WorldWideScience

Sample records for clinical oncology k12

  1. American Society of Clinical Oncology

    Science.gov (United States)

    ... Media Policy Sponsor Policy Terms of Use American Society of Clinical Oncology Genitourinary Cancers Symposium Call for ... or cosponsored by ASCO View Event 13th Asian Society for Neuro-Oncology (ASNO) Meeting/9th COGNO Annual ...

  2. Topics in clinical oncology. 15

    International Nuclear Information System (INIS)

    The monograph comprising primarily papers on topical subjects of oncology and cancer research, contains also a selection of papers presented at the 2. Congress of the Czechoslovak Society of Nuclear Medicine and Radiation Hygiene. Seven papers were selected on behalf of their subject related to clinical oncology. All of them were iputted in INIS; five of them deal with the scintiscanning of the skeleton of cancer patients, one with radioimmunodetection of tumors, and one with radionuclide lymphography. (A.K.)

  3. Raman Spectroscopy for Clinical Oncology

    Directory of Open Access Journals (Sweden)

    Michael B. Fenn

    2011-01-01

    Full Text Available Cancer is one of the leading causes of death throughout the world. Advancements in early and improved diagnosis could help prevent a significant number of these deaths. Raman spectroscopy is a vibrational spectroscopic technique which has received considerable attention recently with regards to applications in clinical oncology. Raman spectroscopy has the potential not only to improve diagnosis of cancer but also to advance the treatment of cancer. A number of studies have investigated Raman spectroscopy for its potential to improve diagnosis and treatment of a wide variety of cancers. In this paper the most recent advances in dispersive Raman spectroscopy, which have demonstrated promising leads to real world application for clinical oncology are reviewed. The application of Raman spectroscopy to breast, brain, skin, cervical, gastrointestinal, oral, and lung cancers is reviewed as well as a special focus on the data analysis techniques, which have been employed in the studies.

  4. Radioimmunoimaging in clinical oncology

    International Nuclear Information System (INIS)

    In the thesis radiolabeled antibodies were tested for screening of cancer in patients without previous knowledge of tumour histopathology. They were tested as well targeting known cancer, sometimes in unknown clinical stage. Methods for detection enhancement utilizing double-tracer techniques and alternative routes of administration were also investigated. (385 refs., 11 tabs.)

  5. Introduction to veterinary clinical oncology

    Energy Technology Data Exchange (ETDEWEB)

    Weller, R.E.

    1991-10-01

    Veterinary clinical oncology involves a multidisciplinary approach to the recognition and management of spontaneously occurring neoplasms of domestic animals. This requires some knowledge of the causes, incidence, and natural course of malignant disease as it occurs in domestic species. The purpose of this course is to acquaint you with the more common neoplastic problems you will encounter in practice, so that you can offer your clients an informed opinion regarding prognosis and possible therapeutic modalities. A major thrust will be directed toward discussing and encouraging treatment/management of malignant disease. Multimodality therapy will be stressed. 10 refs., 3 tabs.

  6. Clinical Oncology Assistantship Program for Medical Students.

    Science.gov (United States)

    Neilan, Barbara A.; And Others

    1985-01-01

    The Clinical Oncology Assistantship Program at the University of Arkansas for Medical Sciences is described, along with student reactions to the program. The summer elective program involves cancer lectures (one week) and clinical exposure (nine weeks) in medical, surgical, and pediatric oncology services, as well as self-directed learning…

  7. American Society of Clinical Oncology Policy Statement on Clinical Pathways in Oncology.

    Science.gov (United States)

    Zon, Robin T; Frame, James N; Neuss, Michael N; Page, Ray D; Wollins, Dana S; Stranne, Steven; Bosserman, Linda D

    2016-03-01

    The use of clinical pathways in oncology care is increasingly important to patients and oncology providers as a tool for enhancing both quality and value. However, with increasing adoption of pathways into oncology practice, concerns have been raised by ASCO members and other stakeholders. These include the process being used for pathway development, the administrative burdens on oncology practices of reporting on pathway adherence, and understanding the true impact of pathway use on patient health outcomes. To address these concerns, ASCO's Board of Directors established a Task Force on Clinical Pathways, charged with articulating a set of recommendations to improve the development of oncology pathways and processes, allowing the demonstration of pathway concordance in a manner that promotes evidence-based, high-value care respecting input from patients, payers, and providers. These recommendations have been approved and adopted by ASCO's Board of Directors on August 12, 2015, and are presented herein. PMID:26759491

  8. Clinical oncology in resource-limited settings

    OpenAIRE

    Buonaguro, Franco M.; Gueye, Serigne N; Wabinga, Henry R; Ngoma, Twalib A.; Vermorken, Jan B; Mbulaiteye, Sam M

    2013-01-01

    Infectious Agents and Cancer is introducing a new section of Clinical Oncology with the main objective of stimulating debate through articles published in the section. Infectious diseases have been the major causes of morbidity and mortality in human populations, and have dominated the medical approach to clinical and public health. Successful efforts to control mortality from acute infections have paved the way for chronic, mostly indolent, infections to become major causes of morbidity. Can...

  9. Topics in clinical oncology. 14

    International Nuclear Information System (INIS)

    The symposium proceedings contain 39 papers. All papers were inputted in INIS. The subjects of the papers were the use of computers in radiotherapy planning, and clinical dosimetry, equipment and quality assurance, biological radiation effects and radiation protection problems in radiotherapy. (J.P.)

  10. Clinical oncology in Malaysia: 1914 to present

    OpenAIRE

    Lim, GCC

    2006-01-01

    A narration of the development of staff, infrastructure and buildings in the various parts of the country is given in this paper. The role of universities and other institutions of learning, public health, palliative care, nuclear medicine and cancer registries is described together with the networking that has been developed between the government, non-governmental organisations and private hospitals. The training of skilled manpower and the commencement of the Master of Clinical Oncology in...

  11. Penile Cancer: Clinical Practice Guidelines in Oncology

    OpenAIRE

    Clark, Peter E.; Philippe E. Spiess; Agarwal, Neeraj; Biagioli, Matthew C.; Eisenberger, Mario A.; Greenberg, Richard E.; Herr, Harry W.; Inman, Brant A.; Kuban, Deborah A.; Kuzel, Timothy M.; Lele, Subodh M.; Michalski, Jeff; Pagliaro, Lance; Pal, Sumanta K.; Patterson, Anthony

    2013-01-01

    Squamous cell carcinoma of the penis represents approximately 0.5% of all cancers among men in the United States and other developed countries. Although rare, it is associated with significant disfigurement, and only half of the patients survive beyond 5 years. Proper evaluation of both the primary lesion and lymph nodes is critical, because nodal involvement is the most important factor of survival. The NCCN Clinical Practice Guidelines in Oncology for Penile Cancer provide recommendations o...

  12. Clinical Oncology-A New Era

    Institute of Scientific and Technical Information of China (English)

    Biyun Qian; Dan Su; Herbert Yu

    2007-01-01

    Rapid growth in biomedical research coupled with dramatic advancement in biotechnology has significantly improved our understanding of the molecular basis involving cancer development and progression.This improvement has led to the discovery of new molecular markers for cancer diagnosis and prognosis as well as new molecular targets for cancer treatment and intervention.Continuous emergence of some new developing area in molecular profiling,new therapeutic agents,tissue microenvironment and systems biology have made significant progress in clinical oncology.Clinical research and investigation that focus on these new developments have begun to show exciting results that indicate future promises in improving patient management and survival.

  13. Clinical applications of PET in oncology.

    Science.gov (United States)

    Rohren, Eric M; Turkington, Timothy G; Coleman, R Edward

    2004-05-01

    Positron emission tomography (PET) provides metabolic information that has been documented to be useful in patient care. The properties of positron decay permit accurate imaging of the distribution of positron-emitting radiopharmaceuticals. The wide array of positron-emitting radiopharmaceuticals has been used to characterize multiple physiologic and pathologic states. PET is used for characterizing brain disorders such as Alzheimer disease and epilepsy and cardiac disorders such as coronary artery disease and myocardial viability. The neurologic and cardiac applications of PET are not covered in this review. The major utilization of PET clinically is in oncology and consists of imaging the distribution of fluorine 18 fluorodeoxyglucose (FDG). FDG, an analogue of glucose, accumulates in most tumors in a greater amount than it does in normal tissue. FDG PET is being used in diagnosis and follow-up of several malignancies, and the list of articles supporting its use continues to grow. In this review, the physics and instrumentation aspects of PET are described. Many of the clinical applications in oncology are mature and readily covered by third-party payers. Other applications are being used clinically but have not been as carefully evaluated in the literature, and these applications may not be covered by third-party payers. The developing applications of PET are included in this review. PMID:15044750

  14. A clinical intranet model for radiation oncology

    International Nuclear Information System (INIS)

    Purpose: A new paradigm in computing is being formulated from advances in client-server technology. This new way of accessing data in a network is referred to variously as Web-based computing, Internet computing, or Intranet computing. The difference between an internet and intranet being that the former is for global access and the later is only for intra-departmental access. Our purpose with this work is to develop a clinically useful radiation oncology intranet for accessing physically disparate data sources. Materials and Methods: We have developed an intranet client-server system using Windows-NT Server 4.0 running Internet Information Server (IIS) on the back-end and client PCs using a typical World Wide Web (WWW) browser. The clients also take advantage of the Microsoft Open Database Connectivity (ODBC) standard for accessing commercial database systems. The various data sources used include: a traditional Radiation Oncology Information (ROIS) System (VARiS 1.3tm); a 3-D treatment planning system (CAD Plantm); a beam scanning system (Wellhoffertm); as well as an electronic portal imaging device (PortalVisiontm) and a CT-Simulator providing digitally reconstructed radiographs (DRRs) (Picker AcQsimtm). We were able to leverage previously developed Microsoft Visual C++ applications without major re-writing of source code for this. Results: With the data sources and development materials used, we were able to develop a series of WWW-based clinical tool kits. The tool kits were designed to provide profession-specific clinical information. The physician's tool kit provides a treatment schedule for daily patients along with a dose summary from VARiS and the ability to review portal images and prescription images from the EPID and Picker. The physicists tool kit compares dose summaries from VARiS with an independent check against RTP beam data and serves as a quick 'chart-checker'. Finally, an administrator tool kit provides a summary of periodic charging

  15. Selenium in Oncology: From Chemistry to Clinics

    Directory of Open Access Journals (Sweden)

    Oliver Micke

    2009-10-01

    Full Text Available The essential trace element selenium, which is a crucial cofactor in the most important endogenous antioxidative systems of the human body, is attracting more and more the attention of both laypersons and expert groups. The interest of oncologists mainly focuses in the following clinical aspects: radioprotection of normal tissues, radiosensitizing in malignant tumors, antiedematous effect, prognostic impact of selenium, and effects in primary and secondary cancer prevention. Selenium is a constituent of the small group of selenocysteine-containing selenoproteins and elicits important structural and enzymatic functions. Selenium deficiency has been linked to increased infection risk and adverse mood states. It has been shown to possess cancer-preventive and cytoprotective activities in both animal models and humans. It is well established that Se has a key role in redox regulation and antioxidant function, and hence in membrane integrity, energy metabolism and protection against DNA damage. Recent clinical trials have shown the importance of selenium in clinical oncology. Our own clinical study involving 48 patients suggest that selenium has a positive effect on radiation-associated secondary lymphedema in patients with limb edemas, as well as in the head and neck region, including endolaryngeal edema. Another randomized phase III study of our group was performed to examine the cytoprotective properties of selenium in radiation oncology. The aim was to evaluate whether sodium selenite is able to compensate a preexisting selenium deficiency and to prevent radiation induced diarrhea in adjuvant radiotherapy for pelvic gynecologic malignancies. Through this study, the significant benefits of sodium selenite supplementation with regards to selenium deficiency and radiotherapy induced diarrhea in patients with cervical and uterine cancer has been shown for the first time in a prospective randomized trial. Survival data imply that supplementation with

  16. Selenium in oncology: from chemistry to clinics.

    Science.gov (United States)

    Micke, Oliver; Schomburg, Lutz; Buentzel, Jens; Kisters, Klaus; Muecke, Ralph

    2009-01-01

    The essential trace element selenium, which is a crucial cofactor in the most important endogenous antioxidative systems of the human body, is attracting more and more the attention of both laypersons and expert groups. The interest of oncologists mainly focuses in the following clinical aspects: radioprotection of normal tissues, radiosensitizing in malignant tumors, antiedematous effect, prognostic impact of selenium, and effects in primary and secondary cancer prevention. Selenium is a constituent of the small group of selenocysteine-containing selenoproteins and elicits important structural and enzymatic functions. Selenium deficiency has been linked to increased infection risk and adverse mood states. It has been shown to possess cancer-preventive and cytoprotective activities in both animal models and humans. It is well established that Se has a key role in redox regulation and antioxidant function, and hence in membrane integrity, energy metabolism and protection against DNA damage. Recent clinical trials have shown the importance of selenium in clinical oncology. Our own clinical study involving 48 patients suggest that selenium has a positive effect on radiation-associated secondary lymphedema in patients with limb edemas, as well as in the head and neck region, including endolaryngeal edema. Another randomized phase III study of our group was performed to examine the cytoprotective properties of selenium in radiation oncology. The aim was to evaluate whether sodium selenite is able to compensate a preexisting selenium deficiency and to prevent radiation induced diarrhea in adjuvant radiotherapy for pelvic gynecologic malignancies. Through this study, the significant benefits of sodium selenite supplementation with regards to selenium deficiency and radiotherapy induced diarrhea in patients with cervical and uterine cancer has been shown for the first time in a prospective randomized trial. Survival data imply that supplementation with selenium does not

  17. Clinical PET: changing the practice of oncology

    International Nuclear Information System (INIS)

    Until recently positron emission tomography (PET) has been largely confined to academic institutions with the capital and human resources to support this technologically advanced modality. More recently its utility in oncology has fuelled the wider dissemination of this modality into routine clinical practice. Small animal PET scanners allow tracers to be validated prior to use in human subjects. The Peter MacCallum Cancer Institute clinical PET program began operation in 1996 and since that time has grown to be the first Australian centre with 2 PET scanners, including the first combined PET/CT. Although the majority of the almost 10,000 studies performed in our facility have utilised FDG, new tracers are increasingly being used in clinical trials, particularly for therapeutic monitoring of novel chemotherapeutic agents. In establishing our facility we have sought to influence referral patterns to those situations where epidemiological and case control data suggest that conventional diagnostic algorithms currently fail us. This is particularly the case in situation where recognition of this failure leads to routine use of either a morbid procedure or treatment in an entire population of patients, even in the absence of abnormality after conventional staging. For example, CT scanning is recognised to have insufficient accuracy for staging the status of mediastinal lymph node spread of non-small cell lung cancer to determine operability. Accordingly, a large number of patients undergo mediastinoscopy and pathological sampling of lymph nodes. Other patients are subjected to futile open and close thoracotomies due to incorrect staging. FDG PET has convincingly been shown to be more accurate than CT for staging the mediastinum and in a recent randomised control trial was shown to significantly reduce unnecessary thoractomies. By trying to limit the use of PET to situations where a range of different management options are available depending on the true extent of

  18. Regulatory and clinical considerations for biosimilar oncology drugs

    Science.gov (United States)

    Bennett, Charles L; Chen, Brian; Hermanson, Terhi; Wyatt, Michael D; Schulz, Richard M; Georgantopoulos, Peter; Kessler, Samuel; Raisch, Dennis W; Qureshi, Zaina P; Lu, Z Kevin; Love, Bryan L; Noxon, Virginia; Bobolts, Laura; Armitage, Melissa; Bian, John; Ray, Paul; Ablin, Richard J; Hrushesky, William J; Macdougall, Iain C; Sartor, Oliver; Armitage, James O

    2015-01-01

    Biological oncology products are integral to cancer treatment, but their high costs pose challenges to patients, families, providers, and insurers. The introduction of biosimilar agents—molecules that are similar in structure, function, activity, immunogenicity, and safety to the original biological drugs—provide opportunities both to improve healthcare access and outcomes, and to reduce costs. Several international regulatory pathways have been developed to expedite entry of biosimilars into global marketplaces. The first wave of oncology biosimilar use was in Europe and India in 2007. Oncology biosimilars are now widely marketed in several countries in Europe, and in Australia, Japan, China, Russia, India, and South Korea. Their use is emerging worldwide, with the notable exception of the USA, where several regulatory and cost barriers to biosimilar approval exist. In this Review, we discuss oncology biosimilars and summarise their regulatory frameworks, clinical experiences, and safety concerns. PMID:25456378

  19. Evidence-based integrative medicine in clinical veterinary oncology.

    Science.gov (United States)

    Raditic, Donna M; Bartges, Joseph W

    2014-09-01

    Integrative medicine is the combined use of complementary and alternative medicine with conventional or traditional Western medicine systems. The demand for integrative veterinary medicine is growing, but evidence-based research on its efficacy is limited. In veterinary clinical oncology, such research could be translated to human medicine, because veterinary patients with spontaneous tumors are valuable translational models for human cancers. An overview of specific herbs, botanics, dietary supplements, and acupuncture evaluated in dogs, in vitro canine cells, and other relevant species both in vivo and in vitro is presented for their potential use as integrative therapies in veterinary clinical oncology. PMID:25174902

  20. Impact of radiation research on clinical trials in radiation oncology

    International Nuclear Information System (INIS)

    The authors present an outline review of the history of the formation of the cooperative group called International Clinical Trials in Radiation Oncology (ICTRO), and the following areas are briefly discussed together with some projections for the direction of clinical trials in radiation oncology into the 1990s:- radiosensitizers, radioprotectors, and their combination, drug-radiation interactions, dose/time/fractionation, hyperthermia, biological response modifiers and radiolabelled antibodies, high LET, particularly neutron therapy, large field irradiation and interoperative irradiation, research studies on specific sites. (U.K.)

  1. Clinical oncology - comparison of two-dimensional and three-dimensional acquisition in oncological patients

    International Nuclear Information System (INIS)

    Full text: The 3D acquisition mode presents the possibility of shorter scan times with decreased injection dose. In the present study, the clinical results in two-dimensional (2D) and three-dimensional (3D) acquisition mode were compared. We report our data of 3D PET imaging for clinical oncological patients using a Siemens ECAT Exact 47. 50 oncological patients were observed with F-18-FDG in a 2D whole body (WB) routine scan (5 or 6 bed positions). The 2D-FDG-PET studies are performed in 2D emission for 8 min and in 2D transmission for 2 min followed by one bedposition scan in 3D technique (5 min 3D emission scan and a 2 min transmission scan ) in a region with detected lesion. Both 2D and 3D data were reconstructed using iterative reconstruction (2 iterations with 8 subsets). A visual interpretation of contrast, identifiability, geometrical form and a quantitative evaluation (SUV and metabolic extension) was performed. No clinically relevant differences in detection of lesions between 2D and 3D mode were found by the qualitative and quantitative analysis. The contrast, geometrical form and the SUV compared side by side showed small differences. Based on this preliminary results, it seems that 3D technique is equal with 2D in clinical oncological PET with reduction in WB scan time. (author)

  2. Medical Oncology Pharmacy: A New Role for the Clinical Pharmacist

    Science.gov (United States)

    Morris, Carl R.; Hickman, Mary Johne

    1977-01-01

    The University of Tennessee has established a training program for clinical pharmacists dealing with cancer chemotherapy patients. Health-care settings are described in which these individuals can contribute as unique health-care team members in oncology. (Author/LBH)

  3. Monitoring cancer stem cells: insights into clinical oncology

    Directory of Open Access Journals (Sweden)

    Lin SC

    2016-02-01

    Full Text Available ShuChen Lin,1,* YingChun Xu,2,* ZhiHua Gan,1 Kun Han,1 HaiYan Hu,3 Yang Yao,3 MingZhu Huang,4 DaLiu Min1 1Department of Oncology, Shanghai Sixth People’s Hospital East Campus, Shanghai Jiao Tong University, 2Department of Oncology, Renji Hospital, Shanghai Jiao Tong University, 3Department of Oncology, The Sixth People’s Hospital, Shanghai Jiao Tong University, 4Department of Medical Oncology, Cancer Hospital of Fudan University, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Cancer stem cells (CSCs are a small, characteristically distinctive subset of tumor cells responsible for tumor initiation and progression. Several treatment modalities, such as surgery, glycolytic inhibition, driving CSC proliferation, immunotherapy, and hypofractionated radiotherapy, may have the potential to eradicate CSCs. We propose that monitoring CSCs is important in clinical oncology as CSC populations may reflect true treatment response and assist with managing treatment strategies, such as defining optimal chemotherapy cycles, permitting pretreatment cancer surveillance, conducting a comprehensive treatment plan, modifying radiation treatment, and deploying rechallenge chemotherapy. Then, we describe methods for monitoring CSCs. Keywords: cancer stem cells, glycolytic inhibition, watchful waiting, rechallenge, immunotherapy

  4. Translating clinical trials from human to veterinary oncology and back

    OpenAIRE

    Fürdös, Irene; Fazekas, Judit; Singer, Josef; Jensen-Jarolim, Erika

    2015-01-01

    In human medicine clinical trials are legally required for drug development and approval. In contrast, clinical trials in small animal cancer patients are less common and legally perceived as animal experiments. Comparative oncology has been recognized as a method to speed up the development of medications by introducing animal patients with naturally developing tumours. In such cases, using animal patients would generate more robust data, as their spontaneous disease resembles the “real life...

  5. Clinical application of PET/MRI in oncology.

    Science.gov (United States)

    Sotoudeh, Houman; Sharma, Akash; Fowler, Kathryn J; McConathy, Jonathan; Dehdashti, Farrokh

    2016-08-01

    Hybrid imaging with integrated positron emission tomography (PET) and magnetic resonance imaging (MRI) combines the advantages of the high-resolution anatomic data from MRI and functional imaging data from PET, and has the potential to improve the diagnostic evaluation of various types of cancers. The clinical oncologic applications of this newest hybrid imaging technology are evolving and substantial efforts are underway to define the role of PET/MRI in routine clinical use. The current published literature suggests that PET/MRI may play an important role in the evaluation of patients with certain types of malignancies, involving anatomic locations such as the pelvis and the liver. The purpose of this article is to review the current published PET/MRI literature in specific body oncologic applications. In addition, PET/MRI protocols and some of the technical issues of this hybrid imaging will be briefly discussed. J. Magn. Reson. Imaging 2016;44:265-276. PMID:27007987

  6. Selenium in Oncology: From Chemistry to Clinics

    OpenAIRE

    Oliver Micke; Lutz Schomburg; Jens Buentzel; Klaus Kisters; Ralph Muecke

    2009-01-01

    The essential trace element selenium, which is a crucial cofactor in the most important endogenous antioxidative systems of the human body, is attracting more and more the attention of both laypersons and expert groups. The interest of oncologists mainly focuses in the following clinical aspects: radioprotection of normal tissues, radiosensitizing in malignant tumors, antiedematous effect, prognostic impact of selenium, and effects in primary and secondary cancer prevention. Selenium is a con...

  7. Integrating pain metrics into oncology clinical trials.

    Science.gov (United States)

    Cleeland, Charles S; O'Mara, Ann; Zagari, Martin; Baas, Carole

    2011-11-01

    Cancer-related pain is highly prevalent and often severe, and as a result is often one of the defining experiences for patients with malignancy. Patients and patients' families almost always live with the ever-present reality that cancer treatment and progression may be accompanied by pain. For patients nearing the end of life, most fear that their final days will be spent living with the terrible effects of the disease, the most important of which is pain. Despite this, there is far less systematic research on the mechanisms of cancer-related pain or on the development of new agents to reduce or eliminate pain in cancer patients compared with research to combat the disease itself. Further, even when the focus of research is treatment of the tumor, the effects of anticancer treatments on pain are often underreported in publications and other forums. To illustrate the relative drought in the cancer pain control area, there have been no new drugs approved for cancer-related pain in recent years. A number of methodologic and logistical challenges that hinder the ability to assess pain response in clinical trials are discussed in this article. Possible ways to address these challenges are also discussed. PMID:22046026

  8. Clinical exercise interventions in pediatric oncology: a systematic review.

    Science.gov (United States)

    Baumann, Freerk T; Bloch, Wilhelm; Beulertz, Julia

    2013-10-01

    Studies in pediatric oncology have shown a positive effect of physical activity on disease- and treatment-related side effects. Although several reviews have approved the benefits of therapeutic exercise for adult cancer patients, no systematic review exists summarizing the evidence of physical activity in pediatric oncology. We identified a total of 17 studies using the PubMed database and Cochrane library. To evaluate the evidence, we used the evaluation system of the Oxford Center for Evidence-Based Medicine 2001. The findings confirm that clinical exercise interventions are feasible and safe, especially with acute lymphoblastic leukemia (ALL) patients and during medical treatment. No adverse effects have been reported. Positive effects were found on fatigue, strength, and quality of life. Single studies present positive effects on the immune system, body composition, sleep, activity levels, and various aspects of physical functioning. Child-specific aspects such as cognitive abilities, growth, adolescence, and reintegration into peer-groups, school, and sports have barely been taken into consideration. The evidence for exercise interventions in pediatric oncology is rated level "3." Although the results are very promising, future research of high methodological quality and focusing on child-specific aspects is needed to establish evidence-based exercise recommendations, particularly for childhood cancer patients. PMID:23857296

  9. Clinical Positioning Space: Residents' Clinical Experiences in the Outpatient Oncology Clinic.

    Science.gov (United States)

    Williams, Lars H; Christensen, Mette K; Rytter, Carsten; Musaeus, Peter

    2015-09-01

    In this article, we present a case study of residents' clinical experiences and communication in outpatient oncology consultations. We apply positioning theory, a dynamic alternative to role theory, to investigate how oncology residents and patients situate themselves as persons with rights and duties. Drawing from seven qualitative interviews and six days of observation, we investigate the residents' social positioning and their conversations with patients or supervisors. Our focus is on how (a) relational shifts in authority depend on each situation and its participants; (b) storylines establish acts and positions and narratively frame what participants can expect from a medical consultation viewed as a social episode; and (c) the positioning of rights and duties can lead to misunderstandings and frustrations. We conclude that residents and patients locate themselves in outpatient conversations as participants who jointly produce and are produced by patients' and nurses' storylines about who should take responsibility for treatment. PMID:25288406

  10. Next-Generation Sequencing in Clinical Oncology: Next Steps Towards Clinical Validation

    Directory of Open Access Journals (Sweden)

    Nigel C. Bennett

    2014-11-01

    Full Text Available Compelling evidence supports the transition of next generation sequencing (NGS technology from a research environment into clinical practice. Before NGS technologies are fully adopted in the clinic, they should be thoroughly scrutinised for their potential as powerful diagnostic and prognostic tools. The importance placed on generating accurate NGS data, and consequently appropriate clinical interpretation, has stimulated much international discussion regarding the creation and implementation of strict guidelines and regulations for NGS clinical use. In the context of clinical oncology, NGS technologies are currently transitioning from a clinical research background into a setting where they will contribute significantly to individual patient cancer management. This paper explores the steps that have been taken, and those still required, for the transition of NGS into the clinical area, with particular emphasis placed on validation in the setting of clinical oncology.

  11. Functional imaging in oncology. Clinical applications. Vol. 2

    Energy Technology Data Exchange (ETDEWEB)

    Luna, Antonio [Case Western Reserve Univ., Cleveland, OH (United States). Dept. of Radiology; MRI Health Time Group, Jaen (Spain); Vilanova, Joan C. [Girona Univ. (Spain). Clinica Girona - Hospital Sta. Caterina; Hygino da Cruz, L. Celso Jr. (ed.) [CDPI and IRM, Rio de Janeiro (Brazil). Dept. of Radiology; Rossi, Santiago E. [Centro de Diagnostico, Buenos Aires (Argentina)

    2014-06-01

    Easy-to-read manual on new functional imaging techniques in oncology. Explains current clinical applications and outlines future avenues. Includes numerous high-quality illustrations to highlight the major teaching points. In the new era of functional and molecular imaging, both currently available imaging biomarkers and biomarkers under development are expected to lead to major changes in the management of oncological patients. This two-volume book is a practical manual on the various imaging techniques capable of delivering functional information on cancer, including diffusion MRI, perfusion CT and MRI, dual-energy CT, spectroscopy, dynamic contrast-enhanced ultrasonography, PET, and hybrid modalities. This second volume considers the applications and benefits of these techniques in a wide range of tumor types, including their role in diagnosis, prediction of treatment outcome, and early evaluation of treatment response. Each chapter addresses a specific malignancy and is written by one or more acclaimed experts. The lucid text is complemented by numerous high-quality illustrations that highlight key features and major teaching points.

  12. Functional imaging in oncology. Clinical applications. Vol. 2

    International Nuclear Information System (INIS)

    Easy-to-read manual on new functional imaging techniques in oncology. Explains current clinical applications and outlines future avenues. Includes numerous high-quality illustrations to highlight the major teaching points. In the new era of functional and molecular imaging, both currently available imaging biomarkers and biomarkers under development are expected to lead to major changes in the management of oncological patients. This two-volume book is a practical manual on the various imaging techniques capable of delivering functional information on cancer, including diffusion MRI, perfusion CT and MRI, dual-energy CT, spectroscopy, dynamic contrast-enhanced ultrasonography, PET, and hybrid modalities. This second volume considers the applications and benefits of these techniques in a wide range of tumor types, including their role in diagnosis, prediction of treatment outcome, and early evaluation of treatment response. Each chapter addresses a specific malignancy and is written by one or more acclaimed experts. The lucid text is complemented by numerous high-quality illustrations that highlight key features and major teaching points.

  13. Phase 0 clinical trials in oncology new drug development

    Directory of Open Access Journals (Sweden)

    Umesh Chandra Gupta

    2011-01-01

    Full Text Available Research focus of pharmaceutical industry has expanded to a larger extent in last few decades putting many more new molecules, particularly targeted agents, for the clinical development. On the other hand, researchers are facing serious challenges due to high failure rates of new molecules in clinical studies. The United States Food and Drug Administration (FDA in combination with academia and industry experts identified many factors responsible for failures of new molecules, and with a vision of taking traditional drug development model toward an innovative paradigm shift, issued regulatory guidance on conduct of exploratory investigational new drug (exploratory IND studies, often called as phase 0 clinical trials, requiring reduced preclinical testing, which has special relevance to life-threatening diseases such as cancer. Phase 0 trials, utilizing much lower drug doses, provide an opportunity to explore the clinical behavior of new molecules very early in the drug development pathway, helping to identify the promising candidates and eliminating non-promising molecules, thus improving the efficiency of overall drug development with significant savings of resources. Being non-therapeutic in nature, these studies, however, pose certain ethical challenges requiring careful study designing and informed consent process. This article reviews the insights and perspectives for the feasibility, utility, planning, designing and conduct of phase 0 clinical trials, in addition to ethical issues and industrial perspective focused at oncology new drug development.

  14. Clinical microdialysis in neuro-oncology: principles and applications

    Institute of Scientific and Technical Information of China (English)

    J. Clay Goodman

    2011-01-01

    Clinical microdialysis allows a discrete volume of the brain to be sampled for neurochemical analysis of neurotransmitters, metabolites, biomarkers, and drugs. The technique can be safely used in humans intraoperatively, in the intensive care unit, and in ambulatory settings. Microdialysis probes, micropumps, and analytical equipment are commercially available and have been used extensively for neurochemical monitoring in traumatic brain injury, stroke, and subarachnoid hemorrhage. There has been very limited use of micredialysis in neuro-oncology, but this technique has groat promise in the study of the basic neurochemistry of brain tumors, alterations in neurochemistry in response to therapy, and the pharmacokinetics of chemotherapeutic agents. Microdialysis probes may also be used to deliver drugs while simultaneously permitting monitoring of neurochemical changes induced by this therapy.

  15. Contract research organizations in oncology clinical research: Challenges and opportunities.

    Science.gov (United States)

    Roberts, Daniel A; Kantarjian, Hagop M; Steensma, David P

    2016-05-15

    Contract research organizations (CROs) represent a multibillion dollar industry that is firmly embedded in the contemporary clinical trial process. Over the past 30 years, and especially within the last decade, the reach of CROs has extended to service all phases of drug trials in an increasingly global research environment. The presence of CROs is particularly noticeable in medical oncology because of the large number of investigational compounds developed to treat cancer that are currently undergoing testing in human subjects. Although limited data are available with which to objectively define the effects that CROs have had on the clinical trial process, with the expansion of these organizations, several reports have called into question whether ethical and professional standards in research conduct are at times secondary to economic considerations. CROs can add considerable value to the clinical trial process, but difficulty communicating with CRO representatives and time spent answering trivial data queries generated by CROs are current obstacles for study site personnel interacting with CROs. Further study of the effect of the CRO industry on the clinical trial process is needed to ensure efficient data collection and patient safety while collaboratively developing novel therapies in an expedited fashion. Cancer 2016;122:1476-82. © 2016 American Cancer Society. PMID:27018651

  16. Clinical Training of Medical Physicists Specializing in Radiation Oncology

    International Nuclear Information System (INIS)

    The application of radiation in human health, for both diagnosis and treatment of disease, is an important component of the work of the IAEA. The responsibility for the increasing technical aspects of this work is undertaken by the medical physicist. To ensure good practice in this vital area structured clinical training programmes are required to complement academic learning. This publication is intended to be a guide to the practical implementation of such a programme for radiation therapy. There is a general and growing awareness that radiation medicine is increasingly dependant on well trained medical physicists that are based in the clinical setting. However an analysis of the availability of medical physicists indicates a large shortfall of qualified and capable professionals. This is particularly evident in developing countries. While strategies to increase academic educational opportunities are critical to such countries, the need for guidance on structured clinical training was recognised by the members of the Regional Cooperative Agreement (RCA) for research, development and training related to nuclear sciences for Asia and the Pacific. Consequently a technical cooperation regional project (RAS6038) under the RCA programme was formulated to address this need in the Asia Pacific region by developing suitable material and establishing its viability. Development of a clinical training guide for medical physicists specialising in radiation therapy was started in 2005 with the appointment of a core drafting committee of regional and international experts. Since 2005 the IAEA has convened two additional consultant group meetings including additional experts to prepare the present publication. The publication drew heavily, particularly in the initial stages, from the experience and documents of the Clinical Training Programme for Radiation Oncology Medical Physicists as developed by the Australasian College of Physical Scientists and Engineers in Medicine. Their

  17. Effects of Age Expectations on Oncology Social Workers' Clinical Judgment

    Science.gov (United States)

    Conlon, Annemarie; Choi, Namkee G.

    2014-01-01

    Objective: This study examined the influence of oncology social workers' expectations regarding aging (ERA) and ERA with cancer (ERAC) on their clinical judgment. Methods: Oncology social workers (N = 322) were randomly assigned to one of four vignettes describing a patient with lung cancer. The vignettes were identical except for the…

  18. A national radiation oncology medical student clerkship survey: Didactic curricular components increase confidence in clinical competency

    Science.gov (United States)

    Jagadeesan, Vikrant S.; Raleigh, David R.; Koshy, Matthew; Howard, Andrew R.; Chmura, Steven J.; Golden, Daniel W.

    2014-01-01

    Purpose/Objectives Students applying to radiation oncology residency programs complete one or more radiation oncology clerkships. This study assesses student experiences and perspectives during radiation oncology clerkships. The impact of didactic components and number of clerkship experiences in relation to confidence in clinical competency and preparation to function as a first year radiation oncology resident are evaluated. Methods and Materials An anonymous, internet-based survey was sent via direct e-mail to all applicants to a single radiation oncology residency program during the 2012–2013 academic year. The survey was composed of three main sections including questions regarding baseline demographic information and prior radiation oncology experience, rotation experiences, and ideal clerkship curriculum content. Results The survey response rate was 37% (70/188). Respondents reported 191 unique clerkship experiences. 27% of respondents (19/70) completed at least one clerkship with a didactic component geared towards their level of training. Completing a clerkship with a didactic component was significantly associated with a respondent’s confidence to function as a first- year radiation oncology resident (Wilcoxon rank-sum p = 0.03). However, the total number of clerkships completed did not correlate with confidence to pursue radiation oncology as a specialty (Spearman’s rho p = 0.48) or confidence to function as a first year resident (Spearman’s rho p = 0.43). Conclusions Based on responses to this survey, rotating students perceive that the majority of radiation oncology clerkships do not have formal didactic curricula. Survey respondents who completed a clerkship with a didactic curriculum reported feeling more prepared to function as a radiation oncology resident. However, completing an increasing number of clerkships does not appear to improve confidence in the decision to pursue radiation oncology as a career or to function as a radiation

  19. A National Radiation Oncology Medical Student Clerkship Survey: Didactic Curricular Components Increase Confidence in Clinical Competency

    International Nuclear Information System (INIS)

    Purpose: Students applying to radiation oncology residency programs complete 1 or more radiation oncology clerkships. This study assesses student experiences and perspectives during radiation oncology clerkships. The impact of didactic components and number of clerkship experiences in relation to confidence in clinical competency and preparation to function as a first-year radiation oncology resident are evaluated. Methods and Materials: An anonymous, Internet-based survey was sent via direct e-mail to all applicants to a single radiation oncology residency program during the 2012-2013 academic year. The survey was composed of 3 main sections including questions regarding baseline demographic information and prior radiation oncology experience, rotation experiences, and ideal clerkship curriculum content. Results: The survey response rate was 37% (70 of 188). Respondents reported 191 unique clerkship experiences. Of the respondents, 27% (19 of 70) completed at least 1 clerkship with a didactic component geared towards their level of training. Completing a clerkship with a didactic component was significantly associated with a respondent's confidence to function as a first-year radiation oncology resident (Wilcoxon rank–sum P=.03). However, the total number of clerkships completed did not correlate with confidence to pursue radiation oncology as a specialty (Spearman ρ P=.48) or confidence to function as a first year resident (Spearman ρ P=.43). Conclusions: Based on responses to this survey, rotating students perceive that the majority of radiation oncology clerkships do not have formal didactic curricula. Survey respondents who completed a clerkship with a didactic curriculum reported feeling more prepared to function as a radiation oncology resident. However, completing an increasing number of clerkships does not appear to improve confidence in the decision to pursue radiation oncology as a career or to function as a radiation oncology resident. These results

  20. Cancer-related fatigue. Clinical practice guidelines in oncology.

    Science.gov (United States)

    2003-07-01

    These guidelines propose a treatment algorithm in which patients are evaluated regularly for fatigue using a brief screening instrument, and are treated as indicated by their fatigue level. The algorithm's goal is to identify and treat all patients with fatigue that causes distress or interferes with their daily activities or functioning. Management of fatigue begins with primary oncology team members who perform the initial screening and either provide basic education and counseling or expand the initial screening to a more focused evaluation for moderate or higher levels of fatigue. At this point the patient is assessed for current disease and treatment status, a review of body systems, and an in-depth fatigue evaluation. In addition, the patient is assessed for the presence of seven treatable factors known to contribute to fatigue: pain, emotional distress, sleep disturbance, anemia, alterations in nutrition, deconditioning, and comorbidities. If any of these conditions are present, they should be treated according to practice guidelines, with referral to other care professionals as appropriate, and the patient's fatigue should be reevaluated regularly. If none of the seven factors are present or the fatigue is unresolved, selection of appropriate fatigue management and treatment strategies is considered within the context of the patient's clinical status: receiving active cancer treatment, receiving disease-free long-term follow-up, or receiving care at the end of life. Management of fatigue is cause-specific when conditions known to cause fatigue can be identified and treated. When specific causes, such as infection, fluid and electrolyte imbalances, or cardiac dysfunction, cannot be identified and corrected, nonpharmacologic and pharmacologic treatment of the fatigue should be considered. Nonpharmacologic interventions may include a moderate exercise program to improve functional capacity and activity tolerance, psychosocial programs to manage stress and

  1. Guide to clinical PET in oncology: Improving clinical management of cancer patients

    International Nuclear Information System (INIS)

    Positron emission tomography (PET) has an approximately 50 year-history. It was developed as a tool of medical science to quantitatively measure metabolic rates of bio-substances in vivo and in particular the number of receptors in neuroscience. Until the late 1990s PET was, in most cases, research oriented activity. In 2001, positron emission tomography/X ray computed tomography (PET/CT) hybrid imaging system became commercially available. An era of clinical PET then emerged, in which PET images were utilized for clinical practice in the treatment and diagnosis of cancer patients. PET imaging could recognize areas of abnormal metabolic behaviour of cancers in vivo, and the addition of CT imaging underlines the site of malignancy. More accurate and precise interpretation of cancer lesions can therefore be performed by PET/CT imaging than PET or CT imaging alone. Clinical PET, in particular with fluorine-18-fluorodeoxyglucose (18F-FDG), has already proven itself to have considerable value in oncology. The indications include malignant lymphoma and melanoma, head and neck cancers, oesophageal cancer, breast cancer, lung cancer and colorectal cancer, and it is still being expanded. The roles of clinical PET could be for 1) preoperative staging of cancers, 2) differentiation between residual tumour and scarring, 3) demonstration of suspected recurrences, 4) monitoring response to therapy, 5) prognosis and 6) radiotherapy treatment planning. Clinical PET can be used to illustrate exactly which treatment should be applied for a cancer patient as well as where surgeons should operate and where radiation oncologists should target radiation therapy. An almost exponential rise in the introduction of clinical PET, as well as the installation of PET/CT has been seen throughout the world. Clinical PET is currently viewed as the most powerful diagnostic tool in its field. This IAEA-TECDOC presents an overview of clinical PET for cancer patients and a relevant source of

  2. Tracking the 2015 Gastrointestinal Cancers Symposium: bridging cancer biology to clinical gastrointestinal oncology

    Directory of Open Access Journals (Sweden)

    Aprile G

    2015-05-01

    Full Text Available Giuseppe Aprile,1 Francesco Leone,2,3 Riccardo Giampieri,4 Mariaelena Casagrande,1 Donatella Marino,2,3 Luca Faloppi,4 Stefano Cascinu,4 Gianpiero Fasola,1 Mario Scartozzi5,6 1Department of Oncology, University and General Hospital, Udine, Italy; 2Medical Oncology Department, University of Turin, 3Institute for Cancer Research and Treatment, Candiolo, Turin, Italy; 4Medical Oncology Unit, Azienda Ospedaliero-Universitaria Ospedali Riuniti, Universita Politecnica delle Marche, Ancona, Italy; 5Medical Oncology Department, University of Cagliari, 6General Hospital, Cagliari, Italy Abstract: The 2015 Gastrointestinal Cancers Symposium (San Francisco, CA, USA; January 15–17 is the world-class conference co-sponsored by the American Society of Clinical Oncology, the American Society for Radiation Oncology, the American Gastroenterological Association Institute, and the Society of Surgical Oncology, in which the most innovative research results in digestive tract oncology are presented and discussed. In its twelfth edition, the meeting has provided new insights focusing on the underpinning biology and clinical management of gastrointestinal malignancies. More than 3,400 health care professionals gathered from all over the world to share their experiences on how to bridge the recent novelties in cancer biology with everyday medical practice. In this article, the authors report on the most significant advances, didactically moving on three different anatomic tracks: gastroesophageal malignancies, pancreatic and biliary cancers, and colorectal adenocarcinomas. Keywords: colorectal cancer, gastric cancer, ramucirumab, pembrolizumab, target therapy, onartuzumab, AMG 337

  3. [Evidence and recommendations for oncologic clinical exercise - a personalized treatment concept for cancer patients].

    Science.gov (United States)

    Baumann, Freerk Theeagnus; Hallek, Michael; Meyer, Janika; Galvão, Daniel Abido; Bloch, Wilhelm; Elter, Thomas

    2015-09-01

    Oncological treatments can lead to acute and chronic cancer related toxicities. In recent years, a large number of clinical studies have reported positive effects of exercise to the bio-psycho-social regeneration of cancer patients. However, very few evidence-based programs have been implemented into practice with little opportunity for cancer patients to engage in such programs. Reviews and RCT studies on exercise and cancer are showing that specific exercise programs have a positive impact on fatigue syndrome, urinary incontinence, lymphedema, polyneuropathy, arthralgia, and androgen deprivation related toxicities. With the increasing evidence for exercise oncology interventions, recommendations arising from clinical trials should be translated into clinical practice and this should be viewed as an important next step in this fast moving field of exercise oncology. For that the personalized treatment concept "Oncologic clinical exercise" (OTT) was developed. PMID:26402184

  4. Contribution for Invitation for The Chinese-German Journal of Clinical Oncology

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The Chinese-German Journal of Clinical Oncology isan international, professional, academic periodical on on-cology, co-edited by China and Germany. With the au-thors from around the world, especially from China, thejournal focuses on introducing clinical experience in diag-nosis and treatment and leading scientific research a-chievement in the tumor domain, in addition to reportingbasic theory research which help to teach the clinicalpractice of oncology and closely connect with the disci-pline. All manuscripts are published in English: the jour-nal is issued quarterly, with the International SerialStandard Number (ISSN) 1610-1979/CN/42-1654/R.

  5. An exploration of oncology specialist nurses’ roles in nurse-led chemotherapy clinics

    OpenAIRE

    Farrell, Carole Denise

    2014-01-01

    The purpose of this study was to investigate nurses’ roles within nurse-led chemotherapy clinics. There has been a rapid expansion and development of nursing roles and responsibilities in oncology, but little understanding of how roles are enacted and their impact on patient experiences and outcomes. This was a two stage approach comprising a survey of UK oncology specialist nurses followed by an ethnographic study of nurses’ roles in nurse led chemotherapy clinics. Ethics approval was obtain...

  6. Lack of timely accrual information in oncology clinical trials: a cross-sectional analysis

    OpenAIRE

    Mitchell, Aaron P.; Bradford R Hirsch; Abernethy, Amy P

    2014-01-01

    Background Poor accrual is a significant barrier to the successful completion of oncology clinical trials; half of all phase 3 oncology trials close due to insufficient accrual. Timely access to accrual data fosters an understanding of successful trial design and can be used to inform the design of new clinical trials prospectively. Accrual statistics are available within research networks, such as the cancer cooperative groups, but comprehensive data reflecting the overall portfolio of cance...

  7. Measurement of nurses' workload in an oncology outpatient clinic

    Directory of Open Access Journals (Sweden)

    Célia Alves de Souza

    2014-02-01

    Full Text Available The growing demand and the degree of patient care in oncological outpatient services, as well as the complexity of treatment have had an impact on the workload of nurses. This study aimed at measuring the workload and productivity of nurses in an oncological outpatient service. An observational study using a work sampling technique was conducted and included seven nurses working in an oncological outpatient service in the south-eastern region of Brazil. A total of 1,487 intervention or activity samples were obtained. Nurses used 43.2% of their time on indirect care, 33.2% on direct care, 11.6% on associated activities, and 12% on personal activities. Their mean productivity was 88.0%. The findings showed that nurses in this service spend most of their time in indirect care activities. Moreover, the productivity index in this study was above that recommended in the literature.

  8. Classifying K-12 Blended Learning

    Science.gov (United States)

    Staker, Heather; Horn, Michael B.

    2012-01-01

    The growth of online learning in the K-12 sector is occurring both remotely through virtual schools and on campuses through blended learning. In emerging fields, definitions are important because they create a shared language that enables people to talk about the new phenomena. The blended-learning taxonomy and definitions presented in this paper…

  9. Project reconversion Service Hospital Radiation Oncology Clinics-Medical School

    International Nuclear Information System (INIS)

    Introduction: The Health Sector operates within the framework of Social Policy and it is therefore one of the ways of distribution of public benefit, like Housing, Education and Social Security. While public spending on health has grown in recent years, its distribution has been uneven and the sector faces funding and management problems. The Service Hospital Radiation Oncology has reduced its health care liavility , lack technological development and unsufficient human resources and training. Aim: developing an inclusive reform bill Service Hospital Radiation Oncology .Material and Methods: This project tends to form a network institutional, introducing concepts of evidence-based medicine, risk models, cost analysis, coding systems, system implementation of quality management (ISO-9000 Standards). Proposes redefining radiotherapy centers and their potential participation in training resource development goals humanos.Promueve scientific research of national interest. Separate strictly administrative function, management and teaching. The project takes into account the characteristics of demand, the need to order it and organize around her, institutional network system and within the Hospital das Clinicas own related services related to Service Hospital Radiation Oncology , Encourages freedom of choice, and confers greater equity in care. The project would managed by the Hospital Clínicas. Conclusions: We believe this proposal identifies problems and opportunities, Service Hospital Radiation Oncology proposes the development of institutional network under one management model

  10. Contribution Invitation of The Chinese-German Journal of Clinical Oncology

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    @@ The Chinese-German Journal of Clinical Oncology is an international professional academic periodical on oncology, being co-edited by China and Germany. The Journal, with the authors from around world, especially from China, is dominated in introducing the clinical experience of diagnosis and treatment as well as leading scientific research achievement in the tumor domain, in addition to report basic theory researches which help instruct the clinical practice of oncology and closely connect with the discipline. All the manuscripts are published in English, quarterly issued both internal and external, 64 -80pages, big 16 opens domains, art paper in offset printing, with lay-out by international customs, unified issuing number: ISSN 1610-1979 (Paper) 1613-9089 (Online)/CN 42-1654/R.

  11. Clinical practice guidelines and consensus statements in oncology--an assessment of their methodological quality.

    Directory of Open Access Journals (Sweden)

    Carmel Jacobs

    Full Text Available BACKGROUND: Consensus statements and clinical practice guidelines are widely available for enhancing the care of cancer patients. Despite subtle differences in their definition and purpose, these terms are often used interchangeably. We systematically assessed the methodological quality of consensus statements and clinical practice guidelines published in three commonly read, geographically diverse, cancer-specific journals. Methods Consensus statements and clinical practice guidelines published between January 2005 and September 2013 in Current Oncology, European Journal of Cancer and Journal of Clinical Oncology were evaluated. Each publication was assessed using the Appraisal of Guidelines for Research and Evaluation II (AGREE II rigour of development and editorial independence domains. For assessment of transparency of document development, 7 additional items were taken from the Institute of Medicine's standards for practice guidelines and the Journal of Clinical Oncology guidelines for authors of guidance documents. METHODS: Consensus statements and clinical practice guidelines published between January 2005 and September 2013 in Current Oncology, European Journal of Cancer and Journal of Clinical Oncology were evaluated. Each publication was assessed using the Appraisal of Guidelines for Research and Evaluation II (AGREE II rigour of development and editorial independence domains. For assessment of transparency of document development, 7 additional items were taken from the Institute of Medicine's standards for practice guidelines and the Journal of Clinical Oncology guidelines for authors of guidance documents. FINDINGS: Thirty-four consensus statements and 67 clinical practice guidelines were evaluated. The rigour of development score for consensus statements over the three journals was 32% lower than that of clinical practice guidelines. The editorial independence score was 15% lower for consensus statements than clinical practice

  12. FDG PET/CT in clinical oncology. Case based approach with teaching points

    International Nuclear Information System (INIS)

    Organized according to the role of FDG PET/CT in the evaluation and management of oncology patients. 100 informative cases reflecting the issues that clinicians address in their daily practice. Ideal for all newcomers to the field, whether medical students, radiology, nuclear medicine, or oncology fellows, or practicing physicians. FDG PET/CT has rapidly emerged as an invaluable combined imaging modality that can identify tumors on the basis of not only anatomical alterations but also metabolic activity, thus allowing the detection of lesions that would otherwise be too small to distinguish. This book, comprising a collection of images from oncology cases, is organized according to the role of FDG PET/CT in the evaluation and management of oncology patients, and only secondarily by organ or tumor entity. In this way, it reflects the issues that clinicians actually address in their daily practice, namely: identification of an unknown or unsuspected primary; determination of the extent of disease; evaluation of response to therapy; and surveillance after response, i.e., detection of recurrent disease. In total, 100 cases involving different primary tumors are presented to illustrate findings in these different circumstances. FDG PET/CT in Clinical Oncology will be of great value to all newcomers to this field, whether medical students, radiology, nuclear medicine, or oncology fellows, or practicing physicians.

  13. FDG PET/CT in clinical oncology. Case based approach with teaching points

    Energy Technology Data Exchange (ETDEWEB)

    Mihailovic, Jasna [Novi Sad Univ. (Serbia). Dept. of Nuclear Medicine; Goldsmith, Stanley J. [Weill Cornell Medical College, New York, NY (United States). Div. of Nuclear Medicine and Molecular Imging; Killeen, Ronan P. [St. Vincents Univ. Hospital, Dublin (Ireland)

    2012-07-01

    Organized according to the role of FDG PET/CT in the evaluation and management of oncology patients. 100 informative cases reflecting the issues that clinicians address in their daily practice. Ideal for all newcomers to the field, whether medical students, radiology, nuclear medicine, or oncology fellows, or practicing physicians. FDG PET/CT has rapidly emerged as an invaluable combined imaging modality that can identify tumors on the basis of not only anatomical alterations but also metabolic activity, thus allowing the detection of lesions that would otherwise be too small to distinguish. This book, comprising a collection of images from oncology cases, is organized according to the role of FDG PET/CT in the evaluation and management of oncology patients, and only secondarily by organ or tumor entity. In this way, it reflects the issues that clinicians actually address in their daily practice, namely: identification of an unknown or unsuspected primary; determination of the extent of disease; evaluation of response to therapy; and surveillance after response, i.e., detection of recurrent disease. In total, 100 cases involving different primary tumors are presented to illustrate findings in these different circumstances. FDG PET/CT in Clinical Oncology will be of great value to all newcomers to this field, whether medical students, radiology, nuclear medicine, or oncology fellows, or practicing physicians.

  14. Reiki as a clinical intervention in oncology nursing practice.

    Science.gov (United States)

    Bossi, Larraine M; Ott, Mary Jane; DeCristofaro, Susan

    2008-06-01

    Oncology nurses and their patients are frequently on the cutting edge of new therapies and interventions that support coping, health, and healing. Reiki is a practice that is requested with increasing frequency, is easy to learn, does not require expensive equipment, and in preliminary research, elicits a relaxation response and helps patients to feel more peaceful and experience less pain. Those who practice Reiki report that it supports them in self-care and a healthy lifestyle. This article will describe the process of Reiki, review current literature, present vignettes of patient responses to the intervention, and make recommendations for future study. PMID:18515247

  15. The Metamorphosis by K. (12)

    CERN Multimedia

    CERN Bulletin

    2012-01-01

    In the last issue of the Bulletin we reported on the first run of the new NA62 experiment. In this issue, we go behind the scenes to take a look at the production of the experiment's new kaon beam.   The start of the K12 beam line as seen during the installation of the shielding. 10-2, 10-3, 10-4, 10-5, 10-6 mbar… send in the protons! Since Thursday 1 November, the P42 beam line of the SPS has once again been sending protons to the beryllium target to produce the K12 kaon beam line eagerly awaited by the NA62 collaboration. This was no trivial matter! The first step was to clear the decks by dismantling the entire H10 beam line and NA60 experiment, as well as most of the NA48 experiment - representing some 1000 tonnes of equipment in total! Next came the complete renovation of the infrastructure, which dated back to 1979. The operation called on the expertise of virtually all branches of the EN and GS departments, as well as the Radiation Protection group: from ...

  16. Postgraduate Training in Clinical Oncology. Report on a WHO Working Group (The Hague, The Netherlands, December 6-8, 1978).

    Science.gov (United States)

    World Health Organization, Copenhagen (Denmark). Regional Office for Europe.

    The 1978 report of the Working Group of Postgraduate Training in Clinical Oncology, convened by the World Health Organization (WHO) Regional Office for Europe in collaboration with the government of The Netherlands, is presented. The groups analyzed models of postgraduate training in clinical oncology and evaluated their suitability in relation to…

  17. Making the right software choice for clinically used equipment in radiation oncology

    International Nuclear Information System (INIS)

    The customer of a new system for clinical use in radiation oncology must consider many options in order to find the optimal combination of software tools. Many commercial systems are available and each system has a large number of technical features. However an appraisal of the technical capabilities, especially the options for clinical implementations, is hardly assessable at first view. The intention of this article was to generate an assessment of the necessary functionalities for high precision radiotherapy and their integration in ROKIS (Radiation oncology clinic information system) for future customers, especially with regard to clinical applicability. Therefore we analysed the clinically required software functionalities and divided them into three categories: minimal, enhanced and optimal requirements for high conformal radiation treatment

  18. A critical appraisal of the clinical utility of proton therapy in oncology

    Directory of Open Access Journals (Sweden)

    Wang D

    2015-10-01

    Full Text Available Dongxu WangDepartment of Radiation Oncology, University of Iowa Hospitals and Clinics, Iowa City, IA, USAAbstract: Proton therapy is an emerging technology for providing radiation therapy to cancer patients. The depth dose distribution of a proton beam makes it a preferable radiation modality as it reduces radiation to the healthy tissue outside the tumor, compared with conventional photon therapy. While theoretically beneficial, its clinical values are still being demonstrated from the increasing number of patients treated with proton therapy, from several dozen proton therapy centers around the world. High equipment and facility costs are often the major obstacle for its wider adoption. Because of the high cost and lack of definite clinical evidence of its superiority, proton therapy treatment faces criticism on its cost-effectiveness. Technological development is causing a gradual lowering of costs, and research and clinical studies are providing further evidence on its clinical utility.Keywords: proton therapy, radiation, cancer, oncology

  19. Factors Predicting Oncology Care Providers' Behavioral Intention to Adopt Clinical Decision Support Systems

    Science.gov (United States)

    Wolfenden, Andrew

    2012-01-01

    The purpose of this quantitative correlation study was to examine the predictors of user behavioral intention on the decision of oncology care providers to adopt or reject the clinical decision support system. The Unified Theory of Acceptance and Use of Technology (UTAUT) formed the foundation of the research model and survey instrument. The…

  20. Scenario drafting for early technology assessment of next generation sequencing in clinical oncology

    NARCIS (Netherlands)

    Joosten, S.E.P.; Retel, V.P.; Coupé, V.M.H.; Heuvel, van den M.M.; Harten, van W.H.

    2016-01-01

    Background Next Generation Sequencing (NGS) is expected to lift molecular diagnostics in clinical oncology to the next level. It enables simultaneous identification of mutations in a patient tumor, after which targeted therapy may be assigned. This approach could improve patient survival and/or assi

  1. Music therapy services in pediatric oncology: a national clinical practice review.

    Science.gov (United States)

    Tucquet, Belinda; Leung, Maggie

    2014-01-01

    This article presents the results of a national clinical practice review conducted in Australia of music therapy services in pediatric oncology hospitals. Literature specifically related to music therapy and symptom management in pediatric oncology is reviewed. The results from a national benchmarking survey distributed to all music therapists working with children with cancer in Australian pediatric hospitals are discussed. Patient and family feedback provided from a quality improvement activity conducted at a major pediatric tertiary hospital is summarized, and considerations for future growth as a profession and further research is proposed. PMID:25027188

  2. Assessing the Value of an Optional Radiation Oncology Clinical Rotation During the Core Clerkships in Medical School

    International Nuclear Information System (INIS)

    Purpose: Few medical students are given proper clinical training in oncology, much less radiation oncology. We attempted to assess the value of adding a radiation oncology clinical rotation to the medical school curriculum. Methods and Materials: In July 2010, Jefferson Medical College began to offer a 3-week radiation oncology rotation as an elective course for third-year medical students during the core surgical clerkship. During 2010 to 2012, 52 medical students chose to enroll in this rotation. The rotation included outpatient clinics, inpatient consults, didactic sessions, and case-based presentations by the students. Tests of students’ knowledge of radiation oncology were administered anonymously before and after the rotation to evaluate the educational effectiveness of the rotation. Students and radiation oncology faculty were given surveys to assess feedback about the rotation. Results: The students’ prerotation test scores had an average of 64% (95% confidence interval [CI], 61–66%). The postrotation test scores improved to an average of 82% (95% CI, 80–83%; 18% absolute improvement). In examination question analysis, scores improved in clinical oncology from 63% to 79%, in radiobiology from 70% to 77%, and in medical physics from 62% to 88%. Improvements in all sections but radiobiology were statistically significant. Students rated the usefulness of the rotation as 8.1 (scale 1–9; 95% CI, 7.3–9.0), their understanding of radiation oncology as a result of the rotation as 8.8 (95% CI, 8.5–9.1), and their recommendation of the rotation to a classmate as 8.2 (95% CI, 7.6–9.0). Conclusions: Integrating a radiation oncology clinical rotation into the medical school curriculum improves student knowledge of radiation oncology, including aspects of clinical oncology, radiobiology, and medical physics. The rotation is appreciated by both students and faculty.

