WorldWideScience

Sample records for cloning nucleotide sequence

  1. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  2. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  3. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    Science.gov (United States)

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  4. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  5. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  6. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-01-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  7. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  8. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  9. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  10. The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

    International Nuclear Information System (INIS)

    Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

    1985-01-01

    The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

  11. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  12. Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

    Science.gov (United States)

    Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

    1994-10-01

    Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

  13. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  14. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  15. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    Science.gov (United States)

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  16. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  17. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  18. Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

    DEFF Research Database (Denmark)

    Dobrowolska, G; Boldyreff, B; Issinger, O G

    1991-01-01

    The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....

  19. Cloning, sequencing and expression of a xylanase gene from the maize pathogen Helminthosporium turcicum

    DEFF Research Database (Denmark)

    Degefu, Y.; Paulin, L.; Lübeck, Peter Stephensen

    2001-01-01

    A gene encoding an endoxylanase from the phytopathogenic fungus Helminthosporium turcicum Pass. was cloned and sequenced. The entire nucleotide sequence of a 1991 bp genomic fragment containing an endoxylanase gene was determined. The xylanase gene of 795 bp, interrupted by two introns of 52 and ...

  20. Molecular cloning and characterization of genes required for nucleotide excision repair in yeast

    International Nuclear Information System (INIS)

    Friedberg, E.C.

    1987-01-01

    Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies

  1. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  2. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  3. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  4. Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha

    NARCIS (Netherlands)

    Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.

    1989-01-01

    We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence

  5. Hybrid sequencing approach applied to human fecal metagenomic clone libraries revealed clones with potential biotechnological applications.

    Science.gov (United States)

    Džunková, Mária; D'Auria, Giuseppe; Pérez-Villarroya, David; Moya, Andrés

    2012-01-01

    Natural environments represent an incredible source of microbial genetic diversity. Discovery of novel biomolecules involves biotechnological methods that often require the design and implementation of biochemical assays to screen clone libraries. However, when an assay is applied to thousands of clones, one may eventually end up with very few positive clones which, in most of the cases, have to be "domesticated" for downstream characterization and application, and this makes screening both laborious and expensive. The negative clones, which are not considered by the selected assay, may also have biotechnological potential; however, unfortunately they would remain unexplored. Knowledge of the clone sequences provides important clues about potential biotechnological application of the clones in the library; however, the sequencing of clones one-by-one would be very time-consuming and expensive. In this study, we characterized the first metagenomic clone library from the feces of a healthy human volunteer, using a method based on 454 pyrosequencing coupled with a clone-by-clone Sanger end-sequencing. Instead of whole individual clone sequencing, we sequenced 358 clones in a pool. The medium-large insert (7-15 kb) cloning strategy allowed us to assemble these clones correctly, and to assign the clone ends to maintain the link between the position of a living clone in the library and the annotated contig from the 454 assembly. Finally, we found several open reading frames (ORFs) with previously described potential medical application. The proposed approach allows planning ad-hoc biochemical assays for the clones of interest, and the appropriate sub-cloning strategy for gene expression in suitable vectors/hosts.

  6. Hybrid sequencing approach applied to human fecal metagenomic clone libraries revealed clones with potential biotechnological applications.

    Directory of Open Access Journals (Sweden)

    Mária Džunková

    Full Text Available Natural environments represent an incredible source of microbial genetic diversity. Discovery of novel biomolecules involves biotechnological methods that often require the design and implementation of biochemical assays to screen clone libraries. However, when an assay is applied to thousands of clones, one may eventually end up with very few positive clones which, in most of the cases, have to be "domesticated" for downstream characterization and application, and this makes screening both laborious and expensive. The negative clones, which are not considered by the selected assay, may also have biotechnological potential; however, unfortunately they would remain unexplored. Knowledge of the clone sequences provides important clues about potential biotechnological application of the clones in the library; however, the sequencing of clones one-by-one would be very time-consuming and expensive. In this study, we characterized the first metagenomic clone library from the feces of a healthy human volunteer, using a method based on 454 pyrosequencing coupled with a clone-by-clone Sanger end-sequencing. Instead of whole individual clone sequencing, we sequenced 358 clones in a pool. The medium-large insert (7-15 kb cloning strategy allowed us to assemble these clones correctly, and to assign the clone ends to maintain the link between the position of a living clone in the library and the annotated contig from the 454 assembly. Finally, we found several open reading frames (ORFs with previously described potential medical application. The proposed approach allows planning ad-hoc biochemical assays for the clones of interest, and the appropriate sub-cloning strategy for gene expression in suitable vectors/hosts.

  7. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  8. Enhanced Protein Production in Escherichia coli by Optimization of Cloning Scars at the Vector-Coding Sequence Junction

    DEFF Research Database (Denmark)

    Mirzadeh, Kiavash; Martinez, Virginia; Toddo, Stephen

    2015-01-01

    are poorly expressed even when they are codon-optimized and expressed from vectors with powerful genetic elements. In this study, we show that poor expression can be caused by certain nucleotide sequences (e.g., cloning scars) at the junction between the vector and the coding sequence. Since these sequences...

  9. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  10. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  11. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  12. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  13. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...

  14. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  15. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  16. Coding sequence of human rho cDNAs clone 6 and clone 9

    Energy Technology Data Exchange (ETDEWEB)

    Chardin, P; Madaule, P; Tavitian, A

    1988-03-25

    The authors have isolated human cDNAs including the complete coding sequence for two rho proteins corresponding to the incomplete isolates previously described as clone 6 and clone 9. The deduced a.a. sequences, when compared to the a.a. sequence deduced from clone 12 cDNA, show that there are in human at least three highly homologous rho genes. They suggest that clone 12 be named rhoA, clone 6 : rhoB and clone 9 : rhoC. RhoA, B and C proteins display approx. 30% a.a. identity with ras proteins,. mainly clustered in four highly homologous internal regions corresponding to the GTP binding site; however at least one significant difference is found; the 3 rho proteins have an Alanine in position corresponding to ras Glycine 13, suggesting that rho and ras proteins might have slightly different biochemical properties.

  17. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  18. Molecular cloning and functional characterization of duck nucleotide-binding oligomerization domain 1 (NOD1).

    Science.gov (United States)

    Li, Huilin; Jin, Hui; Li, Yaqian; Liu, Dejian; Foda, Mohamed Frahat; Jiang, Yunbo; Luo, Rui

    2017-09-01

    Nucleotide-binding oligomerization domain 1 (NOD1) is an imperative cytoplasmic pattern recognition receptor (PRR) and considered as a key member of the NOD-like receptor (NLR) family which plays a critical role in innate immunity through sensing microbial components derived from bacterial peptidoglycan. In the current study, the full-length of duck NOD1 (duNOD1) cDNA from duck embryo fibroblasts (DEFs) was cloned. Multiple sequence alignment and phylogenetic analysis demonstrated that duNOD1 exhibited a strong evolutionary relationship with chicken and rock pigeon NOD1. Tissue-specific expression analysis showed that duNOD1 was widely distributed in various organs, with the highest expression observed in the liver. Furthermore, duNOD1 overexpression induced NF-κB activation in DEFs and the CARD domain is crucial for duNOD1-mediated NF-κB activation. In addition, silencing the duNOD1 decreased the activity of NF-κB in DEFs stimulated by iE-DAP. Overexpression of duNOD1 significantly increased the expression of TNF-α, IL-6, and RANTES in DEFs. These findings highlight the crucial role of duNOD1 as an intracellular sensor in duck innate immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    International Nuclear Information System (INIS)

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.; Price, S.R.; Moss, J.; Vaughan, M.

    1989-01-01

    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A) + RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A) + RNA are consistent with the presence of at least two, and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs

  20. Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

    International Nuclear Information System (INIS)

    Ghaffari, S.H.; Olson, M.O.J.

    1986-01-01

    Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

  1. Molecular cloning, expression analysis and sequence prediction of ...

    African Journals Online (AJOL)

    CCAAT/enhancer-binding protein beta as an essential transcriptional factor, regulates the differentiation of adipocytes and the deposition of fat. Herein, we cloned the whole open reading frame (ORF) of bovine C/EBPβ gene and analyzed its putative protein structures via DNA cloning and sequence analysis. Then, the ...

  2. MEANS AND METHODS FOR CLONING NUCLEIC ACID SEQUENCES

    NARCIS (Netherlands)

    Geertsma, Eric Robin; Poolman, Berend

    2008-01-01

    The invention provides means and methods for efficiently cloning nucleic acid sequences of interest in micro-organisms that are less amenable to conventional nucleic acid manipulations, as compared to, for instance, E.coli. The present invention enables high-throughput cloning (and, preferably,

  3. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  4. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  5. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  6. Cloning and sequencing of the bovine gastrin gene

    DEFF Research Database (Denmark)

    Lund, T; Rehfeld, J F; Olsen, Jørgen

    1989-01-01

    In order to deduce the primary structure of bovine preprogastrin we therefore sequenced a gastrin DNA clone isolated from a bovine liver cosmid library. Bovine preprogastrin comprises 104 amino acids and consists of a signal peptide, a 37 amino acid spacer-sequence, the gastrin-34 sequence followed...

  7. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  8. Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

    Science.gov (United States)

    Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

    2000-02-01

    A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

  9. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  10. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...

  11. Cloning and sequence analysis of benzo-a-pyreneinducible ...

    African Journals Online (AJOL)

    The phylogenetic tree based on the amino acid sequences clearly shows tilapia CYP1A and killifish CYP1A to be more closely related to each other than to the other CYP1A subfamilies. Sequence analysis of 3727 bp of genomic DNA showed that the clone obtained was the structural gene of CYP1A which consists of ...

  12. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  13. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  14. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  15. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  16. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  17. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  18. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  19. [Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain].

    Science.gov (United States)

    Wu, Qinggang; Zhang, Jingping; Zhao, Chuncheng; Zhu, Jianguo

    2008-09-01

    Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain to investigate the differences of the sequences of the papA of UPEC4030 strain and the ones of related genes, in order to make whether or not it was a new genotype. Cloning and sequencing methods were used to analyze the sequence of the papA of UPEC4030 strain in comparison with related sequences. The sequence analysis of papA revealed a 722 bp gene and encode 192 amino acid polypeptide. The overall homology of the papA genes between UPEC4030 and the standard strains of ten F types were 36.11%-77.95% and 22.20%-78.34% at nucleotide and deduced amino acid levels. The homology between the sequence of the reverse primers and the corresponding sequence of UPEC4030 papA was 10%-66.67%. The results confirmed that UPEC4030 strain contained a novel papA variant. UPEC4030 strain could contain an unknown papA variant or the novel genotype. The pathogenic mechanism and epidemiology related need to be further studied.

  20. Enzyme assay, cloning and sequencing of novel β-glucosidase ...

    African Journals Online (AJOL)

    Bioinformatics studies also suggested that the cloned β-glucosidases share some characteristics with their bacterial counterparts. The findings in this study highlight the increasing need for more information on β-glucosidase structure and function. Keywords: Aspergillus niger, β-glucosidase, cellulase, PCR, sequencing, ...

  1. Molecular Cloning And Sequencing Of Disintegrin Like Domain ...

    African Journals Online (AJOL)

    Disintegrin-like domain was cloned and sequenced from Cerastes cerastes venom gland tissue. Nested RT-PCR was performed using initial primers designed based on the homology of disintegrins from Trimeresurus flavoviridis, Glodius halys , Agkistrodon halys and Trimeresurus macrosquamatus. The homology was ...

  2. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  3. Cloning and sequence analysis of the defective in anther ...

    African Journals Online (AJOL)

    To clone the defective in anther dehiscence1 (DAD1) gene fragment of Chinese kale, about 700 bp product was obtained by PCR amplification using Chinese kale genomic DNA as the template and a pair of specific primers designed according to the conserved sequence of DAD1 genes of Arabidopsis thaliana and ...

  4. Cloning and sequencing of the gene for human β-casein

    International Nuclear Information System (INIS)

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O.

    1990-01-01

    Human β-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on βcasein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic 32 p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human β-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human β-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human β-casein gene and will facilitate studies on factors affecting its expression

  5. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  6. RTA, a candidate G protein-coupled receptor: Cloning, sequencing, and tissue distribution

    International Nuclear Information System (INIS)

    Ross, P.C.; Figler, R.A.; Corjay, M.H.; Barber, C.M.; Adam, N.; Harcus, D.R.; Lynch, K.R.

    1990-01-01

    Genomic and cDNA clones, encoding a protein that is a member of the guanine nucleotide-binding regulatory protein (G protein)-coupled receptor superfamily, were isolated by screening rat genomic and thoracic aorta cDNA libraries with an oligonucleotide encoding a highly conserved region of the M 1 muscarinic acetylcholine receptor. Sequence analyses of these clones showed that they encode a 343-amino acid protein (named RTA). The RTA gene is single copy, as demonstrated by restriction mapping and Southern blotting of genomic clones and rat genomic DNA. RTA RNA sequences are relatively abundant throughout the gut, vas deferens, uterus, and aorta but are only barely detectable (on Northern blots) in liver, kidney, lung, and salivary gland. In the rat brain, RTA sequences are markedly abundant in the cerebellum. TRA is most closely related to the mas oncogene (34% identity), which has been suggested to be a forebrain angiotensin receptor. They conclude that RTA is not an angiotensin receptor; to date, they have been unable to identify its ligand

  7. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    Science.gov (United States)

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  8. Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

    Science.gov (United States)

    Liu, X; Gorovsky, M A

    1996-01-01

    A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

  9. Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

  10. Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

    Science.gov (United States)

    Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

    2015-03-31

    Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

  11. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  12. Cloning and sequence analysis of serine proteinase of Gloydius ussuriensis venom gland

    International Nuclear Information System (INIS)

    Sun Dejun; Liu Shanshan; Yang Chunwei; Zhao Yizhuo; Chang Shufang; Yan Weiqun

    2005-01-01

    Objective: To construct a cDNA library by using mRNA from Gloydius ussuriensis (G. Ussuriensis) venom gland, to clone and analyze serine proteinase gene from the cDNA library. Methods: Total RNA was isolated from venom gland of G. ussuriensis, mRNA was purified by using mRNA isolation Kit. The whole length cDNA was synthesized by means of smart cDNA synthesis strategy, and amplified by long distance PCR procedure, lately cDAN was cloned into vector pBluescrip-sk. The recombinant cDNA was transformed into E. coli DH5α. The cDNA of serine proteinase gene in the venom gland of G. ussuriensis was detected and amplified using the in situ hybridization. The cDNA fragment was inserted into pGEMT vector, cloned and its nucleotide sequence was determined. Results: The capacity of cDNA library of venom gland was above 2.3 x 10 6 . Its open reading frame was composed of 702 nucleotides and coded a protein pre-zymogen of 234 amino acids. It contained 12 cysteine residues. The sequence analysis indicated that the deduced amino acid sequence of the cDNA fragment shared high identity with the thrombin-like enzyme genes of other snakes in the GenBank. the query sequence exhibited strong amino acid sequence homology of 85% to the serine proteas of T. gramineus, thrombin-like serine proteinase I of D. acutus and serine protease catroxase II of C. atrox respectively. Based on the amino acid sequences of other thrombin-like enzymes, the catalytic residues and disulfide bridges of this thrombin-like enzyme were deduced as follows: catalytic residues, His 41 , Asp 86 , Ser 180 ; and six disulfide bridges Cys 7 -Cys 139 , Cys 26 -Cys 42 , Cys 74 -Cys 232 , Cys 118 -Cys 186 , Cys 150 -Cys 165 , Cys 176 -Cys 201 . Conclusion: The capacity of cDNA library of venom gland is above 2.3 x 10 6 , overtop the level of 10 5 capicity. The constructed cDNA library of G. ussuriensis venom gland would be helpful platform to detect new target genes and further gene manipulate. The cloned serine

  13. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  14. The nucleotide sequence of a Polish isolate of Tomato torrado virus.

    Science.gov (United States)

    Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

    2008-12-01

    A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

  15. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Janeth Silva Pinheiro

    2008-01-01

    Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

  16. Evaluation of a pooled strategy for high-throughput sequencing of cosmid clones from metagenomic libraries.

    Science.gov (United States)

    Lam, Kathy N; Hall, Michael W; Engel, Katja; Vey, Gregory; Cheng, Jiujun; Neufeld, Josh D; Charles, Trevor C

    2014-01-01

    High-throughput sequencing methods have been instrumental in the growing field of metagenomics, with technological improvements enabling greater throughput at decreased costs. Nonetheless, the economy of high-throughput sequencing cannot be fully leveraged in the subdiscipline of functional metagenomics. In this area of research, environmental DNA is typically cloned to generate large-insert libraries from which individual clones are isolated, based on specific activities of interest. Sequence data are required for complete characterization of such clones, but the sequencing of a large set of clones requires individual barcode-based sample preparation; this can become costly, as the cost of clone barcoding scales linearly with the number of clones processed, and thus sequencing a large number of metagenomic clones often remains cost-prohibitive. We investigated a hybrid Sanger/Illumina pooled sequencing strategy that omits barcoding altogether, and we evaluated this strategy by comparing the pooled sequencing results to reference sequence data obtained from traditional barcode-based sequencing of the same set of clones. Using identity and coverage metrics in our evaluation, we show that pooled sequencing can generate high-quality sequence data, without producing problematic chimeras. Though caveats of a pooled strategy exist and further optimization of the method is required to improve recovery of complete clone sequences and to avoid circumstances that generate unrecoverable clone sequences, our results demonstrate that pooled sequencing represents an effective and low-cost alternative for sequencing large sets of metagenomic clones.

  17. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  18. Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland.

    Science.gov (United States)

    Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H

    2004-04-01

    Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

  19. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21(T) showed reaction...

  20. Molecular cloning of chicken metallothionein. Deduction of the complete amino acid sequence and analysis of expression using cloned cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Wei, D; Andrews, G K

    1988-01-25

    A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.

  1. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  2. Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

    Science.gov (United States)

    Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

    2009-06-01

    The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

  3. Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

    Science.gov (United States)

    Li, Chao; Chang, Wei Shan

    2014-01-01

    Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

  4. Exponential megapriming PCR (EMP cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    Directory of Open Access Journals (Sweden)

    Alexander Ulrich

    Full Text Available We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  5. Cloning and sequence analysis of a partial CDS of leptospiral ligA gene in pET-32a - Escherichia coli DH5α system

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2018-04-01

    Full Text Available Aim: This study aims at cloning, sequencing, and phylogenetic analysis of a partial CDS of ligA gene in pET-32a - Escherichia coli DH5α system, with the objective of identifying the conserved nature of the ligA gene in the genus Leptospira. Materials and Methods: A partial CDS (nucleotide 1873 to nucleotide 3363 of the ligA gene was amplified from genomic DNA of Leptospira interrogans serovar Canicola by polymerase chain reaction (PCR. The PCR-amplified DNA was cloned into pET-32a vector and transformed into competent E. coli DH5α bacterial cells. The partial ligA gene insert was sequenced and the nucleotide sequences obtained were aligned with the published ligA gene sequences of other Leptospira serovars, using nucleotide BLAST, NCBI. Phylogenetic analysis of the gene sequence was done by maximum likelihood method using Mega 6.06 software. Results: The PCR could amplify the 1491 nucleotide sequence spanning from nucleotide 1873 to nucleotide 3363 of the ligA gene and the partial ligA gene could be successfully cloned in E. coli DH5α cells. The nucleotide sequence when analyzed for homology with the reported gene sequences of other Leptospira serovars was found to have 100% homology to the 1910 bp to 3320 bp sequence of ligA gene of L. interrogans strain Kito serogroup Canicola. The predicted protein consisted of 470 aminoacids. Phylogenetic analysis revealed that the ligA gene was conserved in L. interrogans species. Conclusion: The partial ligA gene could be successfully cloned and sequenced from E. coli DH5α cells. The sequence showed 100% homology to the published ligA gene sequences. The phylogenetic analysis revealed the conserved nature of the ligA gene. Further studies on the expression and immunogenicity of the partial LigA protein need to be carried out to determine its competence as a subunit vaccine candidate.

  6. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  7. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  8. Cloning and sequence of the human adrenodoxin reductase gene

    International Nuclear Information System (INIS)

    Lin, Dong; Shi, Y.; Miller, W.L.

    1990-01-01

    Adrenodoxin reductase is a flavoprotein mediating electron transport to all mitochondrial forms of cytochrome P450. The authors cloned the human adrenodoxin reductase gene and characterized it by restriction endonuclease mapping and DNA sequencing. The entire gene is approximately 12 kilobases long and consists of 12 exons. The first exon encodes the first 26 of the 32 amino acids of the signal peptide, and the second exon encodes the remainder of signal peptide and the apparent FAD binding site. The remaining 10 exons are clustered in a region of only 4.3 kilobases, separated from the first two exons by a large intron of about 5.6 kilobases. Two forms of human adrenodoxin reductase mRNA, differing by the presence or absence of 18 bases in the middle of the sequence, arise from alternate splicing at the 5' end of exon 7. This alternately spliced region is directly adjacent to the NADPH binding site, which is entirely contained in exon 6. The immediate 5' flanking region lacks TATA and CAAT boxes; however, this region is rich in G+C and contains six copies of the sequence GGGCGGG, resembling promoter sequences of housekeeping genes. RNase protection experiments show that transcription is initiated from multiple sites in the 5' flanking region, located about 21-91 base pairs upstream from the AUG translational initiation codon

  9. Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

    International Nuclear Information System (INIS)

    Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

    1990-08-01

    The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

  10. Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

    Science.gov (United States)

    Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

    2010-12-01

    Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

  11. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  12. A novel approach to sequence validating protein expression clones with automated decision making

    Directory of Open Access Journals (Sweden)

    Mohr Stephanie E

    2007-06-01

    Full Text Available Abstract Background Whereas the molecular assembly of protein expression clones is readily automated and routinely accomplished in high throughput, sequence verification of these clones is still largely performed manually, an arduous and time consuming process. The ultimate goal of validation is to determine if a given plasmid clone matches its reference sequence sufficiently to be "acceptable" for use in protein expression experiments. Given the accelerating increase in availability of tens of thousands of unverified clones, there is a strong demand for rapid, efficient and accurate software that automates clone validation. Results We have developed an Automated Clone Evaluation (ACE system – the first comprehensive, multi-platform, web-based plasmid sequence verification software package. ACE automates the clone verification process by defining each clone sequence as a list of multidimensional discrepancy objects, each describing a difference between the clone and its expected sequence including the resulting polypeptide consequences. To evaluate clones automatically, this list can be compared against user acceptance criteria that specify the allowable number of discrepancies of each type. This strategy allows users to re-evaluate the same set of clones against different acceptance criteria as needed for use in other experiments. ACE manages the entire sequence validation process including contig management, identifying and annotating discrepancies, determining if discrepancies correspond to polymorphisms and clone finishing. Designed to manage thousands of clones simultaneously, ACE maintains a relational database to store information about clones at various completion stages, project processing parameters and acceptance criteria. In a direct comparison, the automated analysis by ACE took less time and was more accurate than a manual analysis of a 93 gene clone set. Conclusion ACE was designed to facilitate high throughput clone sequence

  13. Planarian homeobox genes: cloning, sequence analysis, and expression.

    Science.gov (United States)

    Garcia-Fernàndez, J; Baguñà, J; Saló, E

    1991-01-01

    Freshwater planarians (Platyhelminthes, Turbellaria, and Tricladida) are acoelomate, triploblastic, unsegmented, and bilaterally symmetrical organisms that are mainly known for their ample power to regenerate a complete organism from a small piece of their body. To identify potential pattern-control genes in planarian regeneration, we have isolated two homeobox-containing genes, Dth-1 and Dth-2 [Dugesia (Girardia) tigrina homeobox], by using degenerate oligonucleotides corresponding to the most conserved amino acid sequence from helix-3 of the homeodomain. Dth-1 and Dth-2 homeodomains are closely related (68% at the nucleotide level and 78% at the protein level) and show the conserved residues characteristic of the homeodomains identified to data. Similarity with most homeobox sequences is low (30-50%), except with Drosophila NK homeodomains (80-82% with NK-2) and the rodent TTF-1 homeodomain (77-87%). Some unusual amino acid residues specific to NK-2, TTF-1, Dth-1, and Dth-2 can be observed in the recognition helix (helix-3) and may define a family of homeodomains. The deduced amino acid sequences from the cDNAs contain, in addition to the homeodomain, other domains also present in various homeobox-containing genes. The expression of both genes, detected by Northern blot analysis, appear slightly higher in cephalic regions than in the rest of the intact organism, while a slight increase is detected in the central period (5 days) or regeneration. Images PMID:1714599

  14. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul

    2008-05-01

    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

  15. Cloning

    Science.gov (United States)

    Cloning describes the processes used to create an exact genetic replica of another cell, tissue or organism. ... named Dolly. There are three different types of cloning: Gene cloning, which creates copies of genes or ...

