.9 million SNPs in 221 individuals from 18 populations sampled in Sudan and South Sudan and combine this data with published genome-wide data from surrounding areas. We find a strong genetic divide between the populations from the northeastern parts of the region (Nubians, central Arab populations, and the Beja) and populations towards the west and south (Nilotes, Darfur and Kordofan populations). This differentiation is mainly caused by a large Eurasian ancestry component of the northeast populations likely driven by migration of Middle Eastern groups followed by admixture that affected the local populations in a north-to-south succession of events. Genetic evidence points to an early admixture event in the Nubians, concurrent with historical contact between North Sudanese and Arab groups. We estimate the admixture in current-day Sudanese Arab populations to about 700 years ago, coinciding with the fall of Dongola in 1315/1316 AD, a wave of admixture that reached the Darfurian/Kordofanian populations some 400-200 years ago. In contrast to the northeastern populations, the current-day Nilotic populations from the south of the region display little or no admixture from Eurasian groups indicating long-term isolation and population continuity in these areas of northeast Africa.

  20. Detecting non-orthology in the COGs database and other approaches grouping orthologs using genome-specific best hits.

    Science.gov (United States)

    Dessimoz, Christophe; Boeckmann, Brigitte; Roth, Alexander C J; Gonnet, Gaston H

    2006-01-01

    Correct orthology assignment is a critical prerequisite of numerous comparative genomics procedures, such as function prediction, construction of phylogenetic species trees and genome rearrangement analysis. We present an algorithm for the detection of non-orthologs that arise by mistake in current orthology classification methods based on genome-specific best hits, such as the COGs database. The algorithm works with pairwise distance estimates, rather than computationally expensive and error-prone tree-building methods. The accuracy of the algorithm is evaluated through verification of the distribution of predicted cases, case-by-case phylogenetic analysis and comparisons with predictions from other projects using independent methods. Our results show that a very significant fraction of the COG groups include non-orthologs: using conservative parameters, the algorithm detects non-orthology in a third of all COG groups. Consequently, sequence analysis sensitive to correct orthology assignments will greatly benefit from these findings.

  1. In Silico Genomic Fingerprints of the Bacillus anthracis Group Obtained by Virtual Hybridization

    Directory of Open Access Journals (Sweden)

    Hueman Jaimes-Díaz

    2015-02-01

    Full Text Available In this study we evaluate the capacity of Virtual Hybridization to identify between highly related bacterial strains. Eight genomic fingerprints were obtained by virtual hybridization for the Bacillus anthracis genome set, and a set of 15,264 13-nucleotide short probes designed to produce genomic fingerprints unique for each organism. The data obtained from each genomic fingerprint were used to obtain hybridization patterns simulating a DNA microarray. Two virtual hybridization methods were used: the Direct and the Extended method to identify the number of potential hybridization sites and thus determine the minimum sensitivity value to discriminate between genomes with 99.9% similarity. Genomic fingerprints were compared using both methods and phylogenomic trees were constructed to verify that the minimum detection value is 0.000017. Results obtained from the genomic fingerprints suggest that the distribution in the trees is correct, as compared to other taxonomic methods. Specific virtual hybridization sites for each of the genomes studied were also identified.

  2. Comparative genomics and functional analysis of the 936 group of lactococcal Siphoviridae phages

    NARCIS (Netherlands)

    Murphy, James; Bottacini, Francesca; Mahony, Jennifer; Kelleher, Philip; Neve, Horst; Zomer, Aldert; Nauta, Arjen; van Sinderen, Douwe

    2016-01-01

    Genome sequencing and comparative analysis of bacteriophage collections has greatly enhanced our understanding regarding their prevalence, phage-host interactions as well as the overall biodiversity of their genomes. This knowledge is very relevant to phages infecting Lactococcus lactis, since they

  3. The MICROBE Project, A Report from the Interagency Working Group on Microbial Genomics

    Science.gov (United States)

    2001-01-01

    functional genomics tools (gene chips, technologies, etc.), comparative genomics, proteomics tools, novel culture techniques, in situ analyses, and...interested in supporting microarray/chip development for gene expression analysis for agricultural microbes, bioinformatics, and proteomics , and the...including one fungus ) in various stages of progress. The closely integrated Natural and Accelerated Bioremediation Research Program in the Office of

  4. Effects of racial and ethnic group and health literacy on responses to genomic risk information in a medically underserved population.

    Science.gov (United States)

    Kaphingst, Kimberly A; Stafford, Jewel D; McGowan, Lucy D'Agostino; Seo, Joann; Lachance, Christina R; Goodman, Melody S

    2015-02-01

    Few studies have examined how individuals respond to genomic risk information for common, chronic diseases. This randomized study examined differences in responses by type of genomic information (genetic test/family history) and disease condition (diabetes/heart disease), and by race/ethnicity in a medically underserved population. 1,057 English-speaking adults completed a survey containing 1 of 4 vignettes (2-by-2 randomized design). Differences in dependent variables (i.e., interest in receiving genomic assessment, discussing with doctor or family, changing health habits) by experimental condition and race/ethnicity were examined using chi-squared tests and multivariable regression analysis. No significant differences were found in dependent variables by type of genomic information or disease condition. In multivariable models, Hispanics were more interested in receiving a genomic assessment than Whites (OR = 1.93; p literacy had greater interest than those with adequate health literacy. Blacks (OR = 1.78; p = .001) and Hispanics (OR = 1.85; p = .001) had greater interest in discussing information with family than Whites. Non-Hispanic Blacks (OR = 1.45; p = .04) had greater interest in discussing genomic information with a doctor than Whites. Blacks (β = -0.41; p literacy was negatively associated with number of health habits participants intended to change. Findings suggest that race/ethnicity may affect responses to genomic risk information. Additional research could examine how cognitive representations of this information differ across racial/ethnic groups. Health literacy is also critical to consider in developing approaches to communicating genomic information.

  5. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes.

    Science.gov (United States)

    Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S; Allard, Marc W; Strain, Errol A; Brown, Eric W

    2016-10-15

    Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST clusters were congruent with MLST-defined clonal groups, which had various degrees of diversity at the whole-genome level. Notably, cgMLST could distinguish among outbreak strains and epidemiologically unrelated strains of the same clonal group, which could not be achieved using classic MLST schemes. The precise selection of cgMLST gene targets may not be critical for the general identification of clonal groups and outbreak strains. cgMLST analyses further identified outbreak strains, including those associated with recent outbreaks linked to contaminated French-style cheese, Hispanic-style cheese, stone fruit, caramel apple, ice cream, and packaged leafy green salad, as belonging to major clonal groups. We further developed lineage-specific cgMLST schemes, which can include accessory genes when core genomes do not possess sufficient diversity, and this provided additional resolution over species-specific cgMLST. Analyses of isolates from different common-source listeriosis outbreaks revealed various degrees of diversity, indicating that the numbers of allelic differences should always be combined with cgMLST clustering and epidemiological evidence to define a listeriosis outbreak. Classic multilocus sequence typing (MLST) schemes targeting internal fragments of 6 to 8 genes that define clonal complexes or epidemic clones have been widely employed to study L. monocytogenes biodiversity and its relation to pathogenicity potential and epidemiology. We demonstrated that core genome MLST

  6. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes

    OpenAIRE

    Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S.; Allard, Marc W.; Strain, Errol A.; Brown, Eric W.

    2016-01-01

    ABSTRACT Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST...

  7. Complete genome sequence of Lactobacillus plantarum LZ95, a potential probiotic strain producing bacteriocins and B-group vitamin riboflavin.

    Science.gov (United States)

    Li, Ping; Gu, Qing

    2016-07-10

    Lactobacillus plantarum LZ95 is a potential probiotic isolated from newborn infant fecal and it is identified to produce riboflavin with great antimicrobial activity. The complete genome sequence of this strain was reported in the present study. The genome contains a 3,261,418-bp chromosome and two plasmids. Genes, related to the biosynthesis of bacteriocins and riboflavin, were identified. This work will facilitate to reveal the biosynthetic mechanism of bacteriocins and B-group vitamins in lactic acid bacteria and provide evidence for its potential application in food industry. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Genomic resources for multiple species in the Drosophila ananassae species group.

    Science.gov (United States)

    Signor, Sarah; Seher, Thaddeus; Kopp, Artyom

    2013-01-01

    The development of genomic resources in non-model taxa is essential for understanding the genetic basis of biological diversity. Although the genomes of many Drosophila species have been sequenced, most of the phenotypic diversity in this genus remains to be explored. To facilitate the genetic analysis of interspecific and intraspecific variation, we have generated new genomic resources for seven species and subspecies in the D. ananassae species subgroup. We have generated large amounts of transcriptome sequence data for D. ercepeae, D. merina, D. bipectinata, D. malerkotliana malerkotliana, D. m. pallens, D. pseudoananassae pseudoananassae, and D. p. nigrens. de novo assembly resulted in contigs covering more than half of the predicted transcriptome and matching an average of 59% of annotated genes in the complete genome of D. ananassae. Most contigs, corresponding to an average of 49% of D. ananassae genes, contain sequence polymorphisms that can be used as genetic markers. Subsets of these markers were validated by genotyping the progeny of inter- and intraspecific crosses. The ananassae subgroup is an excellent model system for examining the molecular basis of speciation and phenotypic evolution. The new genomic resources will facilitate the genetic analysis of inter- and intraspecific differences in this lineage. Transcriptome sequencing provides a simple and cost-effective way to identify molecular markers at nearly single-gene density, and is equally applicable to any non-model taxa.

  9. Genomic analysis of Melioribacter roseus, facultatively anaerobic organotrophic bacterium representing a novel deep lineage within Bacteriodetes/Chlorobi group.

    Directory of Open Access Journals (Sweden)

    Vitaly V Kadnikov

    Full Text Available Melioribacter roseus is a moderately thermophilic facultatively anaerobic organotrophic bacterium representing a novel deep branch within Bacteriodetes/Chlorobi group. To better understand the metabolic capabilities and possible ecological functions of M. roseus and get insights into the evolutionary history of this bacterial lineage, we sequenced the genome of the type strain P3M-2(T. A total of 2838 open reading frames was predicted from its 3.30 Mb genome. The whole proteome analysis supported phylum-level classification of M. roseus since most of the predicted proteins had closest matches in Bacteriodetes, Proteobacteria, Chlorobi, Firmicutes and deeply-branching bacterium Caldithrix abyssi, rather than in one particular phylum. Consistent with the ability of the bacterium to grow on complex carbohydrates, the genome analysis revealed more than one hundred glycoside hydrolases, glycoside transferases, polysaccharide lyases and carbohydrate esterases. The reconstructed central metabolism revealed pathways enabling the fermentation of complex organic substrates, as well as their complete oxidation through aerobic and anaerobic respiration. Genes encoding the photosynthetic and nitrogen-fixation machinery of green sulfur bacteria, as well as key enzymes of autotrophic carbon fixation pathways, were not identified. The M. roseus genome supports its affiliation to a novel phylum Ignavibateriae, representing the first step on the evolutionary pathway from heterotrophic ancestors of Bacteriodetes/Chlorobi group towards anaerobic photoautotrophic Chlorobi.

  10. Genomic analysis of NAC transcription factors in banana (Musa acuminata) and definition of NAC orthologous groups for monocots and dicots.

    Science.gov (United States)

    Cenci, Albero; Guignon, Valentin; Roux, Nicolas; Rouard, Mathieu

    2014-05-01

    Identifying the molecular mechanisms underlying tolerance to abiotic stresses is important in crop breeding. A comprehensive understanding of the gene families associated with drought tolerance is therefore highly relevant. NAC transcription factors form a large plant-specific gene family involved in the regulation of tissue development and responses to biotic and abiotic stresses. The main goal of this study was to set up a framework of orthologous groups determined by an expert sequence comparison of NAC genes from both monocots and dicots. In order to clarify the orthologous relationships among NAC genes of different species, we performed an in-depth comparative study of four divergent taxa, in dicots and monocots, whose genomes have already been completely sequenced: Arabidopsis thaliana, Vitis vinifera, Musa acuminata and Oryza sativa. Due to independent evolution, NAC copy number is highly variable in these plant genomes. Based on an expert NAC sequence comparison, we propose forty orthologous groups of NAC sequences that were probably derived from an ancestor gene present in the most recent common ancestor of dicots and monocots. These orthologous groups provide a curated resource for large-scale protein sequence annotation of NAC transcription factors. The established orthology relationships also provide a useful reference for NAC function studies in newly sequenced genomes such as M. acuminata and other plant species.

  11. Complete genome sequence and comparative genomic analysis of Mycobacterium massiliense JCM 15300 in the Mycobacterium abscessus group reveal a conserved genomic island MmGI-1 related to putative lipid metabolism.

    Directory of Open Access Journals (Sweden)

    Tsuyoshi Sekizuka

    Full Text Available Mycobacterium abscessus group subsp., such as M. massiliense, M. abscessus sensu stricto and M. bolletii, are an environmental organism found in soil, water and other ecological niches, and have been isolated from respiratory tract infection, skin and soft tissue infection, postoperative infection of cosmetic surgery. To determine the unique genetic feature of M. massiliense, we sequenced the complete genome of M. massiliense type strain JCM 15300 (corresponding to CCUG 48898. Comparative genomic analysis was performed among Mycobacterium spp. and among M. abscessus group subspp., showing that additional ß-oxidation-related genes and, notably, the mammalian cell entry (mce operon were located on a genomic island, M. massiliense Genomic Island 1 (MmGI-1, in M. massiliense. In addition, putative anaerobic respiration system-related genes and additional mycolic acid cyclopropane synthetase-related genes were found uniquely in M. massiliense. Japanese isolates of M. massiliense also frequently possess the MmGI-1 (14/44, approximately 32% and three unique conserved regions (26/44; approximately 60%, 34/44; approximately 77% and 40/44; approximately 91%, as well as isolates of other countries (Malaysia, France, United Kingdom and United States. The well-conserved genomic island MmGI-1 may play an important role in high growth potential with additional lipid metabolism, extra factors for survival in the environment or synthesis of complex membrane-associated lipids. ORFs on MmGI-1 showed similarities to ORFs of phylogenetically distant M. avium complex (MAC, suggesting that horizontal gene transfer or genetic recombination events might have occurred within MmGI-1 among M. massiliense and MAC.

  12. Social evolution. Genomic signatures of evolutionary transitions from solitary to group living.

    Science.gov (United States)

    Kapheim, Karen M; Pan, Hailin; Li, Cai; Salzberg, Steven L; Puiu, Daniela; Magoc, Tanja; Robertson, Hugh M; Hudson, Matthew E; Venkat, Aarti; Fischman, Brielle J; Hernandez, Alvaro; Yandell, Mark; Ence, Daniel; Holt, Carson; Yocum, George D; Kemp, William P; Bosch, Jordi; Waterhouse, Robert M; Zdobnov, Evgeny M; Stolle, Eckart; Kraus, F Bernhard; Helbing, Sophie; Moritz, Robin F A; Glastad, Karl M; Hunt, Brendan G; Goodisman, Michael A D; Hauser, Frank; Grimmelikhuijzen, Cornelis J P; Pinheiro, Daniel Guariz; Nunes, Francis Morais Franco; Soares, Michelle Prioli Miranda; Tanaka, Érica Donato; Simões, Zilá Luz Paulino; Hartfelder, Klaus; Evans, Jay D; Barribeau, Seth M; Johnson, Reed M; Massey, Jonathan H; Southey, Bruce R; Hasselmann, Martin; Hamacher, Daniel; Biewer, Matthias; Kent, Clement F; Zayed, Amro; Blatti, Charles; Sinha, Saurabh; Johnston, J Spencer; Hanrahan, Shawn J; Kocher, Sarah D; Wang, Jun; Robinson, Gene E; Zhang, Guojie

    2015-06-05

    The evolution of eusociality is one of the major transitions in evolution, but the underlying genomic changes are unknown. We compared the genomes of 10 bee species that vary in social complexity, representing multiple independent transitions in social evolution, and report three major findings. First, many important genes show evidence of neutral evolution as a consequence of relaxed selection with increasing social complexity. Second, there is no single road map to eusociality; independent evolutionary transitions in sociality have independent genetic underpinnings. Third, though clearly independent in detail, these transitions do have similar general features, including an increase in constrained protein evolution accompanied by increases in the potential for gene regulation and decreases in diversity and abundance of transposable elements. Eusociality may arise through different mechanisms each time, but would likely always involve an increase in the complexity of gene networks. Copyright © 2015, American Association for the Advancement of Science.

  13. A core phylogeny of Dictyostelia inferred from genomes representative of the eight major and minor taxonomic divisions of the group.

    Science.gov (United States)

    Singh, Reema; Schilde, Christina; Schaap, Pauline

    2016-11-17

    Dictyostelia are a well-studied group of organisms with colonial multicellularity, which are members of the mostly unicellular Amoebozoa. A phylogeny based on SSU rDNA data subdivided all Dictyostelia into four major groups, but left the position of the root and of six group-intermediate taxa unresolved. Recent phylogenies inferred from 30 or 213 proteins from sequenced genomes, positioned the root between two branches, each containing two major groups, but lacked data to position the group-intermediate taxa. Since the positions of these early diverging taxa are crucial for understanding the evolution of phenotypic complexity in Dictyostelia, we sequenced six representative genomes of early diverging taxa. We retrieved orthologs of 47 housekeeping proteins with an average size of 890 amino acids from six newly sequenced and eight published genomes of Dictyostelia and unicellular Amoebozoa and inferred phylogenies from single and concatenated protein sequence alignments. Concatenated alignments of all 47 proteins, and four out of five subsets of nine concatenated proteins all produced the same consensus phylogeny with 100% statistical support. Trees inferred from just two out of the 47 proteins, individually reproduced the consensus phylogeny, highlighting that single gene phylogenies will rarely reflect correct species relationships. However, sets of two or three concatenated proteins again reproduced the consensus phylogeny, indicating that a small selection of genes suffices for low cost classification of as yet unincorporated or newly discovered dictyostelid and amoebozoan taxa by gene amplification. The multi-locus consensus phylogeny shows that groups 1 and 2 are sister clades in branch I, with the group-intermediate taxon D. polycarpum positioned as outgroup to group 2. Branch II consists of groups 3 and 4, with the group-intermediate taxon Polysphondylium violaceum positioned as sister to group 4, and the group-intermediate taxon Dictyostelium polycephalum

  14. Influencing governance of a public-private partnership in plant genomics: The societal interface group as a new instrument for public involvement

    NARCIS (Netherlands)

    Hanssen, L.; Gremmen, B.

    2013-01-01

    The Centre for BioSystems Genomics (CBSG) is a Dutch public-private partnership in plant genomics active in potato and tomato research and exploitation. Its Societal Interface Group (SIG) has been developed to inform its communication strategy and governance practice. This new instrument identifies

  15. Comparative genomics of a plant-parasitic nematode endosymbiont suggest a role in nutritional symbiosis

    Science.gov (United States)

    Bacterial mutualists can increase the biochemical capacity of animals. Highly co-evolved nutritional mutualists do this by synthesizing nutrients missing from the host's diet. Genomics tools have recently advanced the study of these partnerships. Here we examined the endosymbiont Xiphinematobacter (...

  16. Exploring the Potential Emotional and Behavioural Impact of Providing Personalised Genomic Risk Information to the Public: A Focus Group Study.

    Science.gov (United States)

    Smit, Amelia K; Keogh, Louise A; Newson, Ainsley J; Hersch, Jolyn; Butow, Phyllis; Cust, Anne E

    2015-01-01

    To explore the potential emotional and behavioural impact of providing information on personalised genomic risk to the public, using melanoma as an example, to aid research translation. We conducted four focus groups in which 34 participants were presented with a hypothetical scenario of an individual's lifetime genomic risk of melanoma (using the term 'genetic risk'). We asked about understanding of genetic risk, who would choose to receive this risk information, potential emotional and behavioural impacts, and other concerns or potential benefits. Data were analysed thematically. Participants thought this risk information could potentially motivate preventive behaviours such as sun protection and related it to screening for other diseases including breast cancer. Factors identified as influencing the decision to receive genetic risk information included education level, children, age and gender. Participants identified potential negative impacts on the recipient such as anxiety and worry, and proposed that this could be mitigated by providing additional explanatory and prevention information, and contact details of a health professional for further discussion. Participants' concerns included workplace and insurance discrimination. Participants recognised the potential for both positive and negative emotional and behavioural impacts related to receiving information on the personalised genomic risk of melanoma. © 2015 S. Karger AG, Basel.

  17. Population genomic analysis of strain variation in Leptospirillum group II bacteria involved in acid mine drainage formation.

    Science.gov (United States)

    Simmons, Sheri L; Dibartolo, Genevieve; Denef, Vincent J; Goltsman, Daniela S Aliaga; Thelen, Michael P; Banfield, Jillian F

    2008-07-22

    Deeply sampled community genomic (metagenomic) datasets enable comprehensive analysis of heterogeneity in natural microbial populations. In this study, we used sequence data obtained from the dominant member of a low-diversity natural chemoautotrophic microbial community to determine how coexisting closely related individuals differ from each other in terms of gene sequence and gene content, and to uncover evidence of evolutionary processes that occur over short timescales. DNA sequence obtained from an acid mine drainage biofilm was reconstructed, taking into account the effects of strain variation, to generate a nearly complete genome tiling path for a Leptospirillum group II species closely related to L. ferriphilum (sampling depth approximately 20x). The population is dominated by one sequence type, yet we detected evidence for relatively abundant variants (>99.5% sequence identity to the dominant type) at multiple loci, and a few rare variants. Blocks of other Leptospirillum group II types ( approximately 94% sequence identity) have recombined into one or more variants. Variant blocks of both types are more numerous near the origin of replication. Heterogeneity in genetic potential within the population arises from localized variation in gene content, typically focused in integrated plasmid/phage-like regions. Some laterally transferred gene blocks encode physiologically important genes, including quorum-sensing genes of the LuxIR system. Overall, results suggest inter- and intrapopulation genetic exchange involving distinct parental genome types and implicate gain and loss of phage and plasmid genes in recent evolution of this Leptospirillum group II population. Population genetic analyses of single nucleotide polymorphisms indicate variation between closely related strains is not maintained by positive selection, suggesting that these regions do not represent adaptive differences between strains. Thus, the most likely explanation for the observed patterns of

  18. Population genomic analysis of strain variation in Leptospirillum group II bacteria involved in acid mine drainage formation.

    Directory of Open Access Journals (Sweden)

    Sheri L Simmons

    2008-07-01

    Full Text Available Deeply sampled community genomic (metagenomic datasets enable comprehensive analysis of heterogeneity in natural microbial populations. In this study, we used sequence data obtained from the dominant member of a low-diversity natural chemoautotrophic microbial community to determine how coexisting closely related individuals differ from each other in terms of gene sequence and gene content, and to uncover evidence of evolutionary processes that occur over short timescales. DNA sequence obtained from an acid mine drainage biofilm was reconstructed, taking into account the effects of strain variation, to generate a nearly complete genome tiling path for a Leptospirillum group II species closely related to L. ferriphilum (sampling depth approximately 20x. The population is dominated by one sequence type, yet we detected evidence for relatively abundant variants (>99.5% sequence identity to the dominant type at multiple loci, and a few rare variants. Blocks of other Leptospirillum group II types ( approximately 94% sequence identity have recombined into one or more variants. Variant blocks of both types are more numerous near the origin of replication. Heterogeneity in genetic potential within the population arises from localized variation in gene content, typically focused in integrated plasmid/phage-like regions. Some laterally transferred gene blocks encode physiologically important genes, including quorum-sensing genes of the LuxIR system. Overall, results suggest inter- and intrapopulation genetic exchange involving distinct parental genome types and implicate gain and loss of phage and plasmid genes in recent evolution of this Leptospirillum group II population. Population genetic analyses of single nucleotide polymorphisms indicate variation between closely related strains is not maintained by positive selection, suggesting that these regions do not represent adaptive differences between strains. Thus, the most likely explanation for the

  19. Admixture patterns and genetic differentiation in negrito groups from West Malaysia estimated from genome-wide SNP data.

    Science.gov (United States)

    Jinam, Timothy A; Phipps, Maude E; Saitou, Naruya

    2013-01-01

    Southeast Asia houses various culturally and linguistically diverse ethnic groups. In Malaysia, where the Malay, Chinese, and Indian ethnic groups form the majority, there exist minority groups such as the "negritos" who are believed to be descendants of the earliest settlers of Southeast Asia. Here we report patterns of genetic substructure and admixture in two Malaysian negrito populations (Jehai and Kensiu), using ~50,000 genome-wide single-nucleotide polymorphism (SNP) data. We found traces of recent admixture in both the negrito populations, particularly in the Jehai, with the Malay through principal component analysis and STRUCTURE analysis software, which suggested that the admixture was as recent as one generation ago. We also identified significantly differentiated nonsynonymous SNPs and haplotype blocks related to intracellular transport, metabolic processes, and detection of stimulus. These results highlight the different levels of admixture experienced by the two Malaysian negritos. Delineating admixture and differentiated genomic regions should be of importance in designing and interpretation of molecular anthropology and disease association studies. Copyright © 2013 Wayne State University Press, Detroit, Michigan 48201-1309.

  20. Genomic Analysis of the Emergence and Rapid Global Dissemination of the Clonal Group 258 Klebsiella pneumoniae Pandemic.

    Directory of Open Access Journals (Sweden)

    Jolene R Bowers

    Full Text Available Multidrug-resistant Klebsiella pneumoniae producing the KPC carbapenemase have rapidly spread throughout the world, causing severe healthcare-associated infections with limited antimicrobial treatment options. Dissemination of KPC-producing K. pneumoniae is largely attributed to expansion of a single dominant strain, ST258. In this study, we explore phylogenetic relationships and evolution within ST258 and its clonal group, CG258, using whole genome sequence analysis of 167 isolates from 20 countries collected over 17 years. Our results show a common ST258 ancestor emerged from its diverse parental clonal group around 1995 and likely acquired blaKPC prior to dissemination. Over the past two decades, ST258 has remained highly clonal despite diversity in accessory elements and divergence in the capsule polysaccharide synthesis locus. Apart from the large recombination event that gave rise to ST258, few mutations set it apart from its clonal group. However, one mutation occurs in a global transcription regulator. Characterization of outer membrane protein sequences revealed a profile in ST258 that includes a truncated OmpK35 and modified OmpK37. Our work illuminates potential genomic contributors to the pathogenic success of ST258, helps us better understand the global dissemination of this strain, and identifies genetic markers unique to ST258.

  1. Genomic identification of WRKY transcription factors in carrot (Daucus carota) and analysis of evolution and homologous groups for plants.

    Science.gov (United States)

    Li, Meng-Yao; Xu, Zhi-Sheng; Tian, Chang; Huang, Ying; Wang, Feng; Xiong, Ai-Sheng

    2016-03-15

    WRKY transcription factors belong to one of the largest transcription factor families. These factors possess functions in plant growth and development, signal transduction, and stress response. Here, we identified 95 DcWRKY genes in carrot based on the carrot genomic and transcriptomic data, and divided them into three groups. Phylogenetic analysis of WRKY proteins from carrot and Arabidopsis divided these proteins into seven subgroups. To elucidate the evolution and distribution of WRKY transcription factors in different species, we constructed a schematic of the phylogenetic tree and compared the WRKY family factors among 22 species, which including plants, slime mold and protozoan. An in-depth study was performed to clarify the homologous factor groups of nine divergent taxa in lower and higher plants. Based on the orthologous factors between carrot and Arabidopsis, 38 DcWRKY proteins were calculated to interact with other proteins in the carrot genome. Yeast two-hybrid assay showed that DcWRKY20 can interact with DcMAPK1 and DcMAPK4. The expression patterns of the selected DcWRKY genes based on transcriptome data and qRT-PCR suggested that those selected DcWRKY genes are involved in root development, biotic and abiotic stress response. This comprehensive analysis provides a basis for investigating the evolution and function of WRKY genes.

  2. Phylogeographic and genome-wide investigations of Vietnam ethnic groups reveal signatures of complex historical demographic movements.

    Science.gov (United States)

    Pischedda, S; Barral-Arca, R; Gómez-Carballa, A; Pardo-Seco, J; Catelli, M L; Álvarez-Iglesias, V; Cárdenas, J M; Nguyen, N D; Ha, H H; Le, A T; Martinón-Torres, F; Vullo, C; Salas, A

    2017-10-03

    The territory of present-day Vietnam was the cradle of one of the world's earliest civilizations, and one of the first world regions to develop agriculture. We analyzed the mitochondrial DNA (mtDNA) complete control region of six ethnic groups and the mitogenomes from Vietnamese in The 1000 Genomes Project (1000G). Genome-wide data from 1000G (~55k SNPs) were also investigated to explore different demographic scenarios. All Vietnamese carry South East Asian (SEA) haplotypes, which show a moderate geographic and ethnic stratification, with the Mong constituting the most distinctive group. Two new mtDNA clades (M7b1a1f1 and F1f1) point to historical gene flow between the Vietnamese and other neighboring countries. Bayesian-based inferences indicate a time-deep and continuous population growth of Vietnamese, although with some exceptions. The dramatic population decrease experienced by the Cham 700 years ago (ya) fits well with the Nam tiến ("southern expansion") southwards from their original heartland in the Red River Delta. Autosomal SNPs consistently point to important historical gene flow within mainland SEA, and add support to a main admixture event occurring between Chinese and a southern Asian ancestral composite (mainly represented by the Malay). This admixture event occurred ~800 ya, again coinciding with the Nam tiến.

  3. Torix group Rickettsia are widespread in Culicoides biting midges (Diptera: Ceratopogonidae), reach high frequency and carry unique genomic features.

    Science.gov (United States)

    Pilgrim, Jack; Ander, Mats; Garros, Claire; Baylis, Matthew; Hurst, Gregory D D; Siozios, Stefanos

    2017-10-01

    There is increasing interest in the heritable bacteria of invertebrate vectors of disease as they present novel targets for control initiatives. Previous studies on biting midges (Culicoides spp.), known to transmit several RNA viruses of veterinary importance, have revealed infections with the endosymbiotic bacteria, Wolbachia and Cardinium. However, rickettsial symbionts in these vectors are underexplored. Here, we present the genome of a previously uncharacterized Rickettsia endosymbiont from Culicoides newsteadi (RiCNE). This genome presents unique features potentially associated with host invasion and adaptation, including genes for the complete non-oxidative phase of the pentose phosphate pathway, and others predicted to mediate lipopolysaccharides and cell wall modification. Screening of 414 Culicoides individuals from 29 Palearctic or Afrotropical species revealed that Rickettsia represent a widespread but previously overlooked association, reaching high frequencies in midge populations and present in 38% of the species tested. Sequence typing clusters the Rickettsia within the Torix group of the genus, a group known to infect several aquatic and hematophagous taxa. FISH analysis indicated the presence of Rickettsia bacteria in ovary tissue, indicating their maternal inheritance. Given the importance of biting midges as vectors, a key area of future research is to establish the impact of this endosymbiont on vector competence. © 2017 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  4. Framework for development of physician competencies in genomic medicine: report of the Competencies Working Group of the Inter-Society Coordinating Committee for Physician Education in Genomics.

    Science.gov (United States)

    Korf, Bruce R; Berry, Anna B; Limson, Melvin; Marian, Ali J; Murray, Michael F; O'Rourke, P Pearl; Passamani, Eugene R; Relling, Mary V; Tooker, John; Tsongalis, Gregory J; Rodriguez, Laura L

    2014-11-01

    Completion of the Human Genome Project, in conjunction with dramatic reductions in the cost of DNA sequencing and advances in translational research, is gradually ushering genomic discoveries and technologies into the practice of medicine. The rapid pace of these advances is opening up a gap between the knowledge available about the clinical relevance of genomic information and the ability of clinicians to include such information in their medical practices. This educational gap threatens to be rate limiting to the clinical adoption of genomics in medicine. Solutions will require not only a better understanding of the clinical implications of genetic discoveries but also training in genomics at all levels of professional development, including for individuals in formal training and others who long ago completed such training. The National Human Genome Research Institute has convened the Inter-Society Coordinating Committee for Physician Education in Genomics (ISCC) to develop and share best practices in the use of genomics in medicine. The ISCC has developed a framework for development of genomics practice competencies that may serve as a starting point for formulation of competencies for physicians in various medical disciplines.

  5. Insights from the Genome Sequence of Acidovorax citrulli M6, a Group I Strain of the Causal Agent of Bacterial Fruit Blotch of Cucurbits.

    Science.gov (United States)

    Eckshtain-Levi, Noam; Shkedy, Dafna; Gershovits, Michael; Da Silva, Gustavo M; Tamir-Ariel, Dafna; Walcott, Ron; Pupko, Tal; Burdman, Saul

    2016-01-01

    Acidovorax citrulli is a seedborne bacterium that causes bacterial fruit blotch of cucurbit plants including watermelon and melon. A. citrulli strains can be divided into two major groups based on DNA fingerprint analyses and biochemical properties. Group I strains have been generally isolated from non-watermelon cucurbits, while group II strains are closely associated with watermelon. In the present study, we report the genome sequence of M6, a group I model A. citrulli strain, isolated from melon. We used comparative genome analysis to investigate differences between the genome of strain M6 and the genome of the group II model strain AAC00-1. The draft genome sequence of A. citrulli M6 harbors 139 contigs, with an overall approximate size of 4.85 Mb. The genome of M6 is ∼500 Kb shorter than that of strain AAC00-1. Comparative analysis revealed that this size difference is mainly explained by eight fragments, ranging from ∼35-120 Kb and distributed throughout the AAC00-1 genome, which are absent in the M6 genome. In agreement with this finding, while AAC00-1 was found to possess 532 open reading frames (ORFs) that are absent in strain M6, only 123 ORFs in M6 were absent in AAC00-1. Most of these M6 ORFs are hypothetical proteins and most of them were also detected in two group I strains that were recently sequenced, tw6 and pslb65. Further analyses by PCR assays and coverage analyses with other A. citrulli strains support the notion that some of these fragments or significant portions of them are discriminative between groups I and II strains of A. citrulli. Moreover, GC content, effective number of codon values and cluster of orthologs' analyses indicate that these fragments were introduced into group II strains by horizontal gene transfer events. Our study reports the genome sequence of a model group I strain of A. citrulli, one of the most important pathogens of cucurbits. It also provides the first comprehensive comparison at the genomic level between the

  6. Coalescent-Based Analyses of Genomic Sequence Data Provide a Robust Resolution of Phylogenetic Relationships among Major Groups of Gibbons

    Science.gov (United States)

    Shi, Cheng-Min; Yang, Ziheng

    2018-01-01

    Abstract The phylogenetic relationships among extant gibbon species remain unresolved despite numerous efforts using morphological, behavorial, and genetic data and the sequencing of whole genomes. A major challenge in reconstructing the gibbon phylogeny is the radiative speciation process, which resulted in extremely short internal branches in the species phylogeny and extensive incomplete lineage sorting with extensive gene-tree heterogeneity across the genome. Here, we analyze two genomic-scale data sets, with ∼10,000 putative noncoding and exonic loci, respectively, to estimate the species tree for the major groups of gibbons. We used the Bayesian full-likelihood method bpp under the multispecies coalescent model, which naturally accommodates incomplete lineage sorting and uncertainties in the gene trees. For comparison, we included three heuristic coalescent-based methods (mp-est, SVDQuartets, and astral) as well as concatenation. From both data sets, we infer the phylogeny for the four extant gibbon genera to be (Hylobates, (Nomascus, (Hoolock, Symphalangus))). We used simulation guided by the real data to evaluate the accuracy of the methods used. Astral, while not as efficient as bpp, performed well in estimation of the species tree even in presence of excessive incomplete lineage sorting. Concatenation, mp-est and SVDQuartets were unreliable when the species tree contains very short internal branches. Likelihood ratio test of gene flow suggests a small amount of migration from Hylobates moloch to H. pileatus, while cross-genera migration is absent or rare. Our results highlight the utility of coalescent-based methods in addressing challenging species tree problems characterized by short internal branches and rampant gene tree-species tree discordance. PMID:29087487

  7. Influencing governance of a public-private partnership in plant genomics: The societal interface group as a new instrument for public involvement.

    Science.gov (United States)

    Hanssen, Lucien; Gremmen, Bart

    2013-08-01

    The Centre for BioSystems Genomics (CBSG) is a Dutch public-private partnership in plant genomics active in potato and tomato research and exploitation. Its Societal Interface Group (SIG) has been developed to inform its communication strategy and governance practice. This new instrument identifies and discusses early signals from society by bringing together people from different societal backgrounds with members of CBSG management. This interactive learning process facilitates the inclusion of public concerns and needs in scientific developments in the field of plant genomics, and simultaneously enables genomics scientists to search for more societal aims, meanings, and starting points for their research agenda. Analysis of the SIG sessions revealed that the input of public expertise is not threatening or irrational, but provides the opportunity to harness the creative potential of future users highly relevant for the development of societal practices in which plant genomics plays a role.

  8. The Transcriptome of the Reference Potato Genome Solanum tuberosum Group Phureja Clone DM1-3 516R44

    Science.gov (United States)

    Massa, Alicia N.; Childs, Kevin L.; Lin, Haining; Bryan, Glenn J.; Giuliano, Giovanni; Buell, C. Robin

    2011-01-01

    Advances in molecular breeding in potato have been limited by its complex biological system, which includes vegetative propagation, autotetraploidy, and extreme heterozygosity. The availability of the potato genome and accompanying gene complement with corresponding gene structure, location, and functional annotation are powerful resources for understanding this complex plant and advancing molecular breeding efforts. Here, we report a reference for the potato transcriptome using 32 tissues and growth conditions from the doubled monoploid Solanum tuberosum Group Phureja clone DM1-3 516R44 for which a genome sequence is available. Analysis of greater than 550 million RNA-Seq reads permitted the detection and quantification of expression levels of over 22,000 genes. Hierarchical clustering and principal component analyses captured the biological variability that accounts for gene expression differences among tissues suggesting tissue-specific gene expression, and genes with tissue or condition restricted expression. Using gene co-expression network analysis, we identified 18 gene modules that represent tissue-specific transcriptional networks of major potato organs and developmental stages. This information provides a powerful resource for potato research as well as studies on other members of the Solanaceae family. PMID:22046362

  9. Genome analysis of Elusimicrobium minutum, the first cultivated representative of the Elusimicrobia phylum (formerly Termite Group 1)

    Energy Technology Data Exchange (ETDEWEB)

    Herlemann, D. P. R.; Geissinger, O.; Ikeda-Ohtsubo, W.; Kunin, V.; Sun, H.; Lapidus, A.; Hugenholtz, P.; Brune, A.

    2009-02-01

    The candidate phylum Termite group 1 (TG1), is regularly 1 encountered in termite hindguts but is present also in many other habitats. Here we report the complete genome sequence (1.64 Mbp) of Elusimicrobium minutum strain Pei191{sup T}, the first cultured representative of the TG1 phylum. We reconstructed the metabolism of this strictly anaerobic bacterium isolated from a beetle larva gut and discuss the findings in light of physiological data. E. minutum has all genes required for uptake and fermentation of sugars via the Embden-Meyerhof pathway, including several hydrogenases, and an unusual peptide degradation pathway comprising transamination reactions and leading to the formation of alanine, which is excreted in substantial amounts. The presence of genes encoding lipopolysaccharide biosynthesis and the presence of a pathway for peptidoglycan formation are consistent with ultrastructural evidence of a Gram-negative cell envelope. Even though electron micrographs showed no cell appendages, the genome encodes many genes putatively involved in pilus assembly. We assigned some to a type II secretion system, but the function of 60 pilE-like genes remains unknown. Numerous genes with hypothetical functions, e.g., polyketide synthesis, non-ribosomal peptide synthesis, antibiotic transport, and oxygen stress protection, indicate the presence of hitherto undiscovered physiological traits. Comparative analysis of 22 concatenated single-copy marker genes corroborated the status of Elusimicrobia (formerly TG1) as a separate phylum in the bacterial domain, which was so far based only on 16S rRNA sequence analysis.

  10. Integrative Sparse K-Means With Overlapping Group Lasso in Genomic Applications for Disease Subtype Discovery.

    Science.gov (United States)

    Huo, Zhiguang; Tseng, George

    2017-06-01

    Cancer subtypes discovery is the first step to deliver personalized medicine to cancer patients. With the accumulation of massive multi-level omics datasets and established biological knowledge databases, omics data integration with incorporation of rich existing biological knowledge is essential for deciphering a biological mechanism behind the complex diseases. In this manuscript, we propose an integrative sparse K -means (is- K means) approach to discover disease subtypes with the guidance of prior biological knowledge via sparse overlapping group lasso. An algorithm using an alternating direction method of multiplier (ADMM) will be applied for fast optimization. Simulation and three real applications in breast cancer and leukemia will be used to compare is- K means with existing methods and demonstrate its superior clustering accuracy, feature selection, functional annotation of detected molecular features and computing efficiency.

  11. Developing a common framework for evaluating the implementation of genomic medicine interventions in clinical care: the IGNITE Network's Common Measures Working Group.

    Science.gov (United States)

    Orlando, Lori A; Sperber, Nina R; Voils, Corrine; Nichols, Marshall; Myers, Rachel A; Wu, R Ryanne; Rakhra-Burris, Tejinder; Levy, Kenneth D; Levy, Mia; Pollin, Toni I; Guan, Yue; Horowitz, Carol R; Ramos, Michelle; Kimmel, Stephen E; McDonough, Caitrin W; Madden, Ebony B; Damschroder, Laura J

    2018-06-01

    PurposeImplementation research provides a structure for evaluating the clinical integration of genomic medicine interventions. This paper describes the Implementing Genomics in Practice (IGNITE) Network's efforts to promote (i) a broader understanding of genomic medicine implementation research and (ii) the sharing of knowledge generated in the network.MethodsTo facilitate this goal, the IGNITE Network Common Measures Working Group (CMG) members adopted the Consolidated Framework for Implementation Research (CFIR) to guide its approach to identifying constructs and measures relevant to evaluating genomic medicine as a whole, standardizing data collection across projects, and combining data in a centralized resource for cross-network analyses.ResultsCMG identified 10 high-priority CFIR constructs as important for genomic medicine. Of those, eight did not have standardized measurement instruments. Therefore, we developed four survey tools to address this gap. In addition, we identified seven high-priority constructs related to patients, families, and communities that did not map to CFIR constructs. Both sets of constructs were combined to create a draft genomic medicine implementation model.ConclusionWe developed processes to identify constructs deemed valuable for genomic medicine implementation and codified them in a model. These resources are freely available to facilitate knowledge generation and sharing across the field.

  12. Whole genome sequencing of group A Streptococcus: development and evaluation of an automated pipeline for emmgene typing

    Directory of Open Access Journals (Sweden)

    Georgia Kapatai

    2017-04-01

    Full Text Available Streptococcus pyogenes group A Streptococcus (GAS is the most common cause of bacterial throat infections, and can cause mild to severe skin and soft tissue infections, including impetigo, erysipelas, necrotizing fasciitis, as well as systemic and fatal infections including septicaemia and meningitis. Estimated annual incidence for invasive group A streptococcal infection (iGAS in industrialised countries is approximately three per 100,000 per year. Typing is currently used in England and Wales to monitor bacterial strains of S. pyogenes causing invasive infections and those isolated from patients and healthcare/care workers in cluster and outbreak situations. Sequence analysis of the emm gene is the currently accepted gold standard methodology for GAS typing. A comprehensive database of emm types observed from superficial and invasive GAS strains from England and Wales informs outbreak control teams during investigations. Each year the Bacterial Reference Department, Public Health England (PHE receives approximately 3,000 GAS isolates from England and Wales. In April 2014 the Bacterial Reference Department, PHE began genomic sequencing of referred S. pyogenes isolates and those pertaining to selected elderly/nursing care or maternity clusters from 2010 to inform future reference services and outbreak analysis (n = 3, 047. In line with the modernizing strategy of PHE, we developed a novel bioinformatics pipeline that can predict emmtypes using whole genome sequence (WGS data. The efficiency of this method was measured by comparing the emmtype assigned by this method against the result from the current gold standard methodology; concordance to emmsubtype level was observed in 93.8% (2,852/3,040 of our cases, whereas in 2.4% (n = 72 of our cases concordance was observed to emm type level. The remaining 3.8% (n = 117 of our cases corresponded to novel types/subtypes, contamination, laboratory sample transcription errors or problems arising

  13. Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation

    Science.gov (United States)

    2013-01-01

    Background The Streptococcus Anginosus Group (SAG) represents three closely related species of the viridans group streptococci recognized as commensal bacteria of the oral, gastrointestinal and urogenital tracts. The SAG also cause severe invasive infections, and are pathogens during cystic fibrosis (CF) pulmonary exacerbation. Little genomic information or description of virulence mechanisms is currently available for SAG. We conducted intra and inter species whole-genome comparative analyses with 59 publically available Streptococcus genomes and seven in-house closed high quality finished SAG genomes; S. constellatus (3), S. intermedius (2), and S. anginosus (2). For each SAG species, we sequenced at least one numerically dominant strain from CF airways recovered during acute exacerbation and an invasive, non-lung isolate. We also evaluated microevolution that occurred within two isolates that were cultured from one individual one year apart. Results The SAG genomes were most closely related to S. gordonii and S. sanguinis, based on shared orthologs and harbor a similar number of proteins within each COG category as other Streptococcus species. Numerous characterized streptococcus virulence factor homologs were identified within the SAG genomes including; adherence, invasion, spreading factors, LPxTG cell wall proteins, and two component histidine kinases known to be involved in virulence gene regulation. Mobile elements, primarily integrative conjugative elements and bacteriophage, account for greater than 10% of the SAG genomes. S. anginosus was the most variable species sequenced in this study, yielding both the smallest and the largest SAG genomes containing multiple genomic rearrangements, insertions and deletions. In contrast, within the S. constellatus and S. intermedius species, there was extensive continuous synteny, with only slight differences in genome size between strains. Within S. constellatus we were able to determine important SNPs and changes in

  14. The Genomics Education Partnership: Successful Integration of Research into Laboratory Classes at a Diverse Group of Undergraduate Institutions

    Science.gov (United States)

    Shaffer, Christopher D.; Alvarez, Consuelo; Bailey, Cheryl; Barnard, Daron; Bhalla, Satish; Chandrasekaran, Chitra; Chandrasekaran, Vidya; Chung, Hui-Min; Dorer, Douglas R.; Du, Chunguang; Eckdahl, Todd T.; Poet, Jeff L.; Frohlich, Donald; Goodman, Anya L.; Gosser, Yuying; Hauser, Charles; Hoopes, Laura L.M.; Johnson, Diana; Jones, Christopher J.; Kaehler, Marian; Kokan, Nighat; Kopp, Olga R.; Kuleck, Gary A.; McNeil, Gerard; Moss, Robert; Myka, Jennifer L.; Nagengast, Alexis; Morris, Robert; Overvoorde, Paul J.; Shoop, Elizabeth; Parrish, Susan; Reed, Kelynne; Regisford, E. Gloria; Revie, Dennis; Rosenwald, Anne G.; Saville, Ken; Schroeder, Stephanie; Shaw, Mary; Skuse, Gary; Smith, Christopher; Smith, Mary; Spana, Eric P.; Spratt, Mary; Stamm, Joyce; Thompson, Jeff S.; Wawersik, Matthew; Wilson, Barbara A.; Youngblom, Jim; Leung, Wilson; Buhler, Jeremy; Mardis, Elaine R.; Lopatto, David

    2010-01-01

    Genomics is not only essential for students to understand biology but also provides unprecedented opportunities for undergraduate research. The goal of the Genomics Education Partnership (GEP), a collaboration between a growing number of colleges and universities around the country and the Department of Biology and Genome Center of Washington University in St. Louis, is to provide such research opportunities. Using a versatile curriculum that has been adapted to many different class settings, GEP undergraduates undertake projects to bring draft-quality genomic sequence up to high quality and/or participate in the annotation of these sequences. GEP undergraduates have improved more than 2 million bases of draft genomic sequence from several species of Drosophila and have produced hundreds of gene models using evidence-based manual annotation. Students appreciate their ability to make a contribution to ongoing research, and report increased independence and a more active learning approach after participation in GEP projects. They show knowledge gains on pre- and postcourse quizzes about genes and genomes and in bioinformatic analysis. Participating faculty also report professional gains, increased access to genomics-related technology, and an overall positive experience. We have found that using a genomics research project as the core of a laboratory course is rewarding for both faculty and students. PMID:20194808

  15. Enrichment and genome sequence of the group I.1a ammonia-oxidizing Archaeon "Ca. Nitrosotenuis uzonensis" representing a clade globally distributed in thermal habitats.

    Directory of Open Access Journals (Sweden)

    Elena V Lebedeva

    Full Text Available The discovery of ammonia-oxidizing archaea (AOA of the phylum Thaumarchaeota and the high abundance of archaeal ammonia monooxygenase subunit A encoding gene sequences in many environments have extended our perception of nitrifying microbial communities. Moreover, AOA are the only aerobic ammonia oxidizers known to be active in geothermal environments. Molecular data indicate that in many globally distributed terrestrial high-temperature habits a thaumarchaeotal lineage within the Nitrosopumilus cluster (also called "marine" group I.1a thrives, but these microbes have neither been isolated from these systems nor functionally characterized in situ yet. In this study, we report on the enrichment and genomic characterization of a representative of this lineage from a thermal spring in Kamchatka. This thaumarchaeote, provisionally classified as "Candidatus Nitrosotenuis uzonensis", is a moderately thermophilic, non-halophilic, chemolithoautotrophic ammonia oxidizer. The nearly complete genome sequence (assembled into a single scaffold of this AOA confirmed the presence of the typical thaumarchaeotal pathways for ammonia oxidation and carbon fixation, and indicated its ability to produce coenzyme F420 and to chemotactically react to its environment. Interestingly, like members of the genus Nitrosoarchaeum, "Candidatus N. uzonensis" also possesses a putative artubulin-encoding gene. Genome comparisons to related AOA with available genome sequences confirmed that the newly cultured AOA has an average nucleotide identity far below the species threshold and revealed a substantial degree of genomic plasticity with unique genomic regions in "Ca. N. uzonensis", which potentially include genetic determinants of ecological niche differentiation.

  16. Enrichment and genome sequence of the group I.1a ammonia-oxidizing Archaeon "Ca. Nitrosotenuis uzonensis" representing a clade globally distributed in thermal habitats.

    Science.gov (United States)

    Lebedeva, Elena V; Hatzenpichler, Roland; Pelletier, Eric; Schuster, Nathalie; Hauzmayer, Sandra; Bulaev, Aleksandr; Grigor'eva, Nadezhda V; Galushko, Alexander; Schmid, Markus; Palatinszky, Marton; Le Paslier, Denis; Daims, Holger; Wagner, Michael

    2013-01-01

    The discovery of ammonia-oxidizing archaea (AOA) of the phylum Thaumarchaeota and the high abundance of archaeal ammonia monooxygenase subunit A encoding gene sequences in many environments have extended our perception of nitrifying microbial communities. Moreover, AOA are the only aerobic ammonia oxidizers known to be active in geothermal environments. Molecular data indicate that in many globally distributed terrestrial high-temperature habits a thaumarchaeotal lineage within the Nitrosopumilus cluster (also called "marine" group I.1a) thrives, but these microbes have neither been isolated from these systems nor functionally characterized in situ yet. In this study, we report on the enrichment and genomic characterization of a representative of this lineage from a thermal spring in Kamchatka. This thaumarchaeote, provisionally classified as "Candidatus Nitrosotenuis uzonensis", is a moderately thermophilic, non-halophilic, chemolithoautotrophic ammonia oxidizer. The nearly complete genome sequence (assembled into a single scaffold) of this AOA confirmed the presence of the typical thaumarchaeotal pathways for ammonia oxidation and carbon fixation, and indicated its ability to produce coenzyme F420 and to chemotactically react to its environment. Interestingly, like members of the genus Nitrosoarchaeum, "Candidatus N. uzonensis" also possesses a putative artubulin-encoding gene. Genome comparisons to related AOA with available genome sequences confirmed that the newly cultured AOA has an average nucleotide identity far below the species threshold and revealed a substantial degree of genomic plasticity with unique genomic regions in "Ca. N. uzonensis", which potentially include genetic determinants of ecological niche differentiation.

  17. Complete genome sequence of the bacteriochlorophyll a-containing Roseibacterium elongatum type strain (DSM 19469(T)), a representative of the Roseobacter group isolated from Australian coast sand.

    Science.gov (United States)

    Riedel, Thomas; Fiebig, Anne; Göker, Markus; Klenk, Hans-Peter

    2014-06-15

    Roseibacterium elongatum Suzuki et al. 2006 is a pink-pigmented and bacteriochlorophyll a-producing representative of the Roseobacter group within the alphaproteobacterial family Rhodobacteraceae. Representatives of the marine 'Roseobacter group' were found to be abundant in the ocean and play an important role in global and biogeochemical processes. In the present study we describe the features of R. elongatum strain OCh 323(T) together with its genome sequence and annotation. The 3,555,102 bp long genome consists of one circular chromosome with no extrachromosomal elements and is one of the smallest known Roseobacter genomes. It contains 3,540 protein-coding genes and 59 RNA genes. Genome analysis revealed the presence of a photosynthetic gene cluster, which putatively enables a photoheterotrophic lifestyle. Gene sequences associated with quorum sensing, motility, surface attachment, and thiosulfate and carbon monoxide oxidation could be detected. The genome was sequenced as part of the activities of the Transregional Collaborative Research Centre 51 (TRR51) funded by the German Research Foundation (DFG).

  18. Genome Sequencing of Bacillus subtilis SC-8, Antagonistic to the Bacillus cereus Group, Isolated from Traditional Korean Fermented-Soybean Food

    OpenAIRE

    Yeo, In-Cheol; Lee, Nam Keun; Hahm, Young Tae

    2012-01-01

    Bacillus subtilis SC-8 is a Gram-positive bacterium displaying narrow antagonistic activity for the Bacillus cereus group. B. subtilis SC-8 was isolated from Korean traditional fermented-soybean food. Here we report the draft genome sequence of B. subtilis SC-8, including biosynthetic genes for antibiotics that may have beneficial effects for control of food-borne pathogens.

  19. The complete genomic sequence of lytic bacteriophage gh-1 infecting Pseudomonas putida--evidence for close relationship to the T7 group

    International Nuclear Information System (INIS)

    Kovalyova, Irina V.; Kropinski, Andrew M.

    2003-01-01

    The genome of the lytic Pseudomonas putida bacteriophage gh-1 is linear double-stranded DNA containing 37,359 bp with 216-bp direct terminal repeats. Like other members of the T7 group, the gh-1 genome contains regions of high homology to T7 interspersed with nonhomologous regions that contain small open reading frames of unknown function. The genome shares 31 genes in common with other members of the T7 group, including RNA polymerase, and an additional 12 unique putative genes. A major difference between gh-1 and other members of this group is the absence of any open reading frames between the left direct terminal repeat and gene 1. Sequence analysis of the gh-1 genome also revealed the presence of 10 putative phage promoters with a consensus sequence similar to the promoters of T3 and phiYeO3-12 (consensus: TAAAAACCCTCACTRTGGCHSCM). P. putida mutants resistant to gh-1 were demonstrated to have an altered lipopolysaccharide structure, indicating that members of this group use lipopolysaccharide as their cellular receptor

  20. Whole-Genome Sequences of Four Strains Closely Related to Members of the Mycobacterium chelonae Group, Isolated from Biofilms in a Drinking Water Distribution System Simulator

    Science.gov (United States)

    We report the draft genome sequences of four Mycobacterium chelonae group strains from biofilms obtained after a ‘chlorine burn’ in a chloraminated drinking water distribution system simulator. These opportunistic pathogens have been detected in drinking and hospital water distr...

  1. Genome-wide Association for Major Depression Through Age at Onset Stratification: Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium.

    Science.gov (United States)

    Power, Robert A; Tansey, Katherine E; Buttenschøn, Henriette Nørmølle; Cohen-Woods, Sarah; Bigdeli, Tim; Hall, Lynsey S; Kutalik, Zoltán; Lee, S Hong; Ripke, Stephan; Steinberg, Stacy; Teumer, Alexander; Viktorin, Alexander; Wray, Naomi R; Arolt, Volker; Baune, Bernard T; Boomsma, Dorret I; Børglum, Anders D; Byrne, Enda M; Castelao, Enrique; Craddock, Nick; Craig, Ian W; Dannlowski, Udo; Deary, Ian J; Degenhardt, Franziska; Forstner, Andreas J; Gordon, Scott D; Grabe, Hans J; Grove, Jakob; Hamilton, Steven P; Hayward, Caroline; Heath, Andrew C; Hocking, Lynne J; Homuth, Georg; Hottenga, Jouke J; Kloiber, Stefan; Krogh, Jesper; Landén, Mikael; Lang, Maren; Levinson, Douglas F; Lichtenstein, Paul; Lucae, Susanne; MacIntyre, Donald J; Madden, Pamela; Magnusson, Patrik K E; Martin, Nicholas G; McIntosh, Andrew M; Middeldorp, Christel M; Milaneschi, Yuri; Montgomery, Grant W; Mors, Ole; Müller-Myhsok, Bertram; Nyholt, Dale R; Oskarsson, Hogni; Owen, Michael J; Padmanabhan, Sandosh; Penninx, Brenda W J H; Pergadia, Michele L; Porteous, David J; Potash, James B; Preisig, Martin; Rivera, Margarita; Shi, Jianxin; Shyn, Stanley I; Sigurdsson, Engilbert; Smit, Johannes H; Smith, Blair H; Stefansson, Hreinn; Stefansson, Kari; Strohmaier, Jana; Sullivan, Patrick F; Thomson, Pippa; Thorgeirsson, Thorgeir E; Van der Auwera, Sandra; Weissman, Myrna M; Breen, Gerome; Lewis, Cathryn M

    2017-02-15

    Major depressive disorder (MDD) is a disabling mood disorder, and despite a known heritable component, a large meta-analysis of genome-wide association studies revealed no replicable genetic risk variants. Given prior evidence of heterogeneity by age at onset in MDD, we tested whether genome-wide significant risk variants for MDD could be identified in cases subdivided by age at onset. Discovery case-control genome-wide association studies were performed where cases were stratified using increasing/decreasing age-at-onset cutoffs; significant single nucleotide polymorphisms were tested in nine independent replication samples, giving a total sample of 22,158 cases and 133,749 control subjects for subsetting. Polygenic score analysis was used to examine whether differences in shared genetic risk exists between earlier and adult-onset MDD with commonly comorbid disorders of schizophrenia, bipolar disorder, Alzheimer's disease, and coronary artery disease. We identified one replicated genome-wide significant locus associated with adult-onset (>27 years) MDD (rs7647854, odds ratio: 1.16, 95% confidence interval: 1.11-1.21, p = 5.2 × 10 -11 ). Using polygenic score analyses, we show that earlier-onset MDD is genetically more similar to schizophrenia and bipolar disorder than adult-onset MDD. We demonstrate that using additional phenotype data previously collected by genetic studies to tackle phenotypic heterogeneity in MDD can successfully lead to the discovery of genetic risk factor despite reduced sample size. Furthermore, our results suggest that the genetic susceptibility to MDD differs between adult- and earlier-onset MDD, with earlier-onset cases having a greater genetic overlap with schizophrenia and bipolar disorder. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  2. Complete mtDNA genomes of Filipino ethnolinguistic groups: a melting pot of recent and ancient lineages in the Asia-Pacific region

    Science.gov (United States)

    Delfin, Frederick; Min-Shan Ko, Albert; Li, Mingkun; Gunnarsdóttir, Ellen D; Tabbada, Kristina A; Salvador, Jazelyn M; Calacal, Gayvelline C; Sagum, Minerva S; Datar, Francisco A; Padilla, Sabino G; De Ungria, Maria Corazon A; Stoneking, Mark

    2014-01-01

    The Philippines is a strategic point in the Asia-Pacific region for the study of human diversity, history and origins, as it is a cross-road for human migrations and consequently exhibits enormous ethnolinguistic diversity. Following on a previous in-depth study of Y-chromosome variation, here we provide new insights into the maternal genetic history of Filipino ethnolinguistic groups by surveying complete mitochondrial DNA (mtDNA) genomes from a total of 14 groups (11 groups in this study and 3 groups previously published) including previously published mtDNA hypervariable segment (HVS) data from Filipino regional center groups. Comparison of HVS data indicate genetic differences between ethnolinguistic and regional center groups. The complete mtDNA genomes of 14 ethnolinguistic groups reveal genetic aspects consistent with the Y-chromosome, namely: diversity and heterogeneity of groups, no support for a simple dichotomy between Negrito and non-Negrito groups, and different genetic affinities with Asia-Pacific groups that are both ancient and recent. Although some mtDNA haplogroups can be associated with the Austronesian expansion, there are others that associate with South Asia, Near Oceania and Australia that are consistent with a southern migration route for ethnolinguistic group ancestors into the Asia-Pacific, with a timeline that overlaps with the initial colonization of the Asia-Pacific region, the initial colonization of the Philippines and a possible separate post-colonization migration into the Philippine archipelago. PMID:23756438

  3. Modeling heterogeneous (co)variances from adjacent-SNP groups improves genomic prediction for milk protein composition traits

    DEFF Research Database (Denmark)

    Gebreyesus, Grum; Lund, Mogens Sandø; Buitenhuis, Albert Johannes

    2017-01-01

    Accurate genomic prediction requires a large reference population, which is problematic for traits that are expensive to measure. Traits related to milk protein composition are not routinely recorded due to costly procedures and are considered to be controlled by a few quantitative trait loci...... of large effect. The amount of variation explained may vary between regions leading to heterogeneous (co)variance patterns across the genome. Genomic prediction models that can efficiently take such heterogeneity of (co)variances into account can result in improved prediction reliability. In this study, we...... developed and implemented novel univariate and bivariate Bayesian prediction models, based on estimates of heterogeneous (co)variances for genome segments (BayesAS). Available data consisted of milk protein composition traits measured on cows and de-regressed proofs of total protein yield derived for bulls...