  3. Single-Cell Sequencing Technology in Oncology: Applications for Clinical Therapies and Research

    Directory of Open Access Journals (Sweden)

    Baixin Ye

    2016-01-01

    Full Text Available Cellular heterogeneity is a fundamental characteristic of many cancers. A lack of cellular homogeneity contributes to difficulty in designing targeted oncological therapies. Therefore, the development of novel methods to determine and characterize oncologic cellular heterogeneity is a critical next step in the development of novel cancer therapies. Single-cell sequencing (SCS technology has been recently employed for analyzing the genetic polymorphisms of individual cells at the genome-wide level. SCS requires (1 precise isolation of the single cell of interest; (2 isolation and amplification of genetic material; and (3 descriptive analysis of genomic, transcriptomic, and epigenomic data. In addition to targeted analysis of single cells isolated from tumor biopsies, SCS technology may be applied to circulating tumor cells, which may aid in predicting tumor progression and metastasis. In this paper, we provide an overview of SCS technology and review the current literature on the potential application of SCS to clinical oncology and research.

  4. American Society of Clinical Oncology Statement: Human Papillomavirus Vaccination for Cancer Prevention.

    Science.gov (United States)

    Bailey, Howard H; Chuang, Linus T; duPont, Nefertiti C; Eng, Cathy; Foxhall, Lewis E; Merrill, Janette K; Wollins, Dana S; Blanke, Charles D

    2016-05-20

    American Society of Clinical Oncology (ASCO), the leading medical professional oncology society, is committed to lessening the burden of cancer and as such will promote underused interventions that have the potential to save millions of lives through cancer prevention. As the main providers of cancer care worldwide, our patients, their families, and our communities look to us for guidance regarding all things cancer related, including cancer prevention. Through this statement and accompanying recommendations, ASCO hopes to increase awareness of the tremendous global impact of human papillomavirus (HPV) -caused cancers, refocus the discussion of HPV vaccination on its likely ability to prevent millions of cancer deaths, and increase HPV vaccination uptake via greater involvement of oncology professionals in ensuring accurate public discourse about HPV vaccination and calling for the implementation of concrete strategies to address barriers to vaccine access and acceptance. PMID:27069078

  5. American Society of Clinical Oncology Policy Statement Update: Genetic and Genomic Testing for Cancer Susceptibility.

    Science.gov (United States)

    Robson, Mark E; Bradbury, Angela R; Arun, Banu; Domchek, Susan M; Ford, James M; Hampel, Heather L; Lipkin, Stephen M; Syngal, Sapna; Wollins, Dana S; Lindor, Noralane M

    2015-11-01

    The American Society of Clinical Oncology (ASCO) has long affirmed that the recognition and management of individuals with an inherited susceptibility to cancer are core elements of oncology care. ASCO released its first statement on genetic testing in 1996 and updated that statement in 2003 and 2010 in response to developments in the field. In 2014, the Cancer Prevention and Ethics Committees of ASCO commissioned another update to reflect the impact of advances in this area on oncology practice. In particular, there was an interest in addressing the opportunities and challenges arising from the application of massively parallel sequencing-also known as next-generation sequencing-to cancer susceptibility testing. This technology introduces a new level of complexity into the practice of cancer risk assessment and management, requiring renewed effort on the part of ASCO to ensure that those providing care to patients with cancer receive the necessary education to use this new technology in the most effective, beneficial manner. The purpose of this statement is to explore the challenges of new and emerging technologies in cancer genetics and provide recommendations to ensure their optimal deployment in oncology practice. Specifically, the statement makes recommendations in the following areas: germline implications of somatic mutation profiling, multigene panel testing for cancer susceptibility, quality assurance in genetic testing, education of oncology professionals, and access to cancer genetic services. PMID:26324357

  6. Quantitative Assessment of Workload and Stressors in Clinical Radiation Oncology

    Energy Technology Data Exchange (ETDEWEB)

    Mazur, Lukasz M., E-mail: lukasz_mazur@ncsu.edu [Department of Radiation Oncology, University of North Carolina, Chapel Hill, North Carolina (United States); Industrial Extension Service, North Carolina State University, Raleigh, North Carolina (United States); Biomedical Engineering, North Carolina State University, Raleigh, North Carolina (United States); Mosaly, Prithima R. [Industrial Extension Service, North Carolina State University, Raleigh, North Carolina (United States); Jackson, Marianne; Chang, Sha X.; Burkhardt, Katharin Deschesne; Adams, Robert D.; Jones, Ellen L.; Hoyle, Lesley [Department of Radiation Oncology, University of North Carolina, Chapel Hill, North Carolina (United States); Xu, Jing [Industrial Extension Service, North Carolina State University, Raleigh, North Carolina (United States); Rockwell, John; Marks, Lawrence B. [Department of Radiation Oncology, University of North Carolina, Chapel Hill, North Carolina (United States)

    2012-08-01

    Purpose: Workload level and sources of stressors have been implicated as sources of error in multiple settings. We assessed workload levels and sources of stressors among radiation oncology professionals. Furthermore, we explored the potential association between workload and the frequency of reported radiotherapy incidents by the World Health Organization (WHO). Methods and Materials: Data collection was aimed at various tasks performed by 21 study participants from different radiation oncology professional subgroups (simulation therapists, radiation therapists, physicists, dosimetrists, and physicians). Workload was assessed using National Aeronautics and Space Administration Task-Load Index (NASA TLX). Sources of stressors were quantified using observational methods and segregated using a standard taxonomy. Comparisons between professional subgroups and tasks were made using analysis of variance ANOVA, multivariate ANOVA, and Duncan test. An association between workload levels (NASA TLX) and the frequency of radiotherapy incidents (WHO incidents) was explored (Pearson correlation test). Results: A total of 173 workload assessments were obtained. Overall, simulation therapists had relatively low workloads (NASA TLX range, 30-36), and physicists had relatively high workloads (NASA TLX range, 51-63). NASA TLX scores for physicians, radiation therapists, and dosimetrists ranged from 40-52. There was marked intertask/professional subgroup variation (P<.0001). Mental demand (P<.001), physical demand (P=.001), and effort (P=.006) significantly differed among professional subgroups. Typically, there were 3-5 stressors per cycle of analyzed tasks with the following distribution: interruptions (41.4%), time factors (17%), technical factors (13.6%), teamwork issues (11.6%), patient factors (9.0%), and environmental factors (7.4%). A positive association between workload and frequency of reported radiotherapy incidents by the WHO was found (r = 0.87, P value=.045

  7. Quantitative Assessment of Workload and Stressors in Clinical Radiation Oncology

    International Nuclear Information System (INIS)

    Purpose: Workload level and sources of stressors have been implicated as sources of error in multiple settings. We assessed workload levels and sources of stressors among radiation oncology professionals. Furthermore, we explored the potential association between workload and the frequency of reported radiotherapy incidents by the World Health Organization (WHO). Methods and Materials: Data collection was aimed at various tasks performed by 21 study participants from different radiation oncology professional subgroups (simulation therapists, radiation therapists, physicists, dosimetrists, and physicians). Workload was assessed using National Aeronautics and Space Administration Task-Load Index (NASA TLX). Sources of stressors were quantified using observational methods and segregated using a standard taxonomy. Comparisons between professional subgroups and tasks were made using analysis of variance ANOVA, multivariate ANOVA, and Duncan test. An association between workload levels (NASA TLX) and the frequency of radiotherapy incidents (WHO incidents) was explored (Pearson correlation test). Results: A total of 173 workload assessments were obtained. Overall, simulation therapists had relatively low workloads (NASA TLX range, 30-36), and physicists had relatively high workloads (NASA TLX range, 51-63). NASA TLX scores for physicians, radiation therapists, and dosimetrists ranged from 40-52. There was marked intertask/professional subgroup variation (P<.0001). Mental demand (P<.001), physical demand (P=.001), and effort (P=.006) significantly differed among professional subgroups. Typically, there were 3-5 stressors per cycle of analyzed tasks with the following distribution: interruptions (41.4%), time factors (17%), technical factors (13.6%), teamwork issues (11.6%), patient factors (9.0%), and environmental factors (7.4%). A positive association between workload and frequency of reported radiotherapy incidents by the WHO was found (r = 0.87, P value=.045

  8. Current practices and guidelines for clinical next-generation sequencing oncology testing

    Institute of Scientific and Technical Information of China (English)

    Samuel P. Strom

    2016-01-01

    Next-generation sequencing (NGS) has been rapidly integrated into molecular pathology, dramatically increasing the breadth genomic of information available to oncologists and their patients. This review will explore the ways in which this new technology is currently applied to bolster care for patients with solid tumors and hematological malignancies, focusing on practices and guidelines for assessing the technical validity and clinical utility of DNA variants identified during clinical NGS oncology testing.

  9. Multi-scale Modeling in Clinical Oncology: Opportunities and Barriers to Success.

    Science.gov (United States)

    Yankeelov, Thomas E; An, Gary; Saut, Oliver; Luebeck, E Georg; Popel, Aleksander S; Ribba, Benjamin; Vicini, Paolo; Zhou, Xiaobo; Weis, Jared A; Ye, Kaiming; Genin, Guy M

    2016-09-01

    Hierarchical processes spanning several orders of magnitude of both space and time underlie nearly all cancers. Multi-scale statistical, mathematical, and computational modeling methods are central to designing, implementing and assessing treatment strategies that account for these hierarchies. The basic science underlying these modeling efforts is maturing into a new discipline that is close to influencing and facilitating clinical successes. The purpose of this review is to capture the state-of-the-art as well as the key barriers to success for multi-scale modeling in clinical oncology. We begin with a summary of the long-envisioned promise of multi-scale modeling in clinical oncology, including the synthesis of disparate data types into models that reveal underlying mechanisms and allow for experimental testing of hypotheses. We then evaluate the mathematical techniques employed most widely and present several examples illustrating their application as well as the current gap between pre-clinical and clinical applications. We conclude with a discussion of what we view to be the key challenges and opportunities for multi-scale modeling in clinical oncology. PMID:27384942

  10. American Cancer Society/American Society of Clinical Oncology Breast Cancer Survivorship Care Guideline.

    Science.gov (United States)

    Runowicz, Carolyn D; Leach, Corinne R; Henry, N Lynn; Henry, Karen S; Mackey, Heather T; Cowens-Alvarado, Rebecca L; Cannady, Rachel S; Pratt-Chapman, Mandi L; Edge, Stephen B; Jacobs, Linda A; Hurria, Arti; Marks, Lawrence B; LaMonte, Samuel J; Warner, Ellen; Lyman, Gary H; Ganz, Patricia A

    2016-02-20

    The purpose of the American Cancer Society/American Society of Clinical Oncology Breast Cancer Survivorship Care Guideline is to provide recommendations to assist primary care and other clinicians in the care of female adult survivors of breast cancer. A systematic review of the literature was conducted using PubMed through April 2015. A multidisciplinary expert workgroup with expertise in primary care, gynecology, surgical oncology, medical oncology, radiation oncology, and nursing was formed and tasked with drafting the Breast Cancer Survivorship Care Guideline. A total of 1,073 articles met inclusion criteria; and, after full text review, 237 were included as the evidence base. Patients should undergo regular surveillance for breast cancer recurrence, including evaluation with a cancer-related history and physical examination, and should be screened for new primary breast cancer. Data do not support performing routine laboratory tests or imaging tests in asymptomatic patients to evaluate for breast cancer recurrence. Primary care clinicians should counsel patients about the importance of maintaining a healthy lifestyle, monitor for post-treatment symptoms that can adversely affect quality of life, and monitor for adherence to endocrine therapy. Recommendations provided in this guideline are based on current evidence in the literature and expert consensus opinion. Most of the evidence is not sufficient to warrant a strong evidence-based recommendation. Recommendations on surveillance for breast cancer recurrence, screening for second primary cancers, assessment and management of physical and psychosocial long-term and late effects of breast cancer and its treatment, health promotion, and care coordination/practice implications are made.This guideline was developed through a collaboration between the American Cancer Society and the American Society of Clinical Oncology and has been published jointly by invitation and consent in both CA: A Cancer Journal for

  11. Recent advances in gastrointestinal oncology - updates and insights from the 2009 annual meeting of the American Society of Clinical Oncology

    Directory of Open Access Journals (Sweden)

    Hsueh Chung-Tsen

    2010-03-01

    Full Text Available Abstract We have reviewed the pivotal presentations related to gastrointestinal malignancies from 2009 annual meeting of the American Society of Clinical Oncology with the theme of "personalizing cancer care". We have discussed the scientific findings and the impact on practice guidelines and ongoing clinical trials. Adding trastuzumab to chemotherapy improved the survival of patients with advanced gastric cancer overexpressing human epidermal growth factor receptor 2. Gemcitabine plus cisplatin has become a new standard for first-line treatment of advanced biliary cancer. Octreotide LAR significantly lengthened median time to tumor progression compared with placebo in patients with metastatic neuroendocrine tumors of the midgut. Addition of oxaliplatin to fluoropyrimidines for preoperative chemoradiotherapy in patients with stage II or III rectal cancer did not improve local tumor response but increased toxicities. Bevacizumab did not provide additional benefit to chemotherapy in adjuvant chemotherapy for stage II or III colon cancer. In patients with resected stage II colon cancer, recurrence score estimated by multigene RT-PCR assay has been shown to provide additional risk stratification. In stage IV colorectal cancer, data have supported the routine use of prophylactic skin treatment in patients receiving antibody against epidermal growth factor receptor, and the use of upfront chemotherapy as initial management in patients with synchronous metastasis without obstruction or bleeding from the primary site.

  12. An exploration of the experience of compassion fatigue in clinical oncology nurses.

    Science.gov (United States)

    Perry, Beth; Toffner, Greg; Merrick, Trish; Dalton, Janice

    2011-01-01

    Compassion fatigue (CF) is "debilitating weariness brought about by repetitive, empathic responses to the pain and suffering of others" (LaRowe, 2005, p. 21). The work performed by oncology nurses, and the experiences of the people they care for, place oncology nurses at high risk for CF (Pierce et al., 2007; Ferrell & Coyle, 2008). Thus oncology nurses were chosen as the study focus. This paper details a descriptive exploratory qualitative research study that investigated the experience of CF in Canadian clinical oncology registered nurses (RNs). A conceptual stress process model by Aneshensel, Pearlin, Mullan, Zarit, and Whitlatch (1995) that considers caregivers' stress in four domains provided the study framework (see Figure 1). Nineteen study participants were recruited through an advertisement in the Canadian Oncology Nursing Journal (CONJ). The advertisement directed potential participants to a university-based online website developed for this study. Participants completed a questionnaire and wrote a narrative describing an experience with CF and submitted these through the secure research website. Data were analyzed thematically. Five themes include: defining CF, causes of CF, factors that worsen CF, factors that lessen CF, and outcomes of CF. Participants had limited knowledge about CF, about lack of external support, and that insufficient time to provide high quality, care may precipitate CF. The gap between quality of care nurses wanted to provide and what they were able to do, compounded by coexisting physical and emotional stress, worsened CF. CF was lessened by colleague support, work-life balance, connecting with others, acknowledgement, and maturity and experience. Outcomes of CF included profound fatigue of mind and body, negative effects on personal relationships, and considering leaving the specialty. Recommendations that may enhance oncology nurse well-being are provided. PMID:21661623

  13. Integrating Personalized Medicine in the Canadian Environment: Efforts Facilitating Oncology Clinical Research.

    Science.gov (United States)

    Syme, Rachel; Carleton, Bruce; Leyens, Lada; Richer, Etienne

    2015-01-01

    There is currently a rapid evolution of clinical practices based on the introduction of patient stratification and molecular diagnosis that is likely to improve health outcomes. Building on a strong research base, complemented by strong support from clinicians and health authorities, the oncology field is at the forefront of this evolution. Yet, clinical research is still facing many challenges that need to be addressed in order to conduct necessary studies and effectively translate medical breakthroughs based on personalized medicine into standards of care. Leveraging its universal health care system and on resources developed to support oncology clinical research, Canada is well positioned to join the international efforts deployed to address these challenges. Available resources include a broad range of structures and funding mechanisms, ranging from direct clinical trial support to post-marketing surveillance. Here, we propose a clinical model for the introduction of innovation for precision medicine in oncology that starts with patients' and clinicians' unmet needs to initiate a cycle of discovery, validation, translation and sustainability development. PMID:26565702

  14. Processes for Quality Improvements in Radiation Oncology Clinical Trials

    International Nuclear Information System (INIS)

    Quality assurance in radiotherapy (RT) has been an integral aspect of cooperative group clinical trials since 1970. In early clinical trials, data acquisition was nonuniform and inconsistent and computational models for radiation dose calculation varied significantly. Process improvements developed for data acquisition, credentialing, and data management have provided the necessary infrastructure for uniform data. With continued improvement in the technology and delivery of RT, evaluation processes for target definition, RT planning, and execution undergo constant review. As we move to multimodality image-based definitions of target volumes for protocols, future clinical trials will require near real-time image analysis and feedback to field investigators. The ability of quality assurance centers to meet these real-time challenges with robust electronic interaction platforms for imaging acquisition, review, archiving, and quantitative review of volumetric RT plans will be the primary challenge for future successful clinical trials

  15. Processes for quality improvements in radiation oncology clinical trials.

    Science.gov (United States)

    FitzGerald, T J; Urie, Marcia; Ulin, Kenneth; Laurie, Fran; Yorty, Jeffrey; Hanusik, Richard; Kessel, Sandy; Jodoin, Maryann Bishop; Osagie, Gani; Cicchetti, M Giulia; Pieters, Richard; McCarten, Kathleen; Rosen, Nancy

    2008-01-01

    Quality assurance in radiotherapy (RT) has been an integral aspect of cooperative group clinical trials since 1970. In early clinical trials, data acquisition was nonuniform and inconsistent and computational models for radiation dose calculation varied significantly. Process improvements developed for data acquisition, credentialing, and data management have provided the necessary infrastructure for uniform data. With continued improvement in the technology and delivery of RT, evaluation processes for target definition, RT planning, and execution undergo constant review. As we move to multimodality image-based definitions of target volumes for protocols, future clinical trials will require near real-time image analysis and feedback to field investigators. The ability of quality assurance centers to meet these real-time challenges with robust electronic interaction platforms for imaging acquisition, review, archiving, and quantitative review of volumetric RT plans will be the primary challenge for future successful clinical trials. PMID:18406943

  16. Photoacoustic Imaging in Oncology: Translational Preclinical and Early Clinical Experience.

    Science.gov (United States)

    Valluru, Keerthi S; Wilson, Katheryne E; Willmann, Jürgen K

    2016-08-01

    Photoacoustic imaging has evolved into a clinically translatable platform with the potential to complement existing imaging techniques for the management of cancer, including detection, characterization, prognosis, and treatment monitoring. In photoacoustic imaging, tissue is optically excited to produce ultrasonographic images that represent a spatial map of optical absorption of endogenous constituents such as hemoglobin, fat, melanin, and water or exogenous contrast agents such as dyes and nanoparticles. It can therefore provide functional and molecular information that allows noninvasive soft-tissue characterization. Photoacoustic imaging has matured over the years and is currently being translated into the clinic with various clinical studies underway. In this review, the current state of photoacoustic imaging is presented, including techniques and instrumentation, followed by a discussion of potential clinical applications of this technique for the detection and management of cancer. (©) RSNA, 2016. PMID:27429141

  17. PROCESSES FOR QUALITY IMPROVEMENTS IN RADIATION ONCOLOGY CLINICAL TRIALS

    OpenAIRE

    FitzGerald, TJ; Urie, Marcia; Ulin, Kenneth; Laurie, Fran; Yorty, Jeffrey; Hanusik, Richard; Kessel, Sandy; Jodoin, Maryann Bishop; Osagie, Gani; Giulia Cicchetti, M.; Pieters, Richard; McCarten, Kathleen; Rosen, Nancy

    2008-01-01

    Quality assurance in radiation therapy has been an integral aspect of cooperative group clinical trials since 1970. In early clinical trials data acquisition was non-uniform and inconsistent; computational models for radiation dose calculation varied significantly. Process improvements developed for data acquisition, credentialing, and data management have provided the necessary infrastructure for uniform data. With continued improvement in the technology and delivery of radiation therapy, ev...

  18. Radiation doses to personnel in clinics for gynecologic oncology

    International Nuclear Information System (INIS)

    Radium or Cesium is used for radiotherapy of gynecologic cancer at six clinics in Sweden. This report gives a survey of the radiation doses the personnel is exposed to. The measurement were performed using TL-dosimeters. The dose equivalents for different parts of the body at specific working moments was deduced as well as the effective dose equivalent and the collective dose equivalent. 1983 the total collective dose equivalent for the six clinics was 1.3 manSv, which corresponds to 3.9 manmSv/g equivalent mass of Radium used at the treatments. (With 11 tables and 10 figures) (L.E.)

  19. Clinical and Outcome Research in oncology The need for integration

    Directory of Open Access Journals (Sweden)

    Apolone Giovanni

    2003-04-01

    Full Text Available Abstract Cancer is one of the main healthcare problems in Europe. Although significant progress has recently been made, long-term survival is still disappointing for most common solid tumours. The explosion of information has strengthened the need to create and sustain coordinated interaction between technology, biology, clinical research, clinical practice and health policy. A simple process based on automatic and passive translation from bench to clinical research and eventually to the bed side is usually assumed but cannot be taken for granted. A critical role might be played by Outcome Research (OR, defined as the discipline that describes, interprets, and predicts the impact of various influences, especially interventions, on final endpoints (from survival to satisfaction with care that matter to decision makers (from patients to society at large, with special emphasis on the use of patient-reported outcomes (PRO. Recently, under pressure from several parts of society, the FDA, recognizing the need for faster drug approval, has modified existing regulations and created new rules to allow anti-cancer drugs to be approved more quickly and, in certain but quite common circumstances, single arm trials and surrogate endpoints to be used as measures of clinical benefit. In this context, the faster approval process may lead to drugs being marketed without there being a complete picture of how effective or safe they are. The FDA move to speed up drug approval, together with the use of not fully validated surrogate endpoints, give OR the unique opportunity to help understand the value of drugs that have received accelerated approval. Despite this opportunity, OR has yet to demonstrate its role in this specific setting and provide proof of the validity, reliability and added value of its primary endpoint measures when evaluated in a broader context. The implementation of lines of OR in the development and evaluation of anti-cancer drugs hinges upon

  20. Role of oncology clinical pharmacist: a case of life-saving interventions

    OpenAIRE

    Osama M. Al-Quteimat; Al-Badaineh, Mariam A.

    2013-01-01

    The oncology clinical pharmacist (CP) has a crucial role in cancer patient care through improving medication use including chemotherapy and other high alert medications. As part of multidisciplinary team CP has major role in assuring safe, effective and cost-effective drug therapy. Herein we report a case of 45 years old male patient diagnosed with diffuse large B-cell lymphoma (DLBCL), treated with high dose methotrexate (MTX) as prophylaxis for central nervous system (CNS) lymphoma, and fol...

  1. Cancer stem cells in basic science and in translational oncology: can we translate into clinical application?

    OpenAIRE

    Schulenburg, Axel; Blatt, Katharina; Cerny-Reiterer, Sabine; Sadovnik, Irina; Herrmann, Harald; Marian, Brigitte; Grunt, Thomas W.; Zielinski, Christoph C.; Valent, Peter

    2015-01-01

    Since their description and identification in leukemias and solid tumors, cancer stem cells (CSC) have been the subject of intensive research in translational oncology. Indeed, recent advances have led to the identification of CSC markers, CSC targets, and the preclinical and clinical evaluation of the CSC-eradicating (curative) potential of various drugs. However, although diverse CSC markers and targets have been identified, several questions remain, such as the origin and evolution of CSC,...

  2. Electronic clinical decision support systems attitudes and barriers to use in the oncology setting.

    LENUS (Irish Health Repository)

    Collins, I M

    2012-03-02

    BACKGROUND: There is little evidence regarding attitudes to clinical decision support systems (CDSS) in oncology. AIMS: We examined the current usage, awareness, and concerns of Irish medical oncologists and oncology pharmacists in this area. METHODS: A questionnaire was sent to 27 medical oncologists and 34 oncology pharmacists, identified through professional interest groups. Respondents ranked concerns regarding their use of a CDSS on a scale from 1 to 4, with 4 being most important. RESULTS: Overall, 67% (41\\/61) responded, 48% (13\\/27) of oncologists and 82% (28\\/34) of pharmacists surveyed. Concerns included "difficulty defining complex clinical situations with a set of rules" (mean ± SD) (3.2 ± 0.9), "ensuring evidence base is up to date and relevant" (3.2 ± 0.9) and "lack of clinically relevant suggestions" (2.9 ± 0.9). Ninety-three percent reported using a CDSS but 54% were unaware of this. CONCLUSION: While there are benefits to using a CDSS, concerns must be addressed through user education. This may be a starting point for a user-centred design approach to the development of future local systems through a consultative process.

  3. Clinical oncologic applications of PET/MRI: a new horizon

    OpenAIRE

    Partovi, Sasan; Kohan, Andres; Rubbert, Christian; Vercher-Conejero, Jose Luis; Gaeta, Chiara; Yuh, Roger; Zipp, Lisa; Herrmann, Karin A.; Robbin, Mark R.; Lee, Zhenghong; Muzic, Raymond F.; Faulhaber, Peter; Ros, Pablo R

    2014-01-01

    Positron emission tomography/magnetic resonance imaging (PET/MRI) leverages the high soft-tissue contrast and the functional sequences of MR with the molecular information of PET in one single, hybrid imaging technology. This technology, which was recently introduced into the clinical arena in a few medical centers worldwide, provides information about tumor biology and microenvironment. Studies on indirect PET/MRI (use of positron emission tomography/computed tomography (PET/CT) images softw...

  4. Clinically relevant drug–drug interactions in oncology

    OpenAIRE

    Mcleod, Howard L.

    1998-01-01

    Although anticancer agents are one of the most toxic classes of medication prescribed today, there is relatively little information available about clinically relevant drug–drug interactions. Pharmacokinetic drug interactions have been described, including alterations in absorption, catabolism, and excretion. For example, an increased bioavailability of 6-mercaptopurine has been observed when combined with either allopurinol or methotrexate, leading to increased toxicity in some patients. Ind...

  5. Nervous Plexopathies in oncologic patients: Anatomical, clinical and radiological Considerations

    International Nuclear Information System (INIS)

    Lumbosacral or brachial plexopathies are lesions of two or more roots of the same plexus. They are very frequent in cancer patients and are usually due to extra spinal involvement of these roots, by a primary or secondary neoplasm. The CT scan is very useful in the evaluation of patients with this disease. In the article anatomic al aspects, the main clinical symptoms and signs, and the performance of CT scan are reviewed with all these elements it is possible to make a diagnosis

  6. Clinical perspectives of cancer stem cell research in radiation oncology

    International Nuclear Information System (INIS)

    Radiotherapy has a proven potential to eradicate cancer stem cells which is reflected by its curative potential in many cancer types. Considerable progress has been made in identification and biological characterisation of cancer stem cells during the past years. Recent biological findings indicate significant inter- and intratumoural and functional heterogeneity of cancer stem cells and lead to more complex models which have potential implications for radiobiology and radiotherapy. Clinical evidence is emerging that biomarkers of cancer stem cells may be prognostic for the outcome of radiotherapy in some tumour entities. Perspectives of cancer stem cell based research for radiotherapy reviewed here include their radioresistance compared to the mass of non-cancer stem cells which form the bulk of all tumour cells, implications for image- and non-image based predictive bio-assays of the outcome of radiotherapy and a combination of novel systemic treatments with radiotherapy

  7. Role of French teams in the development of clinical and translational research in radiation oncology

    International Nuclear Information System (INIS)

    Many clinical studies have showed the key role of radiotherapy in anticancer treatment strategy. Radiations are delivered alone or in combination with systemic therapies. In recent years, the main goal of all clinical developments has focused on improving clinical benefit, with an increased tumour control and a higher normal tissue protection. This research was designed to reduce local recurrences, to increase recurrence-free or overall survival and to decrease acute and late effects. Technological and biological evolutions (or revolutions) accompanied clinicians to improve clinical benefit, namely with strong progress in radiology and better understanding of radiobiology, particularly at the molecular level. Differences in tumour and normal tissues radiosensitivity are nowadays integrated in daily clinical practice of radiation oncologists. The current report details the last 5-year developments of clinical and translational research in radiation oncology, especially the role of French teams in the development of personalized treatment. (authors)

  8. Role of American Society of Clinical Oncology in low- and middle-income countries.

    Science.gov (United States)

    Patel, Jyoti D; Galsky, Matthew D; Chagpar, Anees B; Pyle, Doug; Loehrer, Patrick J

    2011-08-01

    The American Society of Clinical Oncology (ASCO) is a global community of health care professionals whose stated purpose is to "make a world of difference" by improving cancer care around the world. Unfortunately, cancer survival rates vary significantly among countries with differing financial and infrastructural resources. Because ASCO is a professional oncology society committed to conquering cancer through research, education, prevention, and delivery of high-quality patient care, it is ideally suited to address this issue. ASCO could bring together oncology professionals and other necessary stakeholders from around the world to improve cancer care and lessen suffering for patients worldwide. As part of the ongoing commitment of ASCO to the future of cancer care, the Leadership Development Program was created to foster the leadership skills of early and midcareer oncologists and provide these participants with a working knowledge of the depth and breadth of the organization. As participants in the inaugural class of the ASCO Leadership Development Program, we were charged with investigating how ASCO might favorably affect cancer prevention and treatment in resource-poor countries in a cost-effective, scalable, and sustainable fashion. ASCO can significantly influence cancer care in low- and middle-income countries through a comprehensive approach that promotes cancer awareness and education, improves clinical practice by identifying and removing barriers to delivery of quality cancer care, and fosters innovation to initiate novel solutions to complex problems. PMID:21709190

  9. Mucosal malignant melanoma - a clinical, oncological, pathological and genetic survey.

    Science.gov (United States)

    Mikkelsen, Lauge H; Larsen, Ann-Cathrine; von Buchwald, Christian; Drzewiecki, Krzysztof T; Prause, Jan U; Heegaard, Steffen

    2016-06-01

    Mucosal melanomas constitute 1.3% of all melanomas and they may develop in any mucosal membrane. Conjunctival melanomas (0.5/million/year) and melanomas in the sinonasal cavity (0.5/million/year) are the most common, followed by anorectal melanomas (0.4/million/year) and melanomas in the oral cavity (0.2/million/year). Anorectal melanoma occurs slightly more often in females, whereas oral melanoma has a male predilection. Mucosal melanoma most commonly develops in a patient's sixth or seventh decade of life, and no differences between races have been found except for sinonasal melanoma and conjunctival melanoma, which are very rare in Black people. The symptoms are not tumour-specific and are related to the organ system affected, and the disease is most often diagnosed at an advanced clinical stage. The diagnosis of a primary tumour is difficult, and metastatic cutaneous melanoma and choroidal melanoma must be excluded. Mutations in KIT are frequently found, while BRAF and NRAS mutations are rarely found - except in conjunctival melanomas that carry BRAF mutations. Mutations in the TERT promotor region are also found in mucosal melanomas. Complete surgical resection with free margins is the treatment of choice. The prognosis is poor, with the 5-year survival rate ranging from 0% (gastric melanoma) to 80% (conjunctival melanoma). PMID:27004972

  10. Approval procedures for clinical trials in the field of radiation oncology

    International Nuclear Information System (INIS)

    Application of ionizing radiation for the purpose of medical research in Germany needs to be approved by the national authority for radiation protection (Bundesamt fuer Strahlenschutz, BfS). For studies in the field of radiation oncology, differentiation between use of radiation for ''medical care (Heilkunde)'' versus ''medical research'' frequently leads to contradictions. The aim of this article is to provide principle investigators, individuals, and institutions involved in the process, as well as institutional review or ethics committees, with the necessary information for this assessment. Information on the legal frame and the approval procedures are also provided. A workshop was co-organized by the German Society for Radiation Oncology (DEGRO), the Working Party for Radiation Oncology (ARO) of the German Cancer Society (DKG), the German Society for Medical Physics (DGMP), and the German Cancer Consortium (DKTK) in October 2013. This paper summarizes the results of the workshop and the follow-up discussions between the organizers and the BfS. Differentiating between ''Heilkunde'' which does not need to be approved by the BfS and ''medical research'' is whether the specific application of radiation (beam quality, dose, schedule, target volume, etc.) is a clinically established and recognized procedure. This must be answered by the qualified physician(s) (''fachkundiger Arzt'' according to German radiation protection law) in charge of the study and the treatments of the patients within the study, taking into consideration of the best available evidence from clinical studies, guidelines and consensus papers. Among the important parameters for assessment are indication, total dose, and fractionation. Radiation treatments applied outside clinical trials do not require approval by the BfS, even if they are applied within a randomized or nonrandomized clinical trial

  11. PET-Based Personalized Management in Clinical Oncology: An Unavoidable Path for the Foreseeable Future.

    Science.gov (United States)

    Basu, Sandip; Alavi, Abass

    2016-07-01

    It is imperative that the thrust of clinical practice in the ensuing years would be to develop personalized management model for various disorders. PET-computed tomography (PET-CT) based molecular functional imaging has been increasingly utilized for assessment of tumor and other nonmalignant disorders and has the ability to explore disease phenotype on an individual basis and address critical clinical decision making questions related to practice of personalized medicine. Hence, it is essential to make a concerted systematic effort to explore and define the appropriate place of PET-CT in personalized clinical practice in each of malignancies, which would strengthen the concept further. The potential advantages of PET based disease management can be classified into broad categories: (1) Traditional: which includes assessment of disease extent such as initial disease staging and restaging, treatment response evaluation particularly early in the course and thus PET-CT response adaptive decision for continuing the same regimen or switching to salvage schedules; there has been continuous addition of newer application of PET based disease restaging in oncological parlance (eg, Richter transformation); (2) Recent and emerging developments: this includes exploring tumor biology with FDG and non-FDG PET tracers. The potential of multitracer PET imaging (particularly new and novel tracers, eg, 68Ga-DOTA-TOC/NOC/TATE in NET, 68Ga-PSMA and 18F-fluorocholine in prostate carcinoma, 18F-fluoroestradiol in breast carcinoma) has provided a scientific basis to stratify and select appropriate targeted therapies (both radionuclide and nonradionuclide treatment), a major boost for individualized disease management in clinical oncology. Integrating the molecular level information obtained from PET with structural imaging further individualizing treatment plan in radiation oncology, precision of interventions and biopsies of a particular lesion and forecasting disease prognosis. PMID

  12. Professional practice assessment. Pertinence of positron emission tomography clinical indications in oncology

    International Nuclear Information System (INIS)

    Introduction As part of the health care quality and safety policy in France, Professional Practice Assessment (P.P.A.) are mandatory in the health services 'certification' process. We present our study regarding the pertinence of Positron Emission Tomography (PET) indications in oncology. Materials and methods A multidisciplinary task group used the Quick Audit method with two rounds of 100 request forms each. The assessment list of criteria comprised four items of decreasing relevance grading the PET scans clinical indications, which were derived from the three French published guidelines (S.O.R. [F.N.C.L.C.C]., 'Guide du bon usage des examens d'imagerie medicale' [S.F.R.-S.F.M.N.], 'Guide pour la redaction de protocoles pour la TEP au F.D.G. en cancerologie' [S.F.M.N.]) and five additional items: clinical information, patient's body weight, previous treatments dates, diabetes, claustrophobia. Results The first round showed that 68% of the requested scans corresponded to the two most relevant groups of indications (S.O.R. Standards and Options). The request forms were correctly filled in regarding the clinical information, but this was not the case for the other items we tested. Several actions were conducted: dedicated PET request form, availability of the S.O.R. on the hospital intranet, boost of the referring physicians awareness during the multidisciplinary oncology meetings (Reunions de Concertation Pluridisciplinaires RCP). The second round showed a better pertinence of the PET scans indications (75% versus 68%); the patient's body weight was more frequently mentioned on the request form. Discussion This study is an example of P.P.A. in our discipline. It led to an improvement of the oncologic PET scans clinical indications in our hospital. This work is pursued in everyday discussion with the referring clinicians, especially during the RCP. (authors)

  13. [Rethinking clinical research in surgical oncology. From comic opera to quality control].

    Science.gov (United States)

    Evrard, Serge

    2016-01-01

    The evidence base for the effectiveness of surgical interventions is relatively poor and data from large, randomized prospective studies are rare with often a poor quality. Many efforts have been made to increase the number of high quality randomized trials in surgery and theoretical proposals have been put forward to improve the situation, but practical implementation of these proposals is seriously lacking. The consequences of this policy are not trivial; with very few patients included in surgical oncology trials, this represents wasted opportunity for advances in cancer treatment. In this review, we cover the difficulties inherent to clinical research in surgical oncology, such as quality control, equipoise, accrual, and funding and promote alternative designs to the randomized controlled trial. Although the classic randomized controlled trial has a valid but limited place in surgical oncology, other prospective designs need to be promoted as a new deal. This new deal not only implicates surgeons but also journal editors, tender jury, as well as regulatory bodies to cover legal gaps currently surrounding surgical innovation. PMID:26610367

  14. New evidence-based adaptive clinical trial methods for optimally integrating predictive biomarkers into oncology clinical development programs

    Institute of Scientific and Technical Information of China (English)

    Robert A.Beckman; Cong Chen

    2013-01-01

    Predictive biomarkers are important to the future of oncology; they can be used to identify patient populations who will benefit from therapy,increase the value of cancer medicines,and decrease the size and cost of clinical trials while increasing their chance of success.But predictive biomarkers do not always work.When unsuccessful,they add cost,complexity,and time to drug development.This perspective describes phases 2 and 3 development methods that efficiently and adaptively check the ability of a biomarker to predict clinical outcomes.In the end,the biomarker is emphasized to the extent that it can actually predict.

  15. Clinical PET/CT Atlas: A Casebook of Imaging in Oncology

    International Nuclear Information System (INIS)

    Integrated positron emission tomography/computed tomography (PET/CT) has evolved since its introduction into the commercial market more than a decade ago. It is now a key procedure, particularly in oncological imaging. Over the last years in routine clinical service, PET/CT has had a significant impact on diagnosis, treatment planning, staging, therapy, and monitoring of treatment response and has therefore played an important role in the care of cancer patients. The high sensitivity from the PET component and the specificity of the CT component give this hybrid imaging modality the unique characteristics that make PET/CT, even after over 10 years of clinical use, one of the fastest growing imaging modalities worldwide. This publication combines over 90 comprehensive cases covering all major indications of fluorodeoxyglucose (18F-FDG)-PET/CT as well as some cases of clinically relevant special tracers. The cases provide an overview of what the specific disease can look like in PET/CT, the typical pattern of the disease’s spread as well as likely pitfalls and teaching points. This PET/CT Atlas will allow professionals interested in PET/CT imaging to embrace the variety of oncological imaging by providing clinically relevant teaching files on the effectiveness and diagnostic quality of FDG-PET/CT imaging in routine applications

  16. An ICT infrastructure to integrate clinical and molecular data in oncology research

    OpenAIRE

    Segagni Daniele; Tibollo Valentina; Dagliati Arianna; Zambelli Alberto; Priori Silvia G; Bellazzi Riccardo

    2012-01-01

    Abstract Background The ONCO-i2b2 platform is a bioinformatics tool designed to integrate clinical and research data and support translational research in oncology. It is implemented by the University of Pavia and the IRCCS Fondazione Maugeri hospital (FSM), and grounded on the software developed by the Informatics for Integrating Biology and the Bedside (i2b2) research center. I2b2 has delivered an open source suite based on a data warehouse, which is efficiently interrogated to find sets of...

  17. Nebraska Science Standards: Grades K-12

    Science.gov (United States)

    Nebraska Department of Education, 2010

    2010-01-01

    This publication presents the Nebraska Science Standards for Grades K-12. The standards are presented according to the following grades: (1) Grades K-2; (2) Grades 3-5; (3) Grades 6-8; and (4) Grades 9-12.

  18. Vision 20/20: Automation and advanced computing in clinical radiation oncology

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Kevin L., E-mail: kevinmoore@ucsd.edu; Moiseenko, Vitali [Department of Radiation Medicine and Applied Sciences, University of California San Diego, La Jolla, California 92093 (United States); Kagadis, George C. [Department of Medical Physics, School of Medicine, University of Patras, Rion, GR 26504 (Greece); McNutt, Todd R. [Department of Radiation Oncology and Molecular Radiation Science, School of Medicine, Johns Hopkins University, Baltimore, Maryland 21231 (United States); Mutic, Sasa [Department of Radiation Oncology, Washington University in St. Louis, St. Louis, Missouri 63110 (United States)

    2014-01-15

    This Vision 20/20 paper considers what computational advances are likely to be implemented in clinical radiation oncology in the coming years and how the adoption of these changes might alter the practice of radiotherapy. Four main areas of likely advancement are explored: cloud computing, aggregate data analyses, parallel computation, and automation. As these developments promise both new opportunities and new risks to clinicians and patients alike, the potential benefits are weighed against the hazards associated with each advance, with special considerations regarding patient safety under new computational platforms and methodologies. While the concerns of patient safety are legitimate, the authors contend that progress toward next-generation clinical informatics systems will bring about extremely valuable developments in quality improvement initiatives, clinical efficiency, outcomes analyses, data sharing, and adaptive radiotherapy.

  19. Vision 20/20: Automation and advanced computing in clinical radiation oncology

    International Nuclear Information System (INIS)

    This Vision 20/20 paper considers what computational advances are likely to be implemented in clinical radiation oncology in the coming years and how the adoption of these changes might alter the practice of radiotherapy. Four main areas of likely advancement are explored: cloud computing, aggregate data analyses, parallel computation, and automation. As these developments promise both new opportunities and new risks to clinicians and patients alike, the potential benefits are weighed against the hazards associated with each advance, with special considerations regarding patient safety under new computational platforms and methodologies. While the concerns of patient safety are legitimate, the authors contend that progress toward next-generation clinical informatics systems will bring about extremely valuable developments in quality improvement initiatives, clinical efficiency, outcomes analyses, data sharing, and adaptive radiotherapy

  20. Application of next-generation sequencing in clinical oncology to advance personalized treatment of cancer

    Institute of Scientific and Technical Information of China (English)

    Yan-Fang Guan; Gai-Rui Li; Rong-Jiao Wang; Yu-Ting Yi; Ling Yang; Dan Jiang; Xiao-Ping Zhang; Yin Peng

    2012-01-01

    With the development and improvement of new sequencing technology,next-generation sequencing (NGS) has been applied increasingly in cancer genomics research over the past decade.More recently,NGS has been adopted in clinical oncology to advance personalized treatment of cancer.NGS is used to identify novel and rare cancer mutations,detect familial cancer mutation carriers,and provide molecular rationale for appropriate targeted therapy.Compared to traditional sequencing,NGS holds many advantages,such as the ability to fully sequence all types of mutations for a large number of genes (hundreds to thousands) in a single test at a relatively low cost.However,significant challenges,particularly with respect to the requirement for simpler assays,more flexible throughput,shorter turnaround time,and most importantly,easier data analysis and interpretation,will have to be overcome to translate NGS to the bedside of cancer patients.Overall,continuous dedication to apply NGS in clinical oncology practice will enable us to be one step closer to personalized medicine.

  1. Application of organ tolerance dose-constraints in clinical studies in radiation oncology

    International Nuclear Information System (INIS)

    In modern radiation oncology, tolerance dose-constraints for organs at risk (OAR) must be considered for treatment planning, but particularly in order to design clinical studies. Tolerance dose tables, however, only address one aspect of the therapeutic ratio of any clinical study, i.e., the limitation of adverse events, but not the desired potential improvement in the tumor effect of a novel treatment strategy. A sensible application of ''tolerance doses'' in a clinical situation requires consideration of various critical aspects addressed here: definition of tolerance dose, specification of an endpoint/symptom, consideration of radiation quality and irradiation protocol, exposed volume and dose distribution, and patient-related factors of radiosensitivity. The currently most comprehensive estimates of OAR radiation tolerance are in the QUANTEC compilations (2010). However, these tolerance dose values must only be regarded as a rough orientation and cannot answer the relevant question for the patients, i.e., if the study can achieve a therapeutic advantage; this can obviously be answered only by the final scientific analysis of the study results. Despite all limitations, the design of clinical studies should currently refer to the QUANTEC values for appreciation of the risk of complications, if needed supplemented by one's own data or further information from the literature. The implementation of a consensus on the safety interests of the patients and on an application and approval process committed to progress in medicine, with transparent quality-assuring requirements with regard to the structural safeguarding of the study activities, plays a central role in clinical research in radiation oncology. (orig.)

  2. Who Enrolls Onto Clinical Oncology Trials? A Radiation Patterns of Care Study Analysis

    International Nuclear Information System (INIS)

    Purpose: To identify factors significantly influencing accrual to clinical protocols by analyzing radiation Patterns of Care Study (PCS) surveys of 3,047 randomly selected radiotherapy (RT) patients. Methods and Materials: Patterns of Care Study surveys from disease sites studied for the periods 1992-1994 and 1996-1999 (breast cancer, n = 1,080; prostate cancer, n = 1,149; esophageal cancer, n = 818) were analyzed. The PCS is a National Cancer Institute-funded national survey of randomly selected RT institutions in the United States. Patients with nonmetastatic disease who received RT as definitive or adjuvant therapy were randomly selected from eligible patients at each institution. To determine national estimates, individual patient records were weighted by the relative contribution of each institution and patients within each institution. Data regarding participation in clinical trials were recorded. The factors age, gender, race, type of insurance, and practice type of treating institution (academic or not) were studied by univariate and multivariate analyses. Results: Overall, only 2.7% of all patients were accrued to clinical protocols. Of these, 57% were enrolled on institutional review board-approved institutional trials, and 43% on National Cancer Institute collaborative group studies. On multivariate analysis, patients treated at academic facilities (p = 0.0001) and white patients (vs. African Americans, p = 0.0002) were significantly more likely to participate in clinical oncology trials. Age, gender, type of cancer, and type of insurance were not predictive. Conclusions: Practice type and race significantly influence enrollment onto clinical oncology trials. This suggests that increased communication and education regarding protocols, particularly focusing on physicians in nonacademic settings and minority patients, will be essential to enhance accrual

  3. Bioluminescent imaging: a critical tool in pre-clinical oncology research.

    LENUS (Irish Health Repository)

    O'Neill, Karen

    2010-02-01

    Bioluminescent imaging (BLI) is a non-invasive imaging modality widely used in the field of pre-clinical oncology research. Imaging of small animal tumour models using BLI involves the generation of light by luciferase-expressing cells in the animal following administration of substrate. This light may be imaged using an external detector. The technique allows a variety of tumour-associated properties to be visualized dynamically in living models. The increasing use of BLI as a small-animal imaging modality has led to advances in the development of xenogeneic, orthotopic, and genetically engineered animal models expressing luciferase genes. This review aims to provide insight into the principles of BLI and its applications in cancer research. Many studies to assess tumour growth and development, as well as efficacy of candidate therapeutics, have been performed using BLI. More recently, advances have also been made using bioluminescent imaging in studies of protein-protein interactions, genetic screening, cell-cycle regulators, and spontaneous cancer development. Such novel studies highlight the versatility and potential of bioluminescent imaging in future oncological research.

  4. Minimal-invasive core needle biopsy of head and neck malignancies: Clinical evaluation for radiation oncology

    International Nuclear Information System (INIS)

    Background and purpose: Neck masses are common presentations of cancer and require tissue sampling to establish a diagnosis prior to the institution of adequate therapy. The purpose of this study was to evaluate the specific use and potential advantages of core needle biopsy (CNB) for radiation oncology in the head and neck. Materials and methods: We performed a retrospective analysis of 346 CNB procedures implemented in 165 patients with cervicofacial masses over a period of 56 months. Seventy-three patients had a history of malignancy, 43 had previously received radiation. Results: High-quality tissue cores were obtained from all patients. The target lesion was correctly sampled in 92.1% of patients. Final diagnosis was malignant in 115 patients, of whom 78 received radiotherapy. One biopsy result was false-negative. CNB was equally successful in the pre-irradiated patients and enabled institution of therapy in 92.3% of lymphoma patients. Conclusions: CNB is an efficient tool for tissue sampling of head and neck masses. The potential advantages of CNB for radiation oncology over fine needle aspiration and open surgical biopsy are discussed. CNB enables clinicians to make optimal therapeutic strategies and facilitates prompt referral to the relevant clinical team, both at initial presentation and during follow-up

  5. Clinically unsuspected pulmonary embolism-an important secondary finding in oncology CT

    International Nuclear Information System (INIS)

    AIM: To determine the rate of finding incidental pulmonary embolisms (PE) at staging or follow-up chest computed tomography (CT) in oncology patients. MATERIALS AND METHODS: Three hundred and eighty-five consecutive chest CT examinations, performed in patients with cancer, were prospectively assessed during a 9-month period between October 2003 and June 2004. These were spiral acquisitions between 5 and 8 mm collimation acquired 25 s after intravenous contrast medium administration. PE was diagnosed if a filling defect was seen in the central pulmonary arteries on two or more consecutive slices. RESULTS: Ten of 385 (2.6%) of these patients had incidentally detected PE. This was not attributable to any specific malignancy or chemotherapeutic regimen. These emboli were all central, between the main pulmonary artery and the lobar level. Although the significance of these findings in patients not clinically suspected of having PE could be contentious, all the patients were started on therapeutic anticoagulation as a result of this observation. CONCLUSION: Over one in 40 oncology patients have incidental central PE visible on the CT images performed to assess their malignancy. Formal review of the pulmonary arteries, using a work station, is advised in patients with malignancy

  6. Ethical issues of clinical trials in paediatric oncology from 2003 to 2013: a systematic review.

    Science.gov (United States)

    Dupont, Jean-Claude K; Pritchard-Jones, Kathy; Doz, François

    2016-05-01

    A state-of-the art approach to the debates on ethical issues is key in order to gain guidance on research practices involving sick children and adolescents, as well as to identify research avenues in which it might be worth cooperating, to generate better or supplementary evidence. Based on a systematic literature search using MEDLINE, we report the main ethical developments in paediatric oncology clinical trials from 2003-13. The present knowledge about normative and empirical ethical demands in this setting is quantified and summarised in a list of 46 issues. This list primarily aims to provide readers with a comprehensive account of the main decision nodes and professional attitudes that enable families to make a safe, competent, and satisfactory decision about their child's enrolment, or non-participation, in cancer clinical trials. Our systematic Review shows how important it is for professionals to engage in a constant reflection on optimum trial designs, on the effect of offering trial participation on key family dynamics, and on the ways to understand families' needs and values accurately. In view of present scientific developments, we further emphasise the need to enhance societal awareness about research in children and adolescents, to prevent so-called research fatigue in small populations due to multiple solicitations or inadequate legal demands, and to reassess longstanding ethical certainties in the strictest view of promoting sick children's interests. This systematic Review allows a series of questions to be drawn to guide and encourage collective and individual endeavours that should lead to constant improvements in our research practices in paediatric clinical oncology research. PMID:27301046

  7. Increasing Minority Enrollment Onto Clinical Trials: Practical Strategies and Challenges Emerge From the NRG Oncology Accrual Workshop.

    Science.gov (United States)

    Brooks, Sandra E; Muller, Carolyn Y; Robinson, William; Walker, Eleanor M; Yeager, Kate; Cook, Elise D; Friedman, Sue; Somkin, Carol P; Brown, Carol Leslie; McCaskill-Stevens, Worta

    2015-11-01

    Racial and ethnic diversity has historically been difficult to achieve in National Cancer Institute-sponsored clinical trials, even while as many as 80% of those trials have faced difficulty in meeting overall recruitment targets. In an attempt to address these issues, NRG Oncology recently convened a comprehensive workshop titled "Clinical Trials Enrollment: Challenges and Opportunities." Discussants at the workshop included representatives of the three legacy groups of the NRG (ie, Gynecologic Oncology Group, National Surgical Adjuvant Breast and Bowel Program, and Radiation Therapy Oncology Group), a minority-based community clinical oncology program, a large integrated health care system, the leadership of the National Cancer Institute, and a large patient advocacy group. This article summarizes the concepts discussed at the workshop, which included: needs assessments, infrastructural support, training of investigators and research staff, specific clinical trial recruitment strategies (both system and community based), and development and mentoring of young investigators. Many new, more specific tactics, including use of diverse cancer care settings, direct-to-consumer communication, and the need for centralized information technology such as the use of software to match trials to special populations, are presented. It was concluded that new, innovative trial designs and the realities of limited funding would require the adoption of effective and efficient recruiting strategies, specialized training, and stakeholder engagement. US clinical research programs must generate and embrace new ideas and pilot test novel recruitment strategies if they are to maintain their historic role as world leaders in cancer care innovation and delivery. PMID:26464496

  8. The roots of modern oncology: from discovery of new antitumor anthracyclines to their clinical use.

    Science.gov (United States)

    Cassinelli, Giuseppe

    2016-06-01

    In May 1960, the Farmitalia CEO Dr. Bertini and the director of the Istituto Nazionale dei Tumori of Milan Prof. Bucalossi (talent scout and city's Mayor) signed a research agreement for the discovery and development up to clinical trials of new natural antitumor agents. This agreement can be considered as a pioneering and fruitful example of a translational discovery program with relevant transatlantic connections. Owing to an eclectic Streptomyces, found near Castel del Monte (Apulia), and to the skilled and motivated participants of both institutions, a new natural antitumor drug, daunomycin, was ready for clinical trials within 3 years. Patent interference by the Farmitalia French partner was overcome by the good quality of the Italian drug and by the cooperation between Prof. Di Marco, director of the Istituto Ricerche Farmitalia Research Laboratories for Microbiology and Chemotherapy, and Prof. Karnofsky, head of the Sloan-Kettering Cancer Institute of New York, leading to the first transatlantic clinical trials. The search for daunomycin's sister anthracyclines led to the discovery and development of adriamycin, one of the best drugs born in Milan. This was the second act prologue of the history of Italian antitumor discovery and clinical oncology, which started in July 1969 when Prof. Di Marco sent Prof. Bonadonna the first vials of adriamycin (doxorubicin) to be tested in clinical trials. This article reviews the Milan scene in the 1960s, a city admired and noted for the outstanding scientific achievements of its private and public institutions in drugs and industrial product discovery. PMID:27103205

  9. Preliminary pediatric clinical evaluation of the oral probiotic Streptococcus salivarius K12 in preventing recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes and recurrent acute otitis media

    Directory of Open Access Journals (Sweden)

    Di Pierro F

    2012-11-01

    Full Text Available Francesco Di Pierro,1 Guido Donato,2 Federico Fomia,3 Teresa Adami,4 Domenico Careddu,5 Claudia Cassandro,6 Roberto Albera61Scientific Department, Velleja Research, Milano, 2ASL 1, Cuneo, 3ASL 3, Brescia, 4Infective Diseases, Verona, 5ASL 13, Novara, 6Surgical Science Department, Università degli Studi, Torino, ItalyBackground: The oral probiotic Streptococcus salivarius K12 has been shown clearly to antagonize the growth of Streptococcus pyogenes, the most important bacterial cause of pharyngeal infections in humans, by releasing two bacteriocins named salivaricin A2 and salivaricin B. Unpublished observations indicate that it can also antagonize the growth of other bacteria involved in acute otitis media. Because of its ability to colonize the oral cavity and its safety profile, we have tested its efficacy in reducing the incidence of streptococcal pharyngitis and/or tonsillitis and episodes of acute otitis media.Methods: We enrolled 82 children, including 65 with and 17 without a recent diagnosis of recurrent oral streptococcal pathology. Of those with recurrent pathology, 45 were treated daily for 90 days with an oral slow-release tablet containing five billion colony-forming units of S. salivarius K12 (Bactoblis®, and the remaining 20 served as an untreated control group. The 17 children without a recent diagnosis of recurrent oral pathology were used as an additional control group. After 90 days of treatment, a 6-month follow-up period without treatment was included to evaluate a possible persistent protective role for the previously administered product.Results: The 41 children who completed the 90-day course of Bactoblis showed a reduction in their episodes of streptococcal pharyngeal infection (about 90% and/or acute otitis media (about 40%, calculated by comparing infection rates in the previous year. The 90-day treatment also reduced the reported incidence of pharyngeal and ear infections by about 65% in the 6-month follow-up period

  10. K-12 Issues Will Await President

    Science.gov (United States)

    Hoff, David J.; Klein, Alyson

    2008-01-01

    At the end of a presidential campaign in which education received some attention but never emerged as a top-tier issue, analysts were trying to look beyond the week's election to the K-12 issues awaiting the next president and gauge where they might fit as a new administration prepares to grapple with a global economic crisis. While education…

  11. Teaching K-12 Students to Combat Obesity

    Science.gov (United States)

    Wallhead, Tristan

    2007-01-01

    Physical education is one of the most viable intervention programs to reach overweight and obese children. Since physical activity habits developed early in life are more likely to persist into adulthood, it is important for K-12 physical educators to teach the skills, knowledge, and attitudes that will motivate students to become more active. Two…

  12. Policy Shop Casts Long K-12 Shadow

    Science.gov (United States)

    Ujifusa, Andrew

    2012-01-01

    In nearly 40 years of legislative advocacy, the American Legislative Exchange Council (ALEC)--a free-market, limited-government group now drawing intense scrutiny for its support of a controversial self-defense law--has had a significant influence on K-12 education through its model legislation and work with state lawmakers to promote such…

  13. Virtual K-12 Leadership: A Postmodern Paradigm

    Science.gov (United States)

    Tucker, Tommy N.

    2014-01-01

    This phenomenological, mixed-method study compared and contrasted virtual K-12 school leadership with traditional face-to-face leadership. All 106 participants served for a minimum of two years in each setting. The study was conducted in two phases in order to reveal consensus and dissensus points of view. Conceptually, a postmodern framework was…

  14. Budget Pain Dampening K-12 Efforts

    Science.gov (United States)

    McNeil, Michele

    2009-01-01

    Governors and state lawmakers are poised to kick off their toughest legislative sessions in years, with the hope of sparing K-12 education from deep budget cuts in the face of mounting deficits--a far cry from the more typical push for new policy initiatives and school programs. Simply holding the line may prove difficult. Together, 31 states face…

  15. Music, K-12. Program of Studies.

    Science.gov (United States)

    Fairfax County Schools, VA.

    This program of studies defines the K-12 instructional program in music developed by the Fairfax County Public Schools, Virginia. The guide contains a general rationale for teaching music, program flow chart, and descriptions of programs in general music, vocal music, and instrumental music. Each general program description includes requisites for…

  16. K12 Inc. Scraps India Outsourcing

    Science.gov (United States)

    Trotter, Andrew

    2008-01-01

    A company that runs one of the nation's largest networks of online schools recently decided to discontinue a program that arranged for high school teachers in the United States to send their students' English essays to India for evaluations by reviewers there. The existence of the program by Herndon, Virginia-based K12 Inc. is an example of the…

  17. A New K-12 Computer Science Curriculum

    Science.gov (United States)

    Tucker, Allen B.