  16. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    International Nuclear Information System (INIS)

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-01-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

  17. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  18. Cloning and sequencing of a cellobiohydrolase gene from Trichoderma harzianum FP108

    Science.gov (United States)

    Patrick Guilfoile; Ron Burns; Zu-Yi Gu; Matt Amundson; Fu-Hsian Chang

    1999-01-01

    A cbbl cellobiohydrolase gene was cloned and sequenced from the fungus Trichoderrna harzianum FP108. The cloning was performed by PCR amplification of T. harzianum genomic DNA, using PCR primers whose sequence was based on the cbbl gene from Tricboderma reesei. The 3' end of the gene was isolated by inverse...

  19. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    Science.gov (United States)

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  20. FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

    Directory of Open Access Journals (Sweden)

    Lu Jia

    2011-10-01

    Full Text Available Abstract Background Although a variety of methods and expensive kits are available, molecular cloning can be a time-consuming and frustrating process. Results Here we report a highly simplified, reliable, and efficient PCR-based cloning technique to insert any DNA fragment into a plasmid vector or into a gene (cDNA in a vector at any desired position. With this method, the vector and insert are PCR amplified separately, with only 18 cycles, using a high fidelity DNA polymerase. The amplified insert has the ends with ~16-base overlapping with the ends of the amplified vector. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli cells to obtain the desired clones. This technique has many advantages over other cloning methods. First, it does not need gel purification of the PCR product or linearized vector. Second, there is no need of any cloning kit or specialized enzyme for cloning. Furthermore, with reduced number of PCR cycles, it also decreases the chance of random mutations. In addition, this method is highly effective and reproducible. Finally, since this cloning method is also sequence independent, we demonstrated that it can be used for chimera construction, insertion, and multiple mutations spanning a stretch of DNA up to 120 bp. Conclusion Our FastCloning technique provides a very simple, effective, reliable, and versatile tool for molecular cloning, chimera construction, insertion of any DNA sequences of interest and also for multiple mutations in a short stretch of a cDNA.

  1. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  2. Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum

    DEFF Research Database (Denmark)

    Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.

    2004-01-01

    The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence re...... with highest similarity to DNA repair protein from Campylobacter jejuni (25% aa). Orf34 showed similarity to sigma factors with highest similarity (28% aa) to the sporulation specific Sigma factor, Sigma 28(K) from Bacillus thuringiensis....

  3. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  4. Nature and distribution of feline sarcoma virus nucleotide sequences.

    Science.gov (United States)

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  5. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    Science.gov (United States)

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  6. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  7. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  8. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  9. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. An accurate clone-based haplotyping method by overlapping pool sequencing.

    Science.gov (United States)

    Li, Cheng; Cao, Changchang; Tu, Jing; Sun, Xiao

    2016-07-08

    Chromosome-long haplotyping of human genomes is important to identify genetic variants with differing gene expression, in human evolution studies, clinical diagnosis, and other biological and medical fields. Although several methods have realized haplotyping based on sequencing technologies or population statistics, accuracy and cost are factors that prohibit their wide use. Borrowing ideas from group testing theories, we proposed a clone-based haplotyping method by overlapping pool sequencing. The clones from a single individual were pooled combinatorially and then sequenced. According to the distinct pooling pattern for each clone in the overlapping pool sequencing, alleles for the recovered variants could be assigned to their original clones precisely. Subsequently, the clone sequences could be reconstructed by linking these alleles accordingly and assembling them into haplotypes with high accuracy. To verify the utility of our method, we constructed 130 110 clones in silico for the individual NA12878 and simulated the pooling and sequencing process. Ultimately, 99.9% of variants on chromosome 1 that were covered by clones from both parental chromosomes were recovered correctly, and 112 haplotype contigs were assembled with an N50 length of 3.4 Mb and no switch errors. A comparison with current clone-based haplotyping methods indicated our method was more accurate. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Directory of Open Access Journals (Sweden)

    Etchells J Peter

    2009-10-01

    Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

  12. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  13. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  14. Single nucleotide polymorphism (SNP) panels for rapid positional cloning in zebrafish

    NARCIS (Netherlands)

    Clark, M.D.; Guryev, V.; de Bruijn, E.; Nijman, I.J.; Tada, M.; Wilson, C.; Deloukas, P.; Postlethwait, J.H.; Cuppen, E.; Stemple, D.L.

    2011-01-01

    Despite considerable genetic and genomic resources the positional cloning of forward mutations remains a slow and manually intensive task, typically using gel based genotyping and sequential rounds of mapping. We have used the latest genetic resources and genotyping technologies to develop two

  15. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  16. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  17. PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

    Science.gov (United States)

    Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

    2009-01-01

    Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

  18. Effects of cloning and root-tip size on observations of fungal ITS sequences from Picea glauca roots

    Science.gov (United States)

    Daniel L. Lindner; Mark T. Banik

    2009-01-01

    To better understand the effects of cloning on observations of fungal ITS sequences from Picea glauca (white spruce) roots two techniques were compared: (i) direct sequencing of fungal ITS regions from individual root tips without cloning and (ii) cloning and sequencing of fungal ITS regions from individual root tips. Effect of root tip size was...

  19. Isolation of a cDNA clone complementary to sequences for a 34-kilodalton protein which is a pp60v-src substrate.

    OpenAIRE

    Tomasiewicz, H G; Cook-Deegan, R; Chikaraishi, D M

    1984-01-01

    We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined that the size of the 34-kilodalton mRNA was 1,100 nucleotides and the level of the 34-kilodalton RNA was the same in various tissues of mature chickens but was significantly higher in chicken embryo fibroblast cells.

  20. Characterization, cloning and sequencing of a thermostable endo-(1, 3-1, 4) beta-glucanase-encoding gene from an alkalophilic Bacillus-brevis

    CSIR Research Space (South Africa)

    Louw, M

    1993-01-01

    Full Text Available - zyme that produced 1 ~tmol reducing sugar calculated as glucose per minute under the conditions of assay. Bacterial strains, growth media and vectors. The Escherichia coli host strain for the original cloning experiment... the gels were washed in phosphate buffer, pH 6.3 (Beguin 1983). The bands of enzyme activity were detected by staining the lichen- an/PAGE gel with Congo red. Restriction mapping and nucleotide sequencing. Restriction en...

  1. Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

    Science.gov (United States)

    Guo, D; Maiss, E; Adam, G; Casper, R

    1995-05-01

    The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

  2. Molecular cloning and sequence analysis of hamster CENP-A cDNA

    Directory of Open Access Journals (Sweden)

    Valdivia Manuel M

    2002-05-01

    Full Text Available Abstract Background The centromere is a specialized locus that mediates chromosome movement during mitosis and meiosis. This chromosomal domain comprises a uniquely packaged form of heterochromatin that acts as a nucleus for the assembly of the kinetochore a trilaminar proteinaceous structure on the surface of each chromatid at the primary constriction. Kinetochores mediate interactions with the spindle fibers of the mitotic apparatus. Centromere protein A (CENP-A is a histone H3-like protein specifically located to the inner plate of kinetochore at active centromeres. CENP-A works as a component of specialized nucleosomes at centromeres bound to arrays of repeat satellite DNA. Results We have cloned the hamster homologue of human and mouse CENP-A. The cDNA isolated was found to contain an open reading frame encoding a polypeptide consisting of 129 amino acid residues with a C-terminal histone fold domain highly homologous to those of CENP-A and H3 sequences previously released. However, significant sequence divergence was found at the N-terminal region of hamster CENP-A that is five and eleven residues shorter than those of mouse and human respectively. Further, a human serine 7 residue, a target site for Aurora B kinase phosphorylation involved in the mechanism of cytokinesis, was not found in the hamster protein. A human autoepitope at the N-terminal region of CENP-A described in autoinmune diseases is not conserved in the hamster protein. Conclusions We have cloned the hamster cDNA for the centromeric protein CENP-A. Significant differences on protein sequence were found at the N-terminal tail of hamster CENP-A in comparison with that of human and mouse. Our results show a high degree of evolutionary divergence of kinetochore CENP-A proteins in mammals. This is related to the high diverse nucleotide repeat sequences found at the centromere DNA among species and support a current centromere model for kinetochore function and structural

  3. Cloning and sequencing of the gene coding for alcohol dehydrogenase of Bacillus stearothermophilus and rational shift of the optimum pH.

    OpenAIRE

    Sakoda, H; Imanaka, T

    1992-01-01

    Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those cata...

  4. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  5. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  6. Cloning, DNA sequence, and expression of the Rhodobacter sphaeroides cytochrome c/sub 2/ gene

    Energy Technology Data Exchange (ETDEWEB)

    Donohue, T.J.; McEwan, A.G.; Kaplan, S.

    1986-11-01

    The Rhodobacter sphaeroides cytochrome c/sub 2/ functions as a mobile electron carrier in both aerobic and photosynthetic electron transport chains. Synthetic deoxyoligonucleotide probes, based on the known amino acid sequence of this protein (M/sub r/ 14,000), were used to identify and clone the cytochrome c/sub 2/ structural gene (cycA). DNA sequence analysis of the cycA gene indicated the presence of a typical procaryotic 21-residue signal sequence, suggesting that this periplasmic protein is synthesized in vivo as a precursor. Synthesis of an immunoreactive cytochrome c/sub 2/ precursor protein (M/sub r/ 15,500) was observed in vitro when plasmids containing the cycA gene were used as templates in an R. sphaeroides coupled transcription-translation system. Approximately 500 base pairs of DNA upstream of the cycA gene was sufficient to allow expression of this gene product in vitro. Northern blot analysis with an internal cycA-specific probe identified at least two possibly monocistronic transcripts present in both different cellular levels and relative stoichiometries in steady-state cells grown under different physiological conditions. The ratio of the small (740-mucleotide) and large (920-nucleotide) cycA-specific mRNA species was dependent on cultural conditions but was not affected by light intensity under photosynthetic conditions. These results suggest that the increase in the cellular level of the cytochrome c/sub 2/ protein found in photosynthetic cells was due, in part, to increased transcription of the single-copy cyc operon.

  7. Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.

    Science.gov (United States)

    Gangras, Pooja; Dayeh, Daniel M; Mabin, Justin W; Nakanishi, Kotaro; Singh, Guramrit

    2018-01-01

    Argonaute proteins (AGOs) are loaded with small RNAs as guides to recognize target mRNAs. Since the target specificity heavily depends on the base complementarity between two strands, it is important to identify small guide and long target RNAs bound to AGOs. For this purpose, next-generation sequencing (NGS) technologies have extended our appreciation truly to the nucleotide level. However, the identification of RNAs via NGS from scarce RNA samples remains a challenge. Further, most commercial and published methods are compatible with either small RNAs or long RNAs, but are not equally applicable to both. Therefore, a single method that yields quantitative, bias-free NGS libraries to identify small and long RNAs from low levels of input will be of wide interest. Here, we introduce such a procedure that is based on several modifications of two published protocols and allows robust, sensitive, and reproducible cloning and sequencing of small amounts of RNAs of variable lengths. The method was applied to the identification of small RNAs bound to a purified eukaryotic AGO. Following ligation of a DNA adapter to RNA 3'-end, the key feature of this method is to use the adapter for priming reverse transcription (RT) wherein biotinylated deoxyribonucleotides specifically incorporated into the extended complementary DNA. Such RT products are enriched on streptavidin beads, circularized while immobilized on beads and directly used for PCR amplification. We provide a stepwise guide to generate RNA-Seq libraries, their purification, quantification, validation, and preparation for next-generation sequencing. We also provide basic steps in post-NGS data analyses using Galaxy, an open-source, web-based platform.

  8. 454 sequencing of pooled BAC clones on chromosome 3H of barley

    Directory of Open Access Journals (Sweden)

    Yamaji Nami

    2011-05-01

    Full Text Available Abstract Background Genome sequencing of barley has been delayed due to its large genome size (ca. 5,000Mbp. Among the fast sequencing systems, 454 liquid phase pyrosequencing provides the longest reads and is the most promising method for BAC clones. Here we report the results of pooled sequencing of BAC clones selected with ESTs genetically mapped to chromosome 3H. Results We sequenced pooled barley BAC clones using a 454 parallel genome sequencer. A PCR screening system based on primer sets derived from genetically mapped ESTs on chromosome 3H was used for clone selection in a BAC library developed from cultivar "Haruna Nijo". The DNA samples of 10 or 20 BAC clones were pooled and used for shotgun library development. The homology between contig sequences generated in each pooled library and mapped EST sequences was studied. The number of contigs assigned on chromosome 3H was 372. Their lengths ranged from 1,230 bp to 58,322 bp with an average 14,891 bp. Of these contigs, 240 showed homology and colinearity with the genome sequence of rice chromosome 1. A contig annotation browser supplemented with query search by unique sequence or genetic map position was developed. The identified contigs can be annotated with barley cDNAs and reference sequences on the browser. Homology analysis of these contigs with rice genes indicated that 1,239 rice genes can be assigned to barley contigs by the simple comparison of sequence lengths in both species. Of these genes, 492 are assigned to rice chromosome 1. Conclusions We demonstrate the efficiency of sequencing gene rich regions from barley chromosome 3H, with special reference to syntenic relationships with rice chromosome 1.

  9. Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

    African Journals Online (AJOL)

    The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

  10. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

  11. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  12. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  13. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

    Science.gov (United States)

    The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

  15. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

    2011-01-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  16. Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp.

    Science.gov (United States)

    Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong

    2015-03-01

    The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.

  17. Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp

    Science.gov (United States)

    DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG

    2015-01-01

    The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

  18. Cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of Clostridium chauvoei

    Directory of Open Access Journals (Sweden)

    Saroj K. Dangi

    2017-09-01

    Full Text Available Aim: Blackleg disease is caused by Clostridium chauvoei in ruminants. Although virulence factors such as C. chauvoei toxin A, sialidase, and flagellin are well characterized, hyaluronidases of C. chauvoei are not characterized. The present study was aimed at cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of C. chauvoei. Materials and Methods: C. chauvoei strain ATCC 10092 was grown in ATCC 2107 media and confirmed by polymerase chain reaction (PCR using the primers specific for 16-23S rDNA spacer region. nagH gene of C. chauvoei was amplified and cloned into pRham-SUMO vector and transformed into Escherichia cloni 10G cells. The construct was then transformed into E. cloni cells. Colony PCR was carried out to screen the colonies followed by sequencing of nagH gene in the construct. Results: PCR amplification yielded nagH gene of 1143 bp product, which was cloned in prokaryotic expression system. Colony PCR, as well as sequencing of nagH gene, confirmed the presence of insert. Sequence was then subjected to BLAST analysis of NCBI, which confirmed that the sequence was indeed of nagH gene of C. chauvoei. Phylogenetic analysis of the sequence showed that it is closely related to Clostridium perfringens and Clostridium paraputrificum. Conclusion: The gene for virulence factor nagH was cloned into a prokaryotic expression vector and confirmed by sequencing.

  19. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  20. Cloning, sequencing, and expression of cDNA for human β-glucuronidase

    International Nuclear Information System (INIS)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-01-01

    The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

  1. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  2. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  3. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  4. CLONING AND SEQUENCING OF THE GENE FOR A LACTOCOCCAL ENDOPEPTIDASE, AN ENZYME WITH SEQUENCE SIMILARITY TO MAMMALIAN ENKEPHALINASE

    NARCIS (Netherlands)

    Mierau, Igor; Tan, Paris S.T.; Haandrikman, Alfred J.; Kok, Jan; Leenhouts, Kees J.; Konings, Wil N.; Venema, Gerard

    The gene specifying an endopeptidase of Lactococcus lactis, named pepO, was cloned from a genomic library of L. lactis subsp. cremoris P8-247 in lambdaEMBL3 and was subsequently sequenced. pepO is probably the last gene of an operon encoding the binding-protein-dependent oligopeptide transport

  5. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  6. Genomic clones of bovine parvovirus: Construction and effect of deletions and terminal sequence inversions on infectivity

    International Nuclear Information System (INIS)

    Shull, B.C.; Chen, K.C.; Lederman, M.; Stout, E.R.; Bates, R.C.

    1988-01-01

    Genomic clones of the autonomous parvovirus bovine parvovirus (BPV) were constructed by blunt-end ligation of reannealed virion plus and minus DNA strands into the plasmid pUC8. These clones were stable during propagation in Escherichia coli JM107. All clones tested were found to be infectious by the criteria of plaque titer and progressive cytophathic effect after transfection into bovine fetal lung cells. Sequencing of the recombinant plasmids demonstrated that all of the BPV inserts had left-end (3')-terminal deletions of up to 34 bases. Defective genomes could also be detected in the progeny DNA even though the infection was initiated with homogeneous, cloned DNA. Full-length genomic clones with 3' flip and 3' flop conformations were constructed and were found to have equal infectivity. Expression of capsid proteins from tranfected genomes was demonstrated by hemagglutination, indirect immunofluorescence, and immunoprecipitation of [ 35 S]methionine-labeled cell lysates. Use of appropriate antiserum for immunoprecipitation showed the synthesis of BPV capsid and noncapsid proteins after transfection. Independently, a series of genomic clones with increasingly larger 3'-terminal deletions was prepared from separately subcloned 3'-terminal fragments. Transfection of these clones into bovine fetal lung cells revealed that deletions of up to 34 bases at the 3' end lowered but did not abolish infectivity, while deletions of greater than 52 bases were lethal. End-label analysis showed that the 34-base deletion was repaired to wild-type length in the progeny virus

  7. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    International Nuclear Information System (INIS)

    Safford, R.; de Silva, J.; Lucas, C.

    1987-01-01

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  8. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  9. Sequence Analysis of the Cryptic Plasmid pMG101 from Rhodopseudomonas palustris and Construction of Stable Cloning Vectors

    Science.gov (United States)

    Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki

    2000-01-01

    A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203

  10. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  11. Capillary electrophoresis fragment analysis and clone sequencing in detection of dynamic mutations of spinocerebellar ataxia

    Directory of Open Access Journals (Sweden)

    Yuan-yuan CHEN

    2018-04-01

    Full Text Available Objective To estimate the accuracy and stability of capillary electrophoresis fragment analysis and clone sequencing in detecting dynamic mutations of spinocerebellar ataxia (SCA. Methods Capillary electrophoresis fragment analysis and clone sequencing were used in detecting trinucleotide repeated sequence of 14 SCA patients (3 cases of SCA2, 2 cases of SCA7, 7 cases of SCA8 and 2 cases of SCA17. Results Capillary electrophoresis fragment analysis of 3 SCA2 cases showed the expanded cytosine-adenine-guanine (CAG repeats were 31, 30 and 32, and the copy numbers of 3 clone sequencing for 3 colonies in each case were 37/40/40, 37/38/39 and 38/39/40 respectively. Capillary electrophoresis fragment analysis of 2 SCA7 cases showed the expanded CAG repeats were 57 and 34, and the copy numbers of repeats were 69, 74, 75 in 3 colonies of one case, and was 45 in the other case. For the 7 SCA8 cases with the expanded cytosine-thymine-adenine (CTA/cytosine-thymine-guanine (CTG repeats of 99, 111, 104, 92, 89, 104 and 75, the results of clone sequencing were 97, 116, 104, 90, 90, 102 and 76 respectively. For 2 SCA17 cases with the short/expanded CAG repeats of 37/50 and 36/45, the results of clone sequencing were 51/50/52 and 45/44 for 3 and 2 colonies. Conclusions Although the higher mobility of polymerase chain reaction (PCR products containing dynamic mutation in the capillary electrophoresis fragment analysis might cause the deviation for analysis of copy numbers, the deviation was predictable and the results were repeatable. The clone sequencing results showed obvious instability, especially for SCA2 and SCA7 genes, which might owing to their simple CAG repeats. Consequently, clone sequencing is not suited for detection of dynamic mutation, not to mention the quantitative criteria of dynamic mutation sequencing. DOI: 10.3969/j.issn.1672-6731.2018.03.008

  12. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  13. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

    Directory of Open Access Journals (Sweden)

    Sukdeb Nandi

    2010-03-01

    Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

  14. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

    Science.gov (United States)

    Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

  15. Molecular cloning, sequence analysis and structure prediction of the ...

    African Journals Online (AJOL)

    AJL

    2012-04-19

    Apr 19, 2012 ... The primers were based on the rBAT sequences of other animals deposited in GenBank. .... fragment; M1, 2000 bp DNA ladder; M2, 1000 bp DNA ladder. spliced to obtain the ..... A traffic signal for heterodimeric amino acid.

  16. Rhipicephalus microplus strain Deutsch, 10 BAC clone sequences

    Science.gov (United States)

    The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. We used labeled DNA probes from the coding reg...

  17. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Science.gov (United States)

    2010-07-01

    ... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

  18. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  19. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  20. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  1. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  2. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  3. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  4. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  5. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  6. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  7. Cloning, sequence analysis, and characterization of the genes involved in isoprimeverose metabolism in Lactobacillus pentosus

    NARCIS (Netherlands)

    Chaillou, S.; Lokman, B.C.; Leer, R.J.; Posthuma, C.; Postma, P.W.; Pouwels, P.H.

    1998-01-01

    Two genes, xylP and xylQ, from the xylose regulon of Lactobacillus pentosus were cloned and sequenced. Together with the repressor gene of the regulon, xylR, the xylPQ genes form an operon which is inducible by xylose and which is transcribed from a promoter located 145 bp upstream of xylP. A

  8. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  9. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    OpenAIRE

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  10. Nucleotide sequence analysis of HTLV-I isolated from cerebrospinal fluid of a patient with TSP/HAM: comparison to other HTLV-I isolates.

    Science.gov (United States)

    Mukhopadhyaya, R; Sadaie, M R

    1993-02-01

    Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.

  11. CLONING AND SEQUENCING OF PSEUDOMONAS GENES DETERMINING SODIUM DODECYL-SULFATE BIODEGRADATION

    NARCIS (Netherlands)

    DAVISON, J; BRUNEL, F; PHANOPOULOS, A; PROZZI, D; TERPSTRA, P

    1992-01-01

    The nucleotide sequences of two genes involved in sodium dodecyl sulfate (SDS) degradation, by Pseudomonas, have been determined. One of these, sdsA, codes for an alkyl sulfatase (58 957 Da) and has similarity (31.8% identity over a 201-amino acid stretch) to the N terminus of a predicted protein of

  12. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  13. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  14. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  15. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  16. Anti-DNA antibodies: Sequencing, cloning, and expression

    Energy Technology Data Exchange (ETDEWEB)

    Barry, M.M.

    1992-01-01

    To gain some insight into the mechanism of systemic lupus erythematosus, and the interactions involved in proteins binding to DNA four anti-DNA antibodies have been investigated. Two of the antibodies, Hed 10 and Jel 242, have previously been prepared from female NZB/NZW mice which develop an autoimmune disease resembling human SLE. The remaining two antibodies, Jel 72 and Jel 318, have previously been produced via immunization of C57BL/6 mice. The isotypes of the four antibodies investigated in this thesis were determined by an enzyme-linked-immunosorbent assay. All four antibodies contained [kappa] light chains and [gamma]2a heavy chains except Jel 318 which contains a [gamma]2b heavy chain. The complete variable regions of the heavy and light chains of these four antibodies were sequenced from their respective mRNAs. The gene segments and variable gene families expressed in each antibody were identified. Analysis of the genes used in the autoimmune anti-DNA antibodies and those produced by immunization indicated no obvious differences to account for their different origins. Examination of the amino acid residues present in the complementary-determining regions of these four antibodies indicates a preference for aromatic amino acids. Jel 72 and Jel 242 contain three arginine residues in the third complementary-determining region. A single-chain Fv and the variable region of the heavy chain of Hed 10 were expressed in Escherichia coli. Expression resulted in the production of a 26,000 M[sub r] protein and a 15,000 M[sub r] protein. An immunoblot indicated that the 26,000 M[sub r] protein was the Fv for Hed 10, while the 15,000 M[sub r] protein was shown to bind poly (dT). The contribution of the heavy chain to DNA binding was assessed.