  4. Population and Whole Genome Sequence Based Characterization of Invasive Group A Streptococci Recovered in the United States during 2015

    Directory of Open Access Journals (Sweden)

    Sopio Chochua

    2017-09-01

    Full Text Available Group A streptococci (GAS are genetically diverse. Determination of strain features can reveal associations with disease and resistance and assist in vaccine formulation. We employed whole-genome sequence (WGS-based characterization of 1,454 invasive GAS isolates recovered in 2015 by Active Bacterial Core Surveillance and performed conventional antimicrobial susceptibility testing. Predictions were made for genotype, GAS carbohydrate, antimicrobial resistance, surface proteins (M family, fibronectin binding, T, R28, secreted virulence proteins (Sda1, Sic, exotoxins, hyaluronate capsule, and an upregulated nga operon (encodes NADase and streptolysin O promoter (Pnga3. Sixty-four M protein gene (emm types were identified among 69 clonal complexes (CCs, including one CC of Streptococcus dysgalactiae subsp. equisimilis. emm types predicted the presence or absence of active sof determinants and were segregated into sof-positive or sof-negative genetic complexes. Only one “emm type switch” between strains was apparent. sof-negative strains showed a propensity to cause infections in the first quarter of the year, while sof+ strain infections were more likely in summer. Of 1,454 isolates, 808 (55.6% were Pnga3 positive and 637 (78.9% were accounted for by types emm1, emm89, and emm12. Theoretical coverage of a 30-valent M vaccine combined with an M-related protein (Mrp vaccine encompassed 98% of the isolates. WGS data predicted that 15.3, 13.8, 12.7, and 0.6% of the isolates were nonsusceptible to tetracycline, erythromycin plus clindamycin, erythromycin, and fluoroquinolones, respectively, with only 19 discordant phenotypic results. Close phylogenetic clustering of emm59 isolates was consistent with recent regional emergence. This study revealed strain traits informative for GAS disease incidence tracking, outbreak detection, vaccine strategy, and antimicrobial therapy.

  5. Complete genome sequence of the bacteriochlorophyll a-containing Roseibacterium elongatum type strain (DSM 19469T), a representative of the Roseobacter group isolated from Australian coast sand

    Science.gov (United States)

    Riedel, Thomas; Fiebig, Anne; Göker, Markus; Klenk, Hans-Peter

    2014-01-01

    Roseibacterium elongatum Suzuki et al. 2006 is a pink-pigmented and bacteriochlorophyll a-producing representative of the Roseobacter group within the alphaproteobacterial family Rhodobacteraceae. Representatives of the marine ‘Roseobacter group’ were found to be abundant in the ocean and play an important role in global and biogeochemical processes. In the present study we describe the features of R. elongatum strain OCh 323T together with its genome sequence and annotation. The 3,555,102 bp long genome consists of one circular chromosome with no extrachromosomal elements and is one of the smallest known Roseobacter genomes. It contains 3,540 protein-coding genes and 59 RNA genes. Genome analysis revealed the presence of a photosynthetic gene cluster, which putatively enables a photoheterotrophic lifestyle. Gene sequences associated with quorum sensing, motility, surface attachment, and thiosulfate and carbon monoxide oxidation could be detected. The genome was sequenced as part of the activities of the Transregional Collaborative Research Centre 51 (TRR51) funded by the German Research Foundation (DFG). PMID:25197467

  6. Molecular cytogenetic and genomic analyses reveal new insights into the origin of the wheat B genome.

    Science.gov (United States)

    Zhang, Wei; Zhang, Mingyi; Zhu, Xianwen; Cao, Yaping; Sun, Qing; Ma, Guojia; Chao, Shiaoman; Yan, Changhui; Xu, Steven S; Cai, Xiwen

    2018-02-01

    This work pinpointed the goatgrass chromosomal segment in the wheat B genome using modern cytogenetic and genomic technologies, and provided novel insights into the origin of the wheat B genome. Wheat is a typical allopolyploid with three homoeologous subgenomes (A, B, and D). The donors of the subgenomes A and D had been identified, but not for the subgenome B. The goatgrass Aegilops speltoides (genome SS) has been controversially considered a possible candidate for the donor of the wheat B genome. However, the relationship of the Ae. speltoides S genome with the wheat B genome remains largely obscure. The present study assessed the homology of the B and S genomes using an integrative cytogenetic and genomic approach, and revealed the contribution of Ae. speltoides to the origin of the wheat B genome. We discovered noticeable homology between wheat chromosome 1B and Ae. speltoides chromosome 1S, but not between other chromosomes in the B and S genomes. An Ae. speltoides-originated segment spanning a genomic region of approximately 10.46 Mb was detected on the long arm of wheat chromosome 1B (1BL). The Ae. speltoides-originated segment on 1BL was found to co-evolve with the rest of the B genome. Evidently, Ae. speltoides had been involved in the origin of the wheat B genome, but should not be considered an exclusive donor of this genome. The wheat B genome might have a polyphyletic origin with multiple ancestors involved, including Ae. speltoides. These novel findings will facilitate genome studies in wheat and other polyploids.

  7. Model comparison on genomic predictions using high-density markers for different groups of bulls in the Nordic Holstein population

    DEFF Research Database (Denmark)

    Gao, Hongding; Su, Guosheng; Janss, Luc

    2013-01-01

    This study compared genomic predictions based on imputed high-density markers (~777,000) in the Nordic Holstein population using a genomic BLUP (GBLUP) model, 4 Bayesian exponential power models with different shape parameters (0.3, 0.5, 0.8, and 1.0) for the exponential power distribution...... relationship with the training population. Groupsmgs had both the sire and the maternal grandsire (MGS), Groupsire only had the sire, Groupmgs only had the MGS, and Groupnon had neither the sire nor the MGS in the training population. Reliability of DGV was measured as the squared correlation between DGV...... and DRP divided by the reliability of DRP for the bulls in validation data set. Unbiasedness of DGV was measured as the regression of DRP on DGV. The results indicated that DGV were more accurate and less biased for animals that were more related to the training population. In general, the Bayesian...

  8. Genomic Comparison of Two Family-Level Groups of the Uncultivated NAG1 Archaeal Lineage from Chemically and Geographically Disparate Hot Springs

    Directory of Open Access Journals (Sweden)

    Eric D. Becraft

    2017-10-01

    Full Text Available Recent progress based on single-cell genomics and metagenomic investigations of archaea in a variety of extreme environments has led to significant advances in our understanding of the diversity, evolution, and metabolic potential of archaea, yet the vast majority of archaeal diversity remains undersampled. In this work, we coordinated single-cell genomics with metagenomics in order to construct a near-complete genome from a deeply branching uncultivated archaeal lineage sampled from Great Boiling Spring (GBS in the U.S. Great Basin, Nevada. This taxon is distantly related (distinct families to an archaeal genome, designated “Novel Archaeal Group 1” (NAG1, which was extracted from a metagenome recovered from an acidic iron spring in Yellowstone National Park (YNP. We compared the metabolic predictions of the NAG1 lineage to better understand how these archaea could inhabit such chemically distinct environments. Similar to the NAG1 population previously studied in YNP, the NAG1 population from GBS is predicted to utilize proteins as a primary carbon source, ferment simple carbon sources, and use oxygen as a terminal electron acceptor under oxic conditions. However, GBS NAG1 populations contained distinct genes involved in central carbon metabolism and electron transfer, including nitrite reductase, which could confer the ability to reduce nitrite under anaerobic conditions. Despite inhabiting chemically distinct environments with large variations in pH, GBS NAG1 populations shared many core genomic and metabolic features with the archaeon identified from YNP, yet were able to carve out a distinct niche at GBS.

  9. A new group in the Leptospirillum clade: cultivation-independent community genomics, proteomics and transcriptomics of the new species Leptospirillum group IV UBA BS.

    Energy Technology Data Exchange (ETDEWEB)

    Goltsman, Daniela [University of California, Berkeley; Dasari, Mauna [University of California, Berkeley; Thomas, BC [University of California, Berkeley; Shah, Manesh B [ORNL; Verberkmoes, Nathan C [ORNL; Hettich, Robert {Bob} L [ORNL; Banfield, Jillian F. [University of California, Berkeley

    2013-01-01

    Leptospirillum spp. are widespread members of acidophilic microbial communities that catalyze ferrous iron oxidation, thereby increasing sulfide mineral dissolution rates. These bacteria play important roles in environmental acidification and are harnessed for bioleaching-based metal recovery. Known members of the Leptospirillum clade of the Nitrospira phylum are Leptospirillum ferrooxidans (group I), Leptospirillum ferriphilum and Leptospirillum rubarum (group II), and Leptospirillum ferrodiazotrophum (group III). In the Richmond Mine acid mine drainage (AMD) system, biofilm formation is initiated by L. rubarum; L. ferrodiazotrophum appears in later developmental stages. Here we used community metagenomic data from unusual, thick floating biofilms to identify distinguishing metabolic traits in a rare and uncultivated community member, the new species Leptospirillum group IV UBA BS. These biofilms typically also contain a variety of Archaea, Actinobacteria, and a few other Leptospirillum spp. The Leptospirillum group IV UBA BS species shares 98% 16S rRNA sequence identity and 70% average amino acid identity between orthologs with its closest relative, L. ferrodiazotrophum. The presence of nitrogen fixation and reverse tricarboxylic acid (TCA) cycle proteins suggest an autotrophic metabolism similar to that of L. ferrodiazotrophum, while hydrogenase proteins suggest anaerobic metabolism. Community transcriptomic and proteomic analyses demonstrate expression of a multicopper oxidase unique to this species, as well as hydrogenases and core metabolic genes. Results suggest that the Leptospirillum group IV UBA BS species might play important roles in carbon fixation, nitrogen fixation, hydrogen metabolism, and iron oxidation in some acidic environments.

  10. Genic non-coding microsatellites in the rice genome: characterization, marker design and use in assessing genetic and evolutionary relationships among domesticated groups

    Directory of Open Access Journals (Sweden)

    Singh Nagendra

    2009-03-01

    Full Text Available Abstract Background Completely sequenced plant genomes provide scope for designing a large number of microsatellite markers, which are useful in various aspects of crop breeding and genetic analysis. With the objective of developing genic but non-coding microsatellite (GNMS markers for the rice (Oryza sativa L. genome, we characterized the frequency and relative distribution of microsatellite repeat-motifs in 18,935 predicted protein coding genes including 14,308 putative promoter sequences. Results We identified 19,555 perfect GNMS repeats with densities ranging from 306.7/Mb in chromosome 1 to 450/Mb in chromosome 12 with an average of 357.5 GNMS per Mb. The average microsatellite density was maximum in the 5' untranslated regions (UTRs followed by those in introns, promoters, 3'UTRs and minimum in the coding sequences (CDS. Primers were designed for 17,966 (92% GNMS repeats, including 4,288 (94% hypervariable class I types, which were bin-mapped on the rice genome. The GNMS markers were most polymorphic in the intronic region (73.3% followed by markers in the promoter region (53.3% and least in the CDS (26.6%. The robust polymerase chain reaction (PCR amplification efficiency and high polymorphic potential of GNMS markers over genic coding and random genomic microsatellite markers suggest their immediate use in efficient genotyping applications in rice. A set of these markers could assess genetic diversity and establish phylogenetic relationships among domesticated rice cultivar groups. We also demonstrated the usefulness of orthologous and paralogous conserved non-coding microsatellite (CNMS markers, identified in the putative rice promoter sequences, for comparative physical mapping and understanding of evolutionary and gene regulatory complexities among rice and other members of the grass family. The divergence between long-grained aromatics and subspecies japonica was estimated to be more recent (0.004 Mya compared to short

  11. Evolution in an autopolyploid group displaying predominantly bivalent pairing at meiosis: genomic similarity of diploid Vaccinium darrowi and autotetraploid V. corymbosum (Ericaceae).

    Science.gov (United States)

    Qu, L; Hancock, J; Whallon, J

    1998-05-01

    The genomic relationship between V. darrowi Camp (2n = 2x = 24) and V. corymbosum L. (2n = 4x = 48) was examined using an interspecific tetraploid hybrid, US 75, and representatives of the parental species. Two features in the background of US 75 led to the prediction that it was an allopolyploid: (1) the parental species are quite distinct morphologically and geographically, and (2) the diploid genome was incorporated into US 75 via an unreduced gamete. However, US 75 recently was shown to display tetrasomic inheritance using molecular markers. In the present cytological study, US 75 was found to have a lower than expected number of multivalents for an autopolyploid, although it had a significantly higher number of quadrivalents than its autotetraploid parent, V. corymbosum. Normal chromosome distributions were observed at anaphase I and II, and pollen viability was high. Our findings suggest that little genomic divergence has developed between the Vaccinium species and that the polyploids may freely exchange genes with sympatric diploid species via unreduced gametes. This pattern of hybridization could be an important component of evolution in all autopolyploid groups, making them much more dynamic than traditionally assumed.

  12. Progress toward characterization of the group A Streptococcus metagenome: complete genome sequence of a macrolide-resistant serotype M6 strain.

    Science.gov (United States)

    Banks, David J; Porcella, Stephen F; Barbian, Kent D; Beres, Stephen B; Philips, Lauren E; Voyich, Jovanka M; DeLeo, Frank R; Martin, Judith M; Somerville, Greg A; Musser, James M

    2004-08-15

    We describe the genome sequence of a macrolide-resistant strain (MGAS10394) of serotype M6 group A Streptococcus (GAS). The genome is 1,900,156 bp in length, and 8 prophage-like elements or remnants compose 12.4% of the chromosome. A 8.3-kb prophage remnant encodes the SpeA4 variant of streptococcal pyrogenic exotoxin A. The genome of strain MGAS10394 contains a chimeric genetic element composed of prophage genes and a transposon encoding the mefA gene conferring macrolide resistance. This chimeric element also has a gene encoding a novel surface-exposed protein (designated "R6 protein"), with an LPKTG cell-anchor motif located at the carboxyterminus. Surface expression of this protein was confirmed by flow cytometry. Humans with GAS pharyngitis caused by serotype M6 strains had antibody against the R6 protein present in convalescent, but not acute, serum samples. Our studies add to the theme that GAS prophage-encoded extracellular proteins contribute to host-pathogen interactions in a strain-specific fashion.

  13. Novel association of ABO histo-blood group antigen with soluble ICAM-1: results of a genome-wide association study of 6,578 women.

    Directory of Open Access Journals (Sweden)

    Guillaume Paré

    2008-07-01

    Full Text Available While circulating levels of soluble Intercellular Adhesion Molecule 1 (sICAM-1 have been associated with diverse conditions including myocardial infarction, stroke, malaria, and diabetes, comprehensive analysis of the common genetic determinants of sICAM-1 is not available. In a genome-wide association study conducted among 6,578 participants in the Women's Genome Health Study, we find that three SNPs at the ICAM1 (19p13.2 locus (rs1799969, rs5498 and rs281437 are non-redundantly associated with plasma sICAM-1 concentrations at a genome-wide significance level (P<5x10(-8, thus extending prior results from linkage and candidate gene studies. We also find that a single SNP (rs507666, P = 5.1x10(-29 at the ABO (9q34.2 locus is highly correlated with sICAM-1 concentrations. The novel association at the ABO locus provides evidence for a previously unknown regulatory role of histo-blood group antigens in inflammatory adhesion processes.

  14. The Mitochondrial Genome of the Prasinophyte Prasinoderma coloniale Reveals Two Trans-Spliced Group I Introns in the Large Subunit rRNA Gene

    Science.gov (United States)

    Pombert, Jean-François; Otis, Christian; Turmel, Monique; Lemieux, Claude

    2013-01-01

    Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI), we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V). This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl) at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI). Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF) occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the possible implications

  15. The mitochondrial genome of the prasinophyte Prasinoderma coloniale reveals two trans-spliced group I introns in the large subunit rRNA gene.

    Directory of Open Access Journals (Sweden)

    Jean-François Pombert

    Full Text Available Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI, we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V. This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI. Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the

  16. A Children's Oncology Group and TARGET initiative exploring the genetic landscape of Wilms tumor. | Office of Cancer Genomics

    Science.gov (United States)

    We performed genome-wide sequencing and analyzed mRNA and miRNA expression, DNA copy number, and DNA methylation in 117 Wilms tumors, followed by targeted sequencing of 651 Wilms tumors. In addition to genes previously implicated in Wilms tumors (WT1, CTNNB1, AMER1, DROSHA, DGCR8, XPO5, DICER1, SIX1, SIX2, MLLT1, MYCN, and TP53), we identified mutations in genes not previously recognized as recurrently involved in Wilms tumors, the most frequent being BCOR, BCORL1, NONO, MAX, COL6A3, ASXL1, MAP3K4, and ARID1A.

  17. Comparative Genomics of the Dual-Obligate Symbionts from the Treehopper, Entylia carinata (Hemiptera: Membracidae), Provide Insight into the Origins and Evolution of an Ancient Symbiosis.

    Science.gov (United States)

    Mao, Meng; Yang, Xiushuai; Poff, Kirsten; Bennett, Gordon

    2017-06-01

    Insect species in the Auchenorrhyncha suborder (Hemiptera) maintain ancient obligate symbioses with bacteria that provide essential amino acids (EAAs) deficient in their plant-sap diets. Molecular studies have revealed that two complementary symbiont lineages, "Candidatus Sulcia muelleri" and a betaproteobacterium ("Ca. Zinderia insecticola" in spittlebugs [Cercopoidea] and "Ca. Nasuia deltocephalinicola" in leafhoppers [Cicadellidae]) may have persisted in the suborder since its origin ∼300 Ma. However, investigation of how this pair has co-evolved on a genomic level is limited to only a few host lineages. We sequenced the complete genomes of Sulcia and a betaproteobacterium from the treehopper, Entylia carinata (Membracidae: ENCA), as the first representative from this species-rich group. It also offers the opportunity to compare symbiont evolution across a major insect group, the Membracoidea (leafhoppers + treehoppers). Genomic analyses show that the betaproteobacteria in ENCA is a member of the Nasuia lineage. Both symbionts have larger genomes (Sulcia = 218 kb and Nasuia = 144 kb) than related lineages in Deltocephalinae leafhoppers, retaining genes involved in basic cellular functions and information processing. Nasuia-ENCA further exhibits few unique gene losses, suggesting that its parent lineage in the common ancestor to the Membracoidea was already highly reduced. Sulcia-ENCA has lost the abilities to synthesize menaquinone cofactor and to complete the synthesis of the branched-chain EAAs. Both capabilities are conserved in other Sulcia lineages sequenced from across the Auchenorrhyncha. Finally, metagenomic sequencing recovered the partial genome of an Arsenophonus symbiont, although it infects only 20% of individuals indicating a facultative role. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Effective identification of Lactobacillus casei group species: genome-based selection of the gene mutL as the target of a novel multiplex PCR assay.

    Science.gov (United States)

    Bottari, Benedetta; Felis, Giovanna E; Salvetti, Elisa; Castioni, Anna; Campedelli, Ilenia; Torriani, Sandra; Bernini, Valentina; Gatti, Monica

    2017-07-01

    Lactobacillus casei,Lactobacillus paracasei and Lactobacillusrhamnosus form a closely related taxonomic group (the L. casei group) within the facultatively heterofermentative lactobacilli. Strains of these species have been used for a long time as probiotics in a wide range of products, and they represent the dominant species of nonstarter lactic acid bacteria in ripened cheeses, where they contribute to flavour development. The close genetic relationship among those species, as well as the similarity of biochemical properties of the strains, hinders the development of an adequate selective method to identify these bacteria. Despite this being a hot topic, as demonstrated by the large amount of literature about it, the results of different proposed identification methods are often ambiguous and unsatisfactory. The aim of this study was to develop a more robust species-specific identification assay for differentiating the species of the L. casei group. A taxonomy-driven comparative genomic analysis was carried out to select the potential target genes whose similarity could better reflect genome-wide diversity. The gene mutL appeared to be the most promising one and, therefore, a novel species-specific multiplex PCR assay was developed to rapidly and effectively distinguish L. casei, L. paracasei and L. rhamnosus strains. The analysis of a collection of 76 wild dairy isolates, previously identified as members of the L. casei group combining the results of multiple approaches, revealed that the novel designed primers, especially in combination with already existing ones, were able to improve the discrimination power at the species level and reveal previously undiscovered intraspecific biodiversity.

  19. Population Genomic Analysis of 1,777 Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolates, Houston, Texas: Unexpected Abundance of Clonal Group 307

    Directory of Open Access Journals (Sweden)

    S. Wesley Long

    2017-05-01

    Full Text Available Klebsiella pneumoniae is a major human pathogen responsible for high morbidity and mortality rates. The emergence and spread of strains resistant to multiple antimicrobial agents and documented large nosocomial outbreaks are especially concerning. To develop new therapeutic strategies for K. pneumoniae, it is imperative to understand the population genomic structure of strains causing human infections. To address this knowledge gap, we sequenced the genomes of 1,777 extended-spectrum beta-lactamase-producing K. pneumoniae strains cultured from patients in the 2,000-bed Houston Methodist Hospital system between September 2011 and May 2015, representing a comprehensive, population-based strain sample. Strains of largely uncharacterized clonal group 307 (CG307 caused more infections than those of well-studied epidemic CG258. Strains varied markedly in gene content and had an extensive array of small and very large plasmids, often containing antimicrobial resistance genes. Some patients with multiple strains cultured over time were infected with genetically distinct clones. We identified 15 strains expressing the New Delhi metallo-beta-lactamase 1 (NDM-1 enzyme that confers broad resistance to nearly all beta-lactam antibiotics. Transcriptome sequencing analysis of 10 phylogenetically diverse strains showed that the global transcriptome of each strain was unique and highly variable. Experimental mouse infection provided new information about immunological parameters of host-pathogen interaction. We exploited the large data set to develop whole-genome sequence-based classifiers that accurately predict clinical antimicrobial resistance for 12 of the 16 antibiotics tested. We conclude that analysis of large, comprehensive, population-based strain samples can assist understanding of the molecular diversity of these organisms and contribute to enhanced translational research.

  20. A 10-year follow-up of a child with mild case of xeroderma pigmentosum complementation group D diagnosed by whole-genome sequencing.

    Science.gov (United States)

    Ono, Ryusuke; Masaki, Taro; Mayca Pozo, Franklin; Nakazawa, Yuka; Swagemakers, Sigrid M A; Nakano, Eiji; Sakai, Wataru; Takeuchi, Seiji; Kanda, Fumio; Ogi, Tomoo; van der Spek, Peter J; Sugasawa, Kaoru; Nishigori, Chikako

    2016-07-01

    Most patients with xeroderma pigmentosum complementation group D (XP-D) from Western countries suffer from neurological symptoms, whereas Japanese patients display only skin manifestations without neurological symptoms. We have previously suggested that these differences in clinical manifestations in XP-D patients are attributed partly to a predominant mutation in ERCC2, and the allele frequency of S541R is highest in Japan. We diagnosed a child with mild case of XP-D by the evaluation of DNA repair activity and whole-genome sequencing, and followed her ten years. Skin cancer, mental retardation, and neurological symptoms were not observed. Her minimal erythema dose was 41 mJ/cm(2) , which was slightly lower than that of healthy Japanese volunteers. The patient's cells showed sixfold hypersensitivity to UV in comparison with normal cells. Post-UV unscheduled DNA synthesis was 20.4%, and post-UV recovery of RNA synthesis was 58% of non-irradiated samples, which was lower than that of normal fibroblasts. Genome sequence analysis indicated that the patient harbored a compound heterozygous mutation of c.1621A>C and c.591_594del, resulting in p.S541R and p.Y197* in ERCC2: then, patient was diagnosed with XP-D. Y197* has not been described before. Her mild skin manifestations might be attributed to the mutational site on her genome and daily strict sun protection. c.1621A>C might be a founder mutation of ERCC2 among Japanese XP-D patients, as it was identified most frequently in Japanese XP-D patients and it has not been found elsewhere outside Japan. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Population Genomic Analysis of 1,777 Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolates, Houston, Texas: Unexpected Abundance of Clonal Group 307.

    Science.gov (United States)

    Long, S Wesley; Olsen, Randall J; Eagar, Todd N; Beres, Stephen B; Zhao, Picheng; Davis, James J; Brettin, Thomas; Xia, Fangfang; Musser, James M

    2017-05-16

    Klebsiella pneumoniae is a major human pathogen responsible for high morbidity and mortality rates. The emergence and spread of strains resistant to multiple antimicrobial agents and documented large nosocomial outbreaks are especially concerning. To develop new therapeutic strategies for K. pneumoniae , it is imperative to understand the population genomic structure of strains causing human infections. To address this knowledge gap, we sequenced the genomes of 1,777 extended-spectrum beta-lactamase-producing K. pneumoniae strains cultured from patients in the 2,000-bed Houston Methodist Hospital system between September 2011 and May 2015, representing a comprehensive, population-based strain sample. Strains of largely uncharacterized clonal group 307 (CG307) caused more infections than those of well-studied epidemic CG258. Strains varied markedly in gene content and had an extensive array of small and very large plasmids, often containing antimicrobial resistance genes. Some patients with multiple strains cultured over time were infected with genetically distinct clones. We identified 15 strains expressing the New Delhi metallo-beta-lactamase 1 (NDM-1) enzyme that confers broad resistance to nearly all beta-lactam antibiotics. Transcriptome sequencing analysis of 10 phylogenetically diverse strains showed that the global transcriptome of each strain was unique and highly variable. Experimental mouse infection provided new information about immunological parameters of host-pathogen interaction. We exploited the large data set to develop whole-genome sequence-based classifiers that accurately predict clinical antimicrobial resistance for 12 of the 16 antibiotics tested. We conclude that analysis of large, comprehensive, population-based strain samples can assist understanding of the molecular diversity of these organisms and contribute to enhanced translational research. IMPORTANCE Klebsiella pneumoniae causes human infections that are increasingly difficult to

  2. TU-CD-BRB-07: Identification of Associations Between Radiologist-Annotated Imaging Features and Genomic Alterations in Breast Invasive Carcinoma, a TCGA Phenotype Research Group Study

    Energy Technology Data Exchange (ETDEWEB)

    Rao, A; Net, J [University of Miami, Miami, Florida (United States); Brandt, K [Mayo Clinic, Rochester, Minnesota (United States); Huang, E [National Cancer Institute, NIH, Bethesda, MD (United States); Freymann, J; Kirby, J [Leidos Biomedical Research Inc., Frederick, MD (United States); Burnside, E [University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin (United States); Morris, E; Sutton, E [Memorial Sloan Kettering Cancer Center, New York, NY (United States); Bonaccio, E [Roswell Park Cancer Institute, Buffalo, NY (United States); Giger, M; Jaffe, C [Univ Chicago, Chicago, IL (United States); Ganott, M; Zuley, M [University of Pittsburgh Medical Center - Magee Womens Hospital, Pittsburgh, Pennsylvania (United States); Le-Petross, H [MD Anderson Cancer Center, Houston, TX (United States); Dogan, B [UT MDACC, Houston, TX (United States); Whitman, G [UTMDACC, Houston, TX (United States)

    2015-06-15

    Purpose: To determine associations between radiologist-annotated MRI features and genomic measurements in breast invasive carcinoma (BRCA) from the Cancer Genome Atlas (TCGA). Methods: 98 TCGA patients with BRCA were assessed by a panel of radiologists (TCGA Breast Phenotype Research Group) based on a variety of mass and non-mass features according to the Breast Imaging Reporting and Data System (BI-RADS). Batch corrected gene expression data was obtained from the TCGA Data Portal. The Kruskal-Wallis test was used to assess correlations between categorical image features and tumor-derived genomic features (such as gene pathway activity, copy number and mutation characteristics). Image-derived features were also correlated with estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2/neu) status. Multiple hypothesis correction was done using Benjamini-Hochberg FDR. Associations at an FDR of 0.1 were selected for interpretation. Results: ER status was associated with rim enhancement and peritumoral edema. PR status was associated with internal enhancement. Several components of the PI3K/Akt pathway were associated with rim enhancement as well as heterogeneity. In addition, several components of cell cycle regulation and cell division were associated with imaging characteristics.TP53 and GATA3 mutations were associated with lesion size. MRI features associated with TP53 mutation status were rim enhancement and peritumoral edema. Rim enhancement was associated with activity of RB1, PIK3R1, MAP3K1, AKT1,PI3K, and PIK3CA. Margin status was associated with HIF1A/ARNT, Ras/ GTP/PI3K, KRAS, and GADD45A. Axillary lymphadenopathy was associated with RB1 and BCL2L1. Peritumoral edema was associated with Aurora A/GADD45A, BCL2L1, CCNE1, and FOXA1. Heterogeneous internal nonmass enhancement was associated with EGFR, PI3K, AKT1, HF/MET, and EGFR/Erbb4/neuregulin 1. Diffuse nonmass enhancement was associated with HGF/MET/MUC20/SHIP

  3. Cephalopod genomics

    DEFF Research Database (Denmark)

    Albertin, Caroline B.; Bonnaud, Laure; Brown, C. Titus

    2012-01-01

    The Cephalopod Sequencing Consortium (CephSeq Consortium) was established at a NESCent Catalysis Group Meeting, ``Paths to Cephalopod Genomics-Strategies, Choices, Organization,'' held in Durham, North Carolina, USA on May 24-27, 2012. Twenty-eight participants representing nine countries (Austria......, Australia, China, Denmark, France, Italy, Japan, Spain and the USA) met to address the pressing need for genome sequencing of cephalopod mollusks. This group, drawn from cephalopod biologists, neuroscientists, developmental and evolutionary biologists, materials scientists, bioinformaticians and researchers...... active in sequencing, assembling and annotating genomes, agreed on a set of cephalopod species of particular importance for initial sequencing and developed strategies and an organization (CephSeq Consortium) to promote this sequencing. The conclusions and recommendations of this meeting are described...

  4. Genetic relatedness of indigenous ethnic groups in northern Borneo to neighboring populations from Southeast Asia, as inferred from genome-wide SNP data.

    Science.gov (United States)

    Yew, Chee Wei; Hoque, Mohd Zahirul; Pugh-Kitingan, Jacqueline; Minsong, Alexander; Voo, Christopher Lok Yung; Ransangan, Julian; Lau, Sophia Tiek Ying; Wang, Xu; Saw, Woei Yuh; Ong, Rick Twee-Hee; Teo, Yik-Ying; Xu, Shuhua; Hoh, Boon-Peng; Phipps, Maude E; Kumar, S Vijay

    2018-07-01

    The region of northern Borneo is home to the current state of Sabah, Malaysia. It is located closest to the southern Philippine islands and may have served as a viaduct for ancient human migration onto or off of Borneo Island. In this study, five indigenous ethnic groups from Sabah were subjected to genome-wide SNP genotyping. These individuals represent the "North Borneo"-speaking group of the great Austronesian family. They have traditionally resided in the inland region of Sabah. The dataset was merged with public datasets, and the genetic relatedness of these groups to neighboring populations from the islands of Southeast Asia, mainland Southeast Asia and southern China was inferred. Genetic structure analysis revealed that these groups formed a genetic cluster that was independent of the clusters of neighboring populations. Additionally, these groups exhibited near-absolute proportions of a genetic component that is also common among Austronesians from Taiwan and the Philippines. They showed no genetic admixture with Austro-Melanesian populations. Furthermore, phylogenetic analysis showed that they are closely related to non-Austro-Melansian Filipinos as well as to Taiwan natives but are distantly related to populations from mainland Southeast Asia. Relatively lower heterozygosity and higher pairwise genetic differentiation index (F ST ) values than those of nearby populations indicate that these groups might have experienced genetic drift in the past, resulting in their differentiation from other Austronesians. Subsequent formal testing suggested that these populations have received no gene flow from neighboring populations. Taken together, these results imply that the indigenous ethnic groups of northern Borneo shared a common ancestor with Taiwan natives and non-Austro-Melanesian Filipinos and then isolated themselves on the inland of Sabah. This isolation presumably led to no admixture with other populations, and these individuals therefore underwent

  5. The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister-group to protostomes

    Energy Technology Data Exchange (ETDEWEB)

    Helfenbein, Kevin G.; Fourcade, H. Matthew; Vanjani, Rohit G.; Boore, Jeffrey L.

    2004-05-01

    We report the first complete mitochondrial (mt) DNA sequence from a member of the phylum Chaetognatha (arrow worms). The Paraspadella gotoi mtDNA is highly unusual, missing 23 of the genes commonly found in animal mtDNAs, including atp6, which has otherwise been found universally to be present. Its 14 genes are unusually arranged into two groups, one on each strand. One group is punctuated by numerous non-coding intergenic nucleotides, while the other group is tightly packed, having no non-coding nucleotides, leading to speculation that there are two transcription units with differing modes of expression. The phylogenetic position of the Chaetognatha within the Metazoa has long been uncertain, with conflicting or equivocal results from various morphological analyses and rRNA sequence comparisons. Comparisons here of amino acid sequences from mitochondrially encoded proteins gives a single most parsimonious tree that supports a position of Chaetognatha as sister to the protostomes studied here. From this, one can more clearly interpret the patterns of evolution of various developmental features, especially regarding the embryological fate of the blastopore.

  6. Genomic characterization, phylogenetic comparison and differential expression of the cyclic nucleotide-gated channels gene family in pear (Pyrus bretchneideri Rehd.).

    Science.gov (United States)

    Chen, Jianqing; Yin, Hao; Gu, Jinping; Li, Leiting; Liu, Zhe; Jiang, Xueting; Zhou, Hongsheng; Wei, Shuwei; Zhang, Shaoling; Wu, Juyou

    2015-01-01

    The cyclic nucleotide-gated channel (CNGC) family is involved in the uptake of various cations, such as Ca(2+), to regulate plant growth and respond to biotic and abiotic stresses. However, there is far less information about this family in woody plants such as pear. Here, we provided a genome-wide identification and analysis of the CNGC gene family in pear. Phylogenetic analysis showed that the 21 pear CNGC genes could be divided into five groups (I, II, III, IVA and IVB). The majority of gene duplications in pear appeared to have been caused by segmental duplication and occurred 32.94-39.14 million years ago. Evolutionary analysis showed that positive selection had driven the evolution of pear CNGCs. Motif analyses showed that Group I CNGCs generally contained 26 motifs, which was the greatest number of motifs in all CNGC groups. Among these, eight motifs were shared by each group, suggesting that these domains play a conservative role in CNGC activity. Tissue-specific expression analysis indicated that functional diversification of the duplicated CNGC genes was a major feature of long-term evolution. Our results also suggested that the P-S6 and PBC & hinge domains had co-evolved during the evolution. These results provide valuable information to increase our understanding of the function, evolution and expression analyses of the CNGC gene family in higher plants. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Genomic analysis reveals multi-drug resistance clusters in Group B Streptococcus CC17 hypervirulent isolates causing neonatal invasive disease in southern mainland China

    Directory of Open Access Journals (Sweden)

    Edmondo Campisi

    2016-08-01

    Full Text Available Neonatal invasive disease caused by group B Streptococcus (GBS represents a significant public health care concern globally. However, data related to disease burden, serotype distribution and molecular epidemiology in China and other Asian countries are very few and specifically relative to confined regions. The aim of this study was to investigate the genetic characteristics of GBS isolates recovered from neonates with invasive disease during 2013-2014 at Guangzhou and Changsha hospitals in southern mainland China. We assessed the capsular polysaccharide (CPS type, pilus islands (PIs distribution and hvgA gene presence in a panel of 26 neonatal clinical isolates, of which 8 were recovered from Early Onset Disease (EOD and 18 from Late Onset Disease (LOD. Among 26 isolates examined, five serotypes were identified. Type III was the most represented (15 cases, particularly among LOD strains (n=11, followed by types Ib (n=5, V (n=3, Ia (n=2 and II (n=1. We performed whole-genome sequencing (WGS analysis and antimicrobial susceptibility testing on the 14 serotype III isolates belonging to the hypervirulent Clonal Complex 17 (serotype III-CC17.The presence of PI-2b alone was associated with 13 out of 14 serotype III-CC17 strains. Genome analysis led us to identify two multi-drug resistance gene clusters harbored in two new versions of integrative and conjugative elements (ICEs, carrying five or eight antibiotic resistance genes, respectively. These ICEs replaced the 16 kb-locus that normally contains the PI-1 operon. All isolates harboring the identified ICEs showed multiple resistances to aminoglycoside, macrolide and tetracycline antibiotic classes. In conclusion, we report the first whole-genome sequence analysis of 14 GBS serotype III-CC17 strains isolated in China, representing the most prevalent lineage causing neonatal invasive disease. The acquisition of newly identified ICEs conferring multiple antibiotic resistances could in part explain

  8. Genomics:GTL Contractor-Grantee Workshop IV and Metabolic Engineering Working Group Inter-Agency Conference on Metabolic Engineering 2006

    Energy Technology Data Exchange (ETDEWEB)

    Mansfield, Betty Kay [ORNL; Martin, Sheryl A [ORNL

    2006-02-01

    Welcome to the 2006 joint meeting of the fourth Genomics:GTL Contractor-Grantee Workshop and the six Metabolic Engineering Working Group Inter-Agency Conference. The vision and scope of the Genomics:GTL program continue to expand and encompass research and technology issues from diverse scientific disciplines, attracting broad interest and support from researchers at universities, DOE national laboratories, and industry. Metabolic engineering's vision is the targeted and purposeful alteration of metabolic pathways to improve the understanding and use of cellular pathways for chemical transformation, energy transduction, and supramolecular assembly. These two programs have much complementarity in both vision and technological approaches, as reflected in this joint workshop. GLT's challenge to the scientific community remains the further development and use of a broad array of innovative technologies and computational tools to systematically leverage the knowledge and capabilities brought to us by DNA sequencing projects. The goal is to seek a broad and predictive understanding of the functioning and control of complex systems--individual microbes, microbial communities, and plants. GTL's prominent position at the interface of the physical, computational, and biological sciences is both a strength and challenge. Microbes remain GTL's principal biological focus. In the complex 'simplicity' of microbes, they find capabilities needed by DOE and the nation for clean and secure energy, cleanup of environmental contamination, and sequestration of atmospheric carbon dioxide that contributes to global warming. An ongoing challenge for the entire GTL community is to demonstrate that the fundamental science conducted in each of your research projects brings us a step closer to biology-based solutions for these important national energy and environmental needs.

  9. A taxonomic framework for emerging groups of ecologically important marine gammaproteobacteria based on the reconstruction of evolutionary relationships using genome-scale data

    Directory of Open Access Journals (Sweden)

    Stefan eSpring

    2015-04-01

    Full Text Available In recent years a large number of isolates were obtained from saline environments that are phylogenetically related to distinct clades of oligotrophic marine gammaproteobacteria, which were originally identified in seawater samples using cultivation independent methods and are characterized by high seasonal abundances in coastal environments. To date a sound taxonomic framework for the classification of these ecologically important isolates and related species in accordance with their evolutionary relationships is missing.In this study we demonstrate that a reliable allocation of members of the oligotrophic marine gammaproteobacteria (OMG group and related species to higher taxonomic ranks is possible by phylogenetic analyses of whole proteomes but also of the RNA polymerase beta subunit, whereas phylogenetic reconstructions based on 16S rRNA genes alone resulted in unstable tree topologies with only insignificant bootstrap support. The identified clades could be correlated with distinct phenotypic traits illustrating an adaptation to common environmental factors in their evolutionary history. Genome wide gene-content analyses revealed the existence of two distinct ecological guilds within the analyzed lineage of marine gammaproteobacteria which can be distinguished by their trophic strategies. Based on our results a novel order within the class Gammaproteobacteria is proposed, which is designated Cellvibrionales ord. nov. and comprises the five novel families Cellvibrionaceae fam. nov., Halieaceae fam. nov., Microbulbiferaceae fam. nov., Porticoccaceae fam. nov., and Spongiibacteraceae fam. nov.

  10. Radiogenomics of High-Grade Serous Ovarian Cancer: Multireader Multi-Institutional Study from the Cancer Genome Atlas Ovarian Cancer Imaging Research Group.

    Science.gov (United States)

    Vargas, Hebert Alberto; Huang, Erich P; Lakhman, Yulia; Ippolito, Joseph E; Bhosale, Priya; Mellnick, Vincent; Shinagare, Atul B; Anello, Maria; Kirby, Justin; Fevrier-Sullivan, Brenda; Freymann, John; Jaffe, C Carl; Sala, Evis

    2017-11-01

    Purpose To evaluate interradiologist agreement on assessments of computed tomography (CT) imaging features of high-grade serous ovarian cancer (HGSOC), to assess their associations with time-to-disease progression (TTP) and HGSOC transcriptomic profiles (Classification of Ovarian Cancer [CLOVAR]), and to develop an imaging-based risk score system to predict TTP and CLOVAR profiles. Materials and Methods This study was a multireader, multi-institutional, institutional review board-approved, HIPAA-compliant retrospective analysis of 92 patients with HGSOC (median age, 61 years) with abdominopelvic CT before primary cytoreductive surgery available through the Cancer Imaging Archive. Eight radiologists from the Cancer Genome Atlas Ovarian Cancer Imaging Research Group developed and independently recorded the following CT features: characteristics of primary ovarian mass(es), presence of definable mesenteric implants and infiltration, presence of other implants, presence and distribution of peritoneal spread, presence and size of pleural effusions and ascites, lymphadenopathy, and distant metastases. Interobserver agreement for CT features was assessed, as were univariate and multivariate associations with TTP and CLOVAR mesenchymal profile (worst prognosis). Results Interobserver agreement for some features was strong (eg, α = .78 for pleural effusion and ascites) but was lower for others (eg, α = .08 for intraparenchymal splenic metastases). Presence of peritoneal disease in the right upper quadrant (P = .0003), supradiaphragmatic lymphadenopathy (P = .0004), more peritoneal disease sites (P = .0006), and nonvisualization of a discrete ovarian mass (P = .0037) were associated with shorter TTP. More peritoneal disease sites (P = .0025) and presence of pouch of Douglas implants (P = .0045) were associated with CLOVAR mesenchymal profile. Combinations of imaging features contained predictive signal for TTP (concordance index = 0.658; P = .0006) and CLOVAR profile (mean

  11. National Human Genome Research Institute

    Science.gov (United States)

    ... Care Genomic Medicine Working Group New Horizons and Research Patient Management Policy and Ethics Issues Quick Links for Patient Care Education All About the Human Genome Project Fact Sheets Genetic Education Resources for ...

  12. Genome sequence of the pink-pigmented marine bacterium Loktanella hongkongensis type strain (UST950701-009P(T)), a representative of the Roseobacter group.

    Science.gov (United States)

    Lau, Stanley Ck; Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Petersen, Jörn; Ivanova, Natalia N; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C; Klenk, Hans-Peter; Qian, Pei-Yuan

    2015-01-01

    Loktanella hongkongensis UST950701-009P(T) is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492(T) together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-coding genes and 57 RNA genes. The two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.

  13. Plant-Associated Methylobacteria as Co-Evolved Phytosymbionts

    Science.gov (United States)

    2007-01-01

    Due to their wall-associated pectin metabolism, growing plant cells emit significant amounts of the one-carbon alcohol methanol. Pink-pigmented microbes of the genus Methylobacterium that colonize the surfaces of leaves (epiphytes) are capable of growth on this volatile C1-compound as sole source of carbon and energy. In this article the results of experiments with germ-free (gnotobiotic) sporophytes of angiosperms (sunflower, maize) and gametophytes of bryophytes (a moss and two liverwort species) are summarized. The data show that methylobacteria do not stimulate the growth of these angiosperms, but organ development in moss protonemata and in thalli of liverworts is considerably enhanced. Since methylobacteria produce and secrete cytokinins and auxin, a model of plant-microbe-interaction (symbiosis) is proposed in which the methanol-consuming bacteria are viewed as coevolved partners of the gametophyte that determine its growth, survival and reproduction (fitness). This symbiosis is restricted to the haploid cells of moisture-dependent “living fossil” plants; it does not apply to the diploid sporophytes of higher embryophytes, which are fully adapted to life on land and apparently produce sufficient amounts of endogenous phytohormones. PMID:19516971

  14. The Sequenced Angiosperm Genomes and Genome Databases.

    Science.gov (United States)

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology.

  15. Genome size analyses of Pucciniales reveal the largest fungal genomes.

    Science.gov (United States)

    Tavares, Sílvia; Ramos, Ana Paula; Pires, Ana Sofia; Azinheira, Helena G; Caldeirinha, Patrícia; Link, Tobias; Abranches, Rita; Silva, Maria do Céu; Voegele, Ralf T; Loureiro, João; Talhinhas, Pedro

    2014-01-01

    Rust fungi (Basidiomycota, Pucciniales) are biotrophic plant pathogens which exhibit diverse complexities in their life cycles and host ranges. The completion of genome sequencing of a few rust fungi has revealed the occurrence of large genomes. Sequencing efforts for other rust fungi have been hampered by uncertainty concerning their genome sizes. Flow cytometry was recently applied to estimate the genome size of a few rust fungi, and confirmed the occurrence of large genomes in this order (averaging 225.3 Mbp, while the average for Basidiomycota was 49.9 Mbp and was 37.7 Mbp for all fungi). In this work, we have used an innovative and simple approach to simultaneously isolate nuclei from the rust and its host plant in order to estimate the genome size of 30 rust species by flow cytometry. Genome sizes varied over 10-fold, from 70 to 893 Mbp, with an average genome size value of 380.2 Mbp. Compared to the genome sizes of over 1800 fungi, Gymnosporangium confusum possesses the largest fungal genome ever reported (893.2 Mbp). Moreover, even the smallest rust genome determined in this study is larger than the vast majority of fungal genomes (94%). The average genome size of the Pucciniales is now of 305.5 Mbp, while the average Basidiomycota genome size has shifted to 70.4 Mbp and the average for all fungi reached 44.2 Mbp. Despite the fact that no correlation could be drawn between the genome sizes, the phylogenomics or the life cycle of rust fungi, it is interesting to note that rusts with Fabaceae hosts present genomes clearly larger than those with Poaceae hosts. Although this study comprises only a small fraction of the more than 7000 rust species described, it seems already evident that the Pucciniales represent a group where genome size expansion could be a common characteristic. This is in sharp contrast to sister taxa, placing this order in a relevant position in fungal genomics research.

  16. Musa sebagai Model Genom

    Directory of Open Access Journals (Sweden)

    RITA MEGIA

    2005-12-01

    Full Text Available During the meeting in Arlington, USA in 2001, the scientists grouped in PROMUSA agreed with the launching of the Global Musa Genomics Consortium. The Consortium aims to apply genomics technologies to the improvement of this important crop. These genome projects put banana as the third model species after Arabidopsis and rice that will be analyzed and sequenced. Comparing to Arabidopsis and rice, banana genome provides a unique and powerful insight into structural and in functional genomics that could not be found in those two species. This paper discussed these subjects-including the importance of banana as the fourth main food in the world, the evolution and biodiversity of this genetic resource and its parasite.

  17. Single-Cell Genome and Group-Specific dsrAB Sequencing Implicate Marine Members of the Class Dehalococcoidia (Phylum Chloroflexi) in Sulfur Cycling

    DEFF Research Database (Denmark)

    Wasmund, Kenneth; Cooper, Myriel; Schreiber, Lars

    2016-01-01

    The marine subsurface sediment biosphere is widely inhabited by bacteria affiliated with the class Dehalococcoidia (DEH), phylum Chloroflexi, and yet little is known regarding their metabolisms. In this report, genomic content from a single DEH cell (DEH-C11) with a 16S rRNA gene that was affilia......The marine subsurface sediment biosphere is widely inhabited by bacteria affiliated with the class Dehalococcoidia (DEH), phylum Chloroflexi, and yet little is known regarding their metabolisms. In this report, genomic content from a single DEH cell (DEH-C11) with a 16S rRNA gene...... that was affiliated with a diverse cluster of 16S rRNA gene sequences prevalent in marine sediments was obtained from sediments of Aarhus Bay, Denmark. The distinctive gene content of this cell suggests metabolic characteristics that differ from those of known DEH and Chloroflexi. The presence of genes encoding...... dissimilatory sulfite reductase (Dsr) suggests that DEH could respire oxidized sulfur compounds, although Chloroflexi have never been implicated in this mode of sulfur cycling. Using long-range PCR assays targeting DEH dsr loci, dsrAB genes were amplified and sequenced from various marine sediments. Many...

  18. BLAST screening of chlamydial genomes to identify signature proteins that are unique for the Chlamydiales, Chlamydiaceae, Chlamydophila and Chlamydia groups of species

    Directory of Open Access Journals (Sweden)

    Gupta Radhey S

    2006-01-01

    Full Text Available Abstract Background Chlamydiae species are of much importance from a clinical viewpoint. Their diversity both in terms of their numbers as well as clinical involvement are presently believed to be significantly underestimated. The obligate intracellular nature of chlamydiae has also limited their genetic and biochemical studies. Thus, it is of importance to develop additional means for their identification and characterization. Results We have carried out analyses of available chlamydiae genomes to identify sets of unique proteins that are either specific for all Chlamydiales genomes, or different Chlamydiaceae family members, or members of the Chlamydia and Chlamydophila genera, or those unique to Protochlamydia amoebophila, but which are not found in any other bacteria. In total, 59 Chlamydiales-specific proteins, 79 Chlamydiaceae-specific proteins, 20 proteins each that are specific for both Chlamydia and Chlamydophila and 445 ORFs that are Protochlamydia-specific were identified. Additionally, 33 cases of possible gene loss or lateral gene transfer were also detected. Conclusion The identified chlamydiae-lineage specific proteins, many of which are highly conserved, provide novel biomarkers that should prove of much value in the diagnosis of these bacteria and in exploration of their prevalence and diversity. These conserved protein sequences (CPSs also provide novel therapeutic targets for drugs that are specific for these bacteria. Lastly, functional studies on these chlamydiae or chlamydiae subgroup-specific proteins should lead to important insights into lineage-specific adaptations with regards to development, infectivity and pathogenicity.

  19. Extreme genomes

    OpenAIRE

    DeLong, Edward F

    2000-01-01

    The complete genome sequence of Thermoplasma acidophilum, an acid- and heat-loving archaeon, has recently been reported. Comparative genomic analysis of this 'extremophile' is providing new insights into the metabolic machinery, ecology and evolution of thermophilic archaea.

  20. Grass genomes

    OpenAIRE

    Bennetzen, Jeffrey L.; SanMiguel, Phillip; Chen, Mingsheng; Tikhonov, Alexander; Francki, Michael; Avramova, Zoya

    1998-01-01

    For the most part, studies of grass genome structure have been limited to the generation of whole-genome genetic maps or the fine structure and sequence analysis of single genes or gene clusters. We have investigated large contiguous segments of the genomes of maize, sorghum, and rice, primarily focusing on intergenic spaces. Our data indicate that much (>50%) of the maize genome is composed of interspersed repetitive DNAs, primarily nested retrotransposons that in...

  1. Cancer genomics

    DEFF Research Database (Denmark)

    Norrild, Bodil; Guldberg, Per; Ralfkiær, Elisabeth Methner

    2007-01-01

    Almost all cells in the human body contain a complete copy of the genome with an estimated number of 25,000 genes. The sequences of these genes make up about three percent of the genome and comprise the inherited set of genetic information. The genome also contains information that determines whe...

  2. Genomic taxonomy of vibrios

    Directory of Open Access Journals (Sweden)

    Iida Tetsuya

    2009-10-01

    Full Text Available Abstract Background Vibrio taxonomy has been based on a polyphasic approach. In this study, we retrieve useful taxonomic information (i.e. data that can be used to distinguish different taxonomic levels, such as species and genera from 32 genome sequences of different vibrio species. We use a variety of tools to explore the taxonomic relationship between the sequenced genomes, including Multilocus Sequence Analysis (MLSA, supertrees, Average Amino Acid Identity (AAI, genomic signatures, and Genome BLAST atlases. Our aim is to analyse the usefulness of these tools for species identification in vibrios. Results We have generated four new genome sequences of three Vibrio species, i.e., V. alginolyticus 40B, V. harveyi-like 1DA3, and V. mimicus strains VM573 and VM603, and present a broad analyses of these genomes along with other sequenced Vibrio species. The genome atlas and pangenome plots provide a tantalizing image of the genomic differences that occur between closely related sister species, e.g. V. cholerae and V. mimicus. The vibrio pangenome contains around 26504 genes. The V. cholerae core genome and pangenome consist of 1520 and 6923 genes, respectively. Pangenomes might allow different strains of V. cholerae to occupy different niches. MLSA and supertree analyses resulted in a similar phylogenetic picture, with a clear distinction of four groups (Vibrio core group, V. cholerae-V. mimicus, Aliivibrio spp., and Photobacterium spp.. A Vibrio species is defined as a group of strains that share > 95% DNA identity in MLSA and supertree analysis, > 96% AAI, ≤ 10 genome signature dissimilarity, and > 61% proteome identity. Strains of the same species and species of the same genus will form monophyletic groups on the basis of MLSA and supertree. Conclusion The combination of different analytical and bioinformatics tools will enable the most accurate species identification through genomic computational analysis. This endeavour will culminate in

  3. Clusters of orthologous genes for 41 archaeal genomes and implications for evolutionary genomics of archaea

    OpenAIRE

    Wolf Yuri I; Novichkov Pavel S; Sorokin Alexander V; Makarova Kira S; Koonin Eugene V

    2007-01-01

    Abstract Background An evolutionary classification of genes from sequenced genomes that distinguishes between orthologs and paralogs is indispensable for genome annotation and evolutionary reconstruction. Shortly after multiple genome sequences of bacteria, archaea, and unicellular eukaryotes became available, an attempt on such a classification was implemented in Clusters of Orthologous Groups of proteins (COGs). Rapid accumulation of genome sequences creates opportunities for refining COGs ...

  4. Genetic, comparative genomic, and expression analyses of the Mc1r locus in the polychromatic Midas cichlid fish (Teleostei, Cichlidae Amphilophus sp.) species group.

    Science.gov (United States)

    Henning, Frederico; Renz, Adina Josepha; Fukamachi, Shoji; Meyer, Axel

    2010-05-01

    Natural populations of the Midas cichlid species in several different crater lakes in Nicaragua exhibit a conspicuous color polymorphism. Most individuals are dark and the remaining have a gold coloration. The color morphs mate assortatively and sympatric population differentiation has been shown based on neutral molecular data. We investigated the color polymorphism using segregation analysis and a candidate gene approach. The segregation patterns observed in a mapping cross between a gold and a dark individual were consistent with a single dominant gene as a cause of the gold phenotype. This suggests that a simple genetic architecture underlies some of the speciation events in the Midas cichlids. We compared the expression levels of several candidate color genes Mc1r, Ednrb1, Slc45a2, and Tfap1a between the color morphs. Mc1r was found to be up regulated in the gold morph. Given its widespread association in color evolution and role on melanin synthesis, the Mc1r locus was further investigated using sequences derived from a genomic library. Comparative analysis revealed conserved synteny in relation to the majority of teleosts and highlighted several previously unidentified conserved non-coding elements (CNEs) in the upstream and downstream regions in the vicinity of Mc1r. The identification of the CNEs regions allowed the comparison of sequences from gold and dark specimens of natural populations. No polymorphisms were found between in the population sample and Mc1r showed no linkage to the gold phenotype in the mapping cross, demonstrating that it is not causally related to the color polymorphism in the Midas cichlid.

  5. Genomic amplification of Fanconi anemia complementation group A (FancA) in head and neck squamous cell carcinoma (HNSCC): Cellular mechanisms of radioresistance and clinical relevance.