    2004-01-01

    Although there are numerous challenges for implementing a comprehensive K-12 computer science curriculum in the United States, the need is obvious, and the time to begin is now. Computer science is a well-established academic discipline at the collegiate and postgraduate levels, as well as a distinct and important profession in the world economy.…

  18. Impact of an oncology palliative care clinic on access to home care services.

    Science.gov (United States)

    Jang, Raymond W; Burman, Debika; Swami, Nadia; Kotler, Jennifer; Banerjee, Subrata; Ridley, Julia; Mak, Ernie; Bryson, John; Rodin, Gary; Le, Lisa W; Zimmermann, Camilla

    2013-08-01

    Home care (HC) is important for patients with cancer as performance status declines. Our study of 1224 patients at a Canadian cancer center examined the impact of an oncology palliative care clinic (OPCC) on HC referral. The HC referral frequency was calculated before and after the first OPCC consultation, in total and according to performance status (Palliative Performance Scale, PPS). Characteristics associated with HC referral were investigated. After the first OPCC consultation, there was an increase in HC referral from 39% (477 of 1224; 49% of those with PPS ≤60) to 69% (841 of 1224; 88% of those with PPS ≤60). Factors independently associated with HC referral were poor PPS (P < .001) and older age (P = .003). Thus OPCC involvement resulted in markedly increased HC referrals, particularly for older patients with poor performance status. PMID:22777408

  19. Research biopsies in the context of early phase oncology studies: clinical and ethical considerations

    Directory of Open Access Journals (Sweden)

    Matilde Saggese

    2013-08-01

    Full Text Available The Personalized Medicine approach in oncology is a direct result of an improved understanding of complex tumor biology and advances in diagnostic technologies. In recent years, there has been an increased demand for archival and fresh tumor analysis in early clinical trials to foster proof-of-concept biomarker development, to understand resistance mechanisms, and ultimately to assess biological response. Although phase I studies are aimed at defining drug safety, pharmacokinetics, and to recommend a phase II dose for further testing, there is now increasing evidence of mandatory tumor biopsies even at the earliest dose-finding stages of drug development. The increasing demand for fresh tumor biopsies adds to the complexity of novel phase I studies and results in different challenges, ranging from logistical support to ethical concerns. This paper investigates key issues, including patients’ perceptions of research biopsies, the need for accurate informed consent, and alternative strategies that may guide the drug development process.

  20. Research biopsies in the context of early phase oncology studies: clinical and ethical considerations

    Directory of Open Access Journals (Sweden)

    Matilde Saggese

    2013-04-01

    Full Text Available The ‘Personalised medicine’ approach in oncology is a direct result of improved understanding of complex tumour biology and advances in diagnostic technologies. In recent years there has been an increased demand for archival and fresh tumour analysis in early clinical trials to foster-proof-of-concept biomarker development, understand resistance mechanisms and ultimately to assess biological response. Although phase-1 studies are aimed to define drug safety, pharmacokinetics and to recommend a phase-2 dose for further testing, there is now increasing evidence of mandatory tumour biopsies even at the earliest dose-finding stages of drug development. The increasing demand for fresh tumour biopsies adds to the complexity of novel phase-1 studies and results in different challenges ranging from logistical support to ethical concerns. This paper investigates key issues including patients’ perceptions towards research biopsies, the need for accurate informed consent and alternative strategies that may guide in the drug development process.

  1. Clinical guidance on the perioperative use of targeted agents in solid tumor oncology.

    Science.gov (United States)

    Mellor, James D; Cassumbhoy, Michelle; Jefford, Michael

    2011-06-01

    The use of targeted anti-cancer agents is increasing. It is common to utilize a multi-modal treatment approach towards solid tumors, often including surgical resection, and it has become apparent that some targeted agents can impair wound healing or cause an increased risk of perioperative complications. This article reviews targeted agents used in solid tumor oncology with an emphasis on clinically relevant details. Overall, the evidence of targeted agents causing surgical complications is limited. The greatest amount of evidence exists for bevacizumab causing perioperative complications, possibly due to its extended half-life. There are limited data for cetuximab, sorafenib and sunitinib and very little for other solid tumor targeted agents. Our findings suggest that there should be heightened pharmacovigilence around targeted agents with respect to perioperative complications and increased post-surgical support for patients to aid early detection of postoperative complications until definitive data become available. PMID:21585689

  2. RADIATION THERAPY ONCOLOGY GROUP TRANSLATIONAL RESEARCH PROGRAM STEM CELL SYMPOSIUM : INCORPORATING STEM CELL HYPOTHESES INTO CLINICAL TRIALS

    NARCIS (Netherlands)

    Woodward, Wendy A.; Bristow, Robert G.; Clarke, Michael F.; Coppes, Robert P.; Cristofanilli, Massimo; Duda, Dan G.; Fike, John R.; Hambardzumyan, Dolores; Hill, Richard P.; Jordan, Craig T.; Milas, Luka; Pajonk, Frank; Curran, Walter J.; Dicker, Adam P.; Chen, Yuhchyau

    2009-01-01

    At a meeting of the Translation Research Program of the Radiation Therapy Oncology Group held in early 2008, attendees focused on updating the current state of knowledge in cancer stem cell research and discussing ways in which this knowledge can be translated into clinical use across all disease si

  3. Clinical trends and outcomes of male breast cancer: Experience of a tertiary oncology centre in India

    Directory of Open Access Journals (Sweden)

    Anindya Mukherjee

    2014-08-01

    Full Text Available Purpose: Because of its rarity in any oncology centre, the clinical trends of male breast cancer specific to its geographical distribution have remained relatively unexplored. This study was done to analyze the clinico-pathological data, treatment given and survival patterns of male breast cancer patients visiting our tertiary medical centre and compare our results with available literature. Methods: All male breast cancer patients registered at our clinic from 2003 to 2009 were included. Frequency distribution analysis of the demographic and clinico-pathological data and treatment variables was done. Treatment outcome was examined from Kaplan-Meir survival estimates. Results: Thirty-three male breast cancer patients were encountered. The median age of presentation was sixty years. Mostly (87.9% they presented with lump in breast or axilla and were clinically staged to be ‘3’ (57.6%.Obesity and alcohol were the commonest risk factors identified. Modified radical mastectomy was the commonest (69.6% definitive therapy rendered with (only for clinically staged 3 patients or without neo-adjuvant chemotherapy. Infiltrating ductal carcinoma was identified in most cases. Twenty-two patients received adjuvant chemotherapy and twenty-four received adjuvant radiotherapy. Eighteen (54.5% patients were hormone-receptor positive and received tamoxifen. The median Overall survival (OS and Progression-free survival (PFS came out to be 14.3 months (standard error, SE of 1.185; 95% confidence interval, CI 12-16.6 and 15.7 (SE 5.35, 95% CI 5.2-26.19 months respectively.Conclusion: Male breast cancers usually carry a poor prognosis due to presentation at later stages. Most of our results correlate with previous literature. Multi-centric prospective studies are required to validate the etiological factors and prognostic determinants of survival.-----------------------------Cite this article as: Mukherjee A, Saha A, Chattopadhyay S, Sur P. Clinical trends and

  4. The role of radiation therapy in pediatric oncology as assessed by cooperative clinical trials

    International Nuclear Information System (INIS)

    Major advances have been made in pediatric oncology, and many are due to the advent of the cooperative clinical trial. This important research tool was originally developed for the testing of various therapeutic strategies for the management of children with acute leukemia. Such trials were eminently successful, as the consistently better long-term survival rates for children with this hitherto uniformly lethal disease can attest. The method soon found favor for the investigation of patients with so-called solid tumors. These trails were originally concerned with the elucidation of the value of various chemotherapeutic agents. Radiation therapists soon became involved, however, and this discipline became more heavily represented in study design and data analyses. Much radiation therapy information has been gained, some through prospective, randomized clinical investigations and some through retrospective reviews of roentgen therapy as it was employed in protocols accenting other aspects of care. Voluminous, important radiation therapy data have been deduced through the latter retrospective kinds of analyses, but this review will be confined largely to the published results of prospective, randomized cooperative clinical trials where radiation therapy was a governing variable. Certain investigations of historical interest will also be cited together with other results that established important principles even though not so rigorous in design

  5. Next-Generation Sequencing in Clinical Oncology: Next Steps Towards Clinical Validation

    OpenAIRE

    Nigel C Bennett; Farah, Camile S.

    2014-01-01

    Compelling evidence supports the transition of next generation sequencing (NGS) technology from a research environment into clinical practice. Before NGS technologies are fully adopted in the clinic, they should be thoroughly scrutinised for their potential as powerful diagnostic and prognostic tools. The importance placed on generating accurate NGS data, and consequently appropriate clinical interpretation, has stimulated much international discussion regarding the creation and implementatio...

  6. Clinical Training of Medical Physicists Specializing in Radiation Oncology (French Ed.)

    International Nuclear Information System (INIS)

    The application of radiation in human health, for both diagnosis and treatment of disease, is an important component of the work of the IAEA. The responsibility for the increasing technical aspects of this work is undertaken by the medical physicist. To ensure good practice in this vital area structured clinical training programmes are required to complement academic learning. This publication is intended to be a guide to the practical implementation of such a programme for radiation therapy. There is a general and growing awareness that radiation medicine is increasingly dependant on well trained medical physicists that are based in the clinical setting. However an analysis of the availability of medical physicists indicates a large shortfall of qualified and capable professionals. This is particularly evident in developing countries. While strategies to increase academic educational opportunities are critical to such countries, the need for guidance on structured clinical training was recognised by the members of the Regional Cooperative Agreement (RCA) for research, development and training related to nuclear sciences for Asia and the Pacific. Consequently a technical cooperation regional project (RAS6038) under the RCA programme was formulated to address this need in the Asia Pacific region by developing suitable material and establishing its viability. Development of a clinical training guide for medical physicists specialising in radiation therapy was started in 2005 with the appointment of a core drafting committee of regional and international experts. Since 2005 the IAEA has convened two additional consultant group meetings including additional experts to prepare the present publication. The publication drew heavily, particularly in the initial stages, from the experience and documents of the Clinical Training Programme for Radiation Oncology Medical Physicists as developed by the Australasian College of Physical Scientists and Engineers in Medicine. Their

  7. Clinical Training of Medical Physicists Specializing in Radiation Oncology (Spanish Ed.)

    International Nuclear Information System (INIS)

    The application of radiation in human health, for both diagnosis and treatment of disease, is an important component of the work of the IAEA. The responsibility for the increasing technical aspects of this work is undertaken by the medical physicist. To ensure good practice in this vital area structured clinical training programmes are required to complement academic learning. This publication is intended to be a guide to the practical implementation of such a programme for radiation therapy. There is a general and growing awareness that radiation medicine is increasingly dependant on well trained medical physicists that are based in the clinical setting. However an analysis of the availability of medical physicists indicates a large shortfall of qualified and capable professionals. This is particularly evident in developing countries. While strategies to increase academic educational opportunities are critical to such countries, the need for guidance on structured clinical training was recognised by the members of the Regional Cooperative Agreement (RCA) for research, development and training related to nuclear sciences for Asia and the Pacific. Consequently a technical cooperation regional project (RAS6038) under the RCA programme was formulated to address this need in the Asia Pacific region by developing suitable material and establishing its viability. Development of a clinical training guide for medical physicists specialising in radiation therapy was started in 2005 with the appointment of a core drafting committee of regional and international experts. Since 2005 the IAEA has convened two additional consultant group meetings including additional experts to prepare the present publication. The publication drew heavily, particularly in the initial stages, from the experience and documents of the Clinical Training Programme for Radiation Oncology Medical Physicists as developed by the Australasian College of Physical Scientists and Engineers in Medicine. Their

  8. Clinical Training of Medical Physicists Specializing in Radiation Oncology (Russian Ed.)

    International Nuclear Information System (INIS)

    The application of radiation in human health, for both diagnosis and treatment of disease, is an important component of the work of the IAEA. The responsibility for the increasing technical aspects of this work is undertaken by the medical physicist. To ensure good practice in this vital area structured clinical training programmes are required to complement academic learning. This publication is intended to be a guide to the practical implementation of such a programme for radiation therapy. There is a general and growing awareness that radiation medicine is increasingly dependant on well trained medical physicists that are based in the clinical setting. However an analysis of the availability of medical physicists indicates a large shortfall of qualified and capable professionals. This is particularly evident in developing countries. While strategies to increase academic educational opportunities are critical to such countries, the need for guidance on structured clinical training was recognised by the members of the Regional Cooperative Agreement (RCA) for research, development and training related to nuclear sciences for Asia and the Pacific. Consequently a technical cooperation regional project (RAS6038) under the RCA programme was formulated to address this need in the Asia Pacific region by developing suitable material and establishing its viability. Development of a clinical training guide for medical physicists specialising in radiation therapy was started in 2005 with the appointment of a core drafting committee of regional and international experts. Since 2005 the IAEA has convened two additional consultant group meetings including additional experts to prepare the present publication. The publication drew heavily, particularly in the initial stages, from the experience and documents of the Clinical Training Programme for Radiation Oncology Medical Physicists as developed by the Australasian College of Physical Scientists and Engineers in Medicine. Their

  9. Perceptions and Referral Trends into Phase I Oncology Trials: Results of a Clinical Survey

    Directory of Open Access Journals (Sweden)

    Andre Brunetto

    2011-01-01

    Full Text Available Introduction. A survey was sent to referring oncologists (ROs to explore the reasons behind their referral patterns and perceptions of Phase I studies before and after being provided with outcome data from advanced colorectal cancer (ACRC patients who participated in Phase I trials at the Royal Marsden Hospital (RMH. Results. The response rate was 32/50 (64%. The most common reason for referral was exhaustion of standard treatments (31%, and the main reason for referring to the RMH was proximity to patients (28%. The most frequent clinical parameter assessed prior to referral was performance status (93%. ROs spent a median of 15 min (range: 5–45 min discussing general aspects of Phase I trials. In the second part of the questionnaire, after reviewing clinical outcome data of ACRC patients who participated in Phase I trials, 47% would change their approach, specifically, spend more time to discuss risks and benefits of Phase I trials (9%, consider prognostic factors before referral (13%, and increase the number of referrals (25%. Conclusion. This is the first report focusing on communication between ROs and a specialist Phase I unit. Outcome reporting can improve communication with ROs and importantly has the potential for better patient selection considered for Phase I oncology trials.

  10. Radiation oncology

    International Nuclear Information System (INIS)

    The Radiation Oncology Division has had as its main objectives both to operate an academic training program and to carry out research on radiation therapy of cancer. Since fiscal year 1975, following a directive from ERDA, increased effort has been given to research. The research activities have been complemented by the training program, which has been oriented toward producing radiation oncologists, giving physicians short-term experience in radiation oncology, and teaching medical students about clinical cancer and its radiation therapy. The purpose of the research effort is to improve present modalities of radiation therapy of cancer. As in previous years, the Division has operated as the Radiation Oncology Program of the Department of Radiological Sciences of the University of Puerto Rico School of Medicine. It has provided radiation oncology support to patients at the University Hospital and to academic programs of the University of Puerto Rico Medical Sciences Campus. The patients, in turn, have provided the clinical basis for the educational and research projects of the Division. Funding has been primarily from PRNC (approx. 40%) and from National Cancer Institute grants channeled through the School of Medicine (approx. 60%). Special inter-institutional relationships with the San Juan Veterans Administration Hospital and the Metropolitan Hospital in San Juan have permitted inclusion of patients from these institutions in the Division's research projects. Medical physics and radiotherapy consultations have been provided to the Radiotherapy Department of the VA Hospital

  11. K-12 Teaching and Physics Enrollment

    Science.gov (United States)

    Masood, Samina

    2007-03-01

    We have collected and analyzed the relevant data from public schools in greater Houston area of Texas. Based on this analysis, we propose a few recommendations towards the improvement of science education in Texas Schools, in general, and greater Houston area schools in particular. Our results indicate that the quality of science education can be improved by organizing teacher training programs at K-12 level as school education plays a pivotal role in the decrease in physics enrollment at the higher level. Similar analysis can actually be generalized to other states to find out the best way to increase the physics enrollment.

  12. The script concordance test in radiation oncology: validation study of a new tool to assess clinical reasoning

    International Nuclear Information System (INIS)

    The Script Concordance test (SCT) is a reliable and valid tool to evaluate clinical reasoning in complex situations where experts' opinions may be divided. Scores reflect the degree of concordance between the performance of examinees and that of a reference panel of experienced physicians. The purpose of this study is to demonstrate SCT's usefulness in radiation oncology. A 90 items radiation oncology SCT was administered to 155 participants. Three levels of experience were tested: medical students (n = 70), radiation oncology residents (n = 38) and radiation oncologists (n = 47). Statistical tests were performed to assess reliability and to document validity. After item optimization, the test comprised 30 cases and 70 questions. Cronbach alpha was 0.90. Mean scores were 51.62 (± 8.19) for students, 71.20 (± 9.45) for residents and 76.67 (± 6.14) for radiation oncologists. The difference between the three groups was statistically significant when compared by the Kruskall-Wallis test (p < 0.001). The SCT is reliable and useful to discriminate among participants according to their level of experience in radiation oncology. It appears as a useful tool to document the progression of reasoning during residency training

  13. Monitoring of patients in the Oncology department of the Clinical Hospital

    International Nuclear Information System (INIS)

    An important number of patients that visit the Oncology department o the Clinicas Hospital lost sight at some stage of their evolution. Our objective was to quantify the proportion of patients who are lost and describe the time spent in the service and its relationship with variables such as age, sex, origin of the patient and progress of the disease, for which we performed a descriptive observational study with an analytical component of 435 stories clinics patients with confirmed diagnosis of cancer, treated from January 2001 to December 2004, in order to have a minimum of 5 years of follow-up potential. Data were processed with Excel 2003. Patients had between 15-85 years old with a mean and median of 52 ± 14 years DS. Two hundred Seventy women and 165 were men, 232 were from the metropolitan area. The time of length of service was 0-114 months with a median of 8 and an average DS 21 months ± 27 months. As of December 2009 31 117 patients had died 36 remained in control and 282 were lost from sight. We found no relationship between age (p = 0.1) nor the state of progress of the disease at diagnosis (p = 0.21) If there were significant differences with greater probability of loss tracking men (p = 0.009) and from sites outside the metropolitan area (p = 0.04). The number of patients who are lost is very large and we must develop strategies more effective monitoring

  14. IAEA training course series TCS-37 clinical training of medical physicists specializing in radiation oncology

    International Nuclear Information System (INIS)

    Training program IAEA TCS-37 (Training course series No.37) 'Clinical Training Specializing in Radiation Oncology (2009)' was fixed to practical training syllabus at faculty and graduate course of medical physics of a university. TCS-47 for diagnostic radiology (2010) and TCS-50 for nuclear medicine (2011) were also involved in the syllabus. These training courses had been developed by IAEA RCA RAS6038 project since 2002. In this paper, first, comparison with other training programs in the world was made in terms of (1) Degree of extent of subject or field, (2) Concreteness or specificity, (3) Degree of completion, (4) Method of certification and (5) Practicability. IAEA TCS series got the most points among ten programs such as EMERALD/EMIT, AAPM rpt. No.90 and CAMPEP accredited programs. Second, TCS-37, TCS-47 and TCS-50 were broken down to 6, 5 and 6 subjects of training course respectively. Third, each subject was further broken down to 15 times of training schedule where every time was composed by 3 hours of training. Totally 45 hours of a subject were assigned to one semester for getting one unit of credit. Seventeen units should be credited up to three years in graduate course to finish the whole program. (author)

  15. Integrative oncology drug discovery accompanied by preclinical translational research as prerequisite for clinical development.

    Science.gov (United States)

    Hoffmann, Jens

    2014-06-01

    The molecular heterogeneity of cancer calls for individualized therapies to become the standard of care. It is now generally accepted that target-specific compounds require specific new development programs. But, even for new drugs with general mode of action (i.e., chemotherapy), tailored treatment approaches, such as specific schedules or combinations, have been shown to improve the therapeutic outcome. Therefore, the preclinical development of new therapeutic agents needs, next to the "classical pharmacodynamic studies", the implementation of integrative translational research (TR) as early as possible. New TR approaches, starting already at target identification and validation (TIV) will allow to defining the optimal patient population for clinical development, to tailor individual treatment of the tumor disease and to choose a rational basis among the manifold options for treatment combinations. We will discuss several examples from TR studies, which have initially been started to evaluate the molecular mode of action and to recognize mechanisms which can lead to resistance. Research was extended later to identify predictive response biomarkers and establish a rationale for combination with different therapies. A detailed gene expression analysis of lung cancer cells and apoptotic pathway interference studies in colon cancer cells provided insight in the molecular mechanisms of action. These new findings are correlated with results from other studies performed during the preclinical development program. We discuss pros and cons, successes and failures of our integrative preclinical development program and provide recommendations for future oncology projects. PMID:25841411

  16. American Society of Clinical Oncology policy statement update: genetic testing for cancer susceptibility.

    Science.gov (United States)

    2003-06-15

    As the leading organization representing cancer specialists involved in patient care and clinical research, the American Society of Clinical Oncology (ASCO) reaffirms its commitment to integrating cancer risk assessment and management, including molecular analysis of cancer predisposition genes, into the practice of oncology and preventive medicine. The primary goal of this effort is to foster expanded access to, and continued advances in, medical care provided to patients and families affected by hereditary cancer syndromes. The 1996 ASCO Statement on Genetic Testing for Cancer Susceptibility set forth specific recommendations relating to clinical practice, research needs, educational opportunities, requirement for informed consent, indications for genetic testing, regulation of laboratories, and protection from discrimination, as well as access to and reimbursement for cancer genetics services. In updating this Statement, ASCO endorses the following principles: Indications for Genetic Testing: ASCO recommends that genetic testing be offered when 1) the individual has personal or family history features suggestive of a genetic cancer susceptibility condition, 2) the test can be adequately interpreted, and 3) the results will aid in diagnosis or influence the medical or surgical management of the patient or family members at hereditary risk of cancer. ASCO recommends that genetic testing only be done in the setting of pre- and post-test counseling, which should include discussion of possible risks and benefits of cancer early detection and prevention modalities. Special Issues in Testing Children for Cancer Susceptibility: ASCO recommends that the decision to offer testing to potentially affected children should take into account the availability of evidence-based risk-reduction strategies and the probability of developing a malignancy during childhood. Where risk-reduction strategies are available or cancer predominantly develops in childhood, ASCO believes that

  17. Genetic Risk Assessment for Women with Epithelial Ovarian Cancer: Referral Patterns and Outcomes in a University Gynecologic Oncology Clinic

    OpenAIRE

    Petzel, Sue v.; Vogel, Rachel Isaksson; Bensend, Tracy; Leininger, Anna; Argenta, Peter A.; Geller, Melissa A.

    2013-01-01

    Little is known about genetic service utilization and ovarian cancer. We identified the frequency and outcome of genetic counseling referral, predictors of referral, and referral uptake for ovarian cancer patients. Using pathology reports, we identified all epithelial ovarian cancer patients seen in a university gynecologic oncology clinic (1/04–8/06). Electronic medical records (EMR) were used to document genetic service referral, time from diagnosis-to-referral, point-in-treatment at referr...

  18. GNOSIS: Guidelines for neuro-oncology: Standards for investigational studies—reporting of phase 1 and phase 2 clinical trials

    Science.gov (United States)

    Chang, Susan M.; Reynolds, Sharon L.; Butowski, Nicholas; Lamborn, Kathleen R.; Buckner, Jan C.; Kaplan, Richard S.; Bigner, Darell D.

    2005-01-01

    We present guidelines to standardize the reporting of phase 1 and phase 2 neuro-oncology trials. The guidelines are also intended to assist with accurate interpretation of results from these trials, to facilitate the peer-review process, and to expedite the publication of important and accurate manuscripts. Our guidelines are summarized in a checklist format that can be used as a framework from which to construct a phase 1 or 2 clinical trial. PMID:16212807

  19. Invited Commentary: “Risk Factors for Renal Cell Cancer in a Japanese Population” Published in Clinical Medicine: Oncology

    OpenAIRE

    Esther Uña Cidon

    2009-01-01

    The well-written and researched article reported in Clinical Medicine: Oncology by Dr. Washio and Dr. Mori entitled “Risk factors for renal cell cancer in a Japanese population”1 makes evident the differences in incidence and mortality rates from renal cell carcinoma (RCC) between different populations and highlights the relevance of carrying out epidemiological studies, investigating additional risk factors which may explain the differences.

  20. Invited Commentary: “Risk Factors for Renal Cell Cancer in a Japanese Population” Published in Clinical Medicine: Oncology

    Directory of Open Access Journals (Sweden)

    Esther Uña Cidon

    2009-01-01

    Full Text Available The well-written and researched article reported in Clinical Medicine: Oncology by Dr. Washio and Dr. Mori entitled “Risk factors for renal cell cancer in a Japanese population”1 makes evident the differences in incidence and mortality rates from renal cell carcinoma (RCC between different populations and highlights the relevance of carrying out epidemiological studies, investigating additional risk factors which may explain the differences.

  1. The usage of three-dimensional nanostructurized biomaterials in experimental and clinical oncology

    Institute of Scientific and Technical Information of China (English)

    Sergeeva; N.; S.; Reshetov; I.; V.; Sviridova; I.; K.; Kirsanova; V.; A.; Achmedova; S.; A.; Barinov; S.; M.; Komlev; V.; S.; Samoylovich; M.; I.; Belyanin; A.; F.; Kleshcheva; S.; M.; Elinson; V.; M.

    2005-01-01

    The usage of biotransplants for substitution of tissue defects (in particular in reconstructive surgery in oncology) require both he suitable cell cultures and different biomaterials with definite and regulate properties.……

  2. The usage of three-dimensional nanostructurized biomaterials in experimental and clinical oncology

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    @@ The usage of biotransplants for substitution of tissue defects (in particular in reconstructive surgery in oncology) require both he suitable cell cultures and different biomaterials with definite and regulate properties.

  3. Active Surveillance for the Management of Localized Prostate Cancer (Cancer Care Ontario Guideline): American Society of Clinical Oncology Clinical Practice Guideline Endorsement

    OpenAIRE

    Chen, RC; Rumble, RB; Loblaw, DA; Finelli, A.; Ehdaie, B; Cooperberg, MR; Morgan, SC; Tyldesley, S; Haluschak, JJ; Tan, W.; Justman, S; Jain, S

    2016-01-01

    To endorse Cancer Care Ontario's guideline on Active Surveillance for the Management of Localized Prostate Cancer. The American Society of Clinical Oncology (ASCO) has a policy and set of procedures for endorsing clinical practice guidelines developed by other professional organizations.The Active Surveillance for the Management of Localized Prostate Cancer guideline was reviewed for developmental rigor by methodologists. The ASCO Endorsement Panel then reviewed the content and the recommenda...

  4. Do Case Rates Affect Physicians' Clinical Practice in Radiation Oncology?: An Observational Study

    Science.gov (United States)

    Loy, Bryan A.; Shkedy, Clive I.; Powell, Adam C.; Happe, Laura E.; Royalty, Julie A.; Miao, Michael T.; Smith, Gary L.; Long, James W.; Gupta, Amit K.

    2016-01-01

    Case rate payments combined with utilization monitoring may have the potential to improve the quality of care by reducing over and under-treatment. Thus, a national managed care organization introduced case rate payments at one multi-site radiation oncology provider while maintaining only fee-for-service payments at others. This study examined whether the introduction of the payment method had an effect on radiation fractions administered when compared to clinical guidelines. The number of fractions of radiation therapy delivered to patients with bone metastases, breast, lung, prostate, and skin cancer was assessed for concordance with clinical guidelines. The proportion of guideline-based care ascertained from the payer's claims database was compared before (2011) and after (2013) the payment method introduction using relative risks (RR). After the introduction of case rates, there were no significant changes in guideline-based care in breast, lung, and skin cancer; however, patients with bone metastases and prostate cancer were significantly more likely to have received guideline-based care (RR = 2.0 and 1.1, respectively, p<0.05). For the aggregate of all cancers, the under-treatment rate significantly declined (p = 0.008) from 4% to 0% after the introduction of case rate payments, while the over-treatment rate remained steady at 9%, with no significant change (p = 0.20). These findings suggest that the introduction of case rate payments did not adversely affect the rate of guideline-based care at the provider examined. Additional research is needed to isolate the effect of the payment model and assess implications in other populations. PMID:26870963

  5. Do Case Rates Affect Physicians' Clinical Practice in Radiation Oncology?: An Observational Study.

    Directory of Open Access Journals (Sweden)

    Bryan A Loy

    Full Text Available Case rate payments combined with utilization monitoring may have the potential to improve the quality of care by reducing over and under-treatment. Thus, a national managed care organization introduced case rate payments at one multi-site radiation oncology provider while maintaining only fee-for-service payments at others. This study examined whether the introduction of the payment method had an effect on radiation fractions administered when compared to clinical guidelines. The number of fractions of radiation therapy delivered to patients with bone metastases, breast, lung, prostate, and skin cancer was assessed for concordance with clinical guidelines. The proportion of guideline-based care ascertained from the payer's claims database was compared before (2011 and after (2013 the payment method introduction using relative risks (RR. After the introduction of case rates, there were no significant changes in guideline-based care in breast, lung, and skin cancer; however, patients with bone metastases and prostate cancer were significantly more likely to have received guideline-based care (RR = 2.0 and 1.1, respectively, p<0.05. For the aggregate of all cancers, the under-treatment rate significantly declined (p = 0.008 from 4% to 0% after the introduction of case rate payments, while the over-treatment rate remained steady at 9%, with no significant change (p = 0.20. These findings suggest that the introduction of case rate payments did not adversely affect the rate of guideline-based care at the provider examined. Additional research is needed to isolate the effect of the payment model and assess implications in other populations.

  6. Compliance with therapeutic guidelines in Radiation Therapy Oncology Group prospective gastrointestinal clinical trials

    International Nuclear Information System (INIS)

    Background: This report analyzes the adherence to radiation therapy protocol guidelines in contemporary Radiation Therapy Oncology Group (RTOG) gastrointestinal trials. We aim to provide insight into current standards and compliance of radiation therapy field design and administration. Methods: From 1994 to 2006, the Gastrointestinal Cancer Committee of the RTOG initiated and completed 15 phase I–III clinical trials utilizing radiation therapy in the multimodality treatment of gastrointestinal cancers. In each protocol, details for planning and executing radiation therapy were outlined and each protocol contained scoring criteria for these components of radiation therapy, characterized according to per-protocol, variation acceptable and deviation unacceptable. Review of treatment planning and implementation was performed in all studies following therapy completion. Results: Radiation therapy planning and implementation was reviewed in 2309 of 2312 (99.9%) patients. The mean rate of compliance over all for the 15 protocols was 65% (total of the 2309 analyzed patients). The mean variation acceptable rate was 21% whereas the mean deviation unacceptable rate was 5%. The mean “other” rate (no RT given or incomplete RT due to death, progression or refusal) was 8%. Two of the 15 trials (13%) had deviation unacceptable rates >10%. In four studies incorporating pre-treatment review of radiation therapy planning and treatment, compliance with protocol therapy was enhanced. Conclusions: The fidelity of radiation planning and execution detailed in protocol to actual therapy is heterogeneous, with a mean per-protocol rate of 65%. As clinical trials evolve, available technology should permit efficient pre-treatment review processes, thus facilitating compliance to protocol therapy. These analyses should also permit prospective analysis of outcome measures by compliance to therapy.

  7. Sociodemographic analysis of patients in radiation therapy oncology group clinical trials

    International Nuclear Information System (INIS)

    Purpose: To assess the degree to which the sociodemographic characteristics of patients enrolled in Radiation Therapy Oncology Group (RTOG) clinical trails are representative of the general population. Methods and Materials: Sociodemographic data were collected on 4016 patients entered in 33 open RTOG studies between July 1991 and June 1994. The data analyzed included educational attainment, age, gender, and race. For comparison, we obtained similar data from the U.S. Department of Census. We also compared our RTOG data with Surveillance Epidemiology and End Results (SEER) data for patients who received radiation therapy, to determine how RTOG patients compared with cancer patients in general, and with patients with cancers at sites typically treated with radiotherapy. Results: Overall, the sociodemographic characteristics of patients entered in RTOG trials were similar to those of the Census data. We found that, in every age group of African-American men and at nearly every level of educational attainment, the proportion of RTOG trial participants mirrored the proportion in the census data. Significant differences were noted only in the youngest category of African-American men, where the RTOG accrues more in the lower educational categories and fewer with college experience. For African-American women, we found a similar pattern in every age group and at each level of educational attainment. As with men, RTOG trials accrued a considerably larger proportion of younger, less educated African-American women than the census reported. Using SEER for comparison, the RTOG enrolled proportionately more African-American men to trials all cancer sites combined, and for prostate and head and neck cancer. In head and neck trials, the RTOG enrolled nearly twice as many African-American men than would be predicted by SEER data. In lung cancer trials, RTOG underrepresented African-American men significantly; however, there was no difference for brain cancer trials. There were

  8. Radiation Therapy Oncology Group Translational Research Program Stem Cell Symposium: Incorporating Stem Cell Hypotheses into Clinical Trials

    International Nuclear Information System (INIS)

    At a meeting of the Translation Research Program of the Radiation Therapy Oncology Group held in early 2008, attendees focused on updating the current state of knowledge in cancer stem cell research and discussing ways in which this knowledge can be translated into clinical use across all disease sites. This report summarizes the major topics discussed and the future directions that research should take. Major conclusions of the symposium were that the flow cytometry of multiple markers in fresh tissue would remain the standard technique of evaluating cancer-initiating cells and that surrogates need to be developed for both experimental and clinical use.

  9. Clinical Significance of Myocardial Uptake on F-18 FDG PET/CT Performed in Oncologic Patients

    International Nuclear Information System (INIS)

    F-18 fluorodeoxyglucose (FDG) uptake of myocardium is influenced by various factors. Increased glycolysis, and subsequent increased F-18 FDG uptake has been reported in ischemic cardiomyopathy. However, clinical significance of incidentally found myocardial F-18 FDG uptake has not been clarified. We retrospectively reviewed the degree and pattern of myocardial uptake in patients without history of ischemic heart disease who underwent torso F-18 FDG PET/CT for evaluation of neoplastic disease. From January 2005 to June 2009, 77 patients who underwent F-18 FDG PET/CT and Tc-99m sestamibi stress/rest SPECT within 3 months were enrolled. Of 77 patients, 55 (71.4%) showed increased F-18 FDG uptake in the myocardium. In this population, 40 showed uniform uptake pattern, while 15 showed focal uptake. In patients with uniform uptake, 17 showed decreased uptake in the septum without perfusion defect on myocardial SPECT. Remaining 23 patients showed uniform uptake, with 1 reversible perfusion defect and 1 fixed perfusion defect. In 15 patients with focal uptake, 9 showed increased F-18 FDG uptake in the base, and only 1 of them showed reversible perfusion defect on myocardial SPECT. In the remaining 6 focal uptake group, 4 had reversible perfusion defect in the corresponding wall, and 1 had apical hypertrophy. We demonstrated that septal defect pattern and basal uptake pattern in the myocardium may represent normal variants. Focal myocardial uptake other than normal variants on oncologic torso F-18 FDG PET/CT with routine fasting protocol may suggest ischemic heart disease, thus further evaluation is warranted

  10. The role of stereotactic ablative radiotherapy in oncological and non-oncological clinical settings: highlights from the 7th Meeting of AIRO--Young Members Working Group (AIRO Giovani).

    Science.gov (United States)

    Franco, Pierfrancesco; De Bari, Berardino; Ciammella, Patrizia; Fiorentino, Alba; Chiesa, Silvia; Amelio, Dante; Pinzi, Valentina; Bonomo, Pierluigi; Vagge, Stefano; Fiore, Michele; Comito, Tiziana; Cecconi, Agnese; Mortellaro, Gianluca; Bruni, Alessio; Trovò, Marco; Filippi, Andrea Riccardo; Greto, Daniela; Alongi, Filippo

    2014-01-01

    Stereotactic ablative radiotherapy is a modern cancer treatment strategy able to deliver highly focused radiation in one or a few fractions with a radical intent in several clinical settings. Young radiation oncologists need a constant and tailored update in this context to improve patient care in daily clinical practice. A recent meeting of AIRO Giovani (AIRO--Young Members Working Group) was specifically addressed to this topic, presenting state-of-the-art knowledge, based on the latest evidence in this field. Highlights of the congress are summarized and presented in this report, including thorough contributions of the speakers dealing with the role of stereotactic ablative radiotherapy in both oncological and non-oncological diseases, divided according to anatomical and clinical scenarios: intra-cranial settings (brain malignant primary tumors, metastases, benign tumors and functional disorders) and extra-cranial indications (lung primary tumors and metastases, thoracic re-irradiation, liver, lymph node and bone metastases, prostate cancer). With literature data discussed during the congress as a background, stereotactic ablative radiotherapy has proved to be a consolidated treatment approach in specific oncological and non-oncological scenarios, as well as a promising option in other clinical settings, requiring a further prospective validation in the near future. We herein present an updated overview of stereotactic ablative radiotherapy use in the clinic. PMID:25688503

  11. Microarray analysis in clinical oncology: pre-clinical optimization using needle core biopsies from xenograft tumors

    International Nuclear Information System (INIS)

    DNA microarray profiling performed on clinical tissue specimens can potentially provide significant information regarding human cancer biology. Biopsy cores, the typical source of human tumor tissue, however, generally provide very small amounts of RNA (0.3–15 μg). RNA amplification is a common method used to increase the amount of material available for hybridization experiments. Using human xenograft tissue, we sought to address the following three questions: 1) is amplified RNA representative of the original RNA profile? 2) what is the minimum amount of total RNA required to perform a representative amplification? 3) are the direct and indirect methods of labeling the hybridization probe equivalent? Total RNA was extracted from human xenograft tissue and amplified using a linear amplification process. RNA was labeled and hybridized, and the resulting images yielded data that was extracted into two categories using the mAdb system: 'all genes' and 'outliers'. Scatter plots were generated for each slide and Pearson Coefficients of correlation were obtained. Results show that the amplification of 5 μg of total RNA yields a Pearson Correlation Coefficient of 0.752 (N = 6,987 genes) between the amplified and total RNA samples. We subsequently determined that amplification of 0.5 μg of total RNA generated a similar Pearson Correlation Coefficient as compared to the corresponding original RNA sample. Similarly, sixty-nine percent of total RNA outliers were detected with 5 μg of amplified starting RNA, and 55% of outliers were detected with 0.5 μg of starting RNA. However, amplification of 0.05 μg of starting RNA resulted in a loss of fidelity (Pearson Coefficient 0.669 between amplified and original samples, 44% outlier concordance). In these studies the direct or indirect methods of probe labeling yielded similar results. Finally, we examined whether RNA obtained from needle core biopsies of human tumor xenografts, amplified and indirectly

  12. K-12 educational outcomes of immigrant youth.

    Science.gov (United States)

    Crosnoe, Robert; Turley, Ruth N López

    2011-01-01

    The children from immigrant families in the United States make up a historically diverse population, and they are demonstrating just as much diversity in their experiences in the K-12 educational system. Robert Crosnoe and Ruth López Turley summarize these K-12 patterns, paying special attention to differences in academic functioning across segments of the immigrant population defined by generational status, race and ethnicity, and national origin. A good deal of evidence points to an immigrant advantage in multiple indicators of academic progress, meaning that many youths from immigrant families outperform their peers in school. This apparent advantage is often referred to as the immigrant paradox, in that it occurs despite higher-than-average rates of social and economic disadvantages in this population as a whole. The immigrant paradox, however, is more pronounced among the children of Asian and African immigrants than other groups, and it is stronger for boys than for girls. Furthermore, evidence for the paradox is far more consistent in secondary school than in elementary school. Indeed, school readiness appears to be one area of potential risk for children from immigrant families, especially those of Mexican origin. For many groups, including those from Latin America, any evidence of the immigrant paradox usually emerges after researchers control for family socioeconomic circumstances and youths' English language skills. For others, including those from Asian countries, it is at least partially explained by the tendency for more socioeconomically advantaged residents of those regions to leave their home country for the United States. Bilingualism and strong family ties help to explain immigrant advantages in schooling; school, community, and other contextual disadvantages may suppress these advantages or lead to immigrant risks. Crosnoe and Turley also discuss several policy efforts targeting young people from immigrant families, especially those of Latin

  13. K-12 Teaching and Physics Enrollment

    CERN Document Server

    Masood, Samina S

    2014-01-01

    We have collected and analyzed the relevant data from public schools in greater Houston area of Texas. Based and analyzed. Since the data is only limited to a few school, we are still working on getting more data so that we can compare and contrast the results adequately and understand the core of the enrollment issue at the national level. However, based on the raw data and partial analysis, we propose a few recommendations towards the improvement of science education in Texas Schools, in general, and greater Houston area schools in particular. Our results indicate that the quality of science education can be improved significantly if we focus on the improvement of high school education or even intermediate schools when students are first time exposed to science in a little technical way. Simply organizing teacher training programs at K-12 level as school education plays a pivotal role in the decrease in physics enrollment at the higher level. Similar analysis can actually be generalized to other states to f...

  14. Quality Research in Radiation Oncology Analysis of Clinical Performance Measures in the Management of Gastric Cancer

    International Nuclear Information System (INIS)

    -based planning with use of DVH to evaluate normal tissue doses. Most patients completed adjuvant RT in the prescribed time frame. IMRT and IGRT were not routinely incorporated into clinical practice during the 2005-2007 period. These data will be a benchmark for future Quality Research in Radiation Oncology GC surveys.

  15. [Introduction of a clinical protocol for extravasation at the National Institute of Oncology, Budapest, Hungary].

    Science.gov (United States)

    Bartal, Alexandra; Mátrai, Zoltán; Rosta, András; Szûcs, Attila

    2011-03-01

    Extravasation of cytostatics occurs when an infusion containing a cytotoxic drug leaks into the surrounding perivascular and subcutaneous tissues. Incidence of cytostatic extravasation is found to be 0.1-6% according to the literature. Depending on the severity of complications, pain, loss of function in the extremities, or in extreme cases tissue necrosis necessitating an amputation may develop, drawing consequences like delay or interruption of the chemotherapy. Extent of complications is greatly influenced by the type of medication administered, general condition of the patient, and professional preparedness of staff providing the oncological health service. The protocol recently implemented in the National Institute of Oncology is a short, compact guidance for physicians and nurses providing oncological care, so by quick and adequate management of extravasation cases, severe complications could be prevented. More complex practical guidelines including algorithms could be created as a result of a wider collaboration, with the help of which oncological health professionals could easily cope with this rare problem. The authors describe in their review the implementation of the use of dry warm and cold packs, dymethylsulfoxide and hyaluronidase and their function within the algorithm of extravasation treatment. PMID:21617787

  16. Group Therapy with Patients in the Waiting Room of an Oncology Clinic.

    Science.gov (United States)

    Arnowitz, Edward; And Others

    1983-01-01

    Describes a therapy group for cancer patients, conducted by cotherapists in an oncology waiting room. Group members provided mutual support and shared concerns and coping methods. Medical staff members became more involved and were more able to address the affective needs of the patients and their families. (JAC)

  17. Evolution of modern nuclear medicine tumor-imaging diagnostics in clinical oncology

    International Nuclear Information System (INIS)

    The evolution of current nuclear medicine diagnostic is closely related to the technical progress in imaging equipment development, and application of radiopharmaceuticals (Rphs) with a different tumor-uptake mechanism. It is the aim of the study to present groups of tumor-imaging Rphs differing by tumor uptake mechanisms, used in clinical oncology. The obtained results are described, and compared with the ones reported by other researchers. Sensitivity and specificity of Rphs for cardio-scintigraphy with 99mTc - MIBI and 201Tl are relatively high, amounting to 93.7% and 60% respectively, in the various tumors. These indicators depend on the stage, location, histopathology, level of malignancy and biological activity of the neoplasm. 99mTc - MIBI scintigraphy is endowed with considerable diagnostic potential for assaying multiple drug resistance (MDR), and is also a good criterion for its elimination following anti-MDR therapy. The obtained results show that radioimmunoscintigraphy (RIS) using different radiolabeled monoclonal antibodies (MoAb) have high sensitivity and specificity respectively: 86% and 80% in ovarian carcinoma with B72.3 antiTAG; 68.6% and 92.5% in colorectal carcinoma with B73.2 antiTAG, antiCEA, antiCA 19-9; 92% and 83% in breast cancer with antiCEA, 86.8% and 67-69% in malignant melanoma with 225.28s. Receptor scintigraphy may reach up to 86% sensitivity and 100% specificity in tumors saturated with somatostatin receptors. Positron emission tomography (PET) with 18F-FDG enhances the metabolic activity of tumor cells, and attains tumor-detecting rate amounting to 97%. Tumor imaging evolution characterized by the introduction and practical implementation of different Rphs, visualizing the functional and biochemical activity of tumor cells in the primary neoplasm, sentinel lymph nodes and distant metastases. radiolabelling of a variety of new biochemical substances, including DNA and RNA, drugs and lysosomes contributes to a successful imaging of

  18. Bioinformatics for precision medicine in oncology: principles and application to the SHIVA clinical trial

    OpenAIRE

    Servant, Nicolas; Roméjon, Julien; Gestraud, Pierre; La Rosa, Philippe; Lucotte, Georges; Lair, Séverine; Bernard, Virginie; Zeitouni, Bruno; Coffin, Fanny; Jules-Clément, Gérôme; Yvon, Florent; Lermine, Alban; Poullet, Patrick; Liva, Stéphane; POOK, Stuart

    2014-01-01

    Precision medicine (PM) requires the delivery of individually adapted medical care based on the genetic characteristics of each patient and his/her tumor. The last decade witnessed the development of high-throughput technologies such as microarrays and next-generation sequencing which paved the way to PM in the field of oncology. While the cost of these technologies decreases, we are facing an exponential increase in the amount of data produced. Our ability to use this information in daily pr...

  19. Emerging molecular targets in oncology: clinical potential of MET/hepatocyte growth-factor inhibitors

    OpenAIRE

    Smyth EC; Sclafani F; Cunningham D

    2014-01-01

    Elizabeth C Smyth, Francesco Sclafani, David Cunningham Department of Gastrointestinal Oncology, Royal Marsden Hospital, Sutton, UK Abstract: The MET/hepatocyte growth-factor (HGF) signaling pathway plays a key role in the processes of embryogenesis, wound healing, and organ regeneration. Aberrant activation of MET/HGF occurs through multiple mechanisms including gene amplification, mutation, protein overexpression, and abnormal gene splicing interrupting autocrine and paracrine regulatory f...

  20. QIN. Promise and pitfalls of quantitative imaging in oncology clinical trials

    OpenAIRE

    Kurland, Brenda F; Gerstner, Elizabeth R.; Mountz, James M; Schwartz, Lawrence H.; Ryan, Christopher W.; Graham, Michael M.; Buatti, John M.; Fennessy, Fiona M.; Eikman, Edward A.; Kumar, Virendra; Forster, Kenneth M.; Wahl, Richard L.; Lieberman, Frank S.

    2012-01-01

    Quantitative imaging using CT, MRI, and PET modalities will play an increasingly important role in the design of oncology trials addressing molecularly targeted, personalized therapies. The advent of molecularly targeted therapies, exemplified by antiangiogenic drugs, creates new complexities in the assessment of response. The Quantitative Imaging Network (QIN) addresses the need for imaging modalities which can accurately and reproducibly measure not just change in tumor size, but changes in...

  1. Practicing radiation oncology in the current health care environment - Part II: Designing a radiation oncology department and setting up a clinical practice program

    International Nuclear Information System (INIS)

    Objective: Identify the business practices necessary to develop a successful radiation oncology department in the current health care environment. Course content will be of interest to new practitioners establishing first time programs or joining existing groups as well as experienced radiation oncologists who are challenged with redesigning programs to be competitive. Course Content: During this session, the following topics will be discussed: 1) Space planning and equipment selection 2) Personnel; creating efficiencies while promoting productivity 3) Professional and Technical Billing; establishing proper fee structures and coding procedures 4) Utilizing benchmarking as a tool to improve operations 5) Information technology in radiation oncology 6) Current and Future Trends: a) Oncology networks b) Reimbursement: managed care and capitation c) Downsizing d) Relative Value Units

  2. Medication double-checking procedures in clinical practice: a cross-sectional survey of oncology nurses' experiences

    Science.gov (United States)

    Pfeiffer, Yvonne; Taxis, Katja

    2016-01-01

    Background Double-checking is widely recommended as an essential method to prevent medication errors. However, prior research has shown that the concept of double-checking is not clearly defined, and that little is known about actual practice in oncology, for example, what kind of checking procedures are applied. Objective To study the practice of different double-checking procedures in chemotherapy administration and to explore nurses' experiences, for example, how often they actually find errors using a certain procedure. General evaluations regarding double-checking, for example, frequency of interruptions during and caused by a check, or what is regarded as its essential feature was assessed. Methods In a cross-sectional survey, qualified nurses working in oncology departments of 3 hospitals were asked to rate 5 different scenarios of double-checking procedures regarding dimensions such as frequency of use in practice and appropriateness to prevent medication errors; they were also asked general questions about double-checking. Results Overall, 274 nurses (70% response rate) participated in the survey. The procedure of jointly double-checking (read-read back) was most commonly used (69% of respondents) and rated as very appropriate to prevent medication errors. Jointly checking medication was seen as the essential characteristic of double-checking—more frequently than ‘carrying out checks independently’ (54% vs 24%). Most nurses (78%) found the frequency of double-checking in their department appropriate. Being interrupted in one's own current activity for supporting a double-check was reported to occur frequently. Regression analysis revealed a strong preference towards checks that are currently implemented at the responders' workplace. Conclusions Double-checking is well regarded by oncology nurses as a procedure to help prevent errors, with jointly checking being used most frequently. Our results show that the notion of independent checking needs to be

  3. "Green Oncology": the Italian medical oncologists' challenge to reduce the ecological impact of their clinical activity.

    Science.gov (United States)

    Bretti, Sergio; Porcile, Gianfranco; Romizi, Roberto; Palazzo, Salvatore; Oliani, Cristina; Crispino, Sergio; Labianca, Roberto

    2014-01-01

    For decades Western medicine has followed a biomedical model based on linear thinking and an individualized, disease-oriented doctor-patient relationship. Today this framework must be replaced by a biopsychosocial model based on complexity theory and a person-oriented medical team-patient relationship, taking into account the psychological and social determinants of health and disease. However, the new model is already proving no longer adequate or appropriate, and current events are urging us to develop an ecological model in which the medical team takes into account both individual illness and population health as a whole, since we are all part of the biosphere. In recent years, the rising costs of cancer treatment have raised a serious issue of economic sustainability. As the population of our planet, we now need to rapidly address this issue, and everyone of us must try to reduce their ecological footprint, measured as CO2 production. Medical oncologists need to reduce the ecological footprint of their professional activity by lowering the consumption of economic resources and avoiding environmental damage as much as possible. This new paradigm is endorsed by the Italian College of Hospital Medical Oncology Directors (CIPOMO). A working group of this organization has drafted the "Green Oncology Position Paper": a proposal of Italian medical oncology (in accordance with international guidelines) that oncologists, while aiming for the same end results, make a commitment toward the more appropriate management of health care and the careful use of resources in order to protect the environment and the ecosphere during the daily exercise of their professional activities. PMID:25076260

  4. Clinical impact of Positron Emission Tomography (PET) on oncological patients and their potentially application context

    International Nuclear Information System (INIS)

    (PET) Positron Emission Tomography is a technique of nuclear medicine that has ability of detecting cancer through mechanisms based on molecular alterations of neoplastic processes. This review describes the PET Oncology applications and discusses the potential application of this technology in the sanitary and national academic framework . The most widely used in Oncology plotter is an analogue of laglucosa labelled with fluo: 18F-2-fluoro-2-Deoxy-D-glucose (FDG). In this way, the PET detects tumour retention of FDG, due to the highest glycolytic of cancer cells. In addition, the PET allow the study of the entire body at the same exploratory and some teams are coupled to systems of axial tomography (PET-CT). By ET-FDG, it is possible to diagnose, staging and restaged the majority of cancers, with diagnostic accuracy close to 90 per cent higher than the values provided by the conventional imaging techniques such. It is also possible to know early response to cancer treatments and obtain relevant medical prognosis information. (author)

  5. Integrated 18FDG PET/CT: Utility and Applications in Clinical Oncology

    Directory of Open Access Journals (Sweden)

    Nieves Gómez-León

    2008-01-01

    Full Text Available Accurate diagnosis and staging are essential for an optimal management of cancer patients. Positron emision tomography with 2-deoxy-2-fluorine-18-fluoro-D-glucose (18FDG-PET and, more recently, 18FDG-PET/computed tomography (18FDG-PET/CT have emerged as powerful imaging tools in oncology, because of the valuable functional information they provide. The combined acquisition of PET and CT has synergistic advantages over its isolated constituents and minimizes their limitations. It decreases examination times by 25%–40%, leads to a higher patient throughput and unificates two imaging procedures in a single session. There is evidence that 18FDG-PET/CT is a more accurate test than either of its components for the evaluation of various tumors. It is a particularly valuable tool for detection of recurrence, especially in asymptomatic patients with rising tumor markers and those with negative or equivocal findings on conventional imaging tests. Yet, there are some limitations and areas of uncertainty, mainly regarding the lack of specificity of the 18FDG uptake and the variable 18FDG avidity of some cancers. This article reviews the advantages, limitations and main applications of 18FDG-PET/CT in oncology, with especial emphasis on lung cancer, colorectal cancer, lymphomas, melanoma and head and neck cancers.

  6. Monitoring the CO2 injection site: K12-B

    NARCIS (Netherlands)

    Vandeweijer, V.; Meer, B. van der; Hofstee, C.; Mulders, F.; D'Hoore, D.; Graven, H.

    2011-01-01

    The K12-B gas field is located in the Dutch sector of the North Sea. The top of the reservoir lies approximately 3800 meters below sea level, and the ambient temperature of the reservoir is over 127 °C. The K12-B gas field has been producing natural gas from 1987 onwards and is currently operated by

  7. Formulating Independent School K-12 Quality Physical Education Program Guidelines

    Science.gov (United States)

    Currie, Stuart M.; Phillips, Michael B.; Jubenville, Colby B.

    2012-01-01

    The purpose of this study was to formulate Tennessee independent school K-12 quality physical education program guidelines. A panel of 18 physical education representatives from Tennessee independent schools K-12 participated in a three-phase Delphi study and completed three opinionnaires via e-mail. In Phase One, Opinionnaire One solicited panel…

  8. A web-based 'patterns of care study' system for clinical radiation oncology in Korea: development, launching, and characteristics

    International Nuclear Information System (INIS)

    We report upon a web-based system for Patterns of Care Study (PCS) devised for Korean radiation oncology, This PCS was designed to establish standard tools for clinical quality assurance, to determine basic parameters for radiation oncology processes, to offer a solid system for cooperative clinical studies and a useful standard database for comparisons with other national databases. The system consisted of a main server with two back-ups in other locations. The program uses a Linux operating system and a MySQL database. Cancers with high frequencies in radiotherapy departments in Korea from 1998 to 1999 were chosen to have a developmental priority. The web-based clinical PCS system for radiotherapy in www.pcs.re.kr was developed in early 2003 for cancers of the breast, rectum, esophagus, larynx and lung, and for brain metastasis. The total number of PCS study items exceeded one thousand. Our PCS system features user-friendliness, double entry checking, data security, encryption, hard disc mirroring, double back-up, and statistical analysis. Alphanumeric data can be input as well as image data. In addition, programs were constructed for IRB submission, random sampling of data, and departmental structure. For the first time in the field of PCS, we have developed a web-based system and associated working programs. With this system, we can gather sample data in a short period and thus save, cost, effort and time. Data should be performed to validate input data. We propose that this system should be considered as a standard method for PCS or similar types of data collection systems

  9. What Medical Oncologist Residents Think about the Italian Speciality Schools: A Survey of the Italian Association of Medical Oncology (AIOM) on Educational, Clinical and Research Activities

    Science.gov (United States)

    Moretti, Anna; De Angelis, Carmine; Lambertini, Matteo; Cremolini, Chiara; Imbimbo, Martina; Berardi, Rossana; Di Maio, Massimo; Cascinu, Stefano; La Verde, Nicla

    2016-01-01

    Background and objectives Relevant heterogeneity exists among Postgraduate Schools in Medical Oncology, also within the same country. In order to provide a comprehensive overview of the landscape of Italian Postgraduate Schools in Medical Oncology, the Italian Association of Medical Oncology (AIOM) undertook an online survey, inviting all the residents to describe their daily activities and to express their overall satisfaction about their programs. Methods A team composed of five residents and three consultants in medical oncology prepared a 38 items questionnaire that was published online in a reserved section, accessible through a link sent by e-mail. Residents were invited to anonymously fill in the questionnaire that included the following sub-sections: quality of teaching, clinical and research activity, overall satisfaction. Results Three-hundred and eleven (57%) out of 547 invited residents filled in the questionnaire. Two-hundred and twenty-three (72%) participants declared that attending lessons was frequently difficult and 153 (49%) declared they did not gain substantial improvement in their knowledge from them. Fifty-five percent stated that they did not receive lessons on palliative care. Their overall judgment about didactic activity was low in 63% of the interviewed. The satisfaction for clinical activity was in 86% of cases good: 84% recognized that, during the training period, they acquired a progressive independence on patients' management. About research activity, the majority (79%) of participants in the survey was actively engaged in managing patients included in clinical trials but the satisfaction level for the involvement in research activities was quite low (54%). Overall, 246 residents (79%) gave a positive global judgment of their Medical Oncology Schools. Conclusions The landscape of Italian Postgraduate Schools in Medical Oncology is quite heterogeneous across the country. Some improvements in the organization of teaching and in the

  10. Streptococcus salivarius K12 Limits Group B Streptococcus Vaginal Colonization.

    Science.gov (United States)

    Patras, Kathryn A; Wescombe, Philip A; Rösler, Berenice; Hale, John D; Tagg, John R; Doran, Kelly S

    2015-09-01

    Streptococcus agalactiae (group B streptococcus [GBS]) colonizes the rectovaginal tract in 20% to 30% of women and during pregnancy can be transmitted to the newborn, causing severe invasive disease. Current routine screening and antibiotic prophylaxis have fallen short of complete prevention of GBS transmission, and GBS remains a leading cause of neonatal infection. We have investigated the ability of Streptococcus salivarius, a predominant member of the native human oral microbiota, to control GBS colonization. Comparison of the antibacterial activities of multiple S. salivarius strains by use of a deferred-antagonism test showed that S. salivarius strain K12 exhibited the broadest spectrum of activity against GBS. K12 effectively inhibited all GBS strains tested, including disease-implicated isolates from newborns and colonizing isolates from the vaginal tract of pregnant women. Inhibition was dependent on the presence of megaplasmid pSsal-K12, which encodes the bacteriocins salivaricin A and salivaricin B; however, in coculture experiments, GBS growth was impeded by K12 independently of the megaplasmid. We also demonstrated that K12 adheres to and invades human vaginal epithelial cells at levels comparable to GBS. Inhibitory activity of K12 was examined in vivo using a mouse model of GBS vaginal colonization. Mice colonized with GBS were treated vaginally with K12. K12 administration significantly reduced GBS vaginal colonization in comparison to nontreated controls, and this effect was partially dependent on the K12 megaplasmid. Our results suggest that K12 may have potential as a preventative therapy to control GBS vaginal colonization and thereby prevent its transmission to the neonate during pregnancy. PMID:26077762

  11. New Mexico K-12 & School Choice Survey: What Do Voters Say about K-12 Education? Polling Paper Number 4

    Science.gov (United States)

    DiPerna, Paul

    2011-01-01

    The "New Mexico K-12 & School Choice Survey" project, commissioned by The Friedman Foundation for Educational Choice and conducted by Braun Research Incorporated (BRI), measures New Mexico voters' familiarity and views on a range of K-12 education issues and school choice reforms. The author and his colleagues report response "levels" and…

  12. The role of radiation therapy in childhood acute leukemia. A review from the viewpoint of basic and clinical radiation oncology

    International Nuclear Information System (INIS)

    Radiation therapy has been playing important roles in the treatment of childhood acute leukemia since the 1970s. The first is the preventive cranial irradiation for central nervous system therapy in acute lymphoblastic leukemia. The second is the total body irradiation as conditioning before bone marrow transplantation for children with acute myeloid leukemia in first remission and with acute lymphoblastic leukemia in second remission. Although some late effects have been reported, a part of them could be overcome by technical improvement in radiation and salvage therapy. Radiation therapy for children might have a successful outcome on a delicate balance between efficiencies and potential late toxicities. The role of radiation therapy for childhood acute leukemia was reviewed from the standpoint of basic and clinical radiation oncology in this paper. (author)

  13. Saudi Oncology Society and Saudi Urology Association combined clinical management guidelines for testicular germ cell tumors

    Directory of Open Access Journals (Sweden)

    Mohammed Alotaibi

    2016-01-01

    Full Text Available This is an update to the previously published Saudi guidelines for the evaluation, medical, and surgical management of patients diagnosed with testicular germ cell tumors. It is categorized according to the stage of the disease using the tumor-node-metastasis staging system 7th edition. The guidelines are presented with supporting evidence level, they are based on comprehensive literature review, several internationally recognized guidelines, and the collective expertise of the guidelines committee members (authors who were selected by the Saudi Oncology Society and Saudi Urological Association. Considerations to the local availability of drugs, technology and expertise have been regarded. These guidelines should serve as a roadmap for the urologists, oncologists, general physicians, support groups, and health care policy makers in the management of patients diagnosed with testicular germ cell tumors.