  17. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

  18. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  19. Cloning and sequencing of growth hormone gene of Iranian Lori Bakhtiari sheep

    Directory of Open Access Journals (Sweden)

    M Dayani-Nia

    2010-05-01

    Full Text Available Growth hormone (GH is a peptide hormone that stimulates growth and cell reproduction in humans and animals. It is a 191-amino acid, single chain polypeptide hormone which is synthesized, stored, and secreted by the somatotroph cells within the lateral wings of the anterior pituitary gland. The goal of this research was to clone and sequence sheep growth hormone of Lori Bakhtiary breed in Iran. For this purpose, RNA was extracted from the pituitary gland of freshly slaughtered sheep and cDNA of growth hormone produced. The T/A cloning technique was used to clone the cDNA of growth hormone and then the synthesized construct was transferred into E. coli as the host. Once the correct recombinants were further confirmed by colony PCR or restriction enzyme digestion, sequencing was done. The sequencing results showed that, the length of sheep growth hormone cDNA was 690 bp fragments. Comparison of sequence of growth hormone inside the synthesized construct with those recorded in Genebank (NCBI, Blast indicated high degrees of similarity between Iranian native sheep and other sheep breeds of the world.

  20. Construction and sequencing of an infectious clone of the human parvovirus B19

    International Nuclear Information System (INIS)

    Zhi Ning; Zadori, Zoltan; Brown, Kevin E.; Tijssen, Peter

    2004-01-01

    Human parvovirus B19 has a nonenveloped, icosahedral capsid packaging a linear single-stranded DNA genome of 5.6 kb with long inverted terminal repeats (ITR) at both the 5' and 3' end. Previous attempts to construct a full-length B19 clone were unsuccessful due to deletions in the ITR sequences. We cloned the complete parvovirus B19 genome with intact ITRs from an aplastic crisis patient. Sequence analysis of the complete viral genome indicated that both 5' and 3' ITRs have two sequence configurations and several base changes within the ITRs compared to previous published sequences. After transfection of the plasmid into permissive cells, spliced and non-spliced viral transcripts and viral capsid proteins could be detected. Southern blot analysis of the DNA purified from the plasmid-transfected cells confirmed parvovirus B19 DNA replication. Production of infectious virus by the B19 plasmid was shown by inoculation of cell lysate derived from transfected cells into fresh cells. Together, these results indicate the first successful production of an infectious clone for parvovirus B19 virus

  1. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  2. cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

    International Nuclear Information System (INIS)

    Aris, J.P.; Blobel, G.

    1991-01-01

    The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is ∼1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain ∼75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis

  3. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  4. The BsaHI restriction-modification system: Cloning, sequencing and analysis of conserved motifs

    Directory of Open Access Journals (Sweden)

    Roberts Richard J

    2008-05-01

    Full Text Available Abstract Background Restriction and modification enzymes typically recognise short DNA sequences of between two and eight bases in length. Understanding the mechanism of this recognition represents a significant challenge that we begin to address for the BsaHI restriction-modification system, which recognises the six base sequence GRCGYC. Results The DNA sequences of the genes for the BsaHI methyltransferase, bsaHIM, and restriction endonuclease, bsaHIR, have been determined (GenBank accession #EU386360, cloned and expressed in E. coli. Both the restriction endonuclease and methyltransferase enzymes share significant similarity with a group of 6 other enzymes comprising the restriction-modification systems HgiDI and HgiGI and the putative HindVP, NlaCORFDP, NpuORFC228P and SplZORFNP restriction-modification systems. A sequence alignment of these homologues shows that their amino acid sequences are largely conserved and highlights several motifs of interest. We target one such conserved motif, reading SPERRFD, at the C-terminal end of the bsaHIR gene. A mutational analysis of these amino acids indicates that the motif is crucial for enzymatic activity. Sequence alignment of the methyltransferase gene reveals a short motif within the target recognition domain that is conserved among enzymes recognising the same sequences. Thus, this motif may be used as a diagnostic tool to define the recognition sequences of the cytosine C5 methyltransferases. Conclusion We have cloned and sequenced the BsaHI restriction and modification enzymes. We have identified a region of the R. BsaHI enzyme that is crucial for its activity. Analysis of the amino acid sequence of the BsaHI methyltransferase enzyme led us to propose two new motifs that can be used in the diagnosis of the recognition sequence of the cytosine C5-methyltransferases.

  5. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  6. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  7. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    Science.gov (United States)

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  8. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  9. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  10. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  11. Draft Genome Sequences of the Probiotic Enterococcus faecalis Symbioflor 1 Clones DSM16430 and DSM16434

    OpenAIRE

    Fritzenwanker, Moritz; Chakraborty, Anindita; Hain, Torsten; Zimmermann, Kurt; Domann, Eugen

    2016-01-01

    The probiotic Symbioflor 1 is a historical concoction of 10 isolates of Enterococcus faecalis. Pulsed-field gel electrophoresis revealed two groups: one comprising eight identical clones (DSM16430, DSM16432, DSM16433, DSM16435 to DSM16439) and a further two isolates (DSM16431, DSM16434) with marginally different profiles. Here, we report a comparative analysis of the draft genome sequences of representative isolates.

  12. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  13. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  14. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  15. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.

    Science.gov (United States)

    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer

    2016-08-01

    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. CLONING AND SEQUENCING OF PGIP FROM ‘JIN SERIES’ ALMOND (PRUNUS DULCIS

    Directory of Open Access Journals (Sweden)

    Yuhu Han

    2015-12-01

    Full Text Available Specific primers synthesized according to conservative regions of polygalacturonase inhibiting protein (PGIP gene were used to amplify Prunus Dulcis genomic DNA by polymerase-chain reaction (PCR. Six bands (pgip1, pgip2, pgip3, pgip4, pgip5 and pgip6 of genes were obtained and cloned into PBS-T vector. According to the length of bands, 717bp, 864bp, 796bp were A1 (pgip1, pgip2, pgip3, A2 (pgip4, A4 (pgip5, pgip6, respectively. DNA sequences showed that the fragments taken together were the gene encoding PGIP. A2 and A3 contained two exons interrupted by one intron, which has GT-AG sequence. Its DNA and amino acid sequences were highly homologies to those from Prunus Persica; Prunus Salicina; Prunus Americana; Prunus Mume, respectively. A conserved lencinerial fragment exists in the derived protein sequence.

  17. Molecular cloning, sequence and structural analysis of dehairing Mn(2+) dependent alkaline serine protease (MASPT) of Bacillus pumilus TMS55.

    Science.gov (United States)

    Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Pandian, Shunmugiah Karutha

    2011-10-01

    Leather industries release a large amount of pollution-causing chemicals which creates one of the major industrial pollutions. The development of enzyme based processes as a potent alternative to pollution-causing chemicals is useful to overcome this issue. Proteases are enzymes which have extensive applications in leather processing and in several bioremediation processes due to their high alkaline protease activity and dehairing efficacy. In the present study, we report cloning, characterization of a Mn2+ dependent alkaline serine protease gene (MASPT) of Bacillus pumilus TMS55. The gene encoding the protease from B. pumilus TMS55 was cloned and its nucleotide sequence was determined. This gene has an open reading frame (ORF) of 1,149 bp that encodes a polypeptide of 383 amino acid residues. Our analysis showed that this polypeptide is composed of 29 residues N-terminal signal peptide, a propeptide of 79 residues and a mature protein of 275 amino acids. We performed bioinformatics analysis to compare MASPT enzyme with other proteases. Homology modeling was employed to model three dimensional structure for MASPT. Structural analysis showed that MASPT structure is composed of nine α-helices and nine β-strands. It has 3 catalytic residues and 14 metal binding residues. Docking analysis showed that residues S223, A260, N263, T328 and S329 interact with Mn2+. This study allows initial inferences about the structure of the protease and will allow the rational design of its derivatives for structure-function studies and also for further improvement of the enzyme.

  18. Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

    Science.gov (United States)

    Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

    2017-08-01

    A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

  19. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    Science.gov (United States)

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  20. Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

    Science.gov (United States)

    Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

    2001-01-01

    Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

  1. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  2. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  3. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  4. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  5. Cloning, analysis and functional annotation of expressed sequence tags from the Earthworm Eisenia fetida

    Science.gov (United States)

    Pirooznia, Mehdi; Gong, Ping; Guan, Xin; Inouye, Laura S; Yang, Kuan; Perkins, Edward J; Deng, Youping

    2007-01-01

    Background Eisenia fetida, commonly known as red wiggler or compost worm, belongs to the Lumbricidae family of the Annelida phylum. Little is known about its genome sequence although it has been extensively used as a test organism in terrestrial ecotoxicology. In order to understand its gene expression response to environmental contaminants, we cloned 4032 cDNAs or expressed sequence tags (ESTs) from two E. fetida libraries enriched with genes responsive to ten ordnance related compounds using suppressive subtractive hybridization-PCR. Results A total of 3144 good quality ESTs (GenBank dbEST accession number EH669363–EH672369 and EL515444–EL515580) were obtained from the raw clone sequences after cleaning. Clustering analysis yielded 2231 unique sequences including 448 contigs (from 1361 ESTs) and 1783 singletons. Comparative genomic analysis showed that 743 or 33% of the unique sequences shared high similarity with existing genes in the GenBank nr database. Provisional function annotation assigned 830 Gene Ontology terms to 517 unique sequences based on their homology with the annotated genomes of four model organisms Drosophila melanogaster, Mus musculus, Saccharomyces cerevisiae, and Caenorhabditis elegans. Seven percent of the unique sequences were further mapped to 99 Kyoto Encyclopedia of Genes and Genomes pathways based on their matching Enzyme Commission numbers. All the information is stored and retrievable at a highly performed, web-based and user-friendly relational database called EST model database or ESTMD version 2. Conclusion The ESTMD containing the sequence and annotation information of 4032 E. fetida ESTs is publicly accessible at . PMID:18047730

  6. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  7. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    International Nuclear Information System (INIS)

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

    1988-01-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

  8. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    Science.gov (United States)

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  9. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

    1991-01-01

    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

  10. AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

    Science.gov (United States)

    Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

    2017-11-14

    Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

  11. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  12. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  13. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  14. Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

    Science.gov (United States)

    Sasaya, T; Ishikawa, K; Koganezawa, H

    2001-06-01

    A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

  15. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  16. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  17. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  18. ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

    Science.gov (United States)

    Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

    2012-09-08

    The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  19. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  20. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Science.gov (United States)

    2012-01-01

    Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

  1. Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries

    DEFF Research Database (Denmark)

    Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.

    2004-01-01

    for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting......  FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes.  ...

  2. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  3. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  4. Molecular cloning and sequence of the B880 holochrome gene from Rhodospirillum rubrum

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    Restriction fragments of genomic Rhodospirillum rubrum DNA were selected according to size by electrophoresis followed by hybridization with [ 32 P]mRNA encoding the two B880 holochrome polypeptides. The fragments were cloned into Escherchia coli C600 with plasmid pBR327 as a vector. The clones were selected by colony hybridization with 32 P-holochrome-mRNA and counter selected by hybridization with Rs. rubrum ribosomal RNA, a minor contaminant of the mRNA preparation. Chimeric plasmid pRR22 was shown to contain the B880 genes by hybrid selection of B880 holochrome-mRNA. A restriction map of its 2.2-kilobase insert and the sequence of a 430 base pair fragment thereof is reported. Genes α and β are nearly contiguous, indicating that they are transcribed as a single operon. The predicted amino acid sequences coincide with the sequences of the α and β polypeptides established in other laboratories, except for additional C-terminal tails of 10 and 13 amino acid residues, respectively

  5. Cloning, sequencing, and expression of interferon-γ from elk in North America

    Science.gov (United States)

    Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.

    2001-01-01

    Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.

  6. Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

    Science.gov (United States)

    Cai, Yongping; Lin, Yi

    2013-01-01

    In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

  7. Molecular cloning and sequence analysis of a phenylalanine ammonia-lyase gene from dendrobium.

    Directory of Open Access Journals (Sweden)

    Qing Jin

    Full Text Available In this study, a phenylalanine ammonia-lyase (PAL gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748 has 2,458 bps and contains a complete open reading frame (ORF of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum.

  8. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  9. CLONING, SEQUENCE ANALYSIS, AND CHARACTERIZATION OF PUTATIVE BETA-LACTAMASE OF STENOTROPHOMONAS MALTOPHILIA

    Directory of Open Access Journals (Sweden)

    Chong Seng Shueh

    2012-10-01

    Full Text Available The main objective of current study was to explore the function of chromosomal putative beta-lactamase gene (smlt 0115 in clinical Stenotrophomonas maltophilia. Antibiotic susceptibility test (AST screening for current antimicrobial drugs was done and Minimum Inhibitory Concentration (MIC level towards beta-lactams was determined by E-test. Putative beta-lactamase gene of S. maltophilia was amplified via PCR, with specific primers, then cloned into pET-15 expression plasmid and transformed into Escherichia coli BL21. The gene was sequenced and analyzed. The expressed protein was purified by affinity chromatography and the kinetic assay was performed. S. maltophilia ATCC 13637 was included in this experiment. Besides, a hospital strain which exhibited resistant to a series of beta-lactams including cefepime was identified via AST and MIC, hence it was named as S2 strain and was considered in this study. Sequencing result showed that putative beta-lactamase gene obtained from ATCC 13637 and S2 strains were predicted to have cephalosporinase activity by National Center for Biotechnology Information (NCBI blast program. Differences in the sequences of both ATCC 13637 and S2 strains were found via ClustalW alignment software. Kinetic assay proved a cephalosporinase characteristic produced by E. coli BL21 clone that overexpressed the putative beta-lactamase gene cloned under the control of an external promoter. Yet, expressed protein purified from S2 strain had high catalytic activity against beta-lactam antibiotics which was 14-fold higher than expressed protein purified from ATCC 13637 strain. This study represents the characterization analysis of putative beta-lactamase gene (smlt 0115 of S. maltophilia. The presence of the respective gene in the chromosome of S. maltophilia suggested that putative beta-lactamase gene (smlt 0115 of S. maltophilia plays a role in beta-lactamase resistance.

  10. Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

    Science.gov (United States)

    Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

    1993-02-01

    A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

  11. Single-Nucleotide Polymorphisms Reveal Spatial Diversity Among Clones of Yersinia pestis During Plague Outbreaks in Colorado and the Western United States.

    Science.gov (United States)

    Lowell, Jennifer L; Antolin, Michael F; Andersen, Gary L; Hu, Ping; Stokowski, Renee P; Gage, Kenneth L

    2015-05-01

    In western North America, plague epizootics caused by Yersinia pestis appear to sweep across landscapes, primarily infecting and killing rodents, especially ground squirrels and prairie dogs. During these epizootics, the risk of Y. pestis transmission to humans is highest. While empirical models that include climatic conditions and densities of rodent hosts and fleas can predict when epizootics are triggered, bacterial transmission patterns across landscapes, and the scale at which Y. pestis is maintained in nature during inter-epizootic periods, are poorly defined. Elucidating the spatial extent of Y. pestis clones during epizootics can determine whether bacteria are propagated across landscapes or arise independently from local inter-epizootic maintenance reservoirs. We used DNA microarray technology to identify single-nucleotide polymorphisms (SNPs) in 34 Y. pestis isolates collected in the western United States from 1980 to 2006, 21 of which were collected during plague epizootics in Colorado. Phylogenetic comparisons were used to elucidate the hypothesized spread of Y. pestis between the mountainous Front Range and the eastern plains of northern Colorado during epizootics. Isolates collected from across the western United States were included for regional comparisons. By identifying SNPs that mark individual clones, our results strongly suggest that Y. pestis is maintained locally and that widespread epizootic activity is caused by multiple clones arising independently at small geographic scales. This is in contrast to propagation of individual clones being transported widely across landscapes. Regionally, our data are consistent with the notion that Y. pestis diversifies at relatively local scales following long-range translocation events. We recommend that surveillance and prediction by public health and wildlife management professionals focus more on models of local or regional weather patterns and ecological factors that may increase risk of widespread

  12. Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

    Science.gov (United States)

    Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

    2003-01-01

    A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

  13. Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

    1989-06-12

    The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

  14. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

    Science.gov (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2012-07-01

    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  15. Rapid in silico cloning of genes using expressed sequence tags (ESTs).

    Science.gov (United States)

    Gill, R W; Sanseau, P

    2000-01-01

    Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

  16. Sequencing and generation of an infectious clone of the pathogenic goose parvovirus strain LH.

    Science.gov (United States)

    Wang, Jianye; Duan, Jinkun; Zhu, Liqian; Jiang, Zhiwei; Zhu, Guoqiang

    2015-03-01

    In this study, the complete genome of the virulent strain LH of goose parvovirus (GPV) was sequenced and cloned into the pBluescript II (SK) plasmid vector. Sequence alignments of the inverted terminal repeats (ITR) of GPV strains revealed a common 14-nt-pair deletion in the stem of the palindromic structure in the LH strain and three other strains isolated after 1982 when compared to three GPV strains isolated earlier than that time. Transfection of 11-day-old embryonated goose eggs with the plasmid pLH, which contains the entire genome of strain LH, resulted in successful rescue of the infectious virus. Death of embryos after transfection via the chorioallantoic membrane infiltration route occurred earlier than when transfection was done via the allantoic cavity inoculation route. The rescued virus exhibited virulence similar to that of its parental virus, as evaluated by the mortality rate in goslings. Generation of the pathogenic infectious clone provides us with a powerful tool to elucidate the molecular pathogenesis of GPV in the future.

  17. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

    1991-01-01

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  18. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  19. Construction and sequencing of an infectious clone of the goose embryo-adapted Muscovy duck parvovirus vaccine strain FZ91-30.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Hardwidge, Philip R; Zhu, Guoqiang

    2016-06-21

    Muscovy duck parvovirus (MDPV) is the etiological agent of Muscovy duckling parvoviral disease, which is characterized by diarrhea, locomotive dysfunction, stunting, and death in young ducklings, and causes substantial economic losses in the Muscovy duck industry worldwide. FZ91-30 is an attenuated vaccine strain that is safe and immunogenic to ducklings, but the genomic information and molecular mechanism underlining the attenuation are not understood. The FZ91-30 strain was propagated in 11-day-old embryonated goose eggs, and viral particles were purified from the pooled allantoic fluid by differential centrifugation and ultracentrifugation. Single-stranded genomic DNA was extracted and annealed to form double-stranded DNA. The dsDNA digested with NcoI resulted two sub-genomic fragments, which were then cloned into the modified plasmid pBluescript II SK, respectively, generating plasmid pBSKNL and pBSKNR. The sub-genomic plasmid clones were sequenced and further combined to construct the plasmid pFZ that contained the entire genome of strain FZ91-30. The complete genome sequences of strain FM and YY and partial genome sequences of other strains were retrieved from GenBank for sequence comparison. The plasmid pFZ containing the entire genome of FZ91-30 was transfected in 11-day-old embryonated goose eggs via the chorioallantoic membranes route to rescue infectious virus. A genetic marker was introduced into the rescued virus to discriminate from its parental virus. The genome of FZ91-30 consists of 5,131 nucleotides and has 98.9 % similarity to the FM strain. The inverted terminal repeats (ITR) are 456 nucleotides in length, 14 nucleotides longer than that of Goose parvovirus (GPV). The exterior 415 nucleotides of the ITR form a hairpin structure, and the interior 41 nucleotides constitute the D sequence, a reverse complement of the D' sequence at the 3' ITR. Amino acid sequence alignment of the VP1 proteins between FZ91-30 and five pathogenic MDPV strains

  20. PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

    Science.gov (United States)

    Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

    1992-06-01

    Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

  1. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  2. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    Science.gov (United States)

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  3. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  4. Genome sequencing and molecular characterisation of Staphylococcus aureus ST772-MRSA-V, "Bengal Bay Clone".

    Science.gov (United States)

    Monecke, Stefan; Baier, Vico; Coombs, Geoffrey W; Slickers, Peter; Ziegler, Albrecht; Ehricht, Ralf

    2013-12-20

    The PVL-positive ST772-MRSA-V is an emerging community-associated (CA-) MRSA clone that has been named Bengal Bay Clone since most patients have epidemiological connections to the Indian subcontinent. It is found increasingly common in other areas of the world. One isolate of ST772-MRSA-V was sequenced using the Illumina Genome Analyzer System. After initial assembling the multiple sequence contigs were analysed using different in-house annotation scripts. Results were compared to microarray hybridisation results of clinical isolates of ST772-MRSA-V, of related strains and to another ST772-MRSA-V genome sequence. According to MLST e-burst analysis, ST772-MRSA-V belongs to Clonal Complex (CC)1, differing from ST1 only in one MLST allele (pta-22). However, there are several additional differences including agr alleles (group II rather than III), capsule type (5 rather than 8), the presence of the egc enterotoxin gene cluster and of the enterotoxin homologue ORF CM14 as well as the absence of the enterotoxin H gene seh. Enterotoxin genes sec and sel are present. ST772-MRSA-V harbours the genes encoding enterotoxin A (sea) and PVL (lukS/F-PV). Both are located on the same prophage. ST772-MRSA-V may have emerged from the same lineage as globally spread CC1 and CC5 strains. It has acquired a variety of virulence factors, and for a CA-MRSA strain it has an unusually high number of genes associated with antibiotic resistance.

  5. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  6. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  7. Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Yu-Hoon Kim

    2014-01-01

    Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

  8. ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.

    Science.gov (United States)

    Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

    2017-03-01

    Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

  9. MOLECULAR CLONING, SEQUENCING, EXPRESSION AND BIOLOGICAL ACTIVITY OF GIANT PANDA (AILUROPODA MELANOLEUCA) INTERFERON-GAMMA.

    Science.gov (United States)

    Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun

    2012-06-29

    The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

  10. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  11. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  12. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  13. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  14. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  15. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  16. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  17. WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

    Science.gov (United States)

    Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

    2010-07-01

    High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

  18. Genome sequence of M6, a diploid inbred clone of the high-glycoalkaloid-producing tuber-bearing potato species Solanum chacoense, reveals residual heterozygosity.

    Science.gov (United States)

    Leisner, Courtney P; Hamilton, John P; Crisovan, Emily; Manrique-Carpintero, Norma C; Marand, Alexandre P; Newton, Linsey; Pham, Gina M; Jiang, Jiming; Douches, David S; Jansky, Shelley H; Buell, C Robin

    2018-05-01

    Cultivated potato (Solanum tuberosum L.) is a highly heterozygous autotetraploid that presents challenges in genome analyses and breeding. Wild potato species serve as a resource for the introgression of important agronomic traits into cultivated potato. One key species is Solanum chacoense and the diploid, inbred clone M6, which is self-compatible and has desirable tuber market quality and disease resistance traits. Sequencing and assembly of the genome of the M6 clone of S. chacoense generated an assembly of 825 767 562 bp in 8260 scaffolds with an N50 scaffold size of 713 602 bp. Pseudomolecule construction anchored 508 Mb of the genome assembly into 12 chromosomes. Genome annotation yielded 49 124 high-confidence gene models representing 37 740 genes. Comparative analyses of the M6 genome with six other Solanaceae species revealed a core set of 158 367 Solanaceae genes and 1897 genes unique to three potato species. Analysis of single nucleotide polymorphisms across the M6 genome revealed enhanced residual heterozygosity on chromosomes 4, 8 and 9 relative to the other chromosomes. Access to the M6 genome provides a resource for identification of key genes for important agronomic traits and aids in genome-enabled development of inbred diploid potatoes with the potential to accelerate potato breeding. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

  19. Alternative splicing of human elastin mRNA indicated by sequence analysis of cloned genomic and complementary DNA

    International Nuclear Information System (INIS)

    Indik, Z.; Yeh, H.; Ornstein-goldstein, N.; Sheppard, P.; Anderson, N.; Rosenbloom, J.C.; Peltonen, L.; Rosenbloom, J.