    Science.gov (United States)

    Hess, Julia; Unger, Kristian; Orth, Michael; Schötz, Ulrike; Schüttrumpf, Lars; Zangen, Verena; Gimenez-Aznar, Igor; Michna, Agata; Schneider, Ludmila; Stamp, Ramona; Selmansberger, Martin; Braselmann, Herbert; Hieber, Ludwig; Drexler, Guido A; Kuger, Sebastian; Klein, Diana; Jendrossek, Verena; Friedl, Anna A; Belka, Claus; Zitzelsberger, Horst; Lauber, Kirsten

    2017-02-01

    Radio (chemo) therapy is a crucial treatment modality for head and neck squamous cell carcinoma (HNSCC), but relapse is frequent, and the underlying mechanisms remain largely elusive. Therefore, novel biomarkers are urgently needed. Previously, we identified gains on 16q23-24 to be associated with amplification of the Fanconi anemia A (FancA) gene and to correlate with reduced progression-free survival after radiotherapy. Here, we analyzed the effects of FancA on radiation sensitivity in vitro, characterized the underlying mechanisms, and evaluated their clinical relevance. Silencing of FancA expression in HNSCC cell lines with genomic gains on 16q23-24 resulted in significantly impaired clonogenic survival upon irradiation. Conversely, overexpression of FancA in immortalized keratinocytes conferred increased survival accompanied by improved DNA repair, reduced accumulation of chromosomal translocations, but no hyperactivation of the FA/BRCA-pathway. Downregulation of interferon signaling as identified by microarray analyses, enforced irradiation-induced senescence, and elevated production of the senescence-associated secretory phenotype (SASP) appeared to be candidate mechanisms contributing to FancA-mediated radioresistance. Data of the TCGA HNSCC cohort confirmed the association of gains on 16q24.3 with FancA overexpression and impaired overall survival. Importantly, transcriptomic alterations similar to those observed upon FancA overexpression in vitro strengthened the clinical relevance. Overall, FancA amplification and overexpression appear to be crucial for radiotherapeutic failure in HNSCC. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  6. All about the Human Genome Project (HGP)

    Science.gov (United States)

    ... Care Genomic Medicine Working Group New Horizons and Research Patient Management Policy and Ethics Issues Quick Links for Patient Care Education All About the Human Genome Project Fact Sheets Genetic Education Resources for ...

  7. Genomics and fish adaptation

    Directory of Open Access Journals (Sweden)

    Agostinho Antunes

    2015-12-01

    Full Text Available The completion of the human genome sequencing in 2003 opened a new perspective into the importance of whole genome sequencing projects, and currently multiple species are having their genomes completed sequenced, from simple organisms, such as bacteria, to more complex taxa, such as mammals. This voluminous sequencing data generated across multiple organisms provides also the framework to better understand the genetic makeup of such species and related ones, allowing to explore the genetic changes underlining the evolution of diverse phenotypic traits. Here, recent results from our group retrieved from comparative evolutionary genomic analyses of varied fish species will be considered to exemplify how gene novelty and gene enhancement by positive selection might have been determinant in the success of adaptive radiations into diverse habitats and lifestyles.

  8. Genomic diversity and affinities in population groups of North West India: an analysis of Alu insertion and a single nucleotide polymorphism.

    Science.gov (United States)

    Saini, J S; Kumar, A; Matharoo, K; Sokhi, J; Badaruddoza; Bhanwer, A J S

    2012-12-15

    The North West region of India is extremely important to understand the peopling of India, as it acted as a corridor to the foreign invaders from Eurasia and Central Asia. A series of these invasions along with multiple migrations led to intermixture of variable populations, strongly contributing to genetic variations. The present investigation was designed to explore the genetic diversities and affinities among the five major ethnic groups from North West India; Brahmin, Jat Sikh, Bania, Rajput and Gujjar. A total of 327 individuals of the abovementioned ethnic groups were analyzed for 4 Alu insertion marker loci (ACE, PV92, APO and D1) and a Single Nucleotide Polymorphism (SNP) rs2234693 in the intronic region of the ESR1 gene. Statistical analysis was performed to interpret the genetic structure and diversity of the population groups. Genotypes for ACE, APO, ESR1 and PV92 loci were found to be in Hardy-Weinberg equilibrium in all the ethnic groups, while significant departures were observed at the D1 locus in every investigated population after Bonferroni's correction. The average heterozygosity for all the loci in these ethnic groups was fairly substantial ranging from 0.3927 ± 0.1877 to 0.4333 ± 0.1416. Inbreeding coefficient indicated an overall 10% decrease in heterozygosity in these North West Indian populations. The gene differentiation among the populations was observed to be of the order of 0.013. Genetic distance estimates revealed that Gujjars were close to Banias and Jat Sikhs were close to Rajputs. Overall the study favored the recent division of the populations of North West India into largely endogamous groups. It was observed that the populations of North West India represent a more or less homogenous genetic entity, owing to their common ancestral history as well as geographical proximity. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. From genomes to metabolomes: Understanding mechanisms of symbiosis and cell-cell signaling using the archaeal system Ignicoccus-Nanoarchaeum

    Energy Technology Data Exchange (ETDEWEB)

    Podar, Mircea [Univ. of Tennessee, Knoxville, TN (United States). Biosciences Division; Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Hettich, Robert [Univ. of Tennessee, Knoxville, TN (United States). Biosciences Division; Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Copie, Valerie [Montana State Univ., Bozeman, MT (United States). Dept. of Chemistry and Biochemistry; Bothner, Brian [Montana State Univ., Bozeman, MT (United States). Dept. of Chemistry and Biochemistry

    2016-12-16

    The main objective of this project was to use symbiotic Nanoarchaeaota, a group of thermophilic Archaea that are obligate symbionts/parasites on other Archaea, to develop an integrated multi-omic approach to study inter-species interactions as well as to understand fundamental mechanism that enable such relationships. As part of this grant we have achieved a number of important milestone on both technical and scientific levels. On the technical side, we developed immunofluorescence labeling and tracking methods to follow Nanoarchaeota in cultures and in environmental samples, we applied such methods in conjunction with flow cytometry to quantify and isolate uncultured representatives from the environment and characterized them by single cell genomics. On the proteomics side, we developed a more efficient and sensitive method to recover and semi-quantitatively measure membrane proteins, while achieving high total cellular proteome coverage (70-80% of the predicted proteome). Metabolomic analyses used complementary NMR and LC/GC mass spectrometry and led to the identification of novel lipids in these organisms as well as quantification of some of the major metabolites. Importantly, using several informatics approaches we were also able to integrate the transcriptomic, proteomic and metabolomic datasets, revealing aspects of the interspecies interaction that were not evident in the single omic analyses (manuscript in review). On the science side we determined that N. equitans and I. hospitalis are metabolically coupled and that N. equitans is strictly dependent on its host both for metabolic precursors and energetic needs. The actual mechanism by which small molecules move across the cell membrane remains unknown. The Ignicoccus host responds to the metabolic and energetic burned by upregulating of key primary metabolism steps and ATP synthesis. The two species have co-evolved, aspect that we determined by comparative genomics with other species of Ignicoccus

  10. Advances in editing microalgae genomes

    OpenAIRE

    Daboussi, Fayza

    2017-01-01

    There have been significant advances in microalgal genomics over the last decade. Nevertheless, there are still insufficient tools for the manipulation of microalgae genomes and the development of microalgae as industrial biofactories. Several research groups have recently contributed to progress by demonstrating that particular nucleases can be used for targeted and stable modifications of the genomes of some microalgae species. The nucleases include Meganucleases, Zinc Finger nucleases, TAL...

  11. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    Science.gov (United States)

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  12. Genome Imprinting

    Indian Academy of Sciences (India)

    the cell nucleus (mitochondrial and chloroplast genomes), and. (3) traits governed ... tively good embryonic development but very poor development of membranes and ... Human homologies for the type of situation described above are naturally ..... imprint; (b) New modifications of the paternal genome in germ cells of each ...

  13. Baculovirus Genomics

    NARCIS (Netherlands)

    Oers, van M.M.; Vlak, J.M.

    2007-01-01

    Baculovirus genomes are covalently closed circles of double stranded-DNA varying in size between 80 and 180 kilobase-pair. The genomes of more than fourty-one baculoviruses have been sequenced to date. The majority of these (37) are pathogenic to lepidopteran hosts; three infect sawflies

  14. Genomic Testing

    Science.gov (United States)

    ... this database. Top of Page Evaluation of Genomic Applications in Practice and Prevention (EGAPP™) In 2004, the Centers for Disease Control and Prevention launched the EGAPP initiative to establish and test a ... and other applications of genomic technology that are in transition from ...

  15. Ancient genomes

    OpenAIRE

    Hoelzel, A Rus

    2005-01-01

    Ever since its invention, the polymerase chain reaction has been the method of choice for work with ancient DNA. In an application of modern genomic methods to material from the Pleistocene, a recent study has instead undertaken to clone and sequence a portion of the ancient genome of the cave bear.

  16. Genome Analysis of a Transmissible Lineage of Pseudomonas aeruginosa Reveals Pathoadaptive Mutations and Distinct Evolutionary Paths of Hypermutators

    DEFF Research Database (Denmark)

    Marvig, Rasmus Lykke; Johansen, Helle Krogh; Molin, Søren

    2013-01-01

    Genome sequencing of bacterial pathogens has advanced our understanding of their evolution, epidemiology, and response to antibiotic therapy. However, we still have only a limited knowledge of the molecular changes in in vivo evolving bacterial populations in relation to long-term, chronic...... targeted by mutations to optimize pathogen fitness (pathoadaptive mutations). These genes were related to antibiotic resistance, the cell envelope, or regulatory functions, and we find that the prevalence of pathoadaptive mutations correlates with evolutionary success of co-evolving sub-lineages. The long...... likelihood to acquire mutations and identify two homopolymer-containing genes preferentially mutated in hypermutators. This homopolymer facilitated differential mutagenesis provides a novel genome-wide perspective on the different evolutionary trajectories of hypermutators, which may help explain...

  17. The promise of insect genomics

    DEFF Research Database (Denmark)

    Grimmelikhuijzen, Cornelis J P; Cazzamali, Giuseppe; Williamson, Michael

    2007-01-01

    Insects are the largest animal group in the world and are ecologically and economically extremely important. This importance of insects is reflected by the existence of currently 24 insect genome projects. Our perspective discusses the state-of-the-art of these genome projects and the impacts...

  18. Genomics of Volvocine Algae

    Science.gov (United States)

    Umen, James G.; Olson, Bradley J.S.C.

    2015-01-01

    Volvocine algae are a group of chlorophytes that together comprise a unique model for evolutionary and developmental biology. The species Chlamydomonas reinhardtii and Volvox carteri represent extremes in morphological diversity within the Volvocine clade. Chlamydomonas is unicellular and reflects the ancestral state of the group, while Volvox is multicellular and has evolved numerous innovations including germ-soma differentiation, sexual dimorphism, and complex morphogenetic patterning. The Chlamydomonas genome sequence has shed light on several areas of eukaryotic cell biology, metabolism and evolution, while the Volvox genome sequence has enabled a comparison with Chlamydomonas that reveals some of the underlying changes that enabled its transition to multicellularity, but also underscores the subtlety of this transition. Many of the tools and resources are in place to further develop Volvocine algae as a model for evolutionary genomics. PMID:25883411

  19. Human social genomics.

    Directory of Open Access Journals (Sweden)

    Steven W Cole

    2014-08-01

    Full Text Available A growing literature in human social genomics has begun to analyze how everyday life circumstances influence human gene expression. Social-environmental conditions such as urbanity, low socioeconomic status, social isolation, social threat, and low or unstable social status have been found to associate with differential expression of hundreds of gene transcripts in leukocytes and diseased tissues such as metastatic cancers. In leukocytes, diverse types of social adversity evoke a common conserved transcriptional response to adversity (CTRA characterized by increased expression of proinflammatory genes and decreased expression of genes involved in innate antiviral responses and antibody synthesis. Mechanistic analyses have mapped the neural "social signal transduction" pathways that stimulate CTRA gene expression in response to social threat and may contribute to social gradients in health. Research has also begun to analyze the functional genomics of optimal health and thriving. Two emerging opportunities now stand to revolutionize our understanding of the everyday life of the human genome: network genomics analyses examining how systems-level capabilities emerge from groups of individual socially sensitive genomes and near-real-time transcriptional biofeedback to empirically optimize individual well-being in the context of the unique genetic, geographic, historical, developmental, and social contexts that jointly shape the transcriptional realization of our innate human genomic potential for thriving.

  20. The genomes and comparative genomics of Lactobacillus delbrueckii phages.

    Science.gov (United States)

    Riipinen, Katja-Anneli; Forsman, Päivi; Alatossava, Tapani

    2011-07-01

    Lactobacillus delbrueckii phages are a great source of genetic diversity. Here, the genome sequences of Lb. delbrueckii phages LL-Ku, c5 and JCL1032 were analyzed in detail, and the genetic diversity of Lb. delbrueckii phages belonging to different taxonomic groups was explored. The lytic isometric group b phages LL-Ku (31,080 bp) and c5 (31,841 bp) showed a minimum nucleotide sequence identity of 90% over about three-fourths of their genomes. The genomic locations of their lysis modules were unique, and the genomes featured several putative overlapping transcription units of genes. LL-Ku and c5 virions displayed peptidoglycan hydrolytic activity associated with a ~36-kDa protein similar in size to the endolysin. Unexpectedly, the 49,433-bp genome of the prolate phage JCL1032 (temperate, group c) revealed a conserved gene order within its structural genes. Lb. delbrueckii phages representing groups a (a phage LL-H), b and c possessed only limited protein sequence homology. Genomic comparison of LL-Ku and c5 suggested that diversification of Lb. delbrueckii phages is mainly due to insertions, deletions and recombination. For the first time, the complete genome sequences of group b and c Lb. delbrueckii phages are reported.

  1. Herbarium genomics

    DEFF Research Database (Denmark)

    Bakker, Freek T.; Lei, Di; Yu, Jiaying

    2016-01-01

    Herbarium genomics is proving promising as next-generation sequencing approaches are well suited to deal with the usually fragmented nature of archival DNA. We show that routine assembly of partial plastome sequences from herbarium specimens is feasible, from total DNA extracts and with specimens...... up to 146 years old. We use genome skimming and an automated assembly pipeline, Iterative Organelle Genome Assembly, that assembles paired-end reads into a series of candidate assemblies, the best one of which is selected based on likelihood estimation. We used 93 specimens from 12 different...... correlation between plastome coverage and nuclear genome size (C value) in our samples, but the range of C values included is limited. Finally, we conclude that routine plastome sequencing from herbarium specimens is feasible and cost-effective (compared with Sanger sequencing or plastome...

  2. Genome-wide discovery of novel M1T1 group A streptococcal determinants important for fitness and virulence during soft-tissue infection.

    Directory of Open Access Journals (Sweden)

    Yoann Le Breton

    2017-08-01

    Full Text Available The Group A Streptococcus remains a significant human pathogen causing a wide array of disease ranging from self-limiting to life-threatening invasive infections. Epithelium (skin or throat colonization with progression to the subepithelial tissues is the common step in all GAS infections. Here, we used transposon-sequencing (Tn-seq to define the GAS 5448 genetic requirements for in vivo fitness in subepithelial tissue. A near-saturation transposon library of the M1T1 GAS 5448 strain was injected subcutaneously into mice, producing suppurative inflammation at 24 h that progressed to prominent abscesses with tissue necrosis at 48 h. The library composition was monitored en masse by Tn-seq and ratios of mutant abundance comparing the output (12, 24 and 48 h versus input (T0 mutant pools were calculated for each gene. We identified a total of 273 subcutaneous fitness (scf genes with 147 genes (55 of unknown function critical for the M1T1 GAS 5448 fitness in vivo; and 126 genes (53 of unknown function potentially linked to in vivo fitness advantage. Selected scf genes were validated in competitive subcutaneous infection with parental 5448. Two uncharacterized genes, scfA and scfB, encoding putative membrane-associated proteins and conserved among Gram-positive pathogens, were further characterized. Defined scfAB mutants in GAS were outcompeted by wild type 5448 in vivo, attenuated for lesion formation in the soft tissue infection model and dissemination to the bloodstream. We hypothesize that scfAB play an integral role in enhancing adaptation and fitness of GAS during localized skin infection, and potentially in propagation to other deeper host environments.

  3. Genome-wide discovery of novel M1T1 group A streptococcal determinants important for fitness and virulence during soft-tissue infection.

    Science.gov (United States)

    Le Breton, Yoann; Belew, Ashton T; Freiberg, Jeffrey A; Sundar, Ganesh S; Islam, Emrul; Lieberman, Joshua; Shirtliff, Mark E; Tettelin, Hervé; El-Sayed, Najib M; McIver, Kevin S

    2017-08-01

    The Group A Streptococcus remains a significant human pathogen causing a wide array of disease ranging from self-limiting to life-threatening invasive infections. Epithelium (skin or throat) colonization with progression to the subepithelial tissues is the common step in all GAS infections. Here, we used transposon-sequencing (Tn-seq) to define the GAS 5448 genetic requirements for in vivo fitness in subepithelial tissue. A near-saturation transposon library of the M1T1 GAS 5448 strain was injected subcutaneously into mice, producing suppurative inflammation at 24 h that progressed to prominent abscesses with tissue necrosis at 48 h. The library composition was monitored en masse by Tn-seq and ratios of mutant abundance comparing the output (12, 24 and 48 h) versus input (T0) mutant pools were calculated for each gene. We identified a total of 273 subcutaneous fitness (scf) genes with 147 genes (55 of unknown function) critical for the M1T1 GAS 5448 fitness in vivo; and 126 genes (53 of unknown function) potentially linked to in vivo fitness advantage. Selected scf genes were validated in competitive subcutaneous infection with parental 5448. Two uncharacterized genes, scfA and scfB, encoding putative membrane-associated proteins and conserved among Gram-positive pathogens, were further characterized. Defined scfAB mutants in GAS were outcompeted by wild type 5448 in vivo, attenuated for lesion formation in the soft tissue infection model and dissemination to the bloodstream. We hypothesize that scfAB play an integral role in enhancing adaptation and fitness of GAS during localized skin infection, and potentially in propagation to other deeper host environments.

  4. Genomes in turmoil: quantification of genome dynamics in prokaryote supergenomes.

    Science.gov (United States)

    Puigbò, Pere; Lobkovsky, Alexander E; Kristensen, David M; Wolf, Yuri I; Koonin, Eugene V

    2014-08-21

    Genomes of bacteria and archaea (collectively, prokaryotes) appear to exist in incessant flux, expanding via horizontal gene transfer and gene duplication, and contracting via gene loss. However, the actual rates of genome dynamics and relative contributions of different types of event across the diversity of prokaryotes are largely unknown, as are the sizes of microbial supergenomes, i.e. pools of genes that are accessible to the given microbial species. We performed a comprehensive analysis of the genome dynamics in 35 groups (34 bacterial and one archaeal) of closely related microbial genomes using a phylogenetic birth-and-death maximum likelihood model to quantify the rates of gene family gain and loss, as well as expansion and reduction. The results show that loss of gene families dominates the evolution of prokaryotes, occurring at approximately three times the rate of gain. The rates of gene family expansion and reduction are typically seven and twenty times less than the gain and loss rates, respectively. Thus, the prevailing mode of evolution in bacteria and archaea is genome contraction, which is partially compensated by the gain of new gene families via horizontal gene transfer. However, the rates of gene family gain, loss, expansion and reduction vary within wide ranges, with the most stable genomes showing rates about 25 times lower than the most dynamic genomes. For many groups, the supergenome estimated from the fraction of repetitive gene family gains includes about tenfold more gene families than the typical genome in the group although some groups appear to have vast, 'open' supergenomes. Reconstruction of evolution for groups of closely related bacteria and archaea reveals an extremely rapid and highly variable flux of genes in evolving microbial genomes, demonstrates that extensive gene loss and horizontal gene transfer leading to innovation are the two dominant evolutionary processes, and yields robust estimates of the supergenome size.

  5. Organizational heterogeneity of vertebrate genomes.

    Science.gov (United States)

    Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham

    2012-01-01

    Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

  6. Organizational heterogeneity of vertebrate genomes.

    Directory of Open Access Journals (Sweden)

    Svetlana Frenkel

    Full Text Available Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

  7. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  8. Using a genomic assay for the detection of SNPs of Knops blood group antigens leads to the identification of two caucasians homozygous for the SNP associated with the knops SL3 antigen

    DEFF Research Database (Denmark)

    Jakobsen, M. A.; Sprogoe, U.

    2015-01-01

    designed a genomic assay based on sequencing targeting the SNPs underlying the antigens of the Knops system. Study Design/Methods: Samples from a total of 105 blood donors and 2 patients were examined for polymorphisms in CR1 exon 29 by using PCR and subsequent Sanger sequencing. Results......Background/Case Studies: The antigens of the Knops (Kn) blood group system are associated with SNPs located on exon 29 and (to lesser extent) on exon 26 of the complement receptor 1 (CR1) gene. Because of a lack of proper typing antibodies, serologic detection of Kn antigens is not feasible. We....../Findings: With regard to Kn a and b antigens, we found SNP frequencies to be 90.5% for G/G (4681)* associated with Kn(a+b-) and 9.5% for G/A associated with Kn(a+b+). None of the 107 patients/donors were found to be homozygous for A/A associated with Kn(ab+). The frequencies of SNPs associated with the KCAM antigen...

  9. Comparative Genomics

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 8. Comparative Genomics - A Powerful New Tool in Biology. Anand K Bachhawat. General Article Volume 11 Issue 8 August 2006 pp 22-40. Fulltext. Click here to view fulltext PDF. Permanent link:

  10. Theory of microbial genome evolution

    Science.gov (United States)

    Koonin, Eugene

    Bacteria and archaea have small genomes tightly packed with protein-coding genes. This compactness is commonly perceived as evidence of adaptive genome streamlining caused by strong purifying selection in large microbial populations. In such populations, even the small cost incurred by nonfunctional DNA because of extra energy and time expenditure is thought to be sufficient for this extra genetic material to be eliminated by selection. However, contrary to the predictions of this model, there exists a consistent, positive correlation between the strength of selection at the protein sequence level, measured as the ratio of nonsynonymous to synonymous substitution rates, and microbial genome size. By fitting the genome size distributions in multiple groups of prokaryotes to predictions of mathematical models of population evolution, we show that only models in which acquisition of additional genes is, on average, slightly beneficial yield a good fit to genomic data. Thus, the number of genes in prokaryotic genomes seems to reflect the equilibrium between the benefit of additional genes that diminishes as the genome grows and deletion bias. New genes acquired by microbial genomes, on average, appear to be adaptive. Evolution of bacterial and archaeal genomes involves extensive horizontal gene transfer and gene loss. Many microbes have open pangenomes, where each newly sequenced genome contains more than 10% `ORFans', genes without detectable homologues in other species. A simple, steady-state evolutionary model reveals two sharply distinct classes of microbial genes, one of which (ORFans) is characterized by effectively instantaneous gene replacement, whereas the other consists of genes with finite, distributed replacement rates. These findings imply a conservative estimate of at least a billion distinct genes in the prokaryotic genomic universe.

  11. Ebolavirus comparative genomics

    Science.gov (United States)

    Jun, Se-Ran; Leuze, Michael R.; Nookaew, Intawat; Uberbacher, Edward C.; Land, Miriam; Zhang, Qian; Wanchai, Visanu; Chai, Juanjuan; Nielsen, Morten; Trolle, Thomas; Lund, Ole; Buzard, Gregory S.; Pedersen, Thomas D.; Wassenaar, Trudy M.; Ussery, David W.

    2015-01-01

    The 2014 Ebola outbreak in West Africa is the largest documented for this virus. To examine the dynamics of this genome, we compare more than 100 currently available ebolavirus genomes to each other and to other viral genomes. Based on oligomer frequency analysis, the family Filoviridae forms a distinct group from all other sequenced viral genomes. All filovirus genomes sequenced to date encode proteins with similar functions and gene order, although there is considerable divergence in sequences between the three genera Ebolavirus, Cuevavirus and Marburgvirus within the family Filoviridae. Whereas all ebolavirus genomes are quite similar (multiple sequences of the same strain are often identical), variation is most common in the intergenic regions and within specific areas of the genes encoding the glycoprotein (GP), nucleoprotein (NP) and polymerase (L). We predict regions that could contain epitope-binding sites, which might be good vaccine targets. This information, combined with glycosylation sites and experimentally determined epitopes, can identify the most promising regions for the development of therapeutic strategies. This manuscript has been authored by UT-Battelle, LLC under Contract No. DE-AC05-00OR22725 with the U.S. Department of Energy. The United States Government retains and the publisher, by accepting the article for publication, acknowledges that the United States Government retains a non-exclusive, paid-up, irrevocable, world-wide license to publish or reproduce the published form of this manuscript, or allow others to do so, for United States Government purposes. The Department of Energy will provide public access to these results of federally sponsored research in accordance with the DOE Public Access Plan (http://energy.gov/downloads/doe-public-access-plan). PMID:26175035

  12. Personal genomics services: whose genomes?

    Science.gov (United States)

    Gurwitz, David; Bregman-Eschet, Yael

    2009-07-01

    New companies offering personal whole-genome information services over the internet are dynamic and highly visible players in the personal genomics field. For fees currently ranging from US$399 to US$2500 and a vial of saliva, individuals can now purchase online access to their individual genetic information regarding susceptibility to a range of chronic diseases and phenotypic traits based on a genome-wide SNP scan. Most of the companies offering such services are based in the United States, but their clients may come from nearly anywhere in the world. Although the scientific validity, clinical utility and potential future implications of such services are being hotly debated, several ethical and regulatory questions related to direct-to-consumer (DTC) marketing strategies of genetic tests have not yet received sufficient attention. For example, how can we minimize the risk of unauthorized third parties from submitting other people's DNA for testing? Another pressing question concerns the ownership of (genotypic and phenotypic) information, as well as the unclear legal status of customers regarding their own personal information. Current legislation in the US and Europe falls short of providing clear answers to these questions. Until the regulation of personal genomics services catches up with the technology, we call upon commercial providers to self-regulate and coordinate their activities to minimize potential risks to individual privacy. We also point out some specific steps, along the trustee model, that providers of DTC personal genomics services as well as regulators and policy makers could consider for addressing some of the concerns raised below.

  13. The Nostoc punctiforme Genome

    Energy Technology Data Exchange (ETDEWEB)

    John C. Meeks

    2001-12-31

    Nostoc punctiforme is a filamentous cyanobacterium with extensive phenotypic characteristics and a relatively large genome, approaching 10 Mb. The phenotypic characteristics include a photoautotrophic, diazotrophic mode of growth, but N. punctiforme is also facultatively heterotrophic; its vegetative cells have multiple development alternatives, including terminal differentiation into nitrogen-fixing heterocysts and transient differentiation into spore-like akinetes or motile filaments called hormogonia; and N. punctiforme has broad symbiotic competence with fungi and terrestrial plants, including bryophytes, gymnosperms and an angiosperm. The shotgun-sequencing phase of the N. punctiforme strain ATCC 29133 genome has been completed by the Joint Genome Institute. Annotation of an 8.9 Mb database yielded 7432 open reading frames, 45% of which encode proteins with known or probable known function and 29% of which are unique to N. punctiforme. Comparative analysis of the sequence indicates a genome that is highly plastic and in a state of flux, with numerous insertion sequences and multilocus repeats, as well as genes encoding transposases and DNA modification enzymes. The sequence also reveals the presence of genes encoding putative proteins that collectively define almost all characteristics of cyanobacteria as a group. N. punctiforme has an extensive potential to sense and respond to environmental signals as reflected by the presence of more than 400 genes encoding sensor protein kinases, response regulators and other transcriptional factors. The signal transduction systems and any of the large number of unique genes may play essential roles in the cell differentiation and symbiotic interaction properties of N. punctiforme.

  14. Visualization for genomics: the Microbial Genome Viewer.

    NARCIS (Netherlands)

    Kerkhoven, R.; Enckevort, F.H.J. van; Boekhorst, J.; Molenaar, D; Siezen, R.J.

    2004-01-01

    SUMMARY: A Web-based visualization tool, the Microbial Genome Viewer, is presented that allows the user to combine complex genomic data in a highly interactive way. This Web tool enables the interactive generation of chromosome wheels and linear genome maps from genome annotation data stored in a

  15. Comparing Mycobacterium tuberculosis genomes using genome topology networks.

    Science.gov (United States)

    Jiang, Jianping; Gu, Jianlei; Zhang, Liang; Zhang, Chenyi; Deng, Xiao; Dou, Tonghai; Zhao, Guoping; Zhou, Yan

    2015-02-14

    Over the last decade, emerging research methods, such as comparative genomic analysis and phylogenetic study, have yielded new insights into genotypes and phenotypes of closely related bacterial strains. Several findings have revealed that genomic structural variations (SVs), including gene gain/loss, gene duplication and genome rearrangement, can lead to different phenotypes among strains, and an investigation of genes affected by SVs may extend our knowledge of the relationships between SVs and phenotypes in microbes, especially in pathogenic bacteria. In this work, we introduce a 'Genome Topology Network' (GTN) method based on gene homology and gene locations to analyze genomic SVs and perform phylogenetic analysis. Furthermore, the concept of 'unfixed ortholog' has been proposed, whose members are affected by SVs in genome topology among close species. To improve the precision of 'unfixed ortholog' recognition, a strategy to detect annotation differences and complete gene annotation was applied. To assess the GTN method, a set of thirteen complete M. tuberculosis genomes was analyzed as a case study. GTNs with two different gene homology-assigning methods were built, the Clusters of Orthologous Groups (COG) method and the orthoMCL clustering method, and two phylogenetic trees were constructed accordingly, which may provide additional insights into whole genome-based phylogenetic analysis. We obtained 24 unfixable COG groups, of which most members were related to immunogenicity and drug resistance, such as PPE-repeat proteins (COG5651) and transcriptional regulator TetR gene family members (COG1309). The GTN method has been implemented in PERL and released on our website. The tool can be downloaded from http://homepage.fudan.edu.cn/zhouyan/gtn/ , and allows re-annotating the 'lost' genes among closely related genomes, analyzing genes affected by SVs, and performing phylogenetic analysis. With this tool, many immunogenic-related and drug resistance-related genes

  16. Avian papillomaviruses: the parrot Psittacus erithacus papillomavirus (PePV genome has a unique organization of the early protein region and is phylogenetically related to the chaffinch papillomavirus

    Directory of Open Access Journals (Sweden)

    Jenson A Bennett

    2002-07-01

    Full Text Available Abstract Background An avian papillomavirus genome has been cloned from a cutaneous exophytic papilloma from an African grey parrot (Psittacus erithacus. The nucleotide sequence, genome organization, and phylogenetic position of the Psittacus erithacus papillomavirus (PePV were determined. This PePV sequence represents the first complete avian papillomavirus genome defined. Results The PePV genome (7304 basepairs differs from other papillomaviruses, in that it has a unique organization of the early protein region lacking classical E6 and E7 open reading frames. Phylogenetic comparison of the PePV sequence with partial E1 and L1 sequences of the chaffinch (Fringilla coelebs papillomavirus (FPV reveals that these two avian papillomaviruses form a monophyletic cluster with a common branch that originates near the unresolved center of the papillomavirus evolutionary tree. Conclusions The PePV genome has a unique layout of the early protein region which represents a novel prototypic genomic organization for avian papillomaviruses. The close relationship between PePV and FPV, and between their Psittaciformes and Passeriformes hosts, supports the hypothesis that papillomaviruses have co-evolved and speciated together with their host species throughout evolution.

  17. Ancient genomics

    DEFF Research Database (Denmark)

    Der Sarkissian, Clio; Allentoft, Morten Erik; Avila Arcos, Maria del Carmen

    2015-01-01

    throughput of next generation sequencing platforms and the ability to target short and degraded DNA molecules. Many ancient specimens previously unsuitable for DNA analyses because of extensive degradation can now successfully be used as source materials. Additionally, the analytical power obtained...... by increasing the number of sequence reads to billions effectively means that contamination issues that have haunted aDNA research for decades, particularly in human studies, can now be efficiently and confidently quantified. At present, whole genomes have been sequenced from ancient anatomically modern humans...

  18. Marine genomics

    DEFF Research Database (Denmark)

    Oliveira Ribeiro, Ângela Maria; Foote, Andrew David; Kupczok, Anne

    2017-01-01

    Marine ecosystems occupy 71% of the surface of our planet, yet we know little about their diversity. Although the inventory of species is continually increasing, as registered by the Census of Marine Life program, only about 10% of the estimated two million marine species are known. This lag......-throughput sequencing approaches have been helping to improve our knowledge of marine biodiversity, from the rich microbial biota that forms the base of the tree of life to a wealth of plant and animal species. In this review, we present an overview of the applications of genomics to the study of marine life, from...

  19. Re-evaluation of the taxonomy of the Mitis group of the genus Streptococcus based on whole genome phylogenetic analyses, and proposed reclassification of Streptococcus dentisani as Streptococcus oralis subsp. dentisani comb. nov., Streptococcus tigurinus as Streptococcus oralis subsp. tigurinus comb. nov., and Streptococcus oligofermentans as a later synonym of Streptococcus cristatus.

    Science.gov (United States)

    Jensen, Anders; Scholz, Christian F P; Kilian, Mogens

    2016-11-01

    The Mitis group of the genus Streptococcus currently comprises 20 species with validly published names, including the pathogen S. pneumoniae. They have been the subject of much taxonomic confusion, due to phenotypic overlap and genetic heterogeneity, which has hampered a full appreciation of their clinical significance. The purpose of this study was to critically re-examine the taxonomy of the Mitis group using 195 publicly available genomes, including designated type strains for phylogenetic analyses based on core genomes, multilocus sequences and 16S rRNA gene sequences, combined with estimates of average nucleotide identity (ANI) and in silico and in vitro analyses of specific phenotypic characteristics. Our core genomic phylogenetic analyses revealed distinct clades that, to some extent, and from the clustering of type strains represent known species. However, many of the genomes have been incorrectly identified adding to the current confusion. Furthermore, our data show that 16S rRNA gene sequences and ANI are unsuitable for identifying and circumscribing new species of the Mitis group of the genus Streptococci. Based on the clustering patterns resulting from core genome phylogenetic analysis, we conclude that S. oligofermentans is a later synonym of S. cristatus. The recently described strains of the species Streptococcus dentisani includes one previously referred to as 'S. mitis biovar 2'. Together with S. oralis, S. dentisani and S. tigurinus form subclusters within a coherent phylogenetic clade. We propose that the species S. oralis consists of three subspecies: S. oralis subsp. oralis subsp. nov., S. oralis subsp. tigurinus comb. nov., and S. oralis subsp. dentisani comb. nov.

  20. Insights into Conifer Giga-Genomes1

    Science.gov (United States)

    De La Torre, Amanda R.; Birol, Inanc; Bousquet, Jean; Ingvarsson, Pär K.; Jansson, Stefan; Jones, Steven J.M.; Keeling, Christopher I.; MacKay, John; Nilsson, Ove; Ritland, Kermit; Street, Nathaniel; Yanchuk, Alvin; Zerbe, Philipp; Bohlmann, Jörg

    2014-01-01

    Insights from sequenced genomes of major land plant lineages have advanced research in almost every aspect of plant biology. Until recently, however, assembled genome sequences of gymnosperms have been missing from this picture. Conifers of the pine family (Pinaceae) are a group of gymnosperms that dominate large parts of the world’s forests. Despite their ecological and economic importance, conifers seemed long out of reach for complete genome sequencing, due in part to their enormous genome size (20–30 Gb) and the highly repetitive nature of their genomes. Technological advances in genome sequencing and assembly enabled the recent publication of three conifer genomes: white spruce (Picea glauca), Norway spruce (Picea abies), and loblolly pine (Pinus taeda). These genome sequences revealed distinctive features compared with other plant genomes and may represent a window into the past of seed plant genomes. This Update highlights recent advances, remaining challenges, and opportunities in light of the publication of the first conifer and gymnosperm genomes. PMID:25349325

  1. Ensembl Genomes 2016: more genomes, more complexity.

    Science.gov (United States)

    Kersey, Paul Julian; Allen, James E; Armean, Irina; Boddu, Sanjay; Bolt, Bruce J; Carvalho-Silva, Denise; Christensen, Mikkel; Davis, Paul; Falin, Lee J; Grabmueller, Christoph; Humphrey, Jay; Kerhornou, Arnaud; Khobova, Julia; Aranganathan, Naveen K; Langridge, Nicholas; Lowy, Ernesto; McDowall, Mark D; Maheswari, Uma; Nuhn, Michael; Ong, Chuang Kee; Overduin, Bert; Paulini, Michael; Pedro, Helder; Perry, Emily; Spudich, Giulietta; Tapanari, Electra; Walts, Brandon; Williams, Gareth; Tello-Ruiz, Marcela; Stein, Joshua; Wei, Sharon; Ware, Doreen; Bolser, Daniel M; Howe, Kevin L; Kulesha, Eugene; Lawson, Daniel; Maslen, Gareth; Staines, Daniel M

    2016-01-04

    Ensembl Genomes (http://www.ensemblgenomes.org) is an integrating resource for genome-scale data from non-vertebrate species, complementing the resources for vertebrate genomics developed in the context of the Ensembl project (http://www.ensembl.org). Together, the two resources provide a consistent set of programmatic and interactive interfaces to a rich range of data including reference sequence, gene models, transcriptional data, genetic variation and comparative analysis. This paper provides an update to the previous publications about the resource, with a focus on recent developments. These include the development of new analyses and views to represent polyploid genomes (of which bread wheat is the primary exemplar); and the continued up-scaling of the resource, which now includes over 23 000 bacterial genomes, 400 fungal genomes and 100 protist genomes, in addition to 55 genomes from invertebrate metazoa and 39 genomes from plants. This dramatic increase in the number of included genomes is one part of a broader effort to automate the integration of archival data (genome sequence, but also associated RNA sequence data and variant calls) within the context of reference genomes and make it available through the Ensembl user interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Rodent malaria parasites : genome organization & comparative genomics

    NARCIS (Netherlands)

    Kooij, Taco W.A.

    2006-01-01

    The aim of the studies described in this thesis was to investigate the genome organization of rodent malaria parasites (RMPs) and compare the organization and gene content of the genomes of RMPs and the human malaria parasite P. falciparum. The release of the complete genome sequence of P.

  3. Feast and famine in plant genomes.

    Science.gov (United States)

    Jonathan F. Wendel; Richard C. Cronn; J. Spencer Jonhston; H. James. Price

    2002-01-01

    Plant genomes vary over several orders of magnitude in size, even among closely related species, yet the origin, genesis and significance of this variation are not clear. Because DNA content varies over a sevenfold range among diploid species in the cotton genus (Gossypium) and its allies, this group offers opportunities for exploring patterns and mechanisms of genome...

  4. Genome bioinformatics of tomato and potato

    NARCIS (Netherlands)

    Datema, E.

    2011-01-01

    In the past two decades genome sequencing has developed from a laborious and costly technology employed by large international consortia to a widely used, automated and affordable tool used worldwide by many individual research groups. Genome sequences of many food animals and crop plants have

  5. Human Germline Genome Editing.

    Science.gov (United States)

    Ormond, Kelly E; Mortlock, Douglas P; Scholes, Derek T; Bombard, Yvonne; Brody, Lawrence C; Faucett, W Andrew; Garrison, Nanibaa' A; Hercher, Laura; Isasi, Rosario; Middleton, Anna; Musunuru, Kiran; Shriner, Daniel; Virani, Alice; Young, Caroline E

    2017-08-03

    With CRISPR/Cas9 and other genome-editing technologies, successful somatic and germline genome editing are becoming feasible. To respond, an American Society of Human Genetics (ASHG) workgroup developed this position statement, which was approved by the ASHG Board in March 2017. The workgroup included representatives from the UK Association of Genetic Nurses and Counsellors, Canadian Association of Genetic Counsellors, International Genetic Epidemiology Society, and US National Society of Genetic Counselors. These groups, as well as the American Society for Reproductive Medicine, Asia Pacific Society of Human Genetics, British Society for Genetic Medicine, Human Genetics Society of Australasia, Professional Society of Genetic Counselors in Asia, and Southern African Society for Human Genetics, endorsed the final statement. The statement includes the following positions. (1) At this time, given the nature and number of unanswered scientific, ethical, and policy questions, it is inappropriate to perform germline gene editing that culminates in human pregnancy. (2) Currently, there is no reason to prohibit in vitro germline genome editing on human embryos and gametes, with appropriate oversight and consent from donors, to facilitate research on the possible future clinical applications of gene editing. There should be no prohibition on making public funds available to support this research. (3) Future clinical application of human germline genome editing should not proceed unless, at a minimum, there is (a) a compelling medical rationale, (b) an evidence base that supports its clinical use, (c) an ethical justification, and (d) a transparent public process to solicit and incorporate stakeholder input. Copyright © 2017 American Society of Human Genetics. All rights reserved.

  6. Funding Opportunity: Genomic Data Centers

    Science.gov (United States)

    Funding Opportunity CCG, Funding Opportunity Center for Cancer Genomics, CCG, Center for Cancer Genomics, CCG RFA, Center for cancer genomics rfa, genomic data analysis network, genomic data analysis network centers,

  7. Exploring Other Genomes: Bacteria.

    Science.gov (United States)

    Flannery, Maura C.

    2001-01-01

    Points out the importance of genomes other than the human genome project and provides information on the identified bacterial genomes Pseudomonas aeuroginosa, Leprosy, Cholera, Meningitis, Tuberculosis, Bubonic Plague, and plant pathogens. Considers the computer's use in genome studies. (Contains 14 references.) (YDS)

  8. Whole-genome sequence of the Tibetan frog Nanorana parkeri and the comparative evolution of tetrapod genomes.

    Science.gov (United States)

    Sun, Yan-Bo; Xiong, Zi-Jun; Xiang, Xue-Yan; Liu, Shi-Ping; Zhou, Wei-Wei; Tu, Xiao-Long; Zhong, Li; Wang, Lu; Wu, Dong-Dong; Zhang, Bao-Lin; Zhu, Chun-Ling; Yang, Min-Min; Chen, Hong-Man; Li, Fang; Zhou, Long; Feng, Shao-Hong; Huang, Chao; Zhang, Guo-Jie; Irwin, David; Hillis, David M; Murphy, Robert W; Yang, Huan-Ming; Che, Jing; Wang, Jun; Zhang, Ya-Ping

    2015-03-17

    The development of efficient sequencing techniques has resulted in large numbers of genomes being available for evolutionary studies. However, only one genome is available for all amphibians, that of Xenopus tropicalis, which is distantly related from the majority of frogs. More than 96% of frogs belong to the Neobatrachia, and no genome exists for this group. This dearth of amphibian genomes greatly restricts genomic studies of amphibians and, more generally, our understanding of tetrapod genome evolution. To fill this gap, we provide the de novo genome of a Tibetan Plateau frog, Nanorana parkeri, and compare it to that of X. tropicalis and other vertebrates. This genome encodes more than 20,000 protein-coding genes, a number similar to that of Xenopus. Although the genome size of Nanorana is considerably larger than that of Xenopus (2.3 vs. 1.5 Gb), most of the difference is due to the respective number of transposable elements in the two genomes. The two frogs exhibit considerable conserved whole-genome synteny despite having diverged approximately 266 Ma, indicating a slow rate of DNA structural evolution in anurans. Multigenome synteny blocks further show that amphibians have fewer interchromosomal rearrangements than mammals but have a comparable rate of intrachromosomal rearrangements. Our analysis also identifies 11 Mb of anuran-specific highly conserved elements that will be useful for comparative genomic analyses of frogs. The Nanorana genome offers an improved understanding of evolution of tetrapod genomes and also provides a genomic reference for other evolutionary studies.

  9. Genomics With Cloud Computing

    OpenAIRE

    Sukhamrit Kaur; Sandeep Kaur

    2015-01-01

    Abstract Genomics is study of genome which provides large amount of data for which large storage and computation power is needed. These issues are solved by cloud computing that provides various cloud platforms for genomics. These platforms provides many services to user like easy access to data easy sharing and transfer providing storage in hundreds of terabytes more computational power. Some cloud platforms are Google genomics DNAnexus and Globus genomics. Various features of cloud computin...

  10. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Science.gov (United States)

    Ping, Zheng; Siegal, Gene P.; Almeida, Jonas S.; Schnitt, Stuart J.; Shen, Dejun

    2014-01-01

    Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA) is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer. PMID:24672738

  11. Mining genome sequencing data to identify the genomic features linked to breast cancer histopathology

    Directory of Open Access Journals (Sweden)

    Zheng Ping

    2014-01-01

    Full Text Available Background: Genetics and genomics have radically altered our understanding of breast cancer progression. However, the genomic basis of various histopathologic features of breast cancer is not yet well-defined. Materials and Methods: The Cancer Genome Atlas (TCGA is an international database containing a large collection of human cancer genome sequencing data. cBioPortal is a web tool developed for mining these sequencing data. We performed mining of TCGA sequencing data in an attempt to characterize the genomic features correlated with breast cancer histopathology. We first assessed the quality of the TCGA data using a group of genes with known alterations in various cancers. Both genome-wide gene mutation and copy number changes as well as a group of genes with a high frequency of genetic changes were then correlated with various histopathologic features of invasive breast cancer. Results: Validation of TCGA data using a group of genes with known alterations in breast cancer suggests that the TCGA has accurately documented the genomic abnormalities of multiple malignancies. Further analysis of TCGA breast cancer sequencing data shows that accumulation of specific genomic defects is associated with higher tumor grade, larger tumor size and receptor negativity. Distinct groups of genomic changes were found to be associated with the different grades of invasive ductal carcinoma. The mutator role of the TP53 gene was validated by genomic sequencing data of invasive breast cancer and TP53 mutation was found to play a critical role in defining high tumor grade. Conclusions: Data mining of the TCGA genome sequencing data is an innovative and reliable method to help characterize the genomic abnormalities associated with histopathologic features of invasive breast cancer.

  12. Genome Maps, a new generation genome browser.

    Science.gov (United States)

    Medina, Ignacio; Salavert, Francisco; Sanchez, Rubén; de Maria, Alejandro; Alonso, Roberto; Escobar, Pablo; Bleda, Marta; Dopazo, Joaquín

    2013-07-01

    Genome browsers have gained importance as more genomes and related genomic information become available. However, the increase of information brought about by new generation sequencing technologies is, at the same time, causing a subtle but continuous decrease in the efficiency of conventional genome browsers. Here, we present Genome Maps, a genome browser that implements an innovative model of data transfer and management. The program uses highly efficient technologies from the new HTML5 standard, such as scalable vector graphics, that optimize workloads at both server and client sides and ensure future scalability. Thus, data management and representation are entirely carried out by the browser, without the need of any Java Applet, Flash or other plug-in technology installation. Relevant biological data on genes, transcripts, exons, regulatory features, single-nucleotide polymorphisms, karyotype and so forth, are imported from web services and are available as tracks. In addition, several DAS servers are already included in Genome Maps. As a novelty, this web-based genome browser allows the local upload of huge genomic data files (e.g. VCF or BAM) that can be dynamically visualized in real time at the client side, thus facilitating the management of medical data affected by privacy restrictions. Finally, Genome Maps can easily be integrated in any web application by including only a few lines of code. Genome Maps is an open source collaborative initiative available in the GitHub repository (https://github.com/compbio-bigdata-viz/genome-maps). Genome Maps is available at: http://www.genomemaps.org.

  13. Whole genome shotgun sequencing of Indian strains of Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Balaji Veeraraghavan

    2017-12-01

    Full Text Available Group B streptococcus is known as a leading cause of neonatal infections in developing countries. The present study describes the whole genome shotgun sequences of four Group B Streptococcus (GBS isolates. Molecular data on clonality is lacking for GBS in India. The present genome report will add important information on the scarce genome data of GBS and will help in deriving comparative genome studies of GBS isolates at global level. This Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession numbers NHPL00000000 – NHPO00000000.

  14. JGI Fungal Genomics Program

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor V.

    2011-03-14

    Genomes of energy and environment fungi are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 50 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such 'parts' suggested by comparative genomics and functional analysis in these areas are presented here

  15. Genomic Encyclopedia of Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor

    2012-08-10

    Genomes of fungi relevant to energy and environment are in focus of the Fungal Genomic Program at the US Department of Energy Joint Genome Institute (JGI). Its key project, the Genomics Encyclopedia of Fungi, targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts), and explores fungal diversity by means of genome sequencing and analysis. Over 150 fungal genomes have been sequenced by JGI to date and released through MycoCosm (www.jgi.doe.gov/fungi), a fungal web-portal, which integrates sequence and functional data with genome analysis tools for user community. Sequence analysis supported by functional genomics leads to developing parts list for complex systems ranging from ecosystems of biofuel crops to biorefineries. Recent examples of such parts suggested by comparative genomics and functional analysis in these areas are presented here.

  16. Identification and assembly of genomes and genetic elements in complex metagenomic samples without using reference genomes

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Almeida, Mathieu; Juncker, Agnieszka

    2014-01-01

    of microbial genomes without the need for reference sequences. We demonstrate the method on data from 396 human gut microbiome samples and identify 7,381 co-abundance gene groups (CAGs), including 741 metagenomic species (MGS). We use these to assemble 238 high-quality microbial genomes and identify...

  17. Genomics With Cloud Computing

    Directory of Open Access Journals (Sweden)

    Sukhamrit Kaur

    2015-04-01

    Full Text Available Abstract Genomics is study of genome which provides large amount of data for which large storage and computation power is needed. These issues are solved by cloud computing that provides various cloud platforms for genomics. These platforms provides many services to user like easy access to data easy sharing and transfer providing storage in hundreds of terabytes more computational power. Some cloud platforms are Google genomics DNAnexus and Globus genomics. Various features of cloud computing to genomics are like easy access and sharing of data security of data less cost to pay for resources but still there are some demerits like large time needed to transfer data less network bandwidth.

  18. Two New Loci for Body-Weight Regulation Identified in a Joint Analysis of Genome-Wide Association Studies for Early-Onset Extreme Obesity in French and German Study Groups

    Science.gov (United States)

    Scherag, André; Dina, Christian; Hinney, Anke; Vatin, Vincent; Scherag, Susann; Vogel, Carla I. G.; Müller, Timo D.; Grallert, Harald; Wichmann, H.-Erich; Balkau, Beverley; Heude, Barbara; Jarvelin, Marjo-Riitta; Hartikainen, Anna-Liisa; Levy-Marchal, Claire; Weill, Jacques; Delplanque, Jérôme; Körner, Antje; Kiess, Wieland; Kovacs, Peter; Rayner, Nigel W.; Prokopenko, Inga; McCarthy, Mark I.; Schäfer, Helmut; Jarick, Ivonne; Boeing, Heiner; Fisher, Eva; Reinehr, Thomas; Heinrich, Joachim; Rzehak, Peter; Berdel, Dietrich; Borte, Michael; Biebermann, Heike; Krude, Heiko; Rosskopf, Dieter; Rimmbach, Christian; Rief, Winfried; Fromme, Tobias; Klingenspor, Martin; Schürmann, Annette; Schulz, Nadja; Nöthen, Markus M.; Mühleisen, Thomas W.; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne; Boes, Tanja; Illig, Thomas; Froguel, Philippe; Hebebrand, Johannes; Meyre, David

    2010-01-01

    Meta-analyses of population-based genome-wide association studies (GWAS) in adults have recently led to the detection of new genetic loci for obesity. Here we aimed to discover additional obesity loci in extremely obese children and adolescents. We also investigated if these results generalize by estimating the effects of these obesity loci in adults and in population-based samples including both children and adults. We jointly analysed two GWAS of 2,258 individuals and followed-up the best, according to lowest p-values, 44 single nucleotide polymorphisms (SNP) from 21 genomic regions in 3,141 individuals. After this DISCOVERY step, we explored if the findings derived from the extremely obese children and adolescents (10 SNPs from 5 genomic regions) generalized to (i) the population level and (ii) to adults by genotyping another 31,182 individuals (GENERALIZATION step). Apart from previously identified FTO, MC4R, and TMEM18, we detected two new loci for obesity: one in SDCCAG8 (serologically defined colon cancer antigen 8 gene; p = 1.85×10−8 in the DISCOVERY step) and one between TNKS (tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase gene) and MSRA (methionine sulfoxide reductase A gene; p = 4.84×10−7), the latter finding being limited to children and adolescents as demonstrated in the GENERALIZATION step. The odds ratios for early-onset obesity were estimated at ∼1.10 per risk allele for both loci. Interestingly, the TNKS/MSRA locus has recently been found to be associated with adult waist circumference. In summary, we have completed a meta-analysis of two GWAS which both focus on extremely obese children and adolescents and replicated our findings in a large followed-up data set. We observed that genetic variants in or near FTO, MC4R, TMEM18, SDCCAG8, and TNKS/MSRA were robustly associated with early-onset obesity. We conclude that the currently known major common variants related to obesity overlap to a substantial degree between

  19. Two new Loci for body-weight regulation identified in a joint analysis of genome-wide association studies for early-onset extreme obesity in French and german study groups.

    Directory of Open Access Journals (Sweden)

    André Scherag

    2010-04-01

    Full Text Available Meta-analyses of population-based genome-wide association studies (GWAS in adults have recently led to the detection of new genetic loci for obesity. Here we aimed to discover additional obesity loci in extremely obese children and adolescents. We also investigated if these results generalize by estimating the effects of these obesity loci in adults and in population-based samples including both children and adults. We jointly analysed two GWAS of 2,258 individuals and followed-up the best, according to lowest p-values, 44 single nucleotide polymorphisms (SNP from 21 genomic regions in 3,141 individuals. After this DISCOVERY step, we explored if the findings derived from the extremely obese children and adolescents (10 SNPs from 5 genomic regions generalized to (i the population level and (ii to adults by genotyping another 31,182 individuals (GENERALIZATION step. Apart from previously identified FTO, MC4R, and TMEM18, we detected two new loci for obesity: one in SDCCAG8 (serologically defined colon cancer antigen 8 gene; p = 1.85x10(-8 in the DISCOVERY step and one between TNKS (tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase gene and MSRA (methionine sulfoxide reductase A gene; p = 4.84x10(-7, the latter finding being limited to children and adolescents as demonstrated in the GENERALIZATION step. The odds ratios for early-onset obesity were estimated at approximately 1.10 per risk allele for both loci. Interestingly, the TNKS/MSRA locus has recently been found to be associated with adult waist circumference. In summary, we have completed a meta-analysis of two GWAS which both focus on extremely obese children and adolescents and replicated our findings in a large followed-up data set. We observed that genetic variants in or near FTO, MC4R, TMEM18, SDCCAG8, and TNKS/MSRA were robustly associated with early-onset obesity. We conclude that the currently known major common variants related to obesity overlap to a substantial

  20. Comparative Genome Analysis and Genome Evolution

    NARCIS (Netherlands)

    Snel, Berend

    2002-01-01

    This thesis described a collection of bioinformatic analyses on complete genome sequence data. We have studied the evolution of gene content and find that vertical inheritance dominates over horizontal gene trasnfer, even to the extent that we can use the gene content to make genome phylogenies.

  1. Genomic definition of species. Revision 2

    Energy Technology Data Exchange (ETDEWEB)

    Crkvenjakov, R.; Drmanac, R.

    1993-03-01

    A genome is the sum total of the DNA sequences in the cells of an individual organism. The common usage that species possess genomes comes naturally to biochemists, who have shown that all protein and nucleic acid molecules are at the same time species- and individual-specific, with minor individual variations being superimposed on a consensus sequence that is constant for a species. By extension, this property is attributed to the common features of DNA in the chromosomes of members of a given species and is called species genome. Our proposal for the definition of a biological species is as follows: A species comprises a group of actual and potential biological organisms built according to a unique genome program that is recorded, and at least in part expressed, in the structures of their genomic nucleic acid molecule(s), having intragroup sequence differences which can be fully interconverted in the process of organismal reproduction.

  2. Genomic Data Commons launches

    Science.gov (United States)

    The Genomic Data Commons (GDC), a unified data system that promotes sharing of genomic and clinical data between researchers, launched today with a visit from Vice President Joe Biden to the operations center at the University of Chicago.

  3. Rat Genome Database (RGD)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Rat Genome Database (RGD) is a collaborative effort between leading research institutions involved in rat genetic and genomic research to collect, consolidate,...

  4. Visualization for genomics: the Microbial Genome Viewer.

    Science.gov (United States)

    Kerkhoven, Robert; van Enckevort, Frank H J; Boekhorst, Jos; Molenaar, Douwe; Siezen, Roland J

    2004-07-22

    A Web-based visualization tool, the Microbial Genome Viewer, is presented that allows the user to combine complex genomic data in a highly interactive way. This Web tool enables the interactive generation of chromosome wheels and linear genome maps from genome annotation data stored in a MySQL database. The generated images are in scalable vector graphics (SVG) format, which is suitable for creating high-quality scalable images and dynamic Web representations. Gene-related data such as transcriptome and time-course microarray experiments can be superimposed on the maps for visual inspection. The Microbial Genome Viewer 1.0 is freely available at http://www.cmbi.kun.nl/MGV

  5. Genomic prediction using subsampling

    OpenAIRE

    Xavier, Alencar; Xu, Shizhong; Muir, William; Rainey, Katy Martin

    2017-01-01

    Background Genome-wide assisted selection is a critical tool for the?genetic improvement of plants and animals. Whole-genome regression models in Bayesian framework represent the main family of prediction methods. Fitting such models with a large number of observations involves a prohibitive computational burden. We propose the use of subsampling bootstrap Markov chain in genomic prediction. Such method consists of fitting whole-genome regression models by subsampling observations in each rou...

  6. Genomic sovereignty and the African promise: mining the African genome for the benefit of Africa.

    Science.gov (United States)

    de Vries, Jantina; Pepper, Michael

    2012-08-01

    Scientific interest in genomics in Africa is on the rise with a number of funding initiatives aimed specifically at supporting research in this area. Genomics research on material of African origin raises a number of important ethical issues. A prominent concern relates to sample export, which is increasingly seen by researchers and ethics committees across the continent as being problematic. The concept of genomic sovereignty proposes that unique patterns of genomic variation can be found in human populations, and that these are commercially, scientifically or symbolically valuable and in need of protection against exploitation. Although it is appealing as a response to increasing concerns regarding sample export, there are a number of important conceptual problems relating to the term. It is not clear, for instance, whether it is appropriate that ownership over human genomic samples should rest with national governments. Furthermore, ethnic groups in Africa are frequently spread across multiple nation states, and protection offered in one state may not prevent researchers from accessing the same group elsewhere. Lastly, scientific evidence suggests that the assumption that genomic data is unique for population groups is false. Although the frequency with which particular variants are found can differ between groups, such genes or variants per se are not unique to any population group. In this paper, the authors describe these concerns in detail and argue that the concept of genomic sovereignty alone may not be adequate to protect the genetic resources of people of African descent.

  7. A 1000 Arab genome project to study the Emirati population.

    Science.gov (United States)

    Al-Ali, Mariam; Osman, Wael; Tay, Guan K; AlSafar, Habiba S

    2018-04-01

    Discoveries from the human genome, HapMap, and 1000 genome projects have collectively contributed toward the creation of a catalog of human genetic variations that has improved our understanding of human diversity. Despite the collegial nature of many of these genome study consortiums, which has led to the cataloging of genetic variations of different ethnic groups from around the world, genome data on the Arab population remains overwhelmingly underrepresented. The National Arab Genome project in the United Arab Emirates (UAE) aims to address this deficiency by using Next Generation Sequencing (NGS) technology to provide data to improve our understanding of the Arab genome and catalog variants that are unique to the Arab population of the UAE. The project was conceived to shed light on the similarities and differences between the Arab genome and those of the other ethnic groups.