  14. Saudi oncology society and Saudi urology association combined clinical management guidelines for prostate cancer

    Directory of Open Access Journals (Sweden)

    Ashraf Abusamra

    2016-01-01

    Full Text Available This is an update to the previously published Saudi guidelines for the evaluation, medical, and surgical management of patients diagnosed with prostate cancer. It is categorized according to the stage of the disease using the tumor node metastasis staging system 7th edition. The guidelines are presented with supporting evidence level, they are based on comprehensive literature review, several internationally recognized guidelines, and the collective expertise of the guidelines committee members (authors who were selected by the Saudi oncology society and Saudi urological association. Considerations to the local availability of drugs, technology, and expertise have been regarded. These guidelines should serve as a roadmap for the urologists, oncologists, general physicians, support groups, and health care policy makers in the management of patients diagnosed with adenocarcinoma of the prostate to.

  15. Non-surgical management of early breast cancer in the United Kingdom: follow-up. Clinical Audit Sub-committee of the Faculty of Clinical Oncology, Royal College of Radiologists, and the Joint Council for Clinical Oncology.

    Science.gov (United States)

    Maher, E J

    1995-01-01

    Follow-up of operable breast cancer patients takes up a significant proportion of British oncologists' time, with 90% seeing 5-50 patients each week. Procedures vary greatly, but, in patients treated by surgery and radiotherapy, care is usually shared, with alternating visits to see each team. Currently, the general practitioner has sole responsibility for follow-up in less than 3% of patients. They tend to be followed up in general, rather than specialist, clinics. There is almost universal agreement that routine blood tests, radiographs and scans are not indicated as part of routine follow-up, but the role of mammography in evaluating an irradiated breast remains a source of debate. Just over a half of the oncologists surveyed order baseline mammography of both treated and contralateral breasts, usually between 6 and 12 months after local excision and radiotherapy, with further follow-up 1-3-yearly thereafter. Ten per cent of the participating oncologists never suggest follow-up mammography. Patients tend to be followed in oncology clinics at 3-4-monthly intervals for the first 2 years, 6-monthly in the third and fourth years and, thereafter, yearly. Fifteen per cent of oncologists discharge patients at 5 years, with the discharge rate rising to 43% at 10 years; around one-third modify follow-up according to the age of the patient. The aims of follow-up were seen to include detection of curable disease, but other goals were perceived as equally important (e.g. detection of iatrogenic problems, audit, counselling, education and the provision of early palliation of incurable and metastatic disease. Breast cancer is no longer seen as an absolute contraindication to either pregnancy or the use of hormone replacement therapy (HRT); however, oncologists are uncertain about the appropriate use of HRT, either alone or with tamoxifen. This audit highlights a number of research areas: the identification of the appropriate site and skill-mix for follow-up of patients

  16. Routine administration of standardized questionnaires that assess aspects of patients quality of life in medical oncology clinics: A systematic review

    International Nuclear Information System (INIS)

    Purpose: Increasing interest in the Quality of Life outcomes in cancer patients led to increase implementation of their use in routine clinical practice. The aim of this systemic review is to review the scientific evidence behind recommending the use of quality of life (QoL) scales routinely in outpatient evaluation. Methods: Systematic review for all published randomized controlled trials in English language between January 1, 1990 till December 31, 2012. Out of 487 articles (476 identified by electronic search + 11 articles identified by manual search), six trials satisfied the eligibility criteria: (1) the study was a randomized controlled trial (RCT) with randomization of patients or health care providers; (2) the findings of the administered questionnaire or scale (the intervention) were given to health care provider, and compared to standard care with no questionnaire administered (the control); (3) study was conducted in outpatient oncology clinics; and (4) an outcome was measured that related to (i) QoL improvement, (ii) reduction in morbidity, (iii) reduction in stress for the patients, (iv) improvement in communication between patients and health care provider, or (v) improved patient satisfaction. Assessment for the quality of the study was done using the GRADE methodology. Results: Serious methodological issues were affecting most of the trials. Overall the evaluation of the quality of the evidence from these identified trials suggests that there is a weak recommendation to use QoL scales in routine oncology practice to improve communication between physicians and patients. Conclusion: The routine use of such tools in the outpatient settings at improving the patient outcome or satisfaction cannot be recommended based on the available evidence. The potential harm with the excess use of resources needed to implement, collect, store, analyse, and present such data to health care providers should be also considered. Further research and better designed

  17. Attitudes of Oncologists, Oncology Nurses, and Patients from a Women's Clinic Regarding Medical Decision Making for Older and Younger Breast Cancer Patients.

    Science.gov (United States)

    Beisecker, Analee E.; And Others

    1994-01-01

    Administered Beisecker Locus of Authority in Decision Making: Breast Cancer survey to 67 oncologists, 94 oncology nurses, and 288 patients from women's clinic. All groups believed that physicians should have dominant role in decision making. Nurses felt that patients should have more input than patients or physicians felt they should. Physicians…

  18. Heterogeneous Optimization Framework: Reproducible Preprocessing of Multi-Spectral Clinical MRI for Neuro-Oncology Imaging Research.

    Science.gov (United States)

    Milchenko, Mikhail; Snyder, Abraham Z; LaMontagne, Pamela; Shimony, Joshua S; Benzinger, Tammie L; Fouke, Sarah Jost; Marcus, Daniel S

    2016-07-01

    Neuroimaging research often relies on clinically acquired magnetic resonance imaging (MRI) datasets that can originate from multiple institutions. Such datasets are characterized by high heterogeneity of modalities and variability of sequence parameters. This heterogeneity complicates the automation of image processing tasks such as spatial co-registration and physiological or functional image analysis. Given this heterogeneity, conventional processing workflows developed for research purposes are not optimal for clinical data. In this work, we describe an approach called Heterogeneous Optimization Framework (HOF) for developing image analysis pipelines that can handle the high degree of clinical data non-uniformity. HOF provides a set of guidelines for configuration, algorithm development, deployment, interpretation of results and quality control for such pipelines. At each step, we illustrate the HOF approach using the implementation of an automated pipeline for Multimodal Glioma Analysis (MGA) as an example. The MGA pipeline computes tissue diffusion characteristics of diffusion tensor imaging (DTI) acquisitions, hemodynamic characteristics using a perfusion model of susceptibility contrast (DSC) MRI, and spatial cross-modal co-registration of available anatomical, physiological and derived patient images. Developing MGA within HOF enabled the processing of neuro-oncology MR imaging studies to be fully automated. MGA has been successfully used to analyze over 160 clinical tumor studies to date within several research projects. Introduction of the MGA pipeline improved image processing throughput and, most importantly, effectively produced co-registered datasets that were suitable for advanced analysis despite high heterogeneity in acquisition protocols. PMID:26910516

  19. Nanotechnology in Radiation Oncology

    OpenAIRE

    Wang, Andrew Z.; Tepper, Joel E.

    2014-01-01

    Nanotechnology, the manipulation of matter on atomic and molecular scales, is a relatively new branch of science. It has already made a significant impact on clinical medicine, especially in oncology. Nanomaterial has several characteristics that are ideal for oncology applications, including preferential accumulation in tumors, low distribution in normal tissues, biodistribution, pharmacokinetics, and clearance, that differ from those of small molecules. Because these properties are also wel...

  20. Instruction in medical ethics during clinical training for medical students. Report on experience in radio-oncology

    International Nuclear Information System (INIS)

    The article gives a review of the current state of education in medical ethics in Germany. The issue is considered from the viewpoint of radio-oncology. Both the pertinent literature and our own experience in teaching medical ethics are presented. In October 2003, medical ethics was integrated into the curriculum of medicine. The aim was to train competence in the field of personal attitudes and to intensify skills of moral reasoning. Our own experiences are positive, which is in accordance with the reports of other working groups. Most of the students were interested in education in medical ethics and looked upon ethical training as being an important part of their studies. Medical students are interested in ethical education during the clinical period of their studies, which has been taken into account since the actual change of the curriculum. Radio-oncologists as specialists in other clinical fields can offer important contributions when they discuss clinical cases from the viewpoint of medical ethics. The long-term effect of such an education will become the subject of future research. (orig.)

  1. Selected clinically established and scientific techniques of diffusion-weighted MRI. In the context of imaging in oncology

    International Nuclear Information System (INIS)

    Diffusion-weighted imaging (DWI) is a magnetic resonance imaging (MRI) technique that was established in the clinical routine primarily for the detection of brain ischemia. In the past 15 years its clinical use has been extended to oncological radiology, as tumor and metastases can be depicted in DWI due to their hypercellular nature. The basis of DWI is the Stejskal-Tanner experiment. The diffusion properties of tissue can be visualized after acquisition of at least two diffusion-weighted series using echo planar imaging and a specific sequence of gradient pulses. The use of DWI in prostate MRI was reported to be one of the first established applications that found its way into internationally recognized clinical guidelines of the European Society of Urological Radiology (ESUR) and the prostate imaging reporting and data system (PI-RADS) scale. Due to recently reported high specificity and negative predictive values of 94 % and 92 %, respectively, its regular use for breast MRI is expected in the near future. Furthermore, DWI can also reliably be used for whole-body imaging in patients with multiple myeloma or for measuring the extent of bone metastases. New techniques in DWI, such as intravoxel incoherent motion imaging, diffusion kurtosis imaging and histogram-based analyses represent promising approaches to achieve a more quantitative evaluation for tumor detection and therapy response. (orig.)

  2. Dosimetric comparison of the linear accelerators at the University Clinic of Radiotherapy and Oncology in Skopje, Macedonia

    International Nuclear Information System (INIS)

    In radiotherapy practice, for various practical reasons it is important to know whether two or more linear accelerators (linacs) are dosimetric matched and whether the patient’s treatment can be shifted from one linac to another without reducing the treatment quality. This work presents the data from the dosimetric comparison of the two Varian Clinacs 23EX and one Varian Clinac iX at the University Clinic of Radiotherapy and Oncology in Skopje. Both Percentage Depth Dose (PDD) and Beam Profile (BP) curves were compared for the photon energies (6MV, 15MV) in use at the clinic. The comparison was performed using the IBA OmniPro Accept 7.4™ software. The results from the comparison of the PDD curves showed that in the clinically significant region the dose differences were smaller than 1%. The results from the comparison of the in line and cross line BP curves showed that in the flattened area the dose differences were smaller than 2.5%, while in the penumbra region they were usually between 2% and 8%, but sometimes up to 21%. This suggests that for treatments where the influence of the penumbra region is small, the three linacs may be considered to be dosimetric matched. For treatments where the influence of the penumbra region is greater, the patient can be switched to another machine only after recalculation of the treatment plan. (Author)

  3. A Bayesian Dose-finding Design for Oncology Clinical Trials of Combinational Biological Agents.

    Science.gov (United States)

    Cai, Chunyan; Yuan, Ying; Ji, Yuan

    2014-01-01

    Treating patients with novel biological agents is becoming a leading trend in oncology. Unlike cytotoxic agents, for which efficacy and toxicity monotonically increase with dose, biological agents may exhibit non-monotonic patterns in their dose-response relationships. Using a trial with two biological agents as an example, we propose a dose-finding design to identify the biologically optimal dose combination (BODC), which is defined as the dose combination of the two agents with the highest efficacy and tolerable toxicity. A change-point model is used to reflect the fact that the dose-toxicity surface of the combinational agents may plateau at higher dose levels, and a flexible logistic model is proposed to accommodate the possible non-monotonic pattern for the dose-efficacy relationship. During the trial, we continuously update the posterior estimates of toxicity and efficacy and assign patients to the most appropriate dose combination. We propose a novel dose-finding algorithm to encourage sufficient exploration of untried dose combinations in the two-dimensional space. Extensive simulation studies show that the proposed design has desirable operating characteristics in identifying the BODC under various patterns of dose-toxicity and dose-efficacy relationships. PMID:24511160

  4. Approval procedures for clinical trials in the field of radiation oncology; Genehmigungsverfahren klinischer Studien im Bereich der Radioonkologie

    Energy Technology Data Exchange (ETDEWEB)

    Simon, Monique; Buettner, Daniel [Deutsches Konsortium fuer Translationale Krebsforschung (DKTK), Dresden (Germany); Deutsches Krebsforschungszentrum (DKFZ), Heidelberg (Germany); Medizinische Fakultaet und Universitaetsklinikum Carl Gustav Carus, Technische Universitaet Dresden, Klinik fuer Strahlentherapie und Radioonkologie und OncoRay - Nationales Zentrum fuer Strahlenforschung in der Onkologie, Dresden (Germany); Habeck, Matthias; Habeck, Uta; Brix, Gunnar [Bundesamt fuer Strahlenschutz (BfS), Fachbereich Strahlenschutz und Gesundheit, Neuherberg (Germany); Krause, Mechthild; Baumann, Michael [Deutsches Konsortium fuer Translationale Krebsforschung (DKTK), Dresden (Germany); Deutsches Krebsforschungszentrum (DKFZ), Heidelberg (Germany); Medizinische Fakultaet und Universitaetsklinikum Carl Gustav Carus, Technische Universitaet Dresden, Klinik fuer Strahlentherapie und Radioonkologie und OncoRay - Nationales Zentrum fuer Strahlenforschung in der Onkologie, Dresden (Germany); Helmholtz-Zentrum Dresden - Rossendorf, Institut fuer Radioonkologie und OncoRay - Nationales Zentrum fuer Strahlenforschung in der Onkologie, Dresden (Germany); Willich, Normann [Universitaetsklinikum Muenster, Klinik fuer Strahlentherapie - Radioonkologie, Muenster (Germany); Wenz, Frederik [Universitaetsmedizin Mannheim, Medizinische Fakultaet Mannheim, Universitaet Heidelberg, Klinik fuer Strahlentherapie und Radioonkologie, Mannheim (Germany); Schmidberger, Heinz [Universitaetsmedizin Mainz, Klinik fuer Radioonkologie und Strahlentherapie, Mainz (Germany); Debus, Juergen [Universitaetsklinikum Heidelberg, Klinik fuer Radioonkologie und Strahlentherapie, Heidelberg (Germany); Noelling, Torsten

    2015-12-15

    Application of ionizing radiation for the purpose of medical research in Germany needs to be approved by the national authority for radiation protection (Bundesamt fuer Strahlenschutz, BfS). For studies in the field of radiation oncology, differentiation between use of radiation for ''medical care (Heilkunde)'' versus ''medical research'' frequently leads to contradictions. The aim of this article is to provide principle investigators, individuals, and institutions involved in the process, as well as institutional review or ethics committees, with the necessary information for this assessment. Information on the legal frame and the approval procedures are also provided. A workshop was co-organized by the German Society for Radiation Oncology (DEGRO), the Working Party for Radiation Oncology (ARO) of the German Cancer Society (DKG), the German Society for Medical Physics (DGMP), and the German Cancer Consortium (DKTK) in October 2013. This paper summarizes the results of the workshop and the follow-up discussions between the organizers and the BfS. Differentiating between ''Heilkunde'' which does not need to be approved by the BfS and ''medical research'' is whether the specific application of radiation (beam quality, dose, schedule, target volume, etc.) is a clinically established and recognized procedure. This must be answered by the qualified physician(s) (''fachkundiger Arzt'' according to German radiation protection law) in charge of the study and the treatments of the patients within the study, taking into consideration of the best available evidence from clinical studies, guidelines and consensus papers. Among the important parameters for assessment are indication, total dose, and fractionation. Radiation treatments applied outside clinical trials do not require approval by the BfS, even if they are applied within a randomized or nonrandomized clinical trial

  5. Patient satisfaction at haematology and oncology clinics in the Free State & Northern Cape

    Directory of Open Access Journals (Sweden)

    W.R. Davies

    2002-09-01

    Full Text Available The Free State and Northern Cape make up some 40% of the land area of South Africa, while being home to only 10% of the total population. Haematology and Oncotherapy outreach clinics were established in Kimberley, Bethlehem and Welkom to provide a more accessible service to the thinly spread population. A previous study showed these clinics to be cost-effective, but we had no idea how the patients experience them. Our aim was to obtain information about the demographics of the patients, the logistical support of the clinics, the medical needs of the patients and how they experience the clinics. This can help us to improve the service. A questionnaire was tested in a pilot study. The demographic questions covered age, sex and ethnicity. The logistical questions dealt with distance travelled to the clinic, mode of transport, length of time as a patient and cost. The medical need questions dealt with type of disease, treatment received, type of doctor seen and origin of referral. The questions about experience covered satisfaction with the service, staff, waiting times and involvement of non-governmental organizations. Of the 95 patients interviewed 42% were from the haematology clinics. The mean age was 59.5 and the male: female ratio was 0.6:1. Forty-six percent of the patients spoke Afrikaans and 31 % spoke South Sotho. The black:white ratio was 1:1. Twenty-eight percent used the government ambulances (of whom 80% were satisfied and 56% used their own cars. The median payment at a clinic was R20 (R0 to R200. Only 19% of patients were paying privately. Ninety-five percent of the patients were follow-ups, with the median length of follow-up being 24 months (1 to 468. The patients were mainly referred by local hospitals. Twentytwo percent of the patients had chronic haematological malignancies, while 68% had solid tumours. Thirty-seven percent of the patients received drugs to take home and only 6% got intravenous chemotherapy. Consultants saw 44

  6. [Communication in the context of phase I clinical trials in oncology: implementation and evaluation of training programs].

    Science.gov (United States)

    Rouby, Pascal; Hollebecque, Antoine; Bahleda, Ratislav; Deutsch, Eric; Gomez-Rocca, Carlos; Angevin, Eric; de La Motte Rouge, Thibault; Soria, Jean-Charles; Dauchy, Sarah

    2015-02-01

    Communication training programs in oncology have demonstrated some efficacy to improve doctors' communication skills. The goal of our study was to evaluate the impact of such training in the particular context of phase I clinical trials. Self-satisfaction and self-efficacy scales evaluating doctor-patient communication was completed by 6 medical oncologists (3 juniors and 3 seniors) before and after their communication training for a total of sixty visits. Two types of visit have been distinguished: the visits between the oncologist and the patient alone (a dual situation) and those with a third party (a trilateral situation). For all the doctors in dual and trialateral situations, self-efficacy scores improved significantly after training. This improvement was more pronounced for juniors oncologists in trilateral situations. Before training, satisfactory scores were worst in duel versus trilateral situations (P=0.01). This was particularly pronounced for junior compared to senior doctors (P=0.035). After training, in trilateral situations, the satisfaction scores of junior doctors matched that of the senior doctors. The communication training programs appear to benefit junior oncologists to a greater extent in trilateral situations. PMID:25609484

  7. Molecular basis of valine resistance in Escherichia coli K-12.

    OpenAIRE

    Lawther, R P; Calhoun, D H; Adams, C W; Hauser, C A; Gray, J.; Hatfield, G W

    1981-01-01

    The relationship of valine resistance to the expression of the ilvGEDA operon of Escherichia coli K-12 has been determined. DNA sequence and in vivo protein analyses indicate that in wild-type E. coli K-12 there is a frameshift site within the gene (ilvG) for valine resistance. The ilvG+2096 (formerly designated ilv02096) mutation displaces this frameshift site, resulting in the expression of ilvG and the relief of transcriptional polarity on the distal genes of this operon. Thus, the "ilv0" ...

  8. ASCO 2007: “Translating Research into Practice”. Report from the 34th Annual Meeting of the American Society of Clinical Oncology

    Directory of Open Access Journals (Sweden)

    Camillo Porta

    2011-12-01

    Full Text Available This year, for the 34th time in its history, the mastodontic machinery of the American Society of Clinical Oncology (ASCO once again welcomed thousand of members and participants from all over the world to the Society’s annual meeting, which, this year, took place in the ample and well-appointed, McCormick’s Convention Center in Chicago, Illinois...

  9. American society of clinical oncology update on the role of bisphosphonates and bone health issues in women with breast cancer Part II. Bisphosphonates in the adjuvant therapy of breast cancer

    Directory of Open Access Journals (Sweden)

    I. V. Vysotskaya

    2014-09-01

    Full Text Available American society of clinical oncology update on the roleof bisphosphonates and bone health issues in women with breast cancer Part II. Bisphosphonates in the adjuvant therapy of breast cancer

  10. Phase III clinical evaluation of gadoteridol injection: Experience in pediatric neuro-oncologic MR imaging

    International Nuclear Information System (INIS)

    Twenty-two pediatric patients with known CNS neoplasms underwent magnetic resonance (MR) imaging before and after intravenous injection of 0.1 mmol/kg gadoteridol injection as part of a Phase IIIB open label multicenter clinical trial. Intravenous adminstration of this neutral, nonionic contrast agent was found to be safe in children. No clinically relevant changes in vital signs or laboratory values were attributed to the administration of gadoteridol injection. There were no systemic complaints. The imaging characteristics of gadoteridol in pediatric CNS disease appeared similar to those of gadopentetate dimeglumine. The very low toxicity, inherent to this nonionic low osmolal paramagnetic contrast formulation may allow administration of increased doses at increased infusion rates for an increased number of indications with improved sensitivity. (orig.)

  11. Next-generation mTOR inhibitors in clinical oncology: how pathway complexity informs therapeutic strategy.

    LENUS (Irish Health Repository)

    Wander, Seth A

    2011-04-01

    Mammalian target of rapamycin (mTOR) is a PI3K-related kinase that regulates cell growth, proliferation, and survival via mTOR complex 1 (mTORC1) and mTORC2. The mTOR pathway is often aberrantly activated in cancers. While hypoxia, nutrient deprivation, and DNA damage restrain mTORC1 activity, multiple genetic events constitutively activate mTOR in cancers. Here we provide a brief overview of the signaling pathways up- and downstream of mTORC1 and -2, and discuss the insights into therapeutic anticancer targets - both those that have been tried in the clinic with limited success and those currently under clinical development - that knowledge of these pathways gives us.

  12. Clinical trial designs for evaluating the medical utility of prognostic and predictive biomarkers in oncology

    OpenAIRE

    Simon, Richard

    2010-01-01

    Physicians need improved tools for selecting treatments for individual patients. Many diagnostic entities hat were traditionally viewed as individual diseases are heterogeneous in their molecular pathogenesis and treatment responsiveness. This results in the treatment of many patients with ineffective drugs, incursion of substantial medical costs for the treatment of patients who do not benefit and the conducting of large clinical trials to identify small, average treatment benefits for heter...

  13. Implementation of Remote 3-Dimensional Image Guided Radiation Therapy Quality Assurance for Radiation Therapy Oncology Group Clinical Trials

    International Nuclear Information System (INIS)

    Purpose: To report the process and initial experience of remote credentialing of three-dimensional (3D) image guided radiation therapy (IGRT) as part of the quality assurance (QA) of submitted data for Radiation Therapy Oncology Group (RTOG) clinical trials; and to identify major issues resulting from this process and analyze the review results on patient positioning shifts. Methods and Materials: Image guided radiation therapy datasets including in-room positioning CT scans and daily shifts applied were submitted through the Image Guided Therapy QA Center from institutions for the IGRT credentialing process, as required by various RTOG trials. A centralized virtual environment is established at the RTOG Core Laboratory, containing analysis tools and database infrastructure for remote review by the Physics Principal Investigators of each protocol. The appropriateness of IGRT technique and volumetric image registration accuracy were evaluated. Registration accuracy was verified by repeat registration with a third-party registration software system. With the accumulated review results, registration differences between those obtained by the Physics Principal Investigators and from the institutions were analyzed for different imaging sites, shift directions, and imaging modalities. Results: The remote review process was successfully carried out for 87 3D cases (out of 137 total cases, including 2-dimensional and 3D) during 2010. Frequent errors in submitted IGRT data and challenges in the review of image registration for some special cases were identified. Workarounds for these issues were developed. The average differences of registration results between reviewers and institutions ranged between 2 mm and 3 mm. Large discrepancies in the superior-inferior direction were found for megavoltage CT cases, owing to low spatial resolution in this direction for most megavoltage CT cases. Conclusion: This first experience indicated that remote review for 3D IGRT as part of QA

  14. The opinion of clinical staff regarding painfulness of procedures in pediatric hematology-oncology: an Italian survey

    OpenAIRE

    Cesaro Simone; Frigo Anna C; Sainati Laura; Benini Franca; Po' Chiara; Farina Maria I; Agosto Caterina

    2011-01-01

    Abstract Background Beliefs of caregivers about patient's pain have been shown to influence assessment and treatment of children's pain, now considered an essential part of cancer treatment. Painful procedures in hematology-oncology are frequently referred by children as the most painful experiences during illness. Aim of this study was to evaluate professionals' beliefs about painfulness of invasive procedures repeatedly performed in Pediatric Hemato-Oncology Units. Methods Physicians, nurse...

  15. Breast-conserving therapy as a model for creating new knowledge in clinical oncology

    International Nuclear Information System (INIS)

    New knowledge can be derived from various kinds of studies. Studies of innovative approaches are the basis for progress. Some advances in treatment are so obvious that they do not need formal testing; e.g., penicillin for pneumococcal infection. For comparing interventions with small differences in efficacy or in groups without predictable outcome, prospective randomized trials are the 'gold standard'. However, randomized trials are cumbersome, expensive, and potentially difficult for both patients and physicians. Retrospective studies are less valid scientifically because they are more likely to suffer from bias, misclassification, confounding variables, and the use of multiple comparisons. Retrospective studies can be made more valid by first specifying the study design and analysis, but are generally most useful to generate hypotheses to be tested more formally. Retrospective studies can be particularly useful in improving outcome by identifying 'problems' and their causes. An important issue for radiation oncologists in doing retrospective studies is the difficulty of assessing an effect on local tumor control in diseases in which there are competing risks of local and distant failure. Many of these points will be illustrated in studies from the Joint Center for Radiation Therapy. Studies of innovative approaches, retrospective reviews and prospective randomized clinical trials have all been useful in establishing breast-conserving therapy as a safe and effective treatment for patients with early-stage breast cancer. Several studies of innovative breast-conserving therapy beginning in the 1960's showed favorable results. Based on this experience, a series of randomized clinical trials were initiated, beginning in the early 1970's, formally comparing mastectomy and breast-conserving therapy. These trials firmly established that the two forms of local treatment provide equivalent survival. Additional retrospective studies have also been useful in establishing

  16. Genetic Basis of Minicell Formation in Escherichia coli K-12

    OpenAIRE

    1984-01-01

    Hfr- and P1-mediated genetic transfer experiments failed to confirm the presence of a " minA " gene in Escherichia coli K-12, leading to the conclusion that mutation at a single locus, the minB locus, is sufficient to cause minicell production in this species.

  17. K-12 Marketplace Sees Major Flow of Venture Capital

    Science.gov (United States)

    Ash, Katie

    2012-01-01

    The flow of venture capital into the K-12 education market has exploded over the past year, reaching its highest transaction values in a decade in 2011, industry observers say. They attribute that rise to such factors as a heightened interest in educational technology; the decreasing cost of electronic devices such as tablet computers, laptops,…

  18. Definitions, Benefits, and Barriers of K-12 Educational Strategic Planning

    Science.gov (United States)

    Hambright, Grant; Diamantes, Thomas

    2004-01-01

    This comprehensive literature review seeks to define strategic planning in a K-12 setting. Principally, it asks, what characteristics distinguish educational strategic planning from other planning approaches? What follows is a content analysis of the educational strategic planning literature detailing the critical attributes of various planning…

  19. The Green Pages: Environmental Education Activities K-12.

    Science.gov (United States)

    Clearing, 1990

    1990-01-01

    Presented are 37 environmental science activities for students in grades K-12. Topics include water pollution, glaciers, protective coloration, shapes in nature, environmental impacts, recycling, creative writing, litter, shapes found in nature, color, rain cycle, waste management, plastics, energy, pH, landfills, runoff, watersheds,…

  20. Addressing Excellence Gaps in K-12 Education. Position Statement

    Science.gov (United States)

    National Association for Gifted Children, 2015

    2015-01-01

    Since the passage of the No Child Left Behind Act in 2001, a major objective of federal and state education policy has been to narrow K-12 achievement gaps. This position statement notes that the available data suggest that the singular focus on the most struggling learners has resulted in meaningful progress in closing minimum-competency…

  1. Project WILD K-12 Curriculum and Activity Guide

    Science.gov (United States)

    Council for Environmental Education, 2011

    2011-01-01

    The "Project WILD K-12 Curriculum and Activity Guide" focuses on wildlife and habitat. It is organized in topic units and is based on the Project WILD conceptual framework. Because these activities are designed for integration into existing courses of study, instructors may use one or many Project WILD activities or the entire set of activities…

  2. Expression of Treponema pallidum antigens in Escherichia coli K-12.

    OpenAIRE

    Stamm, L V; Folds, J D; Bassford, P J

    1982-01-01

    A colony bank of recombinant plasmids harboring Treponema pallidum DNA inserts has been established in Escherichia coli K-12. By using an in situ immunoassay, we identified four E. coli clones that expressed T. pallidum antigens. Thus, recombinant DNA technology may provide powerful new tools for studying the pathogenesis of T. pallidum infection.

  3. Leadership Analysis in K-12 Case Study: "Divided Loyalties"

    Science.gov (United States)

    Alsubaie, Merfat Ayesh

    2016-01-01

    This report mainly aims to provide a critical and in-depth analysis of the K-12 Case, "Divided Loyalty" by Holy and Tartar (2004). The case recounts how the manifestation of inadequate leadership skills in a school setting could affect negatively the performance of students.

  4. Best Practices in Administration of K-12 Dance Programs

    Science.gov (United States)

    Henneman, Suzanne E.

    2013-01-01

    The role of administering K-12 dance education programs is both exciting and invigorating. Being part of the decision-making process, problem solving with teams of colleagues, establishing routines and initiatives, creating "something from nothing," and watching programs grow is appealing to dance teachers as creative and critical…

  5. Transforming K-12 Rural Education through Blended Learning: Teacher Perspectives

    Science.gov (United States)

    Kellerer, Paula; Kellerer, Eric; Werth, Eric; Werth, Lori; Montgomery, Danielle; Clyde, Rozella; Cozart, Joe; Creach, Laura; Hibbard, Laura; LaFrance, Jason; Rupp, Nadine; Walker, Niki; Carter, Theresa; Kennedy, Kathryn

    2014-01-01

    A qualitative study exploring rural teacher perspectives on the impact of blended learning on students and teachers was conducted in Idaho during the Fall of 2013. Researchers from Northwest Nazarene University's DOCEO Center in partnership with Idaho Digital Learning Academy (IDLA) and the International Association for K-12 Online Learning…

  6. Designer Librarian: Embedded in K12 Online Learning

    Science.gov (United States)

    Boyer, Brenda

    2015-01-01

    Over the past two decades, shifts in technology have altered the roles of school librarians in a multitude of ways. New rigorous standards, proliferation of devices, and steady growth of online and blended learning for the K12 market now demand librarians engage with learners in online environments. Taking an instructional design approach is the…

  7. Tablets in K-12 Education: Integrated Experiences and Implications

    Science.gov (United States)

    An, Heejung, Ed.; Alon, Sandra, Ed.; Fuentes, David, Ed.

    2015-01-01

    The inclusion of new and emerging technologies in the education sector has been a topic of interest to researchers, educators, and software developers alike in recent years. Utilizing the proper tools in a classroom setting is a critical factor in student success. "Tablets in K-12 Education: Integrated Experiences and Implications"…

  8. Information Security Management Practices of K-12 School Districts

    Science.gov (United States)

    Nyachwaya, Samson

    2013-01-01

    The research problem addressed in this quantitative correlational study was the inadequacy of sound information security management (ISM) practices in K-12 school districts, despite their increasing ownership of information assets. Researchers have linked organizational and sociotechnical factors to the implementation of information security…

  9. Gender Sorting across K-12 Schools in the United States

    Science.gov (United States)

    Long, Mark C.; Conger, Dylan

    2013-01-01

    This article documents evidence of nonrandom gender sorting across K-12 schools in the United States. The sorting exists among coed schools and at all grade levels, and it is highest in the secondary school grades. We observe some gender sorting across school sectors and types: for instance, males are slightly underrepresented in private schools…

  10. Florida's Opinion on K-12 Public Education Spending

    Science.gov (United States)

    Forster, Greg

    2006-01-01

    This scientifically representative poll of 1,200 Floridians finds that public opinion about K-12 public education spending is seriously misinformed. Floridians think public schools need more money, but the main reason is that they are badly mistaken about how much money the public schools actually get. Key findings of the study include: (1) Half…

  11. Ohio Economics: K-12 Model Course of Study in Economics.

    Science.gov (United States)

    Ohio Council on Economic Education.

    The K-12 Model Course of Study in Economics (MCSE) provides Ohio school district personnel with assistance in the development and implementation of economics courses of study for kindergarten through twelfth grade. The guide also offers information to help readers integrate economics into their curricula across disciplines. In addition to an…

  12. Developing Open Education Literacies with Practicing K-12 Teachers

    Directory of Open Access Journals (Sweden)

    Royce M Kimmons

    2014-12-01

    Full Text Available This study seeks to understand how to use formal learning activities to effectively support the development of open education literacies among K-12 teachers. Considering pre- and post-surveys from K-12 teachers (n = 80 who participated in a three-day institute, this study considers whether participants entered institutes with false confidence or misconceptions related to open education, whether participant knowledge grew as a result of participation, whether takeaways matched expectations, whether time teaching (i.e., teacher veterancy impacted participant data, and what specific evaluation items influenced participants’ overall evaluations of the institutes. Results indicated that 1 participants entered the institutes with misconceptions or false confidence in several areas (e.g., copyright, fair use, 2 the institute was effective for helping to improve participant knowledge in open education areas, 3 takeaways did not match expectations, 4 time teaching did not influence participant evaluations, expectations, or knowledge, and 5 three specific evaluation items significantly influenced overall evaluations of the institute: learning activities, instructor, and website / online resources. Researchers conclude that this type of approach is valuable for improving K-12 teacher open education literacies, that various misconceptions must be overcome to support large-scale development of open education literacies in K-12, and that open education advocates should recognize that all teachers, irrespective of time teaching, want to innovate, utilize open resources, and share in an open manner.

  13. A risk management approach for imaging biomarker-driven clinical trials in oncology.

    Science.gov (United States)

    Liu, Yan; deSouza, Nandita M; Shankar, Lalitha K; Kauczor, Hans-Ulrich; Trattnig, Siegfried; Collette, Sandra; Chiti, Arturo

    2015-12-01

    Imaging has steadily evolved in clinical cancer research as a result of improved conventional imaging methods and the innovation of new functional and molecular imaging techniques. Despite this evolution, the design and data quality derived from imaging within clinical trials are not ideal and gaps exist with paucity of optimised methods, constraints of trial operational support, and scarce resources. Difficulties associated with integrating imaging biomarkers into trials have been neglected compared with inclusion of tissue and blood biomarkers, largely because of inherent challenges in the complexity of imaging technologies, safety issues related to new imaging contrast media, standardisation of image acquisition across multivendor platforms, and various postprocessing options available with advanced software. Ignorance of these pitfalls directly affects the quality of the imaging read-out, leading to trial failure, particularly when imaging is a primary endpoint. Therefore, we propose a practical risk-based framework and recommendations for trials driven by imaging biomarkers, which allow identification of risks at trial initiation to better allocate resources and prioritise key tasks. PMID:26678215

  14. Associations between clinical and sociodemographic data and patterns of communication in pediatric oncology

    Directory of Open Access Journals (Sweden)

    Marina Kohlsdorf

    2016-01-01

    Full Text Available Abstract Pediatric communication directly contributes to treatment adherence, fewer symptoms, better clinical responses, healthier treatment adaptation and management of psychosocial issues. This study aimed to evaluate associations between the clinical and sociodemographic data of caregivers and children and the communicative patterns of pediatricians. Three oncohematology physicians and 44 child-caregiver dyads took part, with audio recording of 146 medical consultations. The physicians interacted more often with older children, offering more guidance, clarifying doubts, and asking for information. The number of questions from children and caregivers was positively correlated with the physician’s communicative behaviors. However, there was no association between the age of the children and the number of doubts of the patients. The diagnosis, treatment time, family income, marital status and caregiver’s level of education were associated with the amount of interaction provided by physicians to the children and caregivers. This study offers subsides relevant to psychosocial interventions that may improve communication in pediatric oncohematology settings.

  15. Soft Tissue Sarcoma, Version 2.2016, NCCN Clinical Practice Guidelines in Oncology.

    Science.gov (United States)

    von Mehren, Margaret; Randall, R Lor; Benjamin, Robert S; Boles, Sarah; Bui, Marilyn M; Conrad, Ernest U; Ganjoo, Kristen N; George, Suzanne; Gonzalez, Ricardo J; Heslin, Martin J; Kane, John M; Koon, Henry; Mayerson, Joel; McCarter, Martin; McGarry, Sean V; Meyer, Christian; O'Donnell, Richard J; Pappo, Alberto S; Paz, I Benjamin; Petersen, Ivy A; Pfeifer, John D; Riedel, Richard F; Schuetze, Scott; Schupak, Karen D; Schwartz, Herbert S; Tap, William D; Wayne, Jeffrey D; Bergman, Mary Anne; Scavone, Jillian

    2016-06-01

    Soft tissue sarcomas (STS) are rare solid tumors of mesenchymal cell origin that display a heterogenous mix of clinical and pathologic characteristics. STS can develop from fat, muscle, nerves, blood vessels, and other connective tissues. The evaluation and treatment of patients with STS requires a multidisciplinary team with demonstrated expertise in the management of these tumors. The complete NCCN Guidelines for Soft Tissue Sarcoma (available at NCCN.org) provide recommendations for the diagnosis, evaluation, and treatment of extremity/superficial trunk/head and neck STS, as well as intra-abdominal/retroperitoneal STS, gastrointestinal stromal tumor, desmoid tumors, and rhabdomyosarcoma. This manuscript discusses guiding principles for the diagnosis and staging of STS and evidence for treatment modalities that include surgery, radiation, chemoradiation, chemotherapy, and targeted therapy. PMID:27283169

  16. Brief Introduction of NCCN Clinical Practice Guidelines for Adolescent and Young Adult Oncology

    Directory of Open Access Journals (Sweden)

    HUANG Xin-en

    2014-09-01

    Full Text Available Cancer is always a main factor threatening human’s health and life, and its incidence and mortality are gradually increasing in recent years. However, some advances have been made with the unremitting efforts and exploration human made and the improvement is mainly made in cancer treatment of young children and older adults, while little in adolescent and young adult (AYA patients, who are generally defined as individuals of 15 to 39 years old at the time of initial cancer diagnosis due to many factors. To highlight the issues of this unique population, National Comprehensive Cancer Network (NCCN absorbs a large amount of information and previous researches and develops a set of clinical practice guidelines. Though the guidelines are more supportive care guidelines than treatment guidelines, they give us the opportunity to learn the latest international developments in AYA treatment and more survival chance for the treatment of AYA patients.

  17. Molecular imaging in oncology

    Energy Technology Data Exchange (ETDEWEB)

    Schober, Otmar; Riemann, Burkhard (eds.) [Universitaetsklinikum Muenster (Germany). Klinik fuer Nuklearmedizin

    2013-02-01

    Considers in detail all aspects of molecular imaging in oncology, ranging from basic research to clinical applications in the era of evidence-based medicine. Examines technological issues and probe design. Discusses preclinical studies in detail, with particular attention to multimodality imaging. Presents current clinical use of PET/CT, SPECT/CT, and optical imagingWritten by acknowledged experts. The impact of molecular imaging on diagnostics, therapy, and follow-up in oncology is increasing significantly. The process of molecular imaging includes key biotarget identification, design of specific molecular imaging probes, and their preclinical evaluation, e.g., in vivo using small animal studies. A multitude of such innovative molecular imaging probes have already entered clinical diagnostics in oncology. There is no doubt that in future the emphasis will be on multimodality imaging in which morphological, functional, and molecular imaging techniques are combined in a single clinical investigation that will optimize diagnostic processes. This handbook addresses all aspects of molecular imaging in oncology, ranging from basic research to clinical applications in the era of evidence-based medicine. The first section is devoted to technology and probe design, and examines a variety of PET and SPECT tracers as well as multimodality probes. Preclinical studies are then discussed in detail, with particular attention to multimodality imaging. In the third section, diverse clinical applications are presented, and the book closes by looking at future challenges. This handbook will be of value to all who are interested in the revolution in diagnostic oncology that is being brought about by molecular imaging.

  18. K-12 Students Flock To ToxTown In San Diego: Results of an SOT K-12 Education Outreach Workshop

    Science.gov (United States)

    Just prior to the start of the 2015 Annual Meeting in San Diego, hundreds of K-12 students, teachers, and science enthusiasts visited the ToxTown booth at the annual San Diego Festival of Science and Engineering grand finale event, EXPO Day. Over 20,000 attendees participated in ...

  19. Clinical usefulness of 99mTc-EDDA/HYNIC-TOC scintigraphy in oncological diagnostics: a preliminary communication

    International Nuclear Information System (INIS)

    This study assessed the clinical usefulness of a new technetium-99m labelled somatostatin analogue from the standpoint of oncological diagnostics. The study group comprised 40 patients in whom malignant neoplasms (32 primary and 8 metastatic) had been diagnosed. Among the primary tumours there were 21 cases of lung cancer (2 small cell and 19 non-small cell), seven pituitary adenomas (five hormonally active and two inactive), one liposarcoma, two carcinoids and one breast carcinoma. The metastatic tumours consisted of three malignant melanomas, one phaeochromocytoma, one prostatic cancer, one leiomyosarcoma, one pancreatic carcinoma ectopically secreting ACTH and one carcinoid of the thymus. The radiopharmaceutical 99mTc-EDDA/HYNIC-Tyr3-octreotide was administered i.v. at an activity of 740-925 MBq. The imaging comprised a whole-body scan and a single-photon emission tomography acquisition. Positive scintigrams were obtained in all cases of small cell and non-small cell lung cancer, four out of five hormonally active pituitary adenomas, one out of two cases of carcinoid, the liposarcoma and the breast cancer. Neoplastic metastases were visualised in two out of three patients with melanoma and in patients with phaeochromocytoma, ACTH-secreting pancreatic carcinoma and thymic carcinoid. Scintigrams were negative in both hormonally inactive pituitary adenomas, in one case of metastatic malignant melanoma, in the leiomyosarcoma and in the case of metastasis from prostatic carcinoma. The results of this pilot study indicate that 99mTc-EDDA/HYNIC-TOC is a potentially useful radiopharmaceutical for imaging of a wide range of primary and metastatic tumours. Special attention should be paid to the successful imaging of all cases of non-small cell lung cancer. (orig.)

  20. Soil Science Society of America - K-12 Outreach

    Science.gov (United States)

    Lindbo, David L.; Loynachan, Tom; Mblia, Monday; Robinson, Clay; Chapman, Susan

    2013-04-01

    The Soil Science Society of America created its K12 Committee in 2006 in part to compliment the Dig It! The Secrets of Soil exhibit that opened in July 2008 at the Smithsonian's Institution's Nation Museum of Natural History (of which SSS was a founding sponsor). The committee's work began quickly with a website designed to provide resources for K12 teachers. The first accomplishments included reviewing and posting links to web based information already available to teachers. These links were sorted by subject and grade level to make it easier for teachers to navigate the web and find what they needed quickly. Several presentations and lessons designed for K12 teachers were also posted at this time. Concurrent with this effort a subcommittee review and organized the national teaching standards to show where soils could fit into the overall K12 curriculum. As the website was being developed another subcommittee developed a soils book (Soil! Get the Inside Scoop, 2008) to further compliment the Dig It! exhibit. This was a new endeavor for SSSA having never worked with the non-academic audience in developing a book. Peer-reviews of this book included not only scientist but also students in order to make sure the book was attractive to them. Once the book was published and the website developed it became clear more outreach was needed. SSSA K12 Committee has attended both the National Science Teachers Association (since 2008) the USA Science and Engineering Festival (since 2010) with exhibits and workshops. It has cooperated and contributed to the American Geologic Institutes' Earth Science Week materials with brochures and lesson plans and with National Association of Conservation Districts by providing peer-review and distribution of materials. The most recent developments from the committee include a web redesign that is more student and teacher friendly, the development of a peer-review system to publish K12 Lesson Plans, and finally the publication of a new soils

  1. Clinical cancer advances 2007: major research advances in cancer treatment, prevention, and screening--a report from the American Society of Clinical Oncology.

    Science.gov (United States)

    Gralow, Julie; Ozols, Robert F; Bajorin, Dean F; Cheson, Bruce D; Sandler, Howard M; Winer, Eric P; Bonner, James; Demetri, George D; Curran, Walter; Ganz, Patricia A; Kramer, Barnett S; Kris, Mark G; Markman, Maurie; Mayer, Robert J; Raghavan, Derek; Ramsey, Scott; Reaman, Gregory H; Sawaya, Raymond; Schuchter, Lynn M; Sweetenham, John W; Vahdat, Linda T; Davidson, Nancy E; Schilsky, Richard L; Lichter, Allen S

    2008-01-10

    A MESSAGE FROM ASCO'S PRESIDENT: For the third year, the American Society of Clinical Oncology (ASCO) is publishing Clinical Cancer Advances: Major Research Advances in Cancer Treatment, Prevention, and Screening, an annual review of the most significant cancer research presented or published over the past year. ASCO publishes this report to demonstrate the important progress being made on the front lines of clinical cancer research today. The report is intended to give all those with an interest in cancer care-the general public, cancer patients and organizations, policymakers, oncologists, and other medical professionals-an accessible summary of the year's most important cancer research advances. These pages report on the use of magnetic resonance imaging for breast cancer screening, the association between hormone replacement therapy and breast cancer incidence, the link between human papillomavirus and head and neck cancers, and the use of radiation therapy to prevent lung cancer from spreading. They also report on effective new targeted therapies for cancers that have been historically difficult to treat, such as liver cancer and kidney cancer, among many others. A total of 24 advances are featured in this year's report. These advances and many more over the past several years show that the nation's long-term investment in cancer research is paying off. But there are disturbing signs that progress could slow. We are now in the midst of the longest sustained period of flat government funding for cancer research in history. The budgets for the National Institutes of Health and the National Cancer Institute (NCI) have been unchanged for four years. When adjusted for inflation, cancer research funding has actually declined 12% since 2004. These budget constraints limit the NCI's ability to fund promising cancer research. In the past several years the number of grants that the NCI has been able to fund has significantly decreased; this year, in response to just the

  2. Initial clinical experience with a radiation oncology dedicated open 1.0T MR-simulation.

    Science.gov (United States)

    Glide-Hurst, Carri K; Wen, Ning; Hearshen, David; Kim, Joshua; Pantelic, Milan; Zhao, Bo; Mancell, Tina; Levin, Kenneth; Movsas, Benjamin; Chetty, Indrin J; Siddiqui, M Salim

    2015-01-01

    The purpose of this study was to describe our experience with 1.0T MR-SIM including characterization, quality assurance (QA) program, and features necessary for treatment planning. Staffing, safety, and patient screening procedures were developed. Utilization of an external laser positioning system (ELPS) and MR-compatible couchtop were illustrated. Spatial and volumetric analyses were conducted between CT-SIM and MR-SIM using a stereotactic QA phantom with known landmarks and volumes. Magnetic field inhomogeneity was determined using phase difference analysis. System-related, in-plane distortion was evaluated and temporal changes were assessed. 3D distortion was characterized for regions of interest (ROIs) 5-20 cm away from isocenter. American College of Radiology (ACR) recommended tests and impact of ELPS on image quality were analyzed. Combined ultrashort echotime Dixon (UTE/Dixon) sequence was evaluated. Amplitude-triggered 4D MRI was implemented using a motion phantom (2-10 phases, ~ 2 cm excursion, 3-5 s periods) and a liver cancer patient. Duty cycle, acquisition time, and excursion were evaluated between maximum intensity projection (MIP) datasets. Less than 2% difference from expected was obtained between CT-SIM and MR-SIM volumes, with a mean distance of Dixon sequences yielded detectability between bone and air. For 4D MRI, faster breathing periods had higher duty cycles than slow (50.4% (3 s) and 39.4% (5 s), p MRI for a patient demonstrated acceptable image quality in ~ 7 min. MR-SIM was integrated into our workflow and QA procedures were developed. Clinical applicability was demonstrated for 4D MRI and UTE imaging to support MR-SIM for single modality treatment planning. PMID:26103190

  3. Performance in quasi-firms: an example from the Community Clinical Oncology Program.

    Science.gov (United States)

    Lacey, L M; Hynes, D M; Kaluzny, A D

    1992-01-01

    In this analysis, the authors examined the effects of different sets of process, structure, and environmental variables on the performance of the CCOP as a quasi-firm. Specifically, they distinguished between internal organizational processes, structural, and size characteristics of the CCOP and the organizational environment created by prior NCI program experience and the relationship within the quasi-firm. The analysis revealed that these sets of organizational and environmental characteristics have differential effects on treatment accrual. The strongest predictors are those associated with the quasi-firm relationship between the CCOP and its chosen research bases. Any definitive policy implications for the design of organizational network relationships--especially the CCOPs--will require further analysis. Particular attention needs to be given to the longitudinal nature of the relationships and the ability of these organizational and environmental factors to affect other aspects of performance. Several points have been made within this initial assessment. First, the structural character of the CCOP and its relationship to its organizational environment are important factors affecting accrual performance. The subtleties of this multivariate model are not as important as simply demonstrating that the various internal and external characteristics of these organizations as quasi-firms simultaneously affect their ability to accrue patients to clinical trials. Secondly, the importance of research base relations, and particularly the significant role of nurses, needs to be emphasized. While CCOPs were originally designed as a network of physicians and hospitals, it appears that an infrastructure of professionally active nurses working within a larger organizational environment is critical to success--at least as defined by accrual to treatment protocols. Finally, the failure of prior experience with other NCI community programs to affect CCOP accrual performance

  4. Results of the 2005-2008 Association of Residents in Radiation Oncology Survey of Chief Residents in the United States: Clinical Training and Resident Working Conditions

    International Nuclear Information System (INIS)

    Purpose: To document clinical training and resident working conditions reported by chief residents during their residency. Methods and Materials: During the academic years 2005 to 2006, 2006 to 2007, and 2007 to 2008, the Association of Residents in Radiation Oncology conducted a nationwide survey of all radiation oncology chief residents in the United States. Chi-square statistics were used to assess changes in clinical training and resident working conditions over time. Results: Surveys were completed by representatives from 55 programs (response rate, 71.4%) in 2005 to 2006, 60 programs (75.9%) in 2006 to 2007, and 74 programs (93.7%) in 2007 to 2008. Nearly all chief residents reported receiving adequate clinical experience in commonly treated disease sites, such as breast and genitourinary malignancies; and commonly performed procedures, such as three-dimensional conformal radiotherapy and intensity-modulated radiotherapy. Clinical experience in extracranial stereotactic radiotherapy increased over time (p < 0.001), whereas clinical experience in endovascular brachytherapy (p <0.001) decreased over time. The distribution of gynecologic and prostate brachytherapy cases remained stable, while clinical case load in breast brachytherapy increased (p = 0.006). A small but significant percentage of residents reported receiving inadequate clinical experience in pediatrics, seeing 10 or fewer pediatric cases during the course of residency. Procedures involving higher capital costs, such as particle beam therapy and intraoperative radiotherapy, and infrequent clinical use, such as head and neck brachytherapy, were limited to a minority of institutions. Most residency programs associated with at least one satellite facility have incorporated resident rotations into their clinical training, and the majority of residents at these programs find them valuable experiences. The majority of residents reported working 60 or fewer hours per week on required clinical duties

  5. Technical Feasibility Study for Zero Energy K-12 Schools

    Energy Technology Data Exchange (ETDEWEB)

    Pless, Shanti D.; Torcellini, Paul A.; Bonnema, Eric; Goldwasser, David

    2016-08-26

    A simulation-based technical feasibility study was completed to show the types of technologies required to achieve ZEB status with this building type. These technologies are prioritized across the building's subsystem such that design teams can readily integrate the ideas. Energy use intensity (EUI) targets were established for U.S. climate zones such that K-12 schools can be zero-ready or can procure solar panels or other renewable energy production sources to meet the zero energy building definition. Results showed that it is possible for K-12 schools to achieve zero energy when the EUI is between 20 and 26 kBtu/ft2/yr. Temperate climates required a smaller percentage of solar panel coverage than very hot or very cold climates. The paper provides a foundation for technically achieving zero energy schools with a vision of transforming the school construction market to mainstream zero energy buildings within typical construction budgets.

  6. Systemic Therapy in Men With Metastatic Castration-Resistant Prostate Cancer: American Society of Clinical Oncology and Cancer Care Ontario Clinical Practice Guideline

    Science.gov (United States)

    Basch, Ethan; Loblaw, D. Andrew; Oliver, Thomas K.; Carducci, Michael; Chen, Ronald C.; Frame, James N.; Garrels, Kristina; Hotte, Sebastien; Kattan, Michael W.; Raghavan, Derek; Saad, Fred; Taplin, Mary-Ellen; Walker-Dilks, Cindy; Williams, James; Winquist, Eric; Bennett, Charles L.; Wootton, Ted; Rumble, R. Bryan; Dusetzina, Stacie B.; Virgo, Katherine S.

    2014-01-01

    Purpose To provide treatment recommendations for men with metastatic castration-resistant prostate cancer (CRPC). Methods The American Society of Clinical Oncology and Cancer Care Ontario convened an expert panel to develop evidence-based recommendations informed by a systematic review of the literature. Results When added to androgen deprivation, therapies demonstrating improved survival, improved quality of life (QOL), and favorable benefit-harm balance include abiraterone acetate/prednisone, enzalutamide, and radium-223 (223Ra; for men with predominantly bone metastases). Improved survival and QOL with moderate toxicity risk are associated with docetaxel/prednisone. For asymptomatic/minimally symptomatic men, improved survival with unclear QOL impact and low toxicity are associated with sipuleucel-T. For men who previously received docetaxel, improved survival, unclear QOL impact, and moderate to high toxicity risk are associated with cabazitaxel/prednisone. Modest QOL benefit (without survival benefit) and high toxicity risk are associated with mitoxantrone/prednisone after docetaxel. No benefit and excess toxicity are observed with bevacizumab, estramustine, and sunitinib. Recommendations Continue androgen deprivation (pharmaceutical or surgical) indefinitely. Abiraterone acetate/prednisone, enzalutamide, or 223Ra should be offered; docetaxel/prednisone should also be offered, accompanied by discussion of toxicity risk. Sipuleucel-T may be offered to asymptomatic/minimally symptomatic men. For men who have experienced progression with docetaxel, cabazitaxel may be offered, accompanied by discussion of toxicity risk. Mitoxantrone may be offered, accompanied by discussion of limited clinical benefit and toxicity risk. Ketoconazole or antiandrogens (eg, bicalutamide, flutamide, nilutamide) may be offered, accompanied by discussion of limited known clinical benefit. Bevacizumab, estramustine, and sunitinib should not be offered. There is insufficient evidence to

  7. Professional practice assessment. Pertinence of positron emission tomography clinical indications in oncology; Evaluation des pratiques professionnelles. Pertinence des indications de la tomographie a emission de positons en cancerologie

    Energy Technology Data Exchange (ETDEWEB)

    Le Stanc, E.; Tainturier, C. [Hopital Foch, Service de Medecine Nucleaire, 92 - Suresnes (France); Swaenepoel, J. [Hopital Foch, Cellule Qualite, 92 - Suresnes (France)

    2009-09-15

    Introduction As part of the health care quality and safety policy in France, Professional Practice Assessment (P.P.A.) are mandatory in the health services 'certification' process. We present our study regarding the pertinence of Positron Emission Tomography (PET) indications in oncology. Materials and methods A multidisciplinary task group used the Quick Audit method with two rounds of 100 request forms each. The assessment list of criteria comprised four items of decreasing relevance grading the PET scans clinical indications, which were derived from the three French published guidelines (S.O.R. [F.N.C.L.C.C]., 'Guide du bon usage des examens d'imagerie medicale' [S.F.R.-S.F.M.N.], 'Guide pour la redaction de protocoles pour la TEP au F.D.G. en cancerologie' [S.F.M.N.]) and five additional items: clinical information, patient's body weight, previous treatments dates, diabetes, claustrophobia. Results The first round showed that 68% of the requested scans corresponded to the two most relevant groups of indications (S.O.R. Standards and Options). The request forms were correctly filled in regarding the clinical information, but this was not the case for the other items we tested. Several actions were conducted: dedicated PET request form, availability of the S.O.R. on the hospital intranet, boost of the referring physicians awareness during the multidisciplinary oncology meetings (Reunions de Concertation Pluridisciplinaires RCP). The second round showed a better pertinence of the PET scans indications (75% versus 68%); the patient's body weight was more frequently mentioned on the request form. Discussion This study is an example of P.P.A. in our discipline. It led to an improvement of the oncologic PET scans clinical indications in our hospital. This work is pursued in everyday discussion with the referring clinicians, especially during the RCP. (authors)

  8. Implementing and Integrating a Clinically-Driven Electronic Medical Record (EMR for Radiation Oncology in a Large Medical Enterprise

    Directory of Open Access Journals (Sweden)

    John Paxton Kirkpatrick

    2013-04-01

    Full Text Available Purpose/Objective: While our department is heavily invested in computer-based treatment planning, we historically relied on paper-based charts for management of Radiation Oncology patients. In early 2009, we initiated the process of conversion to an electronic medical record (EMR eliminating the need for paper charts. Key goals included the ability to readily access information wherever and whenever needed, without compromising safety, treatment quality, confidentiality or productivity.Methodology: In February, 2009, we formed a multi-disciplinary team of Radiation Oncology physicians, nurses, therapists, administrators, physicists/dosimetrists, and information technology (IT specialists, along with staff from the Duke Health System IT department. The team identified all existing processes and associated information/reports, established the framework for the EMR system and generated, tested and implemented specific EMR processes.Results: Two broad classes of information were identified: information which must be readily accessed by anyone in the health system versus that used solely within the Radiation Oncology department. Examples of the former are consultation reports, weekly treatment check notes and treatment summaries; the latter includes treatment plans, daily therapy records and quality assurance reports. To manage the former, we utilized the enterprise-wide system , which required an intensive effort to design and implement procedures to export information from Radiation Oncology into that system. To manage "Radiation Oncology" data, we used our existing system (ARIA, Varian Medical Systems. The ability to access both systems simultaneously from a single workstation (WS was essential, requiring new WS and modified software. As of January, 2010, all new treatments were managed solely with an EMR. We find that an EMR makes information more widely accessible and does not compromise patient safety, treatment quality or confidentiality

  9. The opinion of clinical staff regarding painfulness of procedures in pediatric hematology-oncology: an Italian survey

    Directory of Open Access Journals (Sweden)

    Cesaro Simone

    2011-06-01

    Full Text Available Abstract Background Beliefs of caregivers about patient's pain have been shown to influence assessment and treatment of children's pain, now considered an essential part of cancer treatment. Painful procedures in hematology-oncology are frequently referred by children as the most painful experiences during illness. Aim of this study was to evaluate professionals' beliefs about painfulness of invasive procedures repeatedly performed in Pediatric Hemato-Oncology Units. Methods Physicians, nurses, psychologists and directors working in Hemato-Oncology Units of the Italian Association of Pediatric Hematology-Oncology (AIEOP were involved in a wide-nation survey. The survey was based on an anonymous questionnaire investigating beliefs of operators about painfulness of invasive procedures (lumbar puncture, bone marrow aspirate and bone marrow biopsy and level of pain management. Results Twenty-four directors, 120 physicians, 248 nurses and 22 psychologists responded to the questionnaire. The score assigned to the procedural pain on a 0-10 scale was higher than 5 in 77% of the operators for lumbar puncture, 97.5% for bone marrow aspiration, and 99.5% for bone marrow biopsy. The scores assigned by nurses differed statistically from those of the physicians and directors for the pain caused by lumbar puncture and bone marrow aspiration. Measures adopted for procedural pain control were generally considered good. Conclusions Invasive diagnostic-therapeutic procedures performed in Italian Pediatric Hemato-Oncology Units are considered painful by all the caregivers involved. Pain management is generally considered good. Aprioristically opinions about pain depend on invasiveness of the procedure and on the professional role.