    1987-01-01

    Poly(A) + RNA, isolated from a single 7-mo fetal human aorta, was used to synthesize cDNA by the RNase H method, and the cDNA was inserted into λgt10. Recombinant phage containing elastin sequences were identified by hybridization with cloned, exon-containing fragments of the human elastin gene. Three clones containing inserts of 3.3, 2.7, and 2.3 kilobases were selected for further analysis. Three overlapping clones containing 17.8 kilobases of the human elastin gene were also isolated from genomic libraries. Complete sequence analysis of the six clones demonstrated that: (i) the cDNA encompassed the entire translated portion of the mRNA encoding 786 amino acids, including several unusual hydrophilic amino acid sequences not previously identified in porcine tropoelastin, (ii) exons encoding either hydrophobic or crosslinking domains in the protein alternated in the gene, and (iii) a great abundance of Alu repetitive sequences occurred throughout the introns. The data also indicated substantial alternative splicing of the mRNA. These results suggest the potential for significant variation in the precise molecular structure of the elastic fiber in the human population

  20. Representational difference analysis of Neisseria meningitidis identifies sequences that are specific for the hyper-virulent lineage III clone

    NARCIS (Netherlands)

    Bart, A.; Dankert, J.; van der Ende, A.

    2000-01-01

    Neisseria meningitidis may cause meningitis and septicemia. Since the early 1980s, an increased incidence of meningococcal disease has been caused by the lineage III clone in many countries in Europe and in New Zealand. We hypothesized that lineage III meningococci have specific DNA sequences,

  1. [Clone, construct, expression and verification of lactoferricin B gene and several sequence mutations in yeast].

    Science.gov (United States)

    Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang

    2007-07-01

    To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.

  2. Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

    Science.gov (United States)

    Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

    2007-01-01

    While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

  3. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  4. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  5. Minimal Residual Disease Detection and Evolved IGH Clones Analysis in Acute B Lymphoblastic Leukemia Using IGH Deep Sequencing.

    Science.gov (United States)

    Wu, Jinghua; Jia, Shan; Wang, Changxi; Zhang, Wei; Liu, Sixi; Zeng, Xiaojing; Mai, Huirong; Yuan, Xiuli; Du, Yuanping; Wang, Xiaodong; Hong, Xueyu; Li, Xuemei; Wen, Feiqiu; Xu, Xun; Pan, Jianhua; Li, Changgang; Liu, Xiao

    2016-01-01

    Acute B lymphoblastic leukemia (B-ALL) is one of the most common types of childhood cancer worldwide and chemotherapy is the main treatment approach. Despite good response rates to chemotherapy regiments, many patients eventually relapse and minimal residual disease (MRD) is the leading risk factor for relapse. The evolution of leukemic clones during disease development and treatment may have clinical significance. In this study, we performed immunoglobulin heavy chain ( IGH ) repertoire high throughput sequencing (HTS) on the diagnostic and post-treatment samples of 51 pediatric B-ALL patients. We identified leukemic IGH clones in 92.2% of the diagnostic samples and nearly half of the patients were polyclonal. About one-third of the leukemic clones have correct open reading frame in the complementarity determining region 3 (CDR3) of IGH , which demonstrates that the leukemic B cells were in the early developmental stage. We also demonstrated the higher sensitivity of HTS in MRD detection and investigated the clinical value of using peripheral blood in MRD detection and monitoring the clonal IGH evolution. In addition, we found leukemic clones were extensively undergoing continuous clonal IGH evolution by variable gene replacement. Dynamic frequency change and newly emerged evolved IGH clones were identified upon the pressure of chemotherapy. In summary, we confirmed the high sensitivity and universal applicability of HTS in MRD detection. We also reported the ubiquitous evolved IGH clones in B-ALL samples and their response to chemotherapy during treatment.

  6. Deciphering KRAS and NRAS mutated clone dynamics in MLL-AF4 paediatric leukaemia by ultra deep sequencing analysis.

    Science.gov (United States)

    Trentin, Luca; Bresolin, Silvia; Giarin, Emanuela; Bardini, Michela; Serafin, Valentina; Accordi, Benedetta; Fais, Franco; Tenca, Claudya; De Lorenzo, Paola; Valsecchi, Maria Grazia; Cazzaniga, Giovanni; Kronnie, Geertruy Te; Basso, Giuseppe

    2016-10-04

    To induce and sustain the leukaemogenic process, MLL-AF4+ leukaemia seems to require very few genetic alterations in addition to the fusion gene itself. Studies of infant and paediatric patients with MLL-AF4+ B cell precursor acute lymphoblastic leukaemia (BCP-ALL) have reported mutations in KRAS and NRAS with incidences ranging from 25 to 50%. Whereas previous studies employed Sanger sequencing, here we used next generation amplicon deep sequencing for in depth evaluation of RAS mutations in 36 paediatric patients at diagnosis of MLL-AF4+ leukaemia. RAS mutations including those in small sub-clones were detected in 63.9% of patients. Furthermore, the mutational analysis of 17 paired samples at diagnosis and relapse revealed complex RAS clone dynamics and showed that the mutated clones present at relapse were almost all originated from clones that were already detectable at diagnosis and survived to the initial therapy. Finally, we showed that mutated patients were indeed characterized by a RAS related signature at both transcriptional and protein levels and that the targeting of the RAS pathway could be of beneficial for treatment of MLL-AF4+ BCP-ALL clones carrying somatic RAS mutations.

  7. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  8. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

    1987-01-01

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  9. Outbreak of OXA-48-Producing Klebsiella pneumoniae Involving a Sequence Type 101 Clone in Batna University Hospital, Algeria.

    Science.gov (United States)

    Loucif, Lotfi; Kassah-Laouar, Ahmed; Saidi, Mahdia; Messala, Amina; Chelaghma, Widad; Rolain, Jean-Marc

    2016-12-01

    Seven nonredundant ertapenem-resistant Klebsiella pneumoniae isolates were collected between May 2014 and 19 January 2015 in the nephrology and hematology units of Batna University Hospital in Algeria. All strains coproduced the bla OXA-48 , bla CTX-M-15 , bla SHV-1 , and bla TEM-1D genes. Six of these isolates belonged to the pandemic clone sequence type 101 (ST101). The bla OXA-48 gene was located on a conjugative IncL/M-type plasmid. This is the first known outbreak of OXA-48-producing K. pneumoniae isolates involving an ST101 clone in Batna University Hospital. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  11. Molecular cloning and functional analysis of nucleotide-binding oligomerization domain-containing protein 1 in rainbow trout, Oncorhynchus mykiss.

    Science.gov (United States)

    Jang, Ju Hye; Kim, Hyun; Kim, Yu Jin; Cho, Ju Hyun

    2016-04-01

    NOD1 has important roles in innate immunity as sensor of microbial components derived from bacterial peptidoglycan. In this study, we identified genes encoding components of the NOD1 signaling pathway, including NOD1 (OmNOD1) and RIP2 (OmRIP2) from rainbow trout, Oncorhynchus mykiss, and investigated whether OmNOD1 has immunomodulating activity in a rainbow trout hepatoma cell line RTH-149 treated with NOD1-specific ligand (iE-DAP). The deduced amino acid sequence of OmNOD1 contained conserved CARD, NOD and LRR domains. Loss-of-function and gain-of-function experiments indicated that OmNOD1 is involved in the expression of pro-inflammatory cytokines. Silencing of OmNOD1 in RTH-149 cells treated with iE-DAP decreased the expression of IL-1β, IL-6, IL-8 and TNF-α. Conversely, overexpression of OmNOD1 resulted in up-regulation of IL-1β, IL-6, IL-8 and TNF-α expression. In addition, RIP2 inhibitor (gefitinib) significantly decreased the expression of these pro-inflammatory cytokines induced by iE-DAP in RTH-149 cells. These findings highlight the important role of NOD1 signaling pathway in fish in eliciting innate immune response. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1988-02-01

    Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

  13. Cloning, Expression, Sequence Analysis and Homology Modeling of the Prolyl Endoprotease from Eurygaster integriceps Puton

    Directory of Open Access Journals (Sweden)

    Ravi Chandra Yandamuri

    2014-10-01

    Full Text Available eurygaster integriceps Puton, commonly known as sunn pest, is a major pest of wheat in Northern Africa, the Middle East and Eastern Europe. This insect injects a prolyl endoprotease into the wheat, destroying the gluten. The purpose of this study was to clone the full length cDNA of the sunn pest prolyl endoprotease (spPEP for expression in E. coli and to compare the amino acid sequence of the enzyme to other known PEPs in both phylogeny and potential tertiary structure. Sequence analysis shows that the 5ꞌ UTR contains several putative transcription factor binding sites for transcription factors known to be expressed in Drosophila that might be useful targets for inhibition of the enzyme. The spPEP was first identified as a prolyl endoprotease by Darkoh et al., 2010. The enzyme is a unique serine protease of the S9A family by way of its substrate recognition of the gluten proteins, which are greater than 30 kD in size. At 51% maximum identity to known PEPs, homology modeling using SWISS-MODEL, the porcine brain PEP (PDB: 2XWD was selected in the database of known PEP structures, resulting in a predicted tertiary structure 99% identical to the porcine brain PEP structure. A Km for the recombinant spPEP was determined to be 210 ± 53 µM for the zGly-Pro-pNA substrate in 0.025 M ethanolamine, pH 8.5, containing 0.1 M NaCl at 37 °C with a turnover rate of 172 ± 47 µM Gly-Pro-pNA/s/µM of enzyme.

  14. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  15. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M

    2018-01-01

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  16. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian

    2018-04-10

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  17. Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

    International Nuclear Information System (INIS)

    Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

    1988-01-01

    cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

  18. Genomic organization and developmental fate of adjacent repeated sequences in a foldback DNA clone of Tetrahymena thermophila

    International Nuclear Information System (INIS)

    Tschunko, A.H.; Loechel, R.H.; McLaren, N.C.; Allen, S.L.

    1987-01-01

    DNA sequence elimination and rearrangement occurs during the development of somatic cell lineages of eukaryotes and was first discovered over a century ago. However, the significance and mechanism of chromatin elimination are not understood. DNA elimination also occurs during the development of the somatic macronucleus from the germinal micronucleus in unicellular ciliated protozoa such as Tetrahymena thermophila. In this study foldback DNA from the micronucleus was used as a probe to isolate ten clones. All of those tested (4/4) contained sequences that were repetitive in the micronucleus and rearranged in the macronucleus. Inverted repeated sequences were present in one clone. This clone, pTtFBl, was subjected to a detailed analysis of its developmental fate. Subregions were subcloned and used as probes against Southern blots of micronuclear and macronuclear DNA. DNA was labeled with [ 33 P]-labeled dATP. The authors found that all subregions defined repeated sequence families in the micronuclear genome. A minimum of four different families was defined, two of which are retained in the macronucleus and two of which are completely eliminated. The inverted repeat family is retained with little rearrangement. Two of the families, defined by subregions that do not contain parts of the inverted repeat are totally eliminated during macronuclear development-and contain open reading frames. The significance of retained inverted repeats to the process of elimination is discussed

  19. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  20. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  1. Mason: a JavaScript web site widget for visualizing and comparing annotated features in nucleotide or protein sequences.

    Science.gov (United States)

    Jaschob, Daniel; Davis, Trisha N; Riffle, Michael

    2015-03-07

    Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.

  2. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  3. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  4. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  5. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Haag KL

    1998-01-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  6. Utilization of a cloned alphoid repeating sequence of human DNA in the study of polymorphism of chromosomal heterochromatin regions

    International Nuclear Information System (INIS)

    Kruminya, A.R.; Kroshkina, V.G.; Yurov, Yu.B.; Aleksandrov, I.A.; Mitkevich, S.P.; Gindilis, V.M.

    1988-01-01

    The chromosomal distribution of the cloned PHS05 fragment of human alphoid DNA was studied by in situ hybridization in 38 individuals. It was shown that this DNA fraction is primarily localized in the pericentric regions of practically all chromosomes of the set. Significant interchromosomal differences and a weakly expressed interindividual polymorphism were discovered in the copying ability of this class of repeating DNA sequences; associations were not found between the results of hybridization and the pattern of Q-polymorphism

  7. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  8. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  9. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    Science.gov (United States)

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  10. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    Directory of Open Access Journals (Sweden)

    Garg Neha

    2012-10-01

    Full Text Available Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac. Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was

  11. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

    Science.gov (United States)

    Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

    2012-10-23

    Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200

  12. Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

    Science.gov (United States)

    Han, S S; Karasev, A V; Ieki, H; Iwanami, T

    2002-11-01

    Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

  13. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  14. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  15. Complete nucleotide sequences and virion particle association of two satellite RNAs of panicum mosaic virus.

    Science.gov (United States)

    Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth

    2017-08-15

    Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  17. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  18. A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

    Directory of Open Access Journals (Sweden)

    Xiaolin Ji

    Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

  19. Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

    Science.gov (United States)

    Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

    2016-01-01

    Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

  20. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  1. Cloning and Sequencing of Gene Encoding Outer Membrane Lipoprotein LipL41 of Leptospira Interrogans Serovar Grippotyphosa

    Directory of Open Access Journals (Sweden)

    M.S. Soltani

    2014-12-01

    Full Text Available Background: Leptospirosis is an infectious bacterial disease caused by pathogenic serovars of Leptospira. Development of reliable and applicable diagnostic test and also recombinant vaccine for this disease require specific antigens that are highly conserved among diverse pathogenic leptospiral serovars. Outer membrane proteins(OMPs of leptospira are effective antigens which can stimulate remarkable immune responses during infection, among them LipL41 is an immunogenic lipoprotein which is present only in pathogenic serovars so it could be regarded as a good candidate for vaccine development and diagnostic method. In order to identify genetic conservation of the lipL41 gene, we cloned and sequenced this gen from Leptospira interrogans serovar vaccinal and field of Grippotyphosa. Materials and Methods: Leptospira interrogans serovar vaccinal Grippotyphosa (RTCC2808 and serovar field Grippotyphosa (RTCC2825were used to inoculate into the selective culture medium(EMJH. The genomic DNA was extracted by standard phenol-chloroform method. The lipL41 gene were amplified by specific primers and cloned into pTZ57R/T vector and transformed into the competent E. coli (Top10 cells. the extracted recombinant plasmid were sequenced. And the related sequences were subjected to homology analysis by comparing them to sequences in the Genbank database. Results: PCR amplification of the lipL41 gene resulted in the 1065 bp PCR product. DNA sequence analysis revealed that lipL41 gene between serovar vaccinal Grippotyphosa (RTCC2808and serovar field Grippotyphosa (RTCC2825 in Iran was 100%. It was also showed that the lipL41 gene had high identity (96%-100% with other pathogenic serovars submitted in Genbank database. Conclusion: The results of this study showed that the lipL41 gene was highly conserved among various pathogenic Leptospira serovars( >95.9 % identity. Hence the cloned gene could be further used for expression of recombinant protein for serodiagnosis

  2. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  3. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  4. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  5. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  6. Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus

    International Nuclear Information System (INIS)

    Upton, C.; McFadden, G.

    1986-01-01

    The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively

  7. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  8. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  9. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  10. Cloning and sequencing of the gene coding for alcohol dehydrogenase of Bacillus stearothermophilus and rational shift of the optimum pH.

    Science.gov (United States)

    Sakoda, H; Imanaka, T

    1992-02-01

    Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those catalytic amino acid residues were fairly conserved in ADH-T and other ADHs, ADH-T was inferred to have basically the same proton release system as horse liver ADH. The putative proton release system of ADH-T was elucidated by introducing point mutations at the catalytic amino acid residues, Cys-38 (cysteine at position 38), Thr-40, and His-43, with site-directed mutagenesis. The mutant enzyme Thr-40-Ser (Thr-40 was replaced by serine) showed a little lower level of activity than wild-type ADH-T did. The result indicates that the OH group of serine instead of threonine can also be used for the catalytic activity. To change the pKa value of the putative system, His-43 was replaced by the more basic amino acid arginine. As a result, the optimum pH of the mutant enzyme His-43-Arg was shifted from 7.8 (wild-type enzyme) to 9.0. His-43-Arg exhibited a higher level of activity than wild-type enzyme at the optimum pH.

  11. The human MCP-2 gene (SCYA8): Cloning, sequence analysis, tissue expression, and assignment to the CC chemokine gene contig on chromosome 17q11.2

    Energy Technology Data Exchange (ETDEWEB)

    Van Coillie, E.; Fiten, P.; Van Damme, J.; Opdenakker, G. [Univ. of Leuven (Belgium)] [and others

    1997-03-01

    Monocyte chemotactic proteins (MCPs) form a subfamily of chemokines that recruit leukocytes to sites of inflammation and that may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. With the use of degenerate primers that were based on CC chemokine consensus sequences, the known MIP-1{alpha}/LD78{alpha}, MCP-1, and MCP-3 genes and the previously unidentified eotaxin and MCP-2 genes were isolated from a YAC contig from human chromosome 17q11.2. The amplified genomic MCP-2 fragment was used to isolate an MCP-2 cosmid from which the gene sequence was determined. The MCP-2 gene shares with the MCP-1 and MCP-3 genes a conserved intron-exon structure and a coding nucleotide sequence homology of 77%. By Northern blot analysis the 1.0-kb MCP-2 mRNA was predominantly detectable in the small intestine, peripheral blood, heart, placenta, lung, skeletal muscle, ovary, colon, spinal cord, pancreas, and thymus. Transcripts of 1.5 and 2.4 kb were found in the testis, the small intestine, and the colon. The isolation of the MCP-2 gene from the chemokine contig localized it on YAC clones of chromosome 17q11.2, which also contain the eotaxin, MCP-1, MCP-3, and NCC-1/MCP-4 genes. The combination of using degenerate primer PCR and YACs illustrates that novel genes can efficiently be isolated from gene cluster contigs with less redundancy and effort than the isolation of novel ESTs. 42 refs., 5 figs., 2 tabs.

  12. Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

    2013-11-01

    Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

  13. The R package otu2ot for implementing the entropy decomposition of nucleotide variation in sequence data

    Directory of Open Access Journals (Sweden)

    Alban eRamette

    2014-11-01

    Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.

  14. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  15. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Morquio A syndrome: Cloning, sequence, and structure of the human N-acetylgalactosamine 6-sulfatase (GALNS) gene

    Energy Technology Data Exchange (ETDEWEB)

    Morris, C.P.; Guo, Xiao-Hui; Apostolou, S. [Adelaide Children`s Hospital, North Adelaide (Australia)] [and others

    1994-08-01

    Deficiency of the lysosomal enzyme, N-acetylgalactosamine 6-sulfatase (GALNS;EC 3.1.6.4), results in the storage of the glycosaminoglycans, keratan sulfate and chrondroitin 6-sulfate, which leads to the lysosomal storage disorder Morquio A syndrome. Four overlapping genomic clones derived from a chromosome 16-specific gridded cosmid library containing the entire GALNS gene were isolated. The structure of the gene and the sequence of the exon/intron boundaries and the 5{prime} promoter region were determined. The GALNS gene is split into 14 exons spanning approximately 40 kb. The potential promoter for GALNS lacks a TATA box but contains GC box consensus sequences, consistent with its role as a housekeeping gene. The GALNS gene contains an Alu repeat in intron 5 and a VNTR-like sequence in intron 6. 12 refs., 3 figs., 1 tab.

  17. CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

    Science.gov (United States)

    Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

  18. Molecular Profiling of Microbial Communities from Contaminated Sources: Use of Subtractive Cloning Methods and rDNA Spacer Sequences; FINAL

    International Nuclear Information System (INIS)

    Robb, Frank T.

    2001-01-01

    The major objective of this research was to provide appropriate sequences and assemble a DNA array of oligonucleotides to be used for rapid profiling of microbial populations from polluted areas and other areas of interest. The sequences to be assigned to the DNA array were chosen from cloned genomic DNA taken from groundwater sites having well characterized pollutant histories at Hanford Nuclear Plant and Lawrence Livermore Site 300. Glass-slide arrays were made and tested; and a new multiplexed, bead-based method was developed that uses nucleic acid hybridization on the surface of microscopic polystyrene spheres to identify specific sequences in heterogeneous mixtures of DNA sequences. The test data revealed considerable strain variation between sample sites showing a striking distribution of sequences. It also suggests that diversity varies greatly with bioremediation, and that there are many bacterial intergenic spacer region sequences that can indicate its effects. The bead method exhibited superior sequence discrimination and has features for easier and more accurate measurement

  19. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    Science.gov (United States)

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  20. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  1. Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

    International Nuclear Information System (INIS)

    Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

    1987-01-01

    Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis

  2. Cloning, sequence analysis, and expression of the large subunit of the human lymphocyte activation antigen 4F2

    Energy Technology Data Exchange (ETDEWEB)

    Lumadue, J.A.; Glick, A.B.; Ruddle, F.H.

    1987-12-01

    Among the earliest expressed antigens on the surface of activated human lymphocytes is the surface antigen 4F2. The authors have used DNA-mediated gene transfer and fluorescence-activated cell sorting to obtain cell lines that contain the gene encoding the large subunit of the human 4F2 antigen in a mouse L-cell background. Human DNAs cloned from these cell lines were subsequently used as hybridization probes to isolate a full-length cDNA clone expressing 4F2. Sequence analysis of the coding region has revealed an amino acid sequence of 529 residues. Hydrophobicity plotting has predicted a probable structure for the protein that includes an external carboxyl terminus, an internal leader sequence, a single hydrophobic transmembrane domain, and two possible membrane-associated domains. The 4F2 cDNA detects a single 1.8-kilobase mRNA in T-cell and B-cell lines. RNA gel blot analysis of RNA derived from quiescent and serum-stimulated Swiss 3T3 fibroblasts reveals a cell-cycle modulation of 4F2 gene expression: the mRNA is present in quiescent fibroblasts but increases 8-fold 24-36 hr after stimulation, at the time of maximal DNA synthesis.

  3. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  4. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  5. Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

    NARCIS (Netherlands)

    Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

    2005-01-01

    The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

  6. Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

    DEFF Research Database (Denmark)

    Defoor, Els Marie Celine; Martinussen, Jan

    A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

  7. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  8. COMPLETE NUCLEOTIDE SEQUENCE OF SPHEROIDIN GENES OF CALLIPTAMUS ITALICUS ENTOMOPOXVIRUS(CIEPV) AND GOMPHOCERUS SIBIRICUS ENTOMOPOXVIRUS(GSEPV)

    Institute of Scientific and Technical Information of China (English)

    Yong-danLi; Li-yingWang; Xi-wuGao; Chao-yangZhao; Zhao-fengTian

    2004-01-01

    The spheroidin genes of Calliptamus italicus entomopoxvirus (CiEPV) and Gomphocerus sibiricus entomopoxvirus (GsEPV) were obtained by PCR,and the fragments were cloned, sequenced and analyzed. The CiEPV and GsEPV spheroidin genes respectively harbored ORFs of 2 922 bps and 2 967 bps that were capable of coding polypeptides of 109.2 and 111.1 kDa. Computer analysis indicated that CiEPV and GsEPV spheroidins shared less than 20% amino acid identities with lepidopteran AmEPV and coleopteran AcEPV spheroidins, but more than 80% amino acid identities with orthopteran OaEPV, MsEPV and AaEPV spheroidins. The CiEPV and GsEPV spheroidins respectively contained 19 and 21 cysteine residues that were particularly abundant at the C-termini, as is the case with those of the other orthopteran EPV spheroidins. The numbers and locations of the cysteine residues of the spheroidins were most similar to those of the spheroidins of EPVs that are virulent on the same insect orders. The promoter regions of the two spheroidin genes were highly conserved (99%) among the orthopteran EPVs and also contained the typical very A+T rich and TAAATG signal mediating transcription of poxvirus late genes. We also sequenced an incomplete ORF downstream of the pheroidin gene of CiEPV and GsEPV. The ORF was in the opposite direction to the spheroidin gene and was homologous to MSV072 putative protein of MsEPV.