  8. Ebolavirus comparative genomics

    DEFF Research Database (Denmark)

    Jun, Se-Ran; Leuze, Michael R.; Nookaew, Intawat

    2015-01-01

    The 2014 Ebola outbreak in West Africa is the largest documented for this virus. To examine the dynamics of this genome, we compare more than 100 currently available ebolavirus genomes to each other and to other viral genomes. Based on oligomer frequency analysis, the family Filoviridae forms...

  9. Observing copepods through a genomic lens

    Science.gov (United States)

    2011-01-01

    Background Copepods outnumber every other multicellular animal group. They are critical components of the world's freshwater and marine ecosystems, sensitive indicators of local and global climate change, key ecosystem service providers, parasites and predators of economically important aquatic animals and potential vectors of waterborne disease. Copepods sustain the world fisheries that nourish and support human populations. Although genomic tools have transformed many areas of biological and biomedical research, their power to elucidate aspects of the biology, behavior and ecology of copepods has only recently begun to be exploited. Discussion The extraordinary biological and ecological diversity of the subclass Copepoda provides both unique advantages for addressing key problems in aquatic systems and formidable challenges for developing a focused genomics strategy. This article provides an overview of genomic studies of copepods and discusses strategies for using genomics tools to address key questions at levels extending from individuals to ecosystems. Genomics can, for instance, help to decipher patterns of genome evolution such as those that occur during transitions from free living to symbiotic and parasitic lifestyles and can assist in the identification of genetic mechanisms and accompanying physiological changes associated with adaptation to new or physiologically challenging environments. The adaptive significance of the diversity in genome size and unique mechanisms of genome reorganization during development could similarly be explored. Genome-wide and EST studies of parasitic copepods of salmon and large EST studies of selected free-living copepods have demonstrated the potential utility of modern genomics approaches for the study of copepods and have generated resources such as EST libraries, shotgun genome sequences, BAC libraries, genome maps and inbred lines that will be invaluable in assisting further efforts to provide genomics tools for

  10. Observing copepods through a genomic lens

    Directory of Open Access Journals (Sweden)

    Johnson Stewart C

    2011-09-01

    Full Text Available Abstract Background Copepods outnumber every other multicellular animal group. They are critical components of the world's freshwater and marine ecosystems, sensitive indicators of local and global climate change, key ecosystem service providers, parasites and predators of economically important aquatic animals and potential vectors of waterborne disease. Copepods sustain the world fisheries that nourish and support human populations. Although genomic tools have transformed many areas of biological and biomedical research, their power to elucidate aspects of the biology, behavior and ecology of copepods has only recently begun to be exploited. Discussion The extraordinary biological and ecological diversity of the subclass Copepoda provides both unique advantages for addressing key problems in aquatic systems and formidable challenges for developing a focused genomics strategy. This article provides an overview of genomic studies of copepods and discusses strategies for using genomics tools to address key questions at levels extending from individuals to ecosystems. Genomics can, for instance, help to decipher patterns of genome evolution such as those that occur during transitions from free living to symbiotic and parasitic lifestyles and can assist in the identification of genetic mechanisms and accompanying physiological changes associated with adaptation to new or physiologically challenging environments. The adaptive significance of the diversity in genome size and unique mechanisms of genome reorganization during development could similarly be explored. Genome-wide and EST studies of parasitic copepods of salmon and large EST studies of selected free-living copepods have demonstrated the potential utility of modern genomics approaches for the study of copepods and have generated resources such as EST libraries, shotgun genome sequences, BAC libraries, genome maps and inbred lines that will be invaluable in assisting further efforts to

  11. The Switchgrass Genome: Tools and Strategies

    Directory of Open Access Journals (Sweden)

    Michael D. Casler

    2011-11-01

    Full Text Available Switchgrass ( L. is a perennial grass species receiving significant focus as a potential bioenergy crop. In the last 5 yr the switchgrass research community has produced a genetic linkage map, an expressed sequence tag (EST database, a set of single nucleotide polymorphism (SNP markers that are distributed across the 18 linkage groups, 4x sampling of the AP13 genome in 400-bp reads, and bacterial artificial chromosome (BAC libraries containing over 200,000 clones. These studies have revealed close collinearity of the switchgrass genome with those of sorghum [ (L. Moench], rice ( L., and (L. P. Beauv. Switchgrass researchers have also developed several microarray technologies for gene expression studies. Switchgrass genomic resources will accelerate the ability of plant breeders to enhance productivity, pest resistance, and nutritional quality. Because switchgrass is a relative newcomer to the genomics world, many secrets of the switchgrass genome have yet to be revealed. To continue to efficiently explore basic and applied topics in switchgrass, it will be critical to capture and exploit the knowledge of plant geneticists and breeders on the next logical steps in the development and utilization of genomic resources for this species. To this end, the community has established a switchgrass genomics executive committee and work group ( [verified 28 Oct. 2011].

  12. The zebrafish genome: a review and msx gene case study.

    Science.gov (United States)

    Postlethwait, J H

    2006-01-01

    Zebrafish is one of several important teleost models for understanding principles of vertebrate developmental, molecular, organismal, genetic, evolutionary, and genomic biology. Efficient investigation of the molecular genetic basis of induced mutations depends on knowledge of the zebrafish genome. Principles of zebrafish genomic analysis, including gene mapping, ortholog identification, conservation of syntenies, genome duplication, and evolution of duplicate gene function are discussed here using as a case study the zebrafish msxa, msxb, msxc, msxd, and msxe genes, which together constitute zebrafish orthologs of tetrapod Msx1, Msx2, and Msx3. Genomic analysis suggests orthologs for this difficult to understand group of paralogs.

  13. Draft genome sequence of the Coccolithovirus Emiliania huxleyi virus 203.

    Science.gov (United States)

    Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

    2011-12-01

    The Coccolithoviridae are a recently discovered group of viruses that infect the marine coccolithophorid Emiliania huxleyi. Emiliania huxleyi virus 203 (EhV-203) has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 400 kbp, consisting of 464 coding sequences (CDSs). Here we describe the genomic features of EhV-203 together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

  14. Draft genome sequence of the coccolithovirus Emiliania huxleyi virus 202.

    Science.gov (United States)

    Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

    2012-02-01

    Emiliania huxleyi virus 202 (EhV-202) is a member of the Coccolithoviridae, a group of viruses that infect the marine coccolithophorid Emiliania huxleyi. EhV-202 has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 407 kbp, consisting of 485 coding sequences (CDSs). Here we describe the genomic features of EhV-202, together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

  15. Isolation of Retroelement from Plant Genomic DNA

    OpenAIRE

    sprotocols

    2014-01-01

    Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...

  16. Phylogenomics and the Dynamic Genome Evolution of the Genus Streptococcus

    Science.gov (United States)

    Richards, Vincent P.; Palmer, Sara R.; Pavinski Bitar, Paulina D.; Qin, Xiang; Weinstock, George M.; Highlander, Sarah K.; Town, Christopher D.; Burne, Robert A.; Stanhope, Michael J.

    2014-01-01

    The genus Streptococcus comprises important pathogens that have a severe impact on human health and are responsible for substantial economic losses to agriculture. Here, we utilize 46 Streptococcus genome sequences (44 species), including eight species sequenced here, to provide the first genomic level insight into the evolutionary history and genetic basis underlying the functional diversity of all major groups of this genus. Gene gain/loss analysis revealed a dynamic pattern of genome evolution characterized by an initial period of gene gain followed by a period of loss, as the major groups within the genus diversified. This was followed by a period of genome expansion associated with the origins of the present extant species. The pattern is concordant with an emerging view that genomes evolve through a dynamic process of expansion and streamlining. A large proportion of the pan-genome has experienced lateral gene transfer (LGT) with causative factors, such as relatedness and shared environment, operating over different evolutionary scales. Multiple gene ontology terms were significantly enriched for each group, and mapping terms onto the phylogeny showed that those corresponding to genes born on branches leading to the major groups represented approximately one-fifth of those enriched. Furthermore, despite the extensive LGT, several biochemical characteristics have been retained since group formation, suggesting genomic cohesiveness through time, and that these characteristics may be fundamental to each group. For example, proteolysis: mitis group; urea metabolism: salivarius group; carbohydrate metabolism: pyogenic group; and transcription regulation: bovis group. PMID:24625962

  17. Big Data Analysis of Human Genome Variations

    KAUST Repository

    Gojobori, Takashi

    2016-01-25

    Since the human genome draft sequence was in public for the first time in 2000, genomic analyses have been intensively extended to the population level. The following three international projects are good examples for large-scale studies of human genome variations: 1) HapMap Data (1,417 individuals) (http://hapmap.ncbi.nlm.nih.gov/downloads/genotypes/2010-08_phaseII+III/forward/), 2) HGDP (Human Genome Diversity Project) Data (940 individuals) (http://www.hagsc.org/hgdp/files.html), 3) 1000 genomes Data (2,504 individuals) http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/release/20130502/ If we can integrate all three data into a single volume of data, we should be able to conduct a more detailed analysis of human genome variations for a total number of 4,861 individuals (= 1,417+940+2,504 individuals). In fact, we successfully integrated these three data sets by use of information on the reference human genome sequence, and we conducted the big data analysis. In particular, we constructed a phylogenetic tree of about 5,000 human individuals at the genome level. As a result, we were able to identify clusters of ethnic groups, with detectable admixture, that were not possible by an analysis of each of the three data sets. Here, we report the outcome of this kind of big data analyses and discuss evolutionary significance of human genomic variations. Note that the present study was conducted in collaboration with Katsuhiko Mineta and Kosuke Goto at KAUST.

  18. Similar Ratios of Introns to Intergenic Sequence across Animal Genomes.

    Science.gov (United States)

    Francis, Warren R; Wörheide, Gert

    2017-06-01

    One central goal of genome biology is to understand how the usage of the genome differs between organisms. Our knowledge of genome composition, needed for downstream inferences, is critically dependent on gene annotations, yet problems associated with gene annotation and assembly errors are usually ignored in comparative genomics. Here, we analyze the genomes of 68 species across 12 animal phyla and some single-cell eukaryotes for general trends in genome composition and transcription, taking into account problems of gene annotation. We show that, regardless of genome size, the ratio of introns to intergenic sequence is comparable across essentially all animals, with nearly all deviations dominated by increased intergenic sequence. Genomes of model organisms have ratios much closer to 1:1, suggesting that the majority of published genomes of nonmodel organisms are underannotated and consequently omit substantial numbers of genes, with likely negative impact on evolutionary interpretations. Finally, our results also indicate that most animals transcribe half or more of their genomes arguing against differences in genome usage between animal groups, and also suggesting that the transcribed portion is more dependent on genome size than previously thought. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Genomic comparison of closely related Giant Viruses supports an accordion-like model of evolution

    OpenAIRE

    Filée, Jonathan

    2015-01-01

    Genome gigantism occurs so far in Phycodnaviridae and Mimiviridae (order Megavirales). Origin and evolution of these Giant Viruses (GVs) remain open questions. Interestingly, availability of a collection of closely related GV genomes enabling genomic comparisons offer the opportunity to better understand the different evolutionary forces acting on these genomes. Whole genome alignment for five groups of viruses belonging to the Mimiviridae and Phycodnaviridae families show that there is no tr...

  20. Origin of the Y genome in Elymus and its relationship to other genomes in Triticeae based on evidence from elongation factor G (EF-G) gene sequences.

    Science.gov (United States)

    Sun, Genlou; Komatsuda, Takao

    2010-08-01

    It is well known that Elymus arose through hybridization between representatives of different genera. Cytogenetic analyses show that all its members include the St genome in combination with one or more of four other genomes, the H, Y, P, and W genomes. The origins of the H, P, and W genomes are known, but not for the Y genome. We analyzed the single copy nuclear gene coding for elongation factor G (EF-G) from 28 accessions of polyploid Elymus species and 45 accessions of diploid Triticeae species in order to investigate origin of the Y genome and its relationship to other genomes in the tribe Triticeae. Sequence comparisons among the St, H, Y, P, W, and E genomes detected genome-specific polymorphisms at 66 nucleotide positions. The St and Y genomes are relatively dissimilar. The phylogeny of the Y genome sequences was investigated for the first time. They were most similar to the W genome sequences. The Y genome sequences were placed in two different groups. These two groups were included in an unresolved clade that included the W and E sequences as well as sequences from many annual species. The H genomes sequences were in a clade with the F, P, and Ns genome sequences as sister groups. These two clades were more closely related to each other and to the L and Xp genomes than they were to the St genome sequences. These data support the hypothesis that the Y genome evolved in a diploid species and has a different origin from the St genome. Copyright 2010 Elsevier Inc. All rights reserved.

  1. Genomic sequence of 'Candidatus Liberibacter solanacearum' haplotype C and its comparison with haplotype A and B genomes.

    Directory of Open Access Journals (Sweden)

    Jinhui Wang

    Full Text Available Haplotypes A and B of 'Candidatus Liberibacter solanacearum' (CLso are associated with diseases of solanaceous plants, especially Zebra chip disease of potato, and haplotypes C, D and E are associated with symptoms on apiaceous plants. To date, one complete genome of haplotype B and two high quality draft genomes of haplotype A have been obtained for these unculturable bacteria using metagenomics from the psyllid vector Bactericera cockerelli. Here, we present the first genomic sequences obtained for the carrot-associated CLso. These two genomic sequences of haplotype C, FIN114 (1.24 Mbp and FIN111 (1.20 Mbp, were obtained from carrot psyllids (Trioza apicalis harboring CLso. Genomic comparisons between the haplotypes A, B and C revealed that the genome organization differs between these haplotypes, due to large inversions and other recombinations. Comparison of protein-coding genes indicated that the core genome of CLso consists of 885 ortholog groups, with the pan-genome consisting of 1327 ortholog groups. Twenty-seven ortholog groups are unique to CLso haplotype C, whilst 11 ortholog groups shared by the haplotypes A and B, are not found in the haplotype C. Some of these ortholog groups that are not part of the core genome may encode functions related to interactions with the different host plant and psyllid species.

  2. Species richness and trophic diversity increase decomposition in a co-evolved food web.

    Directory of Open Access Journals (Sweden)

    Benjamin Baiser

    Full Text Available Ecological communities show great variation in species richness, composition and food web structure across similar and diverse ecosystems. Knowledge of how this biodiversity relates to ecosystem functioning is important for understanding the maintenance of diversity and the potential effects of species losses and gains on ecosystems. While research often focuses on how variation in species richness influences ecosystem processes, assessing species richness in a food web context can provide further insight into the relationship between diversity and ecosystem functioning and elucidate potential mechanisms underpinning this relationship. Here, we assessed how species richness and trophic diversity affect decomposition rates in a complete aquatic food web: the five trophic level web that occurs within water-filled leaves of the northern pitcher plant, Sarracenia purpurea. We identified a trophic cascade in which top-predators--larvae of the pitcher-plant mosquito--indirectly increased bacterial decomposition by preying on bactivorous protozoa. Our data also revealed a facultative relationship in which larvae of the pitcher-plant midge increased bacterial decomposition by shredding detritus. These important interactions occur only in food webs with high trophic diversity, which in turn only occur in food webs with high species richness. We show that species richness and trophic diversity underlie strong linkages between food web structure and dynamics that influence ecosystem functioning. The importance of trophic diversity and species interactions in determining how biodiversity relates to ecosystem functioning suggests that simply focusing on species richness does not give a complete picture as to how ecosystems may change with the loss or gain of species.

  3. Mirroring co-evolving trees in the light of their topologies.

    Science.gov (United States)

    Hajirasouliha, Iman; Schönhuth, Alexander; de Juan, David; Valencia, Alfonso; Sahinalp, S Cenk

    2012-05-01

    Determining the interaction partners among protein/domain families poses hard computational problems, in particular in the presence of paralogous proteins. Available approaches aim to identify interaction partners among protein/domain families through maximizing the similarity between trimmed versions of their phylogenetic trees. Since maximization of any natural similarity score is computationally difficult, many approaches employ heuristics to evaluate the distance matrices corresponding to the tree topologies in question. In this article, we devise an efficient deterministic algorithm which directly maximizes the similarity between two leaf labeled trees with edge lengths, obtaining a score-optimal alignment of the two trees in question. Our algorithm is significantly faster than those methods based on distance matrix comparison: 1 min on a single processor versus 730 h on a supercomputer. Furthermore, we outperform the current state-of-the-art exhaustive search approach in terms of precision, while incurring acceptable losses in recall. A C implementation of the method demonstrated in this article is available at http://compbio.cs.sfu.ca/mirrort.htm

  4. Do Export and Technological Specialisation Patterns Co-evolve in Terms of Convergence or Divergence?

    DEFF Research Database (Denmark)

    Laursen, Keld

    2000-01-01

    Several researchers looking at the development of international export specialisation patterns have shown that there is a weak tendency for OECD countries to exhibit decreased levels of specialisation. This finding is in contrast to findings made by other authors, who found increasing technological...... and level of aggregation. The second aim is to analyse the extent to which countries and sectors display stable specialisation patterns over time, also both in terms of exports and in terms of technology. The paper confirms that the OECD countries tend in general to become less specialised in terms...... of exports. The evidence is less conclusive with regard to technological specialisation, as the results are mixed in the sense that just about half of the countries tend to exhibit increased levels of specialisation, while the other half tend to exhibit lower levels of specialisation. In terms of country...

  5. Plant-Associated Methylobacteria as Co-Evolved Phytosymbionts: A Hypothesis

    OpenAIRE

    Kutschera, Ulrich

    2007-01-01

    Due to their wall-associated pectin metabolism, growing plant cells emit significant amounts of the one-carbon alcohol methanol. Pink-pigmented microbes of the genus Methylobacterium that colonize the surfaces of leaves (epiphytes) are capable of growth on this volatile C1-compound as sole source of carbon and energy. In this article the results of experiments with germ-free (gnotobiotic) sporophytes of angiosperms (sunflower, maize) and gametophytes of bryophytes (a moss and two liverwort sp...

  6. Plant-associated methylobacteria as co-evolved phytosymbionts: a hypothesis.

    Science.gov (United States)

    Kutschera, Ulrich

    2007-03-01

    Due to their wall-associated pectin metabolism, growing plant cells emit significant amounts of the one-carbon alcohol methanol. Pink-pigmented microbes of the genus Methylobacterium that colonize the surfaces of leaves (epiphytes) are capable of growth on this volatile C1-compound as sole source of carbon and energy. In this article the results of experiments with germ-free (gnotobiotic) sporophytes of angiosperms (sunflower, maize) and gametophytes of bryophytes (a moss and two liverwort species) are summarized. The data show that methylobacteria do not stimulate the growth of these angiosperms, but organ development in moss protonemata and in thalli of liverworts is considerably enhanced. Since methylobacteria produce and secrete cytokinins and auxin, a model of plant-microbe-interaction (symbiosis) is proposed in which the methanol-consuming bacteria are viewed as coevolved partners of the gametophyte that determine its growth, survival and reproduction (fitness). This symbiosis is restricted to the haploid cells of moisture-dependent "living fossil" plants; it does not apply to the diploid sporophytes of higher embryophytes, which are fully adapted to life on land and apparently produce sufficient amounts of endogenous phytohormones.

  7. Patrilocal Exogamy as a Monitoring Mechanism : How Inheritance and Residence Patterns Co-evolve

    OpenAIRE

    Brishti Guha

    2010-01-01

    Economists have modeled inheritance norms assuming the pattern of post-marital residence is exogenous. We model the co-evolution of these two institutions, examining how patrilineal inheritance and patrilocal exogamy reinforced each other in a patrilineal-patrilocal equilibrium. We also derive conditions for a matrilineal-matrilocal equilibrium. The endogenous choice of the old to monitor the sexual behavior of the young women who reside with them, thereby affecting the paternity confidence o...

  8. Bioinformatics decoding the genome

    CERN Multimedia

    CERN. Geneva; Deutsch, Sam; Michielin, Olivier; Thomas, Arthur; Descombes, Patrick

    2006-01-01

    Extracting the fundamental genomic sequence from the DNA From Genome to Sequence : Biology in the early 21st century has been radically transformed by the availability of the full genome sequences of an ever increasing number of life forms, from bacteria to major crop plants and to humans. The lecture will concentrate on the computational challenges associated with the production, storage and analysis of genome sequence data, with an emphasis on mammalian genomes. The quality and usability of genome sequences is increasingly conditioned by the careful integration of strategies for data collection and computational analysis, from the construction of maps and libraries to the assembly of raw data into sequence contigs and chromosome-sized scaffolds. Once the sequence is assembled, a major challenge is the mapping of biologically relevant information onto this sequence: promoters, introns and exons of protein-encoding genes, regulatory elements, functional RNAs, pseudogenes, transposons, etc. The methodological ...

  9. Genomic research in Eucalyptus.

    Science.gov (United States)

    Poke, Fiona S; Vaillancourt, René E; Potts, Brad M; Reid, James B

    2005-09-01

    Eucalyptus L'Hérit. is a genus comprised of more than 700 species that is of vital importance ecologically to Australia and to the forestry industry world-wide, being grown in plantations for the production of solid wood products as well as pulp for paper. With the sequencing of the genomes of Arabidopsis thaliana and Oryza sativa and the recent completion of the first tree genome sequence, Populus trichocarpa, attention has turned to the current status of genomic research in Eucalyptus. For several eucalypt species, large segregating families have been established, high-resolution genetic maps constructed and large EST databases generated. Collaborative efforts have been initiated for the integration of diverse genomic projects and will provide the framework for future research including exploiting the sequence of the entire eucalypt genome which is currently being sequenced. This review summarises the current position of genomic research in Eucalyptus and discusses the direction of future research.

  10. Comparative Genome Analysis of Enterobacter cloacae

    Science.gov (United States)

    Liu, Wing-Yee; Wong, Chi-Fat; Chung, Karl Ming-Kar; Jiang, Jing-Wei; Leung, Frederick Chi-Ching

    2013-01-01

    The Enterobacter cloacae species includes an extremely diverse group of bacteria that are associated with plants, soil and humans. Publication of the complete genome sequence of the plant growth-promoting endophytic E. cloacae subsp. cloacae ENHKU01 provided an opportunity to perform the first comparative genome analysis between strains of this dynamic species. Examination of the pan-genome of E. cloacae showed that the conserved core genome retains the general physiological and survival genes of the species, while genomic factors in plasmids and variable regions determine the virulence of the human pathogenic E. cloacae strain; additionally, the diversity of fimbriae contributes to variation in colonization and host determination of different E. cloacae strains. Comparative genome analysis further illustrated that E. cloacae strains possess multiple mechanisms for antagonistic action against other microorganisms, which involve the production of siderophores and various antimicrobial compounds, such as bacteriocins, chitinases and antibiotic resistance proteins. The presence of Type VI secretion systems is expected to provide further fitness advantages for E. cloacae in microbial competition, thus allowing it to survive in different environments. Competition assays were performed to support our observations in genomic analysis, where E. cloacae subsp. cloacae ENHKU01 demonstrated antagonistic activities against a wide range of plant pathogenic fungal and bacterial species. PMID:24069314

  11. Microbial genome analysis: the COG approach.

    Science.gov (United States)

    Galperin, Michael Y; Kristensen, David M; Makarova, Kira S; Wolf, Yuri I; Koonin, Eugene V

    2017-09-14

    For the past 20 years, the Clusters of Orthologous Genes (COG) database had been a popular tool for microbial genome annotation and comparative genomics. Initially created for the purpose of evolutionary classification of protein families, the COG have been used, apart from straightforward functional annotation of sequenced genomes, for such tasks as (i) unification of genome annotation in groups of related organisms; (ii) identification of missing and/or undetected genes in complete microbial genomes; (iii) analysis of genomic neighborhoods, in many cases allowing prediction of novel functional systems; (iv) analysis of metabolic pathways and prediction of alternative forms of enzymes; (v) comparison of organisms by COG functional categories; and (vi) prioritization of targets for structural and functional characterization. Here we review the principles of the COG approach and discuss its key advantages and drawbacks in microbial genome analysis. Published by Oxford University Press 2017. This work is written by US Government employees and is in the public domain in the US.

  12. A Distance Measure for Genome Phylogenetic Analysis

    Science.gov (United States)

    Cao, Minh Duc; Allison, Lloyd; Dix, Trevor

    Phylogenetic analyses of species based on single genes or parts of the genomes are often inconsistent because of factors such as variable rates of evolution and horizontal gene transfer. The availability of more and more sequenced genomes allows phylogeny construction from complete genomes that is less sensitive to such inconsistency. For such long sequences, construction methods like maximum parsimony and maximum likelihood are often not possible due to their intensive computational requirement. Another class of tree construction methods, namely distance-based methods, require a measure of distances between any two genomes. Some measures such as evolutionary edit distance of gene order and gene content are computational expensive or do not perform well when the gene content of the organisms are similar. This study presents an information theoretic measure of genetic distances between genomes based on the biological compression algorithm expert model. We demonstrate that our distance measure can be applied to reconstruct the consensus phylogenetic tree of a number of Plasmodium parasites from their genomes, the statistical bias of which would mislead conventional analysis methods. Our approach is also used to successfully construct a plausible evolutionary tree for the γ-Proteobacteria group whose genomes are known to contain many horizontally transferred genes.

  13. The mitochondrial genome of Grateloupia taiwanensis (Halymeniaceae, Rhodophyta) and comparative mitochondrial genomics of red algae.

    Science.gov (United States)

    DePriest, Michael S; Bhattacharya, Debashish; López-Bautista, Juan M

    2014-10-01

    Although red algae are economically highly valuable for their gelatinous cell wall compounds as well as being integral parts of marine benthic habitats, very little genome data are currently available. We present mitochondrial genome sequence data from the red alga Grateloupia taiwanensis S.-M. Lin & H.-Y. Liang. Comprising 28,906 nucleotide positions, the mitochondrial genome contig contains 25 protein-coding genes and 24 transfer RNA genes. It is highly similar to other red algal genomes in gene content as well as overall structure. An intron in the cox1 gene was found to be shared by G. taiwanensis and Grateloupia angusta (Okamura) S. Kawaguchi & H. W. Wang. We also used whole-genome alignments to compare G. taiwanensis to different groups of red algae, and these results are consistent with the currently accepted phylogeny of Rhodophyta. © 2014 Marine Biological Laboratory.

  14. Comparative genomic data of the Avian Phylogenomics Project.

    Science.gov (United States)

    Zhang, Guojie; Li, Bo; Li, Cai; Gilbert, M Thomas P; Jarvis, Erich D; Wang, Jun

    2014-01-01

    The evolutionary relationships of modern birds are among the most challenging to understand in systematic biology and have been debated for centuries. To address this challenge, we assembled or collected the genomes of 48 avian species spanning most orders of birds, including all Neognathae and two of the five Palaeognathae orders, and used the genomes to construct a genome-scale avian phylogenetic tree and perform comparative genomics analyses (Jarvis et al. in press; Zhang et al. in press). Here we release assemblies and datasets associated with the comparative genome analyses, which include 38 newly sequenced avian genomes plus previously released or simultaneously released genomes of Chicken, Zebra finch, Turkey, Pigeon, Peregrine falcon, Duck, Budgerigar, Adelie penguin, Emperor penguin and the Medium Ground Finch. We hope that this resource will serve future efforts in phylogenomics and comparative genomics. The 38 bird genomes were sequenced using the Illumina HiSeq 2000 platform and assembled using a whole genome shotgun strategy. The 48 genomes were categorized into two groups according to the N50 scaffold size of the assemblies: a high depth group comprising 23 species sequenced at high coverage (>50X) with multiple insert size libraries resulting in N50 scaffold sizes greater than 1 Mb (except the White-throated Tinamou and Bald Eagle); and a low depth group comprising 25 species sequenced at a low coverage (~30X) with two insert size libraries resulting in an average N50 scaffold size of about 50 kb. Repetitive elements comprised 4%-22% of the bird genomes. The assembled scaffolds allowed the homology-based annotation of 13,000 ~ 17000 protein coding genes in each avian genome relative to chicken, zebra finch and human, as well as comparative and sequence conservation analyses. Here we release full genome assemblies of 38 newly sequenced avian species, link genome assembly downloads for the 7 of the remaining 10 species, and provide a guideline of

  15. Genome packaging in viruses

    OpenAIRE

    Sun, Siyang; Rao, Venigalla B.; Rossmann, Michael G.

    2010-01-01

    Genome packaging is a fundamental process in a viral life cycle. Many viruses assemble preformed capsids into which the genomic material is subsequently packaged. These viruses use a packaging motor protein that is driven by the hydrolysis of ATP to condense the nucleic acids into a confined space. How these motor proteins package viral genomes had been poorly understood until recently, when a few X-ray crystal structures and cryo-electron microscopy structures became available. Here we discu...

  16. Between Two Fern Genomes

    Science.gov (United States)

    2014-01-01

    Ferns are the only major lineage of vascular plants not represented by a sequenced nuclear genome. This lack of genome sequence information significantly impedes our ability to understand and reconstruct genome evolution not only in ferns, but across all land plants. Azolla and Ceratopteris are ideal and complementary candidates to be the first ferns to have their nuclear genomes sequenced. They differ dramatically in genome size, life history, and habit, and thus represent the immense diversity of extant ferns. Together, this pair of genomes will facilitate myriad large-scale comparative analyses across ferns and all land plants. Here we review the unique biological characteristics of ferns and describe a number of outstanding questions in plant biology that will benefit from the addition of ferns to the set of taxa with sequenced nuclear genomes. We explain why the fern clade is pivotal for understanding genome evolution across land plants, and we provide a rationale for how knowledge of fern genomes will enable progress in research beyond the ferns themselves. PMID:25324969

  17. Causes of genome instability

    DEFF Research Database (Denmark)

    Langie, Sabine A S; Koppen, Gudrun; Desaulniers, Daniel

    2015-01-01

    function, chromosome segregation, telomere length). The purpose of this review is to describe the crucial aspects of genome instability, to outline the ways in which environmental chemicals can affect this cancer hallmark and to identify candidate chemicals for further study. The overall aim is to make......Genome instability is a prerequisite for the development of cancer. It occurs when genome maintenance systems fail to safeguard the genome's integrity, whether as a consequence of inherited defects or induced via exposure to environmental agents (chemicals, biological agents and radiation). Thus...

  18. Fungal Genomics Program

    Energy Technology Data Exchange (ETDEWEB)

    Grigoriev, Igor

    2012-03-12

    The JGI Fungal Genomics Program aims to scale up sequencing and analysis of fungal genomes to explore the diversity of fungi important for energy and the environment, and to promote functional studies on a system level. Combining new sequencing technologies and comparative genomics tools, JGI is now leading the world in fungal genome sequencing and analysis. Over 120 sequenced fungal genomes with analytical tools are available via MycoCosm (www.jgi.doe.gov/fungi), a web-portal for fungal biologists. Our model of interacting with user communities, unique among other sequencing centers, helps organize these communities, improves genome annotation and analysis work, and facilitates new larger-scale genomic projects. This resulted in 20 high-profile papers published in 2011 alone and contributing to the Genomics Encyclopedia of Fungi, which targets fungi related to plant health (symbionts, pathogens, and biocontrol agents) and biorefinery processes (cellulose degradation, sugar fermentation, industrial hosts). Our next grand challenges include larger scale exploration of fungal diversity (1000 fungal genomes), developing molecular tools for DOE-relevant model organisms, and analysis of complex systems and metagenomes.

  19. MIPS plant genome information resources.

    Science.gov (United States)

    Spannagl, Manuel; Haberer, Georg; Ernst, Rebecca; Schoof, Heiko; Mayer, Klaus F X

    2007-01-01

    The Munich Institute for Protein Sequences (MIPS) has been involved in maintaining plant genome databases since the Arabidopsis thaliana genome project. Genome databases and analysis resources have focused on individual genomes and aim to provide flexible and maintainable data sets for model plant genomes as a backbone against which experimental data, for example from high-throughput functional genomics, can be organized and evaluated. In addition, model genomes also form a scaffold for comparative genomics, and much can be learned from genome-wide evolutionary studies.

  20. Group X

    Energy Technology Data Exchange (ETDEWEB)

    Fields, Susannah

    2007-08-16

    This project is currently under contract for research through the Department of Homeland Security until 2011. The group I was responsible for studying has to remain confidential so as not to affect the current project. All dates, reference links and authors, and other distinguishing characteristics of the original group have been removed from this report. All references to the name of this group or the individual splinter groups has been changed to 'Group X'. I have been collecting texts from a variety of sources intended for the use of recruiting and radicalizing members for Group X splinter groups for the purpose of researching the motivation and intent of leaders of those groups and their influence over the likelihood of group radicalization. This work included visiting many Group X websites to find information on splinter group leaders and finding their statements to new and old members. This proved difficult because the splinter groups of Group X are united in beliefs, but differ in public opinion. They are eager to tear each other down, prove their superiority, and yet remain anonymous. After a few weeks of intense searching, a list of eight recruiting texts and eight radicalizing texts from a variety of Group X leaders were compiled.

  1. Genomic Diversity of Lactobacillus salivarius▿ †

    Science.gov (United States)

    Raftis, Emma J.; Salvetti, Elisa; Torriani, Sandra; Felis, Giovanna E.; O'Toole, Paul W.

    2011-01-01

    Strains of Lactobacillus salivarius are increasingly employed as probiotic agents for humans or animals. Despite the diversity of environmental sources from which they have been isolated, the genomic diversity of L. salivarius has been poorly characterized, and the implications of this diversity for strain selection have not been examined. To tackle this, we applied comparative genomic hybridization (CGH) and multilocus sequence typing (MLST) to 33 strains derived from humans, animals, or food. The CGH, based on total genome content, including small plasmids, identified 18 major regions of genomic variation, or hot spots for variation. Three major divisions were thus identified, with only a subset of the human isolates constituting an ecologically discernible group. Omission of the small plasmids from the CGH or analysis by MLST provided broadly concordant fine divisions and separated human-derived and animal-derived strains more clearly. The two gene clusters for exopolysaccharide (EPS) biosynthesis corresponded to regions of significant genomic diversity. The CGH-based groupings of these regions did not correlate with levels of production of bound or released EPS. Furthermore, EPS production was significantly modulated by available carbohydrate. In addition to proving difficult to predict from the gene content, EPS production levels correlated inversely with production of biofilms, a trait considered desirable in probiotic commensals. L. salivarius displays a high level of genomic diversity, and while selection of L. salivarius strains for probiotic use can be informed by CGH or MLST, it also requires pragmatic experimental validation of desired phenotypic traits. PMID:21131523

  2. Group Flow and Group Genius

    Science.gov (United States)

    Sawyer, Keith

    2015-01-01

    Keith Sawyer views the spontaneous collaboration of group creativity and improvisation actions as "group flow," which organizations can use to function at optimum levels. Sawyer establishes ideal conditions for group flow: group goals, close listening, complete concentration, being in control, blending egos, equal participation, knowing…

  3. Genomic evolution of 11 type strains within family Planctomycetaceae.

    Directory of Open Access Journals (Sweden)

    Min Guo

    Full Text Available The species in family Planctomycetaceae are ideal groups for investigating the origin of eukaryotes. Their cells are divided by a lipidic intracytoplasmic membrane and they share a number of eukaryote-like molecular characteristics. However, their genomic structures, potential abilities, and evolutionary status are still unknown. In this study, we searched for common protein families and a core genome/pan genome based on 11 sequenced species in family Planctomycetaceae. Then, we constructed phylogenetic tree based on their 832 common protein families. We also annotated the 11 genomes using the Clusters of Orthologous Groups database. Moreover, we predicted and reconstructed their core/pan metabolic pathways using the KEGG (Kyoto Encyclopedia of Genes and Genomes orthology system. Subsequently, we identified genomic islands (GIs and structural variations (SVs among the five complete genomes and we specifically investigated the integration of two Planctomycetaceae plasmids in all 11 genomes. The results indicate that Planctomycetaceae species share diverse genomic variations and unique genomic characteristics, as well as have huge potential for human applications.

  4. Newly discovered young CORE-SINEs in marsupial genomes.

    Science.gov (United States)

    Munemasa, Maruo; Nikaido, Masato; Nishihara, Hidenori; Donnellan, Stephen; Austin, Christopher C; Okada, Norihiro

    2008-01-15

    Although recent mammalian genome projects have uncovered a large part of genomic component of various groups, several repetitive sequences still remain to be characterized and classified for particular groups. The short interspersed repetitive elements (SINEs) distributed among marsupial genomes are one example. We have identified and characterized two new SINEs from marsupial genomes that belong to the CORE-SINE family, characterized by a highly conserved "CORE" domain. PCR and genomic dot blot analyses revealed that the distribution of each SINE shows distinct patterns among the marsupial genomes, implying different timing of their retroposition during the evolution of marsupials. The members of Mar3 (Marsupialia 3) SINE are distributed throughout the genomes of all marsupials, whereas the Mac1 (Macropodoidea 1) SINE is distributed specifically in the genomes of kangaroos. Sequence alignment of the Mar3 SINEs revealed that they can be further divided into four subgroups, each of which has diagnostic nucleotides. The insertion patterns of each SINE at particular genomic loci, together with the distribution patterns of each SINE, suggest that the Mar3 SINEs have intensively amplified after the radiation of diprotodontians, whereas the Mac1 SINE has amplified only slightly after the divergence of hypsiprimnodons from other macropods. By compiling the information of CORE-SINEs characterized to date, we propose a comprehensive picture of how SINE evolution occurred in the genomes of marsupials.

  5. Correction: Studholme et al., Draft Genome Sequences of Xanthomonas sacchari and Two Banana-Associated Xanthomonads Reveal Insights into the Xanthomonas Group 1 clade. Genes 2011, 2, 1050–1065.

    Directory of Open Access Journals (Sweden)

    Murray Grant

    2012-01-01

    Full Text Available Following publication of our article [1], we found errors in analyses performed by the corresponding author (DJS related to the phylogenetic relationship between Xylella species and the other xanthomonads. These errors do not make any difference to the main findings and conclusions reported in our paper. For example, the phylogenetic positions of NCPPB1131, NCPPB1132 and NCPPB4393 within the Group 1 Xanthomonas species are unaffected. However, we wish to apologize to the authors of a previous work [2] for creating any negative impression on the quality of their phylogenetic analyses and to take this opportunity to rectify the errors. [...

  6. Permutation groups

    CERN Document Server

    Passman, Donald S

    2012-01-01

    This volume by a prominent authority on permutation groups consists of lecture notes that provide a self-contained account of distinct classification theorems. A ready source of frequently quoted but usually inaccessible theorems, it is ideally suited for professional group theorists as well as students with a solid background in modern algebra.The three-part treatment begins with an introductory chapter and advances to an economical development of the tools of basic group theory, including group extensions, transfer theorems, and group representations and characters. The final chapter feature

  7. Genomic alterations detected by comparative genomic hybridization in ovarian endometriomas

    Directory of Open Access Journals (Sweden)

    L.C. Veiga-Castelli

    2010-08-01

    Full Text Available Endometriosis is a complex and multifactorial disease. Chromosomal imbalance screening in endometriotic tissue can be used to detect hot-spot regions in the search for a possible genetic marker for endometriosis. The objective of the present study was to detect chromosomal imbalances by comparative genomic hybridization (CGH in ectopic tissue samples from ovarian endometriomas and eutopic tissue from the same patients. We evaluated 10 ovarian endometriotic tissues and 10 eutopic endometrial tissues by metaphase CGH. CGH was prepared with normal and test DNA enzymatically digested, ligated to adaptors and amplified by PCR. A second PCR was performed for DNA labeling. Equal amounts of both normal and test-labeled DNA were hybridized in human normal metaphases. The Isis FISH Imaging System V 5.0 software was used for chromosome analysis. In both eutopic and ectopic groups, 4/10 samples presented chromosomal alterations, mainly chromosomal gains. CGH identified 11q12.3-q13.1, 17p11.1-p12, 17q25.3-qter, and 19p as critical regions. Genomic imbalances in 11q, 17p, 17q, and 19p were detected in normal eutopic and/or ectopic endometrium from women with ovarian endometriosis. These regions contain genes such as POLR2G, MXRA7 and UBA52 involved in biological processes that may lead to the establishment and maintenance of endometriotic implants. This genomic imbalance may affect genes in which dysregulation impacts both eutopic and ectopic endometrium.

  8. Computational genomics of hyperthermophiles

    NARCIS (Netherlands)

    Werken, van de H.J.G.

    2008-01-01

    With the ever increasing number of completely sequenced prokaryotic genomes and the subsequent use of functional genomics tools, e.g. DNA microarray and proteomics, computational data analysis and the integration of microbial and molecular data is inevitable. This thesis describes the computational

  9. Safeguarding genome integrity

    DEFF Research Database (Denmark)

    Sørensen, Claus Storgaard; Syljuåsen, Randi G

    2012-01-01

    Mechanisms that preserve genome integrity are highly important during the normal life cycle of human cells. Loss of genome protective mechanisms can lead to the development of diseases such as cancer. Checkpoint kinases function in the cellular surveillance pathways that help cells to cope with D...

  10. Human genome I

    International Nuclear Information System (INIS)

    Anon.

    1989-01-01

    An international conference, Human Genome I, was held Oct. 2-4, 1989 in San Diego, Calif. Selected speakers discussed: Current Status of the Genome Project; Technique Innovations; Interesting regions; Applications; and Organization - Different Views of Current and Future Science and Procedures. Posters, consisting of 119 presentations, were displayed during the sessions. 119 were indexed for inclusion to the Energy Data Base

  11. Genomic and Genetic Diversity within the Pseudomonas fluorescens Complex.

    Directory of Open Access Journals (Sweden)

    Daniel Garrido-Sanz

    Full Text Available The Pseudomonas fluorescens complex includes Pseudomonas strains that have been taxonomically assigned to more than fifty different species, many of which have been described as plant growth-promoting rhizobacteria (PGPR with potential applications in biocontrol and biofertilization. So far the phylogeny of this complex has been analyzed according to phenotypic traits, 16S rDNA, MLSA and inferred by whole-genome analysis. However, since most of the type strains have not been fully sequenced and new species are frequently described, correlation between taxonomy and phylogenomic analysis is missing. In recent years, the genomes of a large number of strains have been sequenced, showing important genomic heterogeneity and providing information suitable for genomic studies that are important to understand the genomic and genetic diversity shown by strains of this complex. Based on MLSA and several whole-genome sequence-based analyses of 93 sequenced strains, we have divided the P. fluorescens complex into eight phylogenomic groups that agree with previous works based on type strains. Digital DDH (dDDH identified 69 species and 75 subspecies within the 93 genomes. The eight groups corresponded to clustering with a threshold of 31.8% dDDH, in full agreement with our MLSA. The Average Nucleotide Identity (ANI approach showed inconsistencies regarding the assignment to species and to the eight groups. The small core genome of 1,334 CDSs and the large pan-genome of 30,848 CDSs, show the large diversity and genetic heterogeneity of the P. fluorescens complex. However, a low number of strains were enough to explain most of the CDSs diversity at core and strain-specific genomic fractions. Finally, the identification and analysis of group-specific genome and the screening for distinctive characters revealed a phylogenomic distribution of traits among the groups that provided insights into biocontrol and bioremediation applications as well as their role as

  12. Rumen microbial genomics

    International Nuclear Information System (INIS)

    Morrison, M.; Nelson, K.E.

    2005-01-01

    Improving microbial degradation of plant cell wall polysaccharides remains one of the highest priority goals for all livestock enterprises, including the cattle herds and draught animals of developing countries. The North American Consortium for Genomics of Fibrolytic Ruminal Bacteria was created to promote the sequencing and comparative analysis of rumen microbial genomes, offering the potential to fully assess the genetic potential in a functional and comparative fashion. It has been found that the Fibrobacter succinogenes genome encodes many more endoglucanases and cellodextrinases than previously isolated, and several new processive endoglucanases have been identified by genome and proteomic analysis of Ruminococcus albus, in addition to a variety of strategies for its adhesion to fibre. The ramifications of acquiring genome sequence data for rumen microorganisms are profound, including the potential to elucidate and overcome the biochemical, ecological or physiological processes that are rate limiting for ruminal fibre degradation. (author)

  13. Microbial Genomes Multiply

    Science.gov (United States)

    Doolittle, Russell F.

    2002-01-01

    The publication of the first complete sequence of a bacterial genome in 1995 was a signal event, underscored by the fact that the article has been cited more than 2,100 times during the intervening seven years. It was a marvelous technical achievement, made possible by automatic DNA-sequencing machines. The feat is the more impressive in that complete genome sequencing has now been adopted in many different laboratories around the world. Four years ago in these columns I examined the situation after a dozen microbial genomes had been completed. Now, with upwards of 60 microbial genome sequences determined and twice that many in progress, it seems reasonable to assess just what is being learned. Are new concepts emerging about how cells work? Have there been practical benefits in the fields of medicine and agriculture? Is it feasible to determine the genomic sequence of every bacterial species on Earth? The answers to these questions maybe Yes, Perhaps, and No, respectively.

  14. The genome editing revolution

    DEFF Research Database (Denmark)

    Stella, Stefano; Montoya, Guillermo

    2016-01-01

    -Cas system has become the main tool for genome editing in many laboratories. Currently the targeted genome editing technology has been used in many fields and may be a possible approach for human gene therapy. Furthermore, it can also be used to modifying the genomes of model organisms for studying human......In the last 10 years, we have witnessed a blooming of targeted genome editing systems and applications. The area was revolutionized by the discovery and characterization of the transcription activator-like effector proteins, which are easier to engineer to target new DNA sequences than...... sequence). This ribonucleoprotein complex protects bacteria from invading DNAs, and it was adapted to be used in genome editing. The CRISPR ribonucleic acid (RNA) molecule guides to the specific DNA site the Cas9 nuclease to cleave the DNA target. Two years and more than 1000 publications later, the CRISPR...

  15. Group devaluation and group identification

    NARCIS (Netherlands)

    Leach, C.W.; Rodriguez Mosquera, P.M.; Vliek, M.L.W.; Hirt, E.

    2010-01-01

    In three studies, we showed that increased in-group identification after (perceived or actual) group devaluation is an assertion of a (preexisting) positive social identity that counters the negative social identity implied in societal devaluation. Two studies with real-world groups used order

  16. Lie groups and algebraic groups

    Indian Academy of Sciences (India)

    We give an exposition of certain topics in Lie groups and algebraic groups. This is not a complete ... of a polynomial equation is equivalent to the solva- bility of the equation ..... to a subgroup of the group of roots of unity in k (in particular, it is a ...

  17. Phytozome Comparative Plant Genomics Portal

    Energy Technology Data Exchange (ETDEWEB)

    Goodstein, David; Batra, Sajeev; Carlson, Joseph; Hayes, Richard; Phillips, Jeremy; Shu, Shengqiang; Schmutz, Jeremy; Rokhsar, Daniel

    2014-09-09

    The Dept. of Energy Joint Genome Institute is a genomics user facility supporting DOE mission science in the areas of Bioenergy, Carbon Cycling, and Biogeochemistry. The Plant Program at the JGI applies genomic, analytical, computational and informatics platforms and methods to: 1. Understand and accelerate the improvement (domestication) of bioenergy crops 2. Characterize and moderate plant response to climate change 3. Use comparative genomics to identify constrained elements and infer gene function 4. Build high quality genomic resource platforms of JGI Plant Flagship genomes for functional and experimental work 5. Expand functional genomic resources for Plant Flagship genomes

  18. Endogenous viral elements in animal genomes.

    Directory of Open Access Journals (Sweden)

    Aris Katzourakis

    2010-11-01

    Full Text Available Integration into the nuclear genome of germ line cells can lead to vertical inheritance of retroviral genes as host alleles. For other viruses, germ line integration has only rarely been documented. Nonetheless, we identified endogenous viral elements (EVEs derived from ten non-retroviral families by systematic in silico screening of animal genomes, including the first endogenous representatives of double-stranded RNA, reverse-transcribing DNA, and segmented RNA viruses, and the first endogenous DNA viruses in mammalian genomes. Phylogenetic and genomic analysis of EVEs across multiple host species revealed novel information about the origin and evolution of diverse virus groups. Furthermore, several of the elements identified here encode intact open reading frames or are expressed as mRNA. For one element in the primate lineage, we provide statistically robust evidence for exaptation. Our findings establish that genetic material derived from all known viral genome types and replication strategies can enter the animal germ line, greatly broadening the scope of paleovirological studies and indicating a more significant evolutionary role for gene flow from virus to animal genomes than has previously been recognized.

  19. Figure 2 from Integrative Genomics Viewer: Visualizing Big Data | Office of Cancer Genomics

    Science.gov (United States)

    Grouping and sorting genomic data in IGV. The IGV user interface displaying 202 glioblastoma samples from TCGA. Samples are grouped by tumor subtype (second annotation column) and data type (first annotation column) and sorted by copy number of the EGFR locus (middle column). Adapted from Figure 1; Robinson et al. 2011

  20. National human genome projects: an update and an agenda.

    Science.gov (United States)

    An, Joon Yong

    2017-01-01

    Population genetic and human genetic studies are being accelerated with genome technology and data sharing. Accordingly, in the past 10 years, several countries have initiated genetic research using genome technology and identified the genetic architecture of the ethnic groups living in the corresponding country or suggested the genetic foundation of a social phenomenon. Genetic research has been conducted from epidemiological studies that previously described the health or disease conditions in defined population. This perspective summarizes national genome projects conducted in the past 10 years and introduces case studies to utilize genomic data in genetic research.

  1. Genome-derived vaccines.

    Science.gov (United States)

    De Groot, Anne S; Rappuoli, Rino

    2004-02-01

    Vaccine research entered a new era when the complete genome of a pathogenic bacterium was published in 1995. Since then, more than 97 bacterial pathogens have been sequenced and at least 110 additional projects are now in progress. Genome sequencing has also dramatically accelerated: high-throughput facilities can draft the sequence of an entire microbe (two to four megabases) in 1 to 2 days. Vaccine developers are using microarrays, immunoinformatics, proteomics and high-throughput immunology assays to reduce the truly unmanageable volume of information available in genome databases to a manageable size. Vaccines composed by novel antigens discovered from genome mining are already in clinical trials. Within 5 years we can expect to see a novel class of vaccines composed by genome-predicted, assembled and engineered T- and Bcell epitopes. This article addresses the convergence of three forces--microbial genome sequencing, computational immunology and new vaccine technologies--that are shifting genome mining for vaccines onto the forefront of immunology research.

  2. The Banana Genome Hub

    Science.gov (United States)

    Droc, Gaëtan; Larivière, Delphine; Guignon, Valentin; Yahiaoui, Nabila; This, Dominique; Garsmeur, Olivier; Dereeper, Alexis; Hamelin, Chantal; Argout, Xavier; Dufayard, Jean-François; Lengelle, Juliette; Baurens, Franc-Christophe; Cenci, Alberto; Pitollat, Bertrand; D’Hont, Angélique; Ruiz, Manuel; Rouard, Mathieu; Bocs, Stéphanie

    2013-01-01

    Banana is one of the world’s favorite fruits and one of the most important crops for developing countries. The banana reference genome sequence (Musa acuminata) was recently released. Given the taxonomic position of Musa, the completed genomic sequence has particular comparative value to provide fresh insights about the evolution of the monocotyledons. The study of the banana genome has been enhanced by a number of tools and resources that allows harnessing its sequence. First, we set up essential tools such as a Community Annotation System, phylogenomics resources and metabolic pathways. Then, to support post-genomic efforts, we improved banana existing systems (e.g. web front end, query builder), we integrated available Musa data into generic systems (e.g. markers and genetic maps, synteny blocks), we have made interoperable with the banana hub, other existing systems containing Musa data (e.g. transcriptomics, rice reference genome, workflow manager) and finally, we generated new results from sequence analyses (e.g. SNP and polymorphism analysis). Several uses cases illustrate how the Banana Genome Hub can be used to study gene families. Overall, with this collaborative effort, we discuss the importance of the interoperability toward data integration between existing information systems. Database URL: http://banana-genome.cirad.fr/ PMID:23707967

  3. Genomic instability following irradiation

    International Nuclear Information System (INIS)

    Hacker-Klom, U.B.; Goehde, W.

    2001-01-01

    Ionising irradiation may induce genomic instability. The broad spectrum of stress reactions in eukaryontic cells to irradiation complicates the discovery of cellular targets and pathways inducing genomic instability. Irradiation may initiate genomic instability by deletion of genes controlling stability, by induction of genes stimulating instability and/or by activating endogeneous cellular viruses. Alternatively or additionally it is discussed that the initiation of genomic instability may be a consequence of radiation or other agents independently of DNA damage implying non nuclear targets, e.g. signal cascades. As a further mechanism possibly involved our own results may suggest radiation-induced changes in chromatin structure. Once initiated the process of genomic instability probably is perpetuated by endogeneous processes necessary for proliferation. Genomic instability may be a cause or a consequence of the neoplastic phenotype. As a conclusion from the data available up to now a new interpretation of low level radiation effects for radiation protection and in radiotherapy appears useful. The detection of the molecular mechanisms of genomic instability will be important in this context and may contribute to a better understanding of phenomenons occurring at low doses <10 cSv which are not well understood up to now. (orig.)

  4. Group Work

    Science.gov (United States)

    Wilson, Kristy J.; Brickman, Peggy; Brame, Cynthia J.

    2018-01-01

    Science, technology, engineering, and mathematics faculty are increasingly incorporating both formal and informal group work in their courses. Implementing group work can be improved by an understanding of the extensive body of educational research studies on this topic. This essay describes an online, evidence-based teaching guide published by…

  5. Reflection groups

    International Nuclear Information System (INIS)

    Eggermont, G.

    2006-01-01

    In 2005, PISA organised proactive meetings of reflection groups on involvement in decision making, expert culture and ethical aspects of radiation protection.All reflection group meetings address particular targeted audiences while the output publication in book form is put forward

  6. Genomic diversity within the haloalkaliphilic genus Thioalkalivibrio.

    Science.gov (United States)

    Ahn, Anne-Catherine; Meier-Kolthoff, Jan P; Overmars, Lex; Richter, Michael; Woyke, Tanja; Sorokin, Dimitry Y; Muyzer, Gerard

    2017-01-01

    Thioalkalivibrio is a genus of obligate chemolithoautotrophic haloalkaliphilic sulfur-oxidizing bacteria. Their habitat are soda lakes which are dual extreme environments with a pH range from 9.5 to 11 and salt concentrations up to saturation. More than 100 strains of this genus have been isolated from various soda lakes all over the world, but only ten species have been effectively described yet. Therefore, the assignment of the remaining strains to either existing or novel species is important and will further elucidate their genomic diversity as well as give a better general understanding of this genus. Recently, the genomes of 76 Thioalkalivibrio strains were sequenced. On these, we applied different methods including (i) 16S rRNA gene sequence analysis, (ii) Multilocus Sequence Analysis (MLSA) based on eight housekeeping genes, (iii) Average Nucleotide Identity based on BLAST (ANIb) and MUMmer (ANIm), (iv) Tetranucleotide frequency correlation coefficients (TETRA), (v) digital DNA:DNA hybridization (dDDH) as well as (vi) nucleotide- and amino acid-based Genome BLAST Distance Phylogeny (GBDP) analyses. We detected a high genomic diversity by revealing 15 new "genomic" species and 16 new "genomic" subspecies in addition to the ten already described species. Phylogenetic and phylogenomic analyses showed that the genus is not monophyletic, because four strains were clearly separated from the other Thioalkalivibrio by type strains from other genera. Therefore, it is recommended to classify the latter group as a novel genus. The biogeographic distribution of Thioalkalivibrio suggested that the different "genomic" species can be classified as candidate disjunct or candidate endemic species. This study is a detailed genome-based classification and identification of members within the genus Thioalkalivibrio. However, future phenotypical and chemotaxonomical studies will be needed for a full species description of this genus.

  7. Traditional medicine and genomics

    Directory of Open Access Journals (Sweden)

    Kalpana Joshi

    2010-01-01

    Full Text Available ′Omics′ developments in the form of genomics, proteomics and metabolomics have increased the impetus of traditional medicine research. Studies exploring the genomic, proteomic and metabolomic basis of human constitutional types based on Ayurveda and other systems of oriental medicine are becoming popular. Such studies remain important to developing better understanding of human variations and individual differences. Countries like India, Korea, China and Japan are investing in research on evidence-based traditional medicines and scientific validation of fundamental principles. This review provides an account of studies addressing relationships between traditional medicine and genomics.

  8. Traditional medicine and genomics.

    Science.gov (United States)

    Joshi, Kalpana; Ghodke, Yogita; Shintre, Pooja

    2010-01-01

    'Omics' developments in the form of genomics, proteomics and metabolomics have increased the impetus of traditional medicine research. Studies exploring the genomic, proteomic and metabolomic basis of human constitutional types based on Ayurveda and other systems of oriental medicine are becoming popular. Such studies remain important to developing better understanding of human variations and individual differences. Countries like India, Korea, China and Japan are investing in research on evidence-based traditional medicines and scientific validation of fundamental principles. This review provides an account of studies addressing relationships between traditional medicine and genomics.

  9. Bacillus subtilis genome diversity.

    Science.gov (United States)

    Earl, Ashlee M; Losick, Richard; Kolter, Roberto

    2007-02-01

    Microarray-based comparative genomic hybridization (M-CGH) is a powerful method for rapidly identifying regions of genome diversity among closely related organisms. We used M-CGH to examine the genome diversity of 17 strains belonging to the nonpathogenic species Bacillus subtilis. Our M-CGH results indicate that there is considerable genetic heterogeneity among members of this species; nearly one-third of Bsu168-specific genes exhibited variability, as measured by the microarray hybridization intensities. The variable loci include those encoding proteins involved in antibiotic production, cell wall synthesis, sporulation, and germination. The diversity in these genes may reflect this organism's ability to survive in diverse natural settings.

  10. Human Genome Project

    Energy Technology Data Exchange (ETDEWEB)

    Block, S. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Cornwall, J. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Dally, W. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Dyson, F. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Fortson, N. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Joyce, G. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Kimble, H. J. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Lewis, N. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Max, C. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Prince, T. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Schwitters, R. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Weinberger, P. [The MITRE Corporation, McLean, VA (US). JASON Program Office; Woodin, W. H. [The MITRE Corporation, McLean, VA (US). JASON Program Office

    1998-01-04

    The study reviews Department of Energy supported aspects of the United States Human Genome Project, the joint National Institutes of Health/Department of Energy program to characterize all human genetic material, to discover the set of human genes, and to render them accessible for further biological study. The study concentrates on issues of technology, quality assurance/control, and informatics relevant to current effort on the genome project and needs beyond it. Recommendations are presented on areas of the genome program that are of particular interest to and supported by the Department of Energy.

  11. Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1993-01-01

    The DOE Human Genome program has grown tremendously, as shown by the marked increase in the number of genome-funded projects since the last workshop held in 1991. The abstracts in this book describe the genome research of DOE-funded grantees and contractors and invited guests, and all projects are represented at the workshop by posters. The 3-day meeting includes plenary sessions on ethical, legal, and social issues pertaining to the availability of genetic data; sequencing techniques, informatics support; and chromosome and cDNA mapping and sequencing.