  10. Tracers in oncology. Preclinical and clinical evaluation; Innovative Tracer in der onkologischen Diagnostik. Praeklinische und klinische Evaluierung

    Energy Technology Data Exchange (ETDEWEB)

    Krause, B.J.; Schwarzenboeck, S.; Schwaiger, M. [Technische Univ. Muenchen, Klinikum rechts der Isar (Germany). Klinik und Poliklinik fuer Nuklearmedizin

    2010-07-01

    In oncology, PET and PET/CT with tracers beyond FDG target more specific biological processes, such as proliferation ({sup 18}F-3'-fluoro-3'-deoxy-L-thymidine; {sup 18}F-FLT), tumour hypoxia ({sup 18}F-fluoromisonidazol; {sup 18}F-FMISO) and phospholipid metabolism (radioactively labelled choline derivates). FLT is a thymidine analogue which can be labelled with {sup 18}F. PET with {sup 18}F-FLT enables to non-invasively image and to quantify the proliferation fraction of tumours. Proliferation dependent accumulation of FLT has been demonstrated for a variety of solid and haematologic neoplasms including lung cancer, breast cancer, gastric cancer, colorectal cancer and malignant lymphoma. Furthermore, FLT has been suggested as surrogate marker for the assessment of response to treatment, especially when targeted drugs are utilized. PET imaging in particular has emerged as a promising non-invasive tool to accurately characterize tumour oxygenation. The great promise of PET/CT is its potential as a single imaging modality for whole body staging that provides anatomical and biological information on the disease as a whole. It allows a more precise estimation of the hypoxic tumour volume as well as comparisons on a voxel-by-voxel basis (parametric mapping). PET and PET/CT with hypoxia tracers thus offer the potential to optimize and individualize therapy for patients suffering from cancer. PET- and PET/CT-studies using {sup 11}C- or {sup 18}F-labeled choline derivates recently have shown promising results for re-staging prostate cancer in patients with biochemical recurrence and advanced prostate cancer. In patients with biochemical recurrence of prostate cancer after primary therapy the detection rate of {sup 11}C-choline- PET/CT shows a positive relationship with serum PSA-levels. In these patients {sup 11}C-choline PET/CT allows not only to diagnose but also to localize recurrent disease with implications on disease management (localised vs. systemic

  11. American Society of Clinical Oncology policy statement update: tobacco control--reducing cancer incidence and saving lives. 2003.

    Science.gov (United States)

    2003-07-15

    As an international medical society dedicated to cancer prevention, the American Society of Clinical Oncology (ASCO) advocates a fundamental reform of United States and international policy toward addictive tobacco products. ASCO's goal is the immediate reduction of tobacco use and ultimate achievement of a tobacco-free world. The centerpiece of ASCO's policy is the recommendation for an independent commission to study the tobacco problem in all of its dimensions: social, medical, legal, and economic (both domestically and globally). The commission membership should include broad-based representation and expertise on tobacco issues. In ASCO's view, tobacco control efforts to date have been less than successful because they are too fragmented and incremental, leaving many important issues unaddressed. A more comprehensive solution could flow from this study, including input from a variety of government agencies involved with public health, agriculture, First Amendment and other legal considerations, and international trade. The study, within defined time limits, should culminate in a report that outlines a strategy for achieving immediate reduction of tobacco use and ultimate achievement of a tobacco-free world, including explicit plans and a timetable for implementation. Although this comprehensive approach to tobacco control will take many years to implement even under the best of circumstances, there are certain measures that could be undertaken immediately with meaningful impact on tobacco usage. These include: Increasing efforts to discourage tobacco use, particularly among the young Raising federal excise taxes by at least $2 per pack and encouraging states to consider tobacco taxes as a first resort in revenue enhancement Ensuring that tobacco settlement funds be devoted only to health-related projects, including medical treatment, biomedical research, and tobacco prevention efforts Requiring disclosure of all ingredients in tobacco products Comprehensively

  12. Analysis of NF-B Pathway Proteins in Pediatric Hodgkin Lymphoma: Correlations with EBV Status and Clinical Outcome—A Children's Oncology Group Study

    OpenAIRE

    Horton, Terzah M.; Sheehan, Andrea M.; Dolores López-Terrada; Hutchison, Robert E.; Sonia Narendra; Meng-Fen Wu; Hao Liu

    2012-01-01

    Constitutively active nuclear factor-κB (NF-κB) is integral to the survival of Hodgkin/Reed-Sternberg cells (H/RS) in Hodgkin lymphoma (HL). To investigate NF-κB pathway proteins in pediatric HL, we utilized a tissue microarray compiled from 102 children enrolled in the Children's Oncology Group intermediate-risk clinical trial AHOD0031 (56 male, 78 Caucasian, median age 15 years (range 1–20 years), 85 nodular sclerosing subtype, 23 Epstein-Barr virus (EBV) positive, and 24 refractory/relapse...

  13. Infrared Astronomy Professional Development for K-12 Educators: WISE Telescope

    Science.gov (United States)

    Borders, Kareen; Mendez, B. M.

    2010-01-01

    K-12 educators need effective and relevant astronomy professional development. WISE Telescope (Wide-Field Infrared Survey Explorer) and Spitzer Space Telescope Education programs provided an immersive teacher professional development workshop at Arecibo Observatory in Puerto Rico during the summer of 2009. As many common misconceptions involve scale and distance, teachers worked with Moon/Earth scale, solar system scale, and distance of objects in the universe. Teachers built and used basic telescopes, learned about the history of telescopes, explored ground and satellite based telescopes, and explored and worked on models of WISE Telescope. An in-depth explanation of WISE and Spitzer telescopes gave participants background knowledge for infrared astronomy observations. We taught the electromagnetic spectrum through interactive stations. The stations included an overview via lecture and power point, the use of ultraviolet beads to determine ultraviolet exposure, the study of WISE lenticulars and diagramming of infrared data, listening to light by using speakers hooked up to photoreceptor cells, looking at visible light through diffraction glasses and diagramming the data, protocols for using astronomy based research in the classroom, and infrared thermometers to compare environmental conditions around the observatory. An overview of LIDAR physics was followed up by a simulated LIDAR mapping of the topography of Mars. We will outline specific steps for K-12 infrared astronomy professional development, provide data demonstrating the impact of the above professional development on educator understanding and classroom use, and detail future plans for additional K-12 professional development. Funding was provided by WISE Telescope, Spitzer Space Telescope, Starbucks, Arecibo Observatory, the American Institute of Aeronautics and Astronautics, and the Washington Space Grant Consortium.

  14. Imaging Opportunities in Radiation Oncology

    International Nuclear Information System (INIS)

    Interdisciplinary efforts may significantly affect the way that clinical knowledge and scientific research related to imaging impact the field of Radiation Oncology. This report summarizes the findings of an intersociety workshop held in October 2008, with the express purpose of exploring 'Imaging Opportunities in Radiation Oncology.' Participants from the American Society for Radiation Oncology (ASTRO), National Institutes of Health (NIH), Radiological Society of North America (RSNA), American Association of physicists in Medicine (AAPM), American Board of Radiology (ABR), Radiation Therapy Oncology Group (RTOG), European Society for Therapeutic Radiology and Oncology (ESTRO), and Society of Nuclear Medicine (SNM) discussed areas of education, clinical practice, and research that bridge disciplines and potentially would lead to improved clinical practice. Findings from this workshop include recommendations for cross-training opportunities within the allowed structured of Radiology and Radiation Oncology residency programs, expanded representation of ASTRO in imaging related multidisciplinary groups (and reciprocal representation within ASTRO committees), increased attention to imaging validation and credentialing for clinical trials (e.g., through the American College of Radiology Imaging Network (ACRIN)), and building ties through collaborative research as well as smaller joint workshops and symposia.

  15. Neurologic complications in oncology

    Directory of Open Access Journals (Sweden)

    Andrea Pace

    2010-06-01

    Full Text Available Neurologic side effects related to cancer therapy are a common problem in oncology practice. These complications can negatively affect the management of the patient, because they can inhibit treatment and diminish quality of life. Therefore specific skills are required to recognise symptoms and clinical manifestations. This review focuses on the most common neurologic complications to improve physician’s familiarity in determining the aetiology of these symptoms.

  16. Development and maturation of Escherichia coli K-12 biofilms

    DEFF Research Database (Denmark)

    Reisner, A.; Haagensen, J.A.J.; Schembri, Mark; Zechner, E.L.; Molin, Søren

    2003-01-01

    The development and maturation of E. coli biofilms in flow-chambers was investigated. We found that the presence of transfer constitutive IncF plasmids induced biofilm development forming structures resembling those reported for Pseudomonas aeruginosa . The development occurred in a step....... We suggest on the basis of these results that E. coli K-12 biofilm development and maturation is dependent on cell-cell adhesion factors, which may act as inducers of self-assembly processes that result in differently structured biofilms depending on the adhesive properties on the cell surface.......-wise process: (i) attachment of cells to the substratum, (ii) clonal growth and microcolony formation, and (iii) differentiation into expanding structures rising 70-100 mum into the water phase. The first two steps were the same in the plasmid-carrying and plasmid-free strains, whereas the third step only...

  17. External audit of clinical practice and medical decision making in a new Asian oncology center: Results and implications for both developing and developed nations

    International Nuclear Information System (INIS)

    Purpose: The external audit of oncologist clinical practice is increasingly important because of the incorporation of audits into national maintenance of certification (MOC) programs. However, there are few reports of external audits of oncology practice or decision making. Our institution (The Cancer Institute, Singapore) was asked to externally audit an oncology department in a developing Asian nation, providing a unique opportunity to explore the feasibility of such a process. Methods and Materials: We audited 100 randomly selected patients simulated for radiotherapy in 2003, using a previously reported audit instrument assessing clinical documentation/quality assurance and medical decision making. Results: Clinical documentation/quality assurance, decision making, and overall performance criteria were adequate 74.4%, 88.3%, and 80.2% of the time, respectively. Overall 52.0% of cases received suboptimal management. Multivariate analysis revealed palliative intent was associated with improved documentation/clinical quality assurance (p = 0.07), decision making (p 0.007), overall performance (p = 0.003), and optimal treatment rates (p 0.07); non-small-cell lung cancer or central nervous system primary sites were associated with better decision making (p = 0.001), overall performance (p = 0.03), and optimal treatment rates (p = 0.002). Conclusions: Despite the poor results, the external audit had several benefits. It identified learning needs for future targeting, and the auditor provided facilitating feedback to address systematic errors identified. Our experience was also helpful in refining our national revalidation audit instrument. The feasibility of the external audit supports the consideration of including audit in national MOC programs

  18. Red Blood Cell Antibodies in Hematology/Oncology Patients: Interpretation of Immunohematologic Tests and Clinical Significance of Detected Antibodies.

    Science.gov (United States)

    Hendrickson, Jeanne E; Tormey, Christopher A

    2016-06-01

    Red blood cell (RBC) transfusion is a cornerstone of the management of patients with hematology/oncology disorders. However, a potentially deleterious consequence of transfusion is the development of alloantibodies against blood group antigens present on RBCs. Such alloantibodies can be an obstacle in providing compatible units for transfusion. Providers in this arena must fully understand the testing performed by blood banks, as well as the consequences of detected antibodies. This article reviews immunohematologic tests, describes how autoimmune hemolytic anemia is classified by autoantibodies; outlines RBC alloimmunization rates, and presents strategies to prevent/mitigate the impact of RBC alloimmunization. PMID:27113001

  19. Non-surgical management of early breast cancer in the United Kingdom: the role and practice of radiotherapy. Clinical Audit Sub-committee of the Faculty of Clinical Oncology, Royal College of Radiologists, and the Joint Council for Clinical Oncology.

    Science.gov (United States)

    Price, P; Yarnold, J R

    1995-01-01

    This paper reports on the delivery of radiotherapy to the primary site and lymphatic pathways in the management of early stage breast cancer. Radiotherapists were clear that their aim of locoregional radiotherapy was to reduce local recurrence. However, variation in policies for delivery were seen: 80% of radiotherapists did not always give radiotherapy routinely following wide local excision as part of breast conserving management; instead they withheld it selectively for a number of reasons. Only 66% routinely used breast boosts. There was a range of indications for giving radiotherapy to the lymphatic pathways; there was also variation in the management of incompletely or marginally excised primary tumours. Most sources of variation in the practice of radiotherapy in the management of women with early stage breast cancer appeared to arise from scientific uncertainty. However, organizational issues influenced many decisions. These scientific uncertainties and organizational issues are best addressed in the context of multidisciplinary breast clinics. PMID:8845315

  20. Ethical issues at the interface of clinical care and research practice in pediatric oncology: a narrative review of parents' and physicians' experiences

    Directory of Open Access Journals (Sweden)

    de Vries Martine C

    2011-09-01

    Full Text Available Abstract Background Pediatric oncology has a strong research culture. Most pediatric oncologists are investigators, involved in clinical care as well as research. As a result, a remarkable proportion of children with cancer enrolls in a trial during treatment. This paper discusses the ethical consequences of the unprecedented integration of research and care in pediatric oncology from the perspective of parents and physicians. Methodology An empirical ethical approach, combining (1 a narrative review of (primarily qualitative studies on parents' and physicians' experiences of the pediatric oncology research practice, and (2 comparison of these experiences with existing theoretical ethical concepts about (pediatric research. The use of empirical evidence enriches these concepts by taking into account the peculiarities that ethical challenges pose in practice. Results Analysis of the 22 studies reviewed revealed that the integration of research and care has consequences for the informed consent process, the promotion of the child's best interests, and the role of the physician (doctor vs. scientist. True consent to research is difficult to achieve due to the complexity of research protocols, emotional stress and parents' dependency on their child's physician. Parents' role is to promote their child's best interests, also when they are asked to consider enrolling their child in a trial. Parents are almost never in equipoise on trial participation, which leaves them with the agonizing situation of wanting to do what is best for their child, while being fearful of making the wrong decision. Furthermore, a therapeutic misconception endangers correct assessment of participation, making parents inaccurately attribute therapeutic intent to research procedures. Physicians prefer the perspective of a therapist over a researcher. Consequently they may truly believe that in the research setting they promote the child's best interests, which maintains the

  1. K-12 Professional Development at the Harvard Forest LTER

    Science.gov (United States)

    Bennett, K.

    2012-12-01

    As part of the Long Term Ecological Research (LTER) program, the Harvard Forest in Petersham, Massachusetts seeks to train the next generation of researchers, by involving K-12 grade students and their teachers in hands-on, field-based, ecological research in their own schoolyard and community. Students learn to collect data on important long-term ecological issues and processes. Student data are then shared on the Harvard Forest website. To prepare teachers for project protocols, teachers are given direct access to Harvard ecologists with professional development workshops and on-line resources. With the Harvard Forest Schoolyard LTER program, students can participate in three different research projects focusing on phenology, invasive insects, and vernal pools. Teachers attend the Summer Institute for Teachers to learn project content and methods. They return in fall to participate in one of three levels of data workshops to learn how to input, manage, and analyze project data. In the spring, teachers again meet with the Harvard ecologists about project protocols, and to share, through a series of teacher presentations, the ways these project themes are being integrated into class curricula. These professional development opportunities result in long term collaborative partnerships with local schools and the Harvard Forest LTER. In addition to the LTER Schoolyard Ecology Program, the Harvard Forest has supported a successful Research Experience for Teachers (RET) program for the last six years. Throughout the summer, teachers work on research projects alongside Harvard Forest and affiliated scientists, post-docs, graduate students, and REU's (Research Experience for Undergraduates). The RET program provides teachers with the opportunity to build scientific knowledge, develop an understanding of research methods, and translate their new knowledge and experiences into cutting edge classroom lessons. The past two summers I have worked with Dr. Andrew Richardson

  2. The ARMADA Project: Bridging Research and K-12 Education

    Science.gov (United States)

    Scowcroft, G.

    2004-12-01

    The ARMADA Project (www.armadaproject.org) is a five-year effort led by the University of Rhode Island's Office of Marine Programs in collaboration with the URI's Graduate School of Oceanography, the Joint Oceanographic Institutions, the Consortium for Oceanographic Research and Education, and the JASON Foundation for Education. At the heart of the ARMADA Project is the development of a unique system for fostering sustainable partnerships between ocean science researchers, teachers, and professional scientist/educators. The ARMADA Project is designed to establish a model framework for facilitating the involvement of a national "ARMADA" of K-12 teachers in active ocean, polar, and environmental science research and mentoring experiences. Further, the project cultivates ongoing relationships with existing successful ocean and earth science research projects, educational programs, and marine science information outlets to effectively disseminate research results and products, relevant standards-based classroom activities, and associated science content to thousands of science, mathematics, and technology teachers nationwide. There are two primary goals for the ARMADA Project: 1) to foster science teacher retention and renewal through pedagogy and content training, research experiences, and mentoring activities, and 2) to advance and sustain the integration of the geoscience research enterprise with the K-12 education community. The second goal directly impacts the scientific community as it fosters the broader impacts of its research, Currently in its second year, the ARMADA Project has placed 26 US master teachers and one Swedish teacher in research experiences around the world - literally from pole to pole. These master teachers have directly spread the impacts of their experiences to 38 mentees. The project is designed to assist the geoscience community with satisfying broader impact goals. There are several levels through which scientists may collaborate with

  3. K-12 Education Nonprofit Employees' Perceptions of Strategies for Recruiting and Retaining Employees

    Science.gov (United States)

    Byrne, Tara Marie

    2013-01-01

    This qualitative study explored the key reasons individuals who work in K-12 education nonprofit organizations enter the field of K-12 nonprofit education and their motivations for doing so. The purpose of this study was to find new strategies for recruiting and retaining K-12 education nonprofit employees by examining the obstacles that exist to…

  4. Interview with Joe Freidhoff: A Bird's-Eye View of K-12 Online Learning

    Science.gov (United States)

    Pourreau, Leslie

    2015-01-01

    The intent of this article is to introduce long-time "Online Learning" readership to the field of K-12 online learning while also providing direction for the K-12 online learning scholars about where the field is going or should be going in terms of meeting the needs of K-12 stakeholders. Recently an interview was conducted with Dr. Joe…

  5. "Flipping" educational technology professional development for K-12 educators

    Science.gov (United States)

    Spencer, Daniel

    As the demand for more effective professional development increases in K-12 schools, trainers must adjust their training methods to meet the needs of their teacher learners. Just as lecture-heavy, teacher-centered instruction only meet the learning needs of a small minority of students, "sit and get" professional development rarely results in the teachers gaining the skills and confidence necessary to use technology effectively in their instruction. To resolve the frustrations of teachers related to ineffective professional development, a "Flipped PD" training model was developed based on the learning needs of adult learners, the integration of technological, pedagogical, and content knowledge (TPACK), learning activities, and the Flipped Classroom concept. Under this model, training shifts from a passive, trainer-centered format, to an active, learner-centered format where teachers learn to use technology in their classrooms by first focusing on pedagogical issues, then choosing the options that work best for addressing those issues in their unique situation, and completing "learn-by-doing" projects. Those who participate in "Flipped PD" style trainings tend to have more confidence upon completion that they can use the tools they were trained on in their teaching, as well as believe that the PD was engaging and a good use of their time.

  6. Development and maturation of Escherichia coli K-12 biofilms

    DEFF Research Database (Denmark)

    Reisner, A.; Haagensen, J.A.J.; Schembri, Mark;

    2003-01-01

    The development and maturation of E. coli biofilms in flow-chambers was investigated. We found that the presence of transfer constitutive IncF plasmids induced biofilm development forming structures resembling those reported for Pseudomonas aeruginosa . The development occurred in a step-wise pro......The development and maturation of E. coli biofilms in flow-chambers was investigated. We found that the presence of transfer constitutive IncF plasmids induced biofilm development forming structures resembling those reported for Pseudomonas aeruginosa . The development occurred in a step....... We further provide evidence that flagella, type 1 fimbriae, curli and Ag43 are all dispensable for the observed biofilm maturation. In addition, our results indicate that cell-to-cell signalling mediated by autoinducer 2 (AI-2) is not required for differentiation of E. coli within a biofilm community....... We suggest on the basis of these results that E. coli K-12 biofilm development and maturation is dependent on cell-cell adhesion factors, which may act as inducers of self-assembly processes that result in differently structured biofilms depending on the adhesive properties on the cell surface....

  7. K-12 Teachers Encounter Digital Games: A Qualitative Investigation of Teachers' Perceptions of the Potential of Digital Games for K-12 Education

    Science.gov (United States)

    Dickey, Michele D.

    2015-01-01

    The purpose of this study is to investigate teachers' perceptions of the integration of digital games for K-12 education. Specifically, this qualitative investigation focuses on reflective dialogued gathered from a group of K-12 educators about their experiences and perceptions of learning about and playing digital games for teaching and learning.…

  8. American Society of Clinical Oncology policy statement: opportunities in the patient protection and affordable care act to reduce cancer care disparities.

    Science.gov (United States)

    Moy, Beverly; Polite, Blase N; Halpern, Michael T; Stranne, Steven K; Winer, Eric P; Wollins, Dana S; Newman, Lisa A

    2011-10-01

    Patients in specific vulnerable population groups suffer disproportionately from cancer. The elimination of cancer disparities is critically important for lessening the burden of cancer. The Patient Protection and Affordable Care Act provides both opportunities and challenges for addressing cancer care disparities and access to care. The American Society of Clinical Oncology (ASCO) advocates for policies that ensure access to cancer care for the underserved. Such policies include insurance reform and the reduction of economic barriers to quality health care. Building on ASCO's prior statement on disparities in cancer care (2009), this article summarizes elements of the health care law that are relevant to cancer disparities and provides recommendations for addressing major provisions in the law. It outlines specific strategies to address insurance reform, access to care, quality of care, prevention and wellness, research on health care disparities, and diversity in the health care workforce. ASCO is committed to leading efforts toward the improvement of cancer care among the most vulnerable patients. PMID:21810680

  9. Bioimpedance-based respiratory gating method for oncologic positron emission tomography (PET) imaging with first clinical results

    International Nuclear Information System (INIS)

    Respiratory motion may cause significant image artefacts in positron emission tomography/computed tomography (PET/CT) imaging. This study introduces a new bioimpedance-based gating method for minimizing respiratory artefacts. The method was studied in 12 oncologic patients by evaluating the following three parameters: maximum metabolic activity of radiopharmaceutical accumulations, the size of these targets as well as their target-to-background ratio. The bioimpedance-gated images were compared with non-gated images and images that were gated with a reference method, chest wall motion monitoring by infrared camera. The bioimpedance method showed clear improvement as increased metabolic activity and decreased target volume compared to non-gated images and produced consistent results with the reference method. Thus, the method may have great potential in the future of respiratory gating in nuclear medicine imaging.

  10. Bioimpedance-based respiratory gating method for oncologic positron emission tomography (PET) imaging with first clinical results

    Science.gov (United States)

    Koivumäki, T.; Vauhkonen, M.; Teuho, J.; Teräs, M.; Hakulinen, M. A.

    2013-04-01

    Respiratory motion may cause significant image artefacts in positron emission tomography/computed tomography (PET/CT) imaging. This study introduces a new bioimpedance-based gating method for minimizing respiratory artefacts. The method was studied in 12 oncologic patients by evaluating the following three parameters: maximum metabolic activity of radiopharmaceutical accumulations, the size of these targets as well as their target-to-background ratio. The bioimpedance-gated images were compared with non-gated images and images that were gated with a reference method, chest wall motion monitoring by infrared camera. The bioimpedance method showed clear improvement as increased metabolic activity and decreased target volume compared to non-gated images and produced consistent results with the reference method. Thus, the method may have great potential in the future of respiratory gating in nuclear medicine imaging.

  11. Tumor thrombus of inferior vena cava in patients with renal cell carcinoma – clinical and oncological outcome of 50 patients after surgery

    Directory of Open Access Journals (Sweden)

    Kocot Arkadius

    2012-06-01

    Full Text Available Abstract Background To evaluate oncological and clinical outcome in patients with renal cell carcinoma (RCC and tumor thrombus involving inferior vena cava (IVC treated with nephrectomy and thrombectomy. Methods We identified 50 patients with a median age of 65 years, who underwent radical surgical treatment for RCC and tumor thrombus of the IVC between 1997 and 2010. The charts were reviewed for pathological and surgical parameters, as well as complications and oncological outcome. Results The median follow-up was 26 months. In 21 patients (42% distant metastases were already present at the time of surgery. All patients underwent radical nephrectomy, thrombectomy and lymph node dissection through a flank (15 patients/30%, thoracoabdominal (14 patients/28% or midline abdominal approach (21 patients/42%, depending upon surgeon preference and upon the characteristics of tumor and associated thrombus. Extracorporal circulation with cardiopulmonary bypass (CPB was performed in 10 patients (20% with supradiaphragmal thrombus of IVC. Cancer-specific survival for the whole cohort at 5 years was 33.1%. Survival for the patients without distant metastasis at 5 years was 50.7%, whereas survival rate in the metastatic group at 5 years was 7.4%. Median survival of patients with metastatic disease was 16.4 months. On multivariate analysis lymph node invasion, distant metastasis and grading were independent prognostic factors. There was no statistically significant influence of level of the tumor thrombus on survival rate. Indeed, patients with supradiaphragmal tumor thrombus (n = 10 even had a better outcome (overall survival at 5 years of 58.33% than the entire cohort. Conclusions An aggressive surgical approach is the most effective therapeutic option in patients with RCC and any level of tumor thrombus and offers a reasonable longterm survival. Due to good clinical and oncological outcome we prefer the use of CPB with extracorporal

  12. Towards secondary use of heterogeneous radio-oncological data for retrospective clinical trials: service-oriented connection of a central research database with image analysis tools

    Science.gov (United States)

    Bougatf, Nina; Bendl, Rolf; Debus, Jürgen

    2015-03-01

    Our overall objective is the utilization of heterogeneous and distributed radio-oncological data in retrospective clinical trials. Previously, we have successfully introduced a central research database for collection of heterogeneous data from distributed systems. The next step is the integration of image analysis tools in the standard retrieval process. Hence, analyses for complex medical questions can be processed automatically and facilitated immensely. In radiation oncology recurrence analysis is a central approach for the evaluation of therapeutic concepts. However, various analysis steps have to be performed like image registration, dose transformation and dose statistics. In this paper we show the integration of image analysis tools in the standard retrieval process by connecting them with our central research database using a service-oriented approach. A concrete problem from recurrence analysis has been selected to prove our concept exemplarily. We implemented service-oriented data collection and analysis tools to use them in a central analysis platform, which is based on a work flow management system. An analysis work flow has been designed that, at first, identifies patients in the research database fulfilling the inclusion criteria. Then the relevant imaging data is collected. Finally the imaging data is analyzed automatically. After the successful work flow execution, the results are available for further evaluation by a physician. As a result, the central research database has been connected successfully with automatic data collection and image analysis tools and the feasibility of our service-oriented approach has been demonstrated. In conclusion, our approach will simplify retrospective clinical trials in our department in future.

  13. Cool Science: K-12 Climate Change Art Displayed on Buses

    Science.gov (United States)

    Chen, R. F.; Lustick, D. S.; Lohmeier, J.; Thompson, S. R.

    2015-12-01

    Cool science is an art contest where K12 students create placards (7" x 22") to educate the public about climate change. Students are prompted to create their artwork in response to questions such as: What is the evidence for climate change? How does climate change impact your local community? What can you do to reduce the impacts of climate change? In each of three years, 500-600 student entrees have been submitted from more than 12 school districts across Massachusetts. A panel of judges including scientists, artists, rapid transit representatives, and educators chooses elementary, middle, and high school winners. Winners (6), runners-up (6), and honorable mentions (12) and their families and teachers are invited to an annual Cool Science Award Ceremony to be recognized and view winning artwork. All winning artwork is posted on the Cool Science website. The winning artwork (2 per grade band) is converted into placards (11" x 28") and posters (2.5' x 12') that are placed on the inside (placards) and outside (posters) of buses. Posters are displayed for one month. So far, Cool Science was implemented in Lowell, MA where over 5000 public viewers see the posters daily on the sides of Lowell Rapid Transit Authority (LRTA) buses, making approximately 1,000,000 impressions per year. Cool Science acts to increase climate literacy in children as well as the public, and as such promotes intergenerational learning. Using art in conjunction with science learning about climate change appears to be effective at engaging not just traditionally high achieving science students, but also those interested in the creative arts. Hearing winners' stories about how they created their artwork and what this contest meant to them supports the idea that Cool Science attracts a wide diversity of students. Parents discuss climate change with their children. Multiple press releases announcing the winners further promotes the awareness of climate change throughout school districts and their

  14. Different Clinical Utility of Oropharyngeal Bacterial Screening prior to Percutaneous Endoscopic Gastrostomy in Oncological and Neurological Patients

    Directory of Open Access Journals (Sweden)

    Radek Kroupa

    2014-01-01

    Full Text Available Background. The aim of this study was to monitor oropharyngeal bacterial colonization in patients indicated for percutaneous endoscopic gastronomy (PEG. Methods. Oropharyngeal swabs were obtained from patients prior to PEG placement. A development of peristomal infection was evaluated. The analysis of oropharyngeal and peristomal site pathogens was done. Results. Consecutive 274 patients referred for PEG due to neurological disorder or cancer completed the study. Oropharyngeal colonization with pathogens was observed in 69% (190/274, dominantly in the neurologic subgroup of patients (P < 0.001. Peristomal infection occurred in 30 (10.9% of patients and in 57% of them the correlation between oropharyngeal and peristomal agents was present. The presence of oropharyngeal pathogens was assessed as an important risk factor for the development of peristomal infection only in oncological patients (OR = 8.33, 95% CI: 1.66–41.76. Despite a high prevalence of pathogens in neurological patients, it did not influence the risk of peristomal infection with the exception for methicillin resistant Staphylococcus aureus (MRSA carriers (OR 4.5, 95% CI: 1.08–18.76. Conclusion. During oropharyngeal microbial screening prior to the PEG insertion, the detection of pathogens may be a marker of the increased risk of peristomal infection in cancer patients only. In neurological patients the benefit of the screening is limited to the detection of MRSA carriers.

  15. Schools K-12, Schools K-12 point layer., Published in 2006, 1:4800 (1in=400ft) scale, Reno County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Schools K-12 dataset, published at 1:4800 (1in=400ft) scale, was produced all or in part from Orthoimagery information as of 2006. It is described as 'Schools...

  16. Communicating Regional Geology and Geohazards to K-12 Teachers

    Science.gov (United States)

    Pratt-Sitaula, B.; Butler, R. F.; Whitman, J. M.; Granshaw, F. D.; Magura, B.; Hedeen, C.; Groom, R.; Thompson, D.; Johnson, J. A.

    2011-12-01

    The Teachers on the Leading Edge (TOTLE) program has designed an innovative model for middle school teacher professional development related to Pacific NW plate margin hazards and EarthScope science. The program has been effective at improving teacher knowledge and confidence and has led to high rates of curricular implementation. The elements particularly key to success are: a) facilitation team with broad expertise in both geoscience and education; b) regional team format that encouraged learning community development; c) teachers' desire to focus on regional geologic hazards; d) significant use of animations and field trips to aid in "visualization" of processes; and e) extensive "kit" of teaching materials for easy classroom transfer. The 1-week workshops were held in summer 2008-2010 and 35 Pacific NW middle school teachers attended each year. Geoscientists from universities and research institutions conducted the field trips and content sessions. Master K-12 Earth science teachers designed or modified curricular materials and led the teaching implementation sessions. Each year, the teachers were divided into 5 regional teams led by geoscience educator team leaders (community college instructors or similar). Teachers were surveyed on teaching confidence and content knowledge before and after the workshops. Follow-up surveys addressed teaching confidence and curricular implementation and were conducted 0.7 years after (all cohorts), 1.7 years after (2009 cohort), and 2.7 years after (2008 cohort). Teacher confidence (4-point scale: 1="not at all confident"; 4="very confident") on workshop content topics continued to rise in each subsequent survey from 2.7 (pre) to 3.3 (post) to 3.5 (0.7 yr follow up) to 3.7 (2-3 yr follow up) suggesting the program impact is long-lived. In the post-workshop surveys, 100% of participants agreed or strongly agreed that the program would positively impact their teaching. Average teacher performance on content questions improved

  17. Thirty years since foundation of the department of gynaecology at the Institute of Clinical Oncology in Bratislava

    International Nuclear Information System (INIS)

    In 1949, the department of gynaecology was set up. After a brief historical draft describing the development of the oncological center, we draw attention to the advantages of its multidisciplinary structure demonstrated in our cooperation with that of radiotherapy. The kinds of treatment and their results are reported with regard to the carcinomas of the cervix, corpus and vulva. Radiotherapy of the carcinoma of the cervix using a modified Stockholm method covers two sessions, with an interval of two to three weeks during which 60 mg radium (= 1600 mgh) intrauterine and twice 30 mg radium (= 1600 mgh) intravaginal are applied for 26.5 hours combined with a percutaneous irradiation of the parametries with 3500 to 4000 rad (gammatron, 60Co; betatron, 42 MeV). We prefer surgical therapy for the carcinoma of the cervix in the Ia, Ib and IIa stages up to the age of 65. We operated on 604 patients between 1957 and 1978, all of them receiving additional radiotherapy, a third preoperative irradiation. Carcinoma of the corpus has rarely been treated surgically in account of the negative selection of our patients. The radiotherapeutic procedure mostly applied is the tamponade of the uterine cavum whereby twelfe 10-mg radium tubes are applied in two sessions for 25 hours, 6000 mgh in all, plus a vaginal implant of 1500 mgh in stage-I cases, and in stage-II cases 3000 mgh intravaginally and a percutaneous telecobalt-dose of 3000 to 4000 rad. Carcinoma of the vulva is, if possible, primarily to be treated surgically by radical vulvectomy and lymphadenectomy of the inguinal and subinguinal lymphodes. Postoperative radiotherapy is carried out, when the lymphodes are positive. (orig.)

  18. Thirty years since foundation of the department of gynaecology at the Institute of Clinical Oncology in Bratislava

    Energy Technology Data Exchange (ETDEWEB)

    Manka, I. (Komenskeho Univerzita, Bratislava (Czechoslovakia). Gynaecological Dept.)

    1980-09-01

    In 1949, the department of gynaecology was set up. After a brief historical draft describing the development of the oncological center, we draw attention to the advantages of its multidisciplinary structure demonstrated in our cooperation with that of radiotherapy. The kinds of treatment and their results are reported with regard to the carcinomas of the cervix, corpus and vulva. Radiotherapy of the carcinoma of the cervix using a modified Stockholm method covers two sessions, with an interval of two to three weeks during which 60 mg radium (= 1600 mgh) intrauterine and twice 30 mg radium (= 1600 mgh) intravaginal are applied for 26.5 hours combined with a percutaneous irradiation of the parametries with 3500 to 4000 rad (gammatron, /sup 60/Co; betatron, 42 MeV). We prefer surgical therapy for the carcinoma of the cervix in the Ia, Ib and IIa stages up to the age of 65. We operated on 604 patients between 1957 and 1978, all of them receiving additional radiotherapy, a third preoperative irradiation. Carcinoma of the corpus has rarely been treated surgically in account of the negative selection of our patients. The radiotherapeutic procedure mostly applied is the tamponade of the uterine cavum whereby twelfe 10-mg radium tubes are applied in two sessions for 25 hours, 6000 mgh in all, plus a vaginal implant of 1500 mgh in stage-I cases, and in stage-II cases 3000 mgh intravaginally and a percutaneous telecobalt-dose of 3000 to 4000 rad. Carcinoma of the vulva is, if possible, primarily to be treated surgically by radical vulvectomy and lymphadenectomy of the inguinal and subinguinal lymphodes. Postoperative radiotherapy is carried out, when the lymphodes are positive.

  19. Introduction of online adaptive radiotherapy for bladder cancer through a multicentre clinical trial (Trans-Tasman Radiation Oncology Group 10.01): lessons learned

    International Nuclear Information System (INIS)

    Online adaptive radiotherapy for bladder cancer is a novel radiotherapy technique that was found feasible in a pilot study at a single academic institution. In September 2010 this technique was opened as a multicenter study through the Trans-Tasman Radiation Oncology Group (TROG 10.01 bladder online adaptive radiotherapy treatment). Twelve centers across Australia and New-Zealand registered interest into the trial. A multidisciplinary team of radiation oncologists, radiation therapists and medical physicists represented the trial credentialing and technical support team. To provide timely activation and proper implementation of the adaptive technique the following key areas were addressed at each site: Staff education/training; Practical image guided radiotherapy assessment; provision of help desk and feedback. The trial credentialing process involved face-to-face training and technical problem solving via full day site visits. A dedicated 'help-desk' team was developed to provide support for the clinical trial. 26% of the workload occurred at the credentialing period while the remaining 74% came post-center activation. The workload was made up of the following key areas; protocol clarification (36%), technical problems (46%) while staff training was less than 10%. Clinical trial credentialing is important to minimizing trial deviations. It should not only focus on site activation quality assurance but also provide ongoing education and technical support. (author)

  20. Introduction of online adaptive radiotherapy for bladder cancer through a multicentre clinical trial (Trans-Tasman Radiation Oncology Group 10.01: Lessons learned

    Directory of Open Access Journals (Sweden)

    Daniel Pham

    2013-01-01

    Full Text Available Online adaptive radiotherapy for bladder cancer is a novel radiotherapy technique that was found feasible in a pilot study at a single academic institution. In September 2010 this technique was opened as a multicenter study through the Trans-Tasman Radiation Oncology Group (TROG 10.01 bladder online adaptive radiotherapy treatment. Twelve centers across Australia and New-Zealand registered interest into the trial. A multidisciplinary team of radiation oncologists, radiation therapists and medical physicists represented the trial credentialing and technical support team. To provide timely activation and proper implementation of the adaptive technique the following key areas were addressed at each site: Staff education/training; Practical image guided radiotherapy assessment; provision of help desk and feedback. The trial credentialing process involved face-to-face training and technical problem solving via full day site visits. A dedicated "help-desk" team was developed to provide support for the clinical trial. 26% of the workload occurred at the credentialing period while the remaining 74% came post-center activation. The workload was made up of the following key areas; protocol clarification (36%, technical problems (46% while staff training was less than 10%. Clinical trial credentialing is important to minimizing trial deviations. It should not only focus on site activation quality assurance but also provide ongoing education and technical support.

  1. Oncology nurses awareness of drug interactions

    OpenAIRE

    Azize Karahan; Sevcan Avcı Isik; Sultan Kav; Aysel Abbasoglu

    2015-01-01

    Objective: The aim of this study was to determine oncology nurses awareness of drug interactions. Methods: This descriptive study was conducted with nurses working in the oncology clinics who are a member of Oncology Nursing Association of Turkey. A total of 115 nurses (response rate %20) were responded to the online survey that consists of 28 questions. Results: The mean age of the nurses was 33 ± 6.8. The majority of nurses work in university hospital (60%) as a clinical nurse (62.6%) and h...

  2. K12-biotinylated Histone H4 Marks Heterochromatin in Human Lymphoblastoma Cells1

    OpenAIRE

    Camporeale, Gabriela; Oommen, Anna M; Griffin, Jacob B.; Sarath, Gautam; Zempleni, Janos

    2007-01-01

    Covalent modifications of histones play crucial roles in chromatin structure and genomic stability. Recently, we reported a novel modification of histones: biotinylation of lysine residues. Here we provide evidence that K12-biotinylated histone H4 (K12Bio H4) maps specifically to both heterochromatin (alpha satellite repeats in pericentromeric regions) and transcriptionally repressed chromatin (γ-G globin and interleukin-2) in human lymphoblastoma cells. The abundance of K12Bio H4 in these re...

  3. Content Management on the Internet: a look at K-12 schools access to resources

    OpenAIRE

    Wenrich, John Richard

    1998-01-01

    The Internet presents a new phenomenon to educators and students in the K-12 environment. It's ease of use and ready access to material provides an overwhelming resource for use in the K-12 classroom. This study looked at content management of Internet resources in the K-12 school environment. Content management is defined as the methods of organizing access to the information available on the Internet allowing the teacher to effectively use resources in a classroom setting. Teachers have man...

  4. Review and comparison of clinical evidence submitted to support European Medicines Agency market authorization of orphan-designated oncological treatments

    OpenAIRE

    Winstone, Julie; Chadda, Shkun; Ralston, Stephen; Sajosi, Peter

    2015-01-01

    Background Clinical trials for treatments indicated for orphan diseases may be limited due to the low prevalence of such diseases; this can result in implications for both regulatory and health economic perspectives. This study assessed the pivotal clinical evidence packages submitted to support applications for European Medicines Agency (EMA) marketing authorizations for treatments for orphan conditions, in relation to the size of the eligible patient population. Methods Approved treatments ...

  5. Hyperthermia - its actual role in radiation oncology. Pt. 3. Clinical rationale and results in deep seated tumors

    International Nuclear Information System (INIS)

    Combined hyperthermia and radiation therapy has been reported to yield higher complete and durable responses than radiotherapy alone in superficial tumors. In deep seated tumors the effect of the combined treatment is still under research. The literature and own clinical data are reviewed with regard to biological and physical fundamentals and clinical results. Clinical phase I to II studies have applied regional hyperthermia in the abdomen, the pelvic region and the extremities. Usually primary advanced, persistent or local recurrent and metastatic tumors were selected for treatment either due to poor response to conventional therapy or for effective palliation. The clinical data are presented concerning the following topics: Invasive thermometry, temperature parameter in tumor and normal tissue, toxicity, tumor response, treatment planning, clinical trials and prognostic factors. Clinical results of thermoradiotherapy for advanced or recurrent rectal cancer, cervical cancer and soft tissue sarcomas are reviewed in detail. In addition, the prognostic relevance of temperature parameters and physiological conditions such as global tumor perfusion are discussed. (orig.)

  6. Oncology Nursing Society

    Science.gov (United States)

    ... Hill Days Monday, August 22, 2016 Oncology Nursing Society Announces Support for DAISY Foundation Monday, August 8, 2016 Oncology Nursing Society and Haymarket Media Inc. Announce Navigation Summit Collaboration ...

  7. [History of Oncology in Slovakia].

    Science.gov (United States)

    Ondruš, D; Kaušitz, J

    2016-01-01

    The history of oncology in Slovakia is closely linked to the history of St. Elizabeth Hospital, which was set up in the mid-18th century by nuns of the St. Elizabeth Order in Bratislava. In the first half of the 20th century, a unit was set up in the hospital dedicated to diagnosis and treatment of cancer. Shortly after World War II, the unit was turned into the Institute for Cancer Research and Treatment. In 1950, St. Elizabeth Hospital was nationalized, and the Cancer Research Institute of the Slovak Academy of Science and the Institute of Clinical Oncology were located there as centers for oncological diagnosis and treatment. After the restitution of church property in the early 1990s, the hospital was returned to the Order of St. Elizabeth, which set up the St. Elisabeth Cancer Institute in the hospital premises in January of 1996. This year marks the 20th anniversary of this institute in its new premises and the 85th anniversary of the Institute of Radiumtherapy founded in Bratislava, and thus the establishment of institutional healthcare for cancer patients in Slovakia is the reason for balancing. We present a view of the consecutive changes in the organization, space and staff of the Institute and evaluate the impact of celebrities on medicine who developed oncology as a clinical, scientific and educational discipline in Bratislava and in other cities and regions of Slovakia. PMID:27296401

  8. Radiation Therapy Oncology Group Consensus Panel Guidelines for the Delineation of the Clinical Target Volume in the Postoperative Treatment of Pancreatic Head Cancer

    International Nuclear Information System (INIS)

    Purpose: To develop contouring guidelines to be used in the Radiation Therapy Oncology Group protocol 0848, a Phase III randomized trial evaluating the benefit of adjuvant chemoradiation in patients with resected head of pancreas cancer. Methods and Materials: A consensus committee of six radiation oncologists with expertise in gastrointestinal radiotherapy developed stepwise contouring guidelines and an atlas for the delineation of the clinical target volume (CTV) in the postoperative treatment of pancreas cancer, based on identifiable regions of interest and margin expansions. Areas at risk for subclinical disease to be included in the CTV were defined, including nodal regions, anastomoses, and the preoperative primary tumor location. Regions of interest that could be reproducibly contoured on postoperative imaging after a pancreaticoduodenectomy were identified. Standardized expansion margins to encompass areas at risk were developed after multiple iterations to determine the optimal margin expansions. Results: New contouring recommendations based on CT anatomy were established. Written guidelines for the delineation of the postoperative CTV and normal tissues, as well as a Web-based atlas, were developed. Conclusions: The postoperative abdomen has been a difficult area for effective radiotherapy. These new guidelines will help physicians create fields that better encompass areas at risk and minimize dose to normal tissues.

  9. Consensus of the Brazilian Society of Infectious Diseases and Brazilian Society of Clinical Oncology on the management and treatment of Kaposi's sarcoma

    Directory of Open Access Journals (Sweden)

    Érico Arruda

    2014-06-01

    Full Text Available Kaposi's sarcoma is a multifocal vascular lesion of low-grade potential that is most often present in mucocutaneous sites and usually also affects lymph nodes and visceral organs. The condition may manifest through purplish lesions, flat or raised with an irregular shape, gastrointestinal bleeding due to lesions located in the digestive system, and dyspnea and hemoptysis associated with pulmonary lesions. In the early 1980s, the appearance of several cases of Kaposi's sarcoma in homosexual men was the first alarm about a newly identified epidemic, acquired immunodeficiency syndrome. In 1994, it was finally demonstrated that the presence of a herpes virus associated with Kaposi's sarcoma called HHV-8 or Kaposi's sarcoma herpes virus and its genetic sequence was rapidly deciphered. The prevalence of this virus is very high (about 50% in some African populations, but stands between 2% and 8% for the entire world population. Kaposi's sarcoma only develops when the immune system is depressed, as in acquired immunodeficiency syndrome, which appears to be associated with a specific variant of the Kaposi's sarcoma herpes virus. There are no treatment guidelines for Kaposi's sarcoma established in Brazil, and thus the Brazilian Society of Clinical Oncology and the Brazilian Society of Infectious Diseases developed the treatment consensus presented here.

  10. New Learning Models: The Evolution of Online Learning into Innovative K-12 Blended Programs

    Science.gov (United States)

    Patrick, Susan

    2011-01-01

    The author traces the growth of K-12 online learning in the United States from its modest genesis in the mid-1990s with 50,000 students to the more than 4 million enrollments today, the fastest scaling ever of any innovation in K-12 education. The evolution from one-size-fits-all online courses to innovative, blended instructional models that are…

  11. The Efficiency and Effectiveness of the K-12 Energy Technology Education Promotion Centers in Taiwan

    Science.gov (United States)

    Lee, Lung-Sheng

    2013-01-01

    In order to promote energy literacy for graders K-12, the Ministry of Education (MOE) in Taiwan initiated a K-12 Energy Technology Education Project in September 2010. This 40-month project has one project office affiliated to a university, and 18 promotion centers affiliated to 18 schools--including 5 regional centers for upper-secondary schools…

  12. An Exploratory Study on K-12 Teachers' Use of Technology and Multimedia in the Classroom

    Science.gov (United States)

    Martin, Florence; Carr, Marsha L.

    2015-01-01

    21st century has seen new technology and multimedia made available for integration in K-12 classrooms. This exploratory study examines K-12 teachers' use of technology and multimedia in the classroom in two southern counties in the Southeastern United States. The purpose of the study was to answer the following five research questions: 1) What…

  13. Integrating Data Mining in Program Evaluation of K-12 Online Education

    Science.gov (United States)

    Hung, Jui-Long; Hsu, Yu-Chang; Rice, Kerry

    2012-01-01

    This study investigated an innovative approach of program evaluation through analyses of student learning logs, demographic data, and end-of-course evaluation surveys in an online K-12 supplemental program. The results support the development of a program evaluation model for decision making on teaching and learning at the K-12 level. A case study…

  14. Development and Evaluation of Food Safety Modules for K-12 Science Education

    Science.gov (United States)

    Chapin, Travis K.; Pfuntner, Rachel C.; Stasiewicz, Matthew J.; Wiedmann, Martin; Orta-Ramirez, Alicia

    2015-01-01

    Career and educational opportunities in food science and food safety are underrecognized by K-12 students and educators. Additionally, misperceptions regarding nature of science understanding persist in K-12 students despite being emphasized as an important component of science education for over 100 y. In an effort to increase awareness…

  15. Identity and biography as mediators of science and mathematics faculty's involvement in K-12 service

    Science.gov (United States)

    Skerrett, Allison; Sevian, Hannah

    2010-09-01

    This article explores aspects of science and mathematics faculty identities and biographies that mediated their involvement in K-12 service. Faculty expressed five motivations for participating in K-12 service—advancing their research agenda, advocating environmental consciousness, desiring to be involved in their children's schools, aspiring to improve their pedagogical practices and promoting equity and social justice.

  16. Safety assessment of the oral cavity probiotic Streptococcus salivarius K12.

    Science.gov (United States)

    Burton, Jeremy P; Wescombe, Philip A; Moore, Chris J; Chilcott, Chris N; Tagg, John R

    2006-04-01

    Streptococcus salivarius is a prominent member of the oral microbiota and has excellent potential for use as a probiotic targeting the oral cavity. In this report we document safety data relating to S. salivarius K12, including assessment of its antibiogram, metabolic profiles, and virulence determinants, and we examine the microbial composition of saliva following the dosing of subjects with K12. PMID:16598017

  17. Extended Safety Data for the Oral Cavity Probiotic Streptococcus salivarius K12.

    Science.gov (United States)

    Burton, J P; Chilcott, C N; Wescombe, P A; Tagg, J R

    2010-10-01

    Previous studies of the bacteriocin-producing Streptococcus salivarius K12 monitored a variety of intrinsic strain characteristics of potential relevance to its application as an oral probiotic in humans. These included the content of antibiotic resistance and virulence determinants, the production of deleterious metabolic by-products and its genetic stability. In the present study, we examined additional safety factors including the responses of rats to either short- or long-term oral dosing with strain K12 preparations. In addition, the potential genotoxicity of strain K12 was tested using a bacterial reverse mutation assay. To determine the occurrence and concentrations in human saliva of S. salivarius having the same bacteriocin phenotype as strain K12, saliva samples from 780 children were evaluated. The level of dosing with strain K12 required to achieve oral cavity colonization levels similar to those occurring naturally for this type of bacteriocin-producing S. salivarius was established using 100 human subjects. Following the oral instillation of lyophilized S. salivarius K12 cells in these subjects, its persistence was not at levels higher than those found naturally for this type of bacterium. The various sets of data obtained in this study showed no evidence of genotoxicity and no acute or subacute toxicity effects associated with strain K12. Based on the previously published data, the long history of use by humans and the information presented here, it is concluded that S. salivarius K12 is safe for human consumption. PMID:26781236

  18. Efficacy of supercritical carbon dioxide for nonthermal inactivation of Escherichia coli K12 in apple cider

    Science.gov (United States)

    This study evaluated the efficacy of a supercritical carbon dioxide (SCCO2) system with a gas-liquid porous metal contactor for eliminating Escherichia coli K12 in apple cider. Pasteurized, preservative-free apple cider was inoculated with E. coli K12 and processed using the SCCO2 system at CO2 conc...

  19. Perspectives on...Special Collections at ARL Libraries and K-12 Outreach: Current Trends

    Science.gov (United States)

    Visser, Michelle

    2006-01-01

    This article examines the results of a survey sent to Association of Research Libraries (ARL) Special Collections requesting information on outreach to K-12 students. Over half of the respondents work with K-12 and many of those who currently do not are planning to. New pressures and changing philosophies contribute to this trend.

  20. K-12 Teachers' Perceptions of School Policy and Fear of School Violence

    Science.gov (United States)

    Ricketts, Melissa L.

    2007-01-01

    Since the 1990s, schools have focused their attention on policies designed to improve school safety. Most researches on school violence policies have concentrated on the needs of students and administrators. This study investigated the impact of school violence policies on K-12 teachers' fear. Using self-report data from 447 K-12 teachers from a…

  1. Development of an Attitude Scale to Assess K-12 Teachers' Attitudes toward Nanotechnology

    Science.gov (United States)

    Lan, Yu-Ling

    2012-01-01

    To maximize the contributions of nanotechnology to this society, at least 60 countries have put efforts into this field. In Taiwan, a government-funded K-12 Nanotechnology Programme was established to train K-12 teachers with adequate nanotechnology literacy to foster the next generation of Taiwanese people with sufficient knowledge in…

  2. K-12 Online Learning and Students with Disabilities: Perspectives from State Special Education Directors

    Science.gov (United States)

    Burdette, Paula J.; Greer, Diana L.; Woods, Kari L.

    2013-01-01

    K-12 special education policies and practices that ensure students with disabilities receive a free, appropriate public education in the least restrictive environment are coming under pressure from the rapid expansion of online learning. Forty-six state and non-state jurisdiction special education directors responded to a brief survey about K-12

  3. From Teacher to Teacher Educator: Should You Move from a K-12 Classroom into Higher Education?

    Science.gov (United States)

    Clement, Mary C.

    2011-01-01

    College teaching can be as rewarding as a K-12 career and, whether in elementary school or college, students deserve good teachers. College professors who prepare teachers can have a tremendous impact on K-12 classrooms for decades into the future. However, career paths vary widely, and the path to teaching in higher education is as unique as the…

  4. STEM Integration in K-12 Education: Status, Prospects, and an Agenda for Research

    Science.gov (United States)

    Honey, Margaret; Pearson, Greg; Schweingruber, Heidi

    2014-01-01

    "STEM Integration in K-12 Education" examines current efforts to connect the STEM disciplines in K-12 education. This report identifies and characterizes existing approaches to integrated STEM education, both in formal and after- and out-of-school settings. The report reviews the evidence for the impact of integrated approaches on…

  5. Development of the Advanced Energy Design Guide for K-12 Schools -- 50% Energy Savings

    Energy Technology Data Exchange (ETDEWEB)

    Bonnema, E.; Leach, M.; Pless, S.; Torcellini, P.

    2013-02-01

    This Technical Support Document (TSD) describes the process and methodology for the development of the Advanced Energy Design Guide for K-12 School Buildings: Achieving 50% Energy Savings Toward a Net Zero Energy Building (AEDG-K12) (ASHRAE et al. 2011a). The AEDG-K12 provides recommendations for achieving 50% whole-building energy savings in K-12 schools over levels achieved by following ANSI/ASHRAE/IESNA Standard 90.1-2004, Energy Standard for Buildings Except Low-Rise Residential Buildings (Standard 90.1-2004) (ASHRAE 2004b). The AEDG-K12 was developed in collaboration with the American Society of Heating, Refrigerating and Air-Conditioning Engineers (ASHRAE), the American Institute of Architects (AIA), the Illuminating Engineering Society of North America (IES), the U.S. Green Building Council (USGBC), and the U.S. Department of Energy (DOE).

  6. Clinical significance of the interaction between non-coding RNAs and the epigenetics machinery: Challenges and opportunities in oncology

    OpenAIRE

    Maia, Beatriz M; Rocha, Rafael M; CALIN, GEORGE A.

    2013-01-01

    Non-coding RNAs and epigenetics are remarkable mechanisms of cellular control. In this review we underline the processes by which non-coding RNAs (ncRNAs), shown to be involved in various diseases, are capable of modifying and being modified by the epigenetic machinery, emphasizing the clinical importance of this network in cancer. Many ncRNAs have been described that play important roles in the establishment and maintenance of the epigenome. However, only a few studies deeply take into accou...

  7. Significance of chronic marked hyperglycemia on FDG-PET. Is it really problematic for clinical oncologic imaging?

    International Nuclear Information System (INIS)

    The purpose of this study was to evaluate the adverse effects of chronic marked hyperglycemia on clinical diagnostic performance of positron emission tomography (PET) using 18F-fluorodeoxyglucose (FDG). Fifty-seven scans of 54 patients, who received FDG-PET for the diagnosis of various cancer(s), and who showed high plasma glucose level of more than 200 mg/dl at the time of administration of FDG in spite of at least 4-h fasting, were retrospectively analyzed. In the clinical follow-up, this high plasma glucose was confirmed as chronic hyperglycemia derived from uncontrolled diabetes (n=32) and untreated diabetes (n=25). Based on the final diagnosis of malignancy obtained by histopathology or clinical follow-up for at least 6 months, the diagnostic performance of visual PET analysis was evaluated. Excluding nine scans of nine patients without sufficient follow-up, final diagnosis was obtained in 48 scans of 45 patients. In 36 scans of 36 patients, at least one malignant lesion was finally confirmed, and true-positive and false-negative results were obtained in 30 and six cases, respectively. Six cases showed false-negative results due to low FDG-avid pathological characteristics (hepatocellular carcinoma, etc.), chemotherapeutic effect or small tumor size. Overall, the patient-based sensitivity, specificity, positive predictive value, negative predictive value and diagnostic accuracy were 83, 83, 94, 63 and 83%, respectively. In lesion-based diagnosis, 56 of 75 lesions (74%) were depicted by PET, while 19 lesions were negative on PET, also due to low FDG-avid characteristics or small size (less than 15 mm). At the time of chronic hyperglycemia (not acute hyperglycemia), the adverse effect caused by high plasma glucose level was minimum. The FDG uptake of the tumor maintained a sufficiently high level for visual clinical diagnosis in most cases, except in the cases of low FDG-avid tumors or small lesions (15 mm in size). (author)

  8. African American Participation in Oncology Clinical Trials-Focus on Prostate Cancer: Implications, Barriers, and Potential Solutions.