  9. Complete Genome Sequences of Isolates of Enterococcus faecium Sequence Type 117, a Globally Disseminated Multidrug-Resistant Clone

    Science.gov (United States)

    Tedim, Ana P.; Lanza, Val F.; Manrique, Marina; Pareja, Eduardo; Ruiz-Garbajosa, Patricia; Cantón, Rafael; Baquero, Fernando; Tobes, Raquel

    2017-01-01

    ABSTRACT The emergence of nosocomial infections by multidrug-resistant sequence type 117 (ST117) Enterococcus faecium has been reported in several European countries. ST117 has been detected in Spanish hospitals as one of the main causes of bloodstream infections. We analyzed genome variations of ST117 strains isolated in Madrid and describe the first ST117 closed genome sequences. PMID:28360174

  10. Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

    Science.gov (United States)

    Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

    2011-05-25

    Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

  11. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Directory of Open Access Journals (Sweden)

    Kei-ichi Morita

    Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  12. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Science.gov (United States)

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  13. The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

    Science.gov (United States)

    Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

    2005-12-20

    Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

  14. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  15. High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

  16. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    Science.gov (United States)

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  17. Amino acid sequence of bovine muzzle epithelial desmocollin derived from cloned cDNA: a novel subtype of desmosomal cadherins.

    Science.gov (United States)

    Koch, P J; Goldschmidt, M D; Walsh, M J; Zimbelmann, R; Schmelz, M; Franke, W W

    1991-05-01

    Desmosomes are cell-type-specific intercellular junctions found in epithelium, myocardium and certain other tissues. They consist of assemblies of molecules involved in the adhesion of specific cell types and in the anchorage of cell-type-specific cytoskeletal elements, the intermediate-size filaments, to the plasma membrane. To explore the individual desmosomal components and their functions we have isolated DNA clones encoding the desmosomal glycoprotein, desmocollin, using antibodies and a cDNA expression library from bovine muzzle epithelium. The cDNA-deduced amino-acid sequence of desmocollin (presently we cannot decide to which of the two desmocollins, DC I or DC II, this clone relates) defines a polypeptide with a calculated molecular weight of 85,000, with a single candidate sequence of 24 amino acids sufficiently long for a transmembrane arrangement, and an extracellular aminoterminal portion of 561 amino acid residues, compared to a cytoplasmic part of only 176 amino acids. Amino acid sequence comparisons have revealed that desmocollin is highly homologous to members of the cadherin family of cell adhesion molecules, including the previously sequenced desmoglein, another desmosome-specific cadherin. Using riboprobes derived from cDNAs for Northern-blot analyses, we have identified an mRNA of approximately 6 kb in stratified epithelia such as muzzle epithelium and tongue mucosa but not in two epithelial cell culture lines containing desmosomes and desmoplakins. The difference may indicate drastic differences in mRNA concentration or the existence of cell-type-specific desmocollin subforms. The molecular topology of desmocollin(s) is discussed in relation to possible functions of the individual molecular domains.

  18. Gene sequencing, cloning, and expression of the recombinant L- Asparaginase of Pseudomonas aeruginosa SN4 strain in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Arastoo Badoei-dalfard

    2016-03-01

    Full Text Available Introduction: L- asparaginase is in an excessive demand in medical applications and in food treating industries, the request for this therapeutic enzyme is growing several folds every year. Materials and methods: In this study, a L- asparaginase gene from Pseudomonas aeruginosa strain SN4 was sequenced and cloned in E. coli. Primers were designed based on L- asparaginase from P. aeruginosa DSM 50071, which show high similarity to SN4 strain, according to 16S rRNA sequence. The L- asparaginase gene was exposed to restriction digestion with NdeI and XhoI enzymes and then ligated into pET21a plasmid. The ligated sample was transformed into competent E. coli (DE3 pLysS DH5a cells, according to CaCl2 method. The transformed E. coli cells were grown into LB agar plate containing 100 µg/ml ampicillin, IPTG (1 mM. Results: Recombinant L- asparaginase from E. coli BL21 induced after 9 h of incubation and showed high L- asparaginase activity about 93.4 IU/ml. Recombinant L- asparaginase sequencing and alignments showed that the presumed amino acid sequence composed of 350 amino acid residues showed high similarity with P. aeruginosa L- asparaginases about 99%. The results also indicated that SN4 L- asparaginase has the catalytic residues and conserve region similar to other L- asparaginases. Discussion and conclusion: This is the first report on cloning and expression of P. aeruginosa L- asparaginases in Escherichia coli. These results indicated a potent source of L- asparaginase for in vitro and in vivio anticancer consideration. 

  19. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  20. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  1. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  2. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  3. Amino acid substitutions in genetic variants of human serum albumin and in sequences inferred from molecular cloning

    International Nuclear Information System (INIS)

    Takahashi, N.; Takahashi, Y.; Blumberg, B.S.; Putnam, F.W.

    1987-01-01

    The structural changes in four genetic variants of human serum albumin were analyzed by tandem high-pressure liquid chromatography (HPLC) of the tryptic peptides, HPLC mapping and isoelectric focusing of the CNBr fragments, and amino acid sequence analysis of the purified peptides. Lysine-372 of normal (common) albumin A was changed to glutamic acid both in albumin Naskapi, a widespread polymorphic variant of North American Indians, and in albumin Mersin found in Eti Turks. The two variants also exhibited anomalous migration in NaDodSO 4 /PAGE, which is attributed to a conformational change. The identity of albumins Naskapi and Mersin may have originated through descent from a common mid-Asiatic founder of the two migrating ethnic groups, or it may represent identical but independent mutations of the albumin gene. In albumin Adana, from Eti Turks, the substitution site was not identified but was localized to the region from positions 447 through 548. The substitution of aspartic acid-550 by glycine was found in albumin Mexico-2 from four individuals of the Pima tribe. Although only single-point substitutions have been found in these and in certain other genetic variants of human albumin, five differences exist in the amino acid sequences inferred from cDNA sequences by workers in three other laboratories. However, our results on albumin A and on 14 different genetic variants accord with the amino acid sequence of albumin deduced from the genomic sequence. The apparent amino acid substitutions inferred from comparison of individual cDNA sequences probably reflect artifacts in cloning or in cDNA sequence analysis rather than polymorphism of the coding sections of the albumin gene

  4. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    D' Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. (Universita di Bari (Italy)); Antonacci, R. (Instituto Anatomia Umana Normale, Modena (Italy))

    1993-11-01

    The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

  5. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  6. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  7. Deciphering the Resistome of the Widespread Pseudomonas aeruginosa Sequence Type 175 International High-Risk Clone through Whole-Genome Sequencing.

    Science.gov (United States)

    Cabot, Gabriel; López-Causapé, Carla; Ocampo-Sosa, Alain A; Sommer, Lea M; Domínguez, María Ángeles; Zamorano, Laura; Juan, Carlos; Tubau, Fe; Rodríguez, Cristina; Moyà, Bartolomé; Peña, Carmen; Martínez-Martínez, Luis; Plesiat, Patrick; Oliver, Antonio

    2016-12-01

    Whole-genome sequencing (WGS) was used for the characterization of the frequently extensively drug resistant (XDR) Pseudomonas aeruginosa sequence type 175 (ST175) high-risk clone. A total of 18 ST175 isolates recovered from 8 different Spanish hospitals were analyzed; 4 isolates from 4 different French hospitals were included for comparison. The typical resistance profile of ST175 included penicillins, cephalosporins, monobactams, carbapenems, aminoglycosides, and fluoroquinolones. In the phylogenetic analysis, the four French isolates clustered together with two isolates from one of the Spanish regions. Sequence variation was analyzed for 146 chromosomal genes related to antimicrobial resistance, and horizontally acquired genes were explored using online databases. The resistome of ST175 was determined mainly by mutational events; resistance traits common to all or nearly all of the strains included specific ampR mutations leading to ampC overexpression, specific mutations in oprD conferring carbapenem resistance, or a mexZ mutation leading to MexXY overexpression. All isolates additionally harbored an aadB gene conferring gentamicin and tobramycin resistance. Several other resistance traits were specific to certain geographic areas, such as a streptomycin resistance gene, aadA13, detected in all four isolates from France and in the two isolates from the Cantabria region and a glpT mutation conferring fosfomycin resistance, detected in all but these six isolates. Finally, several unique resistance mutations were detected in single isolates; particularly interesting were those in genes encoding penicillin-binding proteins (PBP1A, PBP3, and PBP4). Thus, these results provide information valuable for understanding the genetic basis of resistance and the dynamics of the dissemination and evolution of high-risk clones. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  8. Highly Stable l-Lysine 6-Dehydrogenase from the Thermophile Geobacillus stearothermophilus Isolated from a Japanese Hot Spring: Characterization, Gene Cloning and Sequencing, and Expression

    Science.gov (United States)

    Heydari, Mojgan; Ohshima, Toshihisa; Nunoura-Kominato, Naoki; Sakuraba, Haruhiko

    2004-01-01

    l-Lysine dehydrogenase, which catalyzes the oxidative deamination of l-lysine in the presence of NAD, was found in the thermophilic bacterium Geobacillus stearothermophilus UTB 1103 and then purified about 3,040-fold from a crude extract of the organism by using four successive column chromatography steps. This is the first report showing the presence of a thermophilic NAD-dependent lysine dehydrogenase. The product of the enzyme catalytic activity was determined to be Δ1-piperideine-6-carboxylate, indicating that the enzyme is l-lysine 6-dehydrogenase (LysDH) (EC 1.4.1.18). The molecular mass of the purified protein was about 260 kDa, and the molecule was determined to be a homohexamer with subunit molecular mass of about 43 kDa. The optimum pH and temperature for the catalytic activity of the enzyme were about 10.1 and 70°C, respectively. No activity was lost at temperatures up to 65°C in the presence of 5 mM l-lysine. The enzyme was relatively selective for l-lysine as the electron donor, and either NAD or NADP could serve as the electron acceptor (NADP exhibited about 22% of the activity of NAD). The Km values for l-lysine, NAD, and NADP at 50°C and pH 10.0 were 0.73, 0.088, and 0.48 mM, respectively. When the gene encoding this LysDH was cloned and overexpressed in Escherichia coli, a crude extract of the recombinant cells had about 800-fold-higher enzyme activity than the extract of G. stearothermophilus. The nucleotide sequence of the LysDH gene encoded a peptide containing 385 amino acids with a calculated molecular mass of 42,239 Da. PMID:14766574

  9. Isolation and characterization of human glycophorin A cDNAs using a synthetic oligonucleotide approach: nucleotide sequence, mRNA structure and regulation by 12-O-tetradecanoylphorbol 13-acetate (TPA)

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    The authors have previously shown that treatment of human erythroleukemic K562 cells with the tumor-promoting phorbol ester, TPA, results in a diminished expression of glycophorin A at the level of protein biosynthesis and in vitro mRNA translation activity. To further examine the structure, relationships and expression of human glycophorins they have successfully isolated and sequenced several glycophorin A specific cDNA clones derived from K562 cells, by making extensive use of mixed and exact synthetic oligonucleotides as primers and radioactively labeled probes. The nucleotide sequence obtained from the largest glycophorin A cDNA suggests the presence of a hydrophobic leader-like peptide of at least 19 amino acids. Northern gel analysis using both whole cDNA-plasmid and synthetic oligonucleotide probes revealed the existence of multiple mRNAs, three of which they believe to be glycophorin A-specific, whereas a fourth and smaller mRNA appears to be glycophorin B-specific. Furthermore, the abundance of all four glycophorin mRNAs were found to be extensively reduced following treatment of K562 cells with TPA suggesting coordinate regulation, possibly at the level of gene transcription

  10. Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

    Science.gov (United States)

    Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

    2009-07-01

    Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

  11. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  12. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  13. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

  14. Primary structure of human pancreatic protease E determined by sequence analysis of the cloned mRNA

    International Nuclear Information System (INIS)

    Shen, W.; Fletcher, T.S.; Largman, C.

    1987-01-01

    Although protease E was isolated from human pancreas over 10 years ago, its amino acid sequence and relationship to the elastases have not been established. The authors report the isolation of a cDNA clone for human pancreatic protease E and determination of the nucleic acid sequence coding for the protein. The deduced amino acid sequence contains all of the features common to serine proteases. The substrate binding region is highly homologous to those of porcine and rat elastases 1, explaining the similar specificity for alanine reported for protease E and these elastases. However, the amino acid sequence outside the substrate binding region is less than 50% conserved, and there is a striking difference in the overall net charge for protease E (6-) and elastases 1 (8+). These findings confirm that protease E is a new member of the serine protease family. They have attempted to identify amino acid residues important for the interaction between elastases and elastin by examining the amino acid sequence differences between elastases and protease E. In addition to the large number of surface charge changes which are outside the substrate binding region, there are several changes which might be crucial for elastolysis: Leu-73/Arg-73; Arg-217A/Ala-217A; Arg-65A/Gln-65A; and the presence of two new cysteine residues (Cys-98 and Cys-99B) which computer modeling studies predict could form a new disulfide bond, not previously observed for serine proteases. They also present evidence which suggests that human pancreas does not synthesize a basic, alanine-specific elastase similar to porcine elastase 1

  15. Molecular characterization and clonal diversity of meticillin-resistant Staphylococcus aureus isolated from the community in Spain: emergence of clone sequence type 72.

    Science.gov (United States)

    Potel, C; Rey, S; Otero, S; Rubio, J; Álvarez, M

    2016-08-01

    Sequence type 72 meticillin-resistant Staphylococcus aureus (ST72 MRSA) was recently detected in our hospital. Although in Europe this clone is rarely isolated, it is the leading cause of community-associated MRSA infections in Korea, spreading also into hospitals, where it has also emerged as the main MRSA clone recovered from raw meat. We studied MRSA isolated from outpatients in Spain during a nine-year period. More than 70% of the isolates belonged to predominant clones found in hospitals. There was a significant increase in the ST72 prevalence. It appears that boundaries of dominance among MRSA clones have become blurred, demanding continuous surveillance. Copyright © 2016 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

  16. Peptide and nucleotide sequences of rat CD4 (W3/25) antigen: evidence for derivation from a structure with four immunoglobulin-related domains

    International Nuclear Information System (INIS)

    Clark, S.J.; Jefferies, W.A.; Barclay, A.N.; Gagnon, J.; Williams, A.F.

    1987-01-01

    The rat W3/25 antigen was the first marker antigen of helper T lymphocytes to be identified. Subsequently, the human OKT4 antigen (now called CD4) was described, and cell distribution and functional data suggested that W3/25 and OKT4 antigens were homologous. This is now confirmed by the matching of peptide sequences from W3/25 antigen with sequence predicted from rat cDNA clones detected by cross-hybridization with a cDNA probe for human CD4. Analysis of the two sequences suggests an evolutionary origin from a structure with four immunoglobulin-related domains, although only domain 1 at the NH 2 terminus meets the standard criteria for an immunoglobulin-related sequence. CD4 domains 2 and 4 contain disulfide bonds but seem like truncated immunoglobulin domains, whereas domain 3 may have a pattern of β-strands like an immunoglobulin variable domain, but without the disulfide bond

  17. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  18. Molecular Cloning and Expression of Sequence Variants of Manganese Superoxide Dismutase Genes from Wheat

    Science.gov (United States)

    Reactive oxygen species (ROS) are very harmful to living organisms due to the potential oxidation of membrane lipids, DNA, proteins, and carbohydrates. Transformed E.coli strain QC 871, superoxide dismutase (SOD) double-mutant, with three sequence variant MnSOD1, MnSOD2, and MnSOD3 manganese supero...

  19. Molecular cloning and sequence analysis of VP6 gene of giant ...

    African Journals Online (AJOL)

    Jane

    2011-10-24

    Oct 24, 2011 ... G), and the major structural protein of inner capsid particles (ICP), and also specific antigen of mucosa immunization that mediate specific immunological reaction. In this report, sequence analysis of VP6 gene of giant panda rotavirus was carried out. Full-length VP6 gene encoding for ICP of giant panda.

  20. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Liu, Siyang; Huang, Shujia; Rao, Junhua

    2015-01-01

    present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

  1. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    Science.gov (United States)

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  2. cDNA cloning and immunological characterization of the rye grass allergen Lol p I.

    Science.gov (United States)

    Perez, M; Ishioka, G Y; Walker, L E; Chesnut, R W

    1990-09-25

    The complete amino acid sequence of two "isoallergenic" forms of Lol p I, the major rye grass (Lolium perenne) pollen allergen, was deduced from cDNA sequence analysis. cDNA clones isolated from a Lolium perenne pollen library contained an open reading frame coding for a 240-amino acid protein. Comparison of the nucleotide and deduced amino acid sequence of two of these clones revealed four changes at the amino acid level and numerous nucleotide differences. Both clones contained one possible asparagine-linked glycosylation site. Northern blot analysis shows one RNA species of 1.2 kilobases. Based on the complete amino acid sequence of Lol p I, overlapping peptides covering the entire molecule were synthesized. Utilizing these peptides we have identified a determinant within the Lol p I molecule that is recognized by human leukocyte antigen class II-restricted T cells obtained from persons allergic to rye grass pollen.

  3. Molecular cloning, sequence characterization and expression pattern of Rab18 gene from watermelon (Citrullus lanatus).

    Science.gov (United States)

    Xinli, Xiao; Lei, Peng

    2015-03-04

    The complete mRNA sequence of watermelon Rab18 gene was amplified through the rapid amplification of cDNA ends (RACE) method. The full-length mRNA was 1010 bp containing a 645 bp open reading frame, which encodes a protein of 214 amino acids. Sequence analysis revealed that watermelon Rab18 protein shares high homology with the Rab18 of cucumber (99%), muskmelon (98%), Morus notabilis (90%), tomato (89%), wine grape (89%) and potato (88%). Phylogenetic analysis revealed that watermelon Rab18 gene has a closer genetic relationship with Rab18 gene of cucumber and muskmelon. Tissue expression profile analysis indicated that watermelon Rab18 gene was highly expressed in root, stem and leaf, moderately expressed in flower and weakly expressed in fruit.

  4. cDNA sequence and tissue distribution of the mRNA for bovine and murine p11, the S100-related light chain of the protein-tyrosine kinase substrate p36 (calpactin I)

    DEFF Research Database (Denmark)

    Saris, Chris J M; Kristensen, Torsten; D’Eustachio, Peter

    1987-01-01

    We have isolated and sequenced cDNA clones of bovine nd murine pl 1 mRNAs. The nonpolyadenylated mRNAs are predicted to be 614 and 600 nucleotides, respectively. The p l l mRNAs both contain a 291 nucleotide open reading frame, preceded by a 5”untranslated region of 73 nucleotides in bovine p l l m...

  5. Cloning, sequence and expression of the pel gene from an Amycolata sp.

    Science.gov (United States)

    Brühlmann, F; Keen, N T

    1997-11-20

    The pel gene from an Amycolata sp. encoding a pectate lyase (EC 4.2.2.2) was isolated by activity screening a genomic DNA library in Streptomyces lividans TK24. Subsequent subcloning and sequencing of a 2.3 kb BamHI BglII fragment revealed an open reading frame of 930 nt corresponding to a protein of 29,660 Da. The overall G + C content for the coding region was 65%, with a strong G + C preference in the third (wobble) codon position (93%). A putative ribosome-binding site 5'-GGGAG-3' preceded the translational start codon by 7 base pairs. The Amycolata pectate lyase contains a signal peptide of 26 amino acids, that is cleaved after the sequence Ala-Thr-Ala. The size of the deduced protein as well as its N-terminal amino-acid sequence match the wild-type pectate lyase from the Amycolata sp. Expression of the pel gene in S. lividans TK24 resulted in high pectate lyase activity in the culture supernatant, concomitant with the appearance of a dominant protein band on a sodium dodecyl polyacrylamide gel at 30 kDa. No pectate lyase activity was detected in E. coli BL21 with the pel gene under the strong T7 promotor. The deduced amino-acid sequence showed 40% identity with PelE from Erwinia chrysanthemi and the pectate lyase from Glomerella cingulata. The Amycolata pectate lyase clearly belongs to the pectate lyase superfamily, sharing all functional amino acids and likely has a similar structural topology as Pels from Erwinia chrysanthemi and Bacillus subtilis.

  6. Rhipicephalus (Boophilus) microplus strain Deutsch, 5 BAC clone sequencing, including two encoding Cytochrome P450s and one encoding CzEst9 carboxylesterase

    Science.gov (United States)

    The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. BAC clones give insight into the genome struct...

  7. Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

    International Nuclear Information System (INIS)

    Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.

    1987-01-01

    The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

  8. Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

    2013-08-01

    Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

  9. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Directory of Open Access Journals (Sweden)

    Pattana Srifah Huehne

    2013-08-01

    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  10. Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates: insertional events of transposons and insertion sequences.

    Directory of Open Access Journals (Sweden)

    Annemieke Smet

    Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of

  11. Cloning, sequencing, purification, and crystal structure of Grenache (Vitis vinifera) polyphenol oxidase.

    Science.gov (United States)

    Virador, Victoria M; Reyes Grajeda, Juan P; Blanco-Labra, Alejandro; Mendiola-Olaya, Elizabeth; Smith, Gary M; Moreno, Abel; Whitaker, John R

    2010-01-27

    The full-length cDNA sequence (P93622_VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C222(1). The structure was obtained at 2.2 A resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1 ) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and alpha, beta, and gamma) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.

  12. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  13. Genome-wide cloning and sequence analysis of leucine-rich repeat receptor-like protein kinase genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Yuan Tong

    2010-01-01

    Full Text Available Abstract Background Transmembrane receptor kinases play critical roles in both animal and plant signaling pathways regulating growth, development, differentiation, cell death, and pathogenic defense responses. In Arabidopsis thaliana, there are at least 223 Leucine-rich repeat receptor-like kinases (LRR-RLKs, representing one of the largest protein families. Although functional roles for a handful of LRR-RLKs have been revealed, the functions of the majority of members in this protein family have not been elucidated. Results As a resource for the in-depth analysis of this important protein family, the complementary DNA sequences (cDNAs of 194 LRR-RLKs were cloned into the GatewayR donor vector pDONR/ZeoR and analyzed by DNA sequencing. Among them, 157 clones showed sequences identical to the predictions in the Arabidopsis sequence resource, TAIR8. The other 37 cDNAs showed gene structures distinct from the predictions of TAIR8, which was mainly caused by alternative splicing of pre-mRNA. Most of the genes have been further cloned into GatewayR destination vectors with GFP or FLAG epitope tags and have been transformed into Arabidopsis for in planta functional analysis. All clones from this study have been submitted to the Arabidopsis Biological Resource Center (ABRC at Ohio State University for full accessibility by the Arabidopsis research community. Conclusions Most of the Arabidopsis LRR-RLK genes have been isolated and the sequence analysis showed a number of alternatively spliced variants. The generated resources, including cDNA entry clones, expression constructs and transgenic plants, will facilitate further functional analysis of the members of this important gene family.

  14. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

    Science.gov (United States)

    Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H

    1995-01-01

    Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

  15. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  16. Primary structure of human pancreatic elastase 2 determined by sequence analysis of the cloned mRNA

    International Nuclear Information System (INIS)

    Fletcher, T.S.; Shen, W.F.; Largman, C.

    1987-01-01

    A cDNA encoding elastase 2 has been cloned from a human pancreatic cDNA library. The cDNA contains a translation initiation site and a poly(A) recognition site and encodes a protein of 269 amino acids, including a proposed 16-residue signal peptide. The amino acid sequence of the deduced mature protein contains a 12-residue activation peptide containing a cysteine at residue 1 similar to that of chymotryspin. The proposed active enzyme contains all of the characteristic active-site amino acids, including His-57, Asp-102, and Ser-195. The S1 binding pocket is bounded by Gly-216 and Ser-226, making this pocket intermediate in size between chymotrypsins and elastase 1 or protease E, consistent with the substrate specificity of elastase 2 for long-chain aliphatic or aromatic amino acids. Computer modeling studies using the amino acid sequence of elastase 2 superimposed on the X-ray structure of porcine elastase 1 suggest that a change of Gln-192 in elastase 1 to Asn-192 in elastase 2 may account for the lower catalytic efficiency of the latter enzyme. Several basic residues appear to be near the ends of the extended binding pocket of elastases which might serve to anchor the enzyme to the elastin substrate. These studies indicate that elastases 2 and elastase 1 both contain an Arg-65A as well as a basic dipeptide at 223/224 which is not present in chymotrypsins. In addition, Arg-217A is present in humaan elastase 2 but absent in rat pancreatic protein which has been proposed to be an elastase 2 on the basis of sequence homology, but which was not isolated during screening of rat pancreatic tissue extracts for elastolytic activity

  17. Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis.

    Science.gov (United States)

    Lowe, A M; Deresiewicz, R L

    1999-01-01

    Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.