  12. Genomic signal processing

    CERN Document Server

    Shmulevich, Ilya

    2007-01-01

    Genomic signal processing (GSP) can be defined as the analysis, processing, and use of genomic signals to gain biological knowledge, and the translation of that knowledge into systems-based applications that can be used to diagnose and treat genetic diseases. Situated at the crossroads of engineering, biology, mathematics, statistics, and computer science, GSP requires the development of both nonlinear dynamical models that adequately represent genomic regulation, and diagnostic and therapeutic tools based on these models. This book facilitates these developments by providing rigorous mathema

  13. Barcode server: a visualization-based genome analysis system.

    Directory of Open Access Journals (Sweden)

    Fenglou Mao

    Full Text Available We have previously developed a computational method for representing a genome as a barcode image, which makes various genomic features visually apparent. We have demonstrated that this visual capability has made some challenging genome analysis problems relatively easy to solve. We have applied this capability to a number of challenging problems, including (a identification of horizontally transferred genes, (b identification of genomic islands with special properties and (c binning of metagenomic sequences, and achieved highly encouraging results. These application results inspired us to develop this barcode-based genome analysis server for public service, which supports the following capabilities: (a calculation of the k-mer based barcode image for a provided DNA sequence; (b detection of sequence fragments in a given genome with distinct barcodes from those of the majority of the genome, (c clustering of provided DNA sequences into groups having similar barcodes; and (d homology-based search using Blast against a genome database for any selected genomic regions deemed to have interesting barcodes. The barcode server provides a job management capability, allowing processing of a large number of analysis jobs for barcode-based comparative genome analyses. The barcode server is accessible at http://csbl1.bmb.uga.edu/Barcode.

  14. A Snapshot of the Emerging Tomato Genome Sequence

    Directory of Open Access Journals (Sweden)

    Lukas A. Mueller

    2009-03-01

    Full Text Available The genome of tomato ( L. is being sequenced by an international consortium of 10 countries (Korea, China, the United Kingdom, India, the Netherlands, France, Japan, Spain, Italy, and the United States as part of the larger “International Solanaceae Genome Project (SOL: Systems Approach to Diversity and Adaptation” initiative. The tomato genome sequencing project uses an ordered bacterial artificial chromosome (BAC approach to generate a high-quality tomato euchromatic genome sequence for use as a reference genome for the Solanaceae and euasterids. Sequence is deposited at GenBank and at the SOL Genomics Network (SGN. Currently, there are around 1000 BACs finished or in progress, representing more than a third of the projected euchromatic portion of the genome. An annotation effort is also underway by the International Tomato Annotation Group. The expected number of genes in the euchromatin is ∼40,000, based on an estimate from a preliminary annotation of 11% of finished sequence. Here, we present this first snapshot of the emerging tomato genome and its annotation, a short comparison with potato ( L. sequence data, and the tools available for the researchers to exploit this new resource are also presented. In the future, whole-genome shotgun techniques will be combined with the BAC-by-BAC approach to cover the entire tomato genome. The high-quality reference euchromatic tomato sequence is expected to be near completion by 2010.

  15. Genomics education for medical professionals - the current UK landscape.

    Science.gov (United States)

    Slade, Ingrid; Subramanian, Deepak N; Burton, Hilary

    2016-08-01

    Genomics education in the UK is at an early stage of development, and its pace of evolution has lagged behind that of the genomics research upon which it is based. As a result, knowledge of genomics and its applications remains limited among non-specialist clinicians. In this review article, we describe the complex landscape for genomics education within the UK, and highlight the large number and variety of organisations that can influence, direct and provide genomics training to medical professionals. Postgraduate genomics education is being shaped by the work of the Health Education England (HEE) Genomics Education Programme, working in conjunction with the Joint Committee on Genomics in Medicine. The success of their work will be greatly enhanced by the full cooperation and engagement of the many groups, societies and organisations involved with medical education and training (such as the royal colleges). Without this cooperation, there is a risk of poor coordination and unnecessary duplication of work. Leadership from an organisation such as the HEE Genomics Education Programme will have a key role in guiding the formulation and delivery of genomics education policy by various stakeholders among the different disciplines in medicine. © 2016 Royal College of Physicians.

  16. The amphioxus genome and the evolution of the chordate karyotype

    Energy Technology Data Exchange (ETDEWEB)

    Putnam, Nicholas H.; Butts, Thomas; Ferrier, David E.K.; Furlong, Rebecca F.; Hellsten, Uffe; Kawashima, Takeshi; Robinson-Rechavi, Marc; Shoguchi, Eiichi; Terry, Astrid; Yu, Jr-Kai; Benito-Gutierrez, Elia; Dubchak, Inna; Garcia-Fernandez, Jordi; Gibson-Brown, Jeremy J.; Grigoriev, Igor V.; Horton, Amy C.; de Jong, Pieter J.; Jurka, Jerzy; Kapitonov, Vladimir; Kohara, Yuji; Kuroki, Yoko; Lindquist, Erika; Lucas, Susan; Osoegawa, Kazutoyo; Pennacchio, Len A.; Salamov, Asaf A.; Satou, Yutaka; Sauka-Spengler, Tatjana; Schmutz[, Jeremy; Shin-I, Tadasu; Toyoda, Atsushi; Bronner-Fraser, Marianne; Fujiyama, Asao; Holland, Linda Z.; Holland, Peter W. H.; Satoh, Nori; Rokhsar, Daniel S.

    2008-04-01

    Lancelets ('amphioxus') are the modern survivors of an ancient chordate lineage with a fossil record dating back to the Cambrian. We describe the structure and gene content of the highly polymorphic {approx}520 million base pair genome of the Florida lancelet Branchiostoma floridae, and analyze it in the context of chordate evolution. Whole genome comparisons illuminate the murky relationships among the three chordate groups (tunicates, lancelets, and vertebrates), and allow reconstruction of not only the gene complement of the last common chordate ancestor, but also a partial reconstruction of its genomic organization, as well as a description of two genome-wide duplications and subsequent reorganizations in the vertebrate lineage. These genome-scale events shaped the vertebrate genome and provided additional genetic variation for exploitation during vertebrate evolution.

  17. Genomic Organization of Zebrafish microRNAs

    Directory of Open Access Journals (Sweden)

    Paydar Ima

    2008-05-01

    Full Text Available Abstract Background microRNAs (miRNAs are small (~22 nt non-coding RNAs that regulate cell movement, specification, and development. Expression of miRNAs is highly regulated, both spatially and temporally. Based on direct cloning, sequence conservation, and predicted secondary structures, a large number of miRNAs have been identified in higher eukaryotic genomes but whether these RNAs are simply a subset of a much larger number of noncoding RNA families is unknown. This is especially true in zebrafish where genome sequencing and annotation is not yet complete. Results We analyzed the zebrafish genome to identify the number and location of proven and predicted miRNAs resulting in the identification of 35 new miRNAs. We then grouped all 415 zebrafish miRNAs into families based on seed sequence identity as a means to identify possible functional redundancy. Based on genomic location and expression analysis, we also identified those miRNAs that are likely to be encoded as part of polycistronic transcripts. Lastly, as a resource, we compiled existing zebrafish miRNA expression data and, where possible, listed all experimentally proven mRNA targets. Conclusion Current analysis indicates the zebrafish genome encodes 415 miRNAs which can be grouped into 44 families. The largest of these families (the miR-430 family contains 72 members largely clustered in two main locations along chromosome 4. Thus far, most zebrafish miRNAs exhibit tissue specific patterns of expression.

  18. Genome shuffling of Saccharomyces cerevisiae through recursive population mating to evolve tolerance to inhibitors of Spent Sulfite Liquor

    Energy Technology Data Exchange (ETDEWEB)

    Martin, V.J.J.; Pinel, D.J.; D' aoust, F. [Concordia Univ., Montreal, PQ (Canada). Dept. of Biological Sciences; Bajwa, P.K.; Trevors, J.T.; Lee, H. [Guelph Univ., ON (Canada). Dept. of Environmental Biology

    2009-07-01

    The biochemical steps in the conversion of cellulosics to biofuels include the pretreatment, hydrolysis and fermentation of substrates into a final product. Fermentation of lignocellulosic substrates derived from waste biomass requires metabolic engineering. A biochemical flow chart from the Tembec Biorefinery plant was presented in which Spent Sulfite Liquor (SSL) was used to add value to the pulp and paper industry. The sugars contained in this carbohydrate-rich effluent from sulfite pulping were used to produce ethanol. A robust, ethanologenic microorganism that can withstand the substrate toxicity was needed. Saccharomyces cerevisiae is currently used for the production of ethanol from SSL. This yeast will succumb to toxicity and inhibition, particularly in the most inhibitor rich forms of SSL such as hardwood SSL (HWSSL). A genome shuffling method was therefore developed to create a better SSL fermenting strain. This method was designed to improve polygenic traits by generating pools of mutants with improved phenotypes, followed by iterative recombination between their genomes. Through 5 rounds of recursive mating and screening, 3 strains that could survive and grow in undiluted HWSSL were obtained. The study demonstrated that the tolerance of these strains to SSL translates into an increased capacity to produce ethanol over time using this substrate, due to continued viability of the yeast population. Phenotypic analysis of the three strains revealed that the genome shuffling approach successfully co-evolved tolerance to acetic acid, NaCl (osmotic) and HMF. A systems biology analysis of strain R57 was initiated in order to establish the genetic basis for HWSSL tolerance. tabs., figs.

  19. Group theory

    CERN Document Server

    Scott, W R

    2010-01-01

    Here is a clear, well-organized coverage of the most standard theorems, including isomorphism theorems, transformations and subgroups, direct sums, abelian groups, and more. This undergraduate-level text features more than 500 exercises.

  20. Group Grammar

    Science.gov (United States)

    Adams, Karen

    2015-01-01

    In this article Karen Adams demonstrates how to incorporate group grammar techniques into a classroom activity. In the activity, students practice using the target grammar to do something they naturally enjoy: learning about each other.

  1. Computer group

    International Nuclear Information System (INIS)

    Bauer, H.; Black, I.; Heusler, A.; Hoeptner, G.; Krafft, F.; Lang, R.; Moellenkamp, R.; Mueller, W.; Mueller, W.F.; Schati, C.; Schmidt, A.; Schwind, D.; Weber, G.

    1983-01-01

    The computer groups has been reorganized to take charge for the general purpose computers DEC10 and VAX and the computer network (Dataswitch, DECnet, IBM - connections to GSI and IPP, preparation for Datex-P). (orig.)

  2. Group learning

    DEFF Research Database (Denmark)

    Pimentel, Ricardo; Noguira, Eloy Eros da Silva; Elkjær, Bente

    The article presents a study that aims at the apprehension of the group learning in a top management team composed by teachers in a Brazilian Waldorf school whose management is collective. After deciding to extend the school, they had problems recruiting teachers who were already trained based...... on the Steiner´s ideas, which created practical problems for conducting management activities. The research seeks to understand how that group of teachers collectively manage the school, facing the lack of resources, a significant heterogeneity in the relationships, and the conflicts and contradictions......, and they are interrelated to the group learning as the construction, maintenance and reconstruction of the intelligibility of practices. From this perspective, it can be said that learning is a practice and not an exceptional phenomenon. Building, maintaining and rebuilding the intelligibility is the group learning...

  3. Comparative analysis of the mitochondrial genomes in gastropods

    International Nuclear Information System (INIS)

    Arquez, Moises; Uribe, Juan Esteban; Castro, Lyda Raquel

    2012-01-01

    In this work we presented a comparative analysis of the mitochondrial genomes in gastropods. Nucleotide and amino acids composition was calculated and a comparative visual analysis of the start and termination codons was performed. The organization of the genome was compared calculating the number of intergenic sequences, the location of the genes and the number of reorganized genes (breakpoints) in comparison with the sequence that is presumed to be ancestral for the group. In order to calculate variations in the rates of molecular evolution within the group, the relative rate test was performed. In spite of the differences in the size of the genomes, the amino acids number is conserved. The nucleotide and amino acid composition is similar between Vetigastropoda, Ceanogastropoda and Neritimorpha in comparison to Heterobranchia and Patellogastropoda. The mitochondrial genomes of the group are very compact with few intergenic sequences, the only exception is the genome of Patellogastropoda with 26,828 bp. Start codons of the Heterobranchia and Patellogastropoda are very variable and there is also an increase in genome rearrangements for these two groups. Generally, the hypothesis of constant rates of molecular evolution between the groups is rejected, except when the genomes of Caenogastropoda and Vetigastropoda are compared.

  4. Group technology

    International Nuclear Information System (INIS)

    Rome, C.P.

    1976-01-01

    Group Technology has been conceptually applied to the manufacture of batch-lots of 554 machined electromechanical parts which now require 79 different types of metal-removal tools. The products have been grouped into 7 distinct families which require from 8 to 22 machines in each machine-cell. Throughput time can be significantly reduced and savings can be realized from tooling, direct-labor, and indirect-labor costs

  5. Lophotrochozoan mitochondrial genomes

    Energy Technology Data Exchange (ETDEWEB)

    Valles, Yvonne; Boore, Jeffrey L.

    2005-10-01

    Progress in both molecular techniques and phylogeneticmethods has challenged many of the interpretations of traditionaltaxonomy. One example is in the recognition of the animal superphylumLophotrochozoa (annelids, mollusks, echiurans, platyhelminthes,brachiopods, and other phyla), although the relationships within thisgroup and the inclusion of some phyla remain uncertain. While much ofthis progress in phylogenetic reconstruction has been based on comparingsingle gene sequences, we are beginning to see the potential of comparinglarge-scale features of genomes, such as the relative order of genes.Even though tremendous progress is being made on the sequencedetermination of whole nuclear genomes, the dataset of choice forgenome-level characters for many animals across a broad taxonomic rangeremains mitochondrial genomes. We review here what is known aboutmitochondrial genomes of the lophotrochozoans and discuss the promisethat this dataset will enable insight into theirrelationships.

  6. Mouse Genome Informatics (MGI)

    Data.gov (United States)

    U.S. Department of Health & Human Services — MGI is the international database resource for the laboratory mouse, providing integrated genetic, genomic, and biological data to facilitate the study of human...

  7. Genomic definition of species

    Energy Technology Data Exchange (ETDEWEB)

    Crkvenjakov, R.; Drmanac, R.

    1991-07-01

    The subject of this paper is the definition of species based on the assumption that genome is the fundamental level for the origin and maintenance of biological diversity. For this view to be logically consistent it is necessary to assume the existence and operation of the new law which we call genome law. For this reason the genome law is included in the explanation of species phenomenon presented here even if its precise formulation and elaboration are left for the future. The intellectual underpinnings of this definition can be traced to Goldschmidt. We wish to explore some philosophical aspects of the definition of species in terms of the genome. The point of proposing the definition on these grounds is that any real advance in evolutionary theory has to be correct in both its philosophy and its science.

  8. Structural genomics in endocrinology

    NARCIS (Netherlands)

    Smit, J. W.; Romijn, J. A.

    2001-01-01

    Traditionally, endocrine research evolved from the phenotypical characterisation of endocrine disorders to the identification of underlying molecular pathophysiology. This approach has been, and still is, extremely successful. The introduction of genomics and proteomics has resulted in a reversal of

  9. Epidemiology & Genomics Research Program

    Science.gov (United States)

    The Epidemiology and Genomics Research Program, in the National Cancer Institute's Division of Cancer Control and Population Sciences, funds research in human populations to understand the determinants of cancer occurrence and outcomes.

  10. Annotating individual human genomes.

    Science.gov (United States)

    Torkamani, Ali; Scott-Van Zeeland, Ashley A; Topol, Eric J; Schork, Nicholas J

    2011-10-01

    Advances in DNA sequencing technologies have made it possible to rapidly, accurately and affordably sequence entire individual human genomes. As impressive as this ability seems, however, it will not likely amount to much if one cannot extract meaningful information from individual sequence data. Annotating variations within individual genomes and providing information about their biological or phenotypic impact will thus be crucially important in moving individual sequencing projects forward, especially in the context of the clinical use of sequence information. In this paper we consider the various ways in which one might annotate individual sequence variations and point out limitations in the available methods for doing so. It is arguable that, in the foreseeable future, DNA sequencing of individual genomes will become routine for clinical, research, forensic, and personal purposes. We therefore also consider directions and areas for further research in annotating genomic variants. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. ANNOTATING INDIVIDUAL HUMAN GENOMES*

    Science.gov (United States)

    Torkamani, Ali; Scott-Van Zeeland, Ashley A.; Topol, Eric J.; Schork, Nicholas J.

    2014-01-01

    Advances in DNA sequencing technologies have made it possible to rapidly, accurately and affordably sequence entire individual human genomes. As impressive as this ability seems, however, it will not likely to amount to much if one cannot extract meaningful information from individual sequence data. Annotating variations within individual genomes and providing information about their biological or phenotypic impact will thus be crucially important in moving individual sequencing projects forward, especially in the context of the clinical use of sequence information. In this paper we consider the various ways in which one might annotate individual sequence variations and point out limitations in the available methods for doing so. It is arguable that, in the foreseeable future, DNA sequencing of individual genomes will become routine for clinical, research, forensic, and personal purposes. We therefore also consider directions and areas for further research in annotating genomic variants. PMID:21839162

  12. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  13. Genetical Genomics for Evolutionary Studies

    NARCIS (Netherlands)

    Prins, J.C.P.; Smant, G.; Jansen, R.C.

    2012-01-01

    Genetical genomics combines acquired high-throughput genomic data with genetic analysis. In this chapter, we discuss the application of genetical genomics for evolutionary studies, where new high-throughput molecular technologies are combined with mapping quantitative trait loci (QTL) on the genome

  14. Lactobacillus paracasei comparative genomics: towards species pan-genome definition and exploitation of diversity.

    Directory of Open Access Journals (Sweden)

    Tamara Smokvina

    Full Text Available Lactobacillus paracasei is a member of the normal human and animal gut microbiota and is used extensively in the food industry in starter cultures for dairy products or as probiotics. With the development of low-cost, high-throughput sequencing techniques it has become feasible to sequence many different strains of one species and to determine its "pan-genome". We have sequenced the genomes of 34 different L. paracasei strains, and performed a comparative genomics analysis. We analysed genome synteny and content, focussing on the pan-genome, core genome and variable genome. Each genome was shown to contain around 2800-3100 protein-coding genes, and comparative analysis identified over 4200 ortholog groups that comprise the pan-genome of this species, of which about 1800 ortholog groups make up the conserved core. Several factors previously associated with host-microbe interactions such as pili, cell-envelope proteinase, hydrolases p40 and p75 or the capacity to produce short branched-chain fatty acids (bkd operon are part of the L. paracasei core genome present in all analysed strains. The variome consists mainly of hypothetical proteins, phages, plasmids, transposon/conjugative elements, and known functions such as sugar metabolism, cell-surface proteins, transporters, CRISPR-associated proteins, and EPS biosynthesis proteins. An enormous variety and variability of sugar utilization gene cassettes were identified, with each strain harbouring between 25-53 cassettes, reflecting the high adaptability of L. paracasei to different niches. A phylogenomic tree was constructed based on total genome contents, and together with an analysis of horizontal gene transfer events we conclude that evolution of these L. paracasei strains is complex and not always related to niche adaptation. The results of this genome content comparison was used, together with high-throughput growth experiments on various carbohydrates, to perform gene-trait matching analysis

  15. Abelian groups

    CERN Document Server

    Fuchs, László

    2015-01-01

    Written by one of the subject’s foremost experts, this book focuses on the central developments and modern methods of the advanced theory of abelian groups, while remaining accessible, as an introduction and reference, to the non-specialist. It provides a coherent source for results scattered throughout the research literature with lots of new proofs. The presentation highlights major trends that have radically changed the modern character of the subject, in particular, the use of homological methods in the structure theory of various classes of abelian groups, and the use of advanced set-theoretical methods in the study of undecidability problems. The treatment of the latter trend includes Shelah’s seminal work on the undecidability in ZFC of Whitehead’s Problem; while the treatment of the former trend includes an extensive (but non-exhaustive) study of p-groups, torsion-free groups, mixed groups, and important classes of groups arising from ring theory. To prepare the reader to tackle these topics, th...

  16. Evolution of genome size and complexity in the rhabdoviridae.

    Directory of Open Access Journals (Sweden)

    Peter J Walker

    2015-02-01

    Full Text Available RNA viruses exhibit substantial structural, ecological and genomic diversity. However, genome size in RNA viruses is likely limited by a high mutation rate, resulting in the evolution of various mechanisms to increase complexity while minimising genome expansion. Here we conduct a large-scale analysis of the genome sequences of 99 animal rhabdoviruses, including 45 genomes which we determined de novo, to identify patterns of genome expansion and the evolution of genome complexity. All but seven of the rhabdoviruses clustered into 17 well-supported monophyletic groups, of which eight corresponded to established genera, seven were assigned as new genera, and two were taxonomically ambiguous. We show that the acquisition and loss of new genes appears to have been a central theme of rhabdovirus evolution, and has been associated with the appearance of alternative, overlapping and consecutive ORFs within the major structural protein genes, and the insertion and loss of additional ORFs in each gene junction in a clade-specific manner. Changes in the lengths of gene junctions accounted for as much as 48.5% of the variation in genome size from the smallest to the largest genome, and the frequency with which new ORFs were observed increased in the 3' to 5' direction along the genome. We also identify several new families of accessory genes encoded in these regions, and show that non-canonical expression strategies involving TURBS-like termination-reinitiation, ribosomal frame-shifts and leaky ribosomal scanning appear to be common. We conclude that rhabdoviruses have an unusual capacity for genomic plasticity that may be linked to their discontinuous transcription strategy from the negative-sense single-stranded RNA genome, and propose a model that accounts for the regular occurrence of genome expansion and contraction throughout the evolution of the Rhabdoviridae.

  17. Evolution of genome size and complexity in the rhabdoviridae.

    Science.gov (United States)

    Walker, Peter J; Firth, Cadhla; Widen, Steven G; Blasdell, Kim R; Guzman, Hilda; Wood, Thomas G; Paradkar, Prasad N; Holmes, Edward C; Tesh, Robert B; Vasilakis, Nikos

    2015-02-01

    RNA viruses exhibit substantial structural, ecological and genomic diversity. However, genome size in RNA viruses is likely limited by a high mutation rate, resulting in the evolution of various mechanisms to increase complexity while minimising genome expansion. Here we conduct a large-scale analysis of the genome sequences of 99 animal rhabdoviruses, including 45 genomes which we determined de novo, to identify patterns of genome expansion and the evolution of genome complexity. All but seven of the rhabdoviruses clustered into 17 well-supported monophyletic groups, of which eight corresponded to established genera, seven were assigned as new genera, and two were taxonomically ambiguous. We show that the acquisition and loss of new genes appears to have been a central theme of rhabdovirus evolution, and has been associated with the appearance of alternative, overlapping and consecutive ORFs within the major structural protein genes, and the insertion and loss of additional ORFs in each gene junction in a clade-specific manner. Changes in the lengths of gene junctions accounted for as much as 48.5% of the variation in genome size from the smallest to the largest genome, and the frequency with which new ORFs were observed increased in the 3' to 5' direction along the genome. We also identify several new families of accessory genes encoded in these regions, and show that non-canonical expression strategies involving TURBS-like termination-reinitiation, ribosomal frame-shifts and leaky ribosomal scanning appear to be common. We conclude that rhabdoviruses have an unusual capacity for genomic plasticity that may be linked to their discontinuous transcription strategy from the negative-sense single-stranded RNA genome, and propose a model that accounts for the regular occurrence of genome expansion and contraction throughout the evolution of the Rhabdoviridae.

  18. Evolution of Genome Size and Complexity in the Rhabdoviridae

    Science.gov (United States)

    Walker, Peter J.; Firth, Cadhla; Widen, Steven G.; Blasdell, Kim R.; Guzman, Hilda; Wood, Thomas G.; Paradkar, Prasad N.; Holmes, Edward C.; Tesh, Robert B.; Vasilakis, Nikos

    2015-01-01

    RNA viruses exhibit substantial structural, ecological and genomic diversity. However, genome size in RNA viruses is likely limited by a high mutation rate, resulting in the evolution of various mechanisms to increase complexity while minimising genome expansion. Here we conduct a large-scale analysis of the genome sequences of 99 animal rhabdoviruses, including 45 genomes which we determined de novo, to identify patterns of genome expansion and the evolution of genome complexity. All but seven of the rhabdoviruses clustered into 17 well-supported monophyletic groups, of which eight corresponded to established genera, seven were assigned as new genera, and two were taxonomically ambiguous. We show that the acquisition and loss of new genes appears to have been a central theme of rhabdovirus evolution, and has been associated with the appearance of alternative, overlapping and consecutive ORFs within the major structural protein genes, and the insertion and loss of additional ORFs in each gene junction in a clade-specific manner. Changes in the lengths of gene junctions accounted for as much as 48.5% of the variation in genome size from the smallest to the largest genome, and the frequency with which new ORFs were observed increased in the 3’ to 5’ direction along the genome. We also identify several new families of accessory genes encoded in these regions, and show that non-canonical expression strategies involving TURBS-like termination-reinitiation, ribosomal frame-shifts and leaky ribosomal scanning appear to be common. We conclude that rhabdoviruses have an unusual capacity for genomic plasticity that may be linked to their discontinuous transcription strategy from the negative-sense single-stranded RNA genome, and propose a model that accounts for the regular occurrence of genome expansion and contraction throughout the evolution of the Rhabdoviridae. PMID:25679389

  19. The human genome project

    International Nuclear Information System (INIS)

    Worton, R.

    1996-01-01

    The Human Genome Project is a massive international research project, costing 3 to 5 billion dollars and expected to take 15 years, which will identify the all the genes in the human genome - i.e. the complete sequence of bases in human DNA. The prize will be the ability to identify genes causing or predisposing to disease, and in some cases the development of gene therapy, but this new knowledge will raise important ethical issues

  20. Decoding the human genome

    CERN Multimedia

    CERN. Geneva. Audiovisual Unit; Antonerakis, S E

    2002-01-01

    Decoding the Human genome is a very up-to-date topic, raising several questions besides purely scientific, in view of the two competing teams (public and private), the ethics of using the results, and the fact that the project went apparently faster and easier than expected. The lecture series will address the following chapters: Scientific basis and challenges. Ethical and social aspects of genomics.

  1. Molluscan Evolutionary Genomics

    Energy Technology Data Exchange (ETDEWEB)

    Simison, W. Brian; Boore, Jeffrey L.

    2005-12-01

    In the last 20 years there have been dramatic advances in techniques of high-throughput DNA sequencing, most recently accelerated by the Human Genome Project, a program that has determined the three billion base pair code on which we are based. Now this tremendous capability is being directed at other genome targets that are being sampled across the broad range of life. This opens up opportunities as never before for evolutionary and organismal biologists to address questions of both processes and patterns of organismal change. We stand at the dawn of a new 'modern synthesis' period, paralleling that of the early 20th century when the fledgling field of genetics first identified the underlying basis for Darwin's theory. We must now unite the efforts of systematists, paleontologists, mathematicians, computer programmers, molecular biologists, developmental biologists, and others in the pursuit of discovering what genomics can teach us about the diversity of life. Genome-level sampling for mollusks to date has mostly been limited to mitochondrial genomes and it is likely that these will continue to provide the best targets for broad phylogenetic sampling in the near future. However, we are just beginning to see an inroad into complete nuclear genome sequencing, with several mollusks and other eutrochozoans having been selected for work about to begin. Here, we provide an overview of the state of molluscan mitochondrial genomics, highlight a few of the discoveries from this research, outline the promise of broadening this dataset, describe upcoming projects to sequence whole mollusk nuclear genomes, and challenge the community to prepare for making the best use of these data.

  2. Human Germline Genome Editing

    OpenAIRE

    Ormond, Kelly E.; Mortlock, Douglas P.; Scholes, Derek T.; Bombard, Yvonne; Brody, Lawrence C.; Faucett, W. Andrew; Garrison, Nanibaa’ A.; Hercher, Laura; Isasi, Rosario; Middleton, Anna; Musunuru, Kiran; Shriner, Daniel; Virani, Alice; Young, Caroline E.

    2017-01-01

    With CRISPR/Cas9 and other genome-editing technologies, successful somatic and germline genome editing are becoming feasible. To respond, an American Society of Human Genetics (ASHG) workgroup developed this position statement, which was approved by the ASHG Board in March 2017. The workgroup included representatives from the UK Association of Genetic Nurses and Counsellors, Canadian Association of Genetic Counsellors, International Genetic Epidemiology Society, and US National Society of Gen...

  3. Comparative Pan-Genome Analysis of Piscirickettsia salmonis Reveals Genomic Divergences within Genogroups

    Directory of Open Access Journals (Sweden)

    Guillermo Nourdin-Galindo

    2017-10-01

    Full Text Available Piscirickettsia salmonis is the etiological agent of salmonid rickettsial septicemia, a disease that seriously affects the salmonid industry. Despite efforts to genomically characterize P. salmonis, functional information on the life cycle, pathogenesis mechanisms, diagnosis, treatment, and control of this fish pathogen remain lacking. To address this knowledge gap, the present study conducted an in silico pan-genome analysis of 19 P. salmonis strains from distinct geographic locations and genogroups. Results revealed an expected open pan-genome of 3,463 genes and a core-genome of 1,732 genes. Two marked genogroups were identified, as confirmed by phylogenetic and phylogenomic relationships to the LF-89 and EM-90 reference strains, as well as by assessments of genomic structures. Different structural configurations were found for the six identified copies of the ribosomal operon in the P. salmonis genome, indicating translocation throughout the genetic material. Chromosomal divergences in genomic localization and quantity of genetic cassettes were also found for the Dot/Icm type IVB secretion system. To determine divergences between core-genomes, additional pan-genome descriptions were compiled for the so-termed LF and EM genogroups. Open pan-genomes composed of 2,924 and 2,778 genes and core-genomes composed of 2,170 and 2,228 genes were respectively found for the LF and EM genogroups. The core-genomes were functionally annotated using the Gene Ontology, KEGG, and Virulence Factor databases, revealing the presence of several shared groups of genes related to basic function of intracellular survival and bacterial pathogenesis. Additionally, the specific pan-genomes for the LF and EM genogroups were defined, resulting in the identification of 148 and 273 exclusive proteins, respectively. Notably, specific virulence factors linked to adherence, colonization, invasion factors, and endotoxins were established. The obtained data suggest that these

  4. RadGenomics project

    Energy Technology Data Exchange (ETDEWEB)

    Iwakawa, Mayumi; Imai, Takashi; Harada, Yoshinobu [National Inst. of Radiological Sciences, Chiba (Japan). Frontier Research Center] [and others

    2002-06-01

    Human health is determined by a complex interplay of factors, predominantly between genetic susceptibility, environmental conditions and aging. The ultimate aim of the RadGenomics (Radiation Genomics) project is to understand the implications of heterogeneity in responses to ionizing radiation arising from genetic variation between individuals in the human population. The rapid progression of the human genome sequencing and the recent development of new technologies in molecular genetics are providing us with new opportunities to understand the genetic basis of individual differences in susceptibility to natural and/or artificial environmental factors, including radiation exposure. The RadGenomics project will inevitably lead to improved protocols for personalized radiotherapy and reductions in the potential side effects of such treatment. The project will contribute to future research into the molecular mechanisms of radiation sensitivity in humans and will stimulate the development of new high-throughput technologies for a broader application of biological and medical sciences. The staff members are specialists in a variety of fields, including genome science, radiation biology, medical science, molecular biology, and informatics, and have joined the RadGenomics project from various universities, companies, and research institutes. The project started in April 2001. (author)

  5. Comparative Genome Viewer

    International Nuclear Information System (INIS)

    Molineris, I.; Sales, G.

    2009-01-01

    The amount of information about genomes, both in the form of complete sequences and annotations, has been exponentially increasing in the last few years. As a result there is the need for tools providing a graphical representation of such information that should be comprehensive and intuitive. Visual representation is especially important in the comparative genomics field since it should provide a combined view of data belonging to different genomes. We believe that existing tools are limited in this respect as they focus on a single genome at a time (conservation histograms) or compress alignment representation to a single dimension. We have therefore developed a web-based tool called Comparative Genome Viewer (Cgv): it integrates a bidimensional representation of alignments between two regions, both at small and big scales, with the richness of annotations present in other genome browsers. We give access to our system through a web-based interface that provides the user with an interactive representation that can be updated in real time using the mouse to move from region to region and to zoom in on interesting details.

  6. RadGenomics project

    International Nuclear Information System (INIS)

    Iwakawa, Mayumi; Imai, Takashi; Harada, Yoshinobu

    2002-01-01

    Human health is determined by a complex interplay of factors, predominantly between genetic susceptibility, environmental conditions and aging. The ultimate aim of the RadGenomics (Radiation Genomics) project is to understand the implications of heterogeneity in responses to ionizing radiation arising from genetic variation between individuals in the human population. The rapid progression of the human genome sequencing and the recent development of new technologies in molecular genetics are providing us with new opportunities to understand the genetic basis of individual differences in susceptibility to natural and/or artificial environmental factors, including radiation exposure. The RadGenomics project will inevitably lead to improved protocols for personalized radiotherapy and reductions in the potential side effects of such treatment. The project will contribute to future research into the molecular mechanisms of radiation sensitivity in humans and will stimulate the development of new high-throughput technologies for a broader application of biological and medical sciences. The staff members are specialists in a variety of fields, including genome science, radiation biology, medical science, molecular biology, and informatics, and have joined the RadGenomics project from various universities, companies, and research institutes. The project started in April 2001. (author)

  7. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  8. Genome Size Diversity and Its Impact on the Evolution of Land Plants

    Directory of Open Access Journals (Sweden)

    Jaume Pellicer

    2018-02-01

    Full Text Available Genome size is a biodiversity trait that shows staggering diversity across eukaryotes, varying over 64,000-fold. Of all major taxonomic groups, land plants stand out due to their staggering genome size diversity, ranging ca. 2400-fold. As our understanding of the implications and significance of this remarkable genome size diversity in land plants grows, it is becoming increasingly evident that this trait plays not only an important role in shaping the evolution of plant genomes, but also in influencing plant community assemblages at the ecosystem level. Recent advances and improvements in novel sequencing technologies, as well as analytical tools, make it possible to gain critical insights into the genomic and epigenetic mechanisms underpinning genome size changes. In this review we provide an overview of our current understanding of genome size diversity across the different land plant groups, its implications on the biology of the genome and what future directions need to be addressed to fill key knowledge gaps.

  9. Complete chloroplast genome sequence of a tree fern Alsophila spinulosa: insights into evolutionary changes in fern chloroplast genomes.

    Science.gov (United States)

    Gao, Lei; Yi, Xuan; Yang, Yong-Xia; Su, Ying-Juan; Wang, Ting

    2009-06-11

    Ferns have generally been neglected in studies of chloroplast genomics. Before this study, only one polypod and two basal ferns had their complete chloroplast (cp) genome reported. Tree ferns represent an ancient fern lineage that first occurred in the Late Triassic. In recent phylogenetic analyses, tree ferns were shown to be the sister group of polypods, the most diverse group of living ferns. Availability of cp genome sequence from a tree fern will facilitate interpretation of the evolutionary changes of fern cp genomes. Here we have sequenced the complete cp genome of a scaly tree fern Alsophila spinulosa (Cyatheaceae). The Alsophila cp genome is 156,661 base pairs (bp) in size, and has a typical quadripartite structure with the large (LSC, 86,308 bp) and small single copy (SSC, 21,623 bp) regions separated by two copies of an inverted repeat (IRs, 24,365 bp each). This genome contains 117 different genes encoding 85 proteins, 4 rRNAs and 28 tRNAs. Pseudogenes of ycf66 and trnT-UGU are also detected in this genome. A unique trnR-UCG gene (derived from trnR-CCG) is found between rbcL and accD. The Alsophila cp genome shares some unusual characteristics with the previously sequenced cp genome of the polypod fern Adiantum capillus-veneris, including the absence of 5 tRNA genes that exist in most other cp genomes. The genome shows a high degree of synteny with that of Adiantum, but differs considerably from two basal ferns (Angiopteris evecta and Psilotum nudum). At one endpoint of an ancient inversion we detected a highly repeated 565-bp-region that is absent from the Adiantum cp genome. An additional minor inversion of the trnD-GUC, which is possibly shared by all ferns, was identified by comparison between the fern and other land plant cp genomes. By comparing four fern cp genome sequences it was confirmed that two major rearrangements distinguish higher leptosporangiate ferns from basal fern lineages. The Alsophila cp genome is very similar to that of the

  10. Complete chloroplast genome sequence of a tree fern Alsophila spinulosa: insights into evolutionary changes in fern chloroplast genomes

    Directory of Open Access Journals (Sweden)

    Yang Yong-Xia

    2009-06-01

    Full Text Available Abstract Background Ferns have generally been neglected in studies of chloroplast genomics. Before this study, only one polypod and two basal ferns had their complete chloroplast (cp genome reported. Tree ferns represent an ancient fern lineage that first occurred in the Late Triassic. In recent phylogenetic analyses, tree ferns were shown to be the sister group of polypods, the most diverse group of living ferns. Availability of cp genome sequence from a tree fern will facilitate interpretation of the evolutionary changes of fern cp genomes. Here we have sequenced the complete cp genome of a scaly tree fern Alsophila spinulosa (Cyatheaceae. Results The Alsophila cp genome is 156,661 base pairs (bp in size, and has a typical quadripartite structure with the large (LSC, 86,308 bp and small single copy (SSC, 21,623 bp regions separated by two copies of an inverted repeat (IRs, 24,365 bp each. This genome contains 117 different genes encoding 85 proteins, 4 rRNAs and 28 tRNAs. Pseudogenes of ycf66 and trnT-UGU are also detected in this genome. A unique trnR-UCG gene (derived from trnR-CCG is found between rbcL and accD. The Alsophila cp genome shares some unusual characteristics with the previously sequenced cp genome of the polypod fern Adiantum capillus-veneris, including the absence of 5 tRNA genes that exist in most other cp genomes. The genome shows a high degree of synteny with that of Adiantum, but differs considerably from two basal ferns (Angiopteris evecta and Psilotum nudum. At one endpoint of an ancient inversion we detected a highly repeated 565-bp-region that is absent from the Adiantum cp genome. An additional minor inversion of the trnD-GUC, which is possibly shared by all ferns, was identified by comparison between the fern and other land plant cp genomes. Conclusion By comparing four fern cp genome sequences it was confirmed that two major rearrangements distinguish higher leptosporangiate ferns from basal fern lineages. The

  11. Coordination of Programs on Domestic Animal Genomics: A Federal Framework

    National Research Council Canada - National Science Library

    2003-01-01

    The Interagency Working Group (IWG) on Domestic Animal Genomics was chartered in March 2002 to enhance communication and awareness of the importance of domesticated animals, both livestock and companion, as a critical part...

  12. Group dynamics.

    Science.gov (United States)

    Scandiffio, A L

    1990-12-01

    Group dynamics play a significant role within any organization, culture, or unit. The important thing to remember with any of these structures is that they are made up of people--people with different ideas, motivations, background, and sometimes different agendas. Most groups, formal or informal, look for a leader in an effort to maintain cohesiveness of the unit. At times, that cultural bond must be developed; once developed, it must be nurtured. There are also times that one of the group no longer finds the culture comfortable and begins to act out behaviorally. It is these times that become trying for the leader as she or he attempts to remain objective when that which was once in the building phase of group cohesiveness starts to fall apart. At all times, the manager must continue to view the employee creating the disturbance as an integral part of the group. It is at this time that it is beneficial to perceive the employee exhibiting problem behaviors as a special employee, as one who needs the benefit of your experience and skills, as one who is still part of the group. It is also during this time that the manager should focus upon her or his own views in the area of power, communication, and the corporate culture of the unit that one has established before attempting to understand another's point of view. Once we understand our own motivation and accept ourselves, it is then that we may move on to offer assistance to another. Once we understand our insecurities recognizing staff dysfunction as a symptom of system dysfunction will not be so threatening to the concept of the manager that we perceive ourselves to be. It takes a secure person to admit that she or he favors staff before deciding to do something to change things. The important thing to know is that it can be done. The favored staff can find a new way of relating to others, the special employee can find new modes of behavior (and even find self-esteem in the process), the group can find new ways

  13. Ultrafast comparison of personal genomes

    OpenAIRE

    Mauldin, Denise; Hood, Leroy; Robinson, Max; Glusman, Gustavo

    2017-01-01

    We present an ultra-fast method for comparing personal genomes. We transform the standard genome representation (lists of variants relative to a reference) into 'genome fingerprints' that can be readily compared across sequencing technologies and reference versions. Because of their reduced size, computation on the genome fingerprints is fast and requires little memory. This enables scaling up a variety of important genome analyses, including quantifying relatedness, recognizing duplicative s...

  14. Evolution of gastropod mitochondrial genome arrangements

    Directory of Open Access Journals (Sweden)

    Zardoya Rafael

    2008-02-01

    Full Text Available Abstract Background Gastropod mitochondrial genomes exhibit an unusually great variety of gene orders compared to other metazoan mitochondrial genome such as e.g those of vertebrates. Hence, gastropod mitochondrial genomes constitute a good model system to study patterns, rates, and mechanisms of mitochondrial genome rearrangement. However, this kind of evolutionary comparative analysis requires a robust phylogenetic framework of the group under study, which has been elusive so far for gastropods in spite of the efforts carried out during the last two decades. Here, we report the complete nucleotide sequence of five mitochondrial genomes of gastropods (Pyramidella dolabrata, Ascobulla fragilis, Siphonaria pectinata, Onchidella celtica, and Myosotella myosotis, and we analyze them together with another ten complete mitochondrial genomes of gastropods currently available in molecular databases in order to reconstruct the phylogenetic relationships among the main lineages of gastropods. Results Comparative analyses with other mollusk mitochondrial genomes allowed us to describe molecular features and general trends in the evolution of mitochondrial genome organization in gastropods. Phylogenetic reconstruction with commonly used methods of phylogenetic inference (ME, MP, ML, BI arrived at a single topology, which was used to reconstruct the evolution of mitochondrial gene rearrangements in the group. Conclusion Four main lineages were identified within gastropods: Caenogastropoda, Vetigastropoda, Patellogastropoda, and Heterobranchia. Caenogastropoda and Vetigastropoda are sister taxa, as well as, Patellogastropoda and Heterobranchia. This result rejects the validity of the derived clade Apogastropoda (Caenogastropoda + Heterobranchia. The position of Patellogastropoda remains unclear likely due to long-branch attraction biases. Within Heterobranchia, the most heterogeneous group of gastropods, neither Euthyneura (because of the inclusion of P

  15. Complete genome sequence of Ikoma lyssavirus.

    Science.gov (United States)

    Marston, Denise A; Ellis, Richard J; Horton, Daniel L; Kuzmin, Ivan V; Wise, Emma L; McElhinney, Lorraine M; Banyard, Ashley C; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E; Fooks, Anthony R

    2012-09-01

    Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isolated from an African civet in Tanzania displaying clinical signs of rabies. Genetically, this virus is the most divergent within the genus Lyssavirus. Characterization of the genome will help to improve our understanding of lyssavirus diversity and enable investigation into vaccine-induced immunity and protection.

  16. Group representations

    CERN Document Server

    Karpilovsky, G

    1994-01-01

    This third volume can be roughly divided into two parts. The first part is devoted to the investigation of various properties of projective characters. Special attention is drawn to spin representations and their character tables and to various correspondences for projective characters. Among other topics, projective Schur index and projective representations of abelian groups are covered. The last topic is investigated by introducing a symplectic geometry on finite abelian groups. The second part is devoted to Clifford theory for graded algebras and its application to the corresponding theory

  17. Lego Group

    DEFF Research Database (Denmark)

    Møller Larsen, Marcus; Pedersen, Torben; Slepniov, Dmitrij

    2010-01-01

    The last years’ rather adventurous journey from 2004 to 2009 had taught the fifth-largest toy-maker in the world - the LEGO Group - the importance of managing the global supply chain effectively. In order to survive the largest internal financial crisis in its roughly 70 years of existence......, the management had, among many initiatives, decided to offshore and outsource a major chunk of its production to Flextronics. In this pursuit of rapid cost-cutting sourcing advantages, the LEGO Group planned to license out as much as 80 per cent of its production besides closing down major parts...

  18. The year of encroaching genomics

    Directory of Open Access Journals (Sweden)

    MG Manfredi-Romanini

    2009-12-01

    Full Text Available The year 2000 has been called “The year of the genome”. Perhaps better would have been to call it “The year of encroaching genomics” (Einarson and Golemis, 2000 intending by this vivid term the torrents of information pouring out of multiorganizational genome sequence projects, large research groups, consortia and industries into the field of active biological research. This is bound to have a strong impact on how research strategies will be designed from now on and it is our expectation that the year 2001 will be the year in which the small academic laboratories now at the forefront of research will have to cope with this new situation if they are to remain at the cutting edge. They will have to show granting institutions how their new research project proposals involve collaboration with large scientific groups and industries such as those mentioned above in order to win financial backing.

  19. Genomics using the Assembly of the Mink Genome

    DEFF Research Database (Denmark)

    Guldbrandtsen, Bernt; Cai, Zexi; Sahana, Goutam

    2018-01-01

    The American Mink’s (Neovison vison) genome has recently been sequenced. This opens numerous avenues of research both for studying the basic genetics and physiology of the mink as well as genetic improvement in mink. Using genotyping-by-sequencing (GBS) generated marker data for 2,352 Danish farm...... mink runs of homozygosity (ROH) were detect in mink genomes. Detectable ROH made up on average 1.7% of the genome indicating the presence of at most a moderate level of genomic inbreeding. The fraction of genome regions found in ROH varied. Ten percent of the included regions were never found in ROH....... The ability to detect ROH in the mink genome also demonstrates the general reliability of the new mink genome assembly. Keywords: american mink, run of homozygosity, genome, selection, genomic inbreeding...

  20. Pan-genome and phylogeny of Bacillus cereus sensu lato

    OpenAIRE

    Bazinet, Adam

    2017-01-01

    Background: Bacillus cereus sensu lato ( s . l .) is an ecologically diverse bacterial group of medical and agricultural significance. In this study, I use publicly available genomes to characterize the B. cereus s. l. pan-genome and perform the largest phylogenetic and population genetic analyses of this group to date in terms of the number of genes and taxa included. With these fundamental data in hand, I identify genes associated with particular phenotypic traits (i.e., "pan-GWAS" analysis...

  1. Pan-genome and phylogeny of Bacillus cereus sensu lato

    OpenAIRE

    Bazinet, Adam L.

    2017-01-01

    Background Bacillus cereus sensu lato (s. l.) is an ecologically diverse bacterial group of medical and agricultural significance. In this study, I use publicly available genomes and novel bioinformatic workflows to characterize the B. cereus s. l. pan-genome and perform the largest phylogenetic and population genetic analyses of this group to date in terms of the number of genes and taxa included. With these fundamental data in hand, I identify genes associated with particular phenotypic tra...

  2. Attitudes towards personal genomics among older Swiss adults: An exploratory study

    Directory of Open Access Journals (Sweden)

    Laura Mählmann

    2016-03-01

    Conclusion: This study indicates a relatively positive overall attitude towards personal genomic testing among older Swiss adults, a group not typically represented in surveys about personal genomics. Genomic data of older adults can be highly relevant to late life health and maintenance of quality of life. In addition they can be an invaluable source for better understanding of longevity, health and disease. Understanding the attitudes of this population towards genomic analyses, although important, remains under-examined.

  3. The international Genome sample resource (IGSR): A worldwide collection of genome variation incorporating the 1000 Genomes Project data.

    Science.gov (United States)

    Clarke, Laura; Fairley, Susan; Zheng-Bradley, Xiangqun; Streeter, Ian; Perry, Emily; Lowy, Ernesto; Tassé, Anne-Marie; Flicek, Paul

    2017-01-04

    The International Genome Sample Resource (IGSR; http://www.internationalgenome.org) expands in data type and population diversity the resources from the 1000 Genomes Project. IGSR represents the largest open collection of human variation data and provides easy access to these resources. IGSR was established in 2015 to maintain and extend the 1000 Genomes Project data, which has been widely used as a reference set of human variation and by researchers developing analysis methods. IGSR has mapped all of the 1000 Genomes sequence to the newest human reference (GRCh38), and will release updated variant calls to ensure maximal usefulness of the existing data. IGSR is collecting new structural variation data on the 1000 Genomes samples from long read sequencing and other technologies, and will collect relevant functional data into a single comprehensive resource. IGSR is extending coverage with new populations sequenced by collaborating groups. Here, we present the new data and analysis that IGSR has made available. We have also introduced a new data portal that increases discoverability of our data-previously only browseable through our FTP site-by focusing on particular samples, populations or data sets of interest. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Mitochondrial genome evolution in the Saccharomyces sensu stricto complex.

    Science.gov (United States)

    Ruan, Jiangxing; Cheng, Jian; Zhang, Tongcun; Jiang, Huifeng

    2017-01-01

    Exploring the evolutionary patterns of mitochondrial genomes is important for our understanding of the Saccharomyces sensu stricto (SSS) group, which is a model system for genomic evolution and ecological analysis. In this study, we first obtained the complete mitochondrial sequences of two important species, Saccharomyces mikatae and Saccharomyces kudriavzevii. We then compared the mitochondrial genomes in the SSS group with those of close relatives, and found that the non-coding regions evolved rapidly, including dramatic expansion of intergenic regions, fast evolution of introns and almost 20-fold higher rearrangement rates than those of the nuclear genomes. However, the coding regions, and especially the protein-coding genes, are more conserved than those in the nuclear genomes of the SSS group. The different evolutionary patterns of coding and non-coding regions in the mitochondrial and nuclear genomes may be related to the origin of the aerobic fermentation lifestyle in this group. Our analysis thus provides novel insights into the evolution of mitochondrial genomes.

  5. Informal groups

    NARCIS (Netherlands)

    E. van den Berg; P. van Houwelingen; J. de Hart

    2011-01-01

    Original title: Informele groepen Going out running with a group of friends, rather than joining an official sports club. Individuals who decide to take action themselves rather than giving money to good causes. Maintaining contact with others not as a member of an association, but through an

  6. Cardiovascular Precision Medicine in the Genomics Era

    Directory of Open Access Journals (Sweden)

    Alexandra M. Dainis, BS

    2018-04-01

    Full Text Available Summary: Precision medicine strives to delineate disease using multiple data sources—from genomics to digital health metrics—in order to be more precise and accurate in our diagnoses, definitions, and treatments of disease subtypes. By defining disease at a deeper level, we can treat patients based on an understanding of the molecular underpinnings of their presentations, rather than grouping patients into broad categories with one-size-fits-all treatments. In this review, the authors examine how precision medicine, specifically that surrounding genetic testing and genetic therapeutics, has begun to make strides in both common and rare cardiovascular diseases in the clinic and the laboratory, and how these advances are beginning to enable us to more effectively define risk, diagnose disease, and deliver therapeutics for each individual patient. Key Words: genome sequencing, genomics, precision medicine, targeted therapeutics

  7. Genomic Diversity in the Genus of Aspergillus

    DEFF Research Database (Denmark)

    Rasmussen, Jane Lind Nybo

    , sections and genus of Aspergillus. The work uncovers a large genomic diversity across all studied groups of species. The genomic diversity was especially evident on the section level, where the proteins shared by all species only represents ⇠55% of the proteome. This number decreases even further, to 38......, sections Nigri, Usti and Cavericolus, clade Tubingensis, and species A. niger. It lastly uses these results to predict genetic traits that take part in fungal speciation. Within a few years the Aspergillus whole-genus sequencing project will have published all currently-accepted Aspergillus genomes......Aspergillus is a highly important genus of saprotrophic filamentous fungi. It is a very diverse genus that is inextricably intertwined with human a↵airs on a daily basis, holding species relevant to plant and human pathology, enzyme and bulk chemistry production, food and beverage biotechnology...

  8. Comparative genomics of Cluster O mycobacteriophages.

    Science.gov (United States)

    Cresawn, Steven G; Pope, Welkin H; Jacobs-Sera, Deborah; Bowman, Charles A; Russell, Daniel A; Dedrick, Rebekah M; Adair, Tamarah; Anders, Kirk R; Ball, Sarah; Bollivar, David; Breitenberger, Caroline; Burnett, Sandra H; Butela, Kristen; Byrnes, Deanna; Carzo, Sarah; Cornely, Kathleen A; Cross, Trevor; Daniels, Richard L; Dunbar, David; Findley, Ann M; Gissendanner, Chris R; Golebiewska, Urszula P; Hartzog, Grant A; Hatherill, J Robert; Hughes, Lee E; Jalloh, Chernoh S; De Los Santos, Carla; Ekanem, Kevin; Khambule, Sphindile L; King, Rodney A; King-Smith, Christina; Klyczek, Karen; Krukonis, Greg P; Laing, Christian; Lapin, Jonathan S; Lopez, A Javier; Mkhwanazi, Sipho M; Molloy, Sally D; Moran, Deborah; Munsamy, Vanisha; Pacey, Eddie; Plymale, Ruth; Poxleitner, Marianne; Reyna, Nathan; Schildbach, Joel F; Stukey, Joseph; Taylor, Sarah E; Ware, Vassie C; Wellmann, Amanda L; Westholm, Daniel; Wodarski, Donna; Zajko, Michelle; Zikalala, Thabiso S; Hendrix, Roger W; Hatfull, Graham F

    2015-01-01

    Mycobacteriophages--viruses of mycobacterial hosts--are genetically diverse but morphologically are all classified in the Caudovirales with double-stranded DNA and tails. We describe here a group of five closely related mycobacteriophages--Corndog, Catdawg, Dylan, Firecracker, and YungJamal--designated as Cluster O with long flexible tails but with unusual prolate capsids. Proteomic analysis of phage Corndog particles, Catdawg particles, and Corndog-infected cells confirms expression of half of the predicted gene products and indicates a non-canonical mechanism for translation of the Corndog tape measure protein. Bioinformatic analysis identifies 8-9 strongly predicted SigA promoters and all five Cluster O genomes contain more than 30 copies of a 17 bp repeat sequence with dyad symmetry located throughout the genomes. Comparison of the Cluster O phages provides insights into phage genome evolution including the processes of gene flux by horizontal genetic exchange.

  9. Comparative genomics of Cluster O mycobacteriophages.

    Directory of Open Access Journals (Sweden)

    Steven G Cresawn

    Full Text Available Mycobacteriophages--viruses of mycobacterial hosts--are genetically diverse but morphologically are all classified in the Caudovirales with double-stranded DNA and tails. We describe here a group of five closely related mycobacteriophages--Corndog, Catdawg, Dylan, Firecracker, and YungJamal--designated as Cluster O with long flexible tails but with unusual prolate capsids. Proteomic analysis of phage Corndog particles, Catdawg particles, and Corndog-infected cells confirms expression of half of the predicted gene products and indicates a non-canonical mechanism for translation of the Corndog tape measure protein. Bioinformatic analysis identifies 8-9 strongly predicted SigA promoters and all five Cluster O genomes contain more than 30 copies of a 17 bp repeat sequence with dyad symmetry located throughout the genomes. Comparison of the Cluster O phages provides insights into phage genome evolution including the processes of gene flux by horizontal genetic exchange.

  10. Genomes and geography: genomic insights into the evolution and phylogeography of the genus Schistosoma

    Directory of Open Access Journals (Sweden)

    Ironside Joe E

    2011-07-01

    Full Text Available Abstract Blood flukes within the genus Schistosoma still remain a major cause of disease in the tropics and subtropics and the study of their evolution has been an area of major debate and research. With the advent of modern molecular and genomic approaches deeper insights have been attained not only into the divergence and speciation of these worms, but also into the historic movement of these parasites from Asia into Africa, via migration and dispersal of definitive and snail intermediate hosts. This movement was subsequently followed by a radiation of Schistosoma species giving rise to the S. mansoni and S. haematobium groups, as well as the S. indicum group that reinvaded Asia. Each of these major evolutionary events has been marked by distinct changes in genomic structure evident in differences in mitochondrial gene order and nuclear chromosomal architecture between the species associated with Asia and Africa. Data from DNA sequencing, comparative molecular genomics and karyotyping are indicative of major constitutional genomic events which would have become fixed in the ancestral populations of these worms. Here we examine how modern genomic techniques may give a more in depth understanding of the evolution of schistosomes and highlight the complexity of speciation and divergence in this group.

  11. Diversity of Pseudomonas Genomes, Including Populus-Associated Isolates, as Revealed by Comparative Genome Analysis.

    Science.gov (United States)

    Jun, Se-Ran; Wassenaar, Trudy M; Nookaew, Intawat; Hauser, Loren; Wanchai, Visanu; Land, Miriam; Timm, Collin M; Lu, Tse-Yuan S; Schadt, Christopher W; Doktycz, Mitchel J; Pelletier, Dale A; Ussery, David W

    2016-01-01

    The Pseudomonas genus contains a metabolically versatile group of organisms that are known to occupy numerous ecological niches, including the rhizosphere and endosphere of many plants. Their diversity influences the phylogenetic diversity and heterogeneity of these communities. On the basis of average amino acid identity, comparative genome analysis of >1,000 Pseudomonas genomes, including 21 Pseudomonas strains isolated from the roots of native Populus deltoides (eastern cottonwood) trees resulted in consistent and robust genomic clusters with phylogenetic homogeneity. All Pseudomonas aeruginosa genomes clustered together, and these were clearly distinct from other Pseudomonas species groups on the basis of pangenome and core genome analyses. In contrast, the genomes of Pseudomonas fluorescens were organized into 20 distinct genomic clusters, representing enormous diversity and heterogeneity. Most of our 21 Populus-associated isolates formed three distinct subgroups within the major P. fluorescens group, supported by pathway profile analysis, while two isolates were more closely related to Pseudomonas chlororaphis and Pseudomonas putida. Genes specific to Populus-associated subgroups were identified. Genes specific to subgroup 1 include several sensory systems that act in two-component signal transduction, a TonB-dependent receptor, and a phosphorelay sensor. Genes specific to subgroup 2 contain hypothetical genes, and genes specific to subgroup 3 were annotated with hydrolase activity. This study justifies the need to sequence multiple isolates, especially from P. fluorescens, which displays the most genetic variation, in order to study functional capabilities from a pangenomic perspective. This information will prove useful when choosing Pseudomonas strains for use to promote growth and increase disease resistance in plants. Copyright © 2015 Jun et al.

  12. Genomic signatures of evolutionary transitions from solitary to group living

    DEFF Research Database (Denmark)

    Kapheim, Karen M.; Pan, Hailin; Li, Cai

    2015-01-01

    . First, many important genes show evidence of neutral evolution as a consequence of relaxed selection with increasing social complexity. Second, there is no single road map to eusociality; independent evolutionary transitions in sociality have independent genetic underpinnings. Third, though clearly...