    Science.gov (United States)

    Ahaghotu, Chiledum; Tyler, Robert; Sartor, Oliver

    2016-04-01

    In the United States, the incidence and mortality rates of many cancers, especially prostate cancer, are disproportionately high among African American men compared with Caucasian men. Recently, mortality rates for prostate cancer have declined more rapidly in African American versus Caucasian men, but prostate cancer is still the most common cancer and the second leading cause of cancer deaths in African American men in the United States. Compared with Caucasian men, prostate cancer occurs at younger ages, has a higher stage at diagnosis, and is more likely to progress after definitive treatments in African American men. Reasons for racial discrepancies in cancer are multifactorial and potentially include socioeconomic, cultural, nutritional, and biologic elements. In addition to improving access to novel therapies, clinical trial participation is essential to adequately establish the risks and benefits of treatments in African American populations. Considering the disproportionately high mortality rates noted in these groups, our understanding of the natural history and responses to therapies is limited. This review will explore African American underrepresentation in clinical trials with a focus on prostate cancer, and potentially effective strategies to engage African American communities in prostate cancer research. Solutions targeting physicians, investigators, the community, and health care systems are identified. Improvement of African American participation in prostate cancer clinical trials will benefit all stakeholders. PMID:26786562

  9. Radiotherapy quality assurance review in a multi-center randomized trial of limited-disease small cell lung cancer: the Japan Clinical Oncology Group (JCOG) trial 0202

    International Nuclear Information System (INIS)

    The purpose of this study was to analyze the radiotherapy (RT) quality assurance (QA) assessment in Japan Clinical Oncology Group (JCOG) 0202, which was the first trial that required on-going RT QA review in the JCOG. JCOG 0202 was a multi-center phase III trial comparing two types of consolidation chemotherapy after concurrent chemoradiotherapy for limited-disease small cell lung cancer. RT requirements included a total dose of 45 Gy/30 fx (bis in die, BID/twice a day) without heterogeneity correction; elective nodal irradiation (ENI) of 30 Gy; at least 1 cm margin around the clinical target volume (CTV); and interfraction interval of 6 hours or longer. Dose constraints were defined in regards to the spinal cord and the lung. The QA assessment was classed as per protocol (PP), deviation acceptable (DA), violation unacceptable (VU), and incomplete/not evaluable (I/NE). A total of 283 cases were accrued, of which 204 were fully evaluable, excluding 79 I/NE cases. There were 18 VU in gross tumor volume (GTV) coverage (8% of 238 evaluated); 4 VU and 23 DA in elective nodal irradiation (ENI) (2% and 9% of 243 evaluated, respectively). Some VU were observed in organs at risk (1 VU in the lung and 5 VU in the spinal cord). Overall RT compliance (PP + DA) was 92% (187 of 204 fully evaluable). Comparison between the former and latter halves of the accrued cases revealed that the number of VU and DA had decreased. The results of the RT QA assessment in JCOG 0202 seemed to be acceptable, providing reliable results

  10. Oral use of Streptococcus salivarius K12 in children with secretory otitis media: preliminary results of a pilot, uncontrolled study

    Directory of Open Access Journals (Sweden)

    Di Pierro F

    2015-09-01

    Full Text Available Francesco Di Pierro,1 Daniele Di Pasquale,2 Maurizio Di Cicco2 1Velleja Research, Milan, Italy; 2ORL Department, Ospedale Maggiore Policlinico Ca’ Grande IRCCS, Milan, Italy Abstract: Secretory otitis media (SOM remains a common disease among children. Although its cause is not yet perfectly established, the pathology, often a sequel of acute otitis media (AOM, is mainly characterized by persistent fluid in the middle ear cavity. Twenty-two children with a diagnosis of SOM were treated daily for 90 days with an oral formulation containing the oral probiotic Streptococcus salivarius K12 (Bactoblis®. After treatment, the children were evaluated for AOM episodes and subjected to tone audiometry, tympanometry, endonasal endoscopy, otoscopy, and tonsillar examination. Subject compliance and probiotic tolerability and side effects have also been evaluated. Our results indicate a good safety profile, a substantial reduction of AOM episodes, and a positive outcome from the treatment for all of the clinical outcomes tested. We conclude that strain K12 may have a role in reducing the occurrence and/or severity of SOM in children. From our perspective, this study constitutes a starting point toward the organization of a more extensive placebo-controlled study aimed at critically appraising our preliminary observations. Keywords: BLIS K12, Bactoblis®, acute otitis media, exudative otitis media

  11. Clinical impact of [18F]FDG-PET in oncology evaluated by the referring physicians during year 2000

    International Nuclear Information System (INIS)

    Full text: The first study evaluating directly by the referring physician the clinical impact of [18F]-FDG PET on modification of patient's management was performed only recently in California by means of a questionnaire. We have used the same methodology to evaluate this clinical impact during the opening year of our PET center in France. A questionnaire was sent to the referring physician of each of the 476 patients who had at least one routine FDG-PET examination during the year 2000. Of 348 responses (response rate 73 %), the disease was upstaged in 26 % of the cases and downstaged in 9 %. Inter-modality management changes (change from a scheduled therapeutic modality for a different one) were reported in 37 % of the cases and intra-modality changes in 9 %. Those modification rates were respectively 38 % and 7 % in recurrence of colorectal cancer (153 patients), 47 % and 7 % in lung cancer (118 patients), 16 % and 23 % in lymphoma (43 patients), 25 % and 6 % in the staging of head and neck cancers (32 patients). When comparing with the corresponding studies performed in California using the same questionnaire, there were no significant differences between the rates of inter-modality management changes (43 % versus 37 %). In contrast, intra-modality management changes were less frequent in our survey (17 % versus 9 %), except for lymphoma (10 % versus 23 %). Globally, the clinical impact of FDG PET was similar, with a higher rate of response to the questionnaire in our study (73 % versus 35 %) which yields a better confidence in the values that are reported here. An extensive survey of literature (including data published as abstracts until 2000) was recently published by Gambhir et al., including more than 3000 patients in the clinical settings of our study. The mean value for the rate of changing patient's management was 31 %. That means that the clinical impact observed in our study (46 %) performed on the opening year of our dedicated-PET center reached the

  12. PET / MRI vs. PET / CT. Indications Oncology

    International Nuclear Information System (INIS)

    Hybrid techniques in Nuclear Medicine is currently a field in full development for diagnosis and treatment of various medical conditions. With the recent advent of PET / MRI much it speculated about whether or not it is superior to PET / CT especially in oncology. The Conference seeks to clarify this situation by dealing issues such as: State of the art technology PET / MRI; Indications Oncology; Some clinical cases. It concludes by explaining the oncological indications of both the real and current situation of the PET / MRI. (author)

  13. Personalized oncology

    DEFF Research Database (Denmark)

    Tuxen, Ida Viller; Jønson, Lars; Santoni-Rugiu, Eric;

    2014-01-01

    . Only a limited number of patients will benefit from the treatment. However, introducing genomic mapping to select patients for early clinical trials with targeted molecular therapy according to the genomic findings, may lead to a better outcome for the patient, an enrichment of phase 1 trials, and...... thereby accelerated drug development. The overall advantage is to determine which mutation profiles correlate with sensitivity or lack of resistance to specific targeted therapies. The utility and current limitations of genomic screening to guide selection to Phase 1 clinical trial will be discussed....... of genes simultaneously, personalized molecular medicine has become an option. New treatments are being investigated in phase 1 trials around the world. Traditionally, the goal of phase 1 studies was to determine the optimal dose and assess dose-limiting toxicity of a potential new experimental drug...

  14. Clinical effectiveness of posaconazole versus fluconazole as antifungal prophylaxis in hematology–oncology patients: a retrospective cohort study

    International Nuclear Information System (INIS)

    In preventing invasive fungal disease (IFD) in patients with acute myelogenous leukemia (AML) or myelodysplastic syndrome (MDS), clinical trials demonstrated efficacy of posaconazole over fluconazole and itraconazole. However, effectiveness of posaconazole has not been investigated in the United States in real-world setting outside the environment of controlled clinical trial. We performed a single-center, retrospective cohort study of 130 evaluable patients ≥18 years of age admitted to Duke University Hospital between 2004 and 2010 who received either posaconazole or fluconazole as prophylaxis during first induction or first reinduction chemotherapy for AML or MDS. The primary endpoint was possible, probable, or definite breakthrough IFD. Baseline characteristics were well balanced between groups, except that posaconazole recipients received reinduction chemotherapy and cytarabine more frequently. IFD occurred in 17/65 (27.0%) in the fluconazole group and in 6/65 (9.2%) in the posaconazole group (P = 0.012). Definite/probable IFDs occurred in 7 (10.8%) and 0 patients (0%), respectively (P = 0.0013). In multivariate analysis, fluconazole prophylaxis and duration of neutropenia were predictors of IFD. Mortality was similar between groups. This study demonstrates superior effectiveness of posaconazole over fluconazole as prophylaxis of IFD in AML and MDS patients. Such superiority did not translate to reductions in 100-day all-cause mortality

  15. Case management in oncology rehabilitation (CAMON: The effect of case management on the quality of life in patients with cancer after one year of ambulant rehabilitation. A study protocol for a randomized controlled clinical trial in oncology rehabilitation

    Directory of Open Access Journals (Sweden)

    Bardheci Katarina

    2011-04-01

    Full Text Available Abstract Background Cancer diseases and their therapies have negative effects on the quality of life. The aim of this study is to assess the effectiveness of case management in a sample of oncological outpatients with the intent of rehabilitation after cancer treatment. Case management wants to support the complex information needs of the patients in addition to the segmented structure of the health care system. Emphasis is put on support for self-management in order to enhance health - conscious behaviour, learning to deal with the burden of the illness and providing the opportunity for regular contacts with care providers. We present a study protocol to investigate the efficacy of a case management in patients following oncology rehabilitation after cancer treatment. Methods The trial is a multicentre, two-arm randomised controlled study. Patients are randomised parallel in either 'usual care' plus case management or 'usual care' alone. Patients with all types of cancer can be included in the study, if they have completed the therapy with chemo- and/or radiotherapy/surgery with curative intention and are expected to have a survival time >1 year. To determine the health-related quality of life the general questionnaire FACT G is used. The direct correlation between self-management and perceived self-efficacy is measured with the Jerusalem & Schwarzer questionnaire. Patients satisfaction with the care received is measured using the Patient Assessment of Chronic Illness Care 5 As (PACIC-5A. Data are collected at the beginning of the trial and after 3, 6 and 12 months. The power analysis revealed a sample size of 102 patients. The recruitment of the centres began in 2009. The inclusion of patients began in May 2010. Discussion Case management has proved to be effective regarding quality of life of patients with chronic diseases. When it comes to oncology, case management is mainly used in cancer treatment, but it is not yet common in the

  16. Epidemiologic and Malignancy Indices of Gastric Cancer in Patients Referred to Oncology Clinic at Ramsar Emam Sajjad Hospital During 2002-2009

    Directory of Open Access Journals (Sweden)

    Z Fotoukian

    2012-05-01

    Full Text Available Introduction: Gastric cancer is considered as one of the most prevalent cancers, such that in our country it is on the top of prevalent cancers. Because of the high prevalence of this cancer in north of Iran, in spite of its incidence decrease in many regions of the world, we decided to determine the epidemiological and malignancy properties of gastric cancer in this region Methods: This research is a descriptive study (based on existing data. The study population consisted of gastric cancer patients referred to oncology clinic at Ramsar Imam Sajjad hospital during 2002- 2009. Necessary information was extracted from their medical files and pathology reports, and statistically analyzed. Results: In this Study, 144 patients were assessed (103 males and 47 females. In 95.8% of patients, tumor was adenocarcinoma. In 45.1% tumor was located in antrum. In 48.6% tumor was poorly differentiated. 72.9% of subjects had positive lymphatic involvement. There was metastatic involvement in 31.9% of patients, and the most common organ for metastasis was liver. 46.5% of Patients were in stage 4 at the time of referring to hospital and in 38.2% of cases tumor has been progressed to T2 Level. Conclusion: By considering this fact that most referring patients (46.5% were in stage 4 when were diagnosed and had poorly differentiated carcinoma, it is recommended that people should consider abdominal discomfort as a serious problem and do necessary diagnostic methods especially in ages above 45 years with especial emphasis on early diagnosis of disease and reduction of death rate for at risk population.

  17. About the Community Oncology and Prevention Trials Research Group | Division of Cancer Prevention

    Science.gov (United States)

    The Community Oncology and Prevention Trials Research Group supports clinical oncology trials in cancer prevention and control in community settings. The group also supports investigator-initiated research projects in supportive, palliative and end-of-life care, and coordinates clinical oncology research projects with other NCI programs to be done in the community setting. |

  18. Development of an Attitude Scale to Assess K-12 Teachers' Attitudes toward Nanotechnology

    Science.gov (United States)

    Lan, Yu-Ling

    2012-05-01

    To maximize the contributions of nanotechnology to this society, at least 60 countries have put efforts into this field. In Taiwan, a government-funded K-12 Nanotechnology Programme was established to train K-12 teachers with adequate nanotechnology literacy to foster the next generation of Taiwanese people with sufficient knowledge in nanotechnology. In the present study, the Nanotechnology Attitude Scale for K-12 teachers (NAS-T) was developed to assess K-12 teachers' attitudes toward nanotechnology. The NAS-T included 23 Likert-scale items that can be grouped into three components: importance of nanotechnology, affective tendencies in science teaching, and behavioural tendencies to teach nanotechnology. A sample of 233 K-12 teachers who have participated in the K-12 Nanotechnology Programme was included in the present study to investigate the psychometric properties of the NAS-T. The exploratory factor analysis of this teacher sample suggested that the NAS-T was a three-factor model that explained 64.11% of the total variances. This model was also confirmed by the confirmatory factor analysis to validate the factor structure of the NAS-T. The Cronbach's alpha values of three NAS-T subscales ranged from 0.89 to 0.95. Moderate to strong correlations among teachers' NAS-T domain scores, self-perception of own nanoscience knowledge, and their science-teaching efficacy demonstrated good convergent validity of the NAS-T. As a whole, psychometric properties of the NAS-T indicated that this instrument is an effective instrument for assessing K-12 teachers' attitudes toward nanotechnology. The NAS-T will serve as a valuable tool to evaluate teachers' attitude changes after participating in the K-12 Nanotechnology Programme.

  19. Use of Streptococcus salivarius K12 in the prevention of streptococcal and viral pharyngotonsillitis in children

    OpenAIRE

    2014-01-01

    Background Streptococcus salivarius K12 is an oral probiotic strain releasing two lantibiotics (salivaricin A2 and salivaricin B) that antagonize the growth of S. pyogenes, the most important bacterial cause of pharyngeal infections in humans also affected by episodes of acute otitis media. S. salivarius K12 successfully colonizes the oral cavity, and is endowed with an excellent safety profile. We tested its preventive role in reducing the incidence of both streptococcal and viral pharyngiti...

  20. Genome sequence of the lantibiotic bacteriocin producer Streptococcus salivarius strain K12.

    Science.gov (United States)

    Barretto, Caroline; Alvarez-Martin, Pablo; Foata, Francis; Renault, Pierre; Berger, Bernard

    2012-11-01

    Streptococcus salivarius is a prevalent commensal species of the oropharyngeal tract. S. salivarius strain K12 is an isolate from the saliva of a healthy child, used as an oral probiotic. Here, we report its genome sequence, i.e., the full sequence of the 190-kb megaplasmid pSsal-K12 and a high-quality draft 2.2-Gb chromosomal sequence. PMID:23045482

  1. Acute oncological emergencies.

    LENUS (Irish Health Repository)

    Gabriel, J

    2012-01-01

    The number of people receiving systemic anti-cancer treatment and presenting at emergency departments with treatment-related problems is rising. Nurses will be the first point of contact for most patients and need to be able to recognise oncological emergencies to initiate urgent assessment of patients and referral to the acute oncology team so that the most appropriate care can be delivered promptly. This article discusses the role of acute oncology services, and provides an overview of the most common acute oncological emergencies.

  2. Cell Line Derived Multi-Gene Predictor of Pathologic Response to Neoadjuvant Chemotherapy in Breast Cancer: A Validation Study on US Oncology 02-103 Clinical Trial

    Directory of Open Access Journals (Sweden)

    Shen Kui

    2012-11-01

    Full Text Available Abstract Background The purpose of this study is to assess the predictive accuracy of a multi-gene predictor of response to docetaxel, 5-fluorouracil, epirubicin and cyclophosphamide combination chemotherapy on gene expression data from patients who received these drugs as neoadjuvant treatment. Methods Tumor samples were obtained from patients with stage II-III breast cancer before starting neoadjuvant chemotherapy with four cycles of 5-fluorouracil/epirubicin/cyclophosphamide (FEC followed by four cycles of docetaxel/capecitabine (TX on US Oncology clinical trial 02-103. Most patients with HER-2-positive cancer also received trastuzumab (H. The chemotherapy predictor (TFEC-MGP was developed from publicly available gene expression data of 42 breast cancer cell-lines with corresponding in vitro chemotherapy sensitivity results for the four chemotherapy drugs. No predictor was developed for treatment with trastuzumab. The predictive performance of TFEC-MGP in distinguishing cases with pathologic complete response from those with residual disease was evaluated for the FEC/TX and FEC/TX plus H group separately. The area under the receiver-operating characteristic curve (AU-ROC was used as the metric of predictive performance. Genomic predictions were performed blinded to clinical outcome. Results The AU-ROC was 0.70 (95% CI: 0.57-0.82 for the FEC/TX group (n=66 and 0.43 (95% CI: 0.20-0.66 for the FEC/TX plus H group (n=25. Among the patients treated with FEC/TX, the AU-ROC was 0.69 (95% CI: 0.52-0.86 for estrogen receptor (ER-negative (n=28 and it was 0.59 (95% CI: 0.36-0.82 for ER-positive cancers (n=37. ER status was not reported for one patient. Conclusions Our results indicate that the cell line derived 291-probeset genomic predictor of response to FEC/TX combination chemotherapy shows good performance in a blinded validation study, particularly in ER-negative patients.

  3. American Society for Radiation Oncology

    Science.gov (United States)

    ... PAC Become an Advocate Log In SNIPEND American Society for Radiation Oncology Plan your time at the ... oncology practices. RO-ILS The only medical specialty society-sponsored incident learning system for radiation oncology. RO ...

  4. Prediction tools in surgical oncology.

    Science.gov (United States)

    Isariyawongse, Brandon K; Kattan, Michael W

    2012-07-01

    Artificial neural networks, prediction tables, and clinical nomograms allow physicians to transmit an immense amount of prognostic information in a format that exhibits comprehensibility and brevity. Current models demonstrate the feasibility to accurately predict many oncologic outcomes, including pathologic stage, recurrence-free survival, and response to adjuvant therapy. Although emphasis should be placed on the independent validation of existing prediction tools, there is a paucity of models in the literature that focus on quality of life outcomes. The unification of tools that predict oncologic and quality of life outcomes into a comparative effectiveness table will furnish patients with cancer with the information they need to make a highly informed and individualized treatment decision. PMID:22583992

  5. Effects of sound exposure on the growth and intracellular macromolecular synthesis of E. coli k-12.

    Science.gov (United States)

    Gu, Shaobin; Zhang, Yongzhu; Wu, Ying

    2016-01-01

    Microbes, as one of the primary producers of the biosphere, play an important role in ecosystems. Exploring the mechanism of adaptation and resistance of microbial population to various environmental factors has come into focus in the fields of modern microbial ecology and molecular ecology. However, facing the increasingly serious problem of acoustic pollution, very few efforts have been put forth into studying the relation of single cell organisms and sound field exposure. Herein, we studied the biological effects of sound exposure on the growth of E. coli K-12 with different acoustic parameters. The effects of sound exposure on the intracellular macromolecular synthesis and cellular morphology of E. coli K-12 were also analyzed and discussed. Experimental results indicated that E. coli K-12 exposed to sound waves owned a higher biomass and a faster specific growth rate compared to the control group. Also, the average length of E. coli K-12 cells increased more than 27.26%. The maximum biomass and maximum specific growth rate of the stimulation group by 8000 Hz, 80dB sound wave was about 1.7 times and 2.5 times that of the control group, respectively. Moreover, it was observed that E. coli K-12 can respond rapidly to sound stress at both the transcriptional and posttranscriptional levels by promoting the synthesis of intracellular RNA and total protein. Some potential mechanisms may be involved in the responses of bacterial cells to sound stress. PMID:27077011

  6. The K-12 Educational Technology Value Chain: Apps for Kids, Tools for Teachers and Levers for Reform

    Science.gov (United States)

    Pierce, Glenn L.; Cleary, Paul F.

    2016-01-01

    Historically implementing, maintaining and managing educational technology has been difficult for K-12 educational systems. Consequently, opportunities for significant advances in K-12 education have often gone unrealized. With the maturation of Internet delivered services along with K-12 institutional trends, educational technologies are poised…

  7. Psycho-oncology: Searching for practical wisdom?

    Science.gov (United States)

    Butlin, Helen

    2015-10-01

    The debate is vigorous in psycho-oncology about whether spiritual, existential, and psychosocial are the most comprehensive terms for academic research discourses investigating meaning and purpose. A call-to-action email from the International Society of Psycho-Oncology included the term soul. The current essay highlights the historical and contemporary uses of "soul" to suggest that the re-emergent soul signifies a tacit quest for an "intangible" that seems missing in current constructs of clinical domains reflected in the vigor of the debates. It is suggested that the re-emergence of the pre-Medieval meaning(s) of the notion of soul affirms a growing need for integrative paradigms on "being human" to guide psycho-oncology practitioners and their research. As a paradigmatic example, a clinical support group entitled Soul Medicine is described as employing the term soul to open up the more marginal discourses about experiences of illness arising from philosophical reflection, arts, humanities, and spirituality within a clinical oncology context. A link between soul and wisdom is suggested for further exploration with the view that phronesis ("the virtue of practical wisdom"), an emerging concept in health professional education research, is of ultimate value to the people psycho-oncology seeks to serve. This group holds that garnering wisdom from the expertise of those living with cancer should be a central aim of our field. PMID:26399749

  8. Oncology Advanced Practitioners Bring Advanced Community Oncology Care.

    Science.gov (United States)

    Vogel, Wendy H

    2016-01-01

    Oncology care is becoming increasingly complex. The interprofessional team concept of care is necessary to meet projected oncology professional shortages, as well as to provide superior oncology care. The oncology advanced practitioner (AP) is a licensed health care professional who has completed advanced training in nursing or pharmacy or has completed training as a physician assistant. Oncology APs increase practice productivity and efficiency. Proven to be cost effective, APs may perform varied roles in an oncology practice. Integrating an AP into an oncology practice requires forethought given to the type of collaborative model desired, role expectations, scheduling, training, and mentoring. PMID:27249776

  9. Identification of E. coli K12 chromosomal insertion sites of bacteriophage φ297

    Institute of Scientific and Technical Information of China (English)

    ZHAI Jing; CAO Qi-zhi; CHANG Wei-shan

    2005-01-01

    Objective:To identify the specific integration site of prophage φ297 in the host of E. coli K12 chromosome. Methods:Using molecular techniques such as Siebert PCR for walking from the int gene of prophage 297, which is similar to that of phage 933W to an unknown region in genomic DNA. A special adaptor is ligated to the ends of DNA fragments generated by digestion of genomic DNA with restriction enzymes that generates blunt ended fragments. Clone and subclone of PCR products, DNA sequencing and data analysis were used in this study. Results:The attL, attR and the core sequences were determined. The bacterial attachment site of phage φ297 was located in the yecE gene of E. coli K12. Conclusion:The phage φ297 integrates into the yecE gene of the E. coli K12 genome.

  10. Application of a Static Fluorescence-based Cytometer (the CellScan in Basic Cytometric Studies, Clinical Pharmacology, Oncology and Clinical Immunology

    Directory of Open Access Journals (Sweden)

    Yehuda Shoenfeld

    2005-01-01

    Full Text Available The CellScan apparatus is a laser scanning cytometer enabling repetitive fluorescence intensity (FI and polarization (FP measurements in living cells, as a means of monitoring lymphocyte activation. The CellScan may serve as a tool for diagnosis of rheumatoid arthritis (RA and systemic lupus erythematosus (SLE as well as other autoimmune diseases by monitoring FP changes in peripheral blood lymphocytes (PBLs following exposure to autoantigenic stimuli. Changes in FI and FP in atherosclerotic patients' PBLs following exposure to various stimuli have established the role of the immune system in atherosclerotic disease. The CellScan has been evaluated as a diagnostic tool for drug-allergy, based on FP reduction in PBLs following incubation with allergenic drugs. FI and FP changes in cancer cells have been found to be well correlated with the cytotoxic effect of anti-neoplastic drugs. In conclusion, the CellScan has a variety of applications in cell biology, immunology, cancer research and clinical pharmacology.

  11. Transformation of Physical DVHs to Radiobiologically Equivalent Ones in Hypofractionated Radiotherapy Analyzing Dosimetric and Clinical Parameters: A Practical Approach for Routine Clinical Practice in Radiation Oncology

    Directory of Open Access Journals (Sweden)

    Zoi Thrapsanioti

    2013-01-01

    Full Text Available Purpose. The purpose of this study was to transform DVHs from physical to radiobiological ones as well as to evaluate their reliability by correlations of dosimetric and clinical parameters for 50 patients with prostate cancer and 50 patients with breast cancer, who were submitted to Hypofractionated Radiotherapy. Methods and Materials. To achieve this transformation, we used both the linear-quadratic model (LQ model and the Niemierko model. The outcome of radiobiological DVHs was correlated with acute toxicity score according to EORTC/RTOG criteria. Results. Concerning the prostate radiotherapy, there was a significant correlation between RTOG acute rectal toxicity and ( and ( dosimetric parameters, calculated for  Gy. Moreover, concerning the breast radiotherapy there was a significant correlation between RTOG skin toxicity and dosimetric parameter, calculated for both  Gy ( and  Gy (. The new tool seems reliable and user-friendly. Conclusions. Our proposed model seems user-friendly. Its reliability in terms of agreement with the presented acute radiation induced toxicity was satisfactory. However, more patients are needed to extract safe conclusions.

  12. K-12 Teacher Understanding of Energy Conservation: Conceptual Metaphor, Dissipation, and Degradation

    Science.gov (United States)

    Daane, Abigail R.

    In K-12 educational settings, conservation of energy is typically presented in two ways: the conservation of energy principle (energy is neither created nor destroyed) and the sociopolitical need to conserve energy (we guard against energy being used up). These two meanings of conservation typically remain disconnected from each other and can appear contradictory, even after instruction. In an effort to support teachers in building robust understandings of energy from their existing knowledge, I designed a study to investigate the productive ideas in K-12 teachers' conversations about energy. A micro-analysis of discourse, gestures, and artifacts of professional development courses revealed teachers' productive ideas about three aspects of energy: conceptual metaphor, dissipation and degradation. In learning about energy, K-12 teachers come to use conceptual metaphors in their own language and value attending to students' metaphorical language as a means of formative assessment. Teachers' conversations about dissipation suggest that apparent difficulties with energy conservation may have their roots in a strong association between forms of energy (thermal) and their perceptible indicators (warmth). Teachers address this challenge by employing an exaggeration strategy to locate the dissipated thermal energy, making the energy indicator perceptible. Finally, teachers' unprompted statements about sociopolitical aspects of energy are related to both statements from the NGSS and aspects of energy degradation. I conclude that energy conservation can be better taught and learned in K-12 Education by: 1) understanding and applying conceptual metaphors about energy in K-12 settings, 2) using prior experiences to better understand dissipative energy processes involving imperceptible thermal energy, thereby understanding how energy conservation applies in all situations, and 3) connecting productive ideas about sociopolitical aspects of energy to canonical physics. Keywords

  13. Advanced Energy Retrofit Guide: Practical Ways to Improve Energy Performance, K-12 Schools (Book)

    Energy Technology Data Exchange (ETDEWEB)

    2013-02-01

    The U.S. Department of Energy developed the K-12 Advanced Energy Retrofit Guide to provide specific methodologies, information, and guidance to help energy managers and other stakeholders plan and execute energy efficiency improvements. We emphasize actionable information, practical methodologies, diverse case studies, and unbiased evaluation of the most promising retrofit measure for each building type. K-12 schools were selected as one of the highest priority building sectors, because schools affect the lives of most Americans. They also represent approximately 8% of the energy use and 10% of the floor area in commercial buildings.

  14. Oncology Nursing Is Evidence-Based Care.

    Science.gov (United States)

    Kennedy Sheldon, Lisa; Brown, Carlton G

    2016-06-01

    This issue of the Clinical Journal of Oncology Nursing (CJON) will be the final time that you will see the Evidence-Based Practice (EBP) feature column. Why? Because we have seen oncology nursing evolve in the past 20 years and EBP is everywhere! We use it in our clinics and hospital units, incorporate it into decisions about symptom management, and use evidence to develop survivorship guidelines. We discuss EBP in journal clubs and use applications on mobile devices to find the best interventions for our patients. We have oncology nurses sitting on committees to develop guidelines based on the best evidence and expert opinion. We have come a long way and it is our belief that EBP is included in almost every article in CJON and, therefore, a need no longer exists for an individual column about EBP. 
. PMID:27206287

  15. Undergraduate preparation of the oncology nurse.

    Science.gov (United States)

    Pierce, M

    1992-09-01

    Determining appropriate cancer-related content for undergraduate nursing curricula requires careful consideration of content that is needed versus content that is desired for the nurse generalist. Studies have indicated a wide variety of topics and time allotment for this content among schools of nursing. Innovative strategies using games, computers, preceptors, and elective courses have allowed schools of nursing to include more comprehensive coverage of oncology-related topics. Issues concerning clinical oncology nursing opportunities for undergraduate studies still need to be clarified. Undergraduate students must be afforded the legitimacy of their status as novices in nursing and in the specialty of oncology. Didactic and clinical experiences should result in the knowledge and skills needed to develop professionally from novice to expert. PMID:1408964

  16. Oral use of Streptococcus salivarius K12 in children with secretory otitis media: preliminary results of a pilot, uncontrolled study.

    Science.gov (United States)

    Di Pierro, Francesco; Di Pasquale, Daniele; Di Cicco, Maurizio

    2015-01-01

    Secretory otitis media (SOM) remains a common disease among children. Although its cause is not yet perfectly established, the pathology, often a sequel of acute otitis media (AOM), is mainly characterized by persistent fluid in the middle ear cavity. Twenty-two children with a diagnosis of SOM were treated daily for 90 days with an oral formulation containing the oral probiotic Streptococcus salivarius K12 (Bactoblis(®)). After treatment, the children were evaluated for AOM episodes and subjected to tone audiometry, tympanometry, endonasal endoscopy, otoscopy, and tonsillar examination. Subject compliance and probiotic tolerability and side effects have also been evaluated. Our results indicate a good safety profile, a substantial reduction of AOM episodes, and a positive outcome from the treatment for all of the clinical outcomes tested. We conclude that strain K12 may have a role in reducing the occurrence and/or severity of SOM in children. From our perspective, this study constitutes a starting point toward the organization of a more extensive placebo-controlled study aimed at critically appraising our preliminary observations. PMID:26396541

  17. Gamma camera based FDG PET in oncology

    International Nuclear Information System (INIS)

    Positron Emission Tomography(PET) was introduced as a research tool in the 1970s and it took about 20 years before PET became an useful clinical imaging modality. In the USA, insurance coverage for PET procedures in the 1990s was the turning point, I believe, for this progress. Initially PET was used in neurology but recently more than 80% of PET procedures are in oncological applications. I firmly believe, in the 21st century, one can not manage cancer patients properly without PET and PET is very important medical imaging modality in basic and clinical sciences. PET is grouped into 2 categories; conventional (c) and gamma camera based (CB) PET. CBPET is more readily available utilizing dual-head gamma cameras and commercially available FDG to many medical centers at low cost to patients. In fact there are more CBPET in operation than cPET in the USA. CBPET is inferior to cPET in its performance but clinical studies in oncology is feasible without expensive infrastructures such as staffing, rooms and equipments. At Ajou university Hospital, CBPET was installed in late 1997 for the first time in Korea as well as in Asia and the system has been used successfully and effectively in oncological applications. Our was the fourth PET operation in Korea and I believe this may have been instrumental for other institutions got interested in clinical PET. The following is a brief description of our clinical experience of FDG CBPET in oncology

  18. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: a randomized, placebo-controlled, double-blind study.

    Science.gov (United States)

    Burton, J P; Cowley, S; Simon, R R; McKinney, J; Wescombe, P A; Tagg, J R

    2011-09-01

    Streptococcus salivarius is naturally a predominant member of the human oropharynx and the commercial probiotic strain K12 has been consumed for more than a decade. The present study examines the health responses of human volunteers to oral ingestion of high doses of S. salivarius K12. A randomized group of 53 subjects received a dose of 1 × 10(10)cfu S. salivarius K12 (N=25) or placebo (N=28) for 28 days, followed by a 28-day wash out period. Blood, urine and saliva samples were collected at baseline and following treatment and analyzed, while the oral and gastrointestinal tolerance of the subjects to the dosing regimen was determined by use of questionnaires. Adverse events (AE)s were recorded for both groups. No statistically significant differences between the probiotic and placebo treated groups were detected in either the blood clinical chemistry or hematology results (P>0.05). The questionnaire responses of the subjects indicated that both treatments were well tolerated. The frequency and intensity of AEs was similar in the two groups. This data demonstrates that the daily ingestion of S. salivarius K12 over a 28-day period does not adversely affect the human host and supports the safety of its oral delivery in a food-based carrier. PMID:21722694

  19. Gaps in Oncology

    Science.gov (United States)

    The first plenary of the EPEC-O (Education in Palliative and End-of-Life Care for Oncology) Self-Study Original Version provides background for the curriculum and identifies gaps in current and desired comprehensive cancer care.

  20. Mobile Apps for Reflection in Learning: A Design Research in K-12 Education

    Science.gov (United States)

    Leinonen, Teemu; Keune, Anna; Veermans, Marjaana; Toikkanen, Tarmo

    2016-01-01

    This study takes a design-based research approach to explore how applications designed for mobile devices could support reflection in learning in K-12 education. Use of mobile devices is increasing in schools. Most of the educational apps support single-person use of interactive learning materials, simulations and learning games. Apps designed to…

  1. Mapping the xyl, mtl, and lct loci in Escherichia coli K-12.

    OpenAIRE

    Lin, R J; Hill, C W

    1983-01-01

    We report a correction to the Escherichia coli K-12 genetic map. The order of genes near minute 80 was found to be xyl-mtl-lct, not xyl-lct-mtl. The mapping utilized two different Tn10 insertion mutations, zia-138::Tn10 between xyl and mtl and zib-137::Tn10 distal to lct.

  2. California K-12 Schools and Communities Collaborate to Support Student Mental Health

    Science.gov (United States)

    Woodbridge, Michelle W.; Goldweber, Asha; Yu, Jennifer; Golan, Shari; Stein, Bradley D.

    2013-01-01

    Across the education, public health, and human and social services areas, there is renewed interest in bringing agency representatives together to work on the promotion of student mental health and wellness. One of the aims of California's Prevention and Early Intervention (PEI) K-12 Student Mental Health (SMH) initiative funded under Proposition…

  3. Impact of Guided Notes on Achievement in K-12 and Special Education Students

    Science.gov (United States)

    Larwin, Karen H.; Dawson, Daniel; Erickson, Matthew; Larwin, David A.

    2012-01-01

    The common practice of using of guided notes in the K-12 and special education classroom is not fully appreciated or understood. In an effort to add to the existing research about this phenomenon, the current investigation expands on previously published research and one previously published meta-analysis that examined the impact of guided notes…

  4. Tech-Savvy Science Education? Understanding Teacher Pedagogical Practices for Integrating Technology in K-12 Classrooms

    Science.gov (United States)

    Hechter, Richard; Vermette, Laurie Anne

    2014-01-01

    This paper examines the technology integration practices of Manitoban K-12 inservice science educators based on the Technological, Pedagogical, and Content knowledge (TPACK) framework. Science teachers (n = 433) completed a 10-item online survey regarding pedagogical beliefs about technology integration, types of technology used, and how often…

  5. Limitations upon Legitimate Authority to Suspend and Expel K-12 Public School Students: A Moral Analysis

    Science.gov (United States)

    Ladenson, Robert F.

    2011-01-01

    This article presents a moral analysis of the limitations upon legitimate authority to suspend and expel students in K-12 public schools, and it brings this analysis to bear on a pair of difficult disciplinary cases. The analysis is grounded in a defense of a child's right to receive a public education. It identifies the minimum content of that…

  6. Towards a formal assessment of design literacy: Analyzing K-12 students' stance towards inquiry

    DEFF Research Database (Denmark)

    Christensen, Kasper Skov; Hjorth, Mikkel; Iversen, Ole Sejer;

    2016-01-01

    We present a tool for quantitative assessment of K-12 students' stance towards inquiry as an important part of students' development of design literacy. On a basis of design thinking literature, we position designerly stance towards inquiry as a prerequisite for engaging with wicked problems. The...

  7. K-12 Online Lesson Alignment to the Principles of Universal Design for Learning: The Khan Academy

    Science.gov (United States)

    Smith, Sean J.; Harvey, Evelyn E.

    2014-01-01

    The field of K-12 education is being transformed, with an influx of students, including those with identified disabilities, engaging in blended and fully online learning. While online learning shows promise for students with disabilities through flexible content and personalised instruction, concerns regarding accessibility and appropriateness of…

  8. The Influence of Lean on K-12 District Management: A Case Study

    Science.gov (United States)

    Brown, Beverly

    2011-01-01

    For decades, policymakers and educators have focused on public school equity and adequacy, while paying little attention to efficiency. This qualitative single case study was designed to capture explicit information about Lean management, operations, and culture in a K-12 Michigan school district engaged in Lean training and implementation for a…

  9. Solving Behavior Problems in Math Class: Academic, Learning, Social, and Emotional Empowerment (Grades K-12)

    Science.gov (United States)

    Taylor-Cox, Jennifer

    2011-01-01

    Reduce the number of discipline issues that arise in your math classroom with ideas from math education expert Jennifer Taylor-Cox. In this book, you'll learn a variety of ways to handle disruptive, disinterested, avoidant, and/or disrespectful students in K-12 math classrooms. Using realistic, case-by-case examples, the author reveals practical…

  10. A Nonverbal Language for Imagining and Learning: Dance Education in K-12 Curriculum

    Science.gov (United States)

    Hanna, Judith Lynne

    2008-01-01

    Curriculum theorists have provided a knowledge base concerning aesthetics, agency, creativity, lived experience, transcendence, learning through the body, and the power of the arts to engender visions of alternative possibilities in culture, politics, and the environment. However, these theoretical threads do not reveal the potential of K-12 dance…

  11. K-12 Single-Sex Education: What Does the Research Say? ERIC Digest.

    Science.gov (United States)

    Haag, Pamela

    Although research on the effects of K-12 single-sex education is inconclusive in general, some common themes emerge in the research literature. This Digest reviews that research with particular attention to effects on girls' attitudes and achievement. The Digest first discusses attitudinal variables (i.e., self-esteem and attitudes toward academic…

  12. Manifesting Destiny: Re/Presentations of Indigenous Peoples in K-12 U.S. History Standards

    Science.gov (United States)

    Shear, Sarah B.; Knowles, Ryan T.; Soden, Gregory J.; Castro, Antonio J.

    2015-01-01

    In this mixed-methods study, we use a postcolonial framework to investigate how state standards represent Indigenous histories and cultures. The research questions that guided this study include: (a) What is the frequency of Indigenous content (histories, cultures, current issues) covered in state-level U.S. history standards for K-12? (b) What is…

  13. Using the van Hiele K-12 Geometry Learning Theory to Modify Engineering Mechanics Instruction

    Science.gov (United States)

    Sharp, Janet M.; Zachary, Loren W.

    2004-01-01

    Engineering students use spatial thinking when examining diagrams or models to study structure design. It is expected that most engineering students have solidified spatial thinking skills during K-12 schooling. However, according to what we know about geometry learning and teaching, spatial thinking probably needs to be explicitly taught within…

  14. Commentary: Mis-Education in K-12 Teaching about Hmong Culture, Identity, History and Religion

    OpenAIRE

    Kou Yang

    2012-01-01

    This commentary article discusses several examples of inaccurate information about the Hmong presented in contemporary materials produced by school district staff and/or published by mainstream publishers in the United States for use with the K-12 market to teach about Hmong culture and history.

  15. A Study of the Tablet Computer's Application in K-12 Schools in China

    Science.gov (United States)

    Long, Taotao; Liang, Wenxin; Yu, Shengquan

    2013-01-01

    As an emerging mobile terminal, the tablet computer has begun to enter into the educational system. With the aim of having a better understanding of the application and people's perspectives on the new technology in K-12 schools in China, a survey was conducted to investigate the tablet computer's application, user's perspectives and requirements…

  16. (Re)Defining the Filipino: Notions of Citizenship in the New K+12 Curriculum

    Science.gov (United States)

    de los Reyes, Elizer Jay

    2013-01-01

    In June 2012, the Philippine government implemented what it called the K+12 Curriculum which reformed its basic education system by adding two more years of schooling to the then existing 10-year structure. Complicated by the long experience and participation of the Filipinos in the diaspora, the constantly lingering thought of leaving for greener…

  17. Perceptions and Experiences of K-12 Educational Leaders in Response to the 27 April 2011 Tornadoes

    Science.gov (United States)

    Bishop, William E.; Fifolt, Matthew; Peters, Gary B.; Gurley, D. Keith; Collins, Loucrecia

    2015-01-01

    The purpose of this phenomenological study was to capture first-hand accounts of K-12 educational leaders whose school districts were directly affected by the deadly 27 April 2011 tornadoes in rural Alabama, USA. This study was framed by the literature base of leadership; specifically crisis leadership and resilience theory. Findings are organised…

  18. Creating a K-12 Adaptive Test: Examining the Stability of Item Parameter Estimates and Measurement Scales

    Science.gov (United States)

    Kingsbury, G. Gage; Wise, Steven L.

    2011-01-01

    Development of adaptive tests used in K-12 settings requires the creation of stable measurement scales to measure the growth of individual students from one grade to the next, and to measure change in groups from one year to the next. Accountability systems like No Child Left Behind require stable measurement scales so that accountability has…

  19. Strategies to Increase the Value of Physical Educators in K-12 Schools

    Science.gov (United States)

    Henninger, Mary L.; Carlson, Kristin B.

    2011-01-01

    There is no denying that physical educators have traditionally been considered second-class citizens within the K-12 educational system in the United States. In some cases the low status of physical educators has resulted from the views of others (e.g., colleagues, administrators, parents, etc.), while at other times physical educators themselves…

  20. The Virtual Scientist: Connecting University Scientists to the K-12 Classroom through Videoconferencing

    Science.gov (United States)

    McCombs, Glenn B.; Ufnar, Jennifer A.; Shepherd, Virginia L.

    2007-01-01

    The Vanderbilt University Center for Science Outreach (CSO) connects university scientists to the K-12 community to enhance and improve science education. The Virtual Scientist program utilizes interactive videoconference (IVC) to facilitate this connection, providing 40-50 sessions per academic year to a national audience. Scientists, defined as…

  1. Integrating Emerging Technologies in Teaching Ugandan Traditional Dances in K-12 Schools in New York City

    Science.gov (United States)

    Mabingo, Alfdaniels

    2015-01-01

    Schools in New York City have made attempts to embrace and support the strand of "making connections", which is laid out in the New York City Department of Dance blueprint for teaching and learning in dance for grades PreK-12. Accordingly, some schools have integrated Ugandan traditional dances into the dance curriculum, and dance…

  2. The Debate of Evolution versus Intelligent Design: Is Critical Thinking Occurring among K-12 Students?

    Science.gov (United States)

    Hoodman, Kyle Nathan

    2010-01-01

    This study investigates how evolution versus intelligent design is handled in the public, private Christian, private Jewish, and Christian Home-school K-12 settings through a review of the current literature and by interviewing teachers in these educational venues. Fourteen public, private, and homeschool educators responded to an interview…

  3. Information behaviors of Chinese K-12physical education teachers:A survey study

    Institute of Scientific and Technical Information of China (English)

    Geoffrey; Z.LIU; Yan; HUO

    2012-01-01

    Purpose:Given the unique characteristics of physical education(PE) teaching in K-12education,PE teachers’ information behaviors deserve special attention.This article reports a survey study of PE teachers’ information behaviors,covering information literacy skills and behaviors of information seeking and information use.Design/methodology/approach:A questionnaire survey was conducted of K-12 PE teachers in the Tianjin municipal region of China,with a response rate of 61.9%.Findings:PE teachers lack skills with information retrieval systems in general.The Internet continues to be their primary information source,and they rely more on personal collection and colleagues than the school library for teaching materials.They rarely develop a searching strategy,employ querying tactics,or use advanced search functions,and they tend to be content with finding a few relevant articles.Research limitations:The survey is limited to the Tianjin municipal region in scope.Though attempting to reach 210 participants from 40 schools,it yielded only 130 valid responses.A larger survey covering more regions and with greater responses may be useful.Practical implications:Insights from this study inform the educational and on-job training of K-12 PE teachers to improve their information literacy skills.Originality/value:Little research exists on PE teachers’ behaviors of information seeking.This study bridges the gap and enriches our understanding of K-12 teachers’ information behaviors.

  4. Constitutional Law and Race-Conscious Policies in K-12 Education. ERIC Digest.

    Science.gov (United States)

    Ancheta, Angelo

    This digest examines the constitutional framework guiding the use of race-conscious policymaking in K-12 education. Despite the requirements of Brown v Board of Education, recent court decisions suggest that desegregation remedies are becoming more limited, and voluntary policies will be subject to greater scrutiny. The legal framework governing…

  5. Teaching K-12 teachers and students about nanoscale science through microscopy

    Science.gov (United States)

    Healy, Nancy

    2014-09-01

    The National Nanotechnology Infrastructure Network (NNIN) is an integrated partnership of 14 universities across the US funded by NSF to support nanoscale researchers. NNIN's education and outreach programs are large and varied and includes outreach to the K-12 community in the form of professional development workshops and school programs. Two important components of nanoscale science education are understanding size and scale and the tools used in nanoscale science and engineering (NSE). As part of our K-12 endeavors, we educate K-12 students and teachers about the tools of nanoscience by providing experiences with the Hitachi TM 3000 tabletop Scanning Electron Microscope (SEM). There are three of these across the network that are used in education and outreach. This paper will discuss approaches we use to engage the K-12 community at NNIN's site at Georgia Institute of Technology to understand size and scale and the applications of a variety of microscopes to demonstrate the imaging capabilities of these to see both the micro and nano scales. We not only use the tabletop SEM but also include USB digital microscopes, a Keyence VHX- 600 Digital Microscope, and even a small lens used with smart phones. The goal of this outreach is to educate students as well as teachers about the capabilities of the various instruments and their importance at different size scales.

  6. When Professions Shape Politics: The Case of Accountability in K-12 and Higher Education

    Science.gov (United States)

    Mehta, Jal

    2014-01-01

    Professionalization is an important but overlooked dimension in education politics, particularly the politics of accountability. To isolate the importance of professionalization, this article compares accountability movements in K-12 education with similar movements in higher education. I draw on three pairs of reports that have sought to impose…

  7. "It's Not My Job": K-12 Teacher Attitudes toward Students' Heritage Language Maintenance

    Science.gov (United States)

    Lee, Jin Sook; Oxelson, Eva

    2006-01-01

    This paper examines teachers' attitudes towards their students' heritage language maintenance and their engagement in classroom practices that may or may not affirm the value of maintaining and developing heritage languages among students. Through surveys and interviews with K-12 teachers in California public schools, the data show that the…

  8. Interactive Teaching as a Recruitment and Training Tool for K-12 Science Teachers

    Science.gov (United States)

    Rosenberg, J. L.

    2004-12-01

    The Science, Technology, Engineering, and Mathematics Teacher Preparation (STEMTP) program at the University of Colorado has been designed to recruit and train prospective K-12 science teachers while improving student learning through interactive teaching. The program has four key goals: (1) recruit undergraduate students into K-12 science education, (2) provide these prospective teachers with hands-on experience in an interactive teaching pedagogy, (3) create an intergrated program designed to support (educationally, socially, and financially) and engage these prospective science teachers up until they obtain liscensure and/or their masters degree in education, and (4) improve student learning in large introductory science classes. Currently there are 31 students involved in the program and a total of 72 students have been involved in the year and a half it has been in existence. I will discuss the design of the STEMTP program, the success in recruiting K-12 science teachers, and the affect on student learning in a large lecture class of implementing interactive learning pedagogies by involving these prospective K-12 science teachers. J. L. Rosenberg would like to acknowledge the NSF Astronomy and Astrophysics Fellowship for support for this work. The course transformation project is also supported by grants from the National Science Foundation.

  9. Efficacy of Webinar Training for Continuing Professional Education: Applications for School Personnel in K-12 Settings

    Science.gov (United States)

    Covington, Julie Anne

    2012-01-01

    The purpose of the researcher was to evaluate the effectiveness of webinar training for K-12 school personnel in childhood obesity prevention tools and resources provided by the North Carolina Prevention Partners (NCPP). A mixed method sequential research design was used to evaluate the training across the first three levels of the Kirkpatrick…

  10. African Dance Aesthetics in a K-12 Dance Setting: From History to Social Justice

    Science.gov (United States)

    Ward, Sheila A.

    2013-01-01

    This article invites the reader to gain a deeper understanding of the aesthetics of African-based dance through the elements of tradition, transformation, and social justice. A discussion of the aesthetics of African dances within Africa and throughout the African diaspora opens the doors to present these dances in a K-12 setting, to explore a…

  11. Virtual K-12 Learning: New Learning Frontiers for State Education Agencies

    Science.gov (United States)

    Natale, Catherine Fisk; Cook, Janet

    2012-01-01

    This article explores the role of state education agencies in three states that have embarked on ambitious kindergarten through Grade 12 (K-12) virtual learning initiatives: Alabama, Florida, and Idaho. Subject to a rapidly changing environment influenced by factors beyond the jurisdiction of many state departments of education, the world of…

  12. Development of a Virtual Technology Coach to Support Technology Integration for K-12 Educators

    Science.gov (United States)

    Sugar, William; van Tryon, Patricia J. Slagter

    2014-01-01

    In an effort to develop a virtual technology coach for K-12 educators, this article analyzed survey results from sixty teachers with regards to specific resources that a technology coach could provide within a virtual environment. A virtual technology coach was proposed as a possible solution to provide continual professional development for…

  13. The Preparation of Teacher Candidates for K-12 Online Learning Environments: A Case Study

    Science.gov (United States)

    Williams, Nicole V.

    2015-01-01

    The purpose of this study was to determine how teacher education programs may better prepare teacher candidates to teach in K-12 online learning environments. The primary research question addressed was: What specific knowledge, skills, and dispositions should teacher education programs include in their curriculum to better prepare teacher…

  14. Perspectives and Visions of Computer Science Education in Primary and Secondary (K-12) Schools

    Science.gov (United States)

    Hubwieser, Peter; Armoni, Michal; Giannakos, Michail N.; Mittermeir, Roland T.

    2014-01-01

    In view of the recent developments in many countries, for example, in the USA and in the UK, it appears that computer science education (CSE) in primary or secondary schools (K-12) has reached a significant turning point, shifting its focus from ICT-oriented to rigorous computer science concepts. The goal of this special issue is to offer a…

  15. Regulation of D-arabinose utilization in Escherichia coli K-12.

    OpenAIRE

    Skjold, A C; Ezekiel, D. H.

    1982-01-01

    Studies involving lambda phage transduction of the D-arabinose utilization gene (dar+) in Escherichia coli K-12 indicated the product of this gene to be a transdominant activator. An apparent anomaly regarding this hypothesis exists in that a diploid recessive lysogen (lambda dar-/dar-) can spontaneously become capable of growth on D-arabinose.

  16. A Look at Research on Mobile Learning in K-12 Education from 2007 to the Present

    Science.gov (United States)

    Liu, Min; Scordino, Robert; Geurtz, Renata; Navarrete, Cesar; Ko, Yujung; Lim, Mihyun

    2014-01-01

    The purpose of this literature review is to examine data-based studies published on mobile learning in K-12 from 2007 to the present. In total, 63 studies from 15 refereed journals were selected for analysis. The findings are organized in four themes: (a) comparison studies, (b) no comparison studies, (c) mobilized learning, and (d) academic…

  17. Teaching and Learning with Mobile Computing Devices: Case Study in K-12 Classrooms

    Science.gov (United States)

    Grant, Michael M.; Tamim, Suha; Brown, Dorian B.; Sweeney, Joseph P.; Ferguson, Fatima K.; Jones, Lakavious B.

    2015-01-01

    While ownership of mobile computing devices, such as cellphones, smartphones, and tablet computers, has been rapid, the adoption of these devices in K-12 classrooms has been measured. Some schools and individual teachers have integrated mobile devices to support teaching and learning. The purpose of this qualitative research was to describe the…

  18. Measurement Invariance of the "Servant Leadership Questionnaire" across K-12 Principal Gender

    Science.gov (United States)

    Xu, Lihua; Stewart, Trae; Haber-Curran, Paige

    2015-01-01

    Measurement invariance of the five-factor "Servant Leadership Questionnaire" between female and male K-12 principals was tested using multi-group confirmatory factor analysis. A sample of 956 principals (56.9% were females and 43.1% were males) was analysed in this study. The hierarchical multi-step measurement invariance test supported…

  19. How to Launch an Energy Star Energy Efficiency Competition for K-12 Schools

    Science.gov (United States)

    Utebay Kudret; McArthur, Ashley

    2012-01-01

    In recent years, schools have been forced by rising costs and shrinking budgets to stretch their resources further than ever before in order to meet the educational needs of today's students. EPA's ENERGY STAR program helps K-12 schools and districts improve energy efficiency, reduce operating costs and redirect critical resources into the…

  20. Comparing Cross-Cultural Multicultural Self-Awareness among K-12 In-Service School Teachers

    Science.gov (United States)

    Koyama, Chieko; Plash, Shawn; Davis, Kirk

    2012-01-01

    The present study explored multicultural self-awareness among 134 K-12 in-service school teachers using the Cultural Diversity Awareness Inventory (CDAI). The results were compared to Yeung's (2006), allowing for a comparison between Eastern and Western cultures. A composite score was generated for each of the five areas measured by the CDAI. A…

  1. An Exploratory Essay on Listening Instruction in the K-12 Curriculum

    Science.gov (United States)

    Hopper, Joanne E.

    2007-01-01

    Even though the importance of effective listening skills is well recognized and many K-12 language arts standards include listening skills, the amount of time devoted to the teaching of listening and the quality of instructional resources that will enable the effectiveness of teaching listening as a two-way communication process are in question.…

  2. Molecular cloning and expression of Treponema pallidum DNA in Escherichia coli K12.

    NARCIS (Netherlands)

    J.D.A. van Embden; H.J.M. van de Donk; R.V.W. van Eijk (Ron); H.G. v.d. Heide; J.A. de Jong (Jan); M.F. van Olderen; A.D.M.E. Osterhaus (Ab); L.M. Schouls

    1983-01-01

    textabstractA gene bank of Treponema pallidum DNA in Escherichia coli K-12 was constructed by cloning SauI-cleaved T. pallidum DNA into the cosmid pHC79. Sixteen of 800 clones investigated produced one or more antigens that reacted with antibodies from syphilitic patients. According to the separatio

  3. A Correlational Analysis of Strategic Information Systems Planning in K-12 Public Educational Organizations

    Science.gov (United States)

    Martin, Christopher J.

    2012-01-01

    Three decades of research has indicated that strategic information systems planning is a vital component to business success. The purpose of this study was to identify the relationship strategic information systems planning and financial commitment has within the K-12 public education sector. Data for this study was obtained from top management of…

  4. Makerspaces: The Next Iteration for Educational Technology in K-12 Schools

    Science.gov (United States)

    Strycker, Jesse

    2015-01-01

    With the continually growing number of computers and mobile devices available in K-12 schools, the need is dwindling for dedicated computer labs and media centers. Some schools are starting to repurpose those facilities into different kinds of exploratory learning environments known as "makerspaces". This article discusses this next…

  5. Evaluating ICT Integration in Turkish K-12 Schools through Teachers' Views

    Science.gov (United States)

    Aydin, Mehmet Kemal; Gürol, Mehmet; Vanderlinde, Ruben

    2016-01-01

    The current study aims to explore ICT integration in Turkish K-12 schools purposively selected as a representation of F@tih and non-F@tih public schools together with a private school. A convergent mixed methods design was employed with a multiple case strategy as such it will enable to make casewise comparisons. The quantitative data was…

  6. Can an Electronic Textbooks Be Part of K-12 Education?: Challenges, Technological Solutions and Open Issues

    Science.gov (United States)

    Lee, HeeJeong Jasmine; Messom, Chris; Yau, Kok-Lim Alvin

    2013-01-01

    An electronic textbook (e-Textbook) is a digitized (or electronic) form of textbook, which normally needs an endorsement by the national or state government when it is used in the K-12 education system. E-Textbooks have been envisioned to replace existing paper-based textbooks due to its educational advantages. Hence, it is of paramount importance…

  7. Urban Teaching in America: Theory, Research, and Practice in K-12 Classrooms

    Science.gov (United States)

    Stairs, Andrea J.; Donnell, Kelly A.; Dunn, Alyssa Hadley

    2011-01-01

    "Urban Teaching in America: Theory, Research, and Practice in K-12 Classrooms" is a brief yet comprehensive overview of urban teaching. Undergraduate and graduate students who are new to the urban context will develop a deeper understanding of the urban teaching environment and the challenges and opportunities they can expect to face while…

  8. Teachers, Please Learn Our Names!: Racial Microagressions and the K-12 Classroom

    Science.gov (United States)

    Kohli, Rita; Solorzano, Daniel G.

    2012-01-01

    Many Students of Color have encountered cultural disrespect within their K-12 education in regards to their names. While the racial undertones to the mispronouncing of names in schools are often understated, when analyzed within a context of historical and current day racism, the authors argue that these incidents are racial…

  9. Monitoring Progress toward Successful K-12 STEM Education: A Nation Advancing?

    Science.gov (United States)

    National Academies Press, 2012

    2012-01-01

    Following a 2011 report by the National Research Council (NRC) on successful K-12 education in science, technology, engineering, and mathematics (STEM), Congress asked the National Science Foundation to identify methods for tracking progress toward the report's recommendations. In response, the NRC convened the Committee on an Evaluation Framework…

  10. Indiana's New and (Somewhat) Improved K-12 School Finance System. School Choice Issues in the State

    Science.gov (United States)

    Aud, Susan L.

    2005-01-01

    Education finance policy has become an urgent concern in many state legislatures. Demands for greater equity and accountability have forced states to review, and in many cases to revise, the method by which schools are funded. This study sheds light on Indiana's financing of public K-12 education by providing a clear explanation of the components…

  11. After 60 Years, Do the Arguments for K-12 Vouchers Still Hold?

    Science.gov (United States)

    Laitsch, Dan

    2016-01-01

    In 1955, Milton Friedman authored a foundational paper proposing a shift in funding and governance mechanisms for public K-12 schools, suggesting that parents be awarded tuition vouchers that they could use to pay for private sector education services for their children, rather than relying on government provided neighborhood schools. Friedman…

  12. Functional characterization of the Escherichia coli K-12 yiaMNO transport protein genes

    NARCIS (Netherlands)

    Plantinga, TH; van der Does, C; Badia, J; Aguilar, J; Konings, WN; Driessen, AJM; Plantinga, Titia H.

    2004-01-01

    The yiaMNO genes of Escherichia coli K-12 encode a binding protein-dependent secondary, or tri-partite ATP-independent periplasmic (TRAP), transporter. Since only a few members of this family have been functionally characterized to date, we aimed to identify the substrate for this transporter. Cells

  13. How to Implement Rigorous Computer Science Education in K-12 Schools? Some Answers and Many Questions

    Science.gov (United States)

    Hubwieser, Peter; Armoni, Michal; Giannakos, Michail N.

    2015-01-01

    Aiming to collect various concepts, approaches, and strategies for improving computer science education in K-12 schools, we edited this second special issue of the "ACM TOCE" journal. Our intention was to collect a set of case studies from different countries that would describe all relevant aspects of specific implementations of…

  14. Empowering K-12 Students with Disabilities to Learn Computational Thinking and Computer Programming

    Science.gov (United States)

    Israel, Maya; Wherfel, Quentin M.; Pearson, Jamie; Shehab, Saadeddine; Tapia, Tanya

    2015-01-01

    This article's focus is on including computing and computational thinking in K-12 instruction within science, technology, engineering, and mathematics (STEM) education, and to provide that instruction in ways that promote access for students traditionally underrepresented in the STEM fields, such as students with disabilities. Providing computing…

  15. Perceptions of Professional and Educational Skills Learning Opportunities Made Available through K-12 Robotics Programming

    Science.gov (United States)

    Bakke, Christine K.

    2013-01-01

    The purpose of this study is to examine whether participation in robotics provides opportunities for educational and professional skill development, significant enough to merit the recommendation of robotics courses as a part of mainstream curriculum offerings in K-12 schools. This non-experimental, mixed methods study examined current junior high…

  16. Valine-Resistant Escherichia coli K-12 Strains with Mutations in the ilvB Operon

    OpenAIRE

    Sutton, Ann; Newman, Thomas; Francis, Marilyn; Freundlich, Martin

    1981-01-01

    Escherichia coli K-12 mutants resistant to growth inhibition by valine were isolated. These strains contained mutations in the ilvB operon effecting either the regulation of acetohydroxy acid synthase I or the sensitivity of the enzyme to end product inhibition by valine.

  17. Are K-12 Learners Motivated in Physical Education? A Meta-Analysis

    Science.gov (United States)

    Chen, Senlin; Chen, Ang; Zhu, Xihe

    2012-01-01

    Previous studies devoted to K-12 learner motivation in physical education share a general assumption that students may lack motivation. This meta-analytic study examined published original studies (n = 79) to determine students' motivation level and the association between motivation and outcomes. Original means of motivation measures were…

  18. NSF GK-12 Fellows as Mentors for K-12 Teachers Participating in Field Research Experiences

    Science.gov (United States)

    Ellins, K.; Perry, E.