  18. Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli

    International Nuclear Information System (INIS)

    Satyanarayana, Tatineni; Gowda, Siddarame; Ayllon, Maria A.; Dawson, William O.

    2003-01-01

    The advent of reverse genetics revolutionized the study of positive-stranded RNA viruses that were amenable for cloning as cDNAs into high-copy-number plasmids of Escherichia coli. However, some viruses are inherently refractory to cloning in high-copy-number plasmids due to toxicity of viral sequences to E. coli. We report a strategy that is a compromise between infectivity of the RNA transcripts and toxicity to E. coli effected by introducing frameshift mutations into 'slippery sequences' near the viral 'toxicity sequences' in the viral cDNA. Citrus tristeza virus (CTV) has cDNA sequences that are toxic to E. coli. The original full-length infectious cDNA of CTV and a derivative replicon, CTV-ΔCla, cloned into pUC119, resulted in unusually limited E. coli growth. However, upon sequencing of these cDNAs, an additional uridinylate (U) was found in a stretch of U's between nts 3726 and 3731 that resulted in a change to a reading frame with a stop codon at nt 3734. Yet, in vitro produced RNA transcripts from these clones infected protoplasts, and the resulting progeny virus was repaired. Correction of the frameshift mutation in the CTV cDNA constructs resulted in increased infectivity of in vitro produced RNA transcripts, but also caused a substantial increase of toxicity to E. coli, now requiring 3 days to develop visible colonies. Frameshift mutations created in sequences not suspected to facilitate reading frame shifting and silent mutations introduced into oligo(U) regions resulted in complete loss of infectivity, suggesting that the oligo(U) region facilitated the repair of the frameshift mutation. Additional frameshift mutations introduced into other oligo(U) regions also resulted in transcripts with reduced infectivity similarly to the original clones with the +1 insertion. However, only the frameshift mutations introduced into oligo(U) regions that were near and before the toxicity region improved growth and stability in E. coli. These data demonstrate that

  19. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  20. CRISPR-Cas9-Edited Site Sequencing (CRES-Seq): An Efficient and High-Throughput Method for the Selection of CRISPR-Cas9-Edited Clones.

    Science.gov (United States)

    Veeranagouda, Yaligara; Debono-Lagneaux, Delphine; Fournet, Hamida; Thill, Gilbert; Didier, Michel

    2018-01-16

    The emergence of clustered regularly interspaced short palindromic repeats-Cas9 (CRISPR-Cas9) gene editing systems has enabled the creation of specific mutants at low cost, in a short time and with high efficiency, in eukaryotic cells. Since a CRISPR-Cas9 system typically creates an array of mutations in targeted sites, a successful gene editing project requires careful selection of edited clones. This process can be very challenging, especially when working with multiallelic genes and/or polyploid cells (such as cancer and plants cells). Here we described a next-generation sequencing method called CRISPR-Cas9 Edited Site Sequencing (CRES-Seq) for the efficient and high-throughput screening of CRISPR-Cas9-edited clones. CRES-Seq facilitates the precise genotyping up to 96 CRISPR-Cas9-edited sites (CRES) in a single MiniSeq (Illumina) run with an approximate sequencing cost of $6/clone. CRES-Seq is particularly useful when multiple genes are simultaneously targeted by CRISPR-Cas9, and also for screening of clones generated from multiallelic genes/polyploid cells. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

  1. PredPPCrys: accurate prediction of sequence cloning, protein production, purification and crystallization propensity from protein sequences using multi-step heterogeneous feature fusion and selection.

    Directory of Open Access Journals (Sweden)

    Huilin Wang

    Full Text Available X-ray crystallography is the primary approach to solve the three-dimensional structure of a protein. However, a major bottleneck of this method is the failure of multi-step experimental procedures to yield diffraction-quality crystals, including sequence cloning, protein material production, purification, crystallization and ultimately, structural determination. Accordingly, prediction of the propensity of a protein to successfully undergo these experimental procedures based on the protein sequence may help narrow down laborious experimental efforts and facilitate target selection. A number of bioinformatics methods based on protein sequence information have been developed for this purpose. However, our knowledge on the important determinants of propensity for a protein sequence to produce high diffraction-quality crystals remains largely incomplete. In practice, most of the existing methods display poorer performance when evaluated on larger and updated datasets. To address this problem, we constructed an up-to-date dataset as the benchmark, and subsequently developed a new approach termed 'PredPPCrys' using the support vector machine (SVM. Using a comprehensive set of multifaceted sequence-derived features in combination with a novel multi-step feature selection strategy, we identified and characterized the relative importance and contribution of each feature type to the prediction performance of five individual experimental steps required for successful crystallization. The resulting optimal candidate features were used as inputs to build the first-level SVM predictor (PredPPCrys I. Next, prediction outputs of PredPPCrys I were used as the input to build second-level SVM classifiers (PredPPCrys II, which led to significantly enhanced prediction performance. Benchmarking experiments indicated that our PredPPCrys method outperforms most existing procedures on both up-to-date and previous datasets. In addition, the predicted crystallization

  2. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  3. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    Science.gov (United States)

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  4. Cloning and Sequencing of Protein Kinase cDNA from Harbor Seal (Phoca vitulina Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jennifer C. C. Neale

    2004-01-01

    Full Text Available Protein kinases (PKs play critical roles in signal transduction and activation of lymphocytes. The identification of PK genes provides a tool for understanding mechanisms of immunotoxic xenobiotics. As part of a larger study investigating persistent organic pollutants in the harbor seal and their possible immunomodulatory actions, we sequenced harbor seal cDNA fragments encoding PKs. The procedure, using degenerate primers based on conserved motifs of human protein tyrosine kinases (PTKs, successfully amplified nine phocid PK gene fragments with high homology to human and rodent orthologs. We identified eight PTKs and one dual (serine/threonine and tyrosine kinase. Among these were several PKs important in early signaling events through the B- and T-cell receptors (FYN, LYN, ITK and SYK and a MAP kinase involved in downstream signal transduction. V-FGR, RET and DDR2 were also expressed. Sequential activation of protein kinases ultimately induces gene transcription leading to the proliferation and differentiation of lymphocytes critical to adaptive immunity. PKs are potential targets of bioactive xenobiotics, including persistent organic pollutants of the marine environment; characterization of these molecules in the harbor seal provides a foundation for further research illuminating mechanisms of action of contaminants speculated to contribute to large-scale die-offs of marine mammals via immunosuppression.

  5. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  6. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

    1987-01-01

    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  7. The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

    Science.gov (United States)

    Le Chevanton, L; Leblon, G

    1989-04-15

    We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

  8. Campylobacter Species Isolated from Pigs in Grenada Exhibited Novel Clones: Genotypes and Antimicrobial Resistance Profiles of Sequence Types.

    Science.gov (United States)

    Amadi, Victor A; Matthew-Belmar, Vanessa; Subbarao, Charmarthy; Kashoma, Isaac; Rajashekara, Gireesh; Sharma, Ravindra; Hariharan, Harry; Stone, Diana

    2017-07-01

    Infections caused by Campylobacter species pose a severe threat to public health worldwide. However, in Grenada, the occurrence and characteristics of Campylobacter in food animals, including pigs, remain mostly unknown. In this study, we identified the sequence types (STs) of Campylobacter from young healthy pigs in Grenada and compared the results with previous studies in Grenada and other countries. Antimicrobial resistance patterns and diversity of the Campylobacter clones were evaluated. Ninety-nine Campylobacter isolates (97 Campylobacter coli and 2 Campylobacter jejuni) were analyzed by multilocus sequence typing. Eighteen previously reported STs and 13 novel STs were identified. Of the 18 previously reported STs, eight STs (ST-854, -887, -1068, -1096, -1445, -1446, 1556, and -1579) have been associated with human gastroenteritis in different geographical regions. Among these 18 previously reported STs, ST-1428, -1096, -1450, and -1058 predominated and accounted for 18.2%, 14.1%, 11.1%, and 8.1% of all isolates, respectively. Of the 13 novel STs, ST-7675 predominated and accounted for 20% (4 of 20 isolates), followed by ST-7678, -7682, and -7691, each accounting for 10% (2 of 20 isolates). Antimicrobial resistance testing using Epsilometer test revealed a low resistance rate (1-3%) of all C. coli/jejuni STs to all antimicrobials except for tetracycline (1-10.1%). Some of the C. coli STs (13 STs, 24/99 isolates, 24.2%) were resistant to multiple antimicrobials. This is the first report on antimicrobial resistance and multidrug resistance patterns associated with Campylobacter STs recovered from swine in Grenada. This study showed that pigs in Grenada are not major reservoirs for STs of C. coli and C. jejuni that are associated with human gastroenteritis worldwide.

  9. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  10. The genomic sequence of cowpea aphid-borne mosaic virus and its similarities with other potyviruses

    NARCIS (Netherlands)

    Mlotshwa, S.; Verver, J.; Sithole-Niang, I.; Kampen, van T.; Kammen, van A.; Wellink, J.

    2002-01-01

    The genomic sequence of a Zimbabwe isolate of Cowpea aphid-borne mosaic virus (CABMV-Z) was determined by sequencing overlapping viral cDNA clones generated by RT-PCR using degenerate and/or specific primers. The sequence is 9465 nucleotides in length excluding the 3' terminal poly (A) tail and

  11. Nucleotide sequences of two cellulase genes from alkalophilic Bacillus sp. strain N-4 and their strong homology.

    OpenAIRE

    Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K

    1986-01-01

    Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...

  12. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  13. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    Science.gov (United States)

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

    2016-12-01

    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  15. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  16. Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

    Science.gov (United States)

    Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

    2018-03-01

    Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

  17. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  18. The first insight into the salvia (lamiaceae) genome via bac library construction and high-throughput sequencing of target bac clones

    International Nuclear Information System (INIS)

    Hao, D.C.; Vautrin, S.; Berges, H.; Chen, S.L.

    2015-01-01

    Salvia is a representative genus of Lamiaceae, a eudicot family with significant species diversity and population adaptibility. One of the key goals of Salvia genomics research is to identify genes of adaptive significance. This information may help to improve the conservation of adaptive genetic variation and the management of medicinal plants to increase their health and productivity. Large-insert genomic libraries are a fundamental tool for achieving this purpose. We report herein the construction, characterization and screening of a gridded BAC library for Salvia officinalis (sage). The S. officinalis BAC library consists of 17,764 clones and the average insert size is 107 Kb, corresponding to 3 haploid genome equivalents. Seventeen positive clones (average insert size 115 Kb) containing five terpene synthase (TPS) genes were screened out by PCR and 12 of them were subject to Illumina HiSeq 2000 sequencing, which yielded 28,097,480 90-bp raw reads (2.53 Gb). Scaffolds containing sabinene synthase (Sab), a Sab homolog, TPS3 (kaurene synthase-like 2), copalyl diphosphate synthase 2 and one cytochrome P450 gene were retrieved via de novo assembly and annotation, which also have flanking noncoding sequences, including predicted promoters and repeat sequences. Among 2,638 repeat sequences, there are 330 amplifiable microsatellites. This BAC library provides a new resource for Lamiaceae genomic studies, including microsatellite marker development, physical mapping, comparative genomics and genome sequencing. Characterization of positive clones provided insights into the structure of the Salvia genome. These sequences will be used in the assembly of a future genome sequence for S. officinalis. (author)

  19. A comparison of parallel pyrosequencing and sanger clone-based sequencing and its impact on the characterization of the genetic diversity of HIV-1.

    Directory of Open Access Journals (Sweden)

    Binhua Liang

    Full Text Available BACKGROUND: Pyrosequencing technology has the potential to rapidly sequence HIV-1 viral quasispecies without requiring the traditional approach of cloning. In this study, we investigated the utility of ultra-deep pyrosequencing to characterize genetic diversity of the HIV-1 gag quasispecies and assessed the possible contribution of pyrosequencing technology in studying HIV-1 biology and evolution. METHODOLOGY/PRINCIPAL FINDINGS: HIV-1 gag gene was amplified from 96 patients using nested PCR. The PCR products were cloned and sequenced using capillary based Sanger fluorescent dideoxy termination sequencing. The same PCR products were also directly sequenced using the 454 pyrosequencing technology. The two sequencing methods were evaluated for their ability to characterize quasispecies variation, and to reveal sites under host immune pressure for their putative functional significance. A total of 14,034 variations were identified by 454 pyrosequencing versus 3,632 variations by Sanger clone-based (SCB sequencing. 11,050 of these variations were detected only by pyrosequencing. These undetected variations were located in the HIV-1 Gag region which is known to contain putative cytotoxic T lymphocyte (CTL and neutralizing antibody epitopes, and sites related to virus assembly and packaging. Analysis of the positively selected sites derived by the two sequencing methods identified several differences. All of them were located within the CTL epitope regions. CONCLUSIONS/SIGNIFICANCE: Ultra-deep pyrosequencing has proven to be a powerful tool for characterization of HIV-1 genetic diversity with enhanced sensitivity, efficiency, and accuracy. It also improved reliability of downstream evolutionary and functional analysis of HIV-1 quasispecies.

  20. Complete genome sequence of community-associated methicillin-resistant Staphylococcus aureus (strain USA400-0051, a prototype of the USA400 clone

    Directory of Open Access Journals (Sweden)

    Marina Farrel Côrtes

    Full Text Available Staphylococcus aureus subsp. aureus, commonly referred as S. aureus, is an important bacterial pathogen frequently involved in hospital- and community-acquired infections in humans, ranging from skin infections to more severe diseases such as pneumonia, bacteraemia, endocarditis, osteomyelitis, and disseminated infections. Here, we report the complete closed genome sequence of a community-acquired methicillin-resistant S. aureus strain, USA400-0051, which is a prototype of the USA400 clone.

  1. The draft genome sequence of multidrug-resistant Pseudomonas aeruginosa strain CCBH4851, a nosocomial isolate belonging to clone SP (ST277 that is prevalent in Brazil

    Directory of Open Access Journals (Sweden)

    Melise Silveira

    2014-12-01

    Full Text Available The high occurrence of nosocomial multidrug-resistant (MDR microorganisms is considered a global health problem. Here, we report the draft genome sequence of a MDR Pseudomonas aeruginosa strain isolated in Brazil that belongs to the endemic clone ST277. The genome encodes important resistance determinant genes and consists of 6.7 Mb with a G+C content of 66.86% and 6,347 predicted coding regions including 60 RNAs.

  2. Complete nucleotide sequence and genome analysis of bacteriophage BFK20 — A lytic phage of the industrial producer Brevibacterium flavum

    Czech Academy of Sciences Publication Activity Database

    Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.

    2006-01-01

    Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006

  3. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  4. Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

    Science.gov (United States)

    Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

    1989-12-21

    The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Cloning and Sequence Analysis of the Amylase Gene from the Rice Pest Walker and its Inhibitor from Wheat (Variety MP Sehore

    Directory of Open Access Journals (Sweden)

    Poonam Sharma

    2009-01-01

    Full Text Available Scirpophaga incertulas Walker (Lepidoptera: Pyralideae, commonly known as yellow stem borer, is a predominant monophagous pest of rice, which causes 5% to 30% loss of the rice crop. We report for the first time, the cloning and sequence analysis of the amylase gene of this pest. The cloned gene translates into a protein of 487 amino acids having a predicted molecular weight of 54,955 daltons and a theoretical pI of 5.9. The 3D structure of the amylase is predicted from its amino acid sequence by homology modeling using the structure of the amylase from Tenebrio molitor L (Coleoptera: Tenebrionidae. We also report the purification of a dimeric α-amylase inhibitor from a local variety of wheat MP Sehore that is specific for the amylase of this pest and does not inhibit human salivary amylase or porcine pancreatic amylase. The gene encoding this inhibitor has been cloned and its sequence has been analysed to find a possible explanation for this specificity.

  6. Molecular study and nucleotide sequencing of Chlamydia abortus isolated from aborted sheep fetuses ewes of Alborz province

    Directory of Open Access Journals (Sweden)

    amirreza ebadi

    2015-02-01

    Full Text Available Chlamydia is an obligate intracellular and gram negative coccobacilli and one of the most important causes of abortion in ruminants especially in ewes. This investigation was performed with the purpose of molecular study and sequencing of Chlamydia abortus isolated from aborted sheep fetuses of Alborz Province. In this study, DNA extraction was performed on 100 samples from aborted fetuses of 32 sheep flocks from different areas of Alborz province. Then using specific primers of gene IGS-Sr- RNA, polymerase chain reaction was conducted and 10 samples were selected randomly from the positive cases were sent to Macrogene company in Korea for sequencing. In this study, 37 samples from a total of 100 aborted fetuses were positive for Chlamydia abortus. After sequencing, more than 99 percent of the positive samples were similar with sequences in gene bank. The sequencing results indicated that the samples were very similar to isolates LN554882/1, AF051935/1 and CR848038/1 of the gene bank and were in the same cluster. Also, this investigation indicated that Chlamydia abortus is one of the main reasons of ewe abortion in Alborz province.

  7. Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

    Science.gov (United States)

    Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

    2004-09-22

    Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

  8. Striking structural dynamism and nucleotide sequence variation of the transposon Galileo in the genome of Drosophila mojavensis.

    Science.gov (United States)

    Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo

    2013-02-04

    Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.

  9. Molecular cloning of cellulase genes from indigenous bacterial isolates

    International Nuclear Information System (INIS)

    Jong Bor Chyan; Pauline Liew Woan Ying; Mat Rasol Awang

    2006-01-01

    Indigenous cellulolytic bacterial isolates having high activities in degrading carboxymethyl cellulose (CMC) were isolated from local environments. Identification of these isolates were performed by molecular techniques. By using polymerase chain reaction (PCR) techniques, PCR products encoding cellulase gene were amplified from the total genomic DNAs. Purified PCR product was successfully cloned and expressed in Escherichia coli host system. The complete nucleotide sequences of the cellulase genes determined. The analysis of amino acid sequences deduced from the genes indicated that the cloned DNA fragments show high homology to those of endoglucanase genes of family GH5. All cloned genes consist of an N-terminal signal peptide, a catalytic domain of family 5 glycosyl hydrolase and a cellulose-binding domain of family III. (Author)

  10. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  11. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

    Science.gov (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A

    2017-08-01

    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  12. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  13. Two-step processing for activation of the cytolysin/hemolysin of Vibrio cholerae O1 biotype El Tor: nucleotide sequence of the structural gene (hlyA) and characterization of the processed products.

    Science.gov (United States)

    Yamamoto, K; Ichinose, Y; Shinagawa, H; Makino, K; Nakata, A; Iwanaga, M; Honda, T; Miwatani, T

    1990-12-01

    Vibrio cholerae O1 biotype El Tor produces and secretes a 65-kDa cytolysin/hemolysin into the culture medium. We cloned the structural gene (hlyA) for the cytolysin from the total DNA of a V. cholerae O1 El Tor strain, N86. Nucleotide sequence analysis of hlyA revealed an open reading frame consisting of 2,223 bp which can code for a protein of 741 amino acids with a molecular weight of 81,961. Consistent with this, a 79-kDa protein was identified as the product of hlyA by maxicell analysis in Escherichia coli. N-terminal amino acids of this 79-kDa HlyA protein and those of a 65-kDa El Tor cytolysin purified from V. cholerae were Asn-26 and Asn-158, respectively. The 82- and 79-kDa precursors of the 65-kDa mature cytolysin were found in V. cholerae by pulse-chase labeling and Western blot (immunoblot) analysis of hlyA products. Hemolytic activity of the 79-kDa HlyA protein from E. coli was less than 5% that for the 65-kDa cytolysin from V. cholerae. Our results suggest that in V. cholerae, the 82-kDa preprotoxin synthesized in the cytoplasm is secreted through the membranes into the culture medium as the 79-kDa inactive protoxin after cleavage of the signal peptide and is then further processed into the 65-kDa active cytolysin by release of the N-terminal 15-kDa fragment.

  14. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  16. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  17. Cloning of the ω-secalin gene family in a wheat 1BL/1RS translocation line using BAC clone sequencing

    Directory of Open Access Journals (Sweden)

    Meng Jun Li

    2016-05-01

    Conclusion: The ω-secalin gene family consisted of at least 18 members in the 1BL/1RS translocation line cv. Shimai 15. Eight ω-secalin genes were expressed during seed development. Eighteen members may originate from a progenitor with a 1,074-bp ORF. The spacers differed in length and sequence conservation.

  18. The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

    2008-09-01

    A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

  19. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    Science.gov (United States)

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  20. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  1. The influence of selection on the evolutionary distance estimated from the base changes observed between homologous nucleotide sequences.

    Science.gov (United States)

    Otsuka, J; Kawai, Y; Sugaya, N

    2001-11-21

    In most studies of molecular evolution, the nucleotide base at a site is assumed to change with the apparent rate under functional constraint, and the comparison of base changes between homologous genes is thought to yield the evolutionary distance corresponding to the site-average change rate multiplied by the divergence time. However, this view is not sufficiently successful in estimating the divergence time of species, but mostly results in the construction of tree topology without a time-scale. In the present paper, this problem is investigated theoretically by considering that observed base changes are the results of comparing the survivals through selection of mutated bases. In the case of weak selection, the time course of base changes due to mutation and selection can be obtained analytically, leading to a theoretical equation showing how the selection has influence on the evolutionary distance estimated from the enumeration of base changes. This result provides a new method for estimating the divergence time more accurately from the observed base changes by evaluating both the strength of selection and the mutation rate. The validity of this method is verified by analysing the base changes observed at the third codon positions of amino acid residues with four-fold codon degeneracy in the protein genes of mammalian mitochondria; i.e. the ratios of estimated divergence times are fairly well consistent with a series of fossil records of mammals. Throughout this analysis, it is also suggested that the mutation rates in mitochondrial genomes are almost the same in different lineages of mammals and that the lineage-specific base-change rates indicated previously are due to the selection probably arising from the preference of transfer RNAs to codons.

  2. Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species.

    Science.gov (United States)

    Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H

    2002-01-01

    Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions

  3. TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

    Science.gov (United States)

    Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

    2016-10-01

    As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

  4. The soybean-Phytophthora resistance locus Rps1-k encompasses coiled coil-nucleotide binding-leucine rich repeat-like genes and repetitive sequences

    Directory of Open Access Journals (Sweden)

    Bhattacharyya Madan K

    2008-03-01

    Full Text Available Abstract Background A series of Rps (resistance to Pytophthora sojae genes have been protecting soybean from the root and stem rot disease caused by the Oomycete pathogen, Phytophthora sojae. Five Rps genes were mapped to the Rps1 locus located near the 28 cM map position on molecular linkage group N of the composite genetic soybean map. Among these five genes, Rps1-k was introgressed from the cultivar, Kingwa. Rps1-k has been providing stable and broad-spectrum Phytophthora resistance in the major soybean-producing regions of the United States. Rps1-k has been mapped and isolated. More than one functional Rps1-k gene was identified from the Rps1-k locus. The clustering feature at the Rps1-k locus might have facilitated the expansion of Rps1-k gene numbers and the generation of new recognition specificities. The Rps1-k region was sequenced to understand the possible evolutionary steps that shaped the generation of Phytophthora resistance genes in soybean. Results Here the analyses of sequences of three overlapping BAC clones containing the 184,111 bp Rps1-k region are reported. A shotgun sequencing strategy was applied in sequencing the BAC contig. Sequence analysis predicted a few full-length genes including two Rps1-k genes, Rps1-k-1 and Rps1-k-2. Previously reported Rps1-k-3 from this genomic region 1 was evolved through intramolecular recombination between Rps1-k-1 and Rps1-k-2 in Escherichia coli. The majority of the predicted genes are truncated and therefore most likely they are nonfunctional. A member of a highly abundant retroelement, SIRE1, was identified from the Rps1-k region. The Rps1-k region is primarily composed of repetitive sequences. Sixteen simple repeat and 63 tandem repeat sequences were identified from the locus. Conclusion These data indicate that the Rps1 locus is located in a gene-poor region. The abundance of repetitive sequences in the Rps1-k region suggested that the location of this locus is in or near a

  5. Meta-analysis of sequence-based association studies across three cattle breeds reveals 25 QTL for fat and protein percentages in milk at nucleotide resolution.