  13. Genomic diversity of drug-resistant Mycobacterium tuberculosis isolates in Lisbon Portugal: Towards tuberculosis genomic epidemiology

    Directory of Open Access Journals (Sweden)

    João Perdigão

    2015-01-01

    Full Text Available Multidrug- (MDR and extensively drug-resistant (XDR tuberculosis (TB present a challenge to disease control and elimination goals. Lisbon, Portugal, has a high TB incidencerate and unusual and successful XDR-TB strains that have been found in circulation foralmost two decades. For the last 20 years, a continued circulation of two phylogenetic clades, Lisboa3 and Q1, which are highly associated with MDR and XDR, have been observed. In recent years, these strains have been well characterized regarding the molecular basis of drug resistance and have been inclusively subjected to whole genome sequencing (WGS. Researchers have been studying the genomic diversity of strains circulating in Lisbon and its genomic determinants through cutting-edge next generation sequencing. An enormous amount of whole genome sequence data are now available for the most prevalent and clinically relevant strains circulating in Lisbon. It is the persistence, prevalence and rapid evolution towards drug resistance that has prompted researchers to investigate the properties of these strains at the genomic level and in the future at a global transcriptomic level. Seventy Mycobacterium tuberculosis (MTB isolates, mostly recovered in Lisbon, were genotyped by 24-loci Mycobacterial Interspersed Repetitive Unit – Variable Number of Tandem Repeats (MIRU-VNTR and the genomes sequenced using a next generation sequencing platform – Illumina HiSeq 2000. The genotyping data revealed three major clusters associated with MDR-TB (Lisboa3-A, Lisboa3-B and Q1, two of which are associated with XDR-TB (Lisboa3-B and Q1, whilst the genomic data contributed to elucidating the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of MTB clinical isolates, revealed two major clades responsible for MDR/XDR-TB in the region

  14. Genomic diversity of drug-resistant Mycobacterium tuberculosis isolates in Lisbon Portugal: Towards tuberculosis genomic epidemiology

    KAUST Repository

    Perdigã o, Joã o; Silva, Hugo; Machado, Diana; Macedo, Rita; Maltez, Fernando; Silva, Carla; Jordao, Luisa; Couto, Isabel; Mallard, Kim; Coll, Francesc; Hill-Cawthorne, Grant A.; McNerney, Ruth; Pain, Arnab; Clark, Taane G.; Viveiros, Miguel; Portugal, Isabel

    2015-01-01

    Multidrug- (MDR) and extensively drug-resistant (XDR) tuberculosis (TB) present a challenge to disease control and elimination goals. Lisbon, Portugal, has a high TB incidence rate and unusual and successful XDR-TB strains that have been found in circulation for almost two decades. For the last 20. years, a continued circulation of two phylogenetic clades, Lisboa3 and Q1, which are highly associated with MDR and XDR, have been observed. In recent years, these strains have been well characterized regarding the molecular basis of drug resistance and have been inclusively subjected to whole genome sequencing (WGS). Researchers have been studying the genomic diversity of strains circulating in Lisbon and its genomic determinants through cutting-edge next generation sequencing. An enormous amount of whole genome sequence data are now available for the most prevalent and clinically relevant strains circulating in Lisbon.It is the persistence, prevalence and rapid evolution towards drug resistance that has prompted researchers to investigate the properties of these strains at the genomic level and in the future at a global transcriptomic level. Seventy Mycobacterium tuberculosis (MTB) isolates, mostly recovered in Lisbon, were genotyped by 24-. loci Mycobacterial Interspersed Repetitive Unit - Variable Number of Tandem Repeats (MIRU-VNTR) and the genomes sequenced using a next generation sequencing platform - Illumina HiSeq 2000.The genotyping data revealed three major clusters associated with MDR-TB (Lisboa3-A, Lisboa3-B and Q1), two of which are associated with XDR-TB (Lisboa3-B and Q1), whilst the genomic data contributed to elucidating the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of MTB clinical isolates, revealed two major clades responsible for MDR/XDR-TB in the region: Lisboa3 and Q

  15. Genomic diversity of drug-resistant Mycobacterium tuberculosis isolates in Lisbon Portugal: Towards tuberculosis genomic epidemiology

    KAUST Repository

    Perdigão, João

    2015-03-01

    Multidrug- (MDR) and extensively drug-resistant (XDR) tuberculosis (TB) present a challenge to disease control and elimination goals. Lisbon, Portugal, has a high TB incidence rate and unusual and successful XDR-TB strains that have been found in circulation for almost two decades. For the last 20. years, a continued circulation of two phylogenetic clades, Lisboa3 and Q1, which are highly associated with MDR and XDR, have been observed. In recent years, these strains have been well characterized regarding the molecular basis of drug resistance and have been inclusively subjected to whole genome sequencing (WGS). Researchers have been studying the genomic diversity of strains circulating in Lisbon and its genomic determinants through cutting-edge next generation sequencing. An enormous amount of whole genome sequence data are now available for the most prevalent and clinically relevant strains circulating in Lisbon.It is the persistence, prevalence and rapid evolution towards drug resistance that has prompted researchers to investigate the properties of these strains at the genomic level and in the future at a global transcriptomic level. Seventy Mycobacterium tuberculosis (MTB) isolates, mostly recovered in Lisbon, were genotyped by 24-. loci Mycobacterial Interspersed Repetitive Unit - Variable Number of Tandem Repeats (MIRU-VNTR) and the genomes sequenced using a next generation sequencing platform - Illumina HiSeq 2000.The genotyping data revealed three major clusters associated with MDR-TB (Lisboa3-A, Lisboa3-B and Q1), two of which are associated with XDR-TB (Lisboa3-B and Q1), whilst the genomic data contributed to elucidating the phylogenetic positioning of circulating MDR-TB strains, showing a high predominance of a single SNP cluster group 5. Furthermore, a genome-wide phylogeny analysis from these strains, together with 19 publicly available genomes of MTB clinical isolates, revealed two major clades responsible for MDR/XDR-TB in the region: Lisboa3 and Q

  16. Clusters of orthologous genes for 41 archaeal genomes and implications for evolutionary genomics of archaea

    Directory of Open Access Journals (Sweden)

    Wolf Yuri I

    2007-11-01

    Full Text Available Abstract Background An evolutionary classification of genes from sequenced genomes that distinguishes between orthologs and paralogs is indispensable for genome annotation and evolutionary reconstruction. Shortly after multiple genome sequences of bacteria, archaea, and unicellular eukaryotes became available, an attempt on such a classification was implemented in Clusters of Orthologous Groups of proteins (COGs. Rapid accumulation of genome sequences creates opportunities for refining COGs but also represents a challenge because of error amplification. One of the practical strategies involves construction of refined COGs for phylogenetically compact subsets of genomes. Results New Archaeal Clusters of Orthologous Genes (arCOGs were constructed for 41 archaeal genomes (13 Crenarchaeota, 27 Euryarchaeota and one Nanoarchaeon using an improved procedure that employs a similarity tree between smaller, group-specific clusters, semi-automatically partitions orthology domains in multidomain proteins, and uses profile searches for identification of remote orthologs. The annotation of arCOGs is a consensus between three assignments based on the COGs, the CDD database, and the annotations of homologs in the NR database. The 7538 arCOGs, on average, cover ~88% of the genes in a genome compared to a ~76% coverage in COGs. The finer granularity of ortholog identification in the arCOGs is apparent from the fact that 4538 arCOGs correspond to 2362 COGs; ~40% of the arCOGs are new. The archaeal gene core (protein-coding genes found in all 41 genome consists of 166 arCOGs. The arCOGs were used to reconstruct gene loss and gene gain events during archaeal evolution and gene sets of ancestral forms. The Last Archaeal Common Ancestor (LACA is conservatively estimated to possess 996 genes compared to 1245 and 1335 genes for the last common ancestors of Crenarchaeota and Euryarchaeota, respectively. It is inferred that LACA was a chemoautotrophic hyperthermophile

  17. Long identical multispecies elements in plant and animal genomes.

    Science.gov (United States)

    Reneker, Jeff; Lyons, Eric; Conant, Gavin C; Pires, J Chris; Freeling, Michael; Shyu, Chi-Ren; Korkin, Dmitry

    2012-05-08

    Ultraconserved elements (UCEs) are DNA sequences that are 100% identical (no base substitutions, insertions, or deletions) and located in syntenic positions in at least two genomes. Although hundreds of UCEs have been found in animal genomes, little is known about the incidence of ultraconservation in plant genomes. Using an alignment-free information-retrieval approach, we have comprehensively identified all long identical multispecies elements (LIMEs), which include both syntenic and nonsyntenic regions, of at least 100 identical base pairs shared by at least two genomes. Among six animal genomes, we found the previously known syntenic UCEs as well as previously undescribed nonsyntenic elements. In contrast, among six plant genomes, we only found nonsyntenic LIMEs. LIMEs can also be classified as either simple (repetitive) or complex (nonrepetitive), they may occur in multiple copies in a genome, and they are often spread across multiple chromosomes. Although complex LIMEs were found in both animal and plant genomes, they differed significantly in their composition and copy number. Further analyses of plant LIMEs revealed their functional diversity, encompassing elements found near rRNA and enzyme-coding genes, as well as those found in transposons and noncoding DNA. We conclude that despite the common presence of LIMEs in both animal and plant lineages, the evolutionary processes involved in the creation and maintenance of these elements differ in the two groups and are likely attributable to several mechanisms, including transfer of genetic material from organellar to nuclear genomes, de novo sequence manufacturing, and purifying selection.

  18. Genomes to Proteomes

    Energy Technology Data Exchange (ETDEWEB)

    Panisko, Ellen A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Grigoriev, Igor [USDOE Joint Genome Inst., Walnut Creek, CA (United States); Daly, Don S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Webb-Robertson, Bobbie-Jo [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Baker, Scott E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2009-03-01

    Biologists are awash with genomic sequence data. In large part, this is due to the rapid acceleration in the generation of DNA sequence that occurred as public and private research institutes raced to sequence the human genome. In parallel with the large human genome effort, mostly smaller genomes of other important model organisms were sequenced. Projects following on these initial efforts have made use of technological advances and the DNA sequencing infrastructure that was built for the human and other organism genome projects. As a result, the genome sequences of many organisms are available in high quality draft form. While in many ways this is good news, there are limitations to the biological insights that can be gleaned from DNA sequences alone; genome sequences offer only a bird's eye view of the biological processes endemic to an organism or community. Fortunately, the genome sequences now being produced at such a high rate can serve as the foundation for other global experimental platforms such as proteomics. Proteomic methods offer a snapshot of the proteins present at a point in time for a given biological sample. Current global proteomics methods combine enzymatic digestion, separations, mass spectrometry and database searching for peptide identification. One key aspect of proteomics is the prediction of peptide sequences from mass spectrometry data. Global proteomic analysis uses computational matching of experimental mass spectra with predicted spectra based on databases of gene models that are often generated computationally. Thus, the quality of gene models predicted from a genome sequence is crucial in the generation of high quality peptide identifications. Once peptides are identified they can be assigned to their parent protein. Proteins identified as expressed in a given experiment are most useful when compared to other expressed proteins in a larger biological context or biochemical pathway. In this chapter we will discuss the automatic

  19. Experimental Induction of Genome Chaos.

    Science.gov (United States)

    Ye, Christine J; Liu, Guo; Heng, Henry H

    2018-01-01

    Genome chaos, or karyotype chaos, represents a powerful survival strategy for somatic cells under high levels of stress/selection. Since the genome context, not the gene content, encodes the genomic blueprint of the cell, stress-induced rapid and massive reorganization of genome topology functions as a very important mechanism for genome (karyotype) evolution. In recent years, the phenomenon of genome chaos has been confirmed by various sequencing efforts, and many different terms have been coined to describe different subtypes of the chaotic genome including "chromothripsis," "chromoplexy," and "structural mutations." To advance this exciting field, we need an effective experimental system to induce and characterize the karyotype reorganization process. In this chapter, an experimental protocol to induce chaotic genomes is described, following a brief discussion of the mechanism and implication of genome chaos in cancer evolution.

  20. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko; Tanaka, Tsuyoshi; Ohyanagi, Hajime; Hsing, Yue-Ie C.; Itoh, Takeshi

    2018-01-01

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  1. Genome Sequences of Oryza Species

    KAUST Repository

    Kumagai, Masahiko

    2018-02-14

    This chapter summarizes recent data obtained from genome sequencing, annotation projects, and studies on the genome diversity of Oryza sativa and related Oryza species. O. sativa, commonly known as Asian rice, is the first monocot species whose complete genome sequence was deciphered based on physical mapping by an international collaborative effort. This genome, along with its accurate and comprehensive annotation, has become an indispensable foundation for crop genomics and breeding. With the development of innovative sequencing technologies, genomic studies of O. sativa have dramatically increased; in particular, a large number of cultivars and wild accessions have been sequenced and compared with the reference rice genome. Since de novo genome sequencing has become cost-effective, the genome of African cultivated rice, O. glaberrima, has also been determined. Comparative genomic studies have highlighted the independent domestication processes of different rice species, but it also turned out that Asian and African rice share a common gene set that has experienced similar artificial selection. An international project aimed at constructing reference genomes and examining the genome diversity of wild Oryza species is currently underway, and the genomes of some species are publicly available. This project provides a platform for investigations such as the evolution, development, polyploidization, and improvement of crops. Studies on the genomic diversity of Oryza species, including wild species, should provide new insights to solve the problem of growing food demands in the face of rapid climatic changes.

  2. Global Implementation of Genomic Medicine: We Are Not Alone

    Science.gov (United States)

    Manolio, Teri A.; Abramowicz, Marc; Al-Mulla, Fahd; Anderson, Warwick; Balling, Rudi; Berger, Adam C.; Bleyl, Steven; Chakravarti, Aravinda; Chantratita, Wasun; Chisholm, Rex L.; Dissanayake, Vajira H. W.; Dunn, Michael; Dzau, Victor J.; Han, Bok-Ghee; Hubbard, Tim; Kolbe, Anne; Korf, Bruce; Kubo, Michiaki; Lasko, Paul; Leego, Erkki; Mahasirimongkol, Surakameth; Majumdar, Partha P.; Matthijs, Gert; McLeod, Howard L.; Metspalu, Andres; Meulien, Pierre; Miyano, Satoru; Naparstek, Yaakov; O’Rourke, P. Pearl; Patrinos, George P.; Rehm, Heidi L.; Relling, Mary V.; Rennert, Gad; Rodriguez, Laura Lyman; Roden, Dan M.; Shuldiner, Alan R.; Sinha, Sukdev; Tan, Patrick; Ulfendahl, Mats; Ward, Robyn; Williams, Marc S.; Wong, John E.L.; Green, Eric D.; Ginsburg, Geoffrey S.

    2016-01-01

    Advances in high-throughput genomic technologies coupled with a growing number of genomic results potentially useful in clinical care have led to ground-breaking genomic medicine implementation programs in various nations. Many of these innovative programs capitalize on unique local capabilities arising from the structure of their health care systems or their cultural or political milieu, as well as from unusual burdens of disease or risk alleles. Many such programs are being conducted in relative isolation and might benefit from sharing of approaches and lessons learned in other nations. The National Human Genome Research Institute recently brought together 25 of these groups from around the world to describe and compare projects, examine the current state of implementation and desired near-term capabilities, and identify opportunities for collaboration to promote the responsible implementation of genomic medicine. The wide variety of nascent programs in diverse settings demonstrates that implementation of genomic medicine is expanding globally in varied and highly innovative ways. Opportunities for collaboration abound in the areas of evidence generation, health information technology, education, workforce development, pharmacogenomics, and policy and regulatory issues. Several international organizations that are already facilitating effective research collaborations should engage to ensure implementation proceeds collaboratively without potentially wasteful duplication. Efforts to coalesce these groups around concrete but compelling signature projects, such as global eradication of genetically-mediated drug reactions or developing a truly global genomic variant data resource across a wide number of ethnicities, would accelerate appropriate implementation of genomics to improve clinical care world-wide. PMID:26041702

  3. Exploration of plant genomes in the FLAGdb++ environment

    Directory of Open Access Journals (Sweden)

    Leplé Jean-Charles

    2011-03-01

    Full Text Available Abstract Background In the contexts of genomics, post-genomics and systems biology approaches, data integration presents a major concern. Databases provide crucial solutions: they store, organize and allow information to be queried, they enhance the visibility of newly produced data by comparing them with previously published results, and facilitate the exploration and development of both existing hypotheses and new ideas. Results The FLAGdb++ information system was developed with the aim of using whole plant genomes as physical references in order to gather and merge available genomic data from in silico or experimental approaches. Available through a JAVA application, original interfaces and tools assist the functional study of plant genes by considering them in their specific context: chromosome, gene family, orthology group, co-expression cluster and functional network. FLAGdb++ is mainly dedicated to the exploration of large gene groups in order to decipher functional connections, to highlight shared or specific structural or functional features, and to facilitate translational tasks between plant species (Arabidopsis thaliana, Oryza sativa, Populus trichocarpa and Vitis vinifera. Conclusion Combining original data with the output of experts and graphical displays that differ from classical plant genome browsers, FLAGdb++ presents a powerful complementary tool for exploring plant genomes and exploiting structural and functional resources, without the need for computer programming knowledge. First launched in 2002, a 15th version of FLAGdb++ is now available and comprises four model plant genomes and over eight million genomic features.

  4. VISTA - computational tools for comparative genomics

    Energy Technology Data Exchange (ETDEWEB)

    Frazer, Kelly A.; Pachter, Lior; Poliakov, Alexander; Rubin,Edward M.; Dubchak, Inna

    2004-01-01

    Comparison of DNA sequences from different species is a fundamental method for identifying functional elements in genomes. Here we describe the VISTA family of tools created to assist biologists in carrying out this task. Our first VISTA server at http://www-gsd.lbl.gov/VISTA/ was launched in the summer of 2000 and was designed to align long genomic sequences and visualize these alignments with associated functional annotations. Currently the VISTA site includes multiple comparative genomics tools and provides users with rich capabilities to browse pre-computed whole-genome alignments of large vertebrate genomes and other groups of organisms with VISTA Browser, submit their own sequences of interest to several VISTA servers for various types of comparative analysis, and obtain detailed comparative analysis results for a set of cardiovascular genes. We illustrate capabilities of the VISTA site by the analysis of a 180 kilobase (kb) interval on human chromosome 5 that encodes for the kinesin family member3A (KIF3A) protein.

  5. Genomics and the making of yeast biodiversity.

    Science.gov (United States)

    Hittinger, Chris Todd; Rokas, Antonis; Bai, Feng-Yan; Boekhout, Teun; Gonçalves, Paula; Jeffries, Thomas W; Kominek, Jacek; Lachance, Marc-André; Libkind, Diego; Rosa, Carlos A; Sampaio, José Paulo; Kurtzman, Cletus P

    2015-12-01

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces cerevisiae; the common human commensal and opportunistic pathogen, Candida albicans; and over 1000 other known species (with more continuing to be discovered). Yeasts are found in every biome and continent and are more genetically diverse than angiosperms or chordates. Ease of culture, simple life cycles, and small genomes (∼10-20Mbp) have made yeasts exceptional models for molecular genetics, biotechnology, and evolutionary genomics. Here we discuss recent developments in understanding the genomic underpinnings of the making of yeast biodiversity, comparing and contrasting natural and human-associated evolutionary processes. Only a tiny fraction of yeast biodiversity and metabolic capabilities has been tapped by industry and science. Expanding the taxonomic breadth of deep genomic investigations will further illuminate how genome function evolves to encode their diverse metabolisms and ecologies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Distinctive characters of Nostoc genomes in cyanolichens.

    Science.gov (United States)

    Gagunashvili, Andrey N; Andrésson, Ólafur S

    2018-06-05

    Cyanobacteria of the genus Nostoc are capable of forming symbioses with a wide range of organism, including a diverse assemblage of cyanolichens. Only certain lineages of Nostoc appear to be able to form a close, stable symbiosis, raising the question whether symbiotic competence is determined by specific sets of genes and functionalities. We present the complete genome sequencing, annotation and analysis of two lichen Nostoc strains. Comparison with other Nostoc genomes allowed identification of genes potentially involved in symbioses with a broad range of partners including lichen mycobionts. The presence of additional genes necessary for symbiotic competence is likely reflected in larger genome sizes of symbiotic Nostoc strains. Some of the identified genes are presumably involved in the initial recognition and establishment of the symbiotic association, while others may confer advantage to cyanobionts during cohabitation with a mycobiont in the lichen symbiosis. Our study presents the first genome sequencing and genome-scale analysis of lichen-associated Nostoc strains. These data provide insight into the molecular nature of the cyanolichen symbiosis and pinpoint candidate genes for further studies aimed at deciphering the genetic mechanisms behind the symbiotic competence of Nostoc. Since many phylogenetic studies have shown that Nostoc is a polyphyletic group that includes several lineages, this work also provides an improved molecular basis for demarcation of a Nostoc clade with symbiotic competence.

  7. Genome position specific priors for genomic prediction

    DEFF Research Database (Denmark)

    Brøndum, Rasmus Froberg; Su, Guosheng; Lund, Mogens Sandø

    2012-01-01

    casual mutation is different between the populations but affects the same gene. Proportions of a four-distribution mixture for SNP effects in segments of fixed size along the genome are derived from one population and set as location specific prior proportions of distributions of SNP effects...... for the target population. The model was tested using dairy cattle populations of different breeds: 540 Australian Jersey bulls, 2297 Australian Holstein bulls and 5214 Nordic Holstein bulls. The traits studied were protein-, fat- and milk yield. Genotypic data was Illumina 777K SNPs, real or imputed Results...

  8. Sauropod dinosaurs evolved moderately sized genomes unrelated to body size.

    Science.gov (United States)

    Organ, Chris L; Brusatte, Stephen L; Stein, Koen

    2009-12-22

    Sauropodomorph dinosaurs include the largest land animals to have ever lived, some reaching up to 10 times the mass of an African elephant. Despite their status defining the upper range for body size in land animals, it remains unknown whether sauropodomorphs evolved larger-sized genomes than non-avian theropods, their sister taxon, or whether a relationship exists between genome size and body size in dinosaurs, two questions critical for understanding broad patterns of genome evolution in dinosaurs. Here we report inferences of genome size for 10 sauropodomorph taxa. The estimates are derived from a Bayesian phylogenetic generalized least squares approach that generates posterior distributions of regression models relating genome size to osteocyte lacunae volume in extant tetrapods. We estimate that the average genome size of sauropodomorphs was 2.02 pg (range of species means: 1.77-2.21 pg), a value in the upper range of extant birds (mean = 1.42 pg, range: 0.97-2.16 pg) and near the average for extant non-avian reptiles (mean = 2.24 pg, range: 1.05-5.44 pg). The results suggest that the variation in size and architecture of genomes in extinct dinosaurs was lower than the variation found in mammals. A substantial difference in genome size separates the two major clades within dinosaurs, Ornithischia (large genomes) and Saurischia (moderate to small genomes). We find no relationship between body size and estimated genome size in extinct dinosaurs, which suggests that neutral forces did not dominate the evolution of genome size in this group.

  9. GenoSets: visual analytic methods for comparative genomics.

    Directory of Open Access Journals (Sweden)

    Aurora A Cain

    Full Text Available Many important questions in biology are, fundamentally, comparative, and this extends to our analysis of a growing number of sequenced genomes. Existing genomic analysis tools are often organized around literal views of genomes as linear strings. Even when information is highly condensed, these views grow cumbersome as larger numbers of genomes are added. Data aggregation and summarization methods from the field of visual analytics can provide abstracted comparative views, suitable for sifting large multi-genome datasets to identify critical similarities and differences. We introduce a software system for visual analysis of comparative genomics data. The system automates the process of data integration, and provides the analysis platform to identify and explore features of interest within these large datasets. GenoSets borrows techniques from business intelligence and visual analytics to provide a rich interface of interactive visualizations supported by a multi-dimensional data warehouse. In GenoSets, visual analytic approaches are used to enable querying based on orthology, functional assignment, and taxonomic or user-defined groupings of genomes. GenoSets links this information together with coordinated, interactive visualizations for both detailed and high-level categorical analysis of summarized data. GenoSets has been designed to simplify the exploration of multiple genome datasets and to facilitate reasoning about genomic comparisons. Case examples are included showing the use of this system in the analysis of 12 Brucella genomes. GenoSets software and the case study dataset are freely available at http://genosets.uncc.edu. We demonstrate that the integration of genomic data using a coordinated multiple view approach can simplify the exploration of large comparative genomic data sets, and facilitate reasoning about comparisons and features of interest.

  10. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2011-01-01

    The CMS Communications Group, established at the start of 2010, has been busy in all three areas of its responsibility: (1) Communications Infrastructure, (2) Information Systems, and (3) Outreach and Education. Communications Infrastructure There are now 55 CMS Centres worldwide that are well used by physicists working on remote CMS shifts, Computing operations, data quality monitoring, data analysis and outreach. The CMS Centre@CERN in Meyrin, is the centre of the CMS offline and computing operations, hosting dedicated analysis efforts such as during the CMS Heavy Ion lead-lead running. With a majority of CMS sub-detectors now operating in a “shifterless” mode, many monitoring operations are now routinely performed from there, rather than in the main Control Room at P5. The CMS Communications Group, CERN IT and the EVO team are providing excellent videoconferencing support for the rapidly-increasing number of CMS meetings. In parallel, CERN IT and ...

  11. Group therapy

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    Full text: In his review 'Genesis of Unified Gauge Theories' at the symposium in Honour of Abdus Salam (June, page 23), Tom Kibble of Imperial College, London, looked back to the physics events around Salam from 1959-67. He described how, in the early 1960s, people were pushing to enlarge the symmetry of strong interactions beyond the SU(2) of isospin and incorporate the additional strangeness quantum number. Kibble wrote - 'Salam had students working on every conceivable symmetry group. One of these was Yuval Ne'eman, who had the good fortune and/or prescience to work on SU(3). From that work, and of course from the independent work of Murray Gell- Mann, stemmed the Eightfold Way, with its triumphant vindication in the discovery of the omega-minus in 1964.' Yuval Ne'eman writes - 'I was the Defence Attaché at the Israeli Embassy in London and was admitted by Salam as a part-time graduate student when I arrived in 1958. I started research after resigning from the Embassy in May 1960. Salam suggested a problem: provide vector mesons with mass - the problem which was eventually solved by Higgs, Guralnik, Kibble,.... (as described by Kibble in his article). I explained to Salam that I had become interested in symmetry. Nobody at Imperial College at the time, other than Salam himself, was doing anything in groups, and attention further afield was focused on the rotation - SO(N) - groups. Reacting to my own half-baked schemes, Salam told me to forget about the rotation groups he taught us, and study group theory in depth, directing me to Eugene Dynkin's classification of Lie subalgebras, about which he had heard from Morton Hamermesh. I found Dynkin incomprehensible without first learning about Lie algebras from Henri Cartan's thesis, which luckily had been reproduced by Dynkin in his 1946 thesis, using his diagram method. From a copy of a translation of Dynkin's thesis which I found in the British Museum Library, I

  12. Genomic V exons from whole genome shotgun data in reptiles.

    Science.gov (United States)

    Olivieri, D N; von Haeften, B; Sánchez-Espinel, C; Faro, J; Gambón-Deza, F

    2014-08-01

    Reptiles and mammals diverged over 300 million years ago, creating two parallel evolutionary lineages amongst terrestrial vertebrates. In reptiles, two main evolutionary lines emerged: one gave rise to Squamata, while the other gave rise to Testudines, Crocodylia, and Aves. In this study, we determined the genomic variable (V) exons from whole genome shotgun sequencing (WGS) data in reptiles corresponding to the three main immunoglobulin (IG) loci and the four main T cell receptor (TR) loci. We show that Squamata lack the TRG and TRD genes, and snakes lack the IGKV genes. In representative species of Testudines and Crocodylia, the seven major IG and TR loci are maintained. As in mammals, genes of the IG loci can be grouped into well-defined IMGT clans through a multi-species phylogenetic analysis. We show that the reptilian IGHV and IGLV genes are distributed amongst the established mammalian clans, while their IGKV genes are found within a single clan, nearly exclusive from the mammalian sequences. The reptilian and mammalian TRAV genes cluster into six common evolutionary clades (since IMGT clans have not been defined for TR). In contrast, the reptilian TRBV genes cluster into three clades, which have few mammalian members. In this locus, the V exon sequences from mammals appear to have undergone different evolutionary diversification processes that occurred outside these shared reptilian clans. These sequences can be obtained in a freely available public repository (http://vgenerepertoire.org).

  13. [Genomic selection and its application].

    Science.gov (United States)

    Li, Heng-De; Bao, Zhen-Min; Sun, Xiao-Wen

    2011-12-01

    Selective breeding is very important in agricultural production and breeding value estimation is the core of selective breeding. With the development of genetic markers, especially high throughput genotyping technology, it becomes available to estimate breeding value at genome level, i.e. genomic selection (GS). In this review, the methods of GS was categorized into two groups: one is to predict genomic estimated breeding value (GEBV) based on the allele effect, such as least squares, random regression - best linear unbiased prediction (RR-BLUP), Bayes and principle component analysis, etc; the other is to predict GEBV with genetic relationship matrix, which constructs genetic relationship matrix via high throughput genetic markers and then predicts GEBV through linear mixed model, i.e. GBLUP. The basic principles of these methods were also introduced according to the above two classifications. Factors affecting GS accuracy include markers of type and density, length of haplotype, the size of reference population, the extent between marker-QTL and so on. Among the methods of GS, Bayes and GBLUP are usually more accurate than the others and least squares is the worst. GBLUP is time-efficient and can combine pedigree with genotypic information, hence it is superior to other methods. Although progress was made in GS, there are still some challenges, for examples, united breeding, long-term genetic gain with GS, and disentangling markers with and without contribution to the traits. GS has been applied in animal and plant breeding practice and also has the potential to predict genetic predisposition in humans and study evolutionary dynamics. GS, which is more precise than the traditional method, is a breakthrough at measuring genetic relationship. Therefore, GS will be a revolutionary event in the history of animal and plant breeding.

  14. Genomics of Preterm Birth

    Science.gov (United States)

    Swaggart, Kayleigh A.; Pavlicev, Mihaela; Muglia, Louis J.

    2015-01-01

    The molecular mechanisms controlling human birth timing at term, or resulting in preterm birth, have been the focus of considerable investigation, but limited insights have been gained over the past 50 years. In part, these processes have remained elusive because of divergence in reproductive strategies and physiology shown by model organisms, making extrapolation to humans uncertain. Here, we summarize the evolution of progesterone signaling and variation in pregnancy maintenance and termination. We use this comparative physiology to support the hypothesis that selective pressure on genomic loci involved in the timing of parturition have shaped human birth timing, and that these loci can be identified with comparative genomic strategies. Previous limitations imposed by divergence of mechanisms provide an important new opportunity to elucidate fundamental pathways of parturition control through increasing availability of sequenced genomes and associated reproductive physiology characteristics across diverse organisms. PMID:25646385

  15. Genomics of Salmonella Species

    Science.gov (United States)

    Canals, Rocio; McClelland, Michael; Santiviago, Carlos A.; Andrews-Polymenis, Helene

    Progress in the study of Salmonella survival, colonization, and virulence has increased rapidly with the advent of complete genome sequencing and higher capacity assays for transcriptomic and proteomic analysis. Although many of these techniques have yet to be used to directly assay Salmonella growth on foods, these assays are currently in use to determine Salmonella factors necessary for growth in animal models including livestock animals and in in vitro conditions that mimic many different environments. As sequencing of the Salmonella genome and microarray analysis have revolutionized genomics and transcriptomics of salmonellae over the last decade, so are new high-throughput sequencing technologies currently accelerating the pace of our studies and allowing us to approach complex problems that were not previously experimentally tractable.

  16. A Mitochondrial Genome of Rhyparochromidae (Hemiptera: Heteroptera) and a Comparative Analysis of Related Mitochondrial Genomes.

    Science.gov (United States)

    Li, Teng; Yang, Jie; Li, Yinwan; Cui, Ying; Xie, Qiang; Bu, Wenjun; Hillis, David M

    2016-10-19

    The Rhyparochromidae, the largest family of Lygaeoidea, encompasses more than 1,850 described species, but no mitochondrial genome has been sequenced to date. Here we describe the first mitochondrial genome for Rhyparochromidae: a complete mitochondrial genome of Panaorus albomaculatus (Scott, 1874). This mitochondrial genome is comprised of 16,345 bp, and contains the expected 37 genes and control region. The majority of the control region is made up of a large tandem-repeat region, which has a novel pattern not previously observed in other insects. The tandem-repeats region of P. albomaculatus consists of 53 tandem duplications (including one partial repeat), which is the largest number of tandem repeats among all the known insect mitochondrial genomes. Slipped-strand mispairing during replication is likely to have generated this novel pattern of tandem repeats. Comparative analysis of tRNA gene families in sequenced Pentatomomorpha and Lygaeoidea species shows that the pattern of nucleotide conservation is markedly higher on the J-strand. Phylogenetic reconstruction based on mitochondrial genomes suggests that Rhyparochromidae is not the sister group to all the remaining Lygaeoidea, and supports the monophyly of Lygaeoidea.

  17. Brief Guide to Genomics: DNA, Genes and Genomes

    Science.gov (United States)

    ... clinic. Most new drugs based on genome-based research are estimated to be at least 10 to 15 years away, though recent genome-driven efforts in lipid-lowering therapy have considerably shortened that interval. According ...

  18. Genomic Prediction in Barley

    DEFF Research Database (Denmark)

    Edriss, Vahid; Cericola, Fabio; Jensen, Jens D

    2015-01-01

    to next generation. The main goal of this study was to see the potential of using genomic prediction in a commercial Barley breeding program. The data used in this study was from Nordic Seed company which is located in Denmark. Around 350 advanced lines were genotyped with 9K Barely chip from Illumina....... Traits used in this study were grain yield, plant height and heading date. Heading date is number days it takes after 1st June for plant to head. Heritabilities were 0.33, 0.44 and 0.48 for yield, height and heading, respectively for the average of nine plots. The GBLUP model was used for genomic...

  19. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium.

    Science.gov (United States)

    Machado, Henrique; Gram, Lone

    2017-01-01

    Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur , amino-acid usage, ANI), which allowed us to identify two misidentified strains. Genome analyses also revealed occurrence of higher and lower GC content clades, correlating with phylogenetic clusters. Pan- and core-genome analysis revealed the conservation of 25% of the genome throughout the genus, with a large and open pan-genome. The major source of genomic diversity could be traced to the smaller chromosome and plasmids. Several of the physiological traits studied in the genus did not correlate with phylogenetic data. Since horizontal gene transfer (HGT) is often suggested as a source of genetic diversity and a potential driver of genomic evolution in bacterial species, we looked into evidence of such in Photobacterium genomes. Genomic islands were the source of genomic differences between strains of the same species. Also, we found transposase genes and CRISPR arrays that suggest multiple encounters with foreign DNA. Presence of genomic exchange traits was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.

  20. Pervasive, Genome-Wide Transcription in the Organelle Genomes of Diverse Plastid-Bearing Protists

    Directory of Open Access Journals (Sweden)

    Matheus Sanitá Lima

    2017-11-01

    Full Text Available Organelle genomes are among the most sequenced kinds of chromosome. This is largely because they are small and widely used in molecular studies, but also because next-generation sequencing technologies made sequencing easier, faster, and cheaper. However, studies of organelle RNA have not kept pace with those of DNA, despite huge amounts of freely available eukaryotic RNA-sequencing (RNA-seq data. Little is known about organelle transcription in nonmodel species, and most of the available eukaryotic RNA-seq data have not been mined for organelle transcripts. Here, we use publicly available RNA-seq experiments to investigate organelle transcription in 30 diverse plastid-bearing protists with varying organelle genomic architectures. Mapping RNA-seq data to organelle genomes revealed pervasive, genome-wide transcription, regardless of the taxonomic grouping, gene organization, or noncoding content. For every species analyzed, transcripts covered ≥85% of the mitochondrial and/or plastid genomes (all of which were ≤105 kb, indicating that most of the organelle DNA—coding and noncoding—is transcriptionally active. These results follow earlier studies of model species showing that organellar transcription is coupled and ubiquitous across the genome, requiring significant downstream processing of polycistronic transcripts. Our findings suggest that noncoding organelle DNA can be transcriptionally active, raising questions about the underlying function of these transcripts and underscoring the utility of publicly available RNA-seq data for recovering complete genome sequences. If pervasive transcription is also found in bigger organelle genomes (>105 kb and across a broader range of eukaryotes, this could indicate that noncoding organelle RNAs are regulating fundamental processes within eukaryotic cells.

  1. Pervasive, Genome-Wide Transcription in the Organelle Genomes of Diverse Plastid-Bearing Protists.

    Science.gov (United States)

    Sanitá Lima, Matheus; Smith, David Roy

    2017-11-06

    Organelle genomes are among the most sequenced kinds of chromosome. This is largely because they are small and widely used in molecular studies, but also because next-generation sequencing technologies made sequencing easier, faster, and cheaper. However, studies of organelle RNA have not kept pace with those of DNA, despite huge amounts of freely available eukaryotic RNA-sequencing (RNA-seq) data. Little is known about organelle transcription in nonmodel species, and most of the available eukaryotic RNA-seq data have not been mined for organelle transcripts. Here, we use publicly available RNA-seq experiments to investigate organelle transcription in 30 diverse plastid-bearing protists with varying organelle genomic architectures. Mapping RNA-seq data to organelle genomes revealed pervasive, genome-wide transcription, regardless of the taxonomic grouping, gene organization, or noncoding content. For every species analyzed, transcripts covered ≥85% of the mitochondrial and/or plastid genomes (all of which were ≤105 kb), indicating that most of the organelle DNA-coding and noncoding-is transcriptionally active. These results follow earlier studies of model species showing that organellar transcription is coupled and ubiquitous across the genome, requiring significant downstream processing of polycistronic transcripts. Our findings suggest that noncoding organelle DNA can be transcriptionally active, raising questions about the underlying function of these transcripts and underscoring the utility of publicly available RNA-seq data for recovering complete genome sequences. If pervasive transcription is also found in bigger organelle genomes (>105 kb) and across a broader range of eukaryotes, this could indicate that noncoding organelle RNAs are regulating fundamental processes within eukaryotic cells. Copyright © 2017 Sanitá Lima and Smith.

  2. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2010-01-01

    The CMS Communications Group, established at the start of 2010, has been strengthening the activities in all three areas of its responsibility: (1) Communications Infrastructure, (2) Information Systems, and (3) Outreach and Education. Communications Infrastructure The Communications Group has invested a lot of effort to support the operations needs of CMS. Hence, the CMS Centres where physicists work on remote CMS shifts, Data Quality Monitoring, and Data Analysis are running very smoothly. There are now 55 CMS Centres worldwide, up from just 16 at the start of CMS data-taking. The latest to join are Imperial College London, the University of Iowa, and the Università di Napoli. The CMS Centre@CERN in Meyrin, which is now full repaired after the major flooding at the beginning of the year, has been at the centre of CMS offline and computing operations, most recently hosting a large fraction of the CMS Heavy Ion community during the lead-lead run. A number of sub-detector shifts can now take pla...

  3. Group play

    DEFF Research Database (Denmark)

    Tychsen, Anders; Hitchens, Michael; Brolund, Thea

    2008-01-01

    Role-playing games (RPGs) are a well-known game form, existing in a number of formats, including tabletop, live action, and various digital forms. Despite their popularity, empirical studies of these games are relatively rare. In particular there have been few examinations of the effects of the v......Role-playing games (RPGs) are a well-known game form, existing in a number of formats, including tabletop, live action, and various digital forms. Despite their popularity, empirical studies of these games are relatively rare. In particular there have been few examinations of the effects...... of the various formats used by RPGs on the gaming experience. This article presents the results of an empirical study, examining how multi-player tabletop RPGs are affected as they are ported to the digital medium. Issues examined include the use of disposition assessments to predict play experience, the effect...... of group dynamics, the influence of the fictional game characters and the comparative play experience between the two formats. The results indicate that group dynamics and the relationship between the players and their digital characters, are integral to the quality of the gaming experience in multiplayer...

  4. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2011-01-01

    The CMS Communications Group has been busy in all three areas of its responsibility: (1) Communications Infrastructure, (2) Information Systems, and (3) Outreach and Education. Communications Infrastructure The 55 CMS Centres worldwide are well used by physicists working on remote CMS shifts, Computing operations, data quality monitoring, data analysis and outreach. The CMS Centre@CERN in Meyrin, is the centre of the CMS Offline and Computing operations, and a number of subdetector shifts can now take place there, rather than in the main Control Room at P5. A new CMS meeting room has been equipped for videoconferencing in building 42, next to building 40. Our building 28 meeting room and the facilities at P5 will be refurbished soon and plans are underway to steadily upgrade the ageing equipment in all 15 CMS meeting rooms at CERN. The CMS evaluation of the Vidyo tool indicates that it is not yet ready to be considered as a potential replacement for EVO. The Communications Group provides the CMS-TV (web) cha...

  5. A Blueprint for Genomic Nursing Science

    Science.gov (United States)

    Calzone, Kathleen A.; Jenkins, Jean; Bakos, Alexis D.; Cashion, Ann; Donaldson, Nancy; Feero, Greg; Feetham, Suzanne; Grady, Patricia A.; Hinshaw, Ada Sue; Knebel, Ann R.; Robinson, Nellie; Ropka, Mary E.; Seibert, Diane; Stevens, Kathleen R.; Tully, Lois A.; Webb, Jo Ann

    2012-01-01

    Purpose This article reports on recommendations arising from an invitational workshop series held at the National Institutes of Health for the purposes of identifying critical genomics problems important to the health of the public that can be addressed through nursing science. The overall purpose of the Genomic Nursing State of the Science Initiative is to establish a nursing research blueprint based on gaps in the evidence and expert evaluation of the current state of the science and through public comment. Organizing Constructs A Genomic Nursing State of the Science Advisory Panel was convened in 2012 to develop the nursing research blueprint. The Advisory Panel, which met via two webinars and two in-person meetings, considered existing evidence from evidence reviews, testimony from key stakeholder groups, presentations from experts in research synthesis, and public comment. Findings The genomic nursing science blueprint arising from the Genomic Nursing State of Science Advisory Panel focuses on biologic plausibility studies as well as interventions likely to improve a variety of outcomes (e.g., clinical, economic, environmental). It also includes all care settings and diverse populations. The focus is on (a) the client, defined as person, family, community, or population; (b) the context, targeting informatics support systems, capacity building, education, and environmental influences; and (c) cross-cutting themes. It was agreed that building capacity to measure the impact of nursing actions on costs, quality, and outcomes of patient care is a strategic and scientific priority if findings are to be synthesized and aggregated to inform practice and policy. Conclusions The genomic nursing science blueprint provides the framework for furthering genomic nursing science to improve health outcomes. This blueprint is an independent recommendation of the Advisory Panel with input from the public and is not a policy statement of the National Institutes of Health or the

  6. phiGENOME: an integrative navigation throughout bacteriophage genomes.

    Science.gov (United States)

    Stano, Matej; Klucar, Lubos

    2011-11-01

    phiGENOME is a web-based genome browser generating dynamic and interactive graphical representation of phage genomes stored in the phiSITE, database of gene regulation in bacteriophages. phiGENOME is an integral part of the phiSITE web portal (http://www.phisite.org/phigenome) and it was optimised for visualisation of phage genomes with the emphasis on the gene regulatory elements. phiGENOME consists of three components: (i) genome map viewer built using Adobe Flash technology, providing dynamic and interactive graphical display of phage genomes; (ii) sequence browser based on precisely formatted HTML tags, providing detailed exploration of genome features on the sequence level and (iii) regulation illustrator, based on Scalable Vector Graphics (SVG) and designed for graphical representation of gene regulations. Bringing 542 complete genome sequences accompanied with their rich annotations and references, makes phiGENOME a unique information resource in the field of phage genomics. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. MIPS: a database for protein sequences and complete genomes.

    Science.gov (United States)

    Mewes, H W; Hani, J; Pfeiffer, F; Frishman, D

    1998-01-01

    The MIPS group [Munich Information Center for Protein Sequences of the German National Center for Environment and Health (GSF)] at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, is involved in a number of data collection activities, including a comprehensive database of the yeast genome, a database reflecting the progress in sequencing the Arabidopsis thaliana genome, the systematic analysis of other small genomes and the collection of protein sequence data within the framework of the PIR-International Protein Sequence Database (described elsewhere in this volume). Through its WWW server (http://www.mips.biochem.mpg.de ) MIPS provides access to a variety of generic databases, including a database of protein families as well as automatically generated data by the systematic application of sequence analysis algorithms. The yeast genome sequence and its related information was also compiled on CD-ROM to provide dynamic interactive access to the 16 chromosomes of the first eukaryotic genome unraveled. PMID:9399795

  8. Illuminating the Druggable Genome (IDG)

    Data.gov (United States)

    Federal Laboratory Consortium — Results from the Human Genome Project revealed that the human genome contains 20,000 to 25,000 genes. A gene contains (encodes) the information that each cell uses...

  9. Leadership, Literacy, and Translational Expertise in Genomics: Challenges and Opportunities for Social Work.

    Science.gov (United States)

    Werner-Lin, Allison; McCoyd, Judith L M; Doyle, Maya H; Gehlert, Sarah J

    2016-08-01

    The transdisciplinary field of genomics is revolutionizing conceptualizations of health, mental health, family formation, and public policy. Many professions must rapidly acquire genomic expertise to maintain state-of-the-art knowledge in their practice. Calls for social workers to build genomic capacity come regularly, yet social work education has not prepared practitioners to join the genomics workforce in providing socially just, ethically informed care to all clients, particularly those from vulnerable and marginalized groups. The authors suggest a set of action steps for bringing social work skills and practice into the 21st century. They propose that good genomic practice entails bringing social work values, skills, and behaviors to genomics. With education and training, social workers may facilitate socially just dissemination of genomic knowledge and services across practice domains. Increased genomic literacy will support the profession's mission to address disparities in health, health care access, and mortality. © 2016 National Association of Social Workers.

  10. KGCAK: a K-mer based database for genome-wide phylogeny and complexity evaluation.

    Science.gov (United States)

    Wang, Dapeng; Xu, Jiayue; Yu, Jun

    2015-09-16

    The K-mer approach, treating genomic sequences as simple characters and counting the relative abundance of each string upon a fixed K, has been extensively applied to phylogeny inference for genome assembly, annotation, and comparison. To meet increasing demands for comparing large genome sequences and to promote the use of the K-mer approach, we develop a versatile database, KGCAK ( http://kgcak.big.ac.cn/KGCAK/ ), containing ~8,000 genomes that include genome sequences of diverse life forms (viruses, prokaryotes, protists, animals, and plants) and cellular organelles of eukaryotic lineages. It builds phylogeny based on genomic elements in an alignment-free fashion and provides in-depth data processing enabling users to compare the complexity of genome sequences based on K-mer distribution. We hope that KGCAK becomes a powerful tool for exploring relationship within and among groups of species in a tree of life based on genomic data.

  11. Genomic prediction using subsampling.

    Science.gov (United States)

    Xavier, Alencar; Xu, Shizhong; Muir, William; Rainey, Katy Martin

    2017-03-24

    Genome-wide assisted selection is a critical tool for the genetic improvement of plants and animals. Whole-genome regression models in Bayesian framework represent the main family of prediction methods. Fitting such models with a large number of observations involves a prohibitive computational burden. We propose the use of subsampling bootstrap Markov chain in genomic prediction. Such method consists of fitting whole-genome regression models by subsampling observations in each round of a Markov Chain Monte Carlo. We evaluated the effect of subsampling bootstrap on prediction and computational parameters. Across datasets, we observed an optimal subsampling proportion of observations around 50% with replacement, and around 33% without replacement. Subsampling provided a substantial decrease in computation time, reducing the time to fit the model by half. On average, losses on predictive properties imposed by subsampling were negligible, usually below 1%. For each dataset, an optimal subsampling point that improves prediction properties was observed, but the improvements were also negligible. Combining subsampling with Gibbs sampling is an interesting ensemble algorithm. The investigation indicates that the subsampling bootstrap Markov chain algorithm substantially reduces computational burden associated with model fitting, and it may slightly enhance prediction properties.

  12. The Lotus japonicus genome

    DEFF Research Database (Denmark)

    Fabaceae, groundbreaking genetic and genomic research has established a significant body of knowledge on Lotus japonicus, which was adopted as a model species more than 20 years ago. The diverse nature of legumes means that such research has a wide potential and agricultural impact, for example...

  13. Genomic taxonomy of vibrios

    DEFF Research Database (Denmark)

    Thompson, Cristiane C.; Vicente, Ana Carolina P.; Souza, Rangel C.

    2009-01-01

    BACKGROUND: Vibrio taxonomy has been based on a polyphasic approach. In this study, we retrieve useful taxonomic information (i.e. data that can be used to distinguish different taxonomic levels, such as species and genera) from 32 genome sequences of different vibrio species. We use a variety of...

  14. The Genome Atlas Resource

    DEFF Research Database (Denmark)

    Azam Qureshi, Matloob; Rotenberg, Eva; Stærfeldt, Hans Henrik

    2010-01-01

    with scripts and algorithms developed in a variety of programming languages at the Centre for Biological Sequence Analysis in order to create a three-tier software application for genome analysis. The results are made available via a web interface developed in Java, PHP and Perl CGI. User...

  15. Genomic Signatures of Reinforcement

    Directory of Open Access Journals (Sweden)

    Austin G. Garner

    2018-04-01

    Full Text Available Reinforcement is the process by which selection against hybridization increases reproductive isolation between taxa. Much research has focused on demonstrating the existence of reinforcement, yet relatively little is known about the genetic basis of reinforcement or the evolutionary conditions under which reinforcement can occur. Inspired by reinforcement’s characteristic phenotypic pattern of reproductive trait divergence in sympatry but not in allopatry, we discuss whether reinforcement also leaves a distinct genomic pattern. First, we describe three patterns of genetic variation we expect as a consequence of reinforcement. Then, we discuss a set of alternative processes and complicating factors that may make the identification of reinforcement at the genomic level difficult. Finally, we consider how genomic analyses can be leveraged to inform if and to what extent reinforcement evolved in the face of gene flow between sympatric lineages and between allopatric and sympatric populations of the same lineage. Our major goals are to understand if genome scans for particular patterns of genetic variation could identify reinforcement, isolate the genetic basis of reinforcement, or infer the conditions under which reinforcement evolved.

  16. Better chocolate through genomics

    Science.gov (United States)

    Theobroma cacao, the cacao or chocolate tree, is a tropical understory tree whose seeds are used to make chocolate. And like any important crop, cacao is the subject of much research. On September 15, 2010, scientists publicly released a preliminary sequence of the cacao genome--which contains all o...

  17. Functional genomics of tomato

    Indian Academy of Sciences (India)

    2014-10-20

    Oct 20, 2014 ... 1Repository of Tomato Genomics Resources, Department of Plant Sciences, School .... Due to its position at the crossroads of Sanger's sequencing .... replacement for the microarray-based expression profiling. .... during RNA fragmentation step prior to library construction, ...... tomato pollen as a test case.

  18. Genomic Signatures of Reinforcement

    Science.gov (United States)

    Goulet, Benjamin E.

    2018-01-01

    Reinforcement is the process by which selection against hybridization increases reproductive isolation between taxa. Much research has focused on demonstrating the existence of reinforcement, yet relatively little is known about the genetic basis of reinforcement or the evolutionary conditions under which reinforcement can occur. Inspired by reinforcement’s characteristic phenotypic pattern of reproductive trait divergence in sympatry but not in allopatry, we discuss whether reinforcement also leaves a distinct genomic pattern. First, we describe three patterns of genetic variation we expect as a consequence of reinforcement. Then, we discuss a set of alternative processes and complicating factors that may make the identification of reinforcement at the genomic level difficult. Finally, we consider how genomic analyses can be leveraged to inform if and to what extent reinforcement evolved in the face of gene flow between sympatric lineages and between allopatric and sympatric populations of the same lineage. Our major goals are to understand if genome scans for particular patterns of genetic variation could identify reinforcement, isolate the genetic basis of reinforcement, or infer the conditions under which reinforcement evolved. PMID:29614048

  19. Comparative Genomics of Eukaryotes.

    NARCIS (Netherlands)

    Noort, V. van

    2007-01-01

    This thesis focuses on developing comparative genomics methods in eukaryotes, with an emphasis on applications for gene function prediction and regulatory element detection. In the past, methods have been developed to predict functional associations between gene pairs in prokaryotes. The challenge

  20. Searching for genomic constraints

    Energy Technology Data Exchange (ETDEWEB)

    Lio` , P [Cambridge, Univ. (United Kingdom). Genetics Dept.; Ruffo, S [Florence, Univ. (Italy). Fac. di Ingegneria. Dipt. di Energetica ` S. Stecco`

    1998-01-01

    The authors have analyzed general properties of very long DNA sequences belonging to simple and complex organisms, by using different correlation methods. They have distinguished those base compositional rules that concern the entire genome which they call `genomic constraints` from the rules that depend on the `external natural selection` acting on single genes, i. e. protein-centered constraints. They show that G + C content, purine / pyrimidine distributions and biological complexity of the organism are the most important factors which determine base compositional rules and genome complexity. Three main facts are here reported: bacteria with high G + C content have more restrictions on base composition than those with low G + C content; at constant G + C content more complex organisms, ranging from prokaryotes to higher eukaryotes (e.g. human) display an increase of repeats 10-20 nucleotides long, which are also partly responsible for long-range correlations; work selection of length 3 to 10 is stronger in human and in bacteria for two distinct reasons. With respect to previous studies, they have also compared the genomic sequence of the archeon Methanococcus jannaschii with those of bacteria and eukaryotes: it shows sometimes an intermediate statistical behaviour.

  1. Searching for genomic constraints

    International Nuclear Information System (INIS)

    Lio', P.; Ruffo, S.

    1998-01-01

    The authors have analyzed general properties of very long DNA sequences belonging to simple and complex organisms, by using different correlation methods. They have distinguished those base compositional rules that concern the entire genome which they call 'genomic constraints' from the rules that depend on the 'external natural selection' acting on single genes, i. e. protein-centered constraints. They show that G + C content, purine / pyrimidine distributions and biological complexity of the organism are the most important factors which determine base compositional rules and genome complexity. Three main facts are here reported: bacteria with high G + C content have more restrictions on base composition than those with low G + C content; at constant G + C content more complex organisms, ranging from prokaryotes to higher eukaryotes (e.g. human) display an increase of repeats 10-20 nucleotides long, which are also partly responsible for long-range correlations; work selection of length 3 to 10 is stronger in human and in bacteria for two distinct reasons. With respect to previous studies, they have also compared the genomic sequence of the archeon Methanococcus jannaschii with those of bacteria and eukaryotes: it shows sometimes an intermediate statistical behaviour

  2. Genomic sequencing in clinical trials

    OpenAIRE

    Mestan, Karen K; Ilkhanoff, Leonard; Mouli, Samdeep; Lin, Simon

    2011-01-01

    Abstract Human genome sequencing is the process by which the exact order of nucleic acid base pairs in the 24 human chromosomes is determined. Since the completion of the Human Genome Project in 2003, genomic sequencing is rapidly becoming a major part of our translational research efforts to understand and improve human health and disease. This article reviews the current and future directions of clinical research with respect to genomic sequencing, a technology that is just beginning to fin...

  3. Statistical Methods in Integrative Genomics

    Science.gov (United States)

    Richardson, Sylvia; Tseng, George C.; Sun, Wei

    2016-01-01

    Statistical methods in integrative genomics aim to answer important biology questions by jointly analyzing multiple types of genomic data (vertical integration) or aggregating the same type of data across multiple studies (horizontal integration). In this article, we introduce different types of genomic data and data resources, and then review statistical methods of integrative genomics, with emphasis on the motivation and rationale of these methods. We conclude with some summary points and future research directions. PMID:27482531

  4. From plant genomes to phenotypes

    OpenAIRE

    Bolger, Marie; Gundlach, Heidrun; Scholz, Uwe; Mayer, Klaus; Usadel, Björn; Schwacke, Rainer; Schmutzer, Thomas; Chen, Jinbo; Arend, Daniel; Oppermann, Markus; Weise, Stephan; Lange, Matthias; Fiorani, Fabio; Spannagl, Manuel

    2017-01-01

    Recent advances in sequencing technologies have greatly accelerated the rate of plant genome and applied breeding research. Despite this advancing trend, plant genomes continue to present numerous difficulties to the standard tools and pipelines not only for genome assembly but also gene annotation and downstream analysis.Here we give a perspective on tools, resources and services necessary to assemble and analyze plant genomes and link them to plant phenotypes.

  5. Comparison of carnivore, omnivore, and herbivore mammalian genomes with a new leopard assembly

    OpenAIRE

    Kim, Soonok; Cho, Yun Sung; Kim, Hak-Min; Chung, Oksung; Kim, Hyunho; Jho, Sungwoong; Seomun, Hong; Kim, Jeongho; Bang, Woo Young; Kim, Changmu; An, Junghwa; Bae, Chang Hwan; Bhak, Youngjune; Jeon, Sungwon; Yoon, Hyejun

    2016-01-01

    Background: There are three main dietary groups in mammals: carnivores, omnivores, and herbivores. Currently, there is limited comparative genomics insight into the evolution of dietary specializations in mammals. Due to recent advances in sequencing technologies, we were able to perform in-depth whole genome analyses of representatives of these three dietary groups. Results: We investigated the evolution of carnivory by comparing 18 representative genomes from across Mammalia with carnivorou...

  6. Role of transposon-derived small RNAs in the interplay between genomes and parasitic DNA in rice.

    Directory of Open Access Journals (Sweden)

    Misuzu Nosaka

    2012-09-01

    Full Text Available RNA silencing is a defense system against "genomic parasites" such as transposable elements (TE, which are potentially harmful to host genomes. In plants, transcripts from TEs induce production of double-stranded RNAs (dsRNAs and are processed into small RNAs (small interfering RNAs, siRNAs that suppress TEs by RNA-directed DNA methylation. Thus, the majority of TEs are epigenetically silenced. On the other hand, most of the eukaryotic genome is composed of TEs and their remnants, suggesting that TEs have evolved countermeasures against host-mediated silencing. Under some circumstances, TEs can become active and increase in copy number. Knowledge is accumulating on the mechanisms of TE silencing by the host; however, the mechanisms by which TEs counteract silencing are poorly understood. Here, we show that a class of TEs in rice produces a microRNA (miRNA to suppress host silencing. Members of the microRNA820 (miR820 gene family are located within CACTA DNA transposons in rice and target a de novo DNA methyltransferase gene, OsDRM2, one of the components of epigenetic silencing. We confirmed that miR820 negatively regulates the expression of OsDRM2. In addition, we found that expression levels of various TEs are increased quite sensitively in response to decreased OsDRM2 expression and DNA methylation at TE loci. Furthermore, we found that the nucleotide sequence of miR820 and its recognition site within the target gene in some Oryza species have co-evolved to maintain their base-pairing ability. The co-evolution of these sequences provides evidence for the functionality of this regulation. Our results demonstrate how parasitic elements in the genome escape the host's defense machinery. Furthermore, our analysis of the regulation of OsDRM2 by miR820 sheds light on the action of transposon-derived small RNAs, not only as a defense mechanism for host genomes but also as a regulator of interactions between hosts and their parasitic elements.