    2005-12-01

    The University of Texas Institute for Geophysics (UTIG) recognizes the value of providing educational opportunities to K-12 teachers who play a critical role in shaping the minds of young people who are the future of our science. To that end, UTIG established the "Texas Teachers in the Field" program in 2000 to formalize the participation of K-12 teachers in field programs that included UTIG scientists. In 2002, "Texas Teachers in the Field" evolved through UTIG's involvement in a University of Texas at Austin GK-12 project led by the Environmental Sciences Institute, which enabled UTIG to partner a subset of GK-12 Fellows with teachers participating in geophysical field programs. During the three years of the GK-12 project, UTIG successfully partnered four GK-12 Fellows with five K-12 teachers. The Fellows served as mentors to the teachers, as liaisons between UTIG scientists leading field programs and teachers and their students, and as resources in science, mathematics, and technology instruction. Specifically, Fellows prepared teachers and their students for the field investigations, supervised the design of individual Teacher Research Experience (TRE) projects, and helped teachers to develop standards-aligned curriculum resources related to the field program for use in their own classrooms, as well as broader distribution. Although all but one TRE occurred during the school year, Texas school districts and principals were willing to release teachers to participate because the experience and destinations were so extraordinary (i.e., a land-based program in Tierra del Fuego, Argentina; and research cruises to the Southeast Caribbean Sea and Hess Deep in the Pacific Ocean) and carried opportunities to work with scientists from around the world. This exceptional collaboration of GK-12 Fellows, K-12 teachers and research scientists enriches K-12 student learning and promotes greater enthusiasm for science. The level of mentoring, preparation and follow-up provided

  19. The SERC K12 Educators Portal to Teaching Activities and Pedagogic Approaches

    Science.gov (United States)

    Larsen, K.; Kirk, K. B.; Manduca, C. A.; Ledley, T. S.; Schmitt, L.

    2013-12-01

    The Science Education Resource Center (SERC) has created a portal to information for K12 educators to provide high-quality grade level appropriate materials from a wide variety of projects and topics. These materials were compiled across the SERC site, showcasing materials that were created for, or easily adaptable to, K12 classrooms. This resource will help support implementation of Next Generation Science Standards by assisting educators in finding innovative resources to address areas of instruction that are conceptually different than previous national and state science standards. Specifically, the K12 portal assists educators in learning about approaches that address the cross-cutting nature of science concepts, increasing students quantitative reasoning and numeracy skills, incorporating technology such as GIS in the classroom, and by assisting educators of all levels of K12 instruction in using relevant and meaningful ways to teach science concepts. The K12 portal supports educators by providing access to hundreds of teaching activities covering a wide array of science topics and grade levels many of which have been rigorously reviewed for pedagogic quality and scientific accuracy. The portal also provides access to web pages that enhance teaching practices that help increase student's system thinking skills, make lectures interactive, assist instructors in conducting safe and effective indoor and outdoor labs, providing support for teaching energy and climate literacy principles, assisting educators in addressing controversial content, provide guidance in engaging students affective domain, and provides a collection of tools for making teaching relevant in 21st century classrooms including using GIS, Google Earth, videos, visualizations and simulations to model and describe scientific concepts. The portal also provides access to material for specific content and audiences by (1) Supporting AGIs 'Map your World' week to specifically highlight teaching

  20. Radiation Oncology in Undergraduate Medical Education: A Literature Review

    International Nuclear Information System (INIS)

    Purpose: To review the published literature pertaining to radiation oncology in undergraduate medical education. Methods and Materials: Ovid MEDLINE, Ovid MEDLINE Daily Update and EMBASE databases were searched for the 11-year period of January 1, 1998, through the last week of March 2009. A medical librarian used an extensive list of indexed subject headings and text words. Results: The search returned 640 article references, but only seven contained significant information pertaining to teaching radiation oncology to medical undergraduates. One article described a comprehensive oncology curriculum including recommended radiation oncology teaching objectives and sample student evaluations, two described integrating radiation oncology teaching into a radiology rotation, two described multidisciplinary anatomy-based courses intended to reinforce principles of tumor biology and radiotherapy planning, one described an exercise designed to test clinical reasoning skills within radiation oncology cases, and one described a Web-based curriculum involving oncologic physics. Conclusions: To the authors' knowledge, this is the first review of the literature pertaining to teaching radiation oncology to medical undergraduates, and it demonstrates the paucity of published work in this area of medical education. Teaching radiation oncology should begin early in the undergraduate process, should be mandatory for all students, and should impart knowledge relevant to future general practitioners rather than detailed information relevant only to oncologists. Educators should make use of available model curricula and should integrate radiation oncology teaching into existing curricula or construct stand-alone oncology rotations where the principles of radiation oncology can be conveyed. Assessments of student knowledge and curriculum effectiveness are critical.

  1. Breakthrough cancer medicine and its impact on novel drug development in China:report of the US Chinese Anti-Cancer Association (USCACA) and Chinese Society of Clinical Oncology (CSCO) Joint Session at the 17th CSCO Annual Meeting

    Institute of Scientific and Technical Information of China (English)

    Feng Roger Luo; Ge Zhang; Li Xu; Pascal Qian; Li Yan; Jian Ding; Helen X. Chen; Hao Liu; Man-Cheong Fung; Maria Koehler; Jean Pierre Armand; Lei Jiang; Xiao Xu

    2014-01-01

    The US Chinese Anti-Cancer Association (USCACA) teamed up with Chinese Society of Clinical Oncology (CSCO) to host a joint session at the17th CSCO Annual Meeting on September 20th, 2014 in Xiamen, China. With a focus on breakthrough cancer medicines, the session featured innovative approaches to evaluate breakthrough agents and established a platform to interactively share successful experiences from case studies of 6 novel agents from both the United States and China. The goal of the session is to inspire scientific and practical considerations for clinical trial design and strategy to expedite cancer drug development in China. A panel discussion further provided in-depth advice on advancing both early and ful development of novel cancer medicines in China.

  2. Imaging in oncology. Terms and definitions

    International Nuclear Information System (INIS)

    Oncologic imaging includes the morphological description of the primary tumor region for an accurate classification of the tumor and lymph node stage and whether distant metastases have occurred according to the TNM staging system. Knowing the stage of the disease helps to plan the treatment and to estimate the prognosis. In clinical routine this is accomplished by conventional imaging techniques, such as ultrasound (US), computed tomography (CT) and magnetic resonance imaging (MRI). Additionally, oncologic imaging is essential in treatment monitoring to visualize and quantify the effect of cancer therapy according to response evaluation criteria in solid tumors (RECIST) and World Health Organization (WHO) criteria. The tremendous development in oncology and technical innovations in imaging represent a particular challenge for radiology. (orig.)

  3. The estimation of the magnitude of affective descriptors of pain by doctors, nurses and patients of an oncology service: a clinical psychophysics approach - doi:10.5020/18061230.2007.p143

    Directory of Open Access Journals (Sweden)

    Catarina Nívea Bezerra Menezes

    2012-01-01

    Full Text Available The aim of this experimental study was to validate a psychophysical scale of languageperception and to rank the pain intensity associated to each one of the descriptors, verifying its consistency-reliability and inter-subjective agreement among professionals and patients. The research was held at the Clinics Hospital of Ribeirão Preto Medical School, from January to June, 2005, with 41 professionals and 20 patients. The pain descriptors were submitted to the analysis of psychophysical scale methods in a single method of category and magnitude estimation. The pain for the professionals of a Gynecologic Oncology service was referred as pungent, thin and piercing and for the patients, as cutting and burning. On the Pediatric Oncology, the professionals expressed the pain as pungent, thin and burning, while the patients as burning; compressive, persistent and piercing. By Spearman’s correlation (0,713, it was demonstrated that there is a high correlation among the doctors. Concerning to magnitude estimation, a high correlation between doctors and nurses (0,871 was verified. It was evidenced by the study that the correlation analyses suggest that the magnitude of different describers, associated to the displeasure of the pain judged by the patients, differ of those referred by different health professionals.

  4. Overcoming Constraints of Building Successful Partnerships Incorporating STEM Research Into K-12 Classrooms

    Science.gov (United States)

    Radencic, S.; McNeal, K. S.; Pierce, D.; Hare, D.

    2011-12-01

    The Initiating New Science Partnerships in Rural Education (INSPIRE) program at Mississippi State University (MSU), funded by the NSF Graduate STEM Fellows in K-12 Education (GK12) program, focuses on the advancement of Earth and Space science education in K-12 classrooms. INSPIRE is currently in its second year of partnering ten graduate students from the STEM fields of Geosciences, Engineering and Chemistry at MSU with five teachers from local, rural school districts. The five year project serves to increase inquiry and technology experiences in science and math while enhancing graduate student's communication skills as they create interactive lessons linking their STEM research focus to the state and national standards covered in the classrooms. Each graduate student is responsible for the development of two lessons each month of the school year that are then published on the INSPIRE project webpage, www.gk12.msstate.edu, where they are a free resource for any K-12 classroom teacher seeking innovative activities for their classrooms. Many of the participating teachers and graduate students share activities developed with non-participating teachers, expanding INSPIRE's outreach throughout the local community. Numerous challenges were met during the formation of the program as well as throughout the first year in which the project management team worked together to find solutions ensuring that INSPIRE maintained successful partnerships for all involved. Proposed solutions of the following key components were identified by INSPIRE through the development, implementation, and continuous evaluation (internal and external) of the first year of the program as areas that can pose challenges to the construction of strong relationships between STEM research and K-12 classrooms: initializing the partnerships with the K-12 classrooms and STEM graduate fields at the university; maintaining strong partnerships; providing appropriate training and support; developing sound

  5. MUST ONCOLOGICAL PRINCIPLES BE IN THE SURGERY OF MENINGIOMAS? EN BLOC REMOVAL OF GIANT RIGHT FRONTAL MENINGIOMA WITH EXTRACRANIAL SPREAD. DESCRIPTION OF A CLINICAL CASE

    Directory of Open Access Journals (Sweden)

    V. B. Karakhan

    2014-01-01

    Full Text Available The use of the oncological principle – en bloc ablastic tumor resection – can expect a breakthrough in the treatment of baseline unfavorable patient groups. In the described case of atypical meningioma, its en bloc resection presents significant technical difficulties when accomplishing the task associated with the giant sizes of a tumor as an iceberg growing outside and into the cranial cavity, its rich vascularization from both the internal and external carotid artery system, with the involvement of the superior sagittal sinus, the presence of a dense bone crown that combines the three-component construction of a neoplasm, which made difficult safe mobilization and scanning in the cranial cavity.In such topographic variants, the criteria for the Simpson radical meningioma resection are inapplicable and only en bloc tumor resection may reflect the oncological principles of surgery. The technologies of en bloc resection of intracranial meningiomas should be more frequently used because preoperative neurovisualization and even histological diagnosis does not always allow the grade of meningiomas to be specified.

  6. Exploring the role of educational videos in radiation oncology practice

    International Nuclear Information System (INIS)

    Patient, staff, and medical student education are essential components of modern radiation oncology practice. Greater involvement of patients in the clinical decision-making process, and the need for other health professionals to be more informed about radiation oncology, provided further demand on resources, despite ever increasing logistic constraints. Videos made by individual departments may augment traditional teaching methods and have applications in documenting clinical practice and response. 8 refs., 1 tab

  7. The problems of surgical training in gynaecologic oncology

    OpenAIRE

    Burger, CW; Oliveira, CF; Kehoe, ST

    2000-01-01

    During the late 60s and early 70s it was recognised that the surgical training for residents in Obstetrics and Gynaecology was inadequate to comprehensively acquire the surgical skills necessary in managing women with gynaecologic cancers. Gynaecologic Oncology (Gynae-Oncology) has three important goals: 1) to maintain the highest standards for patients with gynaecologic cancer, 2) to provide the trainee with clinical skills and structural clinical research after his/her surgical completion, ...

  8. Generation of Comprehensive Thoracic Oncology Database - Tool for Translational Research

    OpenAIRE

    Surati, Mosmi; Robinson, Matthew; Nandi, Suvobroto; Faoro, Leonardo; Demchuk, Carley; Kanteti, Rajani; Ferguson, Benjamin; Gangadhar, Tara; Hensing, Thomas; Hasina, Rifat; Husain, Aliya; Ferguson, Mark; Karrison, Theodore; Salgia, Ravi

    2011-01-01

    The Thoracic Oncology Program Database Project was created to serve as a comprehensive, verified, and accessible repository for well-annotated cancer specimens and clinical data to be available to researchers within the Thoracic Oncology Research Program. This database also captures a large volume of genomic and proteomic data obtained from various tumor tissue studies. A team of clinical and basic science researchers, a biostatistician, and a bioinformatics expert was convened to design the ...

  9. Pro-inflammatory potential of Escherichia coli strains K12 and Nissle 1917 in a murine model of acute ileitis

    OpenAIRE

    Bereswill, S.; Fischer, A; Dunay, I R; Kühl, A. A.; Göbel, U B; Liesenfeld, O.; Heimesaat, M. M.

    2013-01-01

    Non-pathogenic Escherichia coli (Ec) strains K12 (EcK12) and Nissle 1917 (EcN) are used for gene technology and probiotic treatment of intestinal inflammation, respectively. We investigated intestinal colonization and potential pro-inflammatory properties of EcK12, EcN, and commensal E. coli (EcCo) strains in Toxoplasma (T.) gondii-induced acute ileitis. Whereas gnotobiotic animals generated by quintuple antibiotic treatment were protected from ileitis, mice replenished with...

  10. Potentiodynamic investigation of A K 12 alloy doped by scandium in the medium of NaCl electrolyte

    International Nuclear Information System (INIS)

    This article is devoted to potentiodynamic investigation of A K 12 alloy doped by scandium in the medium of NaCl electrolyte. Studying of electrochemical corrosion properties of A K 12 alloy doped by scandium showed that scandium additives decrease the corrosion rate of initial alloy. The corrosion-electrochemical properties of A K 12 alloy doped by scandium are studied by means of potentiodynamic method in the medium of 0.03, 0.3, and 3% NaCl solution.

  11. Exploration of cooperation mode between clinical pharmacists and medical team in the Department of Oncology%肿瘤专科临床药师与医护团队协作模式探讨

    Institute of Scientific and Technical Information of China (English)

    王伟兰; 郭代红; 朱曼; 陈超

    2013-01-01

    目的:探讨肿瘤专科临床药师与医护团队协作,共同促进合理用药的工作模式.方法:解放军总医院肿瘤中心的临床药师与医护团队实施协作4年多来,开展特色全程化药学服务,深入临床为医师、护士和患者提供用药咨询,开设系列药学专题讲座、对患者进行用药教育、编写肿瘤专科实用药物手册,并协助制订医嘱,处理药品不良反应.结果和结论:肿瘤专科的医、药、护团队协作工作模式促进了合理用药,提高了临床药学服务水平.%Objective:To explore the cooperation mode between clinical pharmacists and medical team in the Department of Oncology,so as to elevate the level of rational medication of drugs.Methods:Clinical pharmacists and the medical team in the tumor center of General Hospital of PLA experienced cooperation for over 4 years,during which clinical pharmacists carried out integrated specific pharmaceutical care,provided consultation for doctors,nurses as well as patients concerning medication of drugs,conducted a series of pharmaceutical lectures,gave lectures to patients on medication,compiled a practical medical handbook,helped doctors to prescribe medical advices and cope with adverse drug reactions.Results and Conclusion:The cooperation mode between pharmacists,the medical and nursing teams in the Department of Oncology promoted rational medication of drugs and elevated the level of pharmaceutical care.

  12. Integrating Robot Design Competitions into the Curriculum and K-12 Outreach Activities

    Science.gov (United States)

    Avanzato, Robert

    The Penn State Abington campus has integrated several mobile robot design competitions into project-based design activities to provide enhancement for undergraduate engineering and information sciences and technology courses and also to provide outreach to K-12 institutions. The robot competitions, which encourage interdisciplinary design, teamwork, and rapid prototyping, support a wide range of educational outcomes in a variety of courses. A survey of undergraduate students was also implemented to identify the key lessons learned and overall educational quality of the robot competition activities. Overall, the responses on the quality of the robot competition experience were very positive. The strategic selection and implementation of robot design competitions, such as described in this paper, provide a cost-effective approach to enhancing the curriculum, promoting retention, and encouraging interest in science and technology (STEM) careers in K-12 students.

  13. Genetic Mapping of the minB Locus in Escherichia coli K-12

    OpenAIRE

    Schaumberg, Thomas H.; Kuempel, Peter L.

    1983-01-01

    The minB (minicell production) locus of Escherichia coli K-12 was mapped by transduction using bacteriophage P1. minB is located at min 25.6, between purB (min 25.2) and dadR (min 25.8). The mapping was facilitated by the use of insertion zcf-236::Tn10, which is inserted at min 25.4.

  14. Technology integration in K-12 science classrooms: An analysis of barriers and implications

    OpenAIRE

    Richard P. Hechter; Laurie Anne Vermette

    2013-01-01

    This paper examines the barriers to technology integration for Manitoban K-12 inservice science educators (n = 430) based on a 10-item online survey; results are analyzed according to teaching stream using the Technology, Pedagogy, and Content Knowledge (TPACK) framework. Quantitative descriptive statistics indicated that the leading barriers experienced by all teachers are inadequate: access; time; resources; training; budget; and support. Upon further examination, Middle Years and Senior Ye...

  15. Use of Streptococcus salivarius K12 in the prevention of streptococcal and viral pharyngotonsillitis in children

    OpenAIRE

    Di Pierro, Francesco

    2014-01-01

    Francesco Di Pierro,1 Maria Colombo,2 Alberto Zanvit,3 Paolo Risso,4 Amilcare S Rottoli5 1Scientific Department, Velleja Research, Milan, 2Pediatric Department, University of Parma, Parma, 3Stomatology Institute, Milan, 4Laboratory of Epidemiology and Social Psychiatry, Mario Negri Institute, Milan, 5Pediatric Department, Uboldo Hospital, Cernusco sul Naviglio, Italy Background: Streptococcus salivarius K12 is an oral probiotic strain releasing two lantibiotics (salivaricin A2 and salivarici...

  16. Characterization of the specific pyruvate transport system in Escherichia coli K-12.

    OpenAIRE

    Lang, V J; Leystra-Lantz, C; Cook, R. A.

    1987-01-01

    A mutant of Escherichia coli K-12 lacking pyruvate dehydrogenase and phosphoenolpyruvate synthase was used to study the transport of pyruvate by whole cells. Uptake of pyruvate was maximal in mid-log phase cells, with a Michaelis constant for transport of 20 microM. Pretreatment of the cells with respiratory chain poisons or uncouplers, except for arsenate, inhibited transport up to 95%. Lactate and alanine were competitive inhibitors, but at nonphysiological concentrations. The synthetic ana...

  17. K-12 Categorical Entitlement Funding for English Language Learners in California: An Intradistrict Case Study

    Science.gov (United States)

    Jimenez-Castellanos, Oscar; Okhremtchouk, Irina

    2013-01-01

    The K-12 student population is becoming increasingly diverse in the United States. In particular, the number of English Language Learners (ELLs) rose from 4.7 million in 1980 to 11.2 million in 2009, more than doubling from 10% to 21% of the student population (U.S. Department of Education n.d.). At approximately 1.8 million, the state of…

  18. Multi-Directional Microaggressions: Filipino Students and Everyday Racism in Hawai`i's K-12 Schools

    OpenAIRE

    Viernes, Kate

    2014-01-01

    This thesis examines Filipino Americans, Hawai`i's largest Asian Pacific Islander (API) group and their experiences with racism in Hawai`i, specifically in its K-12 educational system. Perceptions of Hawai`i as a model of "multiculturalism" obscure how the state's racially diverse population lives in the condition of settler colonialism which reproduce processes of racialization enabled by the islands' white colonizers. Through Critical Race Theory (CRT), I document how racial microaggression...

  19. Hrothgar IE: A Distributed, Persistent Inquiry Environment for K-12 Learning

    OpenAIRE

    Gottschalk, T.D.

    1999-01-01

    he concept of a scalable, interactive simulation environment is explored as a substantive application of High-Performance Computing (HPC) technology within K-12 education. An integrated system, combining a scalable simulation engine, information/discourse database components and WWW-based access is proposed as a prototype framework for an inquiry-based learning environment - a progressive approach consistent with the calls for fundamental changes in science education advocated in both the Nat...

  20. WebSEM: an assessment of K-12 remote microscopy efforts.

    Science.gov (United States)

    Chumbley, A E; Chumbley, L S

    2007-01-01

    Within the past 10 years a number of institutions have developed and instituted systems and programs that enable remote control of a scanning electron microscope (SEM). Geared toward use by teachers and educators in K-12 classrooms, these systems have offered access to advanced instrumentation to thousands of students over the past decade. However, despite the enormous potential and promise associated with remote microscopy, the reality has been that most such systems are not utilized to their fullest extent. This is partly due to time constraints on the instrument; many such systems are an integral part of the research and/or teaching focus of the institution that offers the service, and as such, K-12 educators are forced to compete with institutional demands. Often this restricts the amount of lessons that can be conducted to a relatively small number, in rather narrowly defined windows of opportunity. However, even when such constraints do not exist, the number of lessons typically requested remains disappointingly low, and the lessons that are conducted are usually simple examinations lacking in depth. In an effort to determine why the promise of K-12 remote microscopy has not been fully realized, a number of assessments have been carried out at Iowa State University in relation to operation and use of the WebSEM, the Web-controllable SEM operated by the Materials Science and Engineering Department of Iowa State University as a part of Project ExCEL, the Extended Classroom for Enhanced Learning. These assessments indicate that the key to successful use of advanced equipment in K-12 classrooms depends less upon hardware than it does upon local instructional situations. Establishing a personal relationship between the SEM operator and the teacher in the classroom appears to be the best way to increase current use of remote microscopy. PMID:17330251

  1. Curricular Value and Instructional Needs for Infusing Engineering Design into K-12 Technology Education

    OpenAIRE

    Gattie, David K.; Wicklein, Robert C.

    2007-01-01

    An overarching objective of Technology Education in the U.S. is to improve technological literacy among K-12 students (DeVore, 1964; Savage and Sterry, 1990; International Technology Education Association, 1996, 2000, 2003). This is addressed in part through a focus on end-product technology and the use and importance of various technologies in society (Savage and Sterry, 1990). While such a focus is certainly necessary, it may not be sufficient if the objective is to infuse engineering into ...

  2. K-12 Neuroscience Education Outreach Program: Interactive Activities for Educating Students about Neuroscience

    OpenAIRE

    Deal, Alex L.; Erickson, Kristen J.; Bilsky, Edward J.; Hillman, Susan J.; Burman, Michael A.

    2014-01-01

    The University of New England’s Center for Excellence in the Neurosciences has developed a successful and growing K-12 outreach program that incorporates undergraduate and graduate/professional students. The program has several goals, including raising awareness about fundamental issues in neuroscience, supplementing science education in area schools and enhancing undergraduate and graduate/professional students’ academic knowledge and skill set. The outreach curriculum is centered on core ne...

  3. PySTEMM: Executable Concept Modeling for K-12 STEM Learning

    OpenAIRE

    D'Souza, Kelsey

    2014-01-01

    Modeling should play a central role in K-12 STEM education, where it could make classes much more engaging. A model underlies every scientific theory, and models are central to all the STEM disciplines (Science, Technology, Engineering, Math). This paper describes executable concept modeling of STEM concepts using immutable objects and pure functions in Python. I present examples in math, physics, chemistry, and engineering, built using a proof-of-concept tool called PySTEMM . The approach ap...

  4. Galactofuranose biosynthesis in Escherichia coli K-12: identification and cloning of UDP-galactopyranose mutase.

    OpenAIRE

    Nassau, P M; Martin, S L; Brown, R. E.; Weston, A; Monsey, D; McNeil, M.R.; Duncan, K.

    1996-01-01

    We have cloned two open reading frames (orf6 and orf8) from the Escherichia coli K-12 rfb region. The genes were expressed in E. coli under control of the T7lac promoter, producing large quantities of recombinant protein, most of which accumulated in insoluble inclusion bodies. Sufficient soluble protein was obtained, however, for use in a radiometric assay designed to detect UDP-galactopyranose mutase activity (the conversion of UDP-galactopyranose to UDP-galactofuranose). The assay is based...

  5. Molecular cloning and expression of Treponema pallidum DNA in Escherichia coli K12.

    OpenAIRE

    van Embden, J. D. A.; Donk, H.J.M.; Eijk, Ron; van der Heide, H. G.; Jong, Jan; van Olderen, M F; Osterhaus, Ab; Schouls, L. M.

    1983-01-01

    textabstractA gene bank of Treponema pallidum DNA in Escherichia coli K-12 was constructed by cloning SauI-cleaved T. pallidum DNA into the cosmid pHC79. Sixteen of 800 clones investigated produced one or more antigens that reacted with antibodies from syphilitic patients. According to the separation pattern of the antigens produced on sodium dodecyl sulfate-polyacrylamide gels, six different phenotypes were distinguished among these 16 clones. These antigens reacted also with anti-T. pallidu...

  6. An Early Start in Robotics – K-12 Case-Study

    Directory of Open Access Journals (Sweden)

    Celina Pinto Leão

    2011-04-01

    Full Text Available

    This paper describes a study carried out with K-12 students. This study is focused on understanding the motivation of these students on the use of robots in the Project Area curricular unit and to understand whether they want to continue their studies in technology areas. K-12 students participated in the RoboParty® event, where the main task is to assemble and program a robot. In other words, the students, in a simple and entertaining way and guided by qualified tutors, learned how to build a robot. At the end of the academic year, a questionnaire was applied to identify and evaluate the K-12 students' opinions regarding the experience. The students’ reaction to this experience as well to the direct contact with the university environment was quite positive.

  7. Advanced Energy Retrofit Guide: Practical Ways to Improve Energy Performance, K-12 Schools (Book)

    Energy Technology Data Exchange (ETDEWEB)

    2013-12-01

    The U.S. Department of Energy developed the Advanced Energy Retrofit Guides (AERGs) to provide specific methodologies, information, and guidance to help energy managers and other stakeholders plan and execute energy efficiency improvements. Detailed technical discussion is fairly limited. Instead, we emphasize actionable information, practical methodologies, diverse case studies, and unbiased evaluations of the most promising retrofit energy efficiency measures for each building type. A series of AERGs is under development, addressing key segments of the commercial building stock. K-12 schools were selected as one of the highest priority building sectors, because schools affect the lives of most Americans. They also represent approximately 8% of the energy use and 10% of the floor area in commercial buildings nationwide. U.S. K-12 school districts spend more than $8 billion each year on energy - more than they spend on computers and textbooks combined. Most occupy older buildings that often have poor operational performance - more than 30% of schools were built before 1960. The average age of a school is about 42 years - which is nearly the expected serviceable lifespan of the building. K-12 schools offer unique opportunities for deep, cost-effective energy efficiency improvements, and this guide provides convenient and practical guidance for exploiting these opportunities in the context of public, private, and parochial schools.

  8. Leakage of 86Rb+ after ultraviolet irradiation of Escherichia coli K-12

    International Nuclear Information System (INIS)

    Stationary phase cultures of a DNA repair proficient Escherichia coli K-12 strain showed a release of intracellular material as assessed by three different methods (260 nm absorption; (methyl-3H) thymidine leakage and 86Rb+ leakage) after broad-band near-UV radiation but not after far-UV (254 nm) radiation. As a control response for membrane damage to cells, this leakage of intracellular material was also determined by each method after mild heat (520C) treatment of E. coli K-12. An action spectrum for the release of 86Rb+ from E. coli K-12 after monochromatic irradiation (254 to 405 nm) is also presented. The action spectrum for lethality (F37 values) shows that leakage of 86Rb+ occurs at fluences around those causing inactivation at wavelengths above 305 nm. In contrast, at wavelengths below 305 nm, leakage of 86Rb+ from irradiated cells can be induced but only at fluences significantly greater than was required to cause cell inactivation. These results indicate that near-UV radiation can damage the cell's permeability barrier which may be significant in causing cell death, whereas the effect is not significant in causing cell death by far-UV radiation where DNA is known to be the main cause of lethality. (author)

  9. Environmental and genetic factors affecting mutability to aminoglycoside antibiotics among Escherichia coli K12 strains

    Directory of Open Access Journals (Sweden)

    Monteiro A.C.M.

    2003-01-01

    Full Text Available Environmental and genetic factors affecting the in vitro spontaneous mutation frequencies to aminoglycoside resistance in Escherichia coli K12 were investigated. Spontaneous mutation frequencies to kanamycin resistance were at least 100 fold higher on modified Luria agar (L2 plates, when compared to results obtained in experiments carried out with Nutrient agar (NA plates. In contrast to rifampincin, the increased mutability to kanamycin resistance could not be attributed to a mutator phenotype expressed by DNA repair defective strains. Kanamycin mutant selection windows and mutant preventive concentrations on L2 plates were at least fourfold higher than on NA plates, further demonstrating the role of growth medium composition on the mutability to aminoglycosides. Mutability to kanamycin resistance was increased following addition of sorbitol, suggesting that osmolarity is involved on the spontaneous mutability of E. coli K12 strains to aminoglycosides. The spontaneous mutation rates to kanamycin resistance on both L2 and NA plates were strictly associated with the selective antibiotic concentrations. Moreover, mutants selected at different antibiotic concentrations expressed heterogeneous resistance levels to kanamycin and most of them expressing multiple resistance to all tested aminoglycoside antibiotics (gentamicin, neomycin, amykacin and tobramycin. These results will contribute to a better understanding of the complex nature of aminoglycoside resistance and the emergence of spontaneous resistant mutants among E. coli K12 strains.

  10. Opinions on computing education in Korean K-12 system: higher education perspective

    Science.gov (United States)

    Kim, Dae-Kyoo; Jeong, Dongwon; Lu, Lunjin; Debnath, Debatosh; Ming, Hua

    2015-10-01

    The need for computing education in the K-12 curriculum has grown globally. The Republic of Korea is not an exception. In response to the need, the Korean Ministry of Education has announced an outline for software-centric computing education in the K-12 system, which aims at enhancing the current computing education with software emphasis. In this paper, we review the outline from a higher education perspective and provide insights into its constructive improvement based on our experience in computer science education in higher education and a study of global initiatives on computing education. We also consider the social environment for computing education in Korea. In the proposed implementation, we first discuss goals for software-centric computing education and identify areas of focus. The identified areas are discussed in terms of topics to be covered and appropriate exposure of knowledge depth in the three levels in the Korean K-12 system. We then discuss necessary preparations for the success of the plan from academic, governmental and social perspectives.

  11. PET in oncology

    Energy Technology Data Exchange (ETDEWEB)

    Dresel, Stefan (ed.) [HELIOS Klinikum Berlin-Buch, Berlin (Germany). Klinik fuer Nuklearmedizin

    2008-07-01

    In the management of oncologic diseases, modern imaging modalities contribute heavily to the decision of which form of treatment - local or systemic, surgical or interdisciplinary - will be most efficient. The addition of functional image information to conventional staging procedures helps improve the diagnostic pathway. The information needed for therapeutic management and for follow-up can be provided by correlative imaging such as positron emission tomography (PET) and computed tomography (CT) or PET/CT. This book is a comprehensive compilation of the accumulated knowledge on PET and PET/CT in oncology, covering the entire spectrum from solidly documented indications, such as staging and monitoring of lung and colorectal cancer, to the application of PET/CT in head and neck surgery, gynecology, radiation therapy, urology, pediatrics etc. It is aimed at nuclear medicine and radiology specialists as well as physicians interested in the possibilities and limitations of PET and PET/CT in oncology. (orig.)

  12. Standardizing Naming Conventions in Radiation Oncology

    International Nuclear Information System (INIS)

    Purpose: The aim of this study was to report on the development of a standardized target and organ-at-risk naming convention for use in radiation therapy and to present the nomenclature for structure naming for interinstitutional data sharing, clinical trial repositories, integrated multi-institutional collaborative databases, and quality control centers. This taxonomy should also enable improved plan benchmarking between clinical institutions and vendors and facilitation of automated treatment plan quality control. Materials and Methods: The Advanced Technology Consortium, Washington University in St. Louis, Radiation Therapy Oncology Group, Dutch Radiation Oncology Society, and the Clinical Trials RT QA Harmonization Group collaborated in creating this new naming convention. The International Commission on Radiation Units and Measurements guidelines have been used to create standardized nomenclature for target volumes (clinical target volume, internal target volume, planning target volume, etc.), organs at risk, and planning organ-at-risk volumes in radiation therapy. The nomenclature also includes rules for specifying laterality and margins for various structures. The naming rules distinguish tumor and nodal planning target volumes, with correspondence to their respective tumor/nodal clinical target volumes. It also provides rules for basic structure naming, as well as an option for more detailed names. Names of nonstandard structures used mainly for plan optimization or evaluation (rings, islands of dose avoidance, islands where additional dose is needed [dose painting]) are identified separately. Results: In addition to its use in 16 ongoing Radiation Therapy Oncology Group advanced technology clinical trial protocols and several new European Organization for Research and Treatment of Cancer protocols, a pilot version of this naming convention has been evaluated using patient data sets with varying treatment sites. All structures in these data sets were

  13. Current management of surgical oncologic emergencies.

    Directory of Open Access Journals (Sweden)

    Marianne R F Bosscher

    Full Text Available For some oncologic emergencies, surgical interventions are necessary for dissolution or temporary relieve. In the absence of guidelines, the most optimal method for decision making would be in a multidisciplinary cancer conference (MCC. In an acute setting, the opportunity for multidisciplinary discussion is often not available. In this study, the management and short term outcome of patients after surgical oncologic emergency consultation was analyzed.A prospective registration and follow up of adult patients with surgical oncologic emergencies between 01-11-2013 and 30-04-2014. The follow up period was 30 days.In total, 207 patients with surgical oncologic emergencies were included. Postoperative wound infections, malignant obstruction, and clinical deterioration due to progressive disease were the most frequent conditions for surgical oncologic emergency consultation. During the follow up period, 40% of patients underwent surgery. The median number of involved medical specialties was two. Only 30% of all patients were discussed in a MCC within 30 days after emergency consultation, and only 41% of the patients who underwent surgery were discussed in a MCC. For 79% of these patients, the surgical procedure was performed before the MCC. Mortality within 30 days was 13%.In most cases, surgery occurred without discussing the patient in a MCC, regardless of the fact that multiple medical specialties were involved in the treatment process. There is a need for prognostic aids and acute oncology pathways with structural multidisciplinary management. These will provide in faster institution of the most appropriate personalized cancer care, and prevent unnecessary investigations or invasive therapy.

  14. A Research Agenda for Radiation Oncology: Results of the Radiation Oncology Institute’s Comprehensive Research Needs Assessment

    International Nuclear Information System (INIS)

    Purpose: To promote the rational use of scarce research funding, scholars have developed methods for the systematic identification and prioritization of health research needs. The Radiation Oncology Institute commissioned an independent, comprehensive assessment of research needs for the advancement of radiation oncology care. Methods and Materials: The research needs assessment used a mixed-method, qualitative and quantitative social scientific approach, including structured interviews with diverse stakeholders, focus groups, surveys of American Society for Radiation Oncology (ASTRO) members, and a prioritization exercise using a modified Delphi technique. Results: Six co-equal priorities were identified: (1) Identify and develop communication strategies to help patients and others better understand radiation therapy; (2) Establish a set of quality indicators for major radiation oncology procedures and evaluate their use in radiation oncology delivery; (3) Identify best practices for the management of radiation toxicity and issues in cancer survivorship; (4) Conduct comparative effectiveness studies related to radiation therapy that consider clinical benefit, toxicity (including quality of life), and other outcomes; (5) Assess the value of radiation therapy; and (6) Develop a radiation oncology registry. Conclusions: To our knowledge, this prioritization exercise is the only comprehensive and methodologically rigorous assessment of research needs in the field of radiation oncology. Broad dissemination of these findings is critical to maximally leverage the impact of this work, particularly because grant funding decisions are often made by committees on which highly specialized disciplines such as radiation oncology are not well represented.

  15. One-to-One Technology in K-12 Classrooms: A Review of the Literature from 2004 through 2014

    Science.gov (United States)

    Harper, Ben; Milman, Natalie B.

    2016-01-01

    This literature review examined empirical research conducted between 2004 and 2014 regarding 1:1 technologies in K-12 educational settings. Our overarching research question was: What does research tell us about 1:1 technology in K-12 classrooms? We used the constant-comparative method to analyze, code, and induce themes from 46 relevant articles.…

  16. The Effectiveness of Educational Technology Applications for Enhancing Mathematics Achievement in K-12 Classrooms: A Meta-Analysis. Educator's Summary

    Science.gov (United States)

    Center for Research and Reform in Education, 2012

    2012-01-01

    This review summarizes research on the effects of technology use on mathematics achievement in K-12 classrooms. The main research questions included: (1) Do education technology applications improve mathematics achievement in K-12 classrooms as compared to traditional teaching methods without education technology?; and (2) What study and research…

  17. Activities and Strategies for the Inclusion of a K-12 Educational Component in Digitization Grant Projects of Academic Libraries

    Science.gov (United States)

    Teel, Linda

    2010-01-01

    This article seeks to explore and discuss activities and strategies for including a K-12 educational component in digitization grant projects in academic libraries. The article is based on cases studying the K-12 educational component of the three following grants awarded to East Carolina University Joyner Library by North Carolina Exploring…

  18. The Platte River Corridor Project: A University/K-12 Collaboration to Meet the Needs of Latino Students

    Science.gov (United States)

    Hof, David D.; Lopez, Samuel T.; Dinsmore, Julie A.; Baker, Jessica; McCarty, Wendy L.; Tracy, Glenn

    2007-01-01

    This article discusses the development and impact of the Platte River Corridor Project, a successful university/K-12 partnership designed to address the inequality in learning outcomes for Latino students by increasing the effectiveness of K-12 classroom teachers in educating Latino English Language Learner (ELL) students and by facilitating…

  19. A Tale of Two Countries: Successes and Challenges in K-12 Computer Science Education in Israel and the United States

    Science.gov (United States)

    Gal-Ezer, Judith; Stephenson, Chris

    2014-01-01

    This article tells a story of K-12 computer science in two different countries. These two countries differ profoundly in culture, language, government and state structure, and in their education systems. Despite these differences, however, they share the pursuit of excellence and high standards in K-12 education. In Israel, curriculum is…

  20. Quality Assessment in Oncology

    International Nuclear Information System (INIS)

    The movement to improve healthcare quality has led to a need for carefully designed quality indicators that accurately reflect the quality of care. Many different measures have been proposed and continue to be developed by governmental agencies and accrediting bodies. However, given the inherent differences in the delivery of care among medical specialties, the same indicators will not be valid across all of them. Specifically, oncology is a field in which it can be difficult to develop quality indicators, because the effectiveness of an oncologic intervention is often not immediately apparent, and the multidisciplinary nature of the field necessarily involves many different specialties. Existing and emerging comparative effectiveness data are helping to guide evidence-based practice, and the increasing availability of these data provides the opportunity to identify key structure and process measures that predict for quality outcomes. The increasing emphasis on quality and efficiency will continue to compel the medical profession to identify appropriate quality measures to facilitate quality improvement efforts and to guide accreditation, credentialing, and reimbursement. Given the wide-reaching implications of quality metrics, it is essential that they be developed and implemented with scientific rigor. The aims of the present report were to review the current state of quality assessment in oncology, identify existing indicators with the best evidence to support their implementation, and propose a framework for identifying and refining measures most indicative of true quality in oncologic care.

  1. Quality Assessment in Oncology

    Energy Technology Data Exchange (ETDEWEB)

    Albert, Jeffrey M. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Das, Prajnan, E-mail: prajdas@mdanderson.org [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2012-07-01

    The movement to improve healthcare quality has led to a need for carefully designed quality indicators that accurately reflect the quality of care. Many different measures have been proposed and continue to be developed by governmental agencies and accrediting bodies. However, given the inherent differences in the delivery of care among medical specialties, the same indicators will not be valid across all of them. Specifically, oncology is a field in which it can be difficult to develop quality indicators, because the effectiveness of an oncologic intervention is often not immediately apparent, and the multidisciplinary nature of the field necessarily involves many different specialties. Existing and emerging comparative effectiveness data are helping to guide evidence-based practice, and the increasing availability of these data provides the opportunity to identify key structure and process measures that predict for quality outcomes. The increasing emphasis on quality and efficiency will continue to compel the medical profession to identify appropriate quality measures to facilitate quality improvement efforts and to guide accreditation, credentialing, and reimbursement. Given the wide-reaching implications of quality metrics, it is essential that they be developed and implemented with scientific rigor. The aims of the present report were to review the current state of quality assessment in oncology, identify existing indicators with the best evidence to support their implementation, and propose a framework for identifying and refining measures most indicative of true quality in oncologic care.

  2. Recommendations for the clinical practice: Standards, options and recommendations 2003 for the use of recombinant erythropoietin (alpha and beta epoetine, alpha darbepoetine, EPO) in the taking charge of anemia in oncology for the patients treated by radiotherapy, update

    International Nuclear Information System (INIS)

    Standards, Options and Recommendations for the use of recombinant erythropoietin (epoietin alpha and beta darbepoietin alpha, EPO) in the management of anaemia in oncology for patient undergoing radiotherapy - UPDATE 2003. Context. - 'The Standards, Options and Recommendations' (SOR) project, started in 1993, is a collaboration between the Federation of French Cancer Centres (FNCLCC), the twenty French cancer centres, and specialists from French public universities, general hospitals and private clinics. The main objective is the development of clinical practice guidelines to improve the quality of health care and the outcome of cancer patients. The methodology is based on a literature review and critical appraisal by a multidisciplinary group of experts, with feedback from specialists in cancer care delivery. Objectives. - To update the Standards, Options and Recommendations clinical practice guidelines for the use of recombinant erythropoietin (epoietin alpha and beta darbepoietin-alpha, EPO) in the management of anaemia in oncology for patient undergoing radiotherapy. Methods. - The working group identified the questions requiring up-dating from the previous guideline. Medline and Embase were searched using specific search strategies from January 1999 to October 2002. Literature monitoring was performed to identify randomized clinical trials published between October 2002 to November 2003. In addition several Internet sites were searched in October 2002. Results. - There is no standard attitude for use of rHuEPO in patients undergoing radiotherapy. There is no evidence to support use of rHuEPO in patients with ENT cancer receiving radiotherapy alone. In patients undergoing curative radiotherapy, it is recommended to correct anaemia under 10 g/dL using transfusion rather than rHuEPO. When the haemoglobin concentration is between 12 g/dL and 14 g/dL initial use of rHuEPO can be an option under certain conditions for radio-chemotherapy if the risk of anaemia is

  3. Budding yeast cDNA sequencing project: Y094_K12_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y094_K12_F.ab1 Y094_K12_F.ab1 DB664754 DB664754 Show Y094_K12_F.ab1 Seqid Y094_K12_F.ab1 Link to ... GAGTGTAAACGACGGCCAGTACGTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTGAACCACGTCACATTATACT CATAACCATAGAATTCACAGA ... TATATTACACCTTG GTTTTTGCCATTCTAGTGGTGGAGATTTTCATGTTCTCC ATTCTAGCCCT ACCAATCC CTTCTAGATACCGTAGGCCTCTCACCTTACT ... GTTATTAAAGC CGTTCAAATCCTCC ACAGTGCAAGTTGCGATCAAGTGTGTACTTGGGTTC ATTCTTTTGCT ... GGGCTAGTCATAGAACTTTTAACCATGAAAGACATATACAGAGCATCGC CTCC AGTAGCCTCC AGCGATGTCAAGAAGAACGACTCTGTTACTGCCGAA GCTG ...

  4. Quality of life in oncology with emphasis upon neuro-oncology.

    Science.gov (United States)

    Choucair, Ali K

    2007-01-01

    Quality of life, as a science has been steadily gaining importance in both clinical practice as well as research. Despite major progress in the development of validated and clinically-relevant health-related quality of life (HRQOL) measures, we still face many challenges in bridging the gap between what we know and how to apply it in clinical practice: in making the transfer from the mere collection of QOL data to its utilization in improving patient outcome through interventional symptomatic therapy. This manuscript traces the development of QOL as a science to its potential utility in both clinical care and clinical research, as well as an outcomes measure. The emphasis has been placed upon quality of life in oncology with special attention to neuro-oncology. PMID:17127306

  5. DEGRO 2009. Radiation oncology - medical physics - radiation biology. Abstracts

    International Nuclear Information System (INIS)

    The special volume of the journal covers the abstracts of the DEGRO 2009 meeting on radiation oncology, medical physics, and radiation biology, covering the following topics: seldom diseases, gastrointestinal tumors, radiation reactions and radiation protection, medical care and science, central nervous system, medical physics, the non-parvicellular lung carcinomas, ear-nose-and throat, target-oriented radiotherapy plus ''X'', radio-oncology - young academics, lymphomas, mammary glands, modern radiotherapy, life quality and palliative radiotherapy, radiotherapy of the prostate carcinoma, imaging for planning and therapy, the digital documentation in clinics and practical experiences, NMR imaging and tomography, hadrons - actual status in Germany, urinal tract oncology, radiotoxicity

  6. Sense and Sensibility: The Case for the Nationwide Inclusion of Engineering in the K-12 Curriculum

    Science.gov (United States)

    Lindberg, Robert E.; Pinelli, Thomas E.; Batterson, James G.

    2008-01-01

    The competitive status of the United States is inextricably linked to innovation just as innovation is inseparable from science, technology, engineering, and mathematics. To stay competitive in innovation requires that the United States produce a 21st century workforce complete with requisite education, training, skills, and motivation. If we accept a priori that science, technology, engineering, and mathematics education are crucial to competitiveness and innovation and that, in terms of innovation, mathematics, science, and engineering are interdependent, why are mathematics and science uniformly ubiquitous in the K-12 curriculum while engineering is conspicuously absent? We are passionate in our belief that the uniform addition of engineering to the K-12 curriculum will help ensure that the nation has "the right" 21st Century workforce. Furthermore, we believe that a nationwide effort, led by a coalition of engineering academics, practitioners, and societies is required to turn this goal into reality. However, accomplishing this goal necessitates, as we are reminded by the title of Jane Austen's timeless novel, "Sense and Sensibility", a workable solution that seeks the "middle ground" between passion and reason. We begin our paper by making two essential points: Engineers are not scientists. Engineering exists separate from science, has its own specialized knowledge community apart from science, and it is largely responsible for many of the most significant advancements and improvements in the quality of our life. Our workable solution requires that K-12 education, nationwide, accommodate the inclusion of engineering as a stand alone curriculum and we offer three reasons to support our position: (1) workforce development, (2) stimulating interest in STEM (science, technology, engineering, and mathematics) courses and careers, and (3) creating a technologically literate society. We conclude with some thoughts on how this important goal can be accomplished.

  7. The cryptic general secretory pathway (gsp) operon of Escherichia coli K-12 encodes functional proteins.

    OpenAIRE

    Francetic, O; Pugsley, A P

    1996-01-01

    Systematic sequencing of the Escherichia coli K-12 chromosome (GenBank entry U18997) has revealed the presence of an apparently complete operon of genes (the gspC-0 operon) similar to genes coding for components of the main terminal branch of the general secretory pathway (e.g., the Klebsiella oxytoca pulC-0 pullulanase secretion operon) and to related genes required for type IV pilus biogenesis. For example, the last gene in the gsp operon, gspO (formerly hopD), encodes a protein which is si...

  8. Code to Learn: Where Does It Belong in the K-12 Curriculum?

    OpenAIRE

    Jesús Moreno León; Gregorio Robles; Marcos Román-González

    2016-01-01

    The introduction of computer programming in K-12 has become mainstream in the last years, as countries around the world are making coding part of their curriculum. Nevertheless, there is a lack of empirical studies that investigate how learning to program at an early age affects other school subjects. In this regard, this paper compares three quasi-experimental research designs conducted in three different schools (n=129 students from 2nd and 6th grade), in order to assess the impact of intro...

  9. A novel L-serine deaminase activity in Escherichia coli K-12.

    OpenAIRE

    Su, H. (Hsin-Ning); Newman, E B

    1991-01-01

    We demonstrate here that Escherichia coli K-12 synthesizes two different L-serine deaminases (L-SD) catalyzing the nonoxidative deamination of L-serine to pyruvate, one coded for by the previously described sdaA gene and a second, hitherto undescribed enzyme which we call L-SD2. A strain carrying a null mutation in sdaA made no detectable L-SD in minimal medium, but had activity in Luria broth. We describe a mutation, sdaX, which affects the regulation of L-SD2 and permits its expression in m...

  10. Implications for Earth and space in new K-12 science standards

    Science.gov (United States)

    Wysession, Michael E.

    2012-11-01

    New science standards for national K-12 science education are in the process of being written by a states-led team of writers organized by Achieve, Inc., with important implications for teaching Earth and space sciences. The final version of these "Next Generation Science Standards" (NGSS) is scheduled to be released in early 2013, but a second draft of the standards will be made public in December 2012. Members of the Earth and space science (ESS) research communities can review this draft of NGSS and provide constructive feedback. Such feedback will help ensure that American students receive instruction that is accurate, relevant, and engaging.

  11. Relevance of DNA repair pathways on ascorbic acid effects on Echerichia Coli K-12 cells

    International Nuclear Information System (INIS)

    Inactivation kinetics were performed with repair proficient and deficient Escherichia coli K-12 cells treated with oxidized solutions of ascorbic acid. The repair pathways controlled by the recA and uvrA gene products are essential for cell survival to the treatment. However, SOS chromotest result indicates that the SOS functions are only induced at high and toxic concentrations of the drug. Moreover, single strand breaks in DNA from treated cells are detected, demonstrating genome damage promoted by oxidized solutions of ascorbate. (M.A.C.)

  12. Sustaining K-12 professional development in geology: Recurrent participation in Rockcamp

    Science.gov (United States)

    Repine, T.E., Jr.; Hemler, D.A.; Behling, R.E.

    2004-01-01

    A reconnaissance study of the geology professional development program known as RockCamp was initiated to examine the sustained, or recurrent, participation of K-12 science teachers. Open-ended interviews, concept mapping, and creative writing assignments were used to explore the perceptions of six teachers possessing an exceptional record of participation. Efficacy, fun, right time of life, and support emerged as unanimous reasons for recurrent participation. Content, friendship, and methodology were very important. College credit was not critical. These teachers' perceptions suggest their sustained involvement in the RockCamp Program is stimulated by situated learning experiences stressing a compare, contrast, connect, and construct pedagogy within a supportive learning community.

  13. The clinical value of combined use of MR imaging and multi-slice spiral CT in limb salvage surgery for orthopaedic oncology patients: initial experience in nine patients

    International Nuclear Information System (INIS)

    The purpose of this prospective study was to evaluate the value of the combined use of MR imaging and multi-slice spiral CT for limb salvage surgery in orthopaedic oncology patients. Nine consecutive patients with lower/upper limb malignant bone tumours (7 osteosarcomas and 2 chondrosarcomas) were treated with limb-salvaging procedures. Preoperative planning including determination of the osteotomy plane and diameters of the prosthesis was performed basing on the preoperative CT and MR images. The histopathology was performed as golden diagnostic criteria to evaluate the accuracy of CT and MR-based determination for tumour’s boundary. The tumour extension measured on MRI was consistent with the actual extension (P>0.05, paired Student’s t test), while the extension measured on CT imaging was less than the actual extension. The length, offset and alignment of the affected limb were reconstructed accurately after the operation. An excellent functional outcome was achieved in all patients. In the present study, MRI was found to be superior to CT for determining the tumour extension, combined use of MRI and CT measurement provided high precision for the fit of the prosthesis and excellent functional results

  14. PET/MR in oncology

    DEFF Research Database (Denmark)

    Balyasnikova, Svetlana; Löfgren, Johan; de Nijs, Robin;

    2012-01-01

    a number of different MRI techniques, such as DWI-MR (diffusion weighted imaging MR), DCE-MR (dynamic contrast enhanced MR), MRS (MR spectroscopy) and MR for attenuation correction of PET. All MR techniques presented in this paper have shown promising results in the treatment of patients with solid......After more than 20 years of research, a fully integrated PET/MR scanner was launched in 2010 enabling simultaneous acquisition of PET and MR imaging. Currently, no clinical indication for combined PET/MR has been established, however the expectations are high. In this paper we will discuss some of...... the challenges inherent in this new technology, but focus on potential applications for simultaneous PET/MR in the field of oncology. Methods and tracers for use with the PET technology will be familiar to most readers of this journal; thus this paper aims to provide a short and basic introduction to...

  15. Preclinical models in radiation oncology

    International Nuclear Information System (INIS)

    As the incidence of cancer continues to rise, the use of radiotherapy has emerged as a leading treatment modality. Preclinical models in radiation oncology are essential tools for cancer research and therapeutics. Various model systems have been used to test radiation therapy, including in vitro cell culture assays as well as in vivo ectopic and orthotopic xenograft models. This review aims to describe such models, their advantages and disadvantages, particularly as they have been employed in the discovery of molecular targets for tumor radiosensitization. Ultimately, any model system must be judged by its utility in developing more effective cancer therapies, which is in turn dependent on its ability to simulate the biology of tumors as they exist in situ. Although every model has its limitations, each has played a significant role in preclinical testing. Continued advances in preclinical models will allow for the identification and application of targets for radiation in the clinic

  16. Drug interactions in female oncologic inpatients: differences among databases

    OpenAIRE

    Patricia Moriel; Jorge Augusto Siqueira; Renata Cavalcanti Carnevale; Caroline de Godoi Rezende Costa; Aline Aparecida da Cruz; Nice Maria Oliveira da Silva; Adélia Corina Bernardes; Roberta Paro Carvalho; Priscila Gava Mazzola

    2013-01-01

    The aim of the present study was to quantify drug interactions in prescriptions for women undergoing supportive therapy in an oncology setting at a women’s hospital in Brazil and compare the information provided by different databases regarding these drug interactions. A convenience sample was selected of prescriptions for patients diagnosed with breast or gynecological tumors hospitalized in the clinical oncology and surgery wards from April to June 2009. DRUGDEX/M...

  17. Hydrodynamics and Geochemical Modelling of CO2 Injection at the K12B Gas Field

    Science.gov (United States)

    Audigane, P.; Oldenburg, C.; van der Meer, B.; Geel, K.; Lions, J.; Gaus, I.; Robelin, C.; Durst, P.; Xu, T.

    2007-12-01

    This paper presents a numerical simulation study of CO2 injection into the nearly depleted gas reservoir at the K12B field, North Sea, selected as a demonstration site for the Offshore Re-injection of CO2 project. Simulations have been carried out using two different codes: TOUGHREACT for characterizing the geochemical fluid-rock interactions that may occur during the injection period (case A), and TOUGH2EOS7C for simulating the CO2 sequestration coupled with enhanced methane production (case B). The reactive transport modelling predict a rather low geochemical reactivity induced by such injection as the gas reservoir contained initially 13% of CO2 in the gas phase and therefore geochemical equilibrium has been established before injection starts. The simulations of the CH4 recovery estimate due to injection predict a short breakthrough time of 60 days and one year for the two producers, respectively. At the end of the 10 years of injection, CO2 remains at 96% under gas phase and structural trapping remains the main process for geological sequestration at the K12B field.

  18. The Development of a Conceptual Framework for New K-12 Science Education Standards (Invited)

    Science.gov (United States)

    Keller, T.

    2010-12-01

    The National Academy of Sciences has created a committee of 18 National Academy of Science and Engineering members, academic scientists, cognitive and learning scientists, and educators, educational policymakers and researchers to develop a framework to guide new K-12 science education standards. The committee began its work in January, 2010, released a draft of the framework in July, 2010, and intends to have the final framework in the first quarter of 2011. The committee was helped in early phases of the work by consultant design teams. The framework is designed to help realize a vision for science and engineering education in which all students actively engage in science and engineering practices in order to deepen their understanding of core ideas in science over multiple years of school. These three dimensions - core disciplinary ideas, science and engineering practices, and cross-cutting elements - must blend together to build an exciting, relevant, and forward looking science education. The framework will be used as a base for development of next generation K-12 science education standards.

  19. Pay It Forward: Teacher Candidates’ Use of Historical Artifacts to Invigorate K-12 History Instruction

    Directory of Open Access Journals (Sweden)

    Scott M. Waring,

    2015-11-01

    Full Text Available The history education literature is replete with a call to help teachers understand that history should be taught as being inquiry-based and interpretive. We are encouraged, and rightfully so, to do history, to perform history, to do democracy, and to motivate students for inquiry and action by using primary sources. The authors developed a unit of study for history and social studies teacher candidates that would address several issues: (a motivate and inspire future teachers to use inquiry as a tool to build K-12 students’ historical understanding and facilitate purposeful utilization of artifacts with ease; (b help future teachers increase their knowledge of local history; and (c present a unit that could be easily used in a secondary history course and, with some modifications, could be adapted for elementary and middle school history classrooms. The assignment was named Pay it Forward: Invigorating Instruction through Local History. This multifaceted assignment included the development of a lesson plan that would (a demonstrate a robust understanding of engaging students in historical inquiry and local history, and (b focus on an artifact that the teacher candidate would find as part of the investigation. The majority of the teacher candidates in this study did show evidence of, albeit limited at times, designing curriculum that encouraged K-12 students to engage in historical inquiry. Making the bridge between theory and practice, or showing evidence of learning from the methods courses, was clearly evident across the lesson plans.

  20. Phleomycin-induced lethality and DNA degradation in Escherichia coli K12

    Energy Technology Data Exchange (ETDEWEB)

    Nakayama, H.

    1975-01-01

    The cell lethality and DNA fragmentation caused by phleomycin (PM) were studied in E. coli K12 strains with special reference to the effects of repair or recombination deficiencies and metabolic inhibitors. Unlike excision-defective derivatives of E. coli B, uvrA, uvrB, and uvrC mutants of strain K12 showed no peculiarities compared with wild type in regard to cell survival. Likewise, mutant alleles at uvrD and polA loci had no effect. In contrast, rec mutants were more sensitive to PM-killing than were rec/sup +/ strains. PM-induced strand breakage in DNA was observed in all strains tested including the above-mentioned mutants. There was no significant distinction between the uvr mutants and the wild type strain, indicating that the uvr-endonuclease was not responsible for the strand breaks. Involvement of endonuclease I was also ruled out. At least some of the PM-induced strand breaks were repairable. PM-induced lethality and strand breakage were totally dependent on energy supply. Inhibition of protein synthesis resulted in a partial and parallel suppression of the two effects. Our results suggest that the lethality is due to DNA strand breakage and the repair of such damage is postulated to be controlled by rec genes.

  1. Associations of Escherichia coli K-12 OmpF trimers with rough and smooth lipopolysaccharides

    International Nuclear Information System (INIS)

    The associations of both rough and smooth lipopolysaccharides (LPS) with the OmpF porin of Escherichia coli K-12 were examined in galE strains deleted for ompC. Transformation with pSS37 and growth with galactose conferred the ability to assemble a Shigella dysenteriae O antigen onto the core oligosaccharide of E. coli K-12 LPS. The association of LPS with OmpF trimers was assessed by staining, autoradiography of LPS specifically labeled with [1-14C]galactose, and Western immunoblotting with a monoclonal antibody specific for OmpF trimers. These techniques revealed that the migration distances and multiple banding patterns of OmpF porin trimers in sodium dodecyl sulfate-polyacrylamide gels were dictated by the chemotype of associated LPS. Expression of smooth LPS caused almost all of the trimeric OmpF to run in gels with a slower mobility than trimers from rough strains. The LPS associated with trimers from a smooth strain differed from the bulk-phase LPS by consisting almost exclusively of molecules with O antigen

  2. Implications of the Next Generation Science Standards for K-12, EPO, and Higher Education

    Science.gov (United States)

    Schultz, G.; Barber, J.; Pomeroy, R.; Reagan, G.

    2014-07-01

    The newly-released Next Generation Science Standards (NGSS) have been under development for a few years with broad community input and explicit involvement of many states likely to adopt these as their own science standards. Several key features of the NGSS make these a substantial advance from the existing National Science Education Standards (NRC 1996), including focus on three dimensions previously outlined in A Framework for K-12 Science Education (NRC 2011): Science and Engineering Practices; Cross-cutting Concepts; and Disciplinary Core Ideas. What are the implications of all this now for K-12 educators, in the immediate term and in the long-term? What do the NGSS imply for EPO professionals, especially those involved in science curriculum development and teacher professional development? What should higher education faculty know about the NGSS, especially as it relates to the preparation of incoming college students, as well as the education of future elementary and secondary science teachers in college (including in Astro 101-type courses)?