    Science.gov (United States)

    Pausch, Hubert; Emmerling, Reiner; Gredler-Grandl, Birgit; Fries, Ruedi; Daetwyler, Hans D; Goddard, Michael E

    2017-11-09

    Genotyping and whole-genome sequencing data have been generated for hundreds of thousands of cattle. International consortia used these data to compile imputation reference panels that facilitate the imputation of sequence variant genotypes for animals that have been genotyped using dense microarrays. Association studies with imputed sequence variant genotypes allow for the characterization of quantitative trait loci (QTL) at nucleotide resolution particularly when individuals from several breeds are included in the mapping populations. We imputed genotypes for 28 million sequence variants in 17,229 cattle of the Braunvieh, Fleckvieh and Holstein breeds in order to compile large mapping populations that provide high power to identify QTL for milk production traits. Association tests between imputed sequence variant genotypes and fat and protein percentages in milk uncovered between six and thirteen QTL (P < 1e-8) per breed. Eight of the detected QTL were significant in more than one breed. We combined the results across breeds using meta-analysis and identified a total of 25 QTL including six that were not significant in the within-breed association studies. Two missense mutations in the ABCG2 (p.Y581S, rs43702337, P = 4.3e-34) and GHR (p.F279Y, rs385640152, P = 1.6e-74) genes were the top variants at QTL on chromosomes 6 and 20. Another known causal missense mutation in the DGAT1 gene (p.A232K, rs109326954, P = 8.4e-1436) was the second top variant at a QTL on chromosome 14 but its allelic substitution effects were inconsistent across breeds. It turned out that the conflicting allelic substitution effects resulted from flaws in the imputed genotypes due to the use of a multi-breed reference population for genotype imputation. Many QTL for milk production traits segregate across breeds and across-breed meta-analysis has greater power to detect such QTL than within-breed association testing. Association testing between imputed sequence variant genotypes and

  6. Single-nucleotide variant in multiple copies of a deleted in azoospermia (DAZ) sequence - a human Y chromosome quantitative polymorphism.

    Science.gov (United States)

    Szmulewicz, Martin N; Ruiz, Luis M; Reategui, Erika P; Hussini, Saeed; Herrera, Rene J

    2002-01-01

    The evolution of the deleted in azoospermia (DAZ) gene family supports prevalent theories on the origin and development of sex chromosomes and sexual dimorphism. The ancestral DAZL gene in human chromosome 3 is known to be involved in germline development of both males and females. The available phylogenetic data suggest that some time after the divergence of the New World and Old World monkey lineages, the DAZL gene, which is found in all mammals, was copied to the Y chromosome of an ancestor to the Old World monkeys, but not New World monkeys. In modern man, the Y-linked DAZ gene complex is located on the distal part of the q arm. It is thought that after being copied to the Y chromosome, and after the divergence of the human and great ape lineages, the DAZ gene in the former underwent internal rearrangements. This included tandem duplications as well as a T > C transition altering an MboI restriction enzyme site in a duplicated sequence. In this study, we report on the ratios of MboI-/MboI+ variant sequences in individuals from seven worldwide human populations (Basque, Benin, Egypt, Formosa, Kungurtug, Oman and Rwanda) in the DAZ complex. The ratio of PCR MboI- and MboI+ amplicons can be used to characterize individuals and populations. Our results show a nonrandom distribution of MboI-/MboI+ sequence ratios in all populations examined, as well as significant differences in ratios between populations when compared pairwise. The multiple ratios imply that there have been more than one recent reorganization events at this locus. Considering the dynamic nature of this locus and its involvement in male fertility, we investigated the extent and distribution of this polymorphism. Copyright 2002 S. Karger AG, Basel

  7. Cloning and sequencing of Lol pI, the major allergenic protein of rye-grass pollen.

    Science.gov (United States)

    Griffith, I J; Smith, P M; Pollock, J; Theerakulpisut, P; Avjioglu, A; Davies, S; Hough, T; Singh, M B; Simpson, R J; Ward, L D

    1991-02-25

    We have isolated a full length cDNA clone encoding the major glycoprotein allergen Lol pI. The clone was selected using a combination of immunological screening of a cDNA expression library and PCR amplification of Lol pI-specific transcripts. Lol pI expressed in bacteria as a fusion protein shows recognition by specific IgE antibodies present in sera of grass pollen-allergic subjects. Northern analysis has shown that the Lol pI transcripts are expressed only in pollen of rye-grass. Molecular cloning of Lol pI provides a molecular genetic approach to study the structure-function relationship of allergens.

  8. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

    1991-01-01

    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

  9. Cloning of the human carnitine-acylcarnitine carrier cDNA and identification of the molecular defect in a patient

    NARCIS (Netherlands)

    Huizing, M.; Iacobazzi, V.; IJlst, L.; Savelkoul, P.; Ruitenbeek, W.; van den Heuvel, L.; Indiveri, C.; Smeitink, J.; Trijbels, F.; Wanders, R.; Palmieri, F.

    1997-01-01

    The carnitine-acylcarnitine carrier (CAC) catalyzes the translocation of long-chain fatty acids across the inner mitochondrial membrane. We cloned and sequenced the human CAC cDNA, which has an open reading frame of 903 nucleotides. Northern blot studies revealed different expression levels of CAC

  10. PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen

    Science.gov (United States)

    Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.

    2004-01-01

    A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853

  11. Characterisation of purified parvalbumin from five fish species and nucleotide sequencing of this major allergen from Pacific pilchard, Sardinops sagax.

    Science.gov (United States)

    Beale, Janine E; Jeebhay, Mohamed F; Lopata, Andreas L

    2009-09-01

    IgE-mediated allergic reaction to seafood is a common cause of food allergy including anaphylactic reactions. Parvalbumin, the major fish allergen, has been shown to display IgE cross-reactivity among fish species consumed predominantly in Europe and the Far East. However, cross-reactivity studies of parvalbumin from fish species widely consumed in the Southern hemisphere are limited as is data relating to immunological and molecular characterisation. In this study, antigenic cross-reactivity and the presence of oligomers and isomers of parvalbumin from five highly consumed fish species in Southern Africa were assessed by immunoblotting using purified parvalbumin and crude fish extracts. Pilchard (Sardinops sagax) parvalbumin was found to display the strongest IgE reactivity among 10 fish-allergic consumers. The cDNA sequence of the beta-form of pilchard parvalbumin was determined and designated Sar sa 1.0101 (accession number FM177701 EMBL/GenBank/DDBJ databases). Oligomeric forms of parvalbumin were observed in all fish species using a monoclonal anti-parvalbumin antibody and subject's sera. Isoforms varied between approximately 10-13 kDa. A highly cross-reactive allergenic isoform of parvalbumin was identified and sequenced, providing a successful primary step towards the generation of a recombinant form that could be used for diagnostic and potential therapeutic use in allergic individuals.

  12. The Arsenic Resistance-Associated Listeria Genomic Island LGI2 Exhibits Sequence and Integration Site Diversity and a Propensity for Three Listeria monocytogenes Clones with Enhanced Virulence.

    Science.gov (United States)

    Lee, Sangmi; Ward, Todd J; Jima, Dereje D; Parsons, Cameron; Kathariou, Sophia

    2017-11-01

    In the foodborne pathogen Listeria monocytogenes , arsenic resistance is encountered primarily in serotype 4b clones considered to have enhanced virulence and is associated with an arsenic resistance gene cluster within a 35-kb chromosomal region, Listeria genomic island 2 (LGI2). LGI2 was first identified in strain Scott A and includes genes putatively involved in arsenic and cadmium resistance, DNA integration, conjugation, and pathogenicity. However, the genomic localization and sequence content of LGI2 remain poorly characterized. Here we investigated 85 arsenic-resistant L. monocytogenes strains, mostly of serotype 4b. All but one of the 70 serotype 4b strains belonged to clonal complex 1 (CC1), CC2, and CC4, three major clones associated with enhanced virulence. PCR analysis suggested that 53 strains (62.4%) harbored an island highly similar to LGI2 of Scott A, frequently (42/53) in the same location as Scott A ( LMOf2365_2257 homolog). Random-primed PCR and whole-genome sequencing revealed seven novel insertion sites, mostly internal to chromosomal coding sequences, among strains harboring LGI2 outside the LMOf2365_2257 homolog. Interestingly, many CC1 strains harbored a noticeably diversified LGI2 (LGI2-1) in a unique location ( LMOf2365_0902 homolog) and with a novel additional gene. With few exceptions, the tested LGI2 genes were not detected in arsenic-resistant strains of serogroup 1/2, which instead often harbored a Tn 554 -associated arsenic resistance determinant not encountered in serotype 4b. These findings indicate that in L. monocytogenes , LGI2 has a propensity for certain serotype 4b clones, exhibits content diversity, and is highly promiscuous, suggesting an ability to mobilize various accessory genes into diverse chromosomal loci. IMPORTANCE Listeria monocytogenes is widely distributed in the environment and causes listeriosis, a foodborne disease with high mortality and morbidity. Arsenic and other heavy metals can powerfully shape the

  13. Molecular cloning, sequencing and structural studies of granulocyte-macrophage colony-stimulating factor (GM-CSF) from Indian water buffalo (Bubalus bubalis)

    KAUST Repository

    Sugumar, Thennarasu; Ganesan, Pugalenthi; Harishankar, Murugesan; Dhinakar Raj, Gopal

    2013-01-01

    Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine that is essential for growth and development of progenitors of granulocytes and monocytes/macrophages. In this study, we report molecular cloning, sequencing and characterization of GM-CSF from Indian water buffalo, Bubalus bubalis. In addition, we performed sequence and structural analysis for buffalo GM-CSF. Buffalo GM-CSF has been compared with 17 mammalian GM-CSFs using multiple sequence alignment and phylogenetic tree. Three-dimensional model for buffalo GM-CSF and human receptor complex was built using homology modelling to study cross-reactivity between two species. Detailed analysis was performed to study GM-CSF interface and various interactions at the interface. © 2013 John Wiley & Sons Ltd.

  14. Molecular cloning, sequencing and structural studies of granulocyte-macrophage colony-stimulating factor (GM-CSF) from Indian water buffalo (Bubalus bubalis)

    KAUST Repository

    Sugumar, Thennarasu

    2013-06-25

    Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine that is essential for growth and development of progenitors of granulocytes and monocytes/macrophages. In this study, we report molecular cloning, sequencing and characterization of GM-CSF from Indian water buffalo, Bubalus bubalis. In addition, we performed sequence and structural analysis for buffalo GM-CSF. Buffalo GM-CSF has been compared with 17 mammalian GM-CSFs using multiple sequence alignment and phylogenetic tree. Three-dimensional model for buffalo GM-CSF and human receptor complex was built using homology modelling to study cross-reactivity between two species. Detailed analysis was performed to study GM-CSF interface and various interactions at the interface. © 2013 John Wiley & Sons Ltd.

  15. Purification, enzymatic characterization, and nucleotide sequence of a high-isoelectric-point alpha-glucosidase from barley malt

    DEFF Research Database (Denmark)

    Frandsen, T P; Lok, F; Mirgorodskaya, E

    2000-01-01

    in the transition state complex. Mass spectrometry of tryptic fragments assigned the 92-kD protein to a barley cDNA (GenBank accession no. U22450) that appears to encode an alpha-glucosidase. A corresponding sequence (HvAgl97; GenBank accession no. AF118226) was isolated from a genomic phage library using a c......High-isoelectric-point (pI) alpha-glucosidase was purified 7, 300-fold from an extract of barley (Hordeum vulgare) malt by ammonium sulfate fractionation, ion-exchange, and butyl-Sepharose chromatography. The enzyme had high activity toward maltose (k(cat) = 25 s(-1)), with an optimum at pH 4...

  16. Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

    Science.gov (United States)

    Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

    2000-05-01

    We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

  17. Species delimitation of common reef corals in the genus Pocillopora using nucleotide sequence phylogenies, population genetics and symbiosis ecology.

    Science.gov (United States)

    Pinzón, Jorge H; LaJeunesse, Todd C

    2011-01-01

    Stony corals in the genus Pocillopora are among the most common and widely distributed of Indo-Pacific corals and, as such, are often the subject of physiological and ecological research. In the far Tropical Eastern Pacific (TEP), they are major constituents of shallow coral communities, exhibiting considerable variability in colony shape and branch morphology and marked differences in response to thermal stress. Numerous intermediates occur between morphospecies that may relate to extensive hybridization. The diversity of the Pocillopora genus in the TEP was analysed genetically using nuclear ribosomal (ITS2) and mitochondrial (ORF) sequences, and population genetic markers (seven microsatellite loci). The resident dinoflagellate endosymbiont (Symbiodinium sp.) in each sample was also characterized using sequences of the internal transcribed spacer 2 (ITS2) rDNA and the noncoding region of the chloroplast psbA minicircle. From these analyses, three symbiotically distinct, reproductively isolated, nonhybridizing, evolutionarily divergent animal lineages were identified. Designated types 1, 2 and 3, these groupings were incongruent with traditional morphospecies classification. Type 1 was abundant and widespread throughout the TEP; type 2 was restricted to the Clipperton Atoll; and type 3 was found only in Panama and the Galapagos Islands. Each type harboured a different Symbiodinium'species lineage' in Clade C, and only type 1 associated with the 'stress-tolerant'Symbiodinium glynni (D1). The accurate delineation of species and implementation of a proper taxonomy may profoundly improve our assessment of Pocillopora's reproductive biology, biogeographic distributions, and resilience to climate warming, information that must be considered when planning for the conservation of reef corals. © 2010 Blackwell Publishing Ltd.

  18. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  19. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  20. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  1. Genetic relatedness among indigenous rice varieties in the Eastern Himalayan region based on nucleotide sequences of the Waxy gene.

    Science.gov (United States)

    Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai

    2014-12-29

    Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.

  2. Characterization of the transcriptome, nucleotide sequence polymorphism, and natural selection in the desert adapted mouse Peromyscus eremicus

    Directory of Open Access Journals (Sweden)

    Matthew D. MacManes

    2014-10-01

    Full Text Available As a direct result of intense heat and aridity, deserts are thought to be among the most harsh of environments, particularly for their mammalian inhabitants. Given that osmoregulation can be challenging for these animals, with failure resulting in death, strong selection should be observed on genes related to the maintenance of water and solute balance. One such animal, Peromyscus eremicus, is native to the desert regions of the southwest United States and may live its entire life without oral fluid intake. As a first step toward understanding the genetics that underlie this phenotype, we present a characterization of the P. eremicus transcriptome. We assay four tissues (kidney, liver, brain, testes from a single individual and supplement this with population level renal transcriptome sequencing from 15 additional animals. We identified a set of transcripts undergoing both purifying and balancing selection based on estimates of Tajima’s D. In addition, we used the branch-site test to identify a transcript—Slc2a9, likely related to desert osmoregulation—undergoing enhanced selection in P. eremicus relative to a set of related non-desert rodents.

  3. Cloning and sequencing of wsp encoding gene fragments reveals a diversity of co-infecting Wolbachia strains in Acromyrmex leafcutter ants

    DEFF Research Database (Denmark)

    van Borm, S.; Wenseleers, T.; Billen, J.

    2003-01-01

    Acromyrmex insinuator hosted two additional infections. The multiple Wolbachia strains may influence the expression of reproductive conflicts in leafcutter ants, but the expected turnover of infections may make the cumulative effects on host ant reproduction complex. The additional Wolbachia infections......By sequencing part of the wsp gene of a series of clones, we detected an unusually high diversity of nine Wolbachia strains in queens of three species of leafcutter ants. Up to four strains co-occurred in a single ant. Most strains occurred in two clusters (InvA and InvB), but the social parasite...

  4. Molecular cloning and characterization of satellite DNA sequences from constitutive heterochromatin of the habu snake (Protobothrops flavoviridis, Viperidae) and the Burmese python (Python bivittatus, Pythonidae).

    Science.gov (United States)

    Matsubara, Kazumi; Uno, Yoshinobu; Srikulnath, Kornsorn; Seki, Risako; Nishida, Chizuko; Matsuda, Yoichi

    2015-12-01

    Highly repetitive DNA sequences of the centromeric heterochromatin provide valuable molecular cytogenetic markers for the investigation of genomic compartmentalization in the macrochromosomes and microchromosomes of sauropsids. Here, the relationship between centromeric heterochromatin and karyotype evolution was examined using cloned repetitive DNA sequences from two snake species, the habu snake (Protobothrops flavoviridis, Crotalinae, Viperidae) and Burmese python (Python bivittatus, Pythonidae). Three satellite DNA (stDNA) families were isolated from the heterochromatin of these snakes: 168-bp PFL-MspI from P. flavoviridis and 196-bp PBI-DdeI and 174-bp PBI-MspI from P. bivittatus. The PFL-MspI and PBI-DdeI sequences were localized to the centromeric regions of most chromosomes in the respective species, suggesting that the two sequences were the major components of the centromeric heterochromatin in these organisms. The PBI-MspI sequence was localized to the pericentromeric region of four chromosome pairs. The PFL-MspI and the PBI-DdeI sequences were conserved only in the genome of closely related species, Gloydius blomhoffii (Crotalinae) and Python molurus, respectively, although their locations on the chromosomes were slightly different. In contrast, the PBI-MspI sequence was also in the genomes of P. molurus and Boa constrictor (Boidae), and additionally localized to the centromeric regions of eight chromosome pairs in B. constrictor, suggesting that this sequence originated in the genome of a common ancestor of Pythonidae and Boidae, approximately 86 million years ago. The three stDNA sequences showed no genomic compartmentalization between the macrochromosomes and microchromosomes, suggesting that homogenization of the centromeric and/or pericentromeric stDNA sequences occurred in the macrochromosomes and microchromosomes of these snakes.

  5. Construction and characterization of the alpha form of a cardiac myosin heavy chain cDNA clone and its developmental expression in the Syrian hamster.

    OpenAIRE

    Liew, C C; Jandreski, M A

    1986-01-01

    A cDNA clone, pVHC1, was isolated from a Syrian hamster heart cDNA library and was compared to the rat alpha (pCMHC21) and beta (pCMHC5) ventricular myosin heavy chain cDNA clones. The DNA sequence and amino acid sequence deducted from the DNA show more homology with pCMHC21 than pCMHC5. This indicates that pVHC1 is an alpha ventricular myosin heavy chain cDNA clone. However, even though pVHC1 shows a high degree of nucleotide and amino acid conservation with the rat myosin heavy chain sequen...

  6. Detection and copy number estimation of the transgenic nucleotide sequences in an unknown GM event of Oryza sativa

    Directory of Open Access Journals (Sweden)

    Ali M. Sajjad

    2016-12-01

    Full Text Available The present study was designed to establish a qualitative detection method based on conventional and real time PCR assay to screen the commonly grown rice varieties for the presence of the cry1Ac gene. The detection of genetically modified rice in the screening process would necessitate accurate assay development and precise qualitative PCR tests complying with established procedures for the detection and characterization of transgenes in food grains. Such assay would not only enable the monitoring of transgene flow in local agricultural environment but also the characterization of different plant species produced with this transgene and its regulatory components. Thus, a reliable and quick screening assay was established for the qualitative detection of the transgene along with the promoter and selectable marker gene in genetically modified rice. By conventional PCR, a fragment of 215 bp was amplified with gene specific primers of cry1Ac. Primers for other transgenes such as gna and bar were also employed; however, no amplification was detected. The presence of the p35s, sps, and nptII genes was confirmed by qualitative real-time PCR. The specificity of the respective PCR products was checked through melt peak curve analysis. Sharp and precise melting temperatures indicated the presence of a single kind of PCR product in correspondence to each of the primers used. Moreover, the copy number of cry1Ac was estimated by ∆∆CT method. It is proposed that the primer sets and experimental conditions used in this study will be sufficient to meet the requirements for molecular detection and characterization of the cry1Ac transgene and affiliated sequences in sorting out conventional rice varieties from the ones which are genetically modified. It will also help to monitor the ecological flow of these transgenes and other biosafety factors.

  7. Molecular cloning of lupin leghemoglobin cDNA

    DEFF Research Database (Denmark)

    Konieczny, A; Jensen, E O; Marcker, K A

    1987-01-01

    Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

  8. Species-Level Phylogeny and Polyploid Relationships in Hordeum (Poaceae) Inferred by Next-Generation Sequencing and In Silico Cloning of Multiple Nuclear Loci.

    Science.gov (United States)

    Brassac, Jonathan; Blattner, Frank R

    2015-09-01

    Polyploidization is an important speciation mechanism in the barley genus Hordeum. To analyze evolutionary changes after allopolyploidization, knowledge of parental relationships is essential. One chloroplast and 12 nuclear single-copy loci were amplified by polymerase chain reaction (PCR) in all Hordeum plus six out-group species. Amplicons from each of 96 individuals were pooled, sheared, labeled with individual-specific barcodes and sequenced in a single run on a 454 platform. Reference sequences were obtained by cloning and Sanger sequencing of all loci for nine supplementary individuals. The 454 reads were assembled into contigs representing the 13 loci and, for polyploids, also homoeologues. Phylogenetic analyses were conducted for all loci separately and for a concatenated data matrix of all loci. For diploid taxa, a Bayesian concordance analysis and a coalescent-based dated species tree was inferred from all gene trees. Chloroplast matK was used to determine the maternal parent in allopolyploid taxa. The relative performance of different multilocus analyses in the presence of incomplete lineage sorting and hybridization was also assessed. The resulting multilocus phylogeny reveals for the first time species phylogeny and progenitor-derivative relationships of all di- and polyploid Hordeum taxa within a single analysis. Our study proves that it is possible to obtain a multilocus species-level phylogeny for di- and polyploid taxa by combining PCR with next-generation sequencing, without cloning and without creating a heavy load of sequence data. © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  9. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  10. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

    Science.gov (United States)

    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

    2014-11-01

    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  11. Molecular cloning of osteoma-inducing replication-competent murine leukemia viruses from the RFB osteoma virus stock

    DEFF Research Database (Denmark)

    Pedersen, Lene; Behnisch, Werner; Schmidt, Jörg

    1992-01-01

    We report the molecular cloning of two replication-competent osteoma-inducing murine leukemia viruses from the RFB osteoma virus stock (M. P. Finkel, C. A. Reilly, Jr., B. O. Biskis, and I. L. Greco, p. 353-366, in C. H. G. Price and F. G. M. Ross, ed., Bone--Certain Aspects of Neoplasia, 1973......). Like the original RFB osteoma virus stock, viruses derived from the molecular RFB clones induced multiple osteomas in mice of the CBA/Ca strain. The cloned RFB viruses were indistinguishable by restriction enzyme analysis and by nucleotide sequence analysis of their long-terminal-repeat regions...

  12. [Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

    Science.gov (United States)

    Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M

    2016-10-02

    Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic

  13. Multilocus Sequence Typing and Staphylococcal Protein A Typing Revealed Novel and Diverse Clones of Methicillin-Resistant Staphylococcus aureus in Seafood and the Aquatic Environment.

    Science.gov (United States)

    Murugadas, V; Toms, C Joseph; Reethu, Sara A; Lalitha, K V

    2017-03-01

    Methicillin-resistant Staphylococcus aureus (MRSA) has been a global health concern since the 1960s, and isolation of this pathogen from food-producing animals has been increasing. However, little information is available on the prevalence of MRSA and its clonal characteristics in seafood and the aquatic environment. In this study, 267 seafood and aquatic environment samples were collected from three districts of Kerala, India. Staphylococcal protein A (spa) typing and multilocus sequence typing (MLST) was performed for 65 MRSA strains isolated from 20 seafood and aquatic environment samples. The MRSA clonal profiles were t657-ST772, t002-ST5, t334-ST5, t311-ST5, t121-ST8, t186-ST88, t127-ST1, and two non-spa assignable strains. Whole spa gene sequence analysis along with MLST confirmed one strain as t711-ST6 and another as a novel MRSA clone identified for the first time in seafood and the aquatic environment with a t15669 spa type and a new MLST profile of ST420-256-236-66-82-411-477. The MRSA strains were clustered into five clonal complexes based on the goeBURST algorithm, indicating high diversity among MRSA strains in seafood and the aquatic environment. The novel clone formed a separate clonal complex with matches to three loci. This study recommends large-scale spa typing and MLST of MRSA isolates from seafood and the aquatic environment to determine the prevalence of new MRSA clones. This monitoring process can be useful for tracing local spread of MRSA isolates into the seafood production chain in a defined geographical area.