  7. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2010-01-01

    The recently established CMS Communications Group, led by Lucas Taylor, has been busy in all three of its main are areas of responsibility: Communications Infrastructure, Information Systems, and Outreach and Education Communications Infrastructure The damage caused by the flooding of the CMS Centre@CERN on 21st December has been completely repaired and all systems are back in operation. Major repairs were made to the roofs, ceilings and one third of the floor had to be completely replaced. Throughout these works, the CMS Centre was kept operating and even hosted a major press event for first 7 TeV collisions, as described below. Incremental work behind the scenes is steadily improving the quality of the CMS communications infrastructure, particularly Webcasting, video conferencing, and meeting rooms at CERN. CERN/IT is also deploying a pilot service of a new videoconference tool called Vidyo, to assess whether it might provide an enhanced service at a lower cost, compared to the EVO tool currently in w...

  8. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2011-01-01

    Communications Infrastructure The 55 CMS Centres worldwide are well used by physicists working on remote CMS shifts, Computing operations, data quality monitoring, data analysis and outreach. The CMS Centre@CERN in Meyrin is particularly busy at the moment, hosting about 50 physicists taking part in the heavy-ion data-taking and analysis. Three new CMS meeting room will be equipped for videoconferencing in early 2012: 40/5B-08, 42/R-031, and 28/S-029. The CMS-TV service showing LHC Page 1, CMS Page 1, etc. (http://cmsdoc.cern.ch/cmscc/projector/index.jsp) is now also available for mobile devices: http://cern.ch/mcmstv. Figure 12: Screenshots of CMS-TV for mobile devices Information Systems CMS has a new web site: (http://cern.ch/cms) using a modern web Content Management System to ensure content and links are managed and updated easily and coherently. It covers all CMS sub-projects and groups, replacing the iCMS internal pages. It also incorporates the existing CMS public web site (http:/...

  9. COMMUNICATIONS GROUP

    CERN Multimedia

    L. Taylor

    2012-01-01

      Outreach and Education We are fortunate that our research has captured the public imagination, even though this inevitably puts us under the global media spotlight, as we saw with the Higgs seminar at CERN in December, which had 110,000 distinct webcast viewers. The media interest was huge with 71 media organisations registering to come to CERN to cover the Higgs seminar, which was followed by a press briefing with the DG and Spokespersons. This event resulted in about 2,000 generally positive stories in the global media. For this seminar, the CMS Communications Group prepared up-to-date news and public material, including links to the CMS results, animations and event displays [http://cern.ch/go/Ch8thttp://cern.ch/go/Ch8t]. There were 44,000 page-views on the CMS public website, with the Higgs news article being by far the most popular item. CMS event displays from iSpy are fast becoming the iconic media images, featuring on numerous major news outlets (BBC, CNN, MSN...) as well as in the sci...

  10. A Thousand Fly Genomes: An Expanded Drosophila Genome Nexus.

    Science.gov (United States)

    Lack, Justin B; Lange, Jeremy D; Tang, Alison D; Corbett-Detig, Russell B; Pool, John E

    2016-12-01

    The Drosophila Genome Nexus is a population genomic resource that provides D. melanogaster genomes from multiple sources. To facilitate comparisons across data sets, genomes are aligned using a common reference alignment pipeline which involves two rounds of mapping. Regions of residual heterozygosity, identity-by-descent, and recent population admixture are annotated to enable data filtering based on the user's needs. Here, we present a significant expansion of the Drosophila Genome Nexus, which brings the current data object to a total of 1,121 wild-derived genomes. New additions include 305 previously unpublished genomes from inbred lines representing six population samples in Egypt, Ethiopia, France, and South Africa, along with another 193 genomes added from recently-published data sets. We also provide an aligned D. simulans genome to facilitate divergence comparisons. This improved resource will broaden the range of population genomic questions that can addressed from multi-population allele frequencies and haplotypes in this model species. The larger set of genomes will also enhance the discovery of functionally relevant natural variation that exists within and between populations. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Elevated Rate of Genome Rearrangements in Radiation-Resistant Bacteria.

    Science.gov (United States)

    Repar, Jelena; Supek, Fran; Klanjscek, Tin; Warnecke, Tobias; Zahradka, Ksenija; Zahradka, Davor

    2017-04-01

    A number of bacterial, archaeal, and eukaryotic species are known for their resistance to ionizing radiation. One of the challenges these species face is a potent environmental source of DNA double-strand breaks, potential drivers of genome structure evolution. Efficient and accurate DNA double-strand break repair systems have been demonstrated in several unrelated radiation-resistant species and are putative adaptations to the DNA damaging environment. Such adaptations are expected to compensate for the genome-destabilizing effect of environmental DNA damage and may be expected to result in a more conserved gene order in radiation-resistant species. However, here we show that rates of genome rearrangements, measured as loss of gene order conservation with time, are higher in radiation-resistant species in multiple, phylogenetically independent groups of bacteria. Comparison of indicators of selection for genome organization between radiation-resistant and phylogenetically matched, nonresistant species argues against tolerance to disruption of genome structure as a strategy for radiation resistance. Interestingly, an important mechanism affecting genome rearrangements in prokaryotes, the symmetrical inversions around the origin of DNA replication, shapes genome structure of both radiation-resistant and nonresistant species. In conclusion, the opposing effects of environmental DNA damage and DNA repair result in elevated rates of genome rearrangements in radiation-resistant bacteria. Copyright © 2017 Repar et al.

  12. Highly variable rates of genome rearrangements between hemiascomycetous yeast lineages.

    Directory of Open Access Journals (Sweden)

    2006-03-01

    Full Text Available Hemiascomycete yeasts cover an evolutionary span comparable to that of the entire phylum of chordates. Since this group currently contains the largest number of complete genome sequences it presents unique opportunities to understand the evolution of genome organization in eukaryotes. We inferred rates of genome instability on all branches of a phylogenetic tree for 11 species and calculated species-specific rates of genome rearrangements. We characterized all inversion events that occurred within synteny blocks between six representatives of the different lineages. We show that the rates of macro- and microrearrangements of gene order are correlated within individual lineages but are highly variable across different lineages. The most unstable genomes correspond to the pathogenic yeasts Candida albicans and Candida glabrata. Chromosomal maps have been intensively shuffled by numerous interchromosomal rearrangements, even between species that have retained a very high physical fraction of their genomes within small synteny blocks. Despite this intensive reshuffling of gene positions, essential genes, which cluster in low recombination regions in the genome of Saccharomyces cerevisiae, tend to remain syntenic during evolution. This work reveals that the high plasticity of eukaryotic genomes results from rearrangement rates that vary between lineages but also at different evolutionary times of a given lineage.

  13. Recent updates and developments to plant genome size databases

    Science.gov (United States)

    Garcia, Sònia; Leitch, Ilia J.; Anadon-Rosell, Alba; Canela, Miguel Á.; Gálvez, Francisco; Garnatje, Teresa; Gras, Airy; Hidalgo, Oriane; Johnston, Emmeline; Mas de Xaxars, Gemma; Pellicer, Jaume; Siljak-Yakovlev, Sonja; Vallès, Joan; Vitales, Daniel; Bennett, Michael D.

    2014-01-01

    Two plant genome size databases have been recently updated and/or extended: the Plant DNA C-values database (http://data.kew.org/cvalues), and GSAD, the Genome Size in Asteraceae database (http://www.asteraceaegenomesize.com). While the first provides information on nuclear DNA contents across land plants and some algal groups, the second is focused on one of the largest and most economically important angiosperm families, Asteraceae. Genome size data have numerous applications: they can be used in comparative studies on genome evolution, or as a tool to appraise the cost of whole-genome sequencing programs. The growing interest in genome size and increasing rate of data accumulation has necessitated the continued update of these databases. Currently, the Plant DNA C-values database (Release 6.0, Dec. 2012) contains data for 8510 species, while GSAD has 1219 species (Release 2.0, June 2013), representing increases of 17 and 51%, respectively, in the number of species with genome size data, compared with previous releases. Here we provide overviews of the most recent releases of each database, and outline new features of GSAD. The latter include (i) a tool to visually compare genome size data between species, (ii) the option to export data and (iii) a webpage containing information about flow cytometry protocols. PMID:24288377

  14. Comparative genomics of chondrichthyan Hoxa clusters

    Directory of Open Access Journals (Sweden)

    Zhong Ying-Fu

    2009-09-01

    Full Text Available Abstract Background The chondrichthyan or cartilaginous fish (chimeras, sharks, skates and rays occupy an important phylogenetic position as the sister group to all other jawed vertebrates and as an early lineage to diverge from the vertebrate lineage following two whole genome duplication events in vertebrate evolution. There have been few comparative genomic analyses incorporating data from chondrichthyan fish and none comparing genomic information from within the group. We have sequenced the complete Hoxa cluster of the Little Skate (Leucoraja erinacea and compared to the published Hoxa cluster of the Horn Shark (Heterodontus francisci and to available data from the Elephant Shark (Callorhinchus milii genome project. Results A BAC clone containing the full Little Skate Hoxa cluster was fully sequenced and assembled. Analyses of coding sequences and conserved non-coding elements reveal a strikingly high level of conservation across the cartilaginous fish, with twenty ultraconserved elements (100%,100 bp found between Skate and Horn Shark, compared to three between human and marsupials. We have also identified novel potential non-coding RNAs in the Skate BAC clone, some of which are conserved to other species. Conclusion We find that the Little Skate Hoxa cluster is remarkably similar to the previously published Horn Shark Hoxa cluster with respect to sequence identity, gene size and intergenic distance despite over 180 million years of separation between the two lineages. We suggest that the genomes of cartilaginous fish are more highly conserved than those of tetrapods or teleost fish and so are more likely to have retained ancestral non-coding elements. While useful for isolating homologous DNA, this complicates bioinformatic approaches to identify chondrichthyan-specific non-coding DNA elements

  15. Complete Genome Analysis of Thermus parvatiensis and Comparative Genomics of Thermus spp. Provide Insights into Genetic Variability and Evolution of Natural Competence as Strategic Survival Attributes

    Directory of Open Access Journals (Sweden)

    Charu Tripathi

    2017-07-01

    Full Text Available Thermophilic environments represent an interesting niche. Among thermophiles, the genus Thermus is among the most studied genera. In this study, we have sequenced the genome of Thermus parvatiensis strain RL, a thermophile isolated from Himalayan hot water springs (temperature >96°C using PacBio RSII SMRT technique. The small genome (2.01 Mbp comprises a chromosome (1.87 Mbp and a plasmid (143 Kbp, designated in this study as pTP143. Annotation revealed a high number of repair genes, a squeezed genome but containing highly plastic plasmid with transposases, integrases, mobile elements and hypothetical proteins (44%. We performed a comparative genomic study of the group Thermus with an aim of analysing the phylogenetic relatedness as well as niche specific attributes prevalent among the group. We compared the reference genome RL with 16 Thermus genomes to assess their phylogenetic relationships based on 16S rRNA gene sequences, average nucleotide identity (ANI, conserved marker genes (31 and 400, pan genome and tetranucleotide frequency. The core genome of the analyzed genomes contained 1,177 core genes and many singleton genes were detected in individual genomes, reflecting a conserved core but adaptive pan repertoire. We demonstrated the presence of metagenomic islands (chromosome:5, plasmid:5 by recruiting raw metagenomic data (from the same niche against the genomic replicons of T. parvatiensis. We also dissected the CRISPR loci wide all genomes and found widespread presence of this system across Thermus genomes. Additionally, we performed a comparative analysis of competence loci wide Thermus genomes and found evidence for recent horizontal acquisition of the locus and continued dispersal among members reflecting that natural competence is a beneficial survival trait among Thermus members and its acquisition depicts unending evolution in order to accomplish optimal fitness.

  16. Towards Viral Genome Annotation Standards, Report from the 2010 NCBI Annotation Workshop.

    Science.gov (United States)

    Brister, James Rodney; Bao, Yiming; Kuiken, Carla; Lefkowitz, Elliot J; Le Mercier, Philippe; Leplae, Raphael; Madupu, Ramana; Scheuermann, Richard H; Schobel, Seth; Seto, Donald; Shrivastava, Susmita; Sterk, Peter; Zeng, Qiandong; Klimke, William; Tatusova, Tatiana

    2010-10-01

    Improvements in DNA sequencing technologies portend a new era in virology and could possibly lead to a giant leap in our understanding of viral evolution and ecology. Yet, as viral genome sequences begin to fill the world's biological databases, it is critically important to recognize that the scientific promise of this era is dependent on consistent and comprehensive genome annotation. With this in mind, the NCBI Genome Annotation Workshop recently hosted a study group tasked with developing sequence, function, and metadata annotation standards for viral genomes. This report describes the issues involved in viral genome annotation and reviews policy recommendations presented at the NCBI Annotation Workshop.

  17. Towards Viral Genome Annotation Standards, Report from the 2010 NCBI Annotation Workshop

    Directory of Open Access Journals (Sweden)

    Qiandong Zeng

    2010-10-01

    Full Text Available Improvements in DNA sequencing technologies portend a new era in virology and could possibly lead to a giant leap in our understanding of viral evolution and ecology. Yet, as viral genome sequences begin to fill the world’s biological databases, it is critically important to recognize that the scientific promise of this era is dependent on consistent and comprehensive genome annotation. With this in mind, the NCBI Genome Annotation Workshop recently hosted a study group tasked with developing sequence, function, and metadata annotation standards for viral genomes. This report describes the issues involved in viral genome annotation and reviews policy recommendations presented at the NCBI Annotation Workshop.

  18. The perennial ryegrass GenomeZipper: targeted use of genome resources for comparative grass genomics.

    Science.gov (United States)

    Pfeifer, Matthias; Martis, Mihaela; Asp, Torben; Mayer, Klaus F X; Lübberstedt, Thomas; Byrne, Stephen; Frei, Ursula; Studer, Bruno

    2013-02-01

    Whole-genome sequences established for model and major crop species constitute a key resource for advanced genomic research. For outbreeding forage and turf grass species like ryegrasses (Lolium spp.), such resources have yet to be developed. Here, we present a model of the perennial ryegrass (Lolium perenne) genome on the basis of conserved synteny to barley (Hordeum vulgare) and the model grass genome Brachypodium (Brachypodium distachyon) as well as rice (Oryza sativa) and sorghum (Sorghum bicolor). A transcriptome-based genetic linkage map of perennial ryegrass served as a scaffold to establish the chromosomal arrangement of syntenic genes from model grass species. This scaffold revealed a high degree of synteny and macrocollinearity and was then utilized to anchor a collection of perennial ryegrass genes in silico to their predicted genome positions. This resulted in the unambiguous assignment of 3,315 out of 8,876 previously unmapped genes to the respective chromosomes. In total, the GenomeZipper incorporates 4,035 conserved grass gene loci, which were used for the first genome-wide sequence divergence analysis between perennial ryegrass, barley, Brachypodium, rice, and sorghum. The perennial ryegrass GenomeZipper is an ordered, information-rich genome scaffold, facilitating map-based cloning and genome assembly in perennial ryegrass and closely related Poaceae species. It also represents a milestone in describing synteny between perennial ryegrass and fully sequenced model grass genomes, thereby increasing our understanding of genome organization and evolution in the most important temperate forage and turf grass species.

  19. Implementing genomics and pharmacogenomics in the clinic: The National Human Genome Research Institute's genomic medicine portfolio.

    Science.gov (United States)

    Manolio, Teri A

    2016-10-01

    Increasing knowledge about the influence of genetic variation on human health and growing availability of reliable, cost-effective genetic testing have spurred the implementation of genomic medicine in the clinic. As defined by the National Human Genome Research Institute (NHGRI), genomic medicine uses an individual's genetic information in his or her clinical care, and has begun to be applied effectively in areas such as cancer genomics, pharmacogenomics, and rare and undiagnosed diseases. In 2011 NHGRI published its strategic vision for the future of genomic research, including an ambitious research agenda to facilitate and promote the implementation of genomic medicine. To realize this agenda, NHGRI is consulting and facilitating collaborations with the external research community through a series of "Genomic Medicine Meetings," under the guidance and leadership of the National Advisory Council on Human Genome Research. These meetings have identified and begun to address significant obstacles to implementation, such as lack of evidence of efficacy, limited availability of genomics expertise and testing, lack of standards, and difficulties in integrating genomic results into electronic medical records. The six research and dissemination initiatives comprising NHGRI's genomic research portfolio are designed to speed the evaluation and incorporation, where appropriate, of genomic technologies and findings into routine clinical care. Actual adoption of successful approaches in clinical care will depend upon the willingness, interest, and energy of professional societies, practitioners, patients, and payers to promote their responsible use and share their experiences in doing so. Published by Elsevier Ireland Ltd.

  20. Applied Genomics of Foodborne Pathogens

    DEFF Research Database (Denmark)

    and customized source of information designed for and accessible to microbiologists interested in applying cutting-edge genomics in food safety and public health research. This book fills this void with a well-selected collection of topics, case studies, and bioinformatics tools contributed by experts......This book provides a timely and thorough snapshot into the emerging and fast evolving area of applied genomics of foodborne pathogens. Driven by the drastic advance of whole genome shot gun sequencing (WGS) technologies, genomics applications are becoming increasingly valuable and even essential...... at the forefront of foodborne pathogen genomics research....

  1. Chromatin dynamics in genome stability

    DEFF Research Database (Denmark)

    Nair, Nidhi; Shoaib, Muhammad; Sørensen, Claus Storgaard

    2017-01-01

    Genomic DNA is compacted into chromatin through packaging with histone and non-histone proteins. Importantly, DNA accessibility is dynamically regulated to ensure genome stability. This is exemplified in the response to DNA damage where chromatin relaxation near genomic lesions serves to promote...... access of relevant enzymes to specific DNA regions for signaling and repair. Furthermore, recent data highlight genome maintenance roles of chromatin through the regulation of endogenous DNA-templated processes including transcription and replication. Here, we review research that shows the importance...... of chromatin structure regulation in maintaining genome integrity by multiple mechanisms including facilitating DNA repair and directly suppressing endogenous DNA damage....

  2. Complete Genome Sequence of Ikoma Lyssavirus

    OpenAIRE

    Marston, Denise A.; Ellis, Richard J.; Horton, Daniel L.; Kuzmin, Ivan V.; Wise, Emma L.; McElhinney, Lorraine M.; Banyard, Ashley C.; Ngeleja, Chanasa; Keyyu, Julius; Cleaveland, Sarah; Lembo, Tiziana; Rupprecht, Charles E.; Fooks, Anthony R.

    2012-01-01

    Lyssaviruses (family Rhabdoviridae) constitute one of the most important groups of viral zoonoses globally. All lyssaviruses cause the disease rabies, an acute progressive encephalitis for which, once symptoms occur, there is no effective cure. Currently available vaccines are highly protective against the predominantly circulating lyssavirus species. Using next-generation sequencing technologies, we have obtained the whole-genome sequence for a novel lyssavirus, Ikoma lyssavirus (IKOV), isol...

  3. Evolution of small prokaryotic genomes

    Directory of Open Access Journals (Sweden)

    David José Martínez-Cano

    2015-01-01

    Full Text Available As revealed by genome sequencing, the biology of prokaryotes with reduced genomes is strikingly diverse. These include free-living prokaryotes with ~800 genes as well as endosymbiotic bacteria with as few as ~140 genes. Comparative genomics is revealing the evolutionary mechanisms that led to these small genomes. In the case of free-living prokaryotes, natural selection directly favored genome reduction, while in the case of endosymbiotic prokaryotes neutral processes played a more prominent role. However, new experimental data suggest that selective processes may be at operation as well for endosymbiotic prokaryotes at least during the first stages of genome reduction. Endosymbiotic prokaryotes have evolved diverse strategies for living with reduced gene sets inside a host-defined medium. These include utilization of host-encoded functions (some of them coded by genes acquired by gene transfer from the endosymbiont and/or other bacteria; metabolic complementation between co-symbionts; and forming consortiums with other bacteria within the host. Recent genome sequencing projects of intracellular mutualistic bacteria showed that previously believed universal evolutionary trends like reduced G+C content and conservation of genome synteny are not always present in highly reduced genomes. Finally, the simplified molecular machinery of some of these organisms with small genomes may be used to aid in the design of artificial minimal cells. Here we review recent genomic discoveries of the biology of prokaryotes endowed with small gene sets and discuss the evolutionary mechanisms that have been proposed to explain their peculiar nature.

  4. Informational laws of genome structures

    Science.gov (United States)

    Bonnici, Vincenzo; Manca, Vincenzo

    2016-06-01

    In recent years, the analysis of genomes by means of strings of length k occurring in the genomes, called k-mers, has provided important insights into the basic mechanisms and design principles of genome structures. In the present study, we focus on the proper choice of the value of k for applying information theoretic concepts that express intrinsic aspects of genomes. The value k = lg2(n), where n is the genome length, is determined to be the best choice in the definition of some genomic informational indexes that are studied and computed for seventy genomes. These indexes, which are based on information entropies and on suitable comparisons with random genomes, suggest five informational laws, to which all of the considered genomes obey. Moreover, an informational genome complexity measure is proposed, which is a generalized logistic map that balances entropic and anti-entropic components of genomes and is related to their evolutionary dynamics. Finally, applications to computational synthetic biology are briefly outlined.

  5. Toward genome-enabled mycology.

    Science.gov (United States)

    Hibbett, David S; Stajich, Jason E; Spatafora, Joseph W

    2013-01-01

    Genome-enabled mycology is a rapidly expanding field that is characterized by the pervasive use of genome-scale data and associated computational tools in all aspects of fungal biology. Genome-enabled mycology is integrative and often requires teams of researchers with diverse skills in organismal mycology, bioinformatics and molecular biology. This issue of Mycologia presents the first complete fungal genomes in the history of the journal, reflecting the ongoing transformation of mycology into a genome-enabled science. Here, we consider the prospects for genome-enabled mycology and the technical and social challenges that will need to be overcome to grow the database of complete fungal genomes and enable all fungal biologists to make use of the new data.

  6. Single-Cell (Meta-Genomics of a Dimorphic Candidatus Thiomargarita nelsonii Reveals Genomic Plasticity

    Directory of Open Access Journals (Sweden)

    Beverly E. Flood

    2016-05-01

    Full Text Available The genus Thiomargarita includes the world’s largest bacteria. But as uncultured organisms, their physiology, metabolism, and basis for their gigantism are not well understood. Thus a genomics approach, applied to a single Candidatus Thiomargarita nelsonii cell was employed to explore the genetic potential of one of these enigmatic giant bacteria. The Thiomargarita cell was obtained from an assemblage of budding Ca. T. nelsonii attached to a provannid gastropod shell from Hydrate Ridge, a methane seep offshore of Oregon, USA. Here we present a manually curated genome of Bud S10 resulting from a hybrid assembly of long Pacific Biosciences and short Illumina sequencing reads. With respect to inorganic carbon fixation and sulfur oxidation pathways, the Ca. T. nelsonii Hydrate Ridge Bud S10 genome was similar to marine sister taxa within the family Beggiatoaceae. However, the Bud S10 genome contains genes suggestive of the genetic potential for lithotrophic growth on arsenite and perhaps hydrogen. The genome also revealed that Bud S10 likely respires nitrate via two pathways: a complete denitrification pathway and a dissimilatory nitrate reduction to ammonia pathway. Both pathways have been predicted, but not previously fully elucidated, in the genomes of other large, vacuolated, sulfur-oxidizing bacteria.Surprisingly, the genome also had a high number of unusual features for a bacterium to include the largest number of metacaspases and introns ever reported in a bacterium. Also present, are a large number of other mobile genetic elements, such as insertion sequence transposable elements and miniature inverted-repeat transposable elements (MITEs. In some cases, mobile genetic elements disrupted key genes in metabolic pathways. For example, a MITE interrupts hupL, which encodes the large subunit of the hydrogenase in hydrogen oxidation. Moreover, we detected a group I intron in one of the most critical genes in the sulfur oxidation pathway, dsr

  7. National human genome projects: an update and an agenda

    OpenAIRE

    An, Joon Yong

    2017-01-01

    Population genetic and human genetic studies are being accelerated with genome technology and data sharing. Accordingly, in the past 10 years, several countries have initiated genetic research using genome technology and identified the genetic architecture of the ethnic groups living in the corresponding country or suggested the genetic foundation of a social phenomenon. Genetic research has been conducted from epidemiological studies that previously described the health or disease conditions...

  8. Mapping genomic features to functional traits through microbial whole genome sequences.

    Science.gov (United States)

    Zhang, Wei; Zeng, Erliang; Liu, Dan; Jones, Stuart E; Emrich, Scott

    2014-01-01

    Recently, the utility of trait-based approaches for microbial communities has been identified. Increasing availability of whole genome sequences provide the opportunity to explore the genetic foundations of a variety of functional traits. We proposed a machine learning framework to quantitatively link the genomic features with functional traits. Genes from bacteria genomes belonging to different functional traits were grouped to Cluster of Orthologs (COGs), and were used as features. Then, TF-IDF technique from the text mining domain was applied to transform the data to accommodate the abundance and importance of each COG. After TF-IDF processing, COGs were ranked using feature selection methods to identify their relevance to the functional trait of interest. Extensive experimental results demonstrated that functional trait related genes can be detected using our method. Further, the method has the potential to provide novel biological insights.

  9. Identification and assembly of genomes and genetic elements in complex metagenomic samples without using reference genomes.

    Science.gov (United States)

    Nielsen, H Bjørn; Almeida, Mathieu; Juncker, Agnieszka Sierakowska; Rasmussen, Simon; Li, Junhua; Sunagawa, Shinichi; Plichta, Damian R; Gautier, Laurent; Pedersen, Anders G; Le Chatelier, Emmanuelle; Pelletier, Eric; Bonde, Ida; Nielsen, Trine; Manichanh, Chaysavanh; Arumugam, Manimozhiyan; Batto, Jean-Michel; Quintanilha Dos Santos, Marcelo B; Blom, Nikolaj; Borruel, Natalia; Burgdorf, Kristoffer S; Boumezbeur, Fouad; Casellas, Francesc; Doré, Joël; Dworzynski, Piotr; Guarner, Francisco; Hansen, Torben; Hildebrand, Falk; Kaas, Rolf S; Kennedy, Sean; Kristiansen, Karsten; Kultima, Jens Roat; Léonard, Pierre; Levenez, Florence; Lund, Ole; Moumen, Bouziane; Le Paslier, Denis; Pons, Nicolas; Pedersen, Oluf; Prifti, Edi; Qin, Junjie; Raes, Jeroen; Sørensen, Søren; Tap, Julien; Tims, Sebastian; Ussery, David W; Yamada, Takuji; Renault, Pierre; Sicheritz-Ponten, Thomas; Bork, Peer; Wang, Jun; Brunak, Søren; Ehrlich, S Dusko

    2014-08-01

    Most current approaches for analyzing metagenomic data rely on comparisons to reference genomes, but the microbial diversity of many environments extends far beyond what is covered by reference databases. De novo segregation of complex metagenomic data into specific biological entities, such as particular bacterial strains or viruses, remains a largely unsolved problem. Here we present a method, based on binning co-abundant genes across a series of metagenomic samples, that enables comprehensive discovery of new microbial organisms, viruses and co-inherited genetic entities and aids assembly of microbial genomes without the need for reference sequences. We demonstrate the method on data from 396 human gut microbiome samples and identify 7,381 co-abundance gene groups (CAGs), including 741 metagenomic species (MGS). We use these to assemble 238 high-quality microbial genomes and identify affiliations between MGS and hundreds of viruses or genetic entities. Our method provides the means for comprehensive profiling of the diversity within complex metagenomic samples.

  10. Genomic research perspectives in Kazakhstan

    Directory of Open Access Journals (Sweden)

    Ainur Akilzhanova

    2014-01-01

    Full Text Available Introduction: Technological advancements rapidly propel the field of genome research. Advances in genetics and genomics such as the sequence of the human genome, the human haplotype map, open access databases, cheaper genotyping and chemical genomics, have transformed basic and translational biomedical research. Several projects in the field of genomic and personalized medicine have been conducted at the Center for Life Sciences in Nazarbayev University. The prioritized areas of research include: genomics of multifactorial diseases, cancer genomics, bioinformatics, genetics of infectious diseases and population genomics. At present, DNA-based risk assessment for common complex diseases, application of molecular signatures for cancer diagnosis and prognosis, genome-guided therapy, and dose selection of therapeutic drugs are the important issues in personalized medicine. Results: To further develop genomic and biomedical projects at Center for Life Sciences, the development of bioinformatics research and infrastructure and the establishment of new collaborations in the field are essential. Widespread use of genetic tools will allow the identification of diseases before the onset of clinical symptoms, the individualization of drug treatment, and could induce individual behavioral changes on the basis of calculated disease risk. However, many challenges remain for the successful translation of genomic knowledge and technologies into health advances, such as medicines and diagnostics. It is important to integrate research and education in the fields of genomics, personalized medicine, and bioinformatics, which will be possible with opening of the new Medical Faculty at Nazarbayev University. People in practice and training need to be educated about the key concepts of genomics and engaged so they can effectively apply their knowledge in a matter that will bring the era of genomic medicine to patient care. This requires the development of well

  11. Mycobacteriophage genome database.

    Science.gov (United States)

    Joseph, Jerrine; Rajendran, Vasanthi; Hassan, Sameer; Kumar, Vanaja

    2011-01-01

    Mycobacteriophage genome database (MGDB) is an exclusive repository of the 64 completely sequenced mycobacteriophages with annotated information. It is a comprehensive compilation of the various gene parameters captured from several databases pooled together to empower mycobacteriophage researchers. The MGDB (Version No.1.0) comprises of 6086 genes from 64 mycobacteriophages classified into 72 families based on ACLAME database. Manual curation was aided by information available from public databases which was enriched further by analysis. Its web interface allows browsing as well as querying the classification. The main objective is to collect and organize the complexity inherent to mycobacteriophage protein classification in a rational way. The other objective is to browse the existing and new genomes and describe their functional annotation. The database is available for free at http://mpgdb.ibioinformatics.org/mpgdb.php.

  12. Precision genome editing

    DEFF Research Database (Denmark)

    Steentoft, Catharina; Bennett, Eric P; Schjoldager, Katrine Ter-Borch Gram

    2014-01-01

    Precise and stable gene editing in mammalian cell lines has until recently been hampered by the lack of efficient targeting methods. While different gene silencing strategies have had tremendous impact on many biological fields, they have generally not been applied with wide success in the field...... of glycobiology, primarily due to their low efficiencies, with resultant failure to impose substantial phenotypic consequences upon the final glycosylation products. Here, we review novel nuclease-based precision genome editing techniques enabling efficient and stable gene editing, including gene disruption...... by introducing single or double-stranded breaks at a defined genomic sequence. We here compare and contrast the different techniques and summarize their current applications, highlighting cases from the field of glycobiology as well as pointing to future opportunities. The emerging potential of precision gene...

  13. Alignment of whole genomes.

    Science.gov (United States)

    Delcher, A L; Kasif, S; Fleischmann, R D; Peterson, J; White, O; Salzberg, S L

    1999-01-01

    A new system for aligning whole genome sequences is described. Using an efficient data structure called a suffix tree, the system is able to rapidly align sequences containing millions of nucleotides. Its use is demonstrated on two strains of Mycoplasma tuberculosis, on two less similar species of Mycoplasma bacteria and on two syntenic sequences from human chromosome 12 and mouse chromosome 6. In each case it found an alignment of the input sequences, using between 30 s and 2 min of computation time. From the system output, information on single nucleotide changes, translocations and homologous genes can easily be extracted. Use of the algorithm should facilitate analysis of syntenic chromosomal regions, strain-to-strain comparisons, evolutionary comparisons and genomic duplications. PMID:10325427

  14. eGenomics: Cataloguing Our Complete Genome Collection III

    Directory of Open Access Journals (Sweden)

    Dawn Field

    2007-01-01

    Full Text Available This meeting report summarizes the proceedings of the “eGenomics: Cataloguing our Complete Genome Collection III” workshop held September 11–13, 2006, at the National Institute for Environmental eScience (NIEeS, Cambridge, United Kingdom. This 3rd workshop of the Genomic Standards Consortium was divided into two parts. The first half of the three-day workshop was dedicated to reviewing the genomic diversity of our current and future genome and metagenome collection, and exploring linkages to a series of existing projects through formal presentations. The second half was dedicated to strategic discussions. Outcomes of the workshop include a revised “Minimum Information about a Genome Sequence” (MIGS specification (v1.1, consensus on a variety of features to be added to the Genome Catalogue (GCat, agreement by several researchers to adopt MIGS for imminent genome publications, and an agreement by the EBI and NCBI to input their genome collections into GCat for the purpose of quantifying the amount of optional data already available (e.g., for geographic location coordinates and working towards a single, global list of all public genomes and metagenomes.

  15. Genomics Portals: integrative web-platform for mining genomics data.

    Science.gov (United States)

    Shinde, Kaustubh; Phatak, Mukta; Johannes, Freudenberg M; Chen, Jing; Li, Qian; Vineet, Joshi K; Hu, Zhen; Ghosh, Krishnendu; Meller, Jaroslaw; Medvedovic, Mario

    2010-01-13

    A large amount of experimental data generated by modern high-throughput technologies is available through various public repositories. Our knowledge about molecular interaction networks, functional biological pathways and transcriptional regulatory modules is rapidly expanding, and is being organized in lists of functionally related genes. Jointly, these two sources of information hold a tremendous potential for gaining new insights into functioning of living systems. Genomics Portals platform integrates access to an extensive knowledge base and a large database of human, mouse, and rat genomics data with basic analytical visualization tools. It provides the context for analyzing and interpreting new experimental data and the tool for effective mining of a large number of publicly available genomics datasets stored in the back-end databases. The uniqueness of this platform lies in the volume and the diversity of genomics data that can be accessed and analyzed (gene expression, ChIP-chip, ChIP-seq, epigenomics, computationally predicted binding sites, etc), and the integration with an extensive knowledge base that can be used in such analysis. The integrated access to primary genomics data, functional knowledge and analytical tools makes Genomics Portals platform a unique tool for interpreting results of new genomics experiments and for mining the vast amount of data stored in the Genomics Portals backend databases. Genomics Portals can be accessed and used freely at http://GenomicsPortals.org.

  16. Genomics Portals: integrative web-platform for mining genomics data

    Directory of Open Access Journals (Sweden)

    Ghosh Krishnendu

    2010-01-01

    Full Text Available Abstract Background A large amount of experimental data generated by modern high-throughput technologies is available through various public repositories. Our knowledge about molecular interaction networks, functional biological pathways and transcriptional regulatory modules is rapidly expanding, and is being organized in lists of functionally related genes. Jointly, these two sources of information hold a tremendous potential for gaining new insights into functioning of living systems. Results Genomics Portals platform integrates access to an extensive knowledge base and a large database of human, mouse, and rat genomics data with basic analytical visualization tools. It provides the context for analyzing and interpreting new experimental data and the tool for effective mining of a large number of publicly available genomics datasets stored in the back-end databases. The uniqueness of this platform lies in the volume and the diversity of genomics data that can be accessed and analyzed (gene expression, ChIP-chip, ChIP-seq, epigenomics, computationally predicted binding sites, etc, and the integration with an extensive knowledge base that can be used in such analysis. Conclusion The integrated access to primary genomics data, functional knowledge and analytical tools makes Genomics Portals platform a unique tool for interpreting results of new genomics experiments and for mining the vast amount of data stored in the Genomics Portals backend databases. Genomics Portals can be accessed and used freely at http://GenomicsPortals.org.

  17. History of genome editing in yeast.

    Science.gov (United States)

    Fraczek, Marcin G; Naseeb, Samina; Delneri, Daniela

    2018-05-01

    For thousands of years humans have used the budding yeast Saccharomyces cerevisiae for the production of bread and alcohol; however, in the last 30-40 years our understanding of the yeast biology has dramatically increased, enabling us to modify its genome. Although S. cerevisiae has been the main focus of many research groups, other non-conventional yeasts have also been studied and exploited for biotechnological purposes. Our experiments and knowledge have evolved from recombination to high-throughput PCR-based transformations to highly accurate CRISPR methods in order to alter yeast traits for either research or industrial purposes. Since the release of the genome sequence of S. cerevisiae in 1996, the precise and targeted genome editing has increased significantly. In this 'Budding topic' we discuss the significant developments of genome editing in yeast, mainly focusing on Cre-loxP mediated recombination, delitto perfetto and CRISPR/Cas. © 2018 The Authors. Yeast published by John Wiley & Sons, Ltd.

  18. Family genome browser: visualizing genomes with pedigree information.

    Science.gov (United States)

    Juan, Liran; Liu, Yongzhuang; Wang, Yongtian; Teng, Mingxiang; Zang, Tianyi; Wang, Yadong

    2015-07-15

    Families with inherited diseases are widely used in Mendelian/complex disease studies. Owing to the advances in high-throughput sequencing technologies, family genome sequencing becomes more and more prevalent. Visualizing family genomes can greatly facilitate human genetics studies and personalized medicine. However, due to the complex genetic relationships and high similarities among genomes of consanguineous family members, family genomes are difficult to be visualized in traditional genome visualization framework. How to visualize the family genome variants and their functions with integrated pedigree information remains a critical challenge. We developed the Family Genome Browser (FGB) to provide comprehensive analysis and visualization for family genomes. The FGB can visualize family genomes in both individual level and variant level effectively, through integrating genome data with pedigree information. Family genome analysis, including determination of parental origin of the variants, detection of de novo mutations, identification of potential recombination events and identical-by-decent segments, etc., can be performed flexibly. Diverse annotations for the family genome variants, such as dbSNP memberships, linkage disequilibriums, genes, variant effects, potential phenotypes, etc., are illustrated as well. Moreover, the FGB can automatically search de novo mutations and compound heterozygous variants for a selected individual, and guide investigators to find high-risk genes with flexible navigation options. These features enable users to investigate and understand family genomes intuitively and systematically. The FGB is available at http://mlg.hit.edu.cn/FGB/. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  19. Genomic Prediction from Whole Genome Sequence in Livestock: The 1000 Bull Genomes Project

    DEFF Research Database (Denmark)

    Hayes, Benjamin J; MacLeod, Iona M; Daetwyler, Hans D

    Advantages of using whole genome sequence data to predict genomic estimated breeding values (GEBV) include better persistence of accuracy of GEBV across generations and more accurate GEBV across breeds. The 1000 Bull Genomes Project provides a database of whole genome sequenced key ancestor bulls....... In a dairy data set, predictions using BayesRC and imputed sequence data from 1000 Bull Genomes were 2% more accurate than with 800k data. We could demonstrate the method identified causal mutations in some cases. Further improvements will come from more accurate imputation of sequence variant genotypes...

  20. Genomic technologies in neonatology

    Directory of Open Access Journals (Sweden)

    L. N. Chernova

    2017-01-01

    Full Text Available In recent years, there has been a tremendous trend toward personalized medicine. Advances in the field forced clinicians, including neonatologists, to take a fresh look at prevention, tactics of management and therapy of various diseases. In the center of attention of foreign, and increasingly Russian, researchers and doctors, there are individual genomic data that allow not only to assess the risks of some form of pathology, but also to successfully apply personalized strategies of prediction, prevention and targeted treatment. This article provides a brief review of the latest achievements of genomic technologies in newborns, examines the problems and potential applications of genomics in promoting the concept of personalized medicine in neonatology. The increasing amount of personalized data simply impossible to analyze only by the human mind. In this connection, the need of computers and bioinformatics is obvious. The article reveals the role of translational bioinformatics in the analysis and integration of the results of the accumulated fundamental research into complete clinical decisions. The latest advances in neonatal translational bioinformatics such as clinical decision support systems are considered. It helps to monitor vital parameters of newborns influencing the course of a particular disease, to calculate the increased risks of the development of various pathologies and to select the drugs.

  1. Value-based genomics.

    Science.gov (United States)

    Gong, Jun; Pan, Kathy; Fakih, Marwan; Pal, Sumanta; Salgia, Ravi

    2018-03-20

    Advancements in next-generation sequencing have greatly enhanced the development of biomarker-driven cancer therapies. The affordability and availability of next-generation sequencers have allowed for the commercialization of next-generation sequencing platforms that have found widespread use for clinical-decision making and research purposes. Despite the greater availability of tumor molecular profiling by next-generation sequencing at our doorsteps, the achievement of value-based care, or improving patient outcomes while reducing overall costs or risks, in the era of precision oncology remains a looming challenge. In this review, we highlight available data through a pre-established and conceptualized framework for evaluating value-based medicine to assess the cost (efficiency), clinical benefit (effectiveness), and toxicity (safety) of genomic profiling in cancer care. We also provide perspectives on future directions of next-generation sequencing from targeted panels to whole-exome or whole-genome sequencing and describe potential strategies needed to attain value-based genomics.

  2. Genome analysis and comparative genomics of a Giardia intestinalis assemblage E isolate

    Directory of Open Access Journals (Sweden)

    Andersson Jan O

    2010-10-01

    Full Text Available Abstract Background Giardia intestinalis is a protozoan parasite that causes diarrhea in a wide range of mammalian species. To further understand the genetic diversity between the Giardia intestinalis species, we have performed genome sequencing and analysis of a wild-type Giardia intestinalis sample from the assemblage E group, isolated from a pig. Results We identified 5012 protein coding genes, the majority of which are conserved compared to the previously sequenced genomes of the WB and GS strains in terms of microsynteny and sequence identity. Despite this, there is an unexpectedly large number of chromosomal rearrangements and several smaller structural changes that are present in all chromosomes. Novel members of the VSP, NEK Kinase and HCMP gene families were identified, which may reveal possible mechanisms for host specificity and new avenues for antigenic variation. We used comparative genomics of the three diverse Giardia intestinalis isolates P15, GS and WB to define a core proteome for this species complex and to identify lineage-specific genes. Extensive analyses of polymorphisms in the core proteome of Giardia revealed differential rates of divergence among cellular processes. Conclusions Our results indicate that despite a well conserved core of genes there is significant genome variation between Giardia isolates, both in terms of gene content, gene polymorphisms, structural chromosomal variations and surface molecule repertoires. This study improves the annotation of the Giardia genomes and enables the identification of functionally important variation.

  3. Genomic profiling of oral squamous cell carcinoma by array-based comparative genomic hybridization.

    Directory of Open Access Journals (Sweden)

    Shunichi Yoshioka

    Full Text Available We designed a study to investigate genetic relationships between primary tumors of oral squamous cell carcinoma (OSCC and their lymph node metastases, and to identify genomic copy number aberrations (CNAs related to lymph node metastasis. For this purpose, we collected a total of 42 tumor samples from 25 patients and analyzed their genomic profiles by array-based comparative genomic hybridization. We then compared the genetic profiles of metastatic primary tumors (MPTs with their paired lymph node metastases (LNMs, and also those of LNMs with non-metastatic primary tumors (NMPTs. Firstly, we found that although there were some distinctive differences in the patterns of genomic profiles between MPTs and their paired LNMs, the paired samples shared similar genomic aberration patterns in each case. Unsupervised hierarchical clustering analysis grouped together 12 of the 15 MPT-LNM pairs. Furthermore, similarity scores between paired samples were significantly higher than those between non-paired samples. These results suggested that MPTs and their paired LNMs are composed predominantly of genetically clonal tumor cells, while minor populations with different CNAs may also exist in metastatic OSCCs. Secondly, to identify CNAs related to lymph node metastasis, we compared CNAs between grouped samples of MPTs and LNMs, but were unable to find any CNAs that were more common in LNMs. Finally, we hypothesized that subpopulations carrying metastasis-related CNAs might be present in both the MPT and LNM. Accordingly, we compared CNAs between NMPTs and LNMs, and found that gains of 7p, 8q and 17q were more common in the latter than in the former, suggesting that these CNAs may be involved in lymph node metastasis of OSCC. In conclusion, our data suggest that in OSCCs showing metastasis, the primary and metastatic tumors share similar genomic profiles, and that cells in the primary tumor may tend to metastasize after acquiring metastasis-associated CNAs.

  4. Genomic comparison of closely related Giant Viruses supports an accordion-like model of evolution.

    Directory of Open Access Journals (Sweden)

    Jonathan eFilée

    2015-06-01

    Full Text Available Genome gigantism occurs so far in Phycodnaviridae and Mimiviridae (order Megavirales. Origin and evolution of these Giant Viruses (GVs remain open questions. Interestingly, availability of a collection of closely related GV genomes enabling genomic comparisons offer the opportunity to better understand the different evolutionary forces acting on these genomes. Whole genome alignment for 5 groups of viruses belonging to the Mimiviridae and Phycodnaviridae families show that there is no trend of genome expansion or general tendency of genome contraction. Instead, GV genomes accumulated genomic mutations over the time with gene gains compensating the different losses. In addition, each lineage displays specific patterns of genome evolution. Mimiviridae (megaviruses and mimiviruses and Chlorella Phycodnaviruses evolved mainly by duplications and losses of genes belonging to large paralogous families (including movements of diverse mobiles genetic elements, whereas Micromonas and Ostreococcus Phycodnaviruses derive most of their genetic novelties thought lateral gene transfers. Taken together, these data support an accordion-like model of evolution in which GV genomes have undergone successive steps of gene gain and gene loss, accrediting the hypothesis that genome gigantism appears early, before the diversification of the different GV lineages.

  5. Genomic comparison of closely related Giant Viruses supports an accordion-like model of evolution.

    Science.gov (United States)

    Filée, Jonathan

    2015-01-01

    Genome gigantism occurs so far in Phycodnaviridae and Mimiviridae (order Megavirales). Origin and evolution of these Giant Viruses (GVs) remain open questions. Interestingly, availability of a collection of closely related GV genomes enabling genomic comparisons offer the opportunity to better understand the different evolutionary forces acting on these genomes. Whole genome alignment for five groups of viruses belonging to the Mimiviridae and Phycodnaviridae families show that there is no trend of genome expansion or general tendency of genome contraction. Instead, GV genomes accumulated genomic mutations over the time with gene gains compensating the different losses. In addition, each lineage displays specific patterns of genome evolution. Mimiviridae (megaviruses and mimiviruses) and Chlorella Phycodnaviruses evolved mainly by duplications and losses of genes belonging to large paralogous families (including movements of diverse mobiles genetic elements), whereas Micromonas and Ostreococcus Phycodnaviruses derive most of their genetic novelties thought lateral gene transfers. Taken together, these data support an accordion-like model of evolution in which GV genomes have undergone successive steps of gene gain and gene loss, accrediting the hypothesis that genome gigantism appears early, before the diversification of the different GV lineages.

  6. Genome fluctuations in cyanobacteria reflect evolutionary, developmental and adaptive traits

    Directory of Open Access Journals (Sweden)

    Nylander Johan AA

    2011-06-01

    Full Text Available Abstract Background Cyanobacteria belong to an ancient group of photosynthetic prokaryotes with pronounced variations in their cellular differentiation strategies, physiological capacities and choice of habitat. Sequencing efforts have shown that genomes within this phylum are equally diverse in terms of size and protein-coding capacity. To increase our understanding of genomic changes in the lineage, the genomes of 58 contemporary cyanobacteria were analysed for shared and unique orthologs. Results A total of 404 protein families, present in all cyanobacterial genomes, were identified. Two of these are unique to the phylum, corresponding to an AbrB family transcriptional regulator and a gene that escapes functional annotation although its genomic neighbourhood is conserved among the organisms examined. The evolution of cyanobacterial genome sizes involves a mix of gains and losses in the clade encompassing complex cyanobacteria, while a single event of reduction is evident in a clade dominated by unicellular cyanobacteria. Genome sizes and gene family copy numbers evolve at a higher rate in the former clade, and multi-copy genes were predominant in large genomes. Orthologs unique to cyanobacteria exhibiting specific characteristics, such as filament formation, heterocyst differentiation, diazotrophy and symbiotic competence, were also identified. An ancestral character reconstruction suggests that the most recent common ancestor of cyanobacteria had a genome size of approx. 4.5 Mbp and 1678 to 3291 protein-coding genes, 4%-6% of which are unique to cyanobacteria today. Conclusions The different rates of genome-size evolution and multi-copy gene abundance suggest two routes of genome development in the history of cyanobacteria. The expansion strategy is driven by gene-family enlargment and generates a broad adaptive potential; while the genome streamlining strategy imposes adaptations to highly specific niches, also reflected in their different

  7. Genome fluctuations in cyanobacteria reflect evolutionary, developmental and adaptive traits

    Science.gov (United States)

    2011-01-01

    Background Cyanobacteria belong to an ancient group of photosynthetic prokaryotes with pronounced variations in their cellular differentiation strategies, physiological capacities and choice of habitat. Sequencing efforts have shown that genomes within this phylum are equally diverse in terms of size and protein-coding capacity. To increase our understanding of genomic changes in the lineage, the genomes of 58 contemporary cyanobacteria were analysed for shared and unique orthologs. Results A total of 404 protein families, present in all cyanobacterial genomes, were identified. Two of these are unique to the phylum, corresponding to an AbrB family transcriptional regulator and a gene that escapes functional annotation although its genomic neighbourhood is conserved among the organisms examined. The evolution of cyanobacterial genome sizes involves a mix of gains and losses in the clade encompassing complex cyanobacteria, while a single event of reduction is evident in a clade dominated by unicellular cyanobacteria. Genome sizes and gene family copy numbers evolve at a higher rate in the former clade, and multi-copy genes were predominant in large genomes. Orthologs unique to cyanobacteria exhibiting specific characteristics, such as filament formation, heterocyst differentiation, diazotrophy and symbiotic competence, were also identified. An ancestral character reconstruction suggests that the most recent common ancestor of cyanobacteria had a genome size of approx. 4.5 Mbp and 1678 to 3291 protein-coding genes, 4%-6% of which are unique to cyanobacteria today. Conclusions The different rates of genome-size evolution and multi-copy gene abundance suggest two routes of genome development in the history of cyanobacteria. The expansion strategy is driven by gene-family enlargment and generates a broad adaptive potential; while the genome streamlining strategy imposes adaptations to highly specific niches, also reflected in their different functional capacities. A few

  8. Genome-wide comparative analysis reveals similar types of NBS genes in hybrid Citrus sinensis genome and original Citrus clementine genome and provides new insights into non-TIR NBS genes.

    Directory of Open Access Journals (Sweden)

    Yunsheng Wang

    Full Text Available In this study, we identified and compared nucleotide-binding site (NBS domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China. Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approximately evenly numbered groups: one group contains the Toll-Interleukin receptor (TIR domain and two different Non-TIR groups in which most of proteins contain the Coiled Coil (CC domain. Motif analysis confirmed that the two groups of CC-containing NBS genes are from different evolutionary origins. We partitioned NBS genes into clades using NBS domain sequence distances and found most clades include NBS genes from all three Citrus genomes. This suggests that three Citrus genomes have similar numbers and types of NBS genes. We also mapped the re-sequenced reads of three pomelo and three mandarin genomes onto the C. sinensis genome. We found that most NBS genes of the hybrid C. sinensis genome have corresponding homologous genes in both pomelo and mandarin genomes. The homologous NBS genes in pomelo and mandarin suggest that the parental species of C. sinensis may contain similar types of NBS genes. This explains why the hybrid C. sinensis and original C. clementina have similar types of NBS genes in this study. Furthermore, we found that sequence variation amongst Citrus NBS genes were shaped by multiple independent and shared accelerated mutation accumulation events among different groups of NBS genes and in different Citrus genomes. Our comparative analyses yield valuable insight into the structure, organization and evolution of NBS genes in Citrus genomes. Furthermore, our comprehensive analysis showed that the non-TIR NBS genes can be divided into two groups that come from different evolutionary origins. This provides new insights into non-TIR genes, which have not received much attention.

  9. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium

    DEFF Research Database (Denmark)

    Machado, Henrique; Gram, Lone

    2017-01-01

    was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.......Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand...... the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur, amino-acid usage, ANI), which allowed us to identify two...

  10. Genome update: the 1000th genome - a cautionary tale

    DEFF Research Database (Denmark)

    Lagesen, Karin; Ussery, David; Wassenaar, Gertrude Maria

    2010-01-01

    conclusions for example about the largest bacterial genome sequenced. Biological diversity is far greater than many have thought. For example, analysis of multiple Escherichia coli genomes has led to an estimate of around 45 000 gene families more genes than are recognized in the human genome. Moreover......There are now more than 1000 sequenced prokaryotic genomes deposited in public databases and available for analysis. Currently, although the sequence databases GenBank, DNA Database of Japan and EMBL are synchronized continually, there are slight differences in content at the genomes level...... for a variety of logistical reasons, including differences in format and loading errors, such as those caused by file transfer protocol interruptions. This means that the 1000th genome will be different in the various databases. Some of the data on the highly accessed web pages are inaccurate, leading to false...

  11. The Pinus taeda genome is characterized by diverse and highly diverged repetitive sequences

    Directory of Open Access Journals (Sweden)

    Yandell Mark

    2010-07-01

    Full Text Available Abstract Background In today's age of genomic discovery, no attempt has been made to comprehensively sequence a gymnosperm genome. The largest genus in the coniferous family Pinaceae is Pinus, whose 110-120 species have extremely large genomes (c. 20-40 Gb, 2N = 24. The size and complexity of these genomes have prompted much speculation as to the feasibility of completing a conifer genome sequence. Conifer genomes are reputed to be highly repetitive, but there is little information available on the nature and identity of repetitive units in gymnosperms. The pines have extensive genetic resources, with approximately 329000 ESTs from eleven species and genetic maps in eight species, including a dense genetic map of the twelve linkage groups in Pinus taeda. Results We present here the Sanger sequence and annotation of ten P. taeda BAC clones and Genome Analyzer II whole genome shotgun (WGS sequences representing 7.5% of the genome. Computational annotation of ten BACs predicts three putative protein-coding genes and at least fifteen likely pseudogenes in nearly one megabase of sequence. We found three conifer-specific LTR retroelements in the BACs, and tentatively identified at least 15 others based on evidence from the distantly related angiosperms. Alignment of WGS sequences to the BACs indicates that 80% of BAC sequences have similar copies (≥ 75% nucleotide identity elsewhere in the genome, but only 23% have identical copies (99% identity. The three most common repetitive elements in the genome were identified and, when combined, represent less than 5% of the genome. Conclusions This study indicates that the majority of repeats in the P. taeda genome are 'novel' and will therefore require additional BAC or genomic sequencing for accurate characterization. The pine genome contains a very large number of diverged and probably defunct repetitive elements. This study also provides new evidence that sequencing a pine genome using a WGS approach is

  12. Comparative Genomic Analysis of Soybean Flowering Genes

    Science.gov (United States)

    Jung, Chol-Hee; Wong, Chui E.; Singh, Mohan B.; Bhalla, Prem L.

    2012-01-01

    Flowering is an important agronomic trait that determines crop yield. Soybean is a major oilseed legume crop used for human and animal feed. Legumes have unique vegetative and floral complexities. Our understanding of the molecular basis of flower initiation and development in legumes is limited. Here, we address this by using a computational approach to examine flowering regulatory genes in the soybean genome in comparison to the most studied model plant, Arabidopsis. For this comparison, a genome-wide analysis of orthologue groups was performed, followed by an in silico gene expression analysis of the identified soybean flowering genes. Phylogenetic analyses of the gene families highlighted the evolutionary relationships among these candidates. Our study identified key flowering genes in soybean and indicates that the vernalisation and the ambient-temperature pathways seem to be the most variant in soybean. A comparison of the orthologue groups containing flowering genes indicated that, on average, each Arabidopsis flowering gene has 2-3 orthologous copies in soybean. Our analysis highlighted that the CDF3, VRN1, SVP, AP3 and PIF3 genes are paralogue-rich genes in soybean. Furthermore, the genome mapping of the soybean flowering genes showed that these genes are scattered randomly across the genome. A paralogue comparison indicated that the soybean genes comprising the largest orthologue group are clustered in a 1.4 Mb region on chromosome 16 of soybean. Furthermore, a comparison with the undomesticated soybean (Glycine soja) revealed that there are hundreds of SNPs that are associated with putative soybean flowering genes and that there are structural variants that may affect the genes of the light-signalling and ambient-temperature pathways in soybean. Our study provides a framework for the soybean flowering pathway and insights into the relationship and evolution of flowering genes between a short-day soybean and the long-day plant, Arabidopsis. PMID:22679494

  13. Efficient Breeding by Genomic Mating.

    Science.gov (United States)

    Akdemir, Deniz; Sánchez, Julio I

    2016-01-01

    Selection in breeding programs can be done by using phenotypes (phenotypic selection), pedigree relationship (breeding value selection) or molecular markers (marker assisted selection or genomic selection). All these methods are based on truncation selection, focusing on the best performance of parents before mating. In this article we proposed an approach to breeding, named genomic mating, which focuses on mating instead of truncation selection. Genomic mating uses information in a similar fashion to genomic selection but includes information on complementation of parents to be mated. Following the efficiency frontier surface, genomic mating uses concepts of estimated breeding values, risk (usefulness) and coefficient of ancestry to optimize mating between parents. We used a genetic algorithm to find solutions to this optimization problem and the results from our simulations comparing genomic selection, phenotypic selection and the mating approach indicate that current approach for breeding complex traits is more favorable than phenotypic and genomic selection. Genomic mating is similar to genomic selection in terms of estimating marker effects, but in genomic mating the genetic information and the estimated marker effects are used to decide which genotypes should be crossed to obtain the next breeding population.

  14. Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium

    OpenAIRE

    Henrique Machado; Henrique Machado; Lone Gram

    2017-01-01

    Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationship...

  15. Whole-genome sequencing of veterinary pathogens

    DEFF Research Database (Denmark)

    Ronco, Troels

    -electrophoresis and single-locus sequencing has been widely used to characterize such types of veterinary pathogens. However, DNA sequencing techniques have become fast and cost effective in recent years and whole-genome sequencing data provide a much higher discriminative power and reproducibility than any...... genetic background. This indicates that dairy cows can be natural carriers of S. aureus subtypes that in certain cases lead to CM. A group of isolates that mostly belonged to ST151 carried three pathogenicity islands that were primarily found in this group. The prevalence of resistance genes was generally...