  3. Serum HER-2 concentrations for monitoring women with breast cancer in a routine oncology setting

    DEFF Research Database (Denmark)

    Sørensen, Patricia Diana; Jakobsen, Erik Hugger; Langkjer, Sven Tyge;

    2009-01-01

    1348 patients with breast cancer: 837 during routine oncology clinic visits and 511 following new diagnosis. All patients with positive serum HER-2, 1/5 of negative patients from the oncology clinic, and all the newly diagnosed were followed; a total of 862 patients. Serum HER-2 was measured using the...

  4. Use of Streptococcus salivarius K12 in the prevention of streptococcal and viral pharyngotonsillitis in children

    Directory of Open Access Journals (Sweden)

    Di Pierro F

    2014-02-01

    Full Text Available Francesco Di Pierro,1 Maria Colombo,2 Alberto Zanvit,3 Paolo Risso,4 Amilcare S Rottoli5 1Scientific Department, Velleja Research, Milan, 2Pediatric Department, University of Parma, Parma, 3Stomatology Institute, Milan, 4Laboratory of Epidemiology and Social Psychiatry, Mario Negri Institute, Milan, 5Pediatric Department, Uboldo Hospital, Cernusco sul Naviglio, Italy Background: Streptococcus salivarius K12 is an oral probiotic strain releasing two lantibiotics (salivaricin A2 and salivaricin B that antagonize the growth of S. pyogenes, the most important bacterial cause of pharyngeal infections in humans also affected by episodes of acute otitis media. S. salivarius K12 successfully colonizes the oral cavity, and is endowed with an excellent safety profile. We tested its preventive role in reducing the incidence of both streptococcal and viral pharyngitis and/or tonsillitis in children. Materials and methods: We enrolled 61 children with a diagnosis of recurrent oral streptococcal disorders. Thirty-one of them were enrolled to be treated daily for 90 days with a slow-release tablet for oral use, containing no less than 1 billion colony-forming units/tablet of S. salivarius K12 (Bactoblis®, and the remaining 30 served as the untreated control group. During treatment, they were all examined for streptococcal infection. Twenty children (ten per group were also assessed in terms of viral infection. Secondary end points in both groups were the number of days under antibiotic and antipyretic therapy and the number of days off school (children and off work (parents. Results: The 30 children who completed the 90-day trial with Bactoblis® showed a significant reduction in their episodes of streptococcal pharyngeal infection (>90%, as calculated by comparing the infection rates of the previous year. No difference was observed in the control group. The treated group showed a significant decrease in the incidence (80% of oral viral infections. Again

  5. Radiotherapy and immune reaction of oncologic patients

    International Nuclear Information System (INIS)

    Represented is a review of data accumulated in literature (1970-1976) on oppression of protection of oncologic patients and more oppression of immune reactions during radiotherapy. Underlined is the significance of studying immune homeostasis in a clinic of radiotherapy to evaluate total resistance of patients before the beginning and in the process of treatment. The prognostic significance of immunodepressive disturbances in patients with malignant tumors is elucidated

  6. Radiopharmaceuticals in oncology

    International Nuclear Information System (INIS)

    Radiopharmaceuticals are generally made of an artificial radionuclide chemically bound to a molecule showing an affinity for a particular type of cells. In oncology, the radionuclide emits either photons for scintigraphic imaging, either beta or alpha particles for metabolic radiotherapy. The development of new radiopharmaceuticals is mostly hampered by the modifications of conformation and hence, of biological behavior, of the original molecule induced by its radiolabelling. The use of positron emitters can be a solution to this difficulty, but their short half-life generates serious management limitations. Radiopharmaceutical used in oncology are targeted toward the cellular and tissular tumorous abnormalities. They belong to different categories: membrane agents, metabolic substrates (such as fluorodeoxyglucose), receptors ligands, antibodies and other agents under development such as hypoxia, apoptosis and genes markers. (authors)

  7. Technical Support Document: Development of the Advanced Energy Design Guide for K-12 Schools--30% Energy Savings

    Energy Technology Data Exchange (ETDEWEB)

    Pless, S.; Torcellini, P.; Long, N.

    2007-09-01

    This Technical Support Document describes the process and methodology for the development of the Advanced Energy Design Guide for K-12 School Buildings (K-12 AEDG), a design guidance document intended to provide recommendations for achieving 30% energy savings in K-12 Schools over levels contained in ANSI/ASHRAE/IESNA Standard 90.1-1999, Energy Standard for Buildings Except Low-Rise Residential Buildings. The 30% energy savings target is the first step toward achieving net-zero energy schools; schools that, on an annual basis, draw from outside sources less or equal energy than they generate on site from renewable energy sources.

  8. Escherichia coli B lacks one of the two initiator tRNA species present in E. coli K-12.

    OpenAIRE

    Mandal, N; RajBhandary, U L

    1992-01-01

    We show that the metY locus which specifies tRNA(2fMet) in Escherichia coli K-12 specifies tRNA(1fMet) in E. coli B. This conclusion is based on results of Southern blot analysis of E. coli B and K-12 DNAs and on polymerase chain reaction amplification, cloning, and sequencing of an approximately 200-bp region of DNA corresponding to the metY loci of E. coli B and E. coli K-12. We also show that the metY locus of E. coli B is transcriptionally active. E. coli strains transformed with the mult...

  9. Oncology and palliative care

    OpenAIRE

    Bausewein, Claudia; Hartenstein, R.

    2000-01-01

    Oncology developed as a discipline over the last decades. Treatment is concentrated on cure or palliation of the illness with the help of chemotherapy, radiotherapy or surgery. Palliative care has its origin in the hospice movement that started around 1960 in the UK. Centre of care is the patient and his family. Focus of care has moved from quantity to quality of life. Symptom control, communication, rehabilitation and care for the dying are main areas of palliative care. Palliative care and ...

  10. The role of Advanced Practice Providers in interdisciplinary oncology care in the United States.

    Science.gov (United States)

    Reynolds, Rae Brana; McCoy, Kimberly

    2016-06-01

    Advanced Practice Registered Nurses (APRNs) and Physician Assistants (PAs), generally referred to as Advanced Practice Providers (APPs), are fundamental to interdisciplinary oncology care. As the projected demand for oncology services is anticipated to outpace the supply of oncologists, APPs will become increasingly vital in the delivery of oncology care and services. The training, education, and scope of practice for APPs gives the interdisciplinary care team professionals that deliver high-quality clinical services and provide valuable contributions and leadership to health care quality improvement initiatives. Optimizing the integration of APPs in oncology care offers immense advantages towards improvement of clinical outcomes. PMID:27197514

  11. [Factitious diseases in oncology].

    Science.gov (United States)

    Reich, Michel; Clermont, Amélie; Amela, Éric; Kotecki, Nuria

    2015-12-01

    Factitious diseases and pathomimias and particularly Munchausen's syndrome, due to their rarity, are poorly diagnosed by medical teams working in oncology. Consequences can be serious and result in unadapted surgery or non justified implementation of chemotherapy and radiotherapy regimens. These patients simulate diseases in order to attract medical attention. They might become belligerent and are likely to promptly discharge themselves from hospital if they do not get the desired attention or are unmasked. With two following case reports and literature review, we would like to alert clinicians about difficulties encountered in diagnosis and management of factitious disorders. When faced with this diagnosis, the patient will tend to deny reality and break contact with the medical team who exposed him. Medical peregrinating behavior surrounded by conflicts with medical team, past psychiatric illness, history of working in the medical and paramedical field and social isolation can guide the diagnosis. Somaticians and especially surgeons working in the oncologic field must remain vigilant about this diagnosis and collaborate with either the psycho-oncologic team or the consultation-liaison psychiatric team. Some recommendations for medical professionals how to cope with these patients will be suggested. PMID:26597474

  12. Quality Indicators in Radiation Oncology

    International Nuclear Information System (INIS)

    Oncologic specialty societies and multidisciplinary collaborative groups have dedicated considerable effort to developing evidence-based quality indicators (QIs) to facilitate quality improvement, accreditation, benchmarking, reimbursement, maintenance of certification, and regulatory reporting. In particular, the field of radiation oncology has a long history of organized quality assessment efforts and continues to work toward developing consensus quality standards in the face of continually evolving technologies and standards of care. This report provides a comprehensive review of the current state of quality assessment in radiation oncology. Specifically, this report highlights implications of the healthcare quality movement for radiation oncology and reviews existing efforts to define and measure quality in the field, with focus on dimensions of quality specific to radiation oncology within the “big picture” of oncologic quality assessment efforts

  13. Global Climate Change and the Wildlands of Montana: Promoting Scientific Understanding for K-12 Educators

    Science.gov (United States)

    Graumlich, L. J.; Simonsen, L. M.

    2004-12-01

    The complexities and uncertainties associated with the science of global climate change is a barrier to the implementation of global change into K-12 classrooms. This issue is part of a larger conundrum where by teachers who are not well-versed in the content of an emerging science field are less likely to incorporate that topic into their curriculum. As such, it is not surprising that the K-12 community has been slow to embrace global climate change as a curriculum element, given that science underlying global climate change is interdisciplinary and replete with new discoveries, complex models, and competing theories. Faculty members associated with the Big Sky Institute have experimented with ways to promote collaboration between researchers and educators to enhance scientific literacy. In 2004, with funding from the US Environmental Protection Agency and private foundations, we implemented a five-day, field based professional development workshop for middle and high school teachers that focused on the research underlying EPA's Climate Change, Wildlife and Wildlands curriculum. A primary objective of the overall project is to promote one-on-one engagement of teachers with researchers whose work forms the basis of the content of the curriculum. Further, we seek to assess the degree to which increased content knowledge leads to incorporation of global climate change content into classrooms and curricula. During the workshop, we focused on two broad research findings, namely: 1) Global climate change is systemically pervasive such that even wildlands (i.e., unmanaged, pristine parks and reserves) are or potentially will be altered by global climate change. 2) At the same time, natural climate variability may enhance or mask human-induced climate impacts on wildlands and wildlife. In addition, we emphasized two broadly framed "ways of thinking" about global climate change, namely: 1) Wildlands can be used to detect and measure the impacts of human-induced climate

  14. Climate Change Education Today in K-12: What's Happening in the Earth and Space Science Classroom?

    Science.gov (United States)

    Holzer, M. A.; National Earth Science Teachers Association

    2011-12-01

    Climate change is a highly interdisciplinary topic, involving not only multiple fields of science, but also social science and the humanities. There are many aspects of climate change science that make it particularly well-suited for exploration in the K-12 setting, including opportunities to explore the unifying processes of science such as complex systems, models, observations, change and evolution. Furthermore, this field of science offers the opportunity to observe the nature of science in action - including how scientists develop and improve their understanding through research and debate. Finally, climate change is inherently highly relevant to students - indeed, students today will need to deal with the consequences of the climate change. The science of climate change is clearly present in current science education standards, both at the National level as well as in the majority of states. Nonetheless, a significant number of teachers across the country report difficulties addressing climate change in the classroom. The National Earth Science Teachers Association has conducted several surveys of Earth and space science educators across the country over the past several years on a number of issues, including their needs and concerns, including their experience of external influences on what they teach. While the number of teachers that report external pressures to not teach climate change science are in the minority (and less than the pressure to not teach evolution and related topics), our results suggest that this pressure against climate change science in the K-12 classroom has grown over the past several years. Some teachers report being threatened by parents, being encouraged by administrators to not teach the subject, and a belief that the "two sides" of climate change should be taught. Survey results indicate that teachers in religious or politically-conservative districts are more likely to report difficulties in teaching about climate change than in

  15. Guidelines for treatment naming in radiation oncology.

    Science.gov (United States)

    Denton, Travis R; Shields, Lisa B E; Hahl, Michael; Maudlin, Casey; Bassett, Mark; Spalding, Aaron C

    2015-01-01

    Safety concerns may arise from a lack of standardization and ambiguity during the treatment planning and delivery process in radiation therapy. A standardized target and organ-at-risk naming convention in radiation therapy was developed by a task force comprised of several Radiation Oncology Societies. We present a nested-survey approach in a community setting to determine the methodology for radiation oncology departments to standardize their practice. Our Institution's continuous quality improvement (CQI) committee recognized that, due to growth from one to three centers, significant variability existed within plan parameters specific to patients' treatment. A multidiscipline, multiclinical site consortium was established to create a guideline for standard naming. Input was gathered using anonymous, electronic surveys from physicians, physicists, dosimetrists, chief therapists, and nurse managers. Surveys consisted of several primary areas of interest: anatomical sites, course naming, treatment plan naming, and treatment field naming. Additional concepts included capitalization, specification of later-ality, course naming in the event of multiple sites being treated within the same course of treatment, primary versus boost planning, the use of bolus, revisions for plans, image-guidance field naming, forbidden characters, and standard units for commonly used physical quantities in radiation oncology practice. Guidelines for standard treatment naming were developed that could be readily adopted. This multidisciplinary study provides a clear, straightforward, and easily implemented protocol for the radiotherapy treatment process. Standard nomenclature facilitates the safe means of communication between team members in radiation oncology. The guidelines presented in this work serve as a model for radiation oncology clinics to standardize their practices. PMID:27074449

  16. Technology for Innovation in Radiation Oncology.

    Science.gov (United States)

    Chetty, Indrin J; Martel, Mary K; Jaffray, David A; Benedict, Stanley H; Hahn, Stephen M; Berbeco, Ross; Deye, James; Jeraj, Robert; Kavanagh, Brian; Krishnan, Sunil; Lee, Nancy; Low, Daniel A; Mankoff, David; Marks, Lawrence B; Ollendorf, Daniel; Paganetti, Harald; Ross, Brian; Siochi, Ramon Alfredo C; Timmerman, Robert D; Wong, John W

    2015-11-01

    Radiation therapy is an effective, personalized cancer treatment that has benefited from technological advances associated with the growing ability to identify and target tumors with accuracy and precision. Given that these advances have played a central role in the success of radiation therapy as a major component of comprehensive cancer care, the American Society for Radiation Oncology (ASTRO), the American Association of Physicists in Medicine (AAPM), and the National Cancer Institute (NCI) sponsored a workshop entitled "Technology for Innovation in Radiation Oncology," which took place at the National Institutes of Health (NIH) in Bethesda, Maryland, on June 13 and 14, 2013. The purpose of this workshop was to discuss emerging technology for the field and to recognize areas for greater research investment. Expert clinicians and scientists discussed innovative technology in radiation oncology, in particular as to how these technologies are being developed and translated to clinical practice in the face of current and future challenges and opportunities. Technologies encompassed topics in functional imaging, treatment devices, nanotechnology, and information technology. The technical, quality, and safety performance of these technologies were also considered. A major theme of the workshop was the growing importance of innovation in the domain of process automation and oncology informatics. The technologically advanced nature of radiation therapy treatments predisposes radiation oncology research teams to take on informatics research initiatives. In addition, the discussion on technology development was balanced with a parallel conversation regarding the need for evidence of efficacy and effectiveness. The linkage between the need for evidence and the efforts in informatics research was clearly identified as synergistic. PMID:26460989

  17. The minutes of Beijing-Tianjin seminar of Chinese Society of Clinical Oncology experts'-consensus on the diagnosis and treatment of osteosarcoma%CSCO骨肉瘤诊治专家共识北京-天津研讨会会议纪要

    Institute of Scientific and Technical Information of China (English)

    孙扬; 金韬; 张清

    2012-01-01

    In order to reach a consensus on the standardized clinical diagnosis and treatment of osteosarcoma and lay the foundation for the future Chinese version of "Experts' Consensus of the Clinical Diagnosis and Treatment of Osteosarcoma", the Beijing-Tianjin seminar of Chinese Society of Clinical Oncology (CSCO) experts' consensus on the diagnosis and treatment of osteosarcoma was held at the China National Convention Centre on April 20, 2012. More than 40 representatives from over 20 hospitals nationwide attended the conference. Insisting on the aim of multidisciplinary mutual learning, communication and enhancement, in the conference there was a heated exchange and discussion in the area of the standardized clinical diagnosis and treatment of osteosarcoma.

  18. 辩证思维在肿瘤放射治疗学临床教学中的应用探讨%Application of dialectical thinking in clinical teaching of radiation oncology

    Institute of Scientific and Technical Information of China (English)

    江浩

    2015-01-01

    The scientific way of thinking to explore the nature of clinical phenomena that exist,is one of the basic requirements of modern medical model.Clinical Radiation Oncology teaching mostly video images as a carrier-based training image thinking,logical thinking and abstract thinking that,especially in the form of dialectical logic thinking in clinical teaching less general application,the instructor is not easily mastered.Training medical students of dialectical thinking ability,and to achieve thinking ability combined image thinking,formal logic thinkingand dialectical logic thinking is a qualified medical students training in basic aspirations.Therefore,in addition to clinical theory class teacher to teach clinical knowledge,strengthenability to the scientific way of thinking of medical students,especially the culture of dialectical thinking ability is very necessary and urgent.In our practice on teaching of radiation oncology,that to teach inducing carcinoma and treating carcinoma by radiation,the pros and cons of gene mutation,damaging normal tissues and killing cancer cells by radiation,grasping intensity of cancer treatment,selectingcancer radiotherapy strategy,and its conversion protagonist and a supporting role of comprehensive treatment,analyzed with dialectical thinking to guide medical students should not only master the micro-level of radiation oncology phenomenon of life,but should learn to understand the use of dialectical thinking from a macro level and explore life movement in a variety of phenomena,and thus more easily to digest and absorb all the important points of radiation oncology.So it not only can make students get knowledge of long-term memory,but can make the medical students handy use the tools of dialectical thinking to solve a lot of complex issues of the clinical practice in the future,in order to better service for future clinical practice.%运用科学的思维方式探讨临床医学中存在的现象与本质,是现代医学模式

  19. Schools K-12, washoe county schools attribute, Published in 2006, 1:1200 (1in=100ft) scale, Washoe County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Schools K-12 dataset, published at 1:1200 (1in=100ft) scale, was produced all or in part from Published Reports/Deeds information as of 2006. It is described...

  20. Schools K-12, schools, Published in unknown, 1:2400 (1in=200ft) scale, Marathon County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Schools K-12 dataset, published at 1:2400 (1in=200ft) scale, was produced all or in part from Other information as of unknown. It is described as 'schools'....

  1. Schools K-12, Published in 2008, 1:1200 (1in=100ft) scale, Brown County, WI.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Schools K-12 dataset, published at 1:1200 (1in=100ft) scale, was produced all or in part from Orthoimagery information as of 2008. Data by this publisher are...

  2. Schools K-12, usd 482 schools, Published in 2008, 1:4800 (1in=400ft) scale, Lane County.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Schools K-12 dataset, published at 1:4800 (1in=400ft) scale, was produced all or in part from Not Provided information as of 2008. It is described as 'usd 482...

  3. Schools K-12, Published in 1990, 1:100000 (1in=8333ft) scale, Pitt County GIS.

    Data.gov (United States)

    NSGIC GIS Inventory (aka Ramona) — This Schools K-12 dataset, published at 1:100000 (1in=8333ft) scale, was produced all or in part from Published Reports/Deeds information as of 1990. Data by this...

  4. Nursing student attitudes toward oncology nursing: an evidence-based literature review.

    Science.gov (United States)

    Komprood, Sarah R

    2013-02-01

    Oncology education can impact nursing students' attitudes toward oncology and their interest in oncology nursing. To explore that relationship, a literature search was conducted using the CINAHL®, Cochrane Library, ERIC®, PubMed, and Scopus® databases. Nineteen pertinent studies were incorporated into the review, and recommendations were graded by strength of evidence schemas. The reviewed literature indicated undergraduate oncology education may be effective in encouraging nursing students to consider oncology as a practice area. Negative attitudes toward oncology such as fear and pessimism often are seen in students and practicing nurses. Educational interventions for students and nurses are effective in increasing knowledge and skills that are instrumental in fostering confidence and positive attitudes toward oncology nursing. All nursing students should have organized, mandatory clinical and didactic oncology nursing education experiences. Additional research is needed to support the effectiveness of educational strategies in influencing students' intent to practice oncology nursing. Innovative strategies including nontraditional clinical experiences, internships, fellowships, high-fidelity simulation, and postgraduate residencies are needed to provide adequate educational opportunities for nursing students to foster a strong and proficient oncology nursing workforce. PMID:23372107

  5. Code to Learn: Where Does It Belong in the K-12 Curriculum?

    Directory of Open Access Journals (Sweden)

    Jesús Moreno León

    2016-06-01

    Full Text Available The introduction of computer programming in K-12 has become mainstream in the last years, as countries around the world are making coding part of their curriculum. Nevertheless, there is a lack of empirical studies that investigate how learning to program at an early age affects other school subjects. In this regard, this paper compares three quasi-experimental research designs conducted in three different schools (n=129 students from 2nd and 6th grade, in order to assess the impact of introducing programming with Scratch at different stages and in several subjects. While both 6th grade experimental groups working with coding activities showed a statistically significant improvement in terms of academic performance, this was not the case in the 2nd grade classroom. Notable disparity was also found regarding the subject in which the programming activities were included, as in social studies the effect size was double that in mathematics.

  6. Achieving Excellence in K-12 Earth Science Education: The Critical Role of Geoscientists.

    Science.gov (United States)

    Low, R.; Reap, M.; Slattery, W.; Crannell, J.

    2005-12-01

    Minnesota has a reputation for excellence in K-12 science education. When the Minnesota Legislature required new academic standards in science, the state became an attractive venue for advocates of creationism and intelligent design who were intent on parallel teaching of evolution and what they refer to as "the" alternative. This paper describes the strategies used by a well-organized movement to include ID in the science standards and provides a case study/example of the so-called Wedge Strategy from the perspective of scientists who served as members of the MN science standards committee. The paper discusses the critial role scientists played in the development of exemplary and rigorous Earth science standards now legislated in MN and concludes with recommendations for the geoscience community derived from the experiences of geoscientists and educators who served as "reluctant warriors" in the battle for standards-based geoscience education in MN and Ohio.

  7. Assessment lessons from K-12 education research: Knowledge representation, learning, and motivation

    Science.gov (United States)

    Shepard, Lorrie A.

    2012-02-01

    Research on teaching to the test in K-12 settings has documented the lack of generalized understanding of underlying principles in tested subjects. This is similar to the experience of physics students who can complete computational problems without conceptual understanding. The PER community is well aware of the importance of explicit representations of learning goals as well as the role of the formative assessment process, especially feedback and self assessment, in promoting or deterring students' engagement and willingness to take responsibility for their own learning. Key principles from socio-cultural learning theory and research on motivation are summarized and used to identify instructional and assessment practices that hold the most promise for engaging students in developing deep conceptual understanding.

  8. Photochromic polyoxotungstoeuropate K12[EuP5W30O110]/polyvinylpyrrolidone nanocomposite films

    International Nuclear Information System (INIS)

    A novel photochromic nanocomposite film containing polyoxotungstoeuropate K12[EuP5W30O110] entrapped in polyvinylpyrrolidone has been prepared through a spin-on coating technique. Thus-obtained amorphous nanocomposite film was characterized by IR spectra, UV-vis absorption spectra, XRD, SEM, TG-DTA, and ESR. Results show that polyoxotungstoeuropate interacts with polyvinylpyrrolidone strongly and disperses homogeneously in the matrix. The composite film exhibits good photochromic properties. When irradiated with UV light, the transparent film changes from colorless to blue. Then, bleaching occurs when the film is in contact with ambient air or O 2 in the dark. The photochromism of the composite film is due to charge transfer by reduction of polyoxotungstoeuropate and oxidation of polyvinylpyrrolidone

  9. Survey on Teaching Science to K-12 Students with Disabilities: Teacher Preparedness and Attitudes

    Science.gov (United States)

    Kahn, Sami; Lewis, Anna R.

    2014-12-01

    Students with disabilities are increasingly included in general education science classrooms and are expected to demonstrate academic proficiency on standardized assessments. Teacher preparation and attitudes have been cited as major factors contributing to either the success or failure of students with disabilities in science. In order to assess the current state of what could be facilitative or inhibitory influences, a national online survey to which 1,088 K-12 science teachers responded was conducted. Mixed methods' analyses suggest that science teachers receive little formal training and feel underprepared to teach students with disabilities. Results identify specific gaps in science teachers' education, as well as attitudinal and institutional barriers that may inhibit students with disabilities' success. However, science teachers remain highly receptive to training and collaboration. Implications for science teacher education are discussed.

  10. A Mixed-Method Approach on Digital Educational Games for K12: Gender, Attitudes and Performance

    Science.gov (United States)

    Law, Effie Lai-Chong; Gamble, Tim; Schwarz, Daniel; Kickmeier-Rust, Michael D.; Holzinger, Andreas

    Research on the influence of gender on attitudes towards and performance in digital educational games (DEGs) has quite a long history. Generally, males tend to play such games more engagingly than females, consequently attitude and performance of males using DEGs should be presumably higher than that of females. This paper reports an investigation of a DEG, which was developed to enhance the acquisition of geographical knowledge, carried out on British, German and Austrian K12 students aged between 11 and 14. Methods include a survey on initial design concepts, user tests on the system and two single-gender focus groups. Gender and cultural differences in gameplay habit, game type preferences and game character perceptions were observed. The results showed that both genders similarly improved their geographical knowledge, although boys tended to have a higher level of positive user experience than the girls. The qualitative data from the focus groups illustrated some interesting gender differences in perceiving various aspects of the game.

  11. Physics (and more) over the Internet: Supporting K-12 teachers through online professional development*

    Science.gov (United States)

    Tuthill, G. F.; Obbink, K.

    2004-03-01

    Teacher professional development is accepted as a key ingredient in the support and improvement of K-12 science education nationwide. Since 1993 Montana State University-Bozeman has operated a large-scale experimental program in online science instruction designed specifically for in-service teachers. With NSF support, MSU's National Teachers Enhancement Network (NTEN) has delivered courses to over 7000 enrollees in all 50 states and beyond, using a delivery model that emphasizes student interactivity and the connections between science understanding and classroom practice. Although NTEN offers courses in a wide range of science areas, physics and astronomy have been the strongest focus. As well as providing an overview of the project, we will discuss strengths and difficulties in this form of instruction, based on participant feedback, studies by the project's external evaluation team, and a decade of personal experience. We will also comment on potential impacts of NCLB on the future of such efforts. *Supported by NSF Grant TE0101985

  12. Achieving 50% Energy Savings in New Schools, Advanced Energy Design Guides: K-12 Schools (Brochure)

    Energy Technology Data Exchange (ETDEWEB)

    2014-09-01

    This fact sheet summarizes recommendations for designing elementary, middle, and high school buildings that will result in 50% less energy use than conventional new schools built to minimum code requirements. The recommendations are drawn from the Advanced Energy Design Guide for K-12 School Buildings, an ASHRAE publication that provides comprehensive recommendations for designing low-energy-use school buildings (see sidebar). Designed as a stand-alone document, this fact sheet provides key principles and a set of prescriptive design recommendations appropriate for smaller schools with insufficient budgets to fully implement best practices for integrated design and optimized performance. The recommendations have undergone a thorough analysis and review process through ASHRAE, and have been deemed the best combination of measures to achieve 50% savings in the greatest number of schools.

  13. Tif-stimulated deoxyribonucleic acid repair in Escherichia coli K-12

    International Nuclear Information System (INIS)

    Bacterial survival is significantly increased after ultraviolet irradiation in tif sfi cells, provided that the thermosensitive tif mutation has been expressed at 410C before irradiation. This tif-mediated reactivation of ultraviolet irradiated bacteria needs de novo protein synthesis, as is the case for the tif-mediated reactivation of ultraviolet-irradiated phage lambda. However, in striking contrast to the phage reactivation process, this tif-mediated reactivation is no longer associated with mutagenesis. It also requires the presence of the uvrA+ excision function. These results strongly suggest the existence in Escherichia coli K-12 of a repair pathway acting on bacterial deoxyribonucleic acid which is inducible, error free, and uvr dependent

  14. Linking Urban Youth to STEM Research: Outcomes of Educational Outreach in Diverse K-12 Schools

    Science.gov (United States)

    Smith, T. T.; Myles, L.

    2012-12-01

    Science, Engineering and Mathematics Link, Inc. (SEM Link) is national nonprofit organization that exposes K-12 students to science, technology, engineering and mathematics (STEM) research. Since 2005, SEM Link has worked with academic, government, and private industry partners to expose urban youth to STEM research. Its dual-core program model includes an Experimental Design Program and Math and Science Career Academy which enhance STEM educational experiences for culturally and ethnically diverse K-12 students in urban schools and youth-serving community organizations in the San Francisco Bay Area, Atlanta, and Washington, DC. The Experimental Design Program teaches students how to design and conduct experiments for science fairs utilizing research, laboratory, and scientific literacy skills. Science fair judging provides opportunities for students to get feedback on their projects from STEM professionals. SEM Link has supported over 20 science fairs at schools, school districts, community organizations and STEM professional societies. The Math and Science Career Academy connects youth with STEM professionals who engage classes in hands-on research activities, after-school programs, field trips and community events such as STEM career fairs and science festivals. Students are provided with opportunities to engage in hands-on STEM activities, explore STEM careers, and learn about real-world applications of STEM in the classroom, after-school programs, outdoors in community parks and greenspaces, and at academic institutions. Learning outcomes have been enhanced by supplementary, structured STEM activities, such as field experiments and science fair support, and by exposure to scientists and other STEM professionals from underrepresented groups.

  15. MO-G-BRE-05: Clinical Process Improvement and Billing in Radiation Oncology: A Case Study of Applying FMEA for CPT Code 77336 (continuing Medical Physics Consultation)

    International Nuclear Information System (INIS)

    Purpose: The improvement of quality in healthcare can be assessed by Failure Mode and Effects Analysis (FMEA). In radiation oncology, FMEA, as applied to the billing CPT code 77336, can improve both charge capture and, most importantly, quality of the performed services. Methods: We created an FMEA table for the process performed under CPT code 77336. For a given process step, each member of the assembled team (physicist, dosimetrist, and therapist) independently assigned numerical values for: probability of occurrence (O, 1–10), severity (S, 1–10), and probability of detection (D, 1–10) for every failure mode cause and effect combination. The risk priority number, RPN, was then calculated as a product of O, S and D from which an average RPN was calculated for each combination mentioned above. A fault tree diagram, with each process sorted into 6 categories, was created with linked RPN. For processes with high RPN recommended actions were assigned. 2 separate R and V systems (Lantis and EMR-based ARIA) were considered. Results: We identified 9 potential failure modes and corresponding 19 potential causes of these failure modes all resulting in unjustified 77336 charge and compromised quality of care. In Lantis, the range of RPN was 24.5–110.8, and of S values – 2–10. The highest ranking RPN of 110.8 came from the failure mode described as “end-of-treatment check not done before the completion of treatment”, and the highest S value of 10 (RPN=105) from “overrides not checked”. For the same failure modes, within ARIA electronic environment with its additional controls, RPN values were significantly lower (44.3 for end-of-treatment missing check and 20.0 for overrides not checked). Conclusion: Our work has shown that when charge capture was missed that also resulted in some services not being performed. Absence of such necessary services may result in sub-optimal quality of care rendered to patients

  16. An Increase in Medical Student Knowledge of Radiation Oncology: A Pre-Post Examination Analysis of the Oncology Education Initiative

    International Nuclear Information System (INIS)

    Purpose: The Oncology Education Initiative was created to advance oncology and radiation oncology education by integrating structured didactics into the existing core radiology clerkship. We set out to determine whether the addition of structured didactics could lead to a significant increase in overall medical student knowledge about radiation oncology. Methods and Materials: We conducted a pre- and posttest examining concepts in general radiation oncology, breast cancer, and prostate cancer. The 15-question, multiple-choice exam was administered before and after a 1.5-hour didactic lecture by an attending physician in radiation oncology. Individual question changes, overall student changes, and overall categorical changes were analyzed. All hypothesis tests were two-tailed (significance level 0.05). Results: Of the 153 fourth-year students, 137 (90%) took the pre- and posttest and were present for the didactic lecture. The average test grade improved from 59% to 70% (p = 0.011). Improvement was seen in all questions except clinical vignettes involving correct identification of TNM staging. Statistically significant improvement (p ≤ 0.03) was seen in the questions regarding acute and late side effects of radiation, brachytherapy for prostate cancer, delivery of radiation treatment, and management of early-stage breast cancer. Conclusions: Addition of didactics in radiation oncology significantly improves medical students' knowledge of the topic. Despite perceived difficulty in teaching radiation oncology and the assumption that it is beyond the scope of reasonable knowledge for medical students, we have shown that even with one dedicated lecture, students can learn and absorb general principles regarding radiation oncology

  17. The Radiation Therapy Oncology in the context of oncological practice

    International Nuclear Information System (INIS)

    This work is about the radiation therapy oncology in the context of oncological practice. The radiotherapy is a speciality within medicine that involves the generation, application and dissemination of knowledge about the biology, causes, prevention and treatment of the cancer and other pathologies by ionising radiation

  18. Novas diretrizes na abordagem clínica da neutropenia febril e da sepse em oncologia pediátrica New guidelines for the clinical management of febrile neutropenia and sepsis in pediatric oncology patients

    Directory of Open Access Journals (Sweden)

    Ana Verena Almeida Mendes

    2007-05-01

    precoce são fundamentais para a melhora da sobrevida.OBJECTIVES: To provide a foundation for the diagnostic, prophylactic and therapeutic management of febrile neutropenia and sepsis in children with oncological diseases, with special attention to new protocols and guidelines. SOURCES: A review of the scientific literature utilizing an electronic bibliographic search on MEDLINE, Medscape, SciELO, Google, Cochrane and PubMED using the keywords febrile, neutropenic, cancer, children, sepsis, intensive, care. Articles published between 1987 and 2007 were selected, with preference given to review articles, protocols, systematic reviews, epidemiological studies, task force recommendations and phase III clinical trials. Consensus documents published by the Infectious Diseases Society of America, the Center for Diseases Control and the Infectious Diseases Working Party of the German Society of Hematology and Oncology, in addition to the recommendations of the World Federation of Pediatric Intensive and Critical Care Societies and Society of Critical Care Medicine, were also reviewed. SUMMARY OF THE FINDINGS: The use of aggressive chemotherapy regimens, bone marrow transplantation and intensive care resources have increased the survival rates of children with cancer and also their infectious morbidity, with septic complications as the principal cause of mortality. Several risk factors have been identified, such as neutropenia, oncology type, clinical signs and inflammatory response markers (polymerase chain reaction, procalcitonin and also increased resistance to antimicrobials and antifungal agents. Protocols for risk classification, diagnosis and treatment should be established at each service, taking into account the microbiological flora of each population. Pediatric intensive care has increased the short and long-term survival of these patients. CONCLUSIONS: Oncology patients are particularly vulnerable to infectious complications. Early identification and treatment are

  19. Radiation oncology a physicist's-eye view

    CERN Document Server

    Goitein, Michael

    2007-01-01

    Radiation Oncology: A Physicist's-Eye View was written for both physicists and medical oncologists with the aim of helping them approach the use of radiation in the treatment of cancer with understanding, confidence, and imagination. The book will let practitioners in one field understand the problems of, and find solutions for, practitioners in the other. It will help them to know "why" certain approaches are fruitful while, at the same time, encouraging them to ask the question "Why not?" in the face of assertions that some proposal of theirs is impractical, unreasonable, or impossible. Unlike a textbook, formal and complete developments of the topics are not among the goals. Instead, the reader will develop a foundation for understanding what the author has found to be matters of importance in radiation oncology during over thirty years of experience. Presentations cover, in largely non-technical language, the principal physical and biological aspects of radiation treatment and address practical clinical c...

  20. Neuro-oncology of CNS tumors

    Energy Technology Data Exchange (ETDEWEB)

    Tonn, J.C. [Klinikum Grosshadern, Muenchen (Germany). Dept. of Neurosurgery; Westphal, M. [Universitaetskrankenhaus Eppendorf, Hamburg (Germany). Neurochirurgische Klinik; Rutka, J.T. [Toronto Univ. Hospital for Sick Children, ON (Canada). Div. of Neurosurgery; Grossmann, S.A. (eds.) [Johns Hopkins Oncology Center Neuro-Oncology, Baltimore, MD (United States)

    2006-07-01

    Diagnosis and treatment modalities for neuro-oncologic diseases have made considerable advances in recent years. There is hardly a segment of the field of solid tumours that is experiencing such dynamic development with regard to basic scientific findings and clinical results. In the present book the world's leading experts have compiled the current practice-relevant knowledge of neuro-oncologic diseases. The book's clear structure and the uniform presentation of all chapters make this volume a valuable reference, especially for practice-oriented activities, allowing swift access to information about current treatment standards. Hence it will be of great value to both clinicians and researchers. (orig.)

  1. Oncologic emergencies. Analysis of surgical outcomes

    International Nuclear Information System (INIS)

    Selecting the optimal treatment strategy for oncologic emergencies requires appropriate condition assessment. In the present study, we report on an algorithm which we developed for such cases. Preoperative pathological conditions, clinical course and prognosis were analyzed using abdominal X-ray and computed tomography images from 11 patients (male: n=8; age range, 42 to 73 years median age, 57 years; female: n=3; age range, 53 to 90 years; median age, 54 years) with oncologic emergencies who underwent laparotomy at our department between January 2003 and December 2007. The carcinoma type comprised seven cases of colon and rectum cancer, and one each of esophageal, intrahepatic cholangiocellular, hepatocellular and cervical cancers. The eight patients with residual tumors died, while the three without residual tumors (all with colon cancer) remained alive over the 26-month follow-up period. We conclude that patients with colon cancer without residual tumors have a greater rate of recurrence-free survival. (author)

  2. Oncology nurses awareness of drug interactions

    Directory of Open Access Journals (Sweden)

    Azize Karahan

    2015-01-01

    Full Text Available Objective: The aim of this study was to determine oncology nurses awareness of drug interactions. Methods: This descriptive study was conducted with nurses working in the oncology clinics who are a member of Oncology Nursing Association of Turkey. A total of 115 nurses (response rate %20 were responded to the online survey that consists of 28 questions. Results: The mean age of the nurses was 33 ± 6.8. The majority of nurses work in university hospital (60% as a clinical nurse (62.6% and have a Bachelor Degree in Nursing (63.5%. The mean working years in oncology was 4 years. Half of them stated receiving information on drug interactions mostly through in-service education and courses/congresses in last 5 years. The majority of them (84.3% indicated that they are considering the possibility of drug interactions when they are scheduling the medication administration time. More than half of the responders (59.1% encountered drug interactions; however, few explored drug interactions with food, drinks, and nutritional supplements. Their practices to assess possibility of drug interactions were reviewing the drug prospectus (78.3%; consulting with their colleagues (58.3% and searching on the available website (42.6% and looking at the drug interaction (39.1%. More than half (65.2% stated lack of any system to identify drug interactions in their workplace. Nearly half of them indicated to including the drug interaction into patient education mostly for food-drug (73.9% and drug-drug (63.5% interactions. Conclusions: Almost all indicated the needs for further education on drug interactions and suggested to have guideline/packet guide.

  3. Case Study for Integration of an Oncology Clinical Site in a Semantic Interoperability Solution based on HL7 v3 and SNOMED-CT: Data Transformation Needs.

    Science.gov (United States)

    Ibrahim, Ahmed; Bucur, Anca; Perez-Rey, David; Alonso, Enrique; de Hoog, Matthy; Dekker, Andre; Marshall, M Scott

    2015-01-01

    This paper describes the data transformation pipeline defined to support the integration of a new clinical site in a standards-based semantic interoperability environment. The available datasets combined structured and free-text patient data in Dutch, collected in the context of radiation therapy in several cancer types. Our approach aims at both efficiency and data quality. We combine custom-developed scripts, standard tools and manual validation by clinical and knowledge experts. We identified key challenges emerging from the several sources of heterogeneity in our case study (systems, language, data structure, clinical domain) and implemented solutions that we will further generalize for the integration of new sites. We conclude that the required effort for data transformation is manageable which supports the feasibility of our semantic interoperability solution. The achieved semantic interoperability will be leveraged for the deployment and evaluation at the clinical site of applications enabling secondary use of care data for research. This work has been funded by the European Commission through the INTEGRATE (FP7-ICT-2009-6-270253) and EURECA (FP7-ICT-2011-288048) projects. PMID:26306242

  4. [Dignity therapy in oncology].

    Science.gov (United States)

    Ripamonti, Carla Ida

    2016-04-01

    In oncology, little is known about dignity, dignity-related distress and the issues that influence the sense of dignity for patients. Dignity is personal, subject to changes depending on the experience and the path of life. In oncology some patients feel that their dignity is directly related to the disease, to physical and emotional symptoms, to the highest level of physical and cognitive autonomy and to the continuity of the self. Patient dignity inventory (PDI) is a validate tool designed to measure various sources of dignity-related distress among patients nearing the end of life and serve as a screening tool to assess a broad range of issues that influence the sense of dignity. Dignity therapy is a novel focused psychotherapy consisting in a brief semi-structured interview, audio-recorded and transcribed in order to obtain the "generativity document". The patients are invited to tell about their life history, and to leave words of guidance and offer instructions to pass along to their son, daughters, husband, wife, parents, others. The generativity document is the result of process of emotional and existential care for the patients and a gift for everybody will receive it. PMID:27093325

  5. Science Communication versus Science Education: The Graduate Student Scientist as a K-12 Classroom Resource

    Science.gov (United States)

    Strauss, Jeff; Shope, Richard E., III; Terebey, Susan

    2005-01-01

    Science literacy is a major goal of science educational reform (NRC, 1996; AAAS, 1998; NCLB Act, 2001). Some believe that teaching science only requires pedagogical content knowledge (PCK). Others believe doing science requires knowledge of the methodologies of scientific inquiry (NRC, 1996). With these two mindsets, the challenge for science educators is to create models that bring the two together. The common ground between those who teach science and those who do science is science communication, an interactive process that galvanizes dialogue among scientists, teachers, and learners in a rich ambience of mutual respect and a common, inclusive language of discourse . The dialogue between science and non-science is reflected in the polarization that separates those who do science and those who teach science, especially as it plays out everyday in the science classroom. You may be thinking, why is this important? It is vital because, although not all science learners become scientists, all K-12 students are expected to acquire science literacy, especially with the implementation of the No Child Left Behind Act of 2001 (NCLB). Students are expected to acquire the ability to follow the discourse of science as well as connect the world of science to the context of their everyday life if they plan on moving to the next grade level, and in some states, to graduate from high school. This paper posits that science communication is highly effective in providing the missing link for K-12 students cognition in science and their attainment of science literacy. This paper will focus on the "Science For Our Schools" (SFOS) model implemented at California State Univetsity, Los Angeles (CSULA) as a project of the National Science Foundation s GK-12 program, (NSF 2001) which has been a huge success in bridging the gap between those who "know" science and those who "teach" science. The SFOS model makes clear the distinctions that identify science, science communication, science

  6. Cataclysms and Catastrophes: A Case Study of Improving K-12 Science Education Through a University Partnership

    Science.gov (United States)

    Fennell, T.; Ellins, K. K.; Morris, M.; Christeson, G.

    2003-12-01

    The K-12 science teacher is always seeking ways of improving and updating their curriculum by integrating the latest research into their most effective classroom activities. However, the daily demands of delivering instruction to large numbers of students coupled with the rapid advances in some fields of science can often overwhelm this effort. The NSF-sponsored Cataclysms and Catastrophes curriculum, developed by scientists from the The University of Texas at Austin Institute for Geophysics (UTIG) and Bureau of Economic Geology (BEG), middle and high school teachers, and UT graduate students (NSF GK-12 fellows) working together through the GK-12 program, is a textbook example of how universities can facilitate this quest, benefiting education at both K-12 and university levels. In 1992, "The Great K-T Extinction Debate" was developed as an activity in the Planet Earth class at the Liberal Arts and Science Academy of Austin as an interdisciplinary approach to science. Taking advantage of the media attention generated by the impact scenario for the K-T extinction, the activity consists of students participating in a simulated senate hearing on the potential causes of the K-T extinction and their implications for society today. This activity not only exposes students to the wide range of science involved in understanding mass extinctions, but also to the social, political and economic implications when this science is brought into the public arena and the corresponding use of data in decision making and disaster preparedness. While "The Great K-T Extinction Debate" was always a popular and effective activity with students, it was in desperate need of updating to keep pace with the evolving scientific debate over the cause of the K-T extinction and the growing body of impact evidence discovered over the past decade. By adding two inquiry-based learning activities that use real geophysical data collected by scientists studying the buried Chicxulub feature as a

  7. Rasburicase in the prevention of laboratory/clinical tumour lysis syndrome in children with advanced mature B-NHL: A Children’s Oncology Group Report

    OpenAIRE

    Galardy, Paul; Hochberg, Jessica; Perkins, Sherrie L.; Harrison, Lauren; Goldman, Stanton; Cairo, Mitchell S

    2013-01-01

    Laboratory (LTLS) and clinical (CTLS) tumour lysis syndrome (TLS) are frequent complications in newly diagnosed children with advanced mature B cell non-Hodgkin lymphoma (B-NHL). Rasburicase, compared to allopurinol, results in more rapid reduction of uric acid in paediatric patients at risk for TLS. However, the safety and efficacy of rasburicase for the treatment or or prevention of TLS has not been prospectively evaluated. Children with newly diagnosed stage III–IV, bone marrow+ and/or cen...

  8. National Institutes of Health Funding in Radiation Oncology: A Snapshot

    International Nuclear Information System (INIS)

    Currently, pay lines for National Institutes of Health (NIH) grants are at a historical low. In this climate of fierce competition, knowledge about the funding situation in a small field like radiation oncology becomes very important for career planning and recruitment of faculty. Unfortunately, these data cannot be easily extracted from the NIH's database because it does not discriminate between radiology and radiation oncology departments. At the start of fiscal year 2013 we extracted records for 952 individual grants, which were active at the time of analysis from the NIH database. Proposals originating from radiation oncology departments were identified manually. Descriptive statistics were generated using the JMP statistical software package. Our analysis identified 197 grants in radiation oncology. These proposals came from 134 individual investigators in 43 academic institutions. The majority of the grants (118) were awarded to principal investigators at the full professor level, and 122 principal investigators held a PhD degree. In 79% of the grants, the research topic fell into the field of biology, 13% in the field of medical physics. Only 7.6% of the proposals were clinical investigations. Our data suggest that the field of radiation oncology is underfunded by the NIH and that the current level of support does not match the relevance of radiation oncology for cancer patients or the potential of its academic work force

  9. Understanding and Improving Full-Time Virtual Schools: A Study of Student Characteristics, School Finance, and School Performance in Schools Operated by K12 Inc. [with Appendices

    Science.gov (United States)

    Miron, Gary; Urschel, Jessica L.

    2012-01-01

    K12 Inc. enrolls more public school students than any other private education management organization in the U.S. Much has been written about K12 Inc. (referred to in this report simply as "K12") by financial analysts and investigative journalists because it is a large, publicly traded company and is the dominant player in the operation and…

  10. Dithiothreitol pretreatment and inducible repair in UV-irradiated Escherichia coli K12 cells

    International Nuclear Information System (INIS)

    The UV radiation survival of several Escherichia coli K12 strains was measured after pretreatment with dithiothreitol (DTT). In DNA repair-competent cells, UV survival was enhanced (ER = 1.2) after pretreating cells for 1.0h using 10 mmol dm-3 DTT and then incubating cells for 1.5h in buffer before UV irradiation. Similar experiments using the excision repair mutant, AB1886μυr A6, or the recombination repair and SOS-deficient mutant, AB2462recA, strains did not show enhanced UV survival. None of the E. coli strains tested were protected against UV killing by simultaneous treatment with DTT (10 mmol dm-3). These results, and the fact that incubation in chloramphenicol removed the wild-type response in DTT-pretreated, UV-irradiated cells, suggest that observed UV radioprotection was a result of inducible enzymatic repair processes such as recA-dependent repair. The proposed stimulus for inducible repair in these cells is DNA damage caused by intracellular hydroxyl radicals arising from thiol oxidation. The involvement of oxygen radicals in the induction pathway is supported by results that showed superoxide dismutase and catalase could inhibit a portion (one-third) of the inducible repair. (author)

  11. YbiV from E. coli K12 is a HAD phosphatase

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, Anne; Lee, Seok-Yong; McCullagh, Emma; Silversmith, Ruth E.; Wemmer, David E.

    2004-03-16

    The protein YbiV from Escherichia coli K12 MG1655 is a hypothetical protein with sequence homology to the haloacid dehalogenase (HAD) superfamily of proteins. Although numerous members of this family have been identified, the functions of few are known. Using the crystal structure, sequence analysis, and biochemical assays, we have characterized ybiV as a HAD phosphatase. The crystal structure of YbiV reveals a two domain protein, one with the characteristic HAD hydrolase fold, the other an inserted a/b fold. In an effort to understand the mechanism we also solved and report the structures of YbiV in complex with beryllofluoride (BeF3-) and aluminum trifluoride (AlF3) which have been shown to mimic the phosphorylated intermediate and transition state for hydrolysis, respectively, in analogy to other HAD phosphatases. Analysis of the structures reveals the substrate binding cavity, which is hydrophilic in nature. Both structure and sequence homology indicate ybiV may be a sugar phosphatase, which is supported by biochemical assays which measured the release of free phosphate on a number of sugar-like substrates. We also investigated available genomic and functional data in an effort to determine the physiological substrate.

  12. Infusing interdisciplinary place-based watershed research into K-12 curricula and university collaborations

    Science.gov (United States)

    Pratt-Sitaula, B.; Gazis, C.; Kurtz, M.; Quitadamo, I.; Wagner, R.

    2007-12-01

    Central Washington University has started a five-year NSF-funded GK-12 project to bring the study of our local river - The Yakima - into 5-11th grade science classes. Faculty members from Geological Sciences have teamed with others from Biology, Chemistry, and Resource Management to develop the Yakima WATERS Project (Watershed Activities To Enhance Research in Schools). This interdisciplinary outreach project teams graduate students with local teachers to bring authentic watershed research into the curriculum. The interdisciplinary research themes are: Riparian Ecology and Biodiversity; Water Chemistry and Quality; Geomorphology and Climate Change; and Changes in Land and Water Use. The Yakima Watershed contains several communities that are traditionally underrepresented in science - Native American, Hispanic, and rural populations. One of the key outcomes we will assess is whether a place-based science study such as this is successful in improving minority students' science scores and whether graduate students from underrepresented groups can be attracted and retained in STEM graduate programs. The project is in its early stages, so results of K-12 student science achievement are not yet available. One unexpected, but positive preliminary result is the possibility of further interdisciplinary research that may stem from the close project-driven interactions between people of different STEM subjects. Faculty members, graduate students, and teachers often fail to interact with members of other departments, but through Project activities support networks are forming and ideas for further research are being developed.

  13. On-Line Earth System Science In-Service Course for K-12 Teachers

    Science.gov (United States)

    Simila, G. W.; Hawkins, B. A.

    2001-12-01

    Initially, the Departments of Geological Sciences and Education cooperated to revise the existing Earth Science and Geology preservice courses for both the elementary and secondary pre-credential majors. The main objective of this collaboration was to promote the growth of knowledgeable and well-equipped K-12 Earth system science future teachers. Now, both Departments, in cooperation with the College of Extended Learning, have instituted The Earth System Science Education Alliance (ESSEA) On-line Professional Development Program of Earth System Science curriculum developed by the Center for Educational Technologies (CET) at Wheeling Jesuit University. These graduate courses have been offered in our first year to teachers of K-4, 5-8, and 9-12 that were selected from the Los Angeles Unified School District (LAUSD) and other local schools. Our team also consists of master science teachers selected from local elementary and high schools. Our project also involves the incorporation of the new California Science Standards, as well as NASA's Strategic Enterprises: the Earth Science Enterprise (ESE) and the Space Science Enterprise (SSE). We will also present various aspects of our experiences in online instruction.

  14. LOW-COST STRATEGIES TO SAVE ENERGY IN K-12 SCHOOLS

    Directory of Open Access Journals (Sweden)

    Raymond C. Tesiero III

    2014-01-01

    Full Text Available Advanced Energy Management Control Systems (EMCS offer an excellent means of reducing energy consumption in Heating, Ventilating and Air Conditioning (HVAC systems while maintaining and improving indoor environmental conditions. This can be achieved through the use of computational intelligence and optimization with a building automation system and multiple sensors, which can be quite expensive. However, energy awareness and proper scheduling achieve the best opportunities to save energy with little to no cost for existing facilities. These “low-tech/low-cost” ideas are easily implemented and quickly reduce utility costs. This article includes actual utility data and information gathered over the past 20 years while performing energy audits at several K-12 Schools in North Carolina, discusses well known and documented control strategies that are rarely implemented in most school districts and universities and will extrapolate savings for an entire school district based on real data. These processes can also be integrated into an EMCS to perform several intelligent functions achieving optimal system performance. This article focuses on control strategies utilizing time-of-day scheduling that can be used with 7-day programmable thermostats, electronic time controllers and a Building Automation System (BAS. These controllers (7d-prog. thermostat, electronic time controller and BAS will achieve lower energy consumption while maintaining occupant comfort by performing and prioritizing the appropriate actions. Real savings can be achieved quickly by utilizing these common sense approaches to control existing HVAC and lighting systems in schools.

  15. W-reactivation of phage lambda in X-irradiated mutants of Escherichia coli K-12

    International Nuclear Information System (INIS)

    The survival of UV irradiated phage lambda was increased on X-irradiated E.coli K-12 host cells over that on unirradiated cells. The frequency of c mutants among the survivieng phages was increased to a similar extent by the X-ray exposure of the host cells as by UV light. This W-reactivation of phage lambda occurred in uvrA, polA, and recB mutants besides the wild type at about equal X-ray doses, but at a reduced reactivation efficiency compared with the wild type. W-reactivation was undetectable in recA mutants. While maximal UV induced W-reactivation occured 30 min after irradiation, the maximal X-ray induced reactivation was found immediately after irradiation. Chloramphenicol (100 μg/ml) and nitrofurantoin (50 μg/ml) inhibited W-reactivation of phage lambda if added before irradiation of the host cells, indicating the necessity of protein synthesis for W-reactivation. (orig.)

  16. Novel recA-Independent Horizontal Gene Transfer in Escherichia coli K-12.

    Directory of Open Access Journals (Sweden)

    Anthony W Kingston

    Full Text Available In bacteria, mechanisms that incorporate DNA into a genome without strand-transfer proteins such as RecA play a major role in generating novelty by horizontal gene transfer. We describe a new illegitimate recombination event in Escherichia coli K-12: RecA-independent homologous replacements, with very large (megabase-length donor patches replacing recipient DNA. A previously uncharacterized gene (yjiP increases the frequency of RecA-independent replacement recombination. To show this, we used conjugal DNA transfer, combining a classical conjugation donor, HfrH, with modern genome engineering methods and whole genome sequencing analysis to enable interrogation of genetic dependence of integration mechanisms and characterization of recombination products. As in classical experiments, genomic DNA transfer begins at a unique position in the donor, entering the recipient via conjugation; antibiotic resistance markers are then used to select recombinant progeny. Different configurations of this system were used to compare known mechanisms for stable DNA incorporation, including homologous recombination, F'-plasmid formation, and genome duplication. A genome island of interest known as the immigration control region was specifically replaced in a minority of recombinants, at a frequency of 3 X 10(-12 CFU/recipient per hour.

  17. Brain Based Learning: K-12 Teachers' Preferred Methods of Science Instruction

    Science.gov (United States)

    Mansy, Donna Lachman

    The purpose of this quantitative study was to investigate Brain Based Learning (BBL) techniques in teaching science. Participants included 216 K-12, full-time, regular education teachers from 8 Northeast Tennessee school systems who taught at least 1 science class. Specifically this research was guided by 7 research questions on teachers' perceptions and practices in teaching science. Data were collected by a survey that consisted of 82 statements where teachers rated their level of agreement and was distributed online via Survey Monkey. The first portion of my survey included demographic identifiers, teachers' knowledge of the term BBL, and inquiries regarding science background and training. The remainder of the statements were focused on teachers' perceptions and practices of BBL strategies in teaching science. The final item was open-ended and allowed teachers to share comments related to teaching science. For statements 6-81, participants responded by using a 5-point Likert scale that ranged from 1 (strongly disagree) to 5 ( strongly agree). Quantitative data were analyzed with a series of independent samples t tests, one-way analysis of variance tests, and a Pearson correlation coefficient. The results of the study indicate that teachers' perceptions are positively correlated to their self-reported practices. Females, in general, and elementary teachers tend to practice BBL strategies in teaching science significantly more than other subgroups.

  18. Scientific Participation at the Poles: K-12 Teachers in Polar Science for Careers and Classrooms

    Science.gov (United States)

    Crowley, S.; Warburton, J.

    2012-12-01

    PolarTREC (Teachers and Researchers Exploring and Collaborating) is a National Science Foundation (NSF) funded program in which K-12 teachers participate in hands-on field research experiences in the polar regions. PolarTREC highlights the importance of involving teachers in scientific research in regards to their careers as educators and their ability to engage students in the direct experience of science. To date, PolarTREC has placed over 90 teachers with research teams in the Arctic and Antarctic. Published results of our program evaluation quantify the effect of the field experience on the teachers' use of the real scientific process in the classroom, the improvement in science content taught in classrooms, and the use of non-fiction texts (real data and science papers) as primary learning tools for students. Teachers and students both report an increase of STEM literacy in the classroom content, confidence in science education, as well as a markedly broadened outlook of science as essential to their future. Research conducted with science teams affirms that they are achieving broader impacts when PolarTREC teachers are involved in their expeditions. Additionally, they reported that these teachers making vital contributions to the success of the scientific project.

  19. Transcriptional regulatory network discovery via multiple method integration: application to e. coli K12

    Directory of Open Access Journals (Sweden)

    Trelinski Michael

    2007-03-01

    Full Text Available Abstract Transcriptional regulatory network (TRN discovery from one method (e.g. microarray analysis, gene ontology, phylogenic similarity does not seem feasible due to lack of sufficient information, resulting in the construction of spurious or incomplete TRNs. We develop a methodology, TRND, that integrates a preliminary TRN, microarray data, gene ontology and phylogenic similarity to accurately discover TRNs and apply the method to E. coli K12. The approach can easily be extended to include other methodologies. Although gene ontology and phylogenic similarity have been used in the context of gene-gene networks, we show that more information can be extracted when gene-gene scores are transformed to gene-transcription factor (TF scores using a preliminary TRN. This seems to be preferable over the construction of gene-gene interaction networks in light of the observed fact that gene expression and activity of a TF made of a component encoded by that gene is often out of phase. TRND multi-method integration is found to be facilitated by the use of a Bayesian framework for each method derived from its individual scoring measure and a training set of gene/TF regulatory interactions. The TRNs we construct are in better agreement with microarray data. The number of gene/TF interactions we discover is actually double that of existing networks.

  20. Using Off-the-Shelf Gaming Controllers For Computer Control in the K-12 Classroom

    Science.gov (United States)

    Bourgoin, N. L.; Withee, J.; Segee, M.; Birkel, S. D.; Albee, E.; Koons, P. O.; Zhu, Y.; Segee, B.

    2009-12-01

    In the classroom, the interaction between students, teachers, and datasets is becoming more game like. Software such as GoogleEarth allow students to interact with data on a more personal level; allowing them the dynamically change variables, move arbitrarily, and personalize their experience with the datasets. As this becomes more immersive, traditional software control such as keyboard and mouse begin to hold the student back in terms of intuitive interfacing with the data. This is a problem that has best been tackled by modern gaming systems such as the Wii, XBox 360, and Playstation 3 Systems. By utilizing the solutions given by these gaming systems, it is possible to further a students immersion with a system. Through an NSF ITEST (Information and Technology Experiences for Students and Teachers) grant, researchers at the University of Maine have experimented with using the game controller that is used for interacting with the Nintendo Wii (often called a Wiimote) with existing geodynamic systems in an effort to eases interaction with these systems. Since these game controllers operate using Bluetooth, a common protocol in computing, Wiimotes can easily communicate with existing laptop computers that are issued to Maine students. This paper describes the technical requirements, setup, and usage of Wiimotes as an input device to complex geodynamical systems for use in the K-12 classroom.