  14. Cloning, sequencing, and transgenic expression of Podospora curvicolla and Sordaria macrospora eEF1A genes: relationship between cytosolic translation and longevity in filamentous fungi.

    Science.gov (United States)

    Gagny, B; Rossignol, M; Silar, P

    1997-12-01

    We have cloned and sequenced the gene encoding the translation elongation factor eEF1A from two filamentous fungi, Podospora curvicolla and Sordaria macrospora. These fungi are close relatives of Podospora anserina and also show senescence syndromes. Comparison of the sequences of the deduced proteins with that of P. anserina reveals that the three proteins differ in several positions. Replacement of the P. anserina gene by either of the two exogenous genes does not entail any modification in P. anserina physiology; the longevity of the fungus is not affected. No alteration of in vivo translational accuracy was detected; however, the exogenous proteins nonetheless promoted a modification of the resistance to the aminoglycoside antibiotic paromomycin. These data suggest that optimization of life span between these closely related fungi has likely not been performed during evolution through modifications of eEF1A activity, despite the fact that mutations in this factor can drastically affect longevity. Copyright 1997 Academic Press.

  15. Cloning and sequencing of V genes from anti-osteosarcoma monoclonal antibodies TP-1 and TP-3: Location of lysine residues and implications for radiolabeling

    International Nuclear Information System (INIS)

    Olafsen, Tove; Bruland, Oeyvind S.; Zalutsky, Michael R.; Sandlie, Inger

    1995-01-01

    Monoclonal antibodies TP-1 and TP-3 are of potential utility for the radioimmunodiagnosis of osteosarcoma in both human and canine patients. The V genes of these antibodies were cloned and sequenced and to facilitate radiolabeling of these proteins, the location of the lysine residues within these sequences have been determined. The V-domains of TP-1 contain a total of 12 lysines, 10 in the framework region and 2 in the CDR region, while the V-domains of TP-3 contain a total of 14 lysines, 11 in the framework region and 3 in the CDR regions. Using space-filling models, the availability of each lysine residue for radiolabeling, and potential interference with antigen binding was predicted

  16. Cloning and sequencing of V genes from anti-osteosarcoma monoclonal antibodies TP-1 and TP-3: Location of lysine residues and implications for radiolabeling

    Energy Technology Data Exchange (ETDEWEB)

    Olafsen, Tove; Bruland, Oeyvind S.; Zalutsky, Michael R.; Sandlie, Inger

    1995-08-01

    Monoclonal antibodies TP-1 and TP-3 are of potential utility for the radioimmunodiagnosis of osteosarcoma in both human and canine patients. The V genes of these antibodies were cloned and sequenced and to facilitate radiolabeling of these proteins, the location of the lysine residues within these sequences have been determined. The V-domains of TP-1 contain a total of 12 lysines, 10 in the framework region and 2 in the CDR region, while the V-domains of TP-3 contain a total of 14 lysines, 11 in the framework region and 3 in the CDR regions. Using space-filling models, the availability of each lysine residue for radiolabeling, and potential interference with antigen binding was predicted.

  17. The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

    Science.gov (United States)

    Nallaseth, Ferez Soli

    The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1

  18. Molecular profiling of microbial communities from contaminated sources: Use of subtractive cloning methods and rDNA spacer sequences. 1998 annual progress report

    International Nuclear Information System (INIS)

    Robb, F.T.

    1998-01-01

    'The major objective of the research is to provide appropriate sequences and to assemble a high-density DNA array of oligonucleotides that can be used for rapid profiling of microbial populations from polluted areas. The sequences to be assigned to the DNA array are chosen from from cloned genomic DNA sequences (the ribosomal operon, described below) from groundwater at DOE sites containing organic solvents. The sites, Hanford Nuclear Plant and Lawrence Livermore Site 300, have well characterized pollutant histories, which have been provided by the collaborators. At this mid-point of the project, over 60 unique sequence classes of intergenic spacer region have been identified from the first sample site. The use of these sequences as hybridization probes, and their frequency of occurrence, allow a clear distinction between bacterial communities before and after remediation by acetate/nitrate pumping. The authors have developed the hybridization conditions for identifying PCR products in a 96 well format, a versatile alignment and visualization program (acronym: MALIGN) developed by Dr. Dennis Maeder, has been used to align the ISRs, which are variable in length and sometimes in position of the tRNAs. Finally, in collaboration with Dr. W. Chen and Dr. J. Zhou at ORNL, they have significant evidence that mass spectrometer analysis can be used to determine the lengths of PCR amplified intergenic spacer DNA.'

  19. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

    Science.gov (United States)

    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

    2010-07-01

    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  20. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  1. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  2. Molecular Comparison and Evolutionary Analyses of VP1 Nucleotide Sequences of New African Human Enterovirus 71 Isolates Reveal a Wide Genetic Diversity

    Science.gov (United States)

    Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel

    2014-01-01

    Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878

  3. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper.

    Science.gov (United States)

    Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun

    2018-01-01

    Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  4. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2018-01-01

    Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  5. Analysis of the Macaca mulatta transcriptome and the sequence divergence between Macaca and human.

    Science.gov (United States)

    Magness, Charles L; Fellin, P Campion; Thomas, Matthew J; Korth, Marcus J; Agy, Michael B; Proll, Sean C; Fitzgibbon, Matthew; Scherer, Christina A; Miner, Douglas G; Katze, Michael G; Iadonato, Shawn P

    2005-01-01

    We report the initial sequencing and comparative analysis of the Macaca mulatta transcriptome. Cloned sequences from 11 tissues, nine animals, and three species (M. mulatta, M. fascicularis, and M. nemestrina) were sampled, resulting in the generation of 48,642 sequence reads. These data represent an initial sampling of the putative rhesus orthologs for 6,216 human genes. Mean nucleotide diversity within M. mulatta and sequence divergence among M. fascicularis, M. nemestrina, and M. mulatta are also reported.

  6. What is Cloning?

    Science.gov (United States)

    Donate Home Cloning What is Cloning What is Cloning Clones are organisms that are exact genetic copies. ... clones made through modern cloning technologies. How Is Cloning Done? Many people first heard of cloning when ...

  7. Molecular Cloning and Nucleotide Sequence of the Gene Encoding the Major Peptidoglycan Hydrolase of Lactococcus lactis, a Muramidase Needed for Cell Separation

    NARCIS (Netherlands)

    Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.

    A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,

  8. Complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R

    1986-01-24

    The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.

  9. Molecular Cloning and Sequencing of AlkalophilicCellulosimicrobium cellulans CKMX1 Xylanase Gene Isolated from Mushroom Compost and Characterization of the Gene Product

    Directory of Open Access Journals (Sweden)

    Abhishek Walia

    2015-12-01

    Full Text Available ABSTRACT A xylanolytic bacterium was isolated from mushroom compost by using enrichment technique. Results from the metabolic fingerprinting, whole-cell fatty acids methyl ester analysis and 16S rDNA sequencing suggested the bacterium to be Cellulosimicrobium cellulans CKMX1. Due to the xylanolytic activity of this bacterium, isolation and characterization of the xylanase gene were attempted. A distinct fragment of about 1671 bp was successfully amplified using PCR and cloned into Escherichia coli DH5α. A BLAST search confirmed that the DNA sequence from the amplified fragment was endo-1, 4-beta-xylanase, which was a member of glycoside hydrolase family 11. It showed 98% homology withCellulosimicrobium sp. xylanase gene (Accession no. FJ859907.1 reported from the gut of Eisenia fetida in Korea. In silicophysico-chemical characterization of amino acid sequence of xylanase showed an open reading frame encoding a 556 amino acid sequence with a molecular weight of 58 kDa and theoretical isolectric point (pI of 4.46 was computed using Expasy's ProtParam server. Secondary and homology based 3D structure of xylanase was analysed using SOPMA and Swiss-Prot software.

  10. Cloning, sequence determination, and expression of the genes encoding the subunits of the nickel-containing 8-hydroxy-5-deazaflavin reducing hydrogenase from Methanobacterium thermoautotrophicum ΔH

    International Nuclear Information System (INIS)

    Alex, L.A.; Reeve, J.N.; Orme-Johnson, W.H.; Walsh, C.T.

    1990-01-01

    The genes frhA (1,217 bp), frhB (845 bp), and frhG (710 bp) encoding the three known subunits, α, β, and γ, of the 8-hydroxy-5-deazaflavin (F 420 ) reducing hydrogenase (FRH) from the thermophilic methanogen Methanobacterium thermoautotrophicum ΔH have been cloned, sequenced, and shown to be tightly linked, indicative of a single transcriptional unit. The DNA sequence contains a fourth open reading frame, designated frhD (476 bp), encoding a polypeptide (δ) that does not copurify with the active enzyme. Expression of the frh gene cluster in Escherichia coli shows that four polypeptides are synthesized. When analyzed by SDS-PAGE, the proteins migrate with mobilities consistent with their calculated molecular weights. In order to understand the mechanism of H 2 oxidation by this enzyme, localization of redox cofactors (Ni, Fe/S, FAD) to specific subunits and information on their structure is needed. This has been hindered due to the refractory nature of the enzyme to denaturation methods needed in order to obtain individual subunits with cofactors intact. In this paper they discuss the possible localization of the redox cofactors as implicated from the DNA-derived protein sequences of the subunits. The amino acid sequences of the subunits of the FRH are compared with those of other Ni-containing hydrogenases, including the methyl viologen reducing hydrogenase (MVH) of M. thermoautotrophicum ΔH

  11. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning

    Science.gov (United States)

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  12. An efficient and high fidelity method for amplification, cloning and sequencing of complete tospovirus genomic RNA segments

    Science.gov (United States)

    Amplification and sequencing of the complete M- and S-RNA segments of Tomato spotted wilt virus and Impatiens necrotic spot virus as a single fragment is useful for whole genome sequencing of tospoviruses co-infecting a single host plant. It avoids issues associated with overlapping amplicon-based ...

  13. Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the Dystrophin gene detected by direct sequencing

    Directory of Open Access Journals (Sweden)

    Corti Stefania

    2011-03-01

    Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects

  14. Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide sequences and antigenicity of recombinant proteins of VP1s and VP4s

    Directory of Open Access Journals (Sweden)

    Sun Yu

    2011-11-01

    Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.

  15. Characterization of the env gene and long terminal repeat of molecularly cloned Friend mink cell focus-inducing virus DNA.

    OpenAIRE

    Adachi, A; Sakai, K; Kitamura, N; Nakanishi, S; Niwa, O; Matsuyama, M; Ishimoto, A

    1984-01-01

    The highly oncogenic erythroleukemia-inducing Friend mink cell focus-inducing (MCF) virus was molecularly cloned in phage lambda gtWES.lambda B, and the DNA sequences of the env gene and the long terminal repeat were determined. The nucleotide sequences of Friend MCF virus and Friend spleen focus-forming virus were quite homologous, supporting the hypothesis that Friend spleen focus-forming virus might be generated via Friend MCF virus from an ecotropic Friend virus mainly by some deletions. ...

  16. Sequence variations in the FAD2 gene in seeded pumpkins.

    Science.gov (United States)

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  17. Whitefly (Bemisia tabaci genome project: analysis of sequenced clones from egg, instar, and adult (viruliferous and non-viruliferous cDNA libraries

    Directory of Open Access Journals (Sweden)

    Czosnek Henryk

    2006-04-01

    Full Text Available Abstract Background The past three decades have witnessed a dramatic increase in interest in the whitefly Bemisia tabaci, owing to its nature as a taxonomically cryptic species, the damage it causes to a large number of herbaceous plants because of its specialized feeding in the phloem, and to its ability to serve as a vector of plant viruses. Among the most important plant viruses to be transmitted by B. tabaci are those in the genus Begomovirus (family, Geminiviridae. Surprisingly, little is known about the genome of this whitefly. The haploid genome size for male B. tabaci has been estimated to be approximately one billion bp by flow cytometry analysis, about five times the size of the fruitfly Drosophila melanogaster. The genes involved in whitefly development, in host range plasticity, and in begomovirus vector specificity and competency, are unknown. Results To address this general shortage of genomic sequence information, we have constructed three cDNA libraries from non-viruliferous whiteflies (eggs, immature instars, and adults and two from adult insects that fed on tomato plants infected by two geminiviruses: Tomato yellow leaf curl virus (TYLCV and Tomato mottle virus (ToMoV. In total, the sequence of 18,976 clones was determined. After quality control, and removal of 5,542 clones of mitochondrial origin 9,110 sequences remained which included 3,843 singletons and 1,017 contigs. Comparisons with public databases indicated that the libraries contained genes involved in cellular and developmental processes. In addition, approximately 1,000 bases aligned with the genome of the B. tabaci endosymbiotic bacterium Candidatus Portiera aleyrodidarum, originating primarily from the egg and instar libraries. Apart from the mitochondrial sequences, the longest and most abundant sequence encodes vitellogenin, which originated from whitefly adult libraries, indicating that much of the gene expression in this insect is directed toward the production

  18. Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

    DEFF Research Database (Denmark)

    Vorum, H; Liu, X; Madsen, Peder

    1998-01-01

    By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

  19. Human terminal deoxyribonucleotidyltransferase: molecular cloning and structural analysis of the gene and 5' flanking region

    International Nuclear Information System (INIS)

    Riley, L.K.; Morrow, J.K.; Danton, M.J.; Coleman, M.S.

    1988-01-01

    Human terminal deoxyribonucleotidyltransferase cDNA contains an open reading frame of 1530 base pairs (bp) corresponding to a protein containing 510 amino acids. The encoded protein is a template-independent DNA polymerase found only in a restricted population of normal and malignant prelymphocytes. To begin to investigate the genetic elements responsible for the tissue-specific expression of terminal deoxyribonucleotidyltransferase, genomic clones, containing the entire human gene were isolated and characterized. Initially, cDNA clones were isolated from a library generated from the human lymphoblastoid cell line, MOLT-4R. A cDNA clone containing the entire coding region of the protein was used to isolate a series of overlapping clones from two human genomic libraries. The gene comprises 11 exons and 10 introns and spans 49.4 kilobases. The 5' flanking region (709 bp) including exon 1 was sequenced. Several putative transcription initiation sites were mapped. Within 500 nucleotides of the translation start site, a series of promoter elements was detected. TATA and CAAT sequences, respectively, were found to start at nucleotides -185 and -204, -328 and -370, and -465 and -505. Start sites were found for a cyclic AMP-dependent promoter analog at nucleotide -121, an eight-base sequence corresponding to the IgG promoter enhancer (cd) at nucleotide -455, and an analog of the IgG promoter (pd) at nucleotide -159. These findings suggest that transcripts coding for terminal deoxyribonucleotidyltransferase may be variable in length and that transcription may be influenced by a variety of genetic elements

  20. A newly constructed primer pair for the PCR amplification, cloning and sequencing of the flagellin (flaA) gene from isolatesof urease-negative Campylobacter lari.

    Science.gov (United States)

    Sekizuka, Tsuyoshi; Yokoi, Taeko; Murayama, Ohoshi; Millar, B Cherie; Moore, Johne; Matsuda, Motoo

    2005-08-01

    A newly constructed primer pair (lari-Af/lari-Ar) designed to generate a product of the flagellin (flaA) gene for urease-negative Campylobacter lari produced a PCR amplicon of about 1700 bp for 16 isolates from 7 seagulls, 5 humans, 3 food animals and one mussel in Japan and Northern Ireland. Nucleotide sequencing and alignments of the flaA amplicons from these isolates demonstrated that the deduced amino acid sequences of the possible open reading frame were 564-572 amino acid residues in length with calculated molecular weights of 58,804 to 59,463. The deduced amino acid sequence similarity analysis strongly suggested that the ORF of the flaA from the 16 isolates showed 70-75% sequence similarities to those of Campylobacter jejuni isolates. The approximate Mr of the flagellin purified from some of the isolates of urease-negative C. lari was estimated to range from 59.6 to 61.8 kDa. Thus, flagellin from the isolates of urease-negative C. lari was shown for the first time to have a molecular size similar to those of C. jejuni and Campylobacter coli isolates, but to be different from the shorter flaA and smaller flagellin of urease-positive thermophilic Campylobacter (UPTC) isolates. Flagellins from C. lari spp., consisting of the two representative taxa of urease-negative C. lari and UPTC, thus show genotypic and phenotypic diversity.

  1. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  2. Direct selection of expressed sequences on a YAC clone revealed proline-rich-like genes and BARE-1 sequences physically linked to the complex ¤Mla¤ powdery mildew resistance locus of barley (¤Hordeum vulgare¤ L.)

    DEFF Research Database (Denmark)

    Schwarz, G.; Michalek, W.; Jahoor, A.

    2002-01-01

    homology to the copia-like retroelement BA REI of barley, putatively involved in evolution of disease resistance loci. The high degree of clones representing barley rRNA sequences or false positives is a major disadvantage of direct selection of cDNAs in barley. (C) 2002 Elsevier Science Ireland Ltd. All...... gene. Of 22 selected cDNA clones, six were re-located on the YAC by southern analysis. Two of these clones are predicted to encode members of the hydroxyproline-rich glycoprotein and proline-rich protein gene families which have been implicated in plant defense response. Four sequences showed high...

  3. Characterization, gene cloning, and sequencing of a fungal phytase, PhyA, from Penicillium oxalicum PJ3.

    Science.gov (United States)

    Lee, Seung Ho; Cho, Jaiesoon; Bok, Jinduck; Kang, Seungha; Choi, Yunjaie; Lee, Peter C W

    2015-01-01

    A phytase from Penicillium oxalicum PJ3, PhyA, was purified near to homogeneity with 427-fold increase in specific phytase activity by ammonium sulfate precipitation, gel filtration, and ion-exchange chromatographies. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and zymogram analysis of the purified enzyme indicated an estimated molecular mass of 65 kD. The optimal pH and temperature of the purified enzyme were pH 4.5 and 55°C, respectively. The enzyme activity was strongly inhibited by Ca(2+), Cu(2+), Zn(2+), and phenylmethylsulfonyl fluoride (PMSF). The Km value for sodium phytate was 0.545 mM with a Vmax of 600 U/mg of protein. The phyA gene was cloned, and it contains an open reading frame of 1,383 with a single intron (118 bp), and encodes a protein of 461 amino acids.

  4. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  5. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  6. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Ciancio, A

    2004-03-01

    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

  7. [Cloning and sequence analysis of the DHBV genome of the brown ducks in Guilin region and establishment of the quantitative method for detecting DHBV].

    Science.gov (United States)

    Su, He-Ling; Huang, Ri-Dong; He, Song-Qing; Xu, Qing; Zhu, Hua; Mo, Zhi-Jing; Liu, Qing-Bo; Liu, Yong-Ming

    2013-03-01

    Brown ducks carrying DHBV were widely used as hepatitis B animal model in the research of the activity and toxicity of anti-HBV dugs. Studies showed that the ratio of DHBV carriers in the brown ducks in Guilin region was relatively high. Nevertheless, the characters of the DHBV genome of Guilin brown duck remain unknown. Here we report the cloning of the genome of Guilin brown duck DHBV and the sequence analysis of the genome. The full length of the DHBV genome of Guilin brown duck was 3 027bp. Analysis using ORF finder found that there was an ORF for an unknown peptide other than S-ORF, PORF and C-ORF in the genome of the DHBV. Vector NTI 8. 0 analysis revealed that the unknown peptide contained a motif which binded to HLA * 0201. Aligning with the DHBV sequences from different countries and regions indicated that there were no obvious differences of regional distribution among the sequences. A fluorescence quantitative PCR for detecting DHBV was establishment based on the recombinant plasmid pGEM-DHBV-S constructed. This study laid the groundwork for using Guilin brown duck as a hepatitis B animal model.

  8. Cloning and Characterization of an Outer Membrane Protein of Vibrio vulnificus Required for Heme Utilization: Regulation of Expression and Determination of the Gene Sequence

    Science.gov (United States)

    Litwin, Christine M.; Byrne, Burke L.

    1998-01-01

    Vibrio vulnificus is a halophilic, marine pathogen that has been associated with septicemia and serious wound infections in patients with iron overload and preexisting liver disease. For V. vulnificus, the ability to acquire iron from the host has been shown to correlate with virulence. V. vulnificus is able to use host iron sources such as hemoglobin and heme. We previously constructed a fur mutant of V. vulnificus which constitutively expresses at least two iron-regulated outer membrane proteins, of 72 and 77 kDa. The N-terminal amino acid sequence of the 77-kDa protein purified from the V. vulnificus fur mutant had 67% homology with the first 15 amino acids of the mature protein of the Vibrio cholerae heme receptor, HutA. In this report, we describe the cloning, DNA sequence, mutagenesis, and analysis of transcriptional regulation of the structural gene for HupA, the heme receptor of V. vulnificus. DNA sequencing of hupA demonstrated a single open reading frame of 712 amino acids that was 50% identical and 66% similar to the sequence of V. cholerae HutA and similar to those of other TonB-dependent outer membrane receptors. Primer extension analysis localized one promoter for the V. vulnificus hupA gene. Analysis of the promoter region of V. vulnificus hupA showed a sequence homologous to the consensus Fur box. Northern blot analysis showed that the transcript was strongly regulated by iron. An internal deletion in the V. vulnificus hupA gene, done by using marker exchange, resulted in the loss of expression of the 77-kDa protein and the loss of the ability to use hemin or hemoglobin as a source of iron. The hupA deletion mutant of V. vulnificus will be helpful in future studies of the role of heme iron in V. vulnificus pathogenesis. PMID:9632577

  9. Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis

    International Nuclear Information System (INIS)

    Kato, Nobuyuki; Hijikata, Makoto; Ootsuyama, Yuko; Nakagawa, Masanori; Ohkoshi, Showgo; Sugimura, Takashi; Shimotohno, Kunitada

    1990-01-01

    The nucleotide sequence of the Japanese type of hepatitis C virus (HCV-J) genome, consisting of 9413 nucleotides, was determined by analyses of cDNA clones from plasma specimens from Japanese patients with chronic hepatitis. HCV-J genome contains a long open reading frame that can encode a sequence of 3010 amino acid residues. Comparison of HCV-J with the American isolate of HCV showed 22.6% difference in nucleotide sequence and 15.1% difference in amino acid sequence. Thus HCV-J and the American isolate of HCV are probably different subtypes of HCV. The relationship of HCV-J with other animal RNA virus families and the putative organization of the HCV-J genome are discussed

  10. Two cloned β thalassemia genes are associated with amber mutations at codon 39

    Science.gov (United States)

    Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

    1981-01-01

    Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

  11. Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

    Directory of Open Access Journals (Sweden)

    Ritland Carol

    2009-08-01

    Full Text Available Abstract Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs and full-length (FLcDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR and a cytochrome P450 (CYP720B4 from a non-arrayed genomic BAC library of white spruce (Picea glauca. Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR and 94 kbp (CYP720B4 long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs, high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene

  12. Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

    Science.gov (United States)

    Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

    2009-08-06

    Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The

  13. Multilocus sequence typing and rtxA toxin gene sequencing analysis of Kingella kingae isolates demonstrates genetic diversity and international clones.

    Directory of Open Access Journals (Sweden)

    Romain Basmaci

    Full Text Available BACKGROUND: Kingella kingae, a normal component of the upper respiratory flora, is being increasingly recognized as an important invasive pathogen in young children. Genetic diversity of this species has not been studied. METHODS: We analyzed 103 strains from different countries and clinical origins by a new multilocus sequence-typing (MLST schema. Putative virulence gene rtxA, encoding an RTX toxin, was also sequenced, and experimental virulence of representative strains was assessed in a juvenile-rat model. RESULTS: Thirty-six sequence-types (ST and nine ST-complexes (STc were detected. The main STc 6, 14 and 23 comprised 23, 17 and 20 strains respectively, and were internationally distributed. rtxA sequencing results were mostly congruent with MLST, and showed horizontal transfer events. Of interest, all members of the distantly related ST-6 (n = 22 and ST-5 (n = 4 harboured a 33 bp duplication or triplication in their rtxA sequence, suggesting that this genetic trait arose through selective advantage. The animal model revealed significant differences in virulence among strains of the species. CONCLUSION: MLST analysis reveals international spread of ST-complexes and will help to decipher acquisition and evolution of virulence traits and diversity of pathogenicity among K. kingae strains, for which an experimental animal model is now available.

  14. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  15. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  16. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-01-01

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157