  16. Inter- and intra-specific pan-genomes of Borrelia burgdorferi sensu lato: genome stability and adaptive radiation

    Science.gov (United States)

    2013-01-01

    Background Lyme disease is caused by spirochete bacteria from the Borrelia burgdorferi sensu lato (B. burgdorferi s.l.) species complex. To reconstruct the evolution of B. burgdorferi s.l. and identify the genomic basis of its human virulence, we compared the genomes of 23 B. burgdorferi s.l. isolates from Europe and the United States, including B. burgdorferi sensu stricto (B. burgdorferi s.s., 14 isolates), B. afzelii (2), B. garinii (2), B. “bavariensis” (1), B. spielmanii (1), B. valaisiana (1), B. bissettii (1), and B. “finlandensis” (1). Results Robust B. burgdorferi s.s. and B. burgdorferi s.l. phylogenies were obtained using genome-wide single-nucleotide polymorphisms, despite recombination. Phylogeny-based pan-genome analysis showed that the rate of gene acquisition was higher between species than within species, suggesting adaptive speciation. Strong positive natural selection drives the sequence evolution of lipoproteins, including chromosomally-encoded genes 0102 and 0404, cp26-encoded ospC and b08, and lp54-encoded dbpA, a07, a22, a33, a53, a65. Computer simulations predicted rapid adaptive radiation of genomic groups as population size increases. Conclusions Intra- and inter-specific pan-genome sizes of B. burgdorferi s.l. expand linearly with phylogenetic diversity. Yet gene-acquisition rates in B. burgdorferi s.l. are among the lowest in bacterial pathogens, resulting in high genome stability and few lineage-specific genes. Genome adaptation of B. burgdorferi s.l. is driven predominantly by copy-number and sequence variations of lipoprotein genes. New genomic groups are likely to emerge if the current trend of B. burgdorferi s.l. population expansion continues. PMID:24112474

  17. Genome sequences and comparative genomics of two Lactobacillus ruminis strains from the bovine and human intestinal tracts

    LENUS (Irish Health Repository)

    2011-08-30

    Abstract Background The genus Lactobacillus is characterized by an extraordinary degree of phenotypic and genotypic diversity, which recent genomic analyses have further highlighted. However, the choice of species for sequencing has been non-random and unequal in distribution, with only a single representative genome from the L. salivarius clade available to date. Furthermore, there is no data to facilitate a functional genomic analysis of motility in the lactobacilli, a trait that is restricted to the L. salivarius clade. Results The 2.06 Mb genome of the bovine isolate Lactobacillus ruminis ATCC 27782 comprises a single circular chromosome, and has a G+C content of 44.4%. In silico analysis identified 1901 coding sequences, including genes for a pediocin-like bacteriocin, a single large exopolysaccharide-related cluster, two sortase enzymes, two CRISPR loci and numerous IS elements and pseudogenes. A cluster of genes related to a putative pilin was identified, and shown to be transcribed in vitro. A high quality draft assembly of the genome of a second L. ruminis strain, ATCC 25644 isolated from humans, suggested a slightly larger genome of 2.138 Mb, that exhibited a high degree of synteny with the ATCC 27782 genome. In contrast, comparative analysis of L. ruminis and L. salivarius identified a lack of long-range synteny between these closely related species. Comparison of the L. salivarius clade core proteins with those of nine other Lactobacillus species distributed across 4 major phylogenetic groups identified the set of shared proteins, and proteins unique to each group. Conclusions The genome of L. ruminis provides a comparative tool for directing functional analyses of other members of the L. salivarius clade, and it increases understanding of the divergence of this distinct Lactobacillus lineage from other commensal lactobacilli. The genome sequence provides a definitive resource to facilitate investigation of the genetics, biochemistry and host

  18. Genome Surfing As Driver of Microbial Genomic Diversity.

    Science.gov (United States)

    Choudoir, Mallory J; Panke-Buisse, Kevin; Andam, Cheryl P; Buckley, Daniel H

    2017-08-01

    Historical changes in population size, such as those caused by demographic range expansions, can produce nonadaptive changes in genomic diversity through mechanisms such as gene surfing. We propose that demographic range expansion of a microbial population capable of horizontal gene exchange can result in genome surfing, a mechanism that can cause widespread increase in the pan-genome frequency of genes acquired by horizontal gene exchange. We explain that patterns of genetic diversity within Streptomyces are consistent with genome surfing, and we describe several predictions for testing this hypothesis both in Streptomyces and in other microorganisms. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Genome U-Plot: a whole genome visualization.

    Science.gov (United States)

    Gaitatzes, Athanasios; Johnson, Sarah H; Smadbeck, James B; Vasmatzis, George

    2018-05-15

    The ability to produce and analyze whole genome sequencing (WGS) data from samples with structural variations (SV) generated the need to visualize such abnormalities in simplified plots. Conventional two-dimensional representations of WGS data frequently use either circular or linear layouts. There are several diverse advantages regarding both these representations, but their major disadvantage is that they do not use the two-dimensional space very efficiently. We propose a layout, termed the Genome U-Plot, which spreads the chromosomes on a two-dimensional surface and essentially quadruples the spatial resolution. We present the Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities. We compare conventional visualization schemas with the Genome U-Plot using visualization metrics such as number of line crossings and crossing angle resolution measures. Based on our metrics, we improve the readability of the resulting graph by at least 2-fold, making apparent important features and making it easy to identify important genomic changes. A whole genome visualization tool with high spatial resolution and improved aesthetic qualities. An implementation and documentation of the Genome U-Plot is publicly available at https://github.com/gaitat/GenomeUPlot. vasmatzis.george@mayo.edu. Supplementary data are available at Bioinformatics online.

  20. Genomic Data Commons and Genomic Cloud Pilots - Google Hangout

    Science.gov (United States)

    Join us for a live, moderated discussion about two NCI efforts to expand access to cancer genomics data: the Genomic Data Commons and Genomic Cloud Pilots. NCI subject matters experts will include Louis M. Staudt, M.D., Ph.D., Director Center for Cancer Genomics, Warren Kibbe, Ph.D., Director, NCI Center for Biomedical Informatics and Information Technology, and moderated by Anthony Kerlavage, Ph.D., Chief, Cancer Informatics Branch, Center for Biomedical Informatics and Information Technology. We welcome your questions before and during the Hangout on Twitter using the hashtag #AskNCI.

  1. Genome-wide Studies of Mycolic Acid Bacteria: Computational Identification and Analysis of a Minimal Genome

    KAUST Repository

    Kamanu, Frederick Kinyua

    2012-12-01

    The mycolic acid bacteria are a distinct suprageneric group of asporogenous Grampositive, high GC-content bacteria, distinguished by the presence of mycolic acids in their cell envelope. They exhibit great diversity in their cell and morphology; although primarily non-pathogens, this group contains three major pathogens Mycobacterium leprae, Mycobacterium tuberculosis complex, and Corynebacterium diphtheria. Although the mycolic acid bacteria are a clearly defined group of bacteria, the taxonomic relationships between its constituent genera and species are less well defined. Two approaches were tested for their suitability in describing the taxonomy of the group. First, a Multilocus Sequence Typing (MLST) experiment was assessed and found to be superior to monophyletic (16S small ribosomal subunit) in delineating a total of 52 mycolic acid bacterial species. Phylogenetic inference was performed using the neighbor-joining method. To further refine phylogenetic analysis and to take advantage of the widespread availability of bacterial genome data, a computational framework that simulates DNA-DNA hybridisation was developed and validated using multiscale bootstrap resampling. The tool classifies microbial genomes based on whole genome DNA, and was deployed as a web-application using PHP and Javascript. It is accessible online at http://cbrc.kaust.edu.sa/dna_hybridization/ A third study was a computational and statistical methods in the identification and analysis of a putative minimal mycolic acid bacterial genome so as to better understand (1) the genomic requirements to encode a mycolic acid bacterial cell and (2) the role and type of genes and genetic elements that lead to the massive increase in genome size in environmental mycolic acid bacteria. Using a reciprocal comparison approach, a total of 690 orthologous gene clusters forming a putative minimal genome were identified across 24 mycolic acid bacterial species. In order to identify new potential drug

  2. Contrasting Patterns of Nucleotide Substitution Rates Provide Insight into Dynamic Evolution of Plastid and Mitochondrial Genomes of Geranium

    OpenAIRE

    Park, Seongjun; Ruhlman, Tracey A.; Weng, Mao-Lun; Hajrah, Nahid H.; Sabir, Jamal S.M.; Jansen, Robert K.

    2017-01-01

    Abstract Geraniaceae have emerged as a model system for investigating the causes and consequences of variation in plastid and mitochondrial genomes. Incredible structural variation in plastid genomes (plastomes) and highly accelerated evolutionary rates have been reported in selected lineages and functional groups of genes in both plastomes and mitochondrial genomes (mitogenomes), and these phenomena have been implicated in cytonuclear incompatibility. Previous organelle genome studies have i...

  3. Whole genome phylogenies for multiple Drosophila species

    Directory of Open Access Journals (Sweden)

    Seetharam Arun

    2012-12-01

    Full Text Available Abstract Background Reconstructing the evolutionary history of organisms using traditional phylogenetic methods may suffer from inaccurate sequence alignment. An alternative approach, particularly effective when whole genome sequences are available, is to employ methods that don’t use explicit sequence alignments. We extend a novel phylogenetic method based on Singular Value Decomposition (SVD to reconstruct the phylogeny of 12 sequenced Drosophila species. SVD analysis provides accurate comparisons for a high fraction of sequences within whole genomes without the prior identification of orthologs or homologous sites. With this method all protein sequences are converted to peptide frequency vectors within a matrix that is decomposed to provide simplified vector representations for each protein of the genome in a reduced dimensional space. These vectors are summed together to provide a vector representation for each species, and the angle between these vectors provides distance measures that are used to construct species trees. Results An unfiltered whole genome analysis (193,622 predicted proteins strongly supports the currently accepted phylogeny for 12 Drosophila species at higher dimensions except for the generally accepted but difficult to discern sister relationship between D. erecta and D. yakuba. Also, in accordance with previous studies, many sequences appear to support alternative phylogenies. In this case, we observed grouping of D. erecta with D. sechellia when approximately 55% to 95% of the proteins were removed using a filter based on projection values or by reducing resolution by using fewer dimensions. Similar results were obtained when just the melanogaster subgroup was analyzed. Conclusions These results indicate that using our novel phylogenetic method, it is possible to consult and interpret all predicted protein sequences within multiple whole genomes to produce accurate phylogenetic estimations of relatedness between

  4. The complete genome sequence and analysis of the human pathogen Campylobacter lari

    DEFF Research Database (Denmark)

    Miller, WG; Wang, G; Binnewies, Tim Terence

    2008-01-01

    Campylobacter lari is a member of the epsilon subdivision of the Proteobacteria and is part of the thermotolerant Campylobacter group, a clade that includes the human pathogen C. jejuni. Here we present the complete genome sequence of the human clinical isolate, C. lari RM2100. The genome of strain...... RM2100 is approximately 1.53 Mb and includes the 46 kb megaplasmid pCL2100. Also present within the strain RM2100 genome is a 36 kb putative prophage, termed CLIE1, which is similar to CJIE4, a putative prophage present within the C. jejuni RM1221 genome. Nearly all (90%) of the gene content...... in strain RM2100 is similar to genes present in the genomes of other characterized thermotolerant campylobacters. However, several genes involved in amino acid biosynthesis and energy metabolism, identified previously in other Campylobacter genomes, are absent from the C. lari RM2100 genome. Therefore, C...

  5. Ensembl 2002: accommodating comparative genomics.

    Science.gov (United States)

    Clamp, M; Andrews, D; Barker, D; Bevan, P; Cameron, G; Chen, Y; Clark, L; Cox, T; Cuff, J; Curwen, V; Down, T; Durbin, R; Eyras, E; Gilbert, J; Hammond, M; Hubbard, T; Kasprzyk, A; Keefe, D; Lehvaslaiho, H; Iyer, V; Melsopp, C; Mongin, E; Pettett, R; Potter, S; Rust, A; Schmidt, E; Searle, S; Slater, G; Smith, J; Spooner, W; Stabenau, A; Stalker, J; Stupka, E; Ureta-Vidal, A; Vastrik, I; Birney, E

    2003-01-01

    The Ensembl (http://www.ensembl.org/) database project provides a bioinformatics framework to organise biology around the sequences of large genomes. It is a comprehensive source of stable automatic annotation of human, mouse and other genome sequences, available as either an interactive web site or as flat files. Ensembl also integrates manually annotated gene structures from external sources where available. As well as being one of the leading sources of genome annotation, Ensembl is an open source software engineering project to develop a portable system able to handle very large genomes and associated requirements. These range from sequence analysis to data storage and visualisation and installations exist around the world in both companies and at academic sites. With both human and mouse genome sequences available and more vertebrate sequences to follow, many of the recent developments in Ensembl have focusing on developing automatic comparative genome analysis and visualisation.

  6. The Ensembl genome database project.

    Science.gov (United States)

    Hubbard, T; Barker, D; Birney, E; Cameron, G; Chen, Y; Clark, L; Cox, T; Cuff, J; Curwen, V; Down, T; Durbin, R; Eyras, E; Gilbert, J; Hammond, M; Huminiecki, L; Kasprzyk, A; Lehvaslaiho, H; Lijnzaad, P; Melsopp, C; Mongin, E; Pettett, R; Pocock, M; Potter, S; Rust, A; Schmidt, E; Searle, S; Slater, G; Smith, J; Spooner, W; Stabenau, A; Stalker, J; Stupka, E; Ureta-Vidal, A; Vastrik, I; Clamp, M

    2002-01-01

    The Ensembl (http://www.ensembl.org/) database project provides a bioinformatics framework to organise biology around the sequences of large genomes. It is a comprehensive source of stable automatic annotation of the human genome sequence, with confirmed gene predictions that have been integrated with external data sources, and is available as either an interactive web site or as flat files. It is also an open source software engineering project to develop a portable system able to handle very large genomes and associated requirements from sequence analysis to data storage and visualisation. The Ensembl site is one of the leading sources of human genome sequence annotation and provided much of the analysis for publication by the international human genome project of the draft genome. The Ensembl system is being installed around the world in both companies and academic sites on machines ranging from supercomputers to laptops.

  7. Comparative Genomics in Homo sapiens.

    Science.gov (United States)

    Oti, Martin; Sammeth, Michael

    2018-01-01

    Genomes can be compared at different levels of divergence, either between species or within species. Within species genomes can be compared between different subpopulations, such as human subpopulations from different continents. Investigating the genomic differences between different human subpopulations is important when studying complex diseases that are affected by many genetic variants, as the variants involved can differ between populations. The 1000 Genomes Project collected genome-scale variation data for 2504 human individuals from 26 different populations, enabling a systematic comparison of variation between human subpopulations. In this chapter, we present step-by-step a basic protocol for the identification of population-specific variants employing the 1000 Genomes data. These variants are subsequently further investigated for those that affect the proteome or RNA splice sites, to investigate potentially biologically relevant differences between the populations.

  8. The genome of Arabidopsis thaliana.

    OpenAIRE

    Goodman, H M; Ecker, J R; Dean, C

    1995-01-01

    Arabidopsis thaliana is a small flowering plant that is a member of the family cruciferae. It has many characteristics--diploid genetics, rapid growth cycle, relatively low repetitive DNA content, and small genome size--that recommend it as the model for a plant genome project. The current status of the genetic and physical maps, as well as efforts to sequence the genome, are presented. Examples are given of genes isolated by using map-based cloning. The importance of the Arabidopsis project ...

  9. Genomic selection in plant breeding.

    Science.gov (United States)

    Newell, Mark A; Jannink, Jean-Luc

    2014-01-01

    Genomic selection (GS) is a method to predict the genetic value of selection candidates based on the genomic estimated breeding value (GEBV) predicted from high-density markers positioned throughout the genome. Unlike marker-assisted selection, the GEBV is based on all markers including both minor and major marker effects. Thus, the GEBV may capture more of the genetic variation for the particular trait under selection.

  10. Genomic Feature Models

    DEFF Research Database (Denmark)

    Sørensen, Peter; Edwards, Stefan McKinnon; Rohde, Palle Duun

    -additive genetic mechanisms. These modeling approaches have proven to be highly useful to determine population genetic parameters as well as prediction of genetic risk or value. We present a series of statistical modelling approaches that use prior biological information for evaluating the collective action......Whole-genome sequences and multiple trait phenotypes from large numbers of individuals will soon be available in many populations. Well established statistical modeling approaches enable the genetic analyses of complex trait phenotypes while accounting for a variety of additive and non...... regions and gene ontologies) that provide better model fit and increase predictive ability of the statistical model for this trait....

  11. Genomic dairy cattle breeding

    DEFF Research Database (Denmark)

    Mark, Thomas; Sandøe, Peter

    2010-01-01

    the thoughts of breeders and other stakeholders on how to best make use of genomic breeding in the future. Intensive breeding has played a major role in securing dramatic increases in milk yield since the Second World War. Until recently, the main focus in dairy cattle breeding was on production traits...... it less accountable to the concern of private farmers for the welfare of their animals. It is argued that there is a need to mobilise a wide range of stakeholders to monitor developments and maintain pressure on breeding companies so that they are aware of the need to take precautionary measures to avoid...

  12. Genome engineering in Vibrio cholerae

    DEFF Research Database (Denmark)

    Val, Marie-Eve; Skovgaard, Ole; Ducos-Galand, Magaly

    2012-01-01

    Although bacteria with multipartite genomes are prevalent, our knowledge of the mechanisms maintaining their genome is very limited, and much remains to be learned about the structural and functional interrelationships of multiple chromosomes. Owing to its bi-chromosomal genome architecture and its....... This difficulty was surmounted using a unique and powerful strategy based on massive rearrangement of prokaryotic genomes. We developed a site-specific recombination-based engineering tool, which allows targeted, oriented, and reciprocal DNA exchanges. Using this genetic tool, we obtained a panel of V. cholerae...

  13. Genome Writing: Current Progress and Related Applications

    Directory of Open Access Journals (Sweden)

    Yueqiang Wang

    2018-02-01

    Full Text Available The ultimate goal of synthetic biology is to build customized cells or organisms to meet specific industrial or medical needs. The most important part of the customized cell is a synthetic genome. Advanced genomic writing technologies are required to build such an artificial genome. Recently, the partially-completed synthetic yeast genome project represents a milestone in this field. In this mini review, we briefly introduce the techniques for de novo genome synthesis and genome editing. Furthermore, we summarize recent research progresses and highlight several applications in the synthetic genome field. Finally, we discuss current challenges and future prospects. Keywords: Synthetic biology, Genome writing, Genome editing, Bioethics, Biosafety

  14. Comparative genomics of Lactobacillus and other LAB

    DEFF Research Database (Denmark)

    Wassenaar, Trudy M.; Lukjancenko, Oksana

    2014-01-01

    that of the others, with the two Streptococcus species having the shortest genomes. The widest distribution in genome content was observed for Lactobacillus. The number of tRNA and rRNA gene copies varied considerably, with exceptional high numbers observed for Lb. delbrueckii, while these numbers were relatively......The genomes of 66 LABs, belonging to five different genera, were compared for genome size and gene content. The analyzed genomes included 37 Lactobacillus genomes of 17 species, six Lactococcus lactis genomes, four Leuconostoc genomes of three species, six Streptococcus genomes of two species...

  15. Comparative genomics of the lactic acid bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, K.; Slesarev, A.; Wolf, Y.; Sorokin, A.; Mirkin, B.; Koonin, E.; Pavlov, A.; Pavlova, N.; Karamychev, V.; Polouchine, N.; Shakhova, V.; Grigoriev, I.; Lou, Y.; Rokhsar, D.; Lucas, S.; Huang, K.; Goodstein, D. M.; Hawkins, T.; Plengvidhya, V.; Welker, D.; Hughes, J.; Goh, Y.; Benson, A.; Baldwin, K.; Lee, J. -H.; Diaz-Muniz, I.; Dosti, B.; Smeianov, V; Wechter, W.; Barabote, R.; Lorca, G.; Altermann, E.; Barrangou, R.; Ganesan, B.; Xie, Y.; Rawsthorne, H.; Tamir, D.; Parker, C.; Breidt, F.; Broadbent, J.; Hutkins, R.; O' Sullivan, D.; Steele, J.; Unlu, G.; Saier, M.; Klaenhammer, T.; Richardson, P.; Kozyavkin, S.; Weimer, B.; Mills, D.

    2006-06-01

    Lactic acid-producing bacteria are associated with various plant and animal niches and play a key role in the production of fermented foods and beverages. We report nine genome sequences representing the phylogenetic and functional diversity of these bacteria. The small genomes of lactic acid bacteria encode a broad repertoire of transporters for efficient carbon and nitrogen acquisition from the nutritionally rich environments they inhabit and reflect a limited range of biosynthetic capabilities that indicate both prototrophic and auxotrophic strains. Phylogenetic analyses, comparison of gene content across the group, and reconstruction of ancestral gene sets indicate a combination of extensive gene loss and key gene acquisitions via horizontal gene transfer during the coevolution of lactic acid bacteria with their habitats.

  16. Oceanographic and Biogeochemical Insights from Diatom Genomes

    Science.gov (United States)

    Bowler, Chris; Vardi, Assaf; Allen, Andrew E.

    2010-01-01

    Diatoms are the most successful group of eukaryotic phytoplankton in the modern ocean and have risen to dominance relatively quickly over the last 100 million years. Recently completed whole genome sequences from two species of diatom, Thalassiosira pseudonana and Phaeodactylum tricornutum, have revealed a wealth of information about the evolutionary origins and metabolic adaptations that have led to their ecological success. A major finding is that they have incorporated genes both from their endosymbiotic ancestors and by horizontal gene transfer from marine bacteria. This unique melting pot of genes encodes novel capacities for metabolic management, for example, allowing the integration of a urea cycle into a photosynthetic cell. In this review we show how genome-enabled approaches are being leveraged to explore major phenomena of oceanographic and biogeochemical relevance, such as nutrient assimilation and life histories in diatoms. We also discuss how diatoms may be affected by climate change-induced alterations in ocean processes.

  17. Characterization of genome in tetraploid StY species of Elymus (Triticeae: Poaceae) using sequential FISH and GISH.

    Science.gov (United States)

    Liu, Ruijuan; Wang, Richard R-C; Yu, Feng; Lu, Xingwang; Dou, Quanwen

    2017-08-01

    Genomes of ten species of Elymus, either presumed or known as tetraploid StY, were characterized using fluorescence in situ hybridization (FISH) and genomic in situ hybridization (GISH). These tetraploid species could be grouped into three categories. Type I included StY genome reported species-Roegneria pendulina, R. nutans, R. glaberrima, R. ciliaris, and Elymus nevskii, and StY genome presumed species-R. sinica, R. breviglumis, and R. dura, whose genome could be separated into two sets based on different GISH intensities. Type I genome constitution was deemed as putative StY. The St genome were mainly characterized with intense hybridization with pAs1, fewer AAG sites, and linked distribution of 5S rDNA and 18S-26S rDNA, while the Y genome with less intense hybridization with pAs1, more varied AAG sites, and isolated distribution of 5S rDNA and 18S-26S rDNA. Nevertheless, further genomic variations were detected among the different StY species. Type II included E. alashanicus, whose genome could be easily separated based on GISH pattern. FISH and GISH patterns suggested that E. alashanicus comprised a modified St genome and an unknown genome. Type III included E. longearistatus, whose genome could not be separated by GISH and was designated as St l Y l . Notably, a close relationship between S l and Y l genomes was observed.

  18. Genome analysis of E. coli isolated from Crohn's disease patients.

    Science.gov (United States)

    Rakitina, Daria V; Manolov, Alexander I; Kanygina, Alexandra V; Garushyants, Sofya K; Baikova, Julia P; Alexeev, Dmitry G; Ladygina, Valentina G; Kostryukova, Elena S; Larin, Andrei K; Semashko, Tatiana A; Karpova, Irina Y; Babenko, Vladislav V; Ismagilova, Ruzilya K; Malanin, Sergei Y; Gelfand, Mikhail S; Ilina, Elena N; Gorodnichev, Roman B; Lisitsyna, Eugenia S; Aleshkin, Gennady I; Scherbakov, Petr L; Khalif, Igor L; Shapina, Marina V; Maev, Igor V; Andreev, Dmitry N; Govorun, Vadim M

    2017-07-19

    Escherichia coli (E. coli) has been increasingly implicated in the pathogenesis of Crohn's disease (CD). The phylogeny of E. coli isolated from Crohn's disease patients (CDEC) was controversial, and while genotyping results suggested heterogeneity, the sequenced strains of E. coli from CD patients were closely related. We performed the shotgun genome sequencing of 28 E. coli isolates from ten CD patients and compared genomes from these isolates with already published genomes of CD strains and other pathogenic and non-pathogenic strains. CDEC was shown to belong to A, B1, B2 and D phylogenetic groups. The plasmid and several operons from the reference CD-associated E. coli strain LF82 were demonstrated to be more often present in CDEC genomes belonging to different phylogenetic groups than in genomes of commensal strains. The operons include carbon-source induced invasion GimA island, prophage I, iron uptake operons I and II, capsular assembly pathogenetic island IV and propanediol and galactitol utilization operons. Our findings suggest that CDEC are phylogenetically diverse. However, some strains isolated from independent sources possess highly similar chromosome or plasmids. Though no CD-specific genes or functional domains were present in all CD-associated strains, some genes and operons are more often found in the genomes of CDEC than in commensal E. coli. They are principally linked to gut colonization and utilization of propanediol and other sugar alcohols.

  19. COGNAT: a web server for comparative analysis of genomic neighborhoods.

    Science.gov (United States)

    Klimchuk, Olesya I; Konovalov, Kirill A; Perekhvatov, Vadim V; Skulachev, Konstantin V; Dibrova, Daria V; Mulkidjanian, Armen Y

    2017-11-22

    In prokaryotic genomes, functionally coupled genes can be organized in conserved gene clusters enabling their coordinated regulation. Such clusters could contain one or several operons, which are groups of co-transcribed genes. Those genes that evolved from a common ancestral gene by speciation (i.e. orthologs) are expected to have similar genomic neighborhoods in different organisms, whereas those copies of the gene that are responsible for dissimilar functions (i.e. paralogs) could be found in dissimilar genomic contexts. Comparative analysis of genomic neighborhoods facilitates the prediction of co-regulated genes and helps to discern different functions in large protein families. We intended, building on the attribution of gene sequences to the clusters of orthologous groups of proteins (COGs), to provide a method for visualization and comparative analysis of genomic neighborhoods of evolutionary related genes, as well as a respective web server. Here we introduce the COmparative Gene Neighborhoods Analysis Tool (COGNAT), a web server for comparative analysis of genomic neighborhoods. The tool is based on the COG database, as well as the Pfam protein families database. As an example, we show the utility of COGNAT in identifying a new type of membrane protein complex that is formed by paralog(s) of one of the membrane subunits of the NADH:quinone oxidoreductase of type 1 (COG1009) and a cytoplasmic protein of unknown function (COG3002). This article was reviewed by Drs. Igor Zhulin, Uri Gophna and Igor Rogozin.

  20. Genome Update: alignment of bacterial chromosomes

    DEFF Research Database (Denmark)

    Ussery, David; Jensen, Mette; Poulsen, Tine Rugh

    2004-01-01

    There are four new microbial genomes listed in this month's Genome Update, three belonging to Gram-positive bacteria and one belonging to an archaeon that lives at pH 0; all of these genomes are listed in Table 1⇓. The method of genome comparison this month is that of genome alignment and, as an ...

  1. Comparative genomics of toxigenic and non-toxigenic Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Leekitcharoenphon, Pimlapas; Pamp, Sünje Johanna; Andresen, Lars Ole

    2016-01-01

    The most common causative agent of exudative epidermitis (EE) in pigs is Staphylococcus hyicus. S. hyicus can be grouped into toxigenic and non-toxigenic strains based on their ability to cause EE in pigs and specific virulence genes have been identified. A genome wide comparison between non......-toxigenic and toxigenic strains has never been performed. In this study, we sequenced eleven toxigenic and six non-toxigenic S. hyicus strains and performed comparative genomic and phylogenetic analysis. Our analyses revealed two genomic regions encoding genes that were predominantly found in toxigenic strains...... (polymorphic toxin) and was associated with the gene encoding ExhA. A clear differentiation between toxigenic and non-toxigenic strains based on genomic and phylogenetic analyses was not apparent. The results of this study support the observation that exfoliative toxins of S. hyicus and S. aureus are located...

  2. Complete genome sequence of 'Thermobaculum terrenum' type strain (YNP1).

    Science.gov (United States)

    Kiss, Hajnalka; Cleland, David; Lapidus, Alla; Lucas, Susan; Del Rio, Tijana Glavina; Nolan, Matt; Tice, Hope; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Ivanova, Natalia; Mavromatis, Konstantinos; Ovchinnikova, Galina; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Lu, Megan; Brettin, Thomas; Detter, John C; Göker, Markus; Tindall, Brian J; Beck, Brian; McDermott, Timothy R; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Cheng, Jan-Fang

    2010-10-27

    'Thermobaculum terrenum' Botero et al. 2004 is the sole species within the proposed genus 'Thermobaculum'. Strain YNP1(T) is the only cultivated member of an acid tolerant, extremely thermophilic species belonging to a phylogenetically isolated environmental clone group within the phylum Chloroflexi. At present, the name 'Thermobaculum terrenum' is not yet validly published as it contravenes Rule 30 (3a) of the Bacteriological Code. The bacterium was isolated from a slightly acidic extreme thermal soil in Yellowstone National Park, Wyoming (USA). Depending on its final taxonomic allocation, this is likely to be the third completed genome sequence of a member of the class Thermomicrobia and the seventh type strain genome from the phylum Chloroflexi. The 3,101,581 bp long genome with its 2,872 protein-coding and 58 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  3. Determining and comparing protein function in Bacterial genome sequences

    DEFF Research Database (Denmark)

    Vesth, Tammi Camilla

    of this class have very little homology to other known genomes making functional annotation based on sequence similarity very difficult. Inspired in part by this analysis, an approach for comparative functional annotation was created based public sequenced genomes, CMGfunc. Functionally related groups......In November 2013, there was around 21.000 different prokaryotic genomes sequenced and publicly available, and the number is growing daily with another 20.000 or more genomes expected to be sequenced and deposited by the end of 2014. An important part of the analysis of this data is the functional...... annotation of genes – the descriptions assigned to genes that describe the likely function of the encoded proteins. This process is limited by several factors, including the definition of a function which can be more or less specific as well as how many genes can actually be assigned a function based...

  4. Genome sequence of Ensifer adhaerens OV14 provides insights into its ability as a novel vector for the genetic transformation of plant genomes.

    Science.gov (United States)

    Rudder, Steven; Doohan, Fiona; Creevey, Christopher J; Wendt, Toni; Mullins, Ewen

    2014-04-07

    Recently it has been shown that Ensifer adhaerens can be used as a plant transformation technology, transferring genes into several plant genomes when equipped with a Ti plasmid. For this study, we have sequenced the genome of Ensifer adhaerens OV14 (OV14) and compared it with those of Agrobacterium tumefaciens C58 (C58) and Sinorhizobium meliloti 1021 (1021); the latter of which has also demonstrated a capacity to genetically transform crop genomes, albeit at significantly reduced frequencies. The 7.7 Mb OV14 genome comprises two chromosomes and two plasmids. All protein coding regions in the OV14 genome were functionally grouped based on an eggNOG database. No genes homologous to the A. tumefaciens Ti plasmid vir genes appeared to be present in the OV14 genome. Unexpectedly, OV14 and 1021 were found to possess homologs to chromosomal based genes cited as essential to A. tumefaciens T-DNA transfer. Of significance, genes that are non-essential but exert a positive influence on virulence and the ability to genetically transform host genomes were identified in OV14 but were absent from the 1021 genome. This study reveals the presence of homologs to chromosomally based Agrobacterium genes that support T-DNA transfer within the genome of OV14 and other alphaproteobacteria. The sequencing and analysis of the OV14 genome increases our understanding of T-DNA transfer by non-Agrobacterium species and creates a platform for the continued improvement of Ensifer-mediated transformation (EMT).

  5. Insights into structural variations and genome rearrangements in prokaryotic genomes.

    Science.gov (United States)

    Periwal, Vinita; Scaria, Vinod

    2015-01-01

    Structural variations (SVs) are genomic rearrangements that affect fairly large fragments of DNA. Most of the SVs such as inversions, deletions and translocations have been largely studied in context of genetic diseases in eukaryotes. However, recent studies demonstrate that genome rearrangements can also have profound impact on prokaryotic genomes, leading to altered cell phenotype. In contrast to single-nucleotide variations, SVs provide a much deeper insight into organization of bacterial genomes at a much better resolution. SVs can confer change in gene copy number, creation of new genes, altered gene expression and many other functional consequences. High-throughput technologies have now made it possible to explore SVs at a much refined resolution in bacterial genomes. Through this review, we aim to highlight the importance of the less explored field of SVs in prokaryotic genomes and their impact. We also discuss its potential applicability in the emerging fields of synthetic biology and genome engineering where targeted SVs could serve to create sophisticated and accurate genome editing. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Comparative genomics reveals insights into avian genome evolution and adaptation

    DEFF Research Database (Denmark)

    Zhang, Guojie; Li, Cai; Li, Qiye

    2014-01-01

    Birds are the most species-rich class of tetrapod vertebrates and have wide relevance across many research fields. We explored bird macroevolution using full genomes from 48 avian species representing all major extant clades. The avian genome is principally characterized by its constrained size, ...

  7. Pre-genomic, genomic and post-genomic study of microbial communities involved in bioenergy.

    Science.gov (United States)

    Rittmann, Bruce E; Krajmalnik-Brown, Rosa; Halden, Rolf U

    2008-08-01

    Microorganisms can produce renewable energy in large quantities and without damaging the environment or disrupting food supply. The microbial communities must be robust and self-stabilizing, and their essential syntrophies must be managed. Pre-genomic, genomic and post-genomic tools can provide crucial information about the structure and function of these microbial communities. Applying these tools will help accelerate the rate at which microbial bioenergy processes move from intriguing science to real-world practice.

  8. Genomic instability and radiation

    Energy Technology Data Exchange (ETDEWEB)

    Little, John B [Harvard School of Public Health, Boston, MA 02115 (United States)

    2003-06-01

    Genomic instability is a hallmark of cancer cells, and is thought to be involved in the process of carcinogenesis. Indeed, a number of rare genetic disorders associated with a predisposition to cancer are characterised by genomic instability occurring in somatic cells. Of particular interest is the observation that transmissible instability can be induced in somatic cells from normal individuals by exposure to ionising radiation, leading to a persistent enhancement in the rate at which mutations and chromosomal aberrations arise in the progeny of the irradiated cells after many generations of replication. If such induced instability is involved in radiation carcinogenesis, it would imply that the initial carcinogenic event may not be a rare mutation occurring in a specific gene or set of genes. Rather, radiation may induce a process of instability in many cells in a population, enhancing the rate at which the multiple gene mutations necessary for the development of cancer may arise in a given cell lineage. Furthermore, radiation could act at any stage in the development of cancer by facilitating the accumulation of the remaining genetic events required to produce a fully malignant tumour. The experimental evidence for such induced instability is reviewed. (review)

  9. Genomic instability and radiation

    International Nuclear Information System (INIS)

    Little, John B

    2003-01-01

    Genomic instability is a hallmark of cancer cells, and is thought to be involved in the process of carcinogenesis. Indeed, a number of rare genetic disorders associated with a predisposition to cancer are characterised by genomic instability occurring in somatic cells. Of particular interest is the observation that transmissible instability can be induced in somatic cells from normal individuals by exposure to ionising radiation, leading to a persistent enhancement in the rate at which mutations and chromosomal aberrations arise in the progeny of the irradiated cells after many generations of replication. If such induced instability is involved in radiation carcinogenesis, it would imply that the initial carcinogenic event may not be a rare mutation occurring in a specific gene or set of genes. Rather, radiation may induce a process of instability in many cells in a population, enhancing the rate at which the multiple gene mutations necessary for the development of cancer may arise in a given cell lineage. Furthermore, radiation could act at any stage in the development of cancer by facilitating the accumulation of the remaining genetic events required to produce a fully malignant tumour. The experimental evidence for such induced instability is reviewed. (review)

  10. Final report: 'Rhodopseudomonas palustris' genome workshop to be held in Spring of 2001; FINAL

    International Nuclear Information System (INIS)

    Harwood, Caroline S.

    2002-01-01

    The 'Rhodopseudomonas palustris' genome workshop took place in Iowa City on April 6-8, 2001. The purpose of the meeting was to instruct members of the annotation working group in approaches to accomplishing the 'human' phase of the 'R. palustris' genome annotation. A partial draft of a paper describing the 'Rhodopseudomonas palustris' genome has been written and a full version of the paper should be ready for submission by the end of the summer 2002

  11. Genomic selection: genome-wide prediction in plant improvement.

    Science.gov (United States)

    Desta, Zeratsion Abera; Ortiz, Rodomiro

    2014-09-01

    Association analysis is used to measure relations between markers and quantitative trait loci (QTL). Their estimation ignores genes with small effects that trigger underpinning quantitative traits. By contrast, genome-wide selection estimates marker effects across the whole genome on the target population based on a prediction model developed in the training population (TP). Whole-genome prediction models estimate all marker effects in all loci and capture small QTL effects. Here, we review several genomic selection (GS) models with respect to both the prediction accuracy and genetic gain from selection. Phenotypic selection or marker-assisted breeding protocols can be replaced by selection, based on whole-genome predictions in which phenotyping updates the model to build up the prediction accuracy. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Parasite Genome Projects and the Trypanosoma cruzi Genome Initiative

    Directory of Open Access Journals (Sweden)

    Wim Degrave

    1997-11-01

    Full Text Available Since the start of the human genome project, a great number of genome projects on other "model" organism have been initiated, some of them already completed. Several initiatives have also been started on parasite genomes, mainly through support from WHO/TDR, involving North-South and South-South collaborations, and great hopes are vested in that these initiatives will lead to new tools for disease control and prevention, as well as to the establishment of genomic research technology in developing countries. The Trypanosoma cruzi genome project, using the clone CL-Brener as starting point, has made considerable progress through the concerted action of more than 20 laboratories, most of them in the South. A brief overview of the current state of the project is given

  13. A Taste of Algal Genomes from the Joint Genome Institute

    Energy Technology Data Exchange (ETDEWEB)

    Kuo, Alan; Grigoriev, Igor

    2012-06-17

    Algae play profound roles in aquatic food chains and the carbon cycle, can impose health and economic costs through toxic blooms, provide models for the study of symbiosis, photosynthesis, and eukaryotic evolution, and are candidate sources for bio-fuels; all of these research areas are part of the mission of DOE's Joint Genome Institute (JGI). To date JGI has sequenced, assembled, annotated, and released to the public the genomes of 18 species and strains of algae, sampling almost all of the major clades of photosynthetic eukaryotes. With more algal genomes currently undergoing analysis, JGI continues its commitment to driving forward basic and applied algal science. Among these ongoing projects are the pan-genome of the dominant coccolithophore Emiliania huxleyi, the interrelationships between the 4 genomes in the nucleomorph-containing Bigelowiella natans and Guillardia theta, and the search for symbiosis genes of lichens.

  14. Genome-Enhanced Detection and Identification (GEDI of plant pathogens

    Directory of Open Access Journals (Sweden)

    Nicolas Feau

    2018-02-01

    Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.

  15. The Power and Potential of Genomics in Weed Biology and Management.

    Science.gov (United States)

    Ravet, Karl; Patterson, Eric L; Krähmer, Hansjörg; Hamouzová, Kateřina; Fan, Longjiang; Jasieniuk, Marie; Lawton-Rauh, Amy; Malone, Jenna M; Scott McElroy, J; Merotto, Aldo; Westra, Philip; Preston, Christopher; Vila-Aiub, Martin M; Busi, Roberto; Tranel, Patrick J; Reinhardt, Carl; Saski, Christopher; Beffa, Roland; Neve, Paul; Gaines, Todd A

    2018-04-24

    There have been previous calls for, and efforts focused on, realizing the power and potential of weed genomics for better understanding of weeds. Sustained advances in genome sequencing and assembly technologies now make it possible for individual research groups to generate reference genomes for multiple weed species at reasonable costs. Here, we present the outcomes from several meetings, discussions, and workshops focused on establishing an International Weed Genomics Consortium (IWGC) for a coordinated international effort in weed genomics. We review the 'state of the art' in genomics and weed genomics, including technologies, applications, and on-going weed genome projects. We also report the outcomes from a workshop and a global survey of the weed science community to identify priority species, key biological questions, and weed management applications that can be addressed through greater availability of, and access to, genomic resources. Major focus areas include the evolution of herbicide resistance and weedy traits, the development of molecular diagnostics, and the identification of novel targets and approaches for weed management. There is increasing interest in, and need for, weed genomics, and the establishment of the IWGC will provide the necessary global platform for communication and coordination of weed genomics research. This article is protected by copyright. All rights reserved.

  16. Genome wide characterization of simple sequence repeats in watermelon genome and their application in comparative mapping and genetic diversity analysis.

    Science.gov (United States)

    Zhu, Huayu; Song, Pengyao; Koo, Dal-Hoe; Guo, Luqin; Li, Yanman; Sun, Shouru; Weng, Yiqun; Yang, Luming

    2016-08-05

    Microsatellite markers are one of the most informative and versatile DNA-based markers used in plant genetic research, but their development has traditionally been difficult and costly. The whole genome sequencing with next-generation sequencing (NGS) technologies provides large amounts of sequence data to develop numerous microsatellite markers at whole genome scale. SSR markers have great advantage in cross-species comparisons and allow investigation of karyotype and genome evolution through highly efficient computation approaches such as in silico PCR. Here we described genome wide development and characterization of SSR markers in the watermelon (Citrullus lanatus) genome, which were then use in comparative analysis with two other important crop species in the Cucurbitaceae family: cucumber (Cucumis sativus L.) and melon (Cucumis melo L.). We further applied these markers in evaluating the genetic diversity and population structure in watermelon germplasm collections. A total of 39,523 microsatellite loci were identified from the watermelon draft genome with an overall density of 111 SSRs/Mbp, and 32,869 SSR primers were designed with suitable flanking sequences. The dinucleotide SSRs were the most common type representing 34.09 % of the total SSR loci and the AT-rich motifs were the most abundant in all nucleotide repeat types. In silico PCR analysis identified 832 and 925 SSR markers with each having a single amplicon in the cucumber and melon draft genome, respectively. Comparative analysis with these cross-species SSR markers revealed complicated mosaic patterns of syntenic blocks among the genomes of three species. In addition, genetic diversity analysis of 134 watermelon accessions with 32 highly informative SSR loci placed these lines into two groups with all accessions of C.lanatus var. citorides and three accessions of C. colocynthis clustered in one group and all accessions of C. lanatus var. lanatus and the remaining accessions of C. colocynthis

  17. OryzaGenome: Genome Diversity Database of Wild Oryza Species

    KAUST Repository

    Ohyanagi, Hajime

    2015-11-18

    The species in the genus Oryza, encompassing nine genome types and 23 species, are a rich genetic resource and may have applications in deeper genomic analyses aiming to understand the evolution of plant genomes. With the advancement of next-generation sequencing (NGS) technology, a flood of Oryza species reference genomes and genomic variation information has become available in recent years. This genomic information, combined with the comprehensive phenotypic information that we are accumulating in our Oryzabase, can serve as an excellent genotype-phenotype association resource for analyzing rice functional and structural evolution, and the associated diversity of the Oryza genus. Here we integrate our previous and future phenotypic/habitat information and newly determined genotype information into a united repository, named OryzaGenome, providing the variant information with hyperlinks to Oryzabase. The current version of OryzaGenome includes genotype information of 446 O. rufipogon accessions derived by imputation and of 17 accessions derived by imputation-free deep sequencing. Two variant viewers are implemented: SNP Viewer as a conventional genome browser interface and Variant Table as a textbased browser for precise inspection of each variant one by one. Portable VCF (variant call format) file or tabdelimited file download is also available. Following these SNP (single nucleotide polymorphism) data, reference pseudomolecules/ scaffolds/contigs and genome-wide variation information for almost all of the closely and distantly related wild Oryza species from the NIG Wild Rice Collection will be available in future releases. All of the resources can be accessed through http://viewer.shigen.info/oryzagenome/.

  18. Applications of blood group genotyping

    Directory of Open Access Journals (Sweden)

    Mariza A. Mota

    2006-03-01

    Full Text Available Introduction: The determination of blood group polymorphism atthe genomic level facilitates the resolution of clinical problemsthat cannot be addressed by hemagglutination. They are useful to(a determine antigen types for which currently available antibodiesare weakly reactive; (b type patients who have been recentlytransfused; (c identify fetuses at risk for hemolytic disease of thenewborn; and (d to increase the reliability of repositories of antigennegative RBCs for transfusion. Objectives: This review assessedthe current applications of blood group genotyping in transfusionmedicine and hemolytic disease of the newborn. Search strategy:Blood group genotyping studies and reviews were searched ingeneral database (MEDLINE and references were reviewed.Selection criteria: All published data and reviews were eligible forinclusion provided they reported results for molecular basis ofblood group antigens, DNA analysis for blood group polymorphisms,determination of fetal group status and applications of blood groupgenotyping in blood transfusion. Data collection: All data werecollected based on studies and reviews of blood grouppolymorphisms and their clinical applications.

  19. Chloroplast Genome Sequence of pigeonpea (Cajanus cajan (L. Millspaugh and Cajanus scarabaeoides: Genome organization and Comparison with other legumes

    Directory of Open Access Journals (Sweden)

    Tanvi Kaila

    2016-12-01

    Full Text Available Pigeonpea (Cajanus cajan (L. Millspaugh, a diploid (2n = 22 legume crop with a genome size of 852 Mbp, serves as an important source of human dietary protein especially in South East Asian and African regions. In this study, the draft chloroplast genomes of Cajanus cajan and Cajanus scarabaeoides were sequenced. Cajanus scarabaeoides is an important species of the Cajanus gene pool and has also been used for developing promising CMS system by different groups. A male sterile genotype harbouring the Cajanus scarabaeoides cytoplasm was used for sequencing the plastid genome. The cp genome of Cajanus cajan is 152,242bp long, having a quadripartite structure with LSC of 83,455 bp and SSC of 17,871 bp separated by IRs of 25,398 bp. Similarly, the cp genome of Cajanus scarabaeoides is 152,201bp long, having a quadripartite structure in which IRs of 25,402 bp length separates 83,423 bp of LSC and 17,854 bp of SSC. The pigeonpea cp genome contains 116 unique genes, including 30 tRNA, 4 rRNA, 78 predicted protein coding genes and 5 pseudogenes. A 50kb inversion was observed in the LSC region of pigeonpea cp genome, consistent with other legumes. Comparison of cp genome with other legumes revealed the contraction of IR boundaries due to the absence of rps19 gene in the IR region. Chloroplast SSRs were mined and a total of 280 and 292 cpSSRs were identified in Cajanus scarabaeoides and Cajanus cajan respectively. RNA editing was observed at 37 sites in both Cajanus scarabaeoides and Cajanus cajan, with maximum occurrence in the ndh genes. The pigeonpea cp genome sequence would be beneficial in providing informative molecular markers which can be utilized for genetic diversity analysis and aid in understanding the plant systematics studies among major grain legumes.

  20. Cocoa/Cotton Comparative Genomics

    Science.gov (United States)

    With genome sequence from two members of the Malvaceae family recently made available, we are exploring syntenic relationships, gene content, and evolutionary trajectories between the cacao and cotton genomes. An assembly of cacao (Theobroma cacao) using Illumina and 454 sequence technology yielded ...

  1. Genomic selection in dairy cattle

    NARCIS (Netherlands)

    Roos, de A.P.W.

    2011-01-01

    The objectives of this Ph.D. thesis were (1) to optimise genomic selection in dairy cattle with respect to the accuracy of predicting total genetic merit and (2) to optimise a dairy cattle breeding program using genomic selection. The study was performed using a combination of real data sets and

  2. Cloud computing for comparative genomics

    Directory of Open Access Journals (Sweden)

    Pivovarov Rimma

    2010-05-01

    Full Text Available Abstract Background Large comparative genomics studies and tools are becoming increasingly more compute-expensive as the number of available genome sequences continues to rise. The capacity and cost of local computing infrastructures are likely to become prohibitive with the increase, especially as the breadth of questions continues to rise. Alternative computing architectures, in particular cloud computing environments, may help alleviate this increasing pressure and enable fast, large-scale, and cost-effective comparative genomics strategies going forward. To test this, we redesigned a typical comparative genomics algorithm, the reciprocal smallest distance algorithm (RSD, to run within Amazon's Elastic Computing Cloud (EC2. We then employed the RSD-cloud for ortholog calculations across a wide selection of fully sequenced genomes. Results We ran more than 300,000 RSD-cloud processes within the EC2. These jobs were farmed simultaneously to 100 high capacity compute nodes using the Amazon Web Service Elastic Map Reduce and included a wide mix of large and small genomes. The total computation time took just under 70 hours and cost a total of $6,302 USD. Conclusions The effort to transform existing comparative genomics algorithms from local compute infrastructures is not trivial. However, the speed and flexibility of cloud computing environments provides a substantial boost with manageable cost. The procedure designed to transform the RSD algorithm into a cloud-ready application is readily adaptable to similar comparative genomics problems.

  3. Cloud computing for comparative genomics.

    Science.gov (United States)

    Wall, Dennis P; Kudtarkar, Parul; Fusaro, Vincent A; Pivovarov, Rimma; Patil, Prasad; Tonellato, Peter J

    2010-05-18

    Large comparative genomics studies and tools are becoming increasingly more compute-expensive as the number of available genome sequences continues to rise. The capacity and cost of local computing infrastructures are likely to become prohibitive with the increase, especially as the breadth of questions continues to rise. Alternative computing architectures, in particular cloud computing environments, may help alleviate this increasing pressure and enable fast, large-scale, and cost-effective comparative genomics strategies going forward. To test this, we redesigned a typical comparative genomics algorithm, the reciprocal smallest distance algorithm (RSD), to run within Amazon's Elastic Computing Cloud (EC2). We then employed the RSD-cloud for ortholog calculations across a wide selection of fully sequenced genomes. We ran more than 300,000 RSD-cloud processes within the EC2. These jobs were farmed simultaneously to 100 high capacity compute nodes using the Amazon Web Service Elastic Map Reduce and included a wide mix of large and small genomes. The total computation time took just under 70 hours and cost a total of $6,302 USD. The effort to transform existing comparative genomics algorithms from local compute infrastructures is not trivial. However, the speed and flexibility of cloud computing environments provides a substantial boost with manageable cost. The procedure designed to transform the RSD algorithm into a cloud-ready application is readily adaptable to similar comparative genomics problems.

  4. Bioinformatics of genomic association mapping

    NARCIS (Netherlands)

    Vaez Barzani, Ahmad

    2015-01-01

    In this thesis we present an overview of bioinformatics-based approaches for genomic association mapping, with emphasis on human quantitative traits and their contribution to complex diseases. We aim to provide a comprehensive walk-through of the classic steps of genomic association mapping

  5. Allele coding in genomic evaluation

    DEFF Research Database (Denmark)

    Standen, Ismo; Christensen, Ole Fredslund

    2011-01-01

    Genomic data are used in animal breeding to assist genetic evaluation. Several models to estimate genomic breeding values have been studied. In general, two approaches have been used. One approach estimates the marker effects first and then, genomic breeding values are obtained by summing marker...... effects. In the second approach, genomic breeding values are estimated directly using an equivalent model with a genomic relationship matrix. Allele coding is the method chosen to assign values to the regression coefficients in the statistical model. A common allele coding is zero for the homozygous...... genotype of the first allele, one for the heterozygote, and two for the homozygous genotype for the other allele. Another common allele coding changes these regression coefficients by subtracting a value from each marker such that the mean of regression coefficients is zero within each marker. We call...

  6. Pathophysiology of MDS: genomic aberrations.

    Science.gov (United States)

    Ichikawa, Motoshi

    2016-01-01

    Myelodysplastic syndromes (MDS) are characterized by clonal proliferation of hematopoietic stem/progenitor cells and their apoptosis, and show a propensity to progress to acute myelogenous leukemia (AML). Although MDS are recognized as neoplastic diseases caused by genomic aberrations of hematopoietic cells, the details of the genetic abnormalities underlying disease development have not as yet been fully elucidated due to difficulties in analyzing chromosomal abnormalities. Recent advances in comprehensive analyses of disease genomes including whole-genome sequencing technologies have revealed the genomic abnormalities in MDS. Surprisingly, gene mutations were found in approximately 80-90% of cases with MDS, and the novel mutations discovered with these technologies included previously unknown, MDS-specific, mutations such as those of the genes in the RNA-splicing machinery. It is anticipated that these recent studies will shed new light on the pathophysiology of MDS due to genomic aberrations.

  7. Chemical biology on the genome.

    Science.gov (United States)

    Balasubramanian, Shankar

    2014-08-15

    In this article I discuss studies towards understanding the structure and function of DNA in the context of genomes from the perspective of a chemist. The first area I describe concerns the studies that led to the invention and subsequent development of a method for sequencing DNA on a genome scale at high speed and low cost, now known as Solexa/Illumina sequencing. The second theme will feature the four-stranded DNA structure known as a G-quadruplex with a focus on its fundamental properties, its presence in cellular genomic DNA and the prospects for targeting such a structure in cels with small molecules. The final topic for discussion is naturally occurring chemically modified DNA bases with an emphasis on chemistry for decoding (or sequencing) such modifications in genomic DNA. The genome is a fruitful topic to be further elucidated by the creation and application of chemical approaches. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. IMA Genome-F 5G

    OpenAIRE

    Wingfield, Brenda D.; Barnes, Irene; Wilhelm de Beer, Z.; De Vos, Lieschen; Duong, Tuan A.; Kanzi, Aquillah M.; Naidoo, Kershney; Nguyen, Hai D.T.; Santana, Quentin C.; Sayari, Mohammad; Seifert, Keith A.; Steenkamp, Emma T.; Trollip, Conrad; van der Merwe, Nicolaas A.; van der Nest, Magriet A.

    2015-01-01

    The genomes of Ceratocystis eucalypticola, Chrysoporthe cubensis, Chrysoporthe deuterocubensis, Davidsoniella virescens, Fusarium temperatum, Graphilbum fragrans, Penicillium nordicum and Thielaviopsis musarum are presented in this genome announcement. These seven genomes are from plant pathogens and otherwise economically important fungal species. The genome sizes range from 28 Mb in the case of T. musarum to 45 Mb for Fusarium temperatum. These genomes include the first reports of genomes f...

  9. [Preface for genome editing special issue].

    Science.gov (United States)

    Gu, Feng; Gao, Caixia

    2017-10-25

    Genome editing technology, as an innovative biotechnology, has been widely used for editing the genome from model organisms, animals, plants and microbes. CRISPR/Cas9-based genome editing technology shows its great value and potential in the dissection of functional genomics, improved breeding and genetic disease treatment. In the present special issue, the principle and application of genome editing techniques has been summarized. The advantages and disadvantages of the current genome editing technology and future prospects would also be highlighted.

  10. Privacy in the Genomic Era.

    Science.gov (United States)

    Naveed, Muhammad; Ayday, Erman; Clayton, Ellen W; Fellay, Jacques; Gunter, Carl A; Hubaux, Jean-Pierre; Malin, Bradley A; Wang, Xiaofeng

    2015-09-01

    Genome sequencing technology has advanced at a rapid pace and it is now possible to generate highly-detailed genotypes inexpensively. The collection and analysis of such data has the potential to support various applications, including personalized medical services. While the benefits of the genomics revolution are trumpeted by the biomedical community, the increased availability of such data has major implications for personal privacy; notably because the genome has certain essential features, which include (but are not limited to) (i) an association with traits and certain diseases, (ii) identification capability (e.g., forensics), and (iii) revelation of family relationships. Moreover, direct-to-consumer DNA testing increases the likelihood that genome data will be made available in less regulated environments, such as the Internet and for-profit companies. The problem of genome data privacy thus resides at the crossroads of computer science, medicine, and public policy. While the computer scientists have addressed data privacy for various data types, there has been less attention dedicated to genomic data. Thus, the goal of this paper is to provide a systematization of knowledge for the computer science community. In doing so, we address some of the (sometimes erroneous) beliefs of this field and we report on a survey we conducted about genome data privacy with biomedical specialists. Then, after characterizing the genome privacy problem, we review the state-of-the-art regarding privacy attacks on genomic data and strategies for mitigating such attacks, as well as contextualizing these attacks from the perspective of medicine and public policy. This paper concludes with an enumeration of the challenges for genome data privacy and presents a framework to systematize the analysis of threats and the design of countermeasures as the field moves forward.

  11. Privacy in the Genomic Era

    Science.gov (United States)

    NAVEED, MUHAMMAD; AYDAY, ERMAN; CLAYTON, ELLEN W.; FELLAY, JACQUES; GUNTER, CARL A.; HUBAUX, JEAN-PIERRE; MALIN, BRADLEY A.; WANG, XIAOFENG

    2015-01-01

    Genome sequencing technology has advanced at a rapid pace and it is now possible to generate highly-detailed genotypes inexpensively. The collection and analysis of such data has the potential to support various applications, including personalized medical services. While the benefits of the genomics revolution are trumpeted by the biomedical community, the increased availability of such data has major implications for personal privacy; notably because the genome has certain essential features, which include (but are not limited to) (i) an association with traits and certain diseases, (ii) identification capability (e.g., forensics), and (iii) revelation of family relationships. Moreover, direct-to-consumer DNA testing increases the likelihood that genome data will be made available in less regulated environments, such as the Internet and for-profit companies. The problem of genome data privacy thus resides at the crossroads of computer science, medicine, and public policy. While the computer scientists have addressed data privacy for various data types, there has been less attention dedicated to genomic data. Thus, the goal of this paper is to provide a systematization of knowledge for the computer science community. In doing so, we address some of the (sometimes erroneous) beliefs of this field and we report on a survey we conducted about genome data privacy with biomedical specialists. Then, after characterizing the genome privacy problem, we review the state-of-the-art regarding privacy attacks on genomic data and strategies for mitigating such attacks, as well as contextualizing these attacks from the perspective of medicine and public policy. This paper concludes with an enumeration of the challenges for genome data privacy and presents a framework to systematize the analysis of threats and the design of countermeasures as the field moves forward. PMID:26640318

  12. Genomics technologies to study structural variations in the grapevine genome

    Directory of Open Access Journals (Sweden)

    Cardone Maria Francesca

    2016-01-01

    Full Text Available Grapevine is one of the most important crop plants in the world. Recently there was great expansion of genomics resources about grapevine genome, thus providing increasing efforts for molecular breeding. Current cultivars display a great level of inter-specific differentiation that needs to be investigated to reach a comprehensive understanding of the genetic basis of phenotypic differences, and to find responsible genes selected by cross breeding programs. While there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs on plant genomes, few data are available on copy number variation (CNV. Furthermore association between structural variations and phenotypes has been described in only a few cases. We combined high throughput biotechnologies and bioinformatics tools, to reveal the first inter-varietal atlas of structural variation (SV for the grapevine genome. We sequenced and compared four table grape cultivars with the Pinot noir inbred line PN40024 genome as the reference. We detected roughly 8% of the grapevine genome affected by genomic variations. Taken into account phenotypic differences existing among the studied varieties we performed comparison of SVs among them and the reference and next we performed an in-depth analysis of gene content of polymorphic regions. This allowed us to identify genes showing differences in copy number as putative functional candidates for important traits in grapevine cultivation.

  13. Comparative genomics of Mycoplasma: analysis of conserved essential genes and diversity of the pan-genome.

    Directory of Open Access Journals (Sweden)

    Wei Liu

    Full Text Available Mycoplasma, the smallest self-replicating organism with a minimal metabolism and little genomic redundancy, is expected to be a close approximation to the minimal set of genes needed to sustain bacterial life. This study employs comparative evolutionary analysis of twenty Mycoplasma genomes to gain an improved understanding of essential genes. By analyzing the core genome of mycoplasmas, we finally revealed the conserved essential genes set for mycoplasma survival. Further analysis showed that the core genome set has many characteristics in common with experimentally identified essential